U.S. patent application number 10/672069 was filed with the patent office on 2005-01-27 for in vivo gene silencing by chemically modified and stable sirna.
This patent application is currently assigned to UNIVERSITY OF MASSACHUSETTS. Invention is credited to Rana, Tariq M..
Application Number | 20050020521 10/672069 |
Document ID | / |
Family ID | 32046073 |
Filed Date | 2005-01-27 |
United States Patent
Application |
20050020521 |
Kind Code |
A1 |
Rana, Tariq M. |
January 27, 2005 |
In vivo gene silencing by chemically modified and stable siRNA
Abstract
The present invention provides compositions for RNA interference
and methods of use thereof. In particular, the invention provides
small interfering RNAs (siRNAs) having modification that enhance
the stability of the siRNA without a concomitant loss in the
ability of the siRNA to participate in RNA interference (RNAi). The
invention also provides siRNAs having modification that increase
targeting efficiency. Modifications include chemical crosslinking
between the two complementary strands of an siRNA and chemical
modification of a 3' terminus of a strand of an siRNA. Preferred
modifications are internal modifications, for example, sugar
modification, nucleobase modification and/or backbone
modifications. Such modifications are also useful, e.g., to improve
uptake of the siRNA by a cell. Functional and genomic and proteomic
methods are featured. Therapeutic methods are also featured.
Inventors: |
Rana, Tariq M.; (Shrewsbury,
MA) |
Correspondence
Address: |
LAHIVE & COCKFIELD, LLP.
28 STATE STREET
BOSTON
MA
02109
US
|
Assignee: |
UNIVERSITY OF MASSACHUSETTS
Worcester
MA
|
Family ID: |
32046073 |
Appl. No.: |
10/672069 |
Filed: |
September 25, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60413529 |
Sep 25, 2002 |
|
|
|
60426982 |
Nov 15, 2002 |
|
|
|
60458051 |
Mar 26, 2003 |
|
|
|
60493095 |
Aug 5, 2003 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/23.1 |
Current CPC
Class: |
C12N 15/111 20130101;
A61K 38/00 20130101; C12Y 207/11022 20130101; C12N 2310/33
20130101; C12N 15/113 20130101; C12N 2320/51 20130101; C07D 495/04
20130101; C12N 15/1137 20130101; C12N 2310/14 20130101; A01K
2217/075 20130101; C12N 2310/335 20130101; C12N 2310/322 20130101;
C12N 2310/3513 20130101; C12N 2310/315 20130101; A61K 48/00
20130101; C07D 213/69 20130101; C12N 2310/53 20130101; C12N 2310/31
20130101; C12N 2310/3341 20130101 |
Class at
Publication: |
514/044 ;
536/023.1 |
International
Class: |
A61K 048/00; C07H
021/02 |
Claims
What is claimed:
1. A small interfering RNA (siRNA), comprising a sense strand and
an antisense strand, wherein the antisense strand has a sequence
sufficiently complementary to a target mRNA sequence to direct
target-specific RNA interference (RNAi) and wherein the sense
strand or antisense strand is modified by the substitution of at
least one internal nucleotide with a modified nucleotide, such that
in vivo stability is enhanced as compared to a corresponding
unmodified siRNA.
2. A small interfering RNA (siRNA), comprising a sense strand and
an antisense strand, wherein the antisense strand has a sequence
sufficiently complementary to a target mRNA sequence to direct
target-specific RNA interference (RNAi) and wherein the sense
strand or antisense strand is modified by the substitution of at
least one internal nucleotide with a modified nucleotide, such that
the target efficiency is enhanced compared to a corresponding
unmodified siRNA.
3. The siRNA of claim 1 or 2 which is sufficiently complementary to
a target mRNA, said target mRNA specifying the amino acid sequence
of a cellular protein.
4. The siRNA of claim 1 or 2 which is sufficiently complementary to
a target mRNA, said target mRNA specifying the amino acid sequence
of a viral protein.
5. The siRNA of any one of claims 1-4, wherein the modified
nucleotide is a sugar-modified nucleotide.
6. The siRNA of any one of claims 1-4, wherein the modified
nucleotide is a nucleobase-modified nucleotide.
7. The siRNA of any one of claims 1-4, wherein the modified
nucleotide is a 2'-deoxy ribonucleotide and is present within the
sense strand.
8. The siRNA of any one of claims 1-4, wherein the modified
nucleotide is a 2'-fluoro modified ribonucleotide.
9. The siRNA of any one of claims 1-4, wherein the modified
nucleotide is selected from the group consisting of a 2'-fluoro,
2'-amino and 2'-thio modified ribonucleotide.
10. The siRNA of any one of claims 1-4, wherein the modified
nucleotides are a 2'-fluoro modified ribonucleotide and a 2'-deoxy
ribonucleotide.
11. The siRNA of claim 10, wherein the 2'-fluoro modified
ribonucleotide is 2'-fluoro uridine or 2'-fluoro cytidine.
12. The siRNA of claim 10, wherein the 2'-deoxy ribonucleotide is
2'-deoxy adenosine or 2'-deoxy guanosine.
13. The siRNA of any one of claims 10-12, wherein the 2'-deoxy
ribonucleotides are in the antisense strand.
14. The siRNA of claim 13, wherein the 2'-deoxy ribonucleotides are
upstream of the cleavage site referencing the antisense strand.
15. The siRNA of claim 13, wherein the 2'-deoxy ribonucleotides are
downstream of the cleavage site referencing the antisense
strand.
16. The siRNA of any one of claims 10-15, wherein the 2'-fluoro
ribonucleotides are in the sense and antisense strands.
17. The siRNA of any one of claims 10-15, wherein the 2'-fluoro
ribonucleotides are every uridine and cytidine.
18. The siRNA of claim 5, wherein the modified nucleotide is
selected from the group consisting of 2'-fluoro-cytidine,
2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine,
2'-amino-cytidine, 2'-amino-uridine, 2'-amino-adenosine,
2'-amino-guanosine and 2'-amino-butyryl-pyrene-uridine.
19. The siRNA of claim 6, wherein the modified nucleotide is
selected from the group consisting of 5-bromo-uridine,
5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine,
5-fluoro-cytidine, and 5-fluoro-uridine, 2,6-diaminopurine,
4-thio-uridine; and 5-amino-allyl-uridine.
20. The siRNA of any one of claims 1-4, wherein the modified
nucleotide is a backbone-modified nucleotide
21. The modified siRNA of claim 20, wherein the backbone-modified
nucleotide contains a phosphorothioate group.
22. The modified siRNA of claim 20, wherein the backbone-modified
nucleotide contains a phosphorothioate group and is present within
the sense and antisense strands.
23. The siRNA of any one of the preceeding claims, wherein the
sense strand is crosslinked to the antisense strand
24. The siRNA of claim 23, wherein the crosslink is present
dowstream of the cleavage site referencing the antisense
strand.
25. The siRNA of claim 23, wherein the crosslink is present at the
5' end of the sense strand.
26. The siRNA of any one of claims 1-4, wherein the antisense
strand and target mRNA sequences are 100% complementary.
27. The siRNA of any one of claims 1-4, wherein the antisense
strand and target mRNA sequences comprise at least one
mismatch.
28. The siRNA of claim 27, wherein the mismatch is downstream of
the cleavage site referencing the antisense strand.
29. The siRNA of claim 27, wherein the mismatch is present within
1-6 nucleotides from the 3' end of the antisense strand.
30. The siRNA of any one of the preceeding claims, wherein a 3' OH
terminus of the sense strand or antisense strand is modified.
31. The siRNA of any one of claims 1-4, wherein the modified
nucelotide does not effect the ability of the antisense strand to
adopt A-form helix conformation when base-pairing with the target
mRNA sequence.
32. The siRNA of any one of claims 1-4, wherein the modified
nucelotide does not effect the ability of the antisense strand to
adopt A-form helix conformation comprising a normal major groove
when base-pairing with the target mRNA sequence.
33. The siRNA of any one of claims 1-4, which is between about 10
and 50 residues in length.
34. The siRNA of any one of claims 1-4, which is between about 15
and 45 residues in length.
35. The siRNA of any one of claims 1-4, which is between about 20
and 40 residues in length.
36. The siRNA of any one of claims 1-4, which is between about 18
and 25 residues in length.
37. The siRNA of any one of claims 1-4, which is chemically
synthesized.
38. A transgene that encodes the siRNA of any one of claims
1-4.
39. A composition comprising the siRNA molecule of any one of
claims 1-37 and a pharmaceutically acceptable carrier.
40. A method of activating target-specific RNA interference (RNAi)
in a cell comprising introducing into said cell the siRNA of any
one of the preceding claims, said siRNA being introduced in an
amount sufficient for degradation of target mRNA to occur, thereby
activating target-specific RNAi in the cell.
41. The method of claim 40, wherein the siRNA is introduced into
the cell by contacting the cell with the siRNA.
42. The method of claim 41, wherein the siRNA is introduced into
the cell by contacting the cell with a composition comprising the
siRNA and a lipophillic carrier.
43. The method of claim 40, wherein the siRNA is introduced into
the cell by transfecting or infecting the cell with a vector
comprising nucleic acid sequences capable of producing the siRNA
when transcribed in the cell.
44. The method of claim 40, wherein the siRNA is introduced into
the cell by injecting into the cell a vector comprising nucleic
acid sequences capable of producing the siRNA when transcribed in
the cell.
45. The method of claim 44, wherein the vector comprises transgene
nucleic acid sequences.
46. The method of any one of claims 40-45, wherein the target mRNA
specifies the amino acid sequence of a protein involved or
predicted to be involved in a human disease or disorder.
47. A cell obtained by the method of any one of claims 40-46.
48. The cell of claim 47 which is of mammalian origin.
49. The cell of claim 47 which is of murine origin.
50. The cell of claim 47 which is of human origin.
51. The cell of claim 47, which is an embryonic stem cell.
52. An organism derived from the cell of claim 51.
53. A method of activating target-specific RNA interference (RNAi)
in an organism comprising administering to said organism the siRNA
of any one of the preeceeding claims, said siRNA being administered
in an amount sufficient for degradation of the target mRNA to
occur, thereby activating target-specific RNAi in the organism.
54. The method of claim 53, wherein the siRNA is administered by an
intravenous or intraperitoneal route.
55. The method of claim 53, wherein the target mRNA specifies the
amino acid sequence of a protein involved or predicted to be
involved in a human disease or disorder.
56. An organism obtained by the method of any one of claims
53-55.
57. The organism of claim 56 which is of mammalian origin.
58. The organism of claim 56 which is of murine origin.
59. The organism of claim 56 which is of human origin.
60. The organism of any one of claims 56-59, wherein the target
mRNA specifies the amino acid sequence of a protein involved or
predicted to be involved in a human disease or disorder.
61. The organism of any one of claims 56-59, wherein degradation of
the target mRNA produces a loss-of-function phenotype.
62. The method of claims 40-45 and 53-55, wherein degradation of
the target mRNA is such that the protein specified by said target
mRNA is decreased by at least 10%.
63. A method of treating a disease or disorder associated with the
activity of a protein specified by a target mRNA in a subject,
comprising administering to said subject the siRNA of any one of
the preceeding claims, said siRNA being administered in an amount
sufficient for degradation of the target mRNA to occur, thereby
treating the disease or disorder associated with the protein.
64. A method for deriving information about the function of a gene
in a cell or organism comprising: (a) introducing into said cell or
organism the siRNA of any one of the preceeding claims; and (b)
maintaining the cell or organism under conditions such that
target-specific RNAi can occur; (c) determining a characteristic or
property of said cell or organism; and (d) comparing said
characteristic or property to a suitable control, the comparison
yielding information about the function of the gene.
65. A method of validating a candidate protein as a suitable target
for drug discovery comprising: (a) introducing into a cell or
organism the siRNA of any one of the preceeding claims; and (b)
maintaining the cell or organism under conditions such that
target-specific RNAi can occur; (c) determining a characteristic or
property of said cell or organism; and (d) comparing said
characteristic or property to a suitable control, the comparison
yielding information about whether the candidate protein is a
suitable target for drug discovery.
66. A kit comprising reagents for activating target-specific RNA
interference (RNAi) in a cell or organism, said kit comprising: (a)
the siRNA molecule of any one of the preceeding claims; and (b)
instructions for use.
67. A small interfering RNA (siRNA), comprising a sense strand and
an antisense strand, wherein the antisense strand has a sequence
sufficiently complementary to a target mRNA sequence to direct
target-specific RNA interference (RNAi), wherein the sense strand
or antisense strand is modified by the substitution of at least one
internal nucleotide with a modified nucleotide, and wherein the
antisense strand is capable of adopting an A-form helix when in
association with a target RNA.
68. A small interfering RNA (siRNA), comprising a sense strand and
an antisense strand, wherein the antisense strand has a sequence
sufficiently complementary to a target mRNA sequence to direct
target-specific RNA interference (RNAi), wherein the sense strand
or antisense strand is modified by the substitution of at least one
internal nucleotide with a modified nucleotide, and wherein the
antisense strand is capable of adopting an A-form helix having a
normal major groove when in association with a target RNA.
69. An siRNA derivative comprising an siRNA having two
complementary strands of nucleic acid, wherein the two strands are
crosslinked, a 3' OH terminus of one of the strands is modified, or
the two strands are crosslinked and modified at the 3'OH
terminus.
70. The siRNA derivative of claim 69: (a) wherein the siRNA
contains a single crosslink. (b) wherein the siRNA is psoralen
crosslinked. (c) comprising a biotin at a 3' terminus. (d)
comprising a photocleavable biotin having the structure depicted in
FIG. 20 at a 3' terminus. (e) comprising a peptide at a 3'
terminus. (f) comprising a nanoparticle, peptidomimetic, or
dendrimer at a 3' terminus. (g) comprising a Tat peptide at the 3'
terminus.
71. A method of inhibiting expression of an RNA, the method
comprising introducing into a cell the siRNA derivative of claim 69
or 70, wherein the siRNA derivative is targeted to the RNA.
72. A method comprising contacting a cell with a concentration of
an siRNA derivative sufficient to inhibit expression of a target
gene, wherein the siRNA derivative: (a) is a crosslinked siRNA; (b)
contains a single crosslink; (c) is psoralen crosslinked. (d) is
modified at a 3' terminus (e) comprises a biotin at a 3' terminus.
(f) comprises a photocleavable biotin having the structure depicted
in FIG. 8 at a 3' terminus. (g) comprises a peptide, nanoparticle,
peptidomimetic, or dendrimer at a 3' terminus. (h) comprises a Tat
peptide at a 3' terminus.
73. The method of claim 72, wherein the siRNA derivative inhibits
expression of the target gene at least 30%.
74. The method of claim 72, wherein the cell is a mammalian
cell.
75. The method of claim 72, wherein the cell is a human cell.
76. The method of claim 72, wherein the concentration of the siRNA
derivative does not completely inhibit expression of the target
gene.
77. The method of claim 72, wherein the contacting of the cell with
the modified siRNA is carried out in the absence of a transfection
reagent.
78. The method of claim 72, wherein the siRNA derivative comprises
a Tat sequence at a 3' terminus.
79. A photocleavable biotin of the formula depicted in FIG. 20.
80. A method of determining whether a candidate siRNA derivative is
an siRNA derivative, the method comprising (a) obtaining a reporter
cell comprising two different fluorescent reporter genes, (b)
transfecting the reporter cell with a candidate siRNA derivative
targeted to one of the fluorescent reporter genes, thereby creating
a test cell; (c) incubating the test cell for a time sufficient for
a reporter cell to express detectable levels of the fluorescent
reporter proteins encoded by the fluorescent reporter genes; (d)
determining the fluorescence intensity of each fluorescent reporter
protein in the test cell; and (e) determining the ratio of the
level of fluorescence intensity between the two fluorescent
reporter proteins in the test cell and normalizing the ratio to the
ratio of fluorescence intensity in a control reporter cell that was
not transfected with the candidate siRNA derivative, wherein a
normalized ratio of less than one indicates that the candidate
siRNA derivative is an siRNA derivative.
81. The method of claim 80, wherein the control reporter cell is
transfected with an antisense sequence that is complementary to the
targeted reporter gene.
82. The method of claim 80, wherein the two reporter proteins are
Green Fluorescent Protein (GFP) and Red Fluorescent Protein
(RFP).
83. The method of claim 80, wherein the normalized ratio is at
least 0.3.
Description
RELATED APPLICATIONS
[0001] This patent application claims the benefit of U.S.
Provisional Patent Application Ser. No. 60/413,529, entitled
"Chemically Modified siRNA and Uses Thereof", filed Sep. 25, 2002;
U.S. Provisional Patent Application Ser. No. 60/426,982, entitled
"In Vivo Gene Silencing by Chemically Modified and Stable siRNA",
filed Nov. 15, 2002; U.S. Provisional Patent Application Ser. No.
60/458,051, entitled "In Vivo Gene Silencing by Chemically Modified
and Stable siRNA", filed Mar. 26, 2003; and U.S. Provisional Patent
Application Ser. No. 60/493095, entitled "In Vivo Gene Silencing by
Chemically Modified and Stable siRNA", filed Aug. 5, 2003 The
entire contents of the above-referenced provisional patent
applications are incorporated herein by this reference.
BACKGROUND OF THE INVENTION
[0002] RNA interference (RNAi) is the process whereby
double-stranded RNA (dsRNA) induces the sequence-specific
degradation of homologous mRNA. Although RNAi was first discovered
in Caenorhabditis elegans (Fire et al., 1998), similar phenomena
had been reported in plants (post-transcriptional gene silencing
[PTGS]) and in Neurospora crassa (quelling) (reviewed in Hammond et
al., 2001; Sharp, 2001). It has become clear that dsRNA-induced
silencing phenomena are present in evolutionarily diverse
organisms, e.g., nematodes, plants, fungi and trypanosomes (Bass,
2000; Cogoni and Macino, 2000; Fire et al., 1998; Hammond et al.,
2001; Ketting and Plasterk, 2000; Matzke et al., 2001; Sharp, 2001;
Sijen and Kooter, 2000; Tuschl, 2001; Waterhouse et al., 2001).
Biochemical studies in Drosophila embryo lysates and S2 cell
extracts have begun to unravel the mechanisms by which RNAi works
(Bernstein et al., 2001; Tuschl et al., 1999; Zamore et al.,
2000).
[0003] RNAi is initiated by an ATP-dependent, processive cleavage
of dsRNA into 21- to 23-nucleotide (nt) short interfering RNAs
(siRNAs) (Bernstein et al., 2001; Hamilton and Baulcombe, 1999;
Hammond et al., 2000; Zamore et al., 2000) by the enzyme Dicer, a
member of the RNase III family of dsRNA-specific endonucleases
(Bernstein et al., 2001). These native siRNA duplexes containing 5'
phosphate and 3' hydroxyl termini are then incorporated into a
protein complex called RNA-induced silencing complex (RISC)
(Hammond et al., 2000). ATP-dependent unwinding of the siRNA duplex
generates an active complex, RISC* (the asterisk indicates the
active conformation of the complex) (Nykanen et al., 2001). Guided
by the antisense strand of siRNA, RISC* recognizes and cleaves the
corresponding mRNA (Elbashir et al., 2001b; Hammond et al., 2000;
Nykanen et al., 2001).
[0004] Recently, Tuschl and colleagues (Elbashir et al., 2001a)
have demonstrated that RNAi can be induced in numerous mammalian
cell lines by introducing synthetic 21-nt siRNAs. By virtue of
their small size, these siRNAs avoid provoking an interferon
response that activates the protein kinase PKR (Stark et al.,
1998). Functional anatomy studies of synthetic siRNA in Drosophila
cell lysates have demonstrated that each siRNA duplex cleaves its
target RNA at a single site (Elbashir et al., 2001c). The 5' end of
the guide siRNA sets the ruler for defining the position of target
RNA cleavage (Elbashir et al., 2001c). 5' phosphorylation of the
antisense strand is required for effective RNA interference in
vitro (Nykanen et al., 2001). Mutation studies have shown that a
single mutation within the center of an siRNA duplex discriminates
between mismatched targets (Elbashir et al., 2001c). These
experiments showed a more stringent requirement for the antisense
strand of the trigger dsRNA as compared to the sense strand
(Grishok et al., 2000; Parrish et al., 2000). Notably these
phenomena were demonstrated in vitro or in cell culture
systems.
[0005] There is a need for further study of such systems. Moreover,
there exists a need for the development of reagents suitable for
use in vivo, in particular for use in developing human
therapeutics.
SUMMARY OF THE INVENTION
[0006] The present invention is based on the suprising discovery
that siRNA molecules (i.e., duplex siRNA molecules) can be modified
at internal residues such that properties important for in vivo
applications, in particular, human therapeutic applications, are
improved without compromising the RNAi activity of the siRNA
molecules. In particular, the invention is based on the discovery
of modifications which are tolerated in siRNA molecules,
modifications which are not tolerated, and three-dimensional
structural features that are or are not required in order for siRNA
molecules to mediate RNAi. Accordingly, the present invention
provides compositions for RNA interference and methods of use
thereof. In particular, the invention provides small interfering
RNAs (siRNAs) having modification or combination of modifications
that enhance the stability of the siRNA without a comcommittent
loss in the ability of the siRNA to participate in RNA interference
(RNAi). The invention also provides siRNAs having modification that
increase targeting efficiency. Modifications include chemical
crosslinking between the two complementary strands of an siRNA and
chemical modification of a 3' terminus of a strand of an siRNA.
Preferred modifications are internal modifications, for example,
sugar modifications, nucleobase modifications and/or backbone
modifications. Such modifications are also useful to improve uptake
of the siRNA by a cell. Functional and genomic and proteomic
methods are featured. Therapeutic methods are also featured.
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIG. 1A-D depicts a dual fluorescence reporter assay system
for RNAi analysis in HeLa cells. (A) Graphical representation of
dsRNAs used for targeting GFP mRNA and RFP mRNA. GFP and RFP were
encoded by the pEGFP-C1 and pDsRed 1-N1 reporter plasmid,
respectively. siRNAs were synthesized with 2-nt deoxythymidine
overhangs at the 3' end. The position of the first nucleotide of
the mRNA target site is indicated relative to the start codon of
GFP mRNA or RFP mRNA. The sequence of the antisense strand of siRNA
is exactly complementary to the mRNA target site. (B) Fluorescence
images showing specific RNA interference effects in living HeLa
cells. Fluorescence in living cells was visualized by fluorescence
microscopy at 48 hours post transfection. Panels a and b, images of
mock-treated cells (no siRNA added); panels c and d, images of GFP
siRNA-treated cells; panels e and f, images of RFP siRNA-treated
cells. (C) Quantitative analysis of RNAi effects in HeLa cells.
Fluorescence emission spectra of GFP and RFP in total cell lysates
were detected by exciting at 488 nm and 568 nm, respectively. (D)
Kinetics of RNAi effects in HeLa cells. Ratios of normalized GFP to
RFP fluorescence intensity over a 66-hour time course. The
fluorescence intensity ratio of target (GFP) to control (RFP)
protein was determined in the presence of double strand (ds) RNA
(green bars) and normalized to the ratio observed in the presence
of antisense strand (as) RNA (blue bars). Normalized ratios less
than 1.0 indicate specific RNA interference. Maximal RNAi effect
occurred at 42 hours post transfection.
[0008] FIG. 1E-F depicts analysis of specific RNAi activities by
Western blotting. Antisense and double strand RNA are indicated as
as and ds, respectively. GFP as (E, left panel), GFP ds (E, right
panel), RFP as (F, left panel) or RFP ds (F, right panel) were
cotransfected with pEGFP-C1 and pDsRed1-N1 reporter plasmids into
HeLa cells. Cells were harvested at various times, resolved on 10%
SDS-PAGE, transferred onto PVDF membranes, and immunoblotted with
antibodies against EGFP and DsRed1-N1. The membrane was stripped
and re-probed with anti-actin antibody to check for equal loading
of total proteins.
[0009] FIG. 1G depicts expression of GFP in HeLa cells treated with
antisense or double-stranded siRNA targeting GFP. Transfected cells
were harvested at various times after transfection and total cell
lysates were analyzed by fluorescence spectroscopy. Fluorescence
emission spectra of GFP and RFP were detected by exciting at 488 nm
and 568 nm, respectively.
[0010] FIG. 2 depicts the modification of GFP siRNA duplexes. (A)
Structure of 5'-N3 (amino group with 3-carbon linker, red) and
3'-Pmn (puromycin, blue) modifications. (B) Classification and
nomenclature of the modified siRNAs. Sense (top row, purple) and
antisense (bottom row, black) strands of siRNA species are shown
with their 5'-N3 (red) and 3'-Pmn or biotin (blue) modifications. A
dinucleotide internal bulge structure (green) was introduced in
sense, antisense, or duplex RNAs.
[0011] FIG. 3 depicts fluorescence images showing RNA interference
effects in living HeLa cells transfected with modified siRNA
duplexes. HeLa cells were cotransfected by lipofectamine with
pEGFP-C1, pDsRed1-N1 reporter plasmids and siRNA with a 5'
modification (panels c, d, and e), 3' modification (panels f, g, h,
and i) or internal bulge (panels j, k, and l). Fluorescence in
living cells was visualized at 48 hours post transfection. GFP
fluorescence (left panels) and phase contrast images (right panels)
are shown. RNA used in each experiment is indicated on the left of
each pair of panels.
[0012] FIG. 4 depicts quantitative analysis of RNAi effects in HeLa
cells transfected with modified siRNAs. pEGFP-C1 (as reporter),
pDsRed1-N1 (as control) plasmids and 50 nM siRNA were cotransfected
into HeLa cells by lipofectamine. Cells were harvested at various
times after transfection. Fluorescence emission spectra of GFP and
RFP in total cell lysates were detected by exciting at 488 nm and
568 nm, respectively. (A) GFP emission spectra of modified
siRNAi-treated cells. Emission spectra of GFP in lysates from cells
transfected with 5'-modified GFP siRNAs (upper panel), 3'-modified
GFP siRNAs (middle panel) and bulge-containing GFP siRNAs (lower
panel). For comparison, results from antisense-(as, red line) and
unmodified duplex siRNA (ds, black line)-treated cells are included
in each panel. (B) Ratios of normalized GFP to RFP fluorescence
intensity in lysates from modified siRNA-treated HeLa cells over 66
hours. The fluorescence intensity ratio of target (GFP) to control
(RFP) fluorophore was determined in the presence of 5'-modified GFP
siRNAs (upper panel), 3'-modified GFP siRNAs (middle panel), and
bulge-containing GFP siRNAs (lower panel) and normalized to the
ratio observed in the presence of antisense strand siRNA.
Normalized ratios less than 1.0 indicate specific RNA interference
effects. For comparison, results from antisense RNA and duplex
siRNA-treated cells are included in each panel (as, orange bars;
ds, yellow bars).
[0013] FIG. 5 depicts the isolation of 5' end phosphorylated and 3'
end biotinylated siRNA from HeLa cells. HeLa cells were
cotransfected with biotinylated GFP duplex siRNA (ss/as3'-Biotin)
and pEGFP-C1 plasmid as described in Experimental Procedures. The
siRNA was isolated by pull out assay and subjected to phosphatase
and kinase reactions (see Experimental Procedures). Briefly,
streptavidin magnetic beads were used to pull out biotinylated
siRNAs from transfected cells, washed to remove unbound RNA, and
split into two aliquots. One aliquot was dephosphorylated with
shrimp alkaline phosphatase (SAP), and the RNA 5' ends labeled with
.sup.32P by T4 polynucleotide kinase (PNK) reaction. The other
aliquot was not dephosphorylated. RNA was resolved on 20%
polyacrylamide-7M Urea gels and visualized by phosphorimager
analysis. Lanes 1-3 (marker lanes) contain 5'-end-labeled RNA: lane
1, sense strand (ss); lane 2,3' biotinylated antisense strand
(as3'-Biotin); lane 3, heat denatured (10 min at 95.degree. C.)
siRNA duplex (ss/as3'-Biotin). Lanes 5-14, isolated biotinylated
siRNA with SAP treatment (lanes 5-9) or without (lanes 10-14). Lane
4, RNA isolated as above from HeLa cells without siRNA
transfection.
[0014] FIG. 6 depicts RNA interference activities of covalently
photocross-linked duplex RNA in HeLa cells. (A) Structure of a
psoralen derivative, 4'-hydroxymethyl-4,5',8-trimethylpsoralen
(HMT), used to cross-link the duplex RNA. (B) Photocross-linking
sites in GFP siRNA. Three preferred sites for psoralen addition to
a duplex RNA are shown by cyan letters with red bars indicating the
C-U cross-links formed by UV irradiation in the presence of HMT.
(C) Psoralen photocross-linking of siRNA duplexes. Mixtures of
siRNA duplex and psoralen were exposed to UV 360 nm and denatured.
Cross-linked and noncross-linked siRNAs were resolved on 20% PAGE
containing 7 M urea (lanes 2 and 3). UV-irradiated RNA bands were
excised from the gel and purified. Purified cross-linked dsRNA
(ds-XL) and noncross-linked dsRNA (ds*) are shown in lanes 6 and 5,
respectively. To confirm the nature and purity of the cross-link, a
portion of the 360 nm UV-irradiated sample (lane 3) was
UV-irradiated at 254 nm. Photoreversal of psoralen cross-linked
siRNA resulted in products with similar electrophoretic mobility to
the siRNA duplex without HMT treatment (lane 4). (D) Fluorescence
images showing RNA interference effects of psoralen
photocross-linked siRNAs in living HeLa cells. Purified
cross-linked ds siRNA (ds-XL, bottom panels) was cotransfected with
reporter pEGFP-C1 and control pDsRed1-N1 plasmids into HeLa cells
for dual fluorescence reporter assays. Fluorescence (left panels)
and phase contrast (right panels) images of living cells were taken
48 hours post transfection. For comparison, images from
noncross-linked ds siRNA (ds*, middle panels) and antisense siRNA
(as, top panels) are also shown. (E) GFP emission spectra of
psoralen photocross-linked siRNA duplex-treated cells. Cell lysates
were prepared from HeLa cells treated with antisense siRNA (as),
unmodified UV-irradiated duplex siRNA (ds*) and cross-linked ds
siRNA (ds-XL) and analyzed by fluorescence spectroscopy.
Fluorescence emission spectra of GFP and RFP were detected by
exciting at 488 nm and 568 nm, respectively. GFP emission spectra
are shown normalized to RFP expression.
[0015] FIG. 7 depicts the isolation of psoralen-cross-linked siRNA
from human cells. siRNA duplexes were conjugated with 3' biotin
(ss/as3'-Biotin), psoralen cross-linked and purified as described
in FIG. 6 and in Experimental Procedures. HeLa cells were
cotransfected by lipofectamine with cross-linked siRNA
(ss/as3'-Biotin-XL) and pEGFP-C1 plasmid, and siRNA were isolated
by biotin pull out assay at 30 h post transfection as described in
Experimental Procedures. Briefly, streptavidin-magnetic beads with
biotinylated siRNA were subjected to phosphatase treatment and 5'
end-labeled with .sup.32P. RNA was resolved on 20%
polyacrylamide-7M urea gels and visualized by phosphorimager
analysis. Lane 1, RNA from HeLa cells without siRNA transfection.
Lane 2, .sup.32P-labeled noncross-linked siRNA duplex
(ss/as3'-Biotin). Lane 3, .sup.32P-labeled 3' biotinylated
anti-sense strand siRNA (as3'-Biotin). Lane 4, .sup.32P-labeled
sense strand RNA (ss). Lane 5, .sup.32P-labeled cross-linked siRNA
duplex (ss/as3'-Biotin-XL). Lanes 7 and 8, siRNA isolated from HeLa
cells treated with cross-linked siRNA duplex (ss/as3'-Biotin-XL).
Lanes 6 and 8, UV-irradiation (254 nm) of cross-linked siRNA to
photoreverse the psoralen cross-links.
[0016] FIG. 8 depicts fluorescence intensity spectra for extracts
of cells transfected with various GFP- and/or RFP-encoding plasmids
and, optionally, treated with siRNAs targeting GFP and/or RFP
mRNAs. (A) depicts the fluorescence intensity spectra for gextracts
from cells transfected with dsRed1-N1 versus dsRed2-N1. (B) depicts
RNAi of GFP or RFP, left and right panels, respectively.
[0017] FIG. 9 depicts a quantitative analysis of RNAi effects in
HeLa cells transfected with modified single-stranded (antisense
strand) siRNAs.
[0018] FIG. 10 depicts a quantitative analysis of RNAi effects in
HeLa cells transfected with modified duplex siRNAs.
[0019] FIG. 11 depicts the kinetics of RNAi effects of duplex siRNA
with 2'-Fluoro uridine and cytidine modification in HeLa cells.
[0020] FIG. 12 depicts the stability of duplex siRNA with 2'-Fluoro
uridine and cytidine modification in HeLa cell lysates.
[0021] FIG. 13 depicts a quantitative analysis of RNAi effects of
duplex siRNAs with 2'-Fluoro uridine and cytidine modifications,
and 2'-Fluoro uridine and cytidine modifications in combination
with 2'-deoxy modifications, in HeLa cells.
[0022] FIG. 14 depicts a quantitative analysis of RNAi effects of
duplex siRNAs with N3-Methyl uridine modifications in HeLa
cells.
[0023] FIG. 15 depicts a quantitative analysis of RNAi effects of
duplex siRNAs with 2-nucleotide mismatches in the antisense strand
in HeLa cells.
[0024] FIG. 16 depicts a quantitative analysis of RNAi effects of
duplex siRNAs with 5-Br uridine, 5-I uridine and diaminopurine
modifications in the antisense strand in HeLa cells.
[0025] FIG. 17 depicts target RNA cleavage by duplex siRNAs with
various modifications in HeLa cell lysates.
[0026] FIG. 18 depicts the mechanism for RNAi in human cells
highlighting the requirement of the A-form helix and major groove
for mRNA cleavage and the steps which do not require the RNA 2' OH
of the guide antisense siRNA.
[0027] FIG. 19 depicts the structures of EGFP siRNA and the
structure and nomenclature of preferred chemical modifications.
[0028] FIG. 20 is a drawing of the structure of a novel
photocleavable biotin.
DETAILED DESCRIPTION OF THE INVENTION
[0029] The present invention is based on the suprising discovery
that siRNA molecules (i.e., duplex siRNA molecules) can be modified
at internal residues such that properties important for in vivo
applications, in particular, human therapeutic applications, are
improved without compromising the RNAi activity of the siRNA
molecules. The instant invention features siRNAs having significant
modification to internal residues within the siRNA, providing new
rules for designing effective and stable siRNAs for RNAi-mediated
gene-silencing applications. Most remarkably, modifications at the
2' position of pentose sugars in siRNAs showed that 2' OH groups
are not required for RNAi, indicating that the RNAi machinery does
not require the 2' OH for recognition of siRNAs and that catalytic
ribonuclease activity of RNA-induced silencing complexes (RISC)
does not involve the 2' OH of the guide antisense RNA. In fact, the
instant inventor was able to replace an entire siRNA strand with 2'
deoxy- and 2' fluoro-nucleotides and still induce RNAi in human
cells.
[0030] This is a significant finding for several reasons. First, it
indicates that, mechanistically, the RNAi machinery does not
require the 2' OH for recognition of siRNAs and that the catalytic
ribonuclease activity of RISC does not involve 2' OH groups of the
guide antisense RNA. This also means that a variety of chemical
groups, including fluoro- or deoxy-groups, could substitute for the
2' OH in siRNAs and that no distinguishing chemical specificity was
required for RNAi at the 2' position. This finding now directs
attention to core structural elements, like the A-form helix and
the major groove formed by the A-form helix at the cleavage site
and not RNA itself, as being the essential determinants of RNAi.
These findings are particularly useful in the design of effective
siRNAs. It also explains why DNA-DNA or DNA-RNA hybrids are not
recognized for RNAi. Differences between the miRNA-induced
silencing mechanism and siRNA-mediated RNAi are further explained
by these results in that what distinguishes whether one is induced
over the other is the structure of the RNA-RNA helix. Still another
important implication of these results is that alternate chemical
groups at the 2' position that allow the A-form helix to be
retained but help siRNAs evade recognition by RNases increased
siRNA stability and prolonged RNAi effects induced in vivo.
[0031] Such modifications have the added feature of enhancing
properties such as cellular uptake of the siRNAs and/or stability
of the siRNAs. Preferred modifications are made at the 2' carbon of
the sugar moiety of nucleotides within the siRNA. Also preferred
are certain backbone modifications, as described herein. Also
preferred are chemical modifications that stabilize interactions
between base pairs, as described herein. Combinations of
substitution are also featured. Preferred modifications maintain
the structural integrity of the antisense siRNA-target mRNA duplex.
Methods of mediating RNAi in mammals, preferably humans, are
featured as are kits for such therapeutic use.
[0032] The present invention features modified siRNAs. siRNA
modifications are designed such that properties important for in
vivo applications, in particular, human therapeutic applications,
are improved without compromising the RNAi activity of the siRNA
molecules e.g., modifications to increase resistance of the siRNA
molecules to nucleases. Modified siRNA molecules of the invention
comprise a sense strand and an antisense strand, wherein the sense
strand or antisense strand is modified by the substitution of at
least one nucleotide with a modified nucleotide, such that, for
example, in vivo stability is enhanced as compared to a
corresponding unmodified siRNA, or such that the target efficiency
is enhanced compared to a corresponding unmodified siRNA. Such
modifications are also useful to improve uptake of the siRNA by a
cell. Preferred modified nucelotides do not effect the ability of
the antisense strand to adopt A-form helix conformation when
base-pairing with the target mRNA sequence, e.g., an A-form helix
conformation comprising a normal major groove when base-pairing
with the target mRNA sequence.
[0033] Modified siRNA molecules of the invention (i.e., duplex
siRNA molecules) can be modified at the 5' end, 3' end, 5' and 3'
end, and/or at internal residues, or any combination thereof.
Internal siRNA modifications can be, for example, sugar
modifications, nucleobase modifications, backbone modifications,
and can contain mismatches, bulges, or crosslinks. Also preferred
are 3' end, 5' end, or 3' and 5' and/or internal modifications,
wherein the modifications are, for example, cross linkers,
heterofunctional cross linkers, dendrimer, nano-particle, peptides,
organic compounds (e.g., fluorescent dyes), and/or photocleavable
compounds.
[0034] In one embodiment, the siRNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) end modifications. Modification at the 5' end is preferred
in the sense strand, and comprises, for example, a 5'-propylamine
group. Modifications to the 3' OH terminus are in the sense strand,
antisense strand, or in the sense and antisense strands. A 3' end
modification comprises, for example, 3'-puromycin, 3'-biotin and
the like.
[0035] In another embodiment, the siRNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) crosslinks, e.g., a crosslink wherein the sense strand is
crosslinked to the antisense strand of the siRNA duplex.
Crosslinkers useful in the invention are those commonly known in
the art, e.g., psoralen, mitomycin C, cisplatin,
chloroethylnitrosoureas and the like. A preferred crosslink of the
invention is a psoralen crosslink. Preferably, the crosslink is
present downstream of the cleavage site referencing the antisense
strand, and more preferably, the crosslink is present at the 5' end
of the sense strand.
[0036] In another embodiment, the siRNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) sugar-modified nucleotides. Sugar-modified nucleotides
useful in the invention include, but are not limited to: 2'-fluoro
modified ribonucleotide, 2'-OMe modified ribonucleotide, 2'-deoxy
ribonucleotide, 2'-amino modified ribonucleotide and 2'-thio
modified ribonucleotide. The sugar-modified nucleotide can be, for
example, 2'-fluoro-cytidine, 2'-fluoro-uridine,
2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine,
2'-amino-uridine, 2'-amino-adenosine, 2'-amino-guanosine or
2'-amino-butyryl-pyrene-uridine. A preferred sugar-modified
nucleotide is a 2'-deoxy ribonucleotide. Preferably, the 2'-deoxy
ribonucleotide is present within the sense strand and, for example,
can be upstream of the cleavage site referencing the antisense
strand or downstream of the cleavage site referencing the antisense
strand. A preferred sugar-modified nucleotide is a 2'-fluoro
modified ribonucleotide. Preferably, the 2'-fluoro ribonucleotides
are in the sense and antisense strands. More preferably, the
2'-fluoro ribonucleotides are every uridine and cytidine.
[0037] In another embodiment, the siRNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) nucleobase-modified nucleotides. Nucleobase-modified
nucleotides useful in the invention include, but are not limited
to: 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine,
ribo-thymidine, 2-aminopurine, 5-fluoro-cytidine, and
5-fluoro-uridine, 2,6-diaminopurine, 4-thio-uridine; and
5-amino-allyl-uridine and the like.
[0038] In another embodiment, the siRNA molecule of the invention
comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more) backbone-modified nucleotides, for example, a
backbone-modified nucleotide containing a phosphorothioate group.
The backbone-modified nucleotide is within the sense strand,
antisense strand, or preferably within the sense and antisense
strands.
[0039] In another embodiment, the siRNA molecule of the invention
comprises a sequence wherein the antisense strand and target mRNA
sequences comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, or more) mismatches. Preferably, the mismatch is downstream
of the cleavage site referencing the antisense strand. More
preferably, the mismatch is present within 1-6 nucleotides from the
3' end of the antisense strand. In another embodiment, the siRNA
molecule of the invention comprises a bulge, e.g., one or more
(e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) unpaired bases
in the duplex siRNA. Preferably, the bulge is in the sense
strand.
[0040] In another embodiment, the siRNA molecule of the invention
comprises any combination of two or more (e.g., about 2, 3, 4, 5,
6, 7, 8, 9, 10, or more) siRNA modifications as described herein.
For example, a siRNA molecule can comprise a combination of two
sugar-modified nucleotides, wherein the sugar-modified nucleotides
are 2'-fluoro modified ribonucleotides, e.g., 2'-fluoro uridine or
2'-fluoro cytidine, and 2'-deoxy ribonucleotides, e.g., 2'-deoxy
adenosine or 2'-deoxy guanosine. Preferably, the 2'-deoxy
ribonucleotides are in the antisense strand, and, for example, can
be upstream of the cleavage site referencing the antisense strand
or downstream of the cleavage site referencing the antisense
strand. Preferably, the 2'-fluoro ribonucleotides are in the sense
and antisense strands. More preferably, the 2'-fluoro
ribonucleotides are every uridine and cytidine.
[0041] The invention is also related to the discovery that certain
characteristics of siRNA are necessary for activity and that
modifications can be made to an siRNA to alter physicochemical
characteristics such as stability in a cell and the ability of an
siRNA to be taken up by a cell. Accordingly, the invention includes
siRNA derivatives; siRNAs that have been chemically modified and
retain activity in RNA interference (RNAi). The invention also
includes a dual fluorescence reporter assay (DFRA) that is useful
for testing the activity of siRNAs and siRNA derivatives.
[0042] Accordingly, the invention includes an siRNA derivative that
includes an siRNA having two complementary strands of nucleic acid,
such that the two strands are crosslinked, a 3' OH terminus of one
of the strands is modified, or the two strands are crosslinked and
modified at the 3'0 OH terminus. The siRNA derivative can contain a
single crosslink (e.g., a psoralen crosslink). In some embodiments,
the siRNA derivative has a biotin at a 3' terminus (e.g., a
photocleavable biotin such as the novel photocleavable biotin of
FIG. 8), a peptide (e.g., a Tat peptide), a nanoparticle, a
peptidomimetic, organic compounds (e.g., a dye such as a
fluorescent dye), or dendrimer.
[0043] The invention also includes a method of inhibiting
expression of an RNA. The method includes the steps of introducing
into a cell an siRNA derivative such as those described herein, and
such that the siRNA derivative is targeted to the RNA.
[0044] The invention also includes a method that includes the step
of contacting a cell with a concentration of an siRNA derivative
sufficient to inhibit expression of a target gene. In some
embodiments, the siRNA derivative is a crosslinked siRNA (e.g.,
contains a single crosslink), is modified at a 3' terminus,
contains a biotin at a 3' terminus, contains a photocleavable
biotin having the structure depicted in FIG. 8 at a 3' terminus, or
contains a peptide (e.g., a Tat peptide), nanoparticle,
peptidomimetic, organic molecule (e.g., a fluorescent dye), or
dendrimer at a 3' terminus. In some embodiments of the method, the
siRNA derivative inhibits expression of the target gene at least
30%. The cell can be a mammalian cell (e.g., human cell). In some
cases, the concentration of the siRNA derivative administered to
the cell or within the cell does not completely inhibit expression
of the target gene. In some embodiments, the modified siRNA is
carried out in the absence of a transfection reagent.
[0045] The invention includes a novel photocleavable biotin of the
formula depicted in FIG. 20, and the method of synthesizing the
compound.
[0046] Exemplary siRNAs to be modified according to the
methodologies described herein are siRNAs targeting transcription
elongation factors (TEFs), in particular, DSIF and P-TEFb, as well
as siRNAs targeting subunits of said TEFs, in particular, CycT1,
CDK9 and Spt5. siRNAs targeting TEFs are described in detail herein
and in PCT/US03/24610. All combinations of modifications described
herein and siRNAs (and other RNAi agents) described, for example,
in PCT/US03/24610, are the intended scope of the instant patent
application. Methods as described herein and, for example, in
PCT/US03/24610, featuring modified siRNAs (or RNAi agents) as
described herein are further the intended scope of the instant
patent application.
[0047] So that the invention may be more readily understood,
certain terms are first defined.
[0048] The term "nucleoside" refers to a molecule having a purine
or pyrimidine base covalently linked to a ribose or deoxyribose
sugar. Exemplary nucleosides include adenosine, guanosine,
cytidine, uridine and thymidine. The term "nucleotide" refers to a
nucleoside having one or more phosphate groups joined in ester
linkages to the sugar moiety. Exemplary nucleotides include
nucleoside monophosphates, diphosphates and triphosphates. The
terms "polynucleotide" and "nucleic acid molecule" are used
interchangeably herein and refer to a polymer of nucleotides joined
together by a phosphodiester linkage between 5' and 3' carbon
atoms.
[0049] The term "RNA" or "RNA molecule" or "ribonucleic acid
molecule" refers to a polymer of ribonucleotides. The term "DNA" or
"DNA molecule" or deoxyribonucleic acid molecule" refers to a
polymer of deoxyribonucleotides. DNA and RNA can be synthesized
naturally (e.g., by DNA replication or transcription of DNA,
respectively). RNA can be post-transcriptionally modified. DNA and
RNA can also be chemically synthesized. DNA and RNA can be
single-stranded (i.e., ssRNA and ssDNA, respectively) or
multi-stranded (e.g., double stranded, i.e., dsRNA and dsDNA,
respectively). "mRNA" or "messenger RNA" is single-stranded RNA
that specifies the amino acid sequence of one or more polypeptide
chains. This information is translated during protein synthesis
when ribosomes bind to the mRNA.
[0050] As used herein, the term "small interfering RNA" ("siRNA")
(also referred to in the art as "short interfering RNAs") refers to
an RNA (or RNA analog) comprising between about 10-50 nucleotides
(or nucleotide analogs) which is capable of directing or mediating
RNA interference.
[0051] The term "nucleotide analog", also referred to herein as an
"altered nucleotide" or "modified nucleotide" refers to a
non-standard nucleotide, including non-naturally occurring
ribonucleotides or deoxyribonucleotides. Preferred nucleotide
analogs are modified at any position so as to alter certain
chemical properties of the nucleotide yet retain the ability of the
nucleotide analog to perform its intended function.
[0052] The term "oligonucleotide" refers to a short polymer of
nucleotides and/or nucleotide analogs. The term "RNA analog" refers
to an polynucleotide (e.g., a chemically synthesized
polynucleotide) having at least one altered or modified nucleotide
as compared to a corresponding unaltered or unmodified RNA but
retaining the same or similar nature or function as the
corresponding unaltered or unmodified RNA. As discussed above, the
oligonucleotides may be linked with linkages which result in a
lower rate of hydrolysis of the RNA analog as compared to an RNA
molecule with phosphodiester linkages. For example, the nucleotides
of the analog may comprise methylenediol, ethylene diol,
oxymethylthio, oxyethylthio, oxycarbonyloxy, phosphorodiamidate,
phophoroamidate, and/or phosphorothioate linkages. Exemplary RNA
analogues include sugar- and/or backbone-modified ribonucleotides
and/or deoxyribonucleotides. Such alterations or modifications can
further include addition of non-nucleotide material, such as to the
end(s) of the RNA or internally (at one or more nucleotides of the
RNA). An RNA analog need only be sufficiently similar to natural
RNA that it has the ability to mediate (mediates) RNA
interference.
[0053] As used herein, the term "RNA interference" ("RNAi") refers
to a selective intracellular degradation of RNA. RNAi occurs in
cells naturally to remove foreign RNAs (e.g., viral RNAs). Natural
RNAi proceeds via fragments cleaved from free dsRNA which direct
the degradative mechanism to other similar RNA sequences.
Alternatively, RNAi can be initiated by the hand of man, for
example, to silence the expression of target genes.
[0054] A siRNA having a "sequence sufficiently complementary to a
target mRNA sequence to direct target-specific RNA interference
(RNAi)" means that the siRNA has a sequence sufficient to trigger
the destruction of the target mRNA by the RNAi machinery or
process.
[0055] The term "cleavage site" refers to the residues, e.g.
nucleotides, at which RISC* cleaves the target RNA, e.g., near the
center of the complementary portion of the target RNA, e.g., about
8-12 nucleotides from the 5' end of the complementary portion of
the target RNA.
[0056] The term "upstream of the cleavage site" refers to residues,
e.g., nucleotides or nucleotide analogs, 5' to the cleavage site.
Upstream of the cleavage site with reference to the antisense
strand refers to residues, e.g. nucleotides or nucleotide analogs
5' to the cleavage site in the antisense strand.
[0057] The term "downstream of the cleavage site" refers to
residues, e.g., nucleotides or nucleotide analogs, located 3' to
the cleavage site. Downstream of the cleavage site with reference
to the antisense strand refers to residues, e.g., nucleotides or
nucleotide analogs, 3' to the cleavage site in the antisense
strand.
[0058] The term "mismatch" refers to a basepair consisting of
noncomplementary bases, e.g. not normal complementary G:C, A:T or
A:U base pairs.
[0059] The term "phosphorylated" means that at least one phosphate
group is attached to a chemical (e.g., organic) compound. Phosphate
groups can be attached, for example, to proteins or to sugar
moieties via the following reaction: free hydroxyl group+phosphate
donor.fwdarw.phosphate ester linkage. The term "5' phosphorylated"
is used to describe, for example, polynucleotides or
oligonucleotides having a phosphate group attached via ester
linkage to the C5 hydroxyl of the 5' sugar (e.g., the 5' ribose or
deoxyribose, or an analog of same). Mono-, di-, and triphosphates
are common. Also intended to be included within the scope of the
instant invention are phosphate group analogs which function in the
same or similar manner as the mono-, di-, or triphosphate groups
found in nature (see e.g., exemplified analogs.)
[0060] As used herein, the term "isolated" molecule (e.g., isolated
nucleic acid molecule) refers to molecules which are substantially
free of other cellular material, or culture medium when produced by
recombinant techniques, or substantially free of chemical
precursors or other chemicals when chemically synthesized.
[0061] The term "in vitro" has its art recognized meaning, e.g.,
involving purified reagents or extracts, e.g., cell extracts. The
term "in vivo" also has its art recognized meaning, e.g., involving
living cells, e.g., immortalized cells, primary cells, cell lines,
and/or cells in an organism.
[0062] A target gene is a gene targeted by a compound of the
invention (e.g., a siRNA (targeted siRNA), candidate siRNA
derivative, siRNA derivative, modified siRNA, etc.), e.g., for
RNAi-mediated gene knockdown. One portion of an siRNA is
complementary (e.g., fully complementary) to a section of the mRNA
of the target gene.
[0063] A gene "involved" in a disorder includes a gene, the normal
or aberrant expression or function of which effects or causes a
disease or disorder or at least one symptom of said disease or
disorder
[0064] The phrase "examining the function of a gene in a cell or
organism" refers to examining or studying the expression, activity,
function or phenotype arising therefrom.
[0065] Various methodologies of the instant invention include step
that involves comparing a value, level, feature, characteristic,
property, etc. to a "suitable control", referred to interchangeably
herein as an "appropriate control". A "suitable control" or
"appropriate control" is any control or standard familiar to one of
ordinary skill in the art useful for comparison purposes. In one
embodiment, a "suitable control" or "appropriate control" is a
value, level, feature, characteristic, property, etc. determined
prior to performing an RNAi methodology, as described herein. For
example, a transcription rate, mRNA level, translation rate,
protein level, biological activity, cellular characteristic or
property, genotype, phenotype, etc. can be determined prior to
introducing a siRNA of the invention into a cell or organism. In
another embodiment, a "suitable control" or "appropriate control"
is a value, level, feature, characteristic, property, etc.
determined in a cell or organism, e.g., a control or normal cell or
organism, exhibiting, for example, normal traits. In yet another
embodiment, a "suitable control" or "appropriate control" is a
predefined value, level, feature, characteristic, property,
etc.
[0066] A cell or culture that has not been contacted with a
modified siRNA or an siRNA derivative is a control cell or control
culture. The control cell or control culture generally contains one
or more reporter genes that are expressed or one or more endogenous
genes of interest, e.g., for RNAi-mediated knockdown. In some
embodiments of the invention, the control cell or control culture
contains an siRNA targeted to a reporter gene or to an endogenous
gene of interest. In some cases, the control cell or control
culture contains an introduced control sequence such as an
antisense strand corresponding to the antisense strand of an siRNA
or modified siRNA.
[0067] A test cell or test culture contains one or more reporter
genes that are expressed or one or more expressed endogenous genes
of interest, e.g., for RNAi-mediated gene knockdown, and also
contains a modified siRNA or siRNA derivative targeted to a
reporter gene or to an endogenous gene of interest.
[0068] Various aspects of the invention are described in further
detail in the following subsections.
[0069] I. siRNA Molecules
[0070] The present invention features "small interfering RNA
molecules" ("siRNA molecules" or "siRNA"), methods of making said
siRNA molecules and methods (e.g., research and/or therapeutic
methods) for using said siRNA molecules. An siRNA molecule of the
invention is a duplex consisting of a sense strand and
complementary antisense strand, the antisense strand having
sufficient complementarity to a target mRNA to mediate RNAi.
Preferably, the strands are aligned such that there are at least 1,
2, or 3 bases at the end of the strands which do not align (i.e.,
for which no complementary bases occur in the opposing strand) such
that an overhang of 1, 2 or 3 residues occurs at one or both ends
of the duplex when strands are annealed. Preferably, the siRNA
molecule has a length from about 10-50 or more nucleotides, i.e.,
each strand comprises 10-50 nucleotides (or nucleotide analogs).
More preferably, the siRNA molecule has a length from about 15-45
nucleotides. Even more preferably, the siRNA molecule has a length
from about 18-25 nucleotides. The siRNA molecules of the invention
further have a sequence that is "sufficiently complementary" to a
target mRNA sequence to direct target-specific RNA interference
(RNAi), as defined herein, i.e., the siRNA has a sequence
sufficient to trigger the destruction of the target mRNA by the
RNAi machinery or process.
[0071] The target RNA cleavage reaction guided by siRNAs (e.g., by
siRNAs) is highly sequence specific. In general, siRNA containing a
nucleotide sequences identical to a portion of the target gene are
preferred for inhibition. However, 100% sequence identity between
the siRNA and the target gene is not required to practice the
present invention. Thus the invention has the advantage of being
able to tolerate sequence variations that might be expected due to
genetic mutation, strain polymorphism, or evolutionary divergence.
For example, siRNA sequences with insertions, deletions, and single
point mutations relative to the target sequence have also been
found to be effective for inhibition. Moreover, not all positions
of a siRNA contribute equally to target recognition. Mismatches in
the center of the siRNA are most critical and essentially abolish
target RNA cleavage. Mismatches upstream of the center or upstream
of the cleavage site referencing the antisense strand are tolerated
but significantly reduce target RNA cleavage. Mismatches downstream
of the center or cleavage site referencing the antisense strand,
preferably located near the 3' end of the antisense strand, e.g. 1,
2, 3, 4, 5 or 6 nucleotides from the 3' end of the antisense
strand, are tolerated and reduce target RNA cleavage only
slightly.
[0072] Sequence identity may determined by sequence comparison and
alignment algorithms known in the art. To determine the percent
identity of two nucleic acid sequences (or of two amino acid
sequences), the sequences are aligned for optimal comparison
purposes (e.g, gaps can be introduced in the first sequence or
second sequence for optimal alignment). The nucleotides (or amino
acid residues) at corresponding nucleotide (or amino acid)
positions are then compared. When a position in the first sequence
is occupied by the same residue as the corresponding position in
the second sequence, then the molecules are identical at that
position. The percent identity between the two sequences is a
function of the number of identical positions shared by the
sequences (i.e., % homology=# of identical positions/total# of
positions.times.100), optionally penalizing the score for the
number of gaps introduced and/or length of gaps introduced.
[0073] The comparison of sequences and determination of percent
identity between two sequences can be accomplished using a
mathematical algorithm. In one embodiment, the alignment generated
over a certain portion of the sequence aligned having sufficient
identity but not over portions having low degree of identity (i.e.,
a local alignment). A preferred, non-limiting example of a local
alignment algorithm utilized for the comparison of sequences is the
algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA
87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl.
Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into
the BLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol.
Biol. 215:403-10.
[0074] In another embodiment, the alignment is optimized by
introducing appropriate gaps and percent identity is determined
over the length of the aligned sequences (i.e., a gapped
alignment). To obtain gapped alignments for comparison purposes,
Gapped BLAST can be utilized as described in Altschul et al.,
(1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment,
the alignment is optimized by introducing appropriate gaps and
percent identity is determined over the entire length of the
sequences aligned (i.e., a global alignment). A preferred,
non-limiting example of a mathematical algorithm utilized for the
global comparison of sequences is the algorithm of Myers and
Miller, CABIOS (1989). Such an algorithm is incorporated into the
ALIGN program (version 2.0) which is part of the GCG sequence
alignment software package. When utilizing the ALIGN program for
comparing amino acid sequences, a PAM120 weight residue table, a
gap length penalty of 12, and a gap penalty of 4 can be used.
[0075] Greater than 90% sequence identity, e.g., 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99% or even 100% sequence identity,
between the siRNA and the portion of the target gene is preferred.
Alternatively, the siRNA may be defined functionally as a
nucleotide sequence (or oligonucleotide sequence) that is capable
of hybridizing with a portion of the target gene transcript (e.g.,
400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C. or
70.degree. C. hybridization for 12-16 hours; followed by washing).
Additional preferred hybridization conditions include hybridization
at 70.degree. C. in 1.times.SSC or 50.degree. C. in 1.times.SSC,
50% formamide followed by washing at 70.degree. C. in 0.3.times.SSC
or hybridization at 70.degree. C. in 4.times.SSC or 50.degree. C.
in 4.times.SSC, 50% formamide followed by washing at 67.degree. C.
in 1.times.SSC. The hybridization temperature for hybrids
anticipated to be less than 50 base pairs in length should be
5-10.degree. C. less than the melting temperature (Tm) of the
hybrid, where Tm is determined according to the following
equations. For hybrids less than 18 base pairs in length,
Tm(.degree. C.)=2(# of A+T bases)+4(# of G+C bases). For hybrids
between 18 and 49 base pairs in length, Tm(.degree.
C.)=81.5+16.6(log 10[Na+])+0.41 (%G+C)-(600/N), where N is the
number of bases in the hybrid, and [Na+] is the concentration of
sodium ions in the hybridization buffer ([Na+] for
1.times.SSC=0.165 M). Additional examples of stringency conditions
for polynucleotide hybridization are provided in Sambrook, J., E.
F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.
Y., chapters 9 and 11, and Current Protocols in Molecular Biology,
1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc.,
sections 2.10 and 6.3-6.4, incorporated herein by reference. The
length of the identical nucleotide sequences may be at least about
10, 12, 15, 17, 20, 22, 25, 27, 30, 32, 35, 37, 40, 42, 45, 47 or
50 bases.
[0076] In a preferred aspect, the invention features small
interfering RNAs (siRNAs) that include a sense strand and an
antisense strand, wherein the antisense strand has a sequence
sufficiently complementary to a target mRNA sequence to direct
target-specific RNA interference (RNAi) and wherein the sense
strand and/or antisense strand is modified by the substitution of
internal nucleotides with modified nucleotides, such that in vivo
stability is enhanced as compared to a corresponding unmodified
siRNA. As defined herein, an "internal" nucleotide is one occurring
at any position other than the 5' end or 3' end of nucleic acid
molecule, polynucleotide or oligonucleoitde. An internal nucleotide
can be within a single-stranded molecule or within a strand of a
duplex or double-stranded molecule. In one embodiment, the sense
strand and/or antisense strand is modified by the substitution of
at least one internal nucleotide. In another embodiment, the sense
strand and/or antisense strand is modified by the substitution of
at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25 or more internal nucleotides. In
another embodiment, the sense strand and/or antisense strand is
modified by the substitution of at least 5%, 10%, 15%, 20%, 25%,
30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%,
95% or more of the internal nucleotides. In yet another embodiment,
the sense strand and/or antisense strand is modified by the
substitution of all of the internal nucleotides.
[0077] In yet another embodiment, the modified nucleotides are
present only in the antisense strand. In yet another embodiment,
the modified nucleotides are present only in the sense strand. In
yet other embodiments, the modified nucleotides are present in both
the sense and antisense strand.
[0078] Preferred modified nucleotides or nucleotide analogues
include sugar- and/or backbone-modified ribonucleotides (i.e.,
include modifications to the phosphate-sugar backbone). For
example, the phosphodiester linkages of natural RNA may be modified
to include at least one of a nitrogen or sulfur heteroatom. In
preferred backbone-modified ribonucleotides the phosphoester group
connecting to adjacent ribonucleotides is replaced by a modified
group, e.g., of phosphothioate group. In preferred sugar-modified
ribonucleotides, the 2' moiety is a group selected from H, OR, R,
halo, SH, SR, NH.sub.2, NHR, NR.sub.2 or ON, wherein R is
C.sub.1-C.sub.6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or
I.
[0079] Preferred are 2'-fluro, 2'-amino and/or 2'-thio
modifications. Particularly preferred modifications include
2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine,
2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine,
2'-amino-adenosine, 2'-amino-guanosine, 2,6-diaminopurine,
4-thio-uridine; and/or 5-amino-allyl-uridine. Additional exemplary
modifications include 5-bromo-uridine, 5-iodo-uridine,
5-methyl-cytidine, ribo-thymidine, 2-aminopurine,
2'-amino-butyryl-pyrene-uridine, 5-fluoro-cytidine, and
5-fluoro-uridine. 2'-deoxy-nucleotides can be used within modified
siRNAs of the instant invention, but are preferably included within
the sense strand of the siRNA duplex. 2'-OMe nucleotides are less
preferred. Additional modified residues have been described in the
art and are commercially available but are less preferred for use
in the modified siRNAs of the instant invention including,
deoxy-abasic, inosine, N3-methyl-uridine, N6,
N6-dimethyl-adenosine, pseudouridine, purine ribonucleoside and
ribavirin. Modification of the linkage between nucleotides or
nucleotide analogs is also preferred, e.g., substitution of
phosphorothioate linkages for phosphodiester linkages.
[0080] Also possible are nucleobase-modified ribonucleotides, i.e.,
ribonucleotides, containing at least one non-naturally occurring
nucleobase instead of a naturally occurring nucleobase. Bases may
be modified to block the activity of adenosine deaminase. Exemplary
modified nucleobases include, but are not limited to, uridine
and/or cytidine modified at the 5-position, e.g., 5-(2-amino)propyl
uridine, 5-bromo uridine; adenosine and/or guanosines modified at
the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g.,
7-deaza-adenosine; O- and N-alkylated nucleotides, e.g., N6-methyl
adenosine are suitable.
[0081] It should be noted that all modifications described herein
may be combined. In a preferred embodiment, 2'-fluoro modified
ribonucleotides and 2'-deoxy ribonucleotides are combined and both
are present within the antisense strand.
[0082] Preferably, an siRNA molecule of the invention will have a
three-dimensional structure resembling A-form RNA helix. More
preferably, an siRNA molecule of the invention will have an
antisense strand which is capable of adopting an A-form helix when
in association with a target RNA (e.g., an mRNA). For this reason,
2'-fluro-modified nucleotides are preferred, as siRNA made with
such modified nucleotides adopts an A-form helix confirmation. In
particular, it is important that an siRNA be capable of adopting an
A-form helix in the portion complementary to the target cleavage
site as it has been discovered that the major groove formed by the
A-form helix at the cleavage site, and not the RNA itself, is an
essential determinant of RNAi. More preferably, a siRNA molecule
will have exhibit increased cellular uptake when contacted with a
cell, e.g., a human cell, as compared to an unmodified siRNA
molecule. Even more preferably, a siRNA molecule will exhibit
increased stability (i. e, resistance to cellular nucleases) as
compared to an unmodified siRNA molecule.
[0083] II. siRNA Derivatives
[0084] Discoveries have been made that elucidate certain mechanisms
of RNAi. These discoveries indicate that the status of the 5'
hydroxyl terminus of the antisense strand of an siRNA determines
RNAi activity, whereas a 3' terminus block is well tolerated in
living cells. Furthermore, isolation of siRNA from human cells has
revealed that 5' hydroxyl termini of the antisense strands are
phosphorylated. It has also been discovered that biotin, chemically
linked to the 3' terminus of an siRNA (e.g., a type of siRNA
derivative), is not efficiently removed and that siRNAs having such
3' biotins are effective in RNAi. In addition, it has been found
that there is no requirement for a perfect A-form helix in siRNA
for interference effects, but an A-form structure is required for
antisense-target RNA duplexes. Strikingly, crosslinking of the
siRNA duplex by psoralen does not completely block RNA
interference, indicating that complete unwinding of the siRNA helix
is not necessary for RNAi activity in vivo. These results highlight
the importance of 5' hydroxyl in the antisense strand of siRNA,
which is essential to initiate the RNAi pathway. Contrary to
current beliefs, these data show that RNA amplification by
RNA-dependent RNA polymerase is not essential for RNAi in mammalian
(e.g., human) cells.
[0085] Based on these discoveries, the invention includes
modifications to siRNA to create corresponding siRNA derivatives.
The siRNA to be modified can be naturally occurring or synthetic.
Modifications include altering a 3' OH end of an siRNA to create a
corresponding siRNA derivative with a new property such as
increased stability or a label. In some embodiments, siRNA is
modified by crosslinking between one or more pairs of nucleotides
in an siRNA, thereby creating another type of siRNA derivative. The
invention also includes a novel photocleavable biotin that is, for
example, useful for labeling a 3' OH terminus of an siRNA.
[0086] In some aspects the invention relates to siRNA derivatives.
An siRNA derivative is a double-stranded RNA-based structure that
is 15-30 nucleotides in length (e.g., 15-25 or in some cases, 21-25
nucleotides in length), has certain features in common with a
corresponding siRNA (an siRNA targeted to the same sequence as the
siRNA derivative) such as the ability to inhibit expression of a
target sequence. The sequence of the antisense strand of an siRNA
or an siRNA derivative is exactly complementary to at least a
portion of the target mRNA. An siRNA typically has a 2-3 nucleotide
3' overhanging end, a 5' phosphate (upon extraction from a cell)
and a 3' hydroxyl terminus. In addition, an siRNA derivative has at
least one of the following which is not a feature of siRNA: a label
at the 3' terminus (e.g., biotin or a fluorescent molecule, the 3'
terminus is blocked, the 3' terminus has a covalently linked group
or compound (e.g., a nanoparticle or a peptide), the siRNA
derivative does not form a perfect A-form helix, but the antisense
strand of the siRNA derivative duplex does form an A-form helix
with target RNA, or the siRNA derivative is crosslinked (e.g., by
psoralen). Methods of synthesizing RNAs and modifying RNAs are
known in the art (e.g., Hwang et al., 1999, Proc. Nat. Acad. Sci.
USA 96:12997-13002; and Huq and Rana, 1997, Biochem.
36:12592-12599).
[0087] In some embodiments of the invention, an siRNA derivative
also exhibits a relatively low level of toxicity. For example, a
concentration of an siRNA derivative that inhibits expression of a
targeted sequence has relatively low toxicity when at least 50% of
the cells in a culture treated with the siRNA derivative are viable
when expression of the targeted sequence is decreased by 50%
compared to expression in a cell that is not treated with the siRNA
derivative. Low toxicity may be associated with greater cell
viability, e.g., at least 60%, 75%, 85%, 90%, 95%, or 100%. Methods
of measuring cell viability are known in the art and include trypan
blue exclusion.
[0088] RNAi provides a new approach for elucidation of gene
function and for inhibiting expression of undesirable genes, which
is also known as "gene knockdown." RNAi-mediated gene knockdown is
useful for, e.g., genome-wide analysis of gene function, target
validation of potentially therapeutic genes, and therapies based on
the elimination, reduction, or elimination of expression of a
specific gene product. In addition, siRNAs are useful tools for
cell biologists studying mammalian gene function. For example,
siRNAs are useful for the analysis of general cell biological
mechanisms such as mitosis, processing and trafficking of RNA
transcripts, the formation of cellular junctions, and membrane
trafficking. Reagents that can be used for such analyses (e.g.,
modified siRNAs with increased stability or functional groups that
endow an siRNA with additional properties) have commercial value
for use in such research.
[0089] The invention provides siRNAs that have been chemically
modified. Certain modifications confer useful properties to siRNA.
For example, increased stability compared to an unmodified siRNA or
a label that can be used, e.g., to trace the siRNA, to purify an
siRNA, or to purify the siRNA and cellular components with which it
is associated. Certain modifications can also increase the uptake
of the siRNA by a cell.
[0090] RNAi-mediated gene knockdown can cause a phenotype that is
lethal or toxic for a cell or the siRNA used to target a gene for
knockdown may affect multiple pathways in the cell. Therefore,
chemically modified siRNAs (siRNA derivatives) that are less
efficient than the corresponding siRNA are still useful in some
applications of RNAi. SiRNA derivatives containing certain
functional groups such as biotin are useful for affinity
purification of proteins and molecular complexes involved in the
RNAi mechanism. The invention also includes methods of testing
modified siRNAs for retention of the ability to act as an siRNA
(e.g., in RNAi) and methods of using siRNA derivatives.
[0091] A. Crosslinked siRNA Derivatives
[0092] Some embodiments include the use of siRNAs that contain one
or more crosslinks between nucleic acids in the complementary
strands of the siRNA. Crosslinks can be introduced into an siRNA
using methods known in the art. In addition to crosslinking using
psoralen (e.g., Example 1 and Example 9, infra; Wang et al., 1996,
J. Biol. Chem. 271:16995-16998) other methods of crosslinking can
be used. In some embodiments, photocrosslinks are made containing
thiouracil (e.g., 4-thiouridine) or thioguanosine bases. In other
embodiments, --SH linkers can be added to the bases or sugar
backbones, which are used to make S--S crosslinks. In some cases,
sugar backbones or amino groups at the C5 position of U, C can be
labeled with benzophenone and other photo crosslinkers or with
chemical crosslinkers. Methods of making such crosslinks are known
in the art (e.g., Wang and Rana, 1998, Biochem. 37:4235-4243;
BioMosaics, Inc., Burlington, Vt.). In general, the stability in a
cell or a cell-free system of a crosslinked siRNA derivative is
greater than that of the corresponding siRNA. In some cases, the
crosslinked siRNA derivative has less activity than the
corresponding siRNA. The ability of a crosslinked siRNA to inhibit
expression of a target sequence can be assayed using methods known
in the art for testing the activity of an siRNA or by methods
disclosed herein such as a dual fluorescence reporter gene
assay.
[0093] In general, an siRNA derivative that is crosslinked contains
one crosslink between two nucleotides of a dsRNA sequence. In some
embodiments, there are two or more crosslinks. Crosslinks are
generally located near the 3' terminus of the antisense strand,
e.g., within about 10 nucleotides of the 3' terminus of the
antisense strand, and generally within about 2-7 nucleotides of the
3' terminus of the antisense strand. A crosslink is to be
distinguished from ligation that joins the ends of the two strands
of an siRNA. A mixture of crosslinked siRNA derivatives that
contains some molecules crosslinked at loci near the middle of the
siRNA or near the 5' terminus of the antisense strand can also be
useful. Such mixtures can have less activity than a mixture of
siRNA derivative that is crosslinked exclusively near the 3'
terminus, but retain sufficient activity to affect expression of a
targeted sequence.
[0094] B. 3' Modifications of siRNA
[0095] It has been discovered that the 3' terminus of siRNA is not
critical for activity in RNAi. Therefore, modifications can be made
to an siRNA to create an siRNA derivative. For example, molecules
that are used for affinity purification or as detectable tags can
be covalently linked to the 3' terminus of an RNAi to create an
siRNA derivative. Such RNAi derivatives are useful, e.g., for
assaying an siRNA by transfecting a cell with an siRNA derivative
of the siRNA containing a detectable tag at the 3' end and
detecting the tag using methods known in the art. Examples of such
tags that can be used for detection or affinity purification of
derivative siRNAs include biotin.
[0096] Methods that can be used to modify an siRNA are known in the
art. For example, crosslinkers can be attached using amino-allyl
coupling methods, e.g., isothiocyanate, N-hydroxysuccinimide (NHS)
esters (Amersham Biosciences Corp., Piscataway, N.J.). A number of
different types of molecules can be attached to a 3' terminus using
such methods including dyes (e.g., Dyomics, Germany; Integrated DNA
Technologies, Coralville, Iowa, ATTO-TEC, Siegen, Germany),
dendrimers (e.g., Dendritech, Midland, Mich.), and nanoparticles.
Crosslinkers can be attached to amino-allyl uridine or amino groups
at sugars using similar chemistry.
[0097] The invention includes conjugation of compounds to an siRNA.
Primary amines are the principal targets for NHS esters. For
example, NHS esters of biotin can be conjugated to free amino
groups at the 3'-end of an siRNA duplex as described in the
Examples.
[0098] In some embodiments, photocrosslinkers (e.g., thiouracil,
thioguanosine, psoralens, benzophenones) are attached at 3'
terminus of an siRNA to create an siRNA derivative. Methods of
synthesizing such modifications are known in the art. Such an siRNA
derivative can be crosslinked to the target cellular machinery in
vitro and in vivo.
[0099] Other heterofunctional linkers can be used to modify the 3'
termini of siRNAs, for example, to link a peptide or a
peptidomimetic oligomer to an siRNA (e.g., Tamilarasu et al., 2001,
Bioorganic & Medicinal Chemistry Letters 11:505-507). For
example, one end of the pair to be linked (siRNA and peptide) can
be made amine reactive and the other thiol reactive. SiRNA that has
been modified in this fashion can be deprotected and linked to
structures that, e.g., improve cellular uptake of the resulting
siRNA derivative compared to uptake of the corresponding siRNA, are
useful for tracing the siRNA derivative in the cell, or improve the
stability of the siRNA derivative compared to the corresponding
siRNA. Example 18 illustrates the use of such a modification in
which a deprotected and purified modified siRNA was linked to Tat
peptides, thereby improving cellular uptake of the siRNA. Such
methods of attaching peptides, including Tat peptides, are known in
the art (e.g., Wang et al., 2001, Biochemistry 40:6458-6464).
Methods of synthesizing peptides and peptidomimetics are known in
the art and can generally be obtained from commercial sources
(e.g., AnaSpec, San Jose, Calif.).
[0100] In another embodiment, the 3' terminus of siRNA is labeled
with dendrimer and/or nanoparticle structures that can enhance
cellular targeting activities without causing any known toxic
effects. In addition, certain dendrimers are useful for
facilitating uptake of molecules into cells, thus covalent linkage
of such a dendrimer to the 3' terminus of an siRNA can increase the
efficiency of uptake into a cell of the resulting dendrimer siRNA
derivative.
[0101] In other embodiments, a dyes can be linked to 3' termini of
an siRNA. Such dyes include those that are useful for energy
transfer and functional assays, e.g., of helicase activity. For
example, a fluorescent donor dye such as isothiocyanate-fluorescein
can be attached to the 3' end of the antisense strand of an siRNA.
An acceptor dye (e.g., isothiocyanate rhodamine) can be attached to
the 5' end. RNA-containing amino groups at the 3' or 5' end can be
obtained from commercial sources or appropriate dyes can be
purchased and the molecules synthesized (Integrated DNA
Technologies, Coralville, Iowa). Such a modified siRNA can be
incubated with RISC complex that contains helicase. Fluorescence
resonance energy transfer (FRET) signals will be altered when the
RNA helix of the modified siRNA is unwound.
[0102] Modification of the 3' end can also include attachment of
photocleavable compounds such as biotin. This is illustrated in
Example 19. RNAi derivatives with photocleavable compounds attached
to the 3' terminus are useful, e.g., for isolating proteins and
other molecular complexes that bind to an siRNA. For example,
photocleavable biotin can be attached to an siRNA. The resulting
derivative is incubated with a cell lysate or transfected into
cells. After a suitable incubation time, the biotin siRNA
derivative is retrieved using avidin attached to a substrate (e.g.,
beads). After washing, the biotin is photocleaved from the siRNA,
thus releasing the siRNA and its interacting proteins. These
proteins can then be subjected to further analysis using methods
known in the art.
[0103] C. Photocleavable Biotin
[0104] The invention includes a method of synthesizing a novel
photocleavable biotin that is depicted in FIG. 8. The novel
photocleavable biotin is useful for methods in which photocleavable
biotins are presently used such as the biotin pull out assay
described in Examples 1 and 5. The advantage of this novel
photocleavable biotin is its increased sensitivity compared to
other photocleavable biotins that are presently known and
commercially available. The advantages of the new photocleavable
biotin disclosed herein include the following features of having a
photolabile linker that is more efficiently cleaved, the compound
contains a longer chain between the biotin and photolabile aromatic
ring, and it makes an amide link with the target protein or other
compound of interest. The novel photocleavable compound is an
oxygenated nitrobenzyl system (in contrast to compounds having only
a nitrobenzyl system) and cleaves efficiently when irradiated at
360 nm (J. Org. Chem., 1995, 60, 7328-7333; Burgess et al., 1997,
J. Org. Chem. 62:5662-5663).
[0105] The synthesis of probe 6 (novel photocleavable biotin)
consists of six reaction steps, which are depicted in the following
scheme. 1
[0106] Synthesis of the amine 3: To prepare amine 3, a stirred
solution of 0.50 g (0.96 mmol) of the photo-linker 1 in 5 ml of
anhydrous DMF, was added 0.15 ml ( 0.96 mmol) of
diisopropylcarbodiimide and 0.13 g (0.96 mmol) of HOBt. A solution
of 0.18 g (0.96 mmol) of compound 2 was then added in 2 ml of DMF
dropwise. The reaction mixture was then stirred overnight at room
temperature. After the completion of the reaction (checked by TLC
analysis), the solvent was evaporated at reduced pressure. Flash
column chromatography on silica gel with 85:15=EtOAC: MeOH afforded
0.64 g (96.5%) of the pure product. To the product thus obtained,
25 ml of 1:1 CH.sub.2Cl.sub.2:TFA was added and the mixture was
stirred at room temperature for 30 minutes. The solvent was
evaporated and the crude product was co-evaporated twice in
anhydrous DMF. This material is used for further coupling
reactions.
[0107] Synthesis of the biotinylated product 4: To synthesize
biotinylated product 4, a mixture of 0.54 g (0.91 mmol) of compound
3, 0.15 ml (0.91 mmol) of diisopropylcarbodiimide, and 0.13 g (0.91
mmol) of HOBt in 5 ml of 1:1 DMF:NMP, was added to a solution of
0.23 g (0.91 mmol) of (+)-Biotin in 2 ml of NMP. The reaction
mixture was then stirred at room temperature for 10 hours. After
the completion of the reaction (as analyzed by HPLC), the solvent
was removed under reduced pressure. Excess reagents and impurities
were then removed by precipitating the product 4 in a mixture of
90:10 CH.sub.2Cl.sub.2:MeOH to afford 0.69 g (92.5%) of the pure
product.
[0108] Synthesis of the acid 5: To a stirred solution of 0.69 g
(0.85 mmol) of 4 in 10 ml of anhydrous DMF, was added 0.17 ml (1.68
mmol) of piperidine. The reaction mixture was stirred at room
temperature for 3 hours and concentrated at rotavapor under reduced
pressure. Excess reagents and side products were then removed by
adding CH.sub.2Cl.sub.2, while the biotinylated amine precipitated
out. It was then collected by filtering through a sintered funnel
and vacuum dried.
[0109] To the amine thus obtained, was added 0.13 g (1.28 mmol) of
succinic anhydride in 5 ml of DMF and the reaction mixture was
stirred at room temperature for 5 hours. It was then concentrated
and the product 5 was precipitated by CH.sub.2Cl.sub.2 to afford
0.48 g (82%) of the pure (HPLC pure) product.
[0110] Synthesis of the succinimidyl ester 6: To a stirred solution
of 95 mg (0.14 mmol) of 5, 22 .mu.L (0.14 mmol) of
diisopropylcarbodiimide and 20 mg (0.14 mmol) of HOBt in 2 ml of
anhydrous DMF, was added 16 mg (0.14 mmol) of N-hydroxysuccinimide
in 0.5 ml of DMF. The pH of the reaction mixture was brought up to
between 8 and 9 and it was stirred overnight at room temperature.
Concentration at reduced pressure and HPLC purification using a
preparative column afforded 90 mg (84%) of 6 in pure form.
[0111] This novel photocleavable biotin is useful, e.g., for
labeling siRNA as described herein.
[0112] D. Use of an siRNA Derivative for Affinity Purification of
RNAi Components
[0113] An siRNA derivative can be used to affinity purify proteins
involved in RNAi and to determine characteristics of molecules that
participate in RNAi. An siRNA derivative can be used for affinity
purification of RNAi proteins from various organisms, e.g., worms
(such as Caenorhabditis elegans), insects (such as Drosophila
melanogaster), and mammals (e.g., mice, rats, domestic animals, and
humans). For example, an siRNA derivative that has been modified by
the addition of a molecule at a 3' terminus that can be used for
crosslinking the siRNA derivative to a solid substrate is useful
for, e.g., recovering an siRNA containing such a modification from
a cell (see the biotin pull out assay in Examples 1 and 5) or for
isolating components of the RNAi machinery such as RISC that bind
to the siRNA derivative. Such molecules provide insight into the
mechanism of RNAi in mammalian cells and additional targets for
compounds that inhibit or enhance RNAi activity. Methods for
attaching a compound to a substrate for use in purification methods
and methods for affinity purification of proteins are known in the
art.
[0114] III. Efficacy Assays
[0115] The invention further features assaying compounds of the
invention that have been altered in at least one of the features
described herein whose efficacy for modulating expression of a
target RNA is not established. In one embodiment, the invention
features methods of assaying the ability of a compound of the
invention (e.g., a siRNA, candidate RNAi derivative, modified
siRNA, etc.) to modulate (e.g., inhibit) expression of a target RNA
using a dual fluorescence system. Other assay systems known in the
art that measure the efficacy of an siRNA can be used to evaluate
whether a modified siRNA is an siRNA derivative. In general, the
ability of an siRNA derivative to inhibit detectable expression of
a target RNA is at least 10%, 20%, or 30% compared to expression of
the target in the absence of the RNAi derivative. In some cases,
expression of the target sequence is inhibited 50%, 75%, 85%, 90%,
or 100%.
[0116] A compound of the invention (e.g., a siRNA, candidate RNAi
derivative, modified siRNA, etc.) can be tested for its ability to
inhibit expression of a targeted gene. For example, candidate RNAi
derivatives that can inhibit such expression are identified as
siRNA derivatives. Any system in which RNAi activity can be
detected can be used to test the activity of a compound of the
invention (e.g., a siRNA, candidate RNAi derivative, modified
siRNA, etc.). In general, a system in which RNAi activity can be
detected is incubated in the presence and absence of a compound of
the invention (e.g., a siRNA, candidate RNAi derivative, modified
siRNA, etc.
[0117] The invention includes a dual fluorescence reporter gene
assay (DFRG assay) that can be used to test a compound of the
invention (e.g., a siRNA, candidate RNAi derivative, modified
siRNA, etc.). The DFRG assay can also be used, for example, to test
the ability of these and other types of compounds to inhibit
expression of a targeted gene (i.e., RNAi inhibitors).
[0118] In the DFRG assay, cells are used that have RNAi activity
and contain at least two reporter genes that encode and can express
at least two different fluorescent proteins. Alternatively, at
least one of the reporter genes can encode hybrid proteins
comprising a portion that corresponds to a reporter protein and a
portion that corresponds to a protein of interest (i.e., is
translated from an mRNA that is targeted by the siRNA or modified
siRNA used in the assay). The fluorescence emission spectra of the
two proteins are such that they can be distinguished when expressed
simultaneously, e.g., red fluorescent protein (RFP) and green
fluorescent protein (GFP). One reporter gene is used as a
reference. The reporter cell is transfected with a compound of the
invention (e.g., a siRNA, candidate RNAi derivative, modified
siRNA, etc.), for example, an siRNA that has been chemically
modified at 3' terminus, contains at least one crosslink between
the two strands of the siRNA, or both. The compound of the
invention (e.g., a siRNA, candidate RNAi derivative, modified
siRNA, etc.) is targeted to one of the reporter gene sequences. In
some cases, the cell is co-transfected with the reporter genes and
the compound of the invention (e.g., a siRNA, candidate RNAi
derivative, modified siRNA, etc.). The cell is incubated for a time
sufficient to produce detectable reporter proteins in the absence
of the compound of the invention (e.g., a siRNA, candidate RNAi
derivative, modified siRNA, etc.). After incubation, the level of
fluorescence is measured using methods known in the art. Generally,
after incubation, the cell is lysed and the lysate is cleared and
protein concentration determined. An aliquot of the lysate is then
assayed for fluorescence intensity.
[0119] The ratio of fluorescence emission intensities between the
two reporter genes is compared to a control to standardize the
ratio. Normalized ratios of less than one (i.e., less fluorophore
expression in the cell contacted with the compound of the invention
(e.g., a siRNA, candidate RNAi derivative, modified siRNA, etc.)
than in the control cell) indicate target sequence-specific
interference.
[0120] In one embodiment, the invention includes a method of
determining whether a candidate siRNA derivative is an siRNA
derivative. The method includes the steps of obtaining a reporter
cell comprising two different fluorescent reporter genes,
transfecting the reporter cell with a candidate siRNA derivative
targeted to one of the fluorescent reporter genes, thus creating a
test cell; incubating the test cell for a time sufficient for a
reporter cell to express detectable levels of the fluorescent
reporter proteins encoded by the fluorescent reporter genes;
determining the fluorescence intensity of each fluorescent reporter
protein in the test cell; and determining the ratio of the level of
fluorescence intensity between the two fluorescent reporter
proteins in the test cell and normalizing the ratio to the ratio of
fluorescence intensity in a control reporter cell that was not
transfected with the candidate siRNA derivative, such that a
normalized ratio of less than one indicates that the candidate
siRNA derivative is an siRNA derivative. In some embodiments of
this method, the control reporter cell is transfected with an
antisense sequence that is complementary to the targeted reporter
gene. In some embodiments, the candidate siRNA derivative is a
crosslinked siRNA (e.g., the modified siRNA contains a single
crosslink), the candidate siRNA derivative is psoralen crosslinked,
the candidate siRNA derivative is modified at a 3' terminus (e.g.,
the modified siRNA comprises a biotin at a 3' terminus), or the
modified siRNA contains a photocleavable biotin having the
structure depicted in FIG. 20 at a 3' terminus. The candidate siRNA
derivative can contain a peptide (e.g., a Tat peptide),
nanoparticle, peptidomimetic, organic molecule (e.g., a fluorescent
dye) or dendrimer at a 3' terminus. In some cases, the two reporter
proteins are Green Fluorescent Protein (GFP) and Red Fluorescent
Protein (RFP). In some cases, the normalized ratio is at least
0.3.
[0121] The control ratio used for normalization is determined by
transfecting a cell with the two reporter genes, incubating, and
determining the ratio of fluorescence intensities from the two
cells as described above for a test cell. In some embodiments, the
control cell is transfected with the reporter genes and with an
antisense RNA that is specific for the reporter gene that is
targeted by the compound of the invention (e.g., a siRNA, candidate
RNAi derivative, modified siRNA, etc.). Methods of designing and
selecting siRNAs are known in the art. In some cases, the targeted
region in the mRNA and the sequence in the siRNA duplex are chosen
using the following guidelines. The targeted sequence is generally
selected from the open reading frame region from the cDNA sequence
of the targeted gene. In general the target site is at least 75-100
nucleotides downstream from the start codon. Neither the 5' nor 3'
untranslated regions and regions near the start codon are generally
used for targeting because these may be richer in regulatory
protein binding sites. After locating the first AA dimer located
about 100 bases downstream from the start codon, the next 19
nucleotides following the AA dimer are recorded The percentage of
guanosines and cytidines (G/C content) of the AA-N19-21 base
sequence is determined. The G/C content of this short sequence must
be less than 70% and greater than 30% for use as siRNA. In general,
the G/C content of the sequence is about 50%. If the selected
sequence does not meet these criteria, the search continues
downstream to the next AA dimer until the G/C conditions are met.
To ensure that only one gene is targeted by the sequence, the
selected sequence (generally about 21 nucleotides) is subjected to
a BLAST search (NCBI database) against EST libraries.
[0122] In some embodiments of the invention, proteins from the
lysates are prepared as described above and analyzed using Western
blotting. Briefly, the proteins prepared from the transfected cells
(control cells and test cells) are subjected to SDS-PAGE (e.g., in
a 10% gel) and transferred to a membrane suitable for Western
blotting (for example, a PVDF membrane). The membrane is
immunoblotted using methods known in the art to detect the
fluorescent reporter proteins. In general, a protein that can be
used as a control for protein loading (such as a housekeeping
protein) is also detected. Less expression of the targeted protein
compared to control indicates that the test sequence (e.g. modified
siRNA) is effective for target sequence-specific interference.
[0123] Cells to be used in a DFRG assay are generally cultured
mammalian cells, e.g., human cells. The cells can be immortal,
primary, or secondary cells. Cells from other organisms that
exhibit RNAi or RNAi-type activity such as quelling can also be
used. Such cells include those from fungi, plants, invertebrates
(e.g., Drosophila melanogaster and Caenorhabditis elegans), and
vertebrates (e.g., zebrafish and mouse). Fluorescent molecules that
can be used in DFRG assays are pairs of fluorescent molecules whose
emission spectra can be distinguished when there is simultaneous
emission. Examples of such pairs include Green Fluorescent Protein
(GFP) and Red Fluorescent Protein (RFP). Additional examples can be
selected, e.g., from those shown in Table 1.
1TABLE I LIVING COLORS FLUORESCENT PROTEINS Excit./ Emiss. Fluor.
Maxima Extinction Quantum Protein (nm) Coefficient Yield Reference
DsRed 668/583 22,500 0.23 Matz et al., 1999 EGFP 488/507 65,000
0.60 D.W. Piston, EYFP 513/527 84,000 0.61 Vanderbilt University,
ECFP 433/475 26,000 0.40 {close oversize brace} Personal comm. EBFP
380/440 31,000 0.18
[0124] IV. Production
[0125] RNA may be produced enzymatically or by partial/total
organic synthesis, any modified ribonucleotide can be introduced by
in vitro enzymatic or organic synthesis. In one embodiment, a siRNA
is prepared chemically. Methods of synthesizing RNA molecules are
known in the art, in particular, the chemical synthesis methods as
de scribed in Verma and Eckstein (1998) Annul Rev. Biochem.
67:99-134. In another embodiment, a siRNA is prepared
enzymatically. For example, a ds-siRNA can be prepared by enzymatic
processing of a long ds RNA having sufficient complementarity to
the desired target mRNA. Processing of long ds RNA can be
accomplished in vitro, for example, using appropriate cellular
lysates and ds-siRNAs can be subsequently purified by gel
electrophoresis or gel filtration. ds-siRNA can then be denatured
according to art-recognized methodologies. In an exemplary
embodiment, RNA can be purified from a mixture by extraction with a
solvent or resin, precipitation, electrophoresis, chromatography,
or a combination thereof. Alternatively, the RNA may be used with
no or a minimum of purification to avoid losses due to sample
processing. Alternatively, the single-stranded RNAs can also be
prepared by enzymatic transcription from synthetic DNA templates or
from DNA plasmids isolated from recombinant bacteria. Typically,
phage RNA polymerases are used such as T7, T3 or SP6 RNA polymerase
(Milligan and Uhlenbeck (1989) Methods Enzymol. 180:51-62). The RNA
may be dried for storage or dissolved in an aqueous solution. The
solution may contain buffers or salts to inhibit annealing, and/or
promote stabilization of the single strands.
[0126] In one embodiment, siRNAs are synthesized either in vivo, in
situ, or in vitro. Endogenous RNA polymerase of the cell may
mediate transcription in vivo or in situ, or cloned RNA polymerase
can be used for transcription in vivo or in vitro. For
transcription from a transgene in vivo or an expression construct,
a regulatory region (e.g., promoter, enhancer, silencer, splice
donor and acceptor, polyadenylation) may be used to transcribe the
siRNA. Inhibition may be targeted by specific transcription in an
organ, tissue, or cell type; stimulation of an environmental
condition (e.g., infection, stress, temperature, chemical
inducers); and/or engineering transcription at a developmental
stage or age. A transgenic organism that expresses siRNA from a
recombinant construct may be produced by introducing the construct
into a zygote, an embryonic stem cell, or another multipotent cell
derived from the appropriate organism.
[0127] V. Targets
[0128] In one embodiment, the target mRNA of the invention
specifies the amino acid sequence of a cellular protein (e.g., a
nuclear, cytoplasmic, transmembrane, or membrane-associated
protein). In another embodiment, the target mRNA of the invention
specifies the amino acid sequence of an extracellular protein
(e.g., an extracellular matrix protein or secreted protein). As
used herein, the phrase "specifies the amino acid sequence" of a
protein means that the mRNA sequence is translated into the amino
acid sequence according to the rules of the genetic code. The
following classes of proteins are listed for illustrative purposes:
developmental proteins (e.g., adhesion molecules, cyclin kinase
inhibitors, Wnt family members, Pax family members, Winged helix
family members, Hox family members, cytokines/lymphokines and their
receptors, growth/differentiation factors and their receptors,
neurotransmitters and their receptors); oncogene-encoded proteins
(e.g., ABLI, BCLI, BCL2, BCL6, CBFA2, CBL, CSFIR, ERBA, ERBB,
EBRB2, ETSI, ETSI, ETV6, FGR, FOS, FYN, HCR, HRAS, JUN, KRAS, LCK,
LYN, MDM2, MLL, MYB, MYC, MYCLI, MYCN, NRAS, PIM I, PML, RET, SRC,
TALI, TCL3, and YES); tumor suppressor proteins (e.g., APC, BRCA1,
BRCA2, MADH4, MCC, NF I, NF2, RB I, TP53, and WTI); and enzymes
(e.g., ACC synthases and oxidases, ACP desaturases and
hydroxylases, ADP-glucose pyrophorylases, ATPases, alcohol
dehydrogenases, amylases, amyloglucosidases, catalases, cellulases,
chalcone synthases, chitinases, cyclooxygenases, decarboxylases,
dextriinases, DNA and RNA polymerases, galactosidases, glucanases,
glucose oxidases, granule-bound starch synthases, GTPases,
helicases, hernicellulases, integrases, inulinases, invertases,
isomerases, kinases, lactases, lipases, lipoxygenases, lysozymes,
nopaline synthases, octopine synthases, pectinesterases,
peroxidases, phosphatases, phospholipases, phosphorylases,
phytases, plant growth regulator synthases, polygalacturonases,
proteinases and peptidases, pullanases, recombinases, reverse
transcriptases, RUBISCOs, topoisomerases, and xylanases).
[0129] In a preferred aspect of the invention, the target mRNA
molecule of the invention specifies the amino acid sequence of a
protein associated with a pathological condition. For example, the
protein may be a pathogen-associated protein (e.g., a viral protein
involved in immunosuppression of the host, replication of the
pathogen, transmission of the pathogen, or maintenance of the
infection), or a host protein which facilitates entry of the
pathogen into the host, drug metabolism by the pathogen or host,
replication or integration of the pathogen's genome, establishment
or spread of infection in the host, or assembly of the next
generation of pathogen. Alternatively, the protein may be a
tumor-associated protein or an autoimmune disease-associated
protein.
[0130] In one embodiment, the target mRNA molecule of the invention
specifies the amino acid sequence of an endogenous protein (i.e., a
protein present in the genome of a cell or organism). In another
embodiment, the target mRNA molecule of the invention specified the
amino acid sequence of a heterologous protein expressed in a
recombinant cell or a genetically altered organism. In another
embodiment, the target mRNA molecule of the invention specified the
amino acid sequence of a protein encoded by a transgene (i.e., a
gene construct inserted at an ectopic site in the genome of the
cell). In yet another embodiment, the target mRNA molecule of the
invention specifies the amino acid sequence of a protein encoded by
a pathogen genome which is capable of infecting a cell or an
organism from which the cell is derived.
[0131] By inhibiting the expression of such proteins, valuable
information regarding the function of said proteins and therapeutic
benefits which may be obtained from said inhibition may be
obtained.
[0132] VI. Targeting Transcription Elongation Factors
[0133] Positive transcription elongation factor complex b (P-TEFb),
which is composed of two subunits, CDK9 and cyclin T1 (CycT1)
(Garber et al., Genes & Dev., 12:3512-3527 (1998)), allows the
transition to productive elongation, producing longer mRNA
transcripts (Price (2000), supra). Two negative transcription
elongation factors, DSIF (DRB sensitivity-inducting factor; DRB is
5, 6-dichloro-1-.beta.-D-ribofuranos- ylbenzimidazole) and NELF
(negative elongation factor), have been identified and
characterized (Wada et al., Genes Dev. 12:343-56 (1998); Yamaguchi
et al., Cell 97:41-51 (1999)). DSIF is composed of at least two
subunits, one 14-kDa and one 160-kDa, which are homologs of the
Saccharomyces cerevisiae transcription factors Spt5 and Spt4,
respectively (Hartzog et al., Genes Dev. 12:357-369 (1998)). NELF
is composed of five polypeptides, named as NELF-A to -E, and
contains a subunit identical to RD, a putatitive RNA-binding
protein (containing arginine-aspartic acid (RD) dipeptide repeats)
of unknown function. DSIF and NELF function cooperatively and
strongly repress RNA pol II elongation (Yamaguchi et al., supra).
In the absence of P-TEFb, DSIF plays the role of a negative
regulator in transcription (Wada et al., EMBO J. 17:7395-7403
(1998)). DSIF subunit Spt5 also has a positive elongation activity
in Tat transactivation (Wu-Baer et al., J. Mol. Biol. 277:179-197
(1998); Kim et al., Mol. Cell.
[0134] Biol. 19:5960-598 (1999)). Another transcription elongation
factor, Spt6, has been identified which is functionally related to
Spt5; Spt5 and Spt6 have been shown to colocalize at regions of
active transcription as well as at certain stress response genes
induced by heat shock (Kaplan et al., Genes Dev. 14:2623-2634
(2000); Andrulis et al., Genes Dev. 14: 2635-2649 (2000)).
[0135] Among the genes regulated in this manner are several
protooncogenes (c-myc, c-myb, c-fos); c-fms, the gene encoding
macrophage colony stimulating factor 1 (CSF-1) receptor; the gene
encoding adenosine deaminase; a collection of stress response genes
including hsp70; and genes involved in replication and pathogenesis
of HIV-1 and HIV-2.
[0136] One elegant example of transcription elongation control is
the mechanism of HIV-1 gene expression (reviewed in: Cullen 1998
Cell 93:685-92; Emerman and Malin 1998 Science 280:1880-4; Jeang et
al. 1999 J Biol Chem 274:28837-40; Jones 1997 Genes Dev
11:2593-2599; Karm 1999 J Mol Biol. 293:235-254; Taube et al. 1999
Virology 264:245-253). The HIV-1 transcriptional activation
mechanism requires Tat interactions with the human Cyclin T1
(hCycT1) subunit of P-TEFb that recruits the kinase complex to the
pol II elongation machinery (Bieniasz et al. 1998 EMBO J.
17:7056-65; Herrmann and Rice 1995 J. Virol. 69:1612-1620; Herrmann
and Rice 1993 Virology 197:601-608; Isel and Karn 1999 J. Mol Biol.
290:929-941; Jones 1997 Genes Dev. 11:2593-2599; Mancebo et al.
1997 Genes Dev 11:2633-2644; Taube et al. 1999 Virology 264:
245-253; Wei et al. 1998 Cell 92:451-62; Yang et al. 1997 Proc Natl
Acad Sci USA 94:12331-12336; Zhu et al. 1997 Genes Dev.
11:2622-32). The pol II CTD, and Spt5 are also intimately connected
to this regulation of HIV gene expression by Tat and P-TEFb. During
HIV transcription, P-TEFb, which is initially found as a component
of the pol II preinitiation complex (PIC), travels with the
transcription elongation complex (TEC) as it moves along the HIV
transcription unit (Ping and Rana 1999 J Biol Chem 274:7399-7404).
In contrast, DSIF and NELF are not present in the PIC, but
associate with the TEC at promoter proximal positions and then
travel with the TECs down the template (Ping and Rana 2001 J Biol
Chem 276:12951-12958).
[0137] Based, at least in part, on the findings presented in
Examples XX-XXXIII, the present invention relates to methods of
modulating (e.g., decreasing) the activity of transcription
elongation factors (TEFs) and more specifically to ribonucleic acid
interference (RNAi) of TEFs (e.g., positive transcription
elongation factors or P-TEFs) or subunits thereof (e.g., the P-TEFb
subunits CDK9 and CycT1).
[0138] In one embodiment, RNA interference (RNAi) methods (e.g.,
featuring siRNAs, siRNA derivative, a modified siRNA, etc., as
described herein) are used to specifically silence one or more
TEFs, e.g., P-TEFb, DSIF and/or Spt6. These RNAi methods can be
used to reduce HIV infectivity and to regulate genes involved in
cell proliferation and differentiation, e.g., genes that have been
correlated with diseases and disorders characterized by unwanted or
aberrant cellular proliferation or differentiation, such as cancer.
In one embodiment, the unwanted cellular proliferation is cancer,
for instance, carcinomas, sarcomas, metastatic disorders, and
hematopoietic neoplastic disorders.
[0139] In one embodiment, the target region of the mRNA sequence is
located from 100 to 300 nucleotides downstream (3') of the start of
translation of the TEF mRNA. In another embodiment, the target
region of the mRNA sequence is located in a 5' untranslated region
(UTR) or a 3' UTR of the mRNA of a TEF, e.g., CDK9, CycT1, Spt4,
Spt5, or Spt6.
[0140] In another aspect, the invention features methods of
treating a subject having a disorder characterized by unwanted
cellular proliferation, e.g., cancer, e.g., carcinomas, sarcomas,
metastatic disorders and hematopoietic neoplastic disorders (e.g.,
leukemias), or proliferative skin disorders, e.g., psoriasis, by
administering to the subject an amount of a nucleic acid
composition, e.g., a therapeutic composition, of the invention,
effective to inhibit TEF activity. As used herein, inhibiting P-TEF
activity refers to a reduction in the activity of TEF, e.g., by
10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%.
[0141] In another aspect, the invention provides a method of
treating a subject infected with HIV by administering to the
subject an amount of the nucleic acid compositions, e.g., the
therapeutic compositions, of the invention, effective to inhibit
TEF expression or activity.
[0142] In another aspect, the invention features a method of
treating a subject having a disorder characterized by aberrant or
unwanted expression of a gene whose expression is regulated by a
TEF, e.g., CDK9, CycT1, Spt4, Spt5 and/or Spt6, by administering to
the subject an amount of the nucleic acid compositions, e.g., the
therapeutic compositions, of the invention, effective to inhibit
TEF expression or activity.
[0143] In another aspect, the invention features a method of
treating a subject having a disorder characterized by aberrant or
unwanted expression or activity of a TEF, e.g., CDK9, CycT1, Spt4,
Spt5 and/or Spt6 by administering to the subject an amount of the
nucleic acid compositions, e.g., the therapeutic compositions, of
the invention, effective to inhibit TEF expression or activity. In
one embodiment, the disorder is HIV/AIDS. In another embodiment,
the disorder is cancer, e.g., carcinomas, sarcomas, metastatic
disorders and hematopoietic neoplastic disorders, e.g.,
leukemia.
[0144] 1. TEF Nucleic Acid Targets
[0145] In one aspect, the invention features compositions (e.g.,
siRNAs, siRNA derivatives, modified siRNAs, etc.) that are targeted
to a CDK9, CycT1, Spt4, Spt5, or Spt6 RNA.
[0146] The mRNA sequence of CDK9 can be any ortholog of CDK9, such
as sequences substantially identical to the S. cerevisiae, human,
C. elegans, D. melanogaster, or mouse CDK9, including but not
limited to GenBank Accession Nos. NM.sub.--001261 (GI:17017983)
(SEQ ID NO:2) (corresponding protein sequence: NP.sub.--001252)
(human); P50750 (human); NP.sub.--570930 (mouse); BA C40824
(mouse); NP.sub.--477226 (fruit fly); NP.sub.--492906 (C. elegans);
or NP.sub.--492907 (C. elegans). The mRNA sequence of CycT1 can be
any ortholog of CycT1, such as sequences substantially identical to
the S. cerevisiae, human, or mouse CycT1, including but not limited
to GenBank Accession Nos. AF048730 (GI:2981195) (corresponding
protein sequence: AAC39664) (human); NM.sub.--001240 (GI:17978465)
(corresponding protein sequence: NP.sub.--001231) (human); AAN73282
(chimpanzee); NP.sub.--033963 (mouse); AAD17205 (mouse); QDQWV9
(mouse); AAM74155 (goat); or AAM74156 (goat).
[0147] The mRNA sequence of Spt4 can be any ortholog of Spt4, such
as sequences substantially identical to the S. cerevisiae, human,
or mouse Spt4, including but not limited to GenBank Accession Nos.
NM 003168 (GI:4507310) (human Spt4); U38817 (GI:1401054)
(humanSpt4); U38818 (GI:1401052) (human Spt4); U43923
(GI:1297309)(human Spt4); NM 009296 (GI:6678180) (mouse Spt4);
U43154 (GI:1401065) (mouse Spt4) or M83672 (S. cerevisiae Spt4).
The mRNA sequence of Spt5 can be any ortholog of Spt5, such as
sequences substantially identical to the S. cerevisiae, human, or
mouse Spt5, including but not limited to GenBank Accession Nos.
BC02403 (GI: 18848307) (human Spt5), NM 003169 (GI:20149523) (human
Spt5); AB000516 (GI:2723379) (human Spt5); AF 040253 (GI:4104823)
(human Spt5); U56402 (GI:1845266) (human Spt5); NM013676
(GI:22094122) (mouse Spt5); U888539 (mouse Spt5); or M 62882 (S.
cerevisiae Spt5). The mRNA sequence of Spt6 can be any ortholog of
Spt6, such as sequences substantially identical to the S.
cerevisiae or mouse Spt6, including but not limited to NM 009297
(GI:6678182) (mouse Spt6) or M34391 (S. cerevisiae Spt6).
[0148] 2. siRNA Molecules
[0149] The compositions (e.g., siRNAs, siRNA derivatives, modified
siRNAs, etc. ) of the invention include dsRNA molecules comprising
16-30, e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, or 30 nucleotides in each strand, wherein one of the strands is
substantially identical, e.g., at least 80% (or more, e.g., 85%,
90%, 95%, or 100%) identical, e.g., having 3, 2, 1, or 0 mismatched
nucleotide(s), to a target region in the mRNA of CDK9, CycT1, Spt4,
Spt5, or Spt6, and the other strand is identical or substantially
identical to the first strand. The compositions of the invention
can be chemically synthesized, or can be transcribed in vitro from
a DNA template, or in vivo from, e.g., shRNA. The dsRNA molecules
can be designed using any method known in the art, for instance, by
using the following protocol:
[0150] A. Beginning with the AUG start codon, look for AA
dinucleotide sequences; each AA and the 3' adjacent 16 or more
nucleotides are potential siRNA targets (see FIGS. 15, 16, 34, 35,
36). siRNAs taken from the 5' untranslated regions (UTRs) and
regions near the start codon (within about 75 bases or so) may be
less useful as they may be richer in regulatory protein binding
sites, and UTR-binding proteins and/or translation initiation
complexes may interfere with binding of the siRNP or RISC
endonuclease complex. Thus, in one embodiment, the nucleic acid
molecules are selected from a region of the cDNA sequence beginning
50 to 100 nt downstream of the start codon. Further, siRNAs with
lower G/C content (35-55%) may be more active than those with G/C
content higher than 55%. Thus in one embodiment, the invention
includes nucleic acid molecules having 35-55% G/C content. In
addition, the strands of the siRNA can be paired in such a way as
to have a 3' overhang of 1 to 4, e.g., 2, nucleotides. Thus in
another embodiment, the nucleic acid molecules can have a 3'
overhang of 2 nucleotides, such as TT. The overhanging nucleotides
can be either RNA or DNA.
[0151] B. Using any method known in the art, compare the potential
targets to the appropriate genome database (human, mouse, rat,
etc.) and eliminate from consideration any target sequences with
significant homology to other coding sequences. One such method for
such sequence homology searches is known as BLAST, which is
available at the National Center for Biotechnology Information web
site of the National Institutes of Health.
[0152] C. Select one or more sequences that meet your criteria for
evaluation.
[0153] Further general information about the design and use of
siRNA can be found in "The siRNA User Guide," available at the web
site of the laboratory of Dr. Thomas Tuschl at Rockefeller
University.
[0154] Negative control siRNAs should have the same nucleotide
composition as the selected siRNA, but without significant sequence
complementarity to the appropriate genome. Such negative controls
can be designed by randomly scrambling the nucleotide sequence of
the selected siRNA; a homology search can be performed to ensure
that the negative control lacks homology to any other gene in the
appropriate genome. In addition, negative control siRNAs can be
designed by introducing one or more base mismatches into the
sequence.
[0155] The nucleic acid compositions of the invention include both
unmodified TEF siRNAs and modified TEF siRNAs as known in the art,
such as crosslinked siRNA derivatives as described in U.S.
Provisional Patent Application 60/413,529, which is incorporated
herein by reference in its entirety. Crosslinking can be employed
to alter the pharmacokinetics of the composition, for example, to
increase half-life in the body. Thus, the invention includes siRNA
derivatives that include siRNA having two complementary strands of
nucleic acid, such that the two strands are crosslinked. For
example, a 3' OH terminus of one of the strands can be modified, or
the two strands can be crosslinked and modified at the 3' OH
terminus. The siRNA derivative can contain a single crosslink
(e.g., a psoralen crosslink). In some embodiments, the siRNA
derivative has at its 3' terminus a biotin molecule (e.g., a
photocleavable biotin), a peptide (e.g., a Tat peptide), a
nanoparticle, a peptidomimetic, organic compounds (e.g., a dye such
as a fluorescent dye), or dendrimer. Modifying SiRNA derivatives in
this way may improve cellular uptake or enhance cellular targeting
activities of the resulting siRNA derivative as compared to the
corresponding siRNA, are useful for tracing the siRNA derivative in
the cell, or improve the stability of the siRNA derivative compared
to the corresponding siRNA.
[0156] The nucleic acid compositions of the invention can be
unconjugated or can be conjugated to another moiety, such as a
nanoparticle, to enhance a property of the compositions, e.g., a
pharmacokinetic parameter such as absorption, efficacy,
bioavailability, and/or half-life. The conjugation can be
accomplished by methods known in the art, e.g., using the methods
of Lambert et al., Drug Deliv. Rev.:47(1), 99-112 (2001) (describes
nucleic acids loaded to polyalkylcyanoacrylate (PACA)
nanoparticles); Fattal et al., J. Control Release 53(1-3):137-43
(1998) (describes nucleic acids bound to nanoparticles); Schwab et
al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (describes nucleic acids
linked to intercalating agents, hydrophobic groups, polycations or
PACA nanoparticles); and Godard et al., Eur. J. Biochem.
232(2):404-10 (1995) (describes nucleic acids linked to
nanoparticles).
[0157] The nucleic acid molecules of the present invention can also
be labeled using any method known in the art; for instance, the
nucleic acid compositions can be labeled with a fluorophore, e.g.,
Cy3, fluorescein, or rhodamine. The labeling can be carried out
using a kit, e.g., the SILENCER.TM. siRNA labeling kit (Ambion).
Additionally, the siRNA can be radiolabeled, e.g., using .sup.3H,
.sup.32P, or other appropriate isotope. The dsRNA molecules of the
present invention can comprise the following sequences as one of
their strands, and the corresponding sequences of allelic variants
thereof:
2 hCycT1 ds 5'-UCCCUUCCUGAUACUAGAAdTdT-3' HcycT1 mm (neg.
5'-UCCCUUCCGUAUACUAGAAdTdT-3' ctrl) CDK9 ds
5'-CCAAAGCUUCCCCCUAUAAdTdT-3' CDK9 mm (neg. ctrl)
5'-CCAAAGCUCUCCCCUAUAAdTdT-3' Spt5 ds
5'-AACTGGGCGAGTATTACATGAdTdT-3 Spt5 mm (neg. ctrl)
5'-AACTGGGCGGATATTACATGAdTdT-3'
[0158] The above sequences (e.g., sense sequences) correspond to
targeted portions of their target mRNAs, as described herein.
Reverse complementary sequences (e.g., antisense sequences) can be
generated according to to art recognized principles. dsRNA
molecules of the present invention preferably comprise one sense
sequence or strand and one respective antisense sequence or
strand.
[0159] Moreover, because RNAi is believed to progress via at least
one single stranded RNA intermediate, the skilled artisan will
appreciate that ss-siRNAs (e.g., the antisense strand of a
ds-siRNA) can also be designed as described herein and utilized
according to the claimed methodologies.
[0160] 3. Methods of Treatment
[0161] The present invention provides for both prophylactic and
therapeutic methods of treating a subject at risk of (or
susceptible to) a disorder or having a disorder associated with
aberrant or unwanted TEF expression or activity, e.g., CDK9, CycT1,
Spt4, Spt5, or Spt6 activity. As used herein, the term "treatment"
is defined as the application or administration of the siRNA
compositions of the present invention to an individual, e.g., a
patient or subject, or application or administration of a
therapeutic composition including the siRNA compositions to an
isolated tissue or cell line from an individual who has a disease,
a symptom of a disease, or a predisposition toward a disease, with
the purpose to cure, heal, alleviate, relieve, alter, remedy,
ameliorate, improve, or affect the disease, the symptoms of
disease, or the predisposition toward disease. The treatment can
include administering siRNAs to one or more target sites on one or
both of the P-TEFb subunits, e.g., CDK9 or CycT1, to one or more
target sites on one or both of the DSIF subunits, e.g., Spt5 or
Spt4, or to target sites on Spt6, as well as siRNAs to other TEFs.
The mixture of different siRNAs can be administered together or
sequentially, and the mixture can be varied over time.
[0162] With regards to both prophylactic and therapeutic methods of
treatment, such treatments can be specifically tailored or
modified, based on knowledge obtained from the field of genomics,
particularly genomics technologies such as gene sequencing,
statistical genetics, and gene expression analysis, as applied to a
patient's genes. Thus, another aspect of the invention provides
methods for tailoring an individual's prophylactic or therapeutic
treatment with the siRNA compositions of the present invention
according to that individual's genotype; e.g., by determining the
exact sequence of the patient's CDK9, CycT1, Spt4, Spt5, and/or
Spt6, and designing, using the present methods, an siRNA molecule
customized for that patient. This allows a clinician or physician
to tailor prophylactic or therapeutic treatments to patients to
enhance the effectiveness or efficacy of the present methods. Also
with regards to both prophylactic and therapeutic methods of
treatment, such treatments can be specifically tailored or
modified, based on knowledge obtained from the field of
pharmacogenomics.
[0163] In one aspect, the invention provides a method for treating
a subject having a disease, disorder, or condition associated with
an aberrant or unwanted TEF expression or activity, e.g. CDK9,
CycT1, Spt4, Spt5, or Spt6 expression or activity, by administering
to the subject a composition including a CDK9, CycT1, Spt4, Spt5,
and/or Spt6 siRNA. Subjects having a disease which is caused or
contributed to by aberrant or unwanted CDK9, CycT1, Spt4, Spt5, or
Spt6 expression or activity can be identified by, for example, any
or a combination of diagnostic or prognostic assays known in the
art or as described herein. Administration of a composition
including a CDK9, CycT1, Spt4, Spt5, or Spt6 siRNA can occur prior
to the manifestation of symptoms characteristic of the CDK9, CycT1,
Spt4, Spt5, or Spt6 aberrance, such that the disease, disorder, or
condition is treated or inhibited.
[0164] In one aspect, the invention provides a method for
preventing in a subject, a disease or condition associated with an
aberrant or unwanted CDK9, CycT1, Spt4, Spt5, or Spt6 expression or
activity, by administering to the subject a composition including a
CDK9, CycT1, Spt4, Spt5, or Spt6 siRNA. Subjects at risk for a
disorder caused or contributed to by aberrant or unwanted CDK9,
CycT1, Spt4, Spt5, or Spt6 expression or activity can be identified
by, for example, any or a combination of diagnostic or prognostic
assays known in the art or as described herein. Administration of a
prophylactic agent can occur prior to the manifestation of symptoms
characteristic of the CDK9, CycT1, Spt4, Spt5, or Spt6 aberrance,
such that a disease or disorder is prevented or, alternatively,
delayed in its progression.
[0165] Additionally, TEF molecules, e.g. CDK9, CycT1, Spt4, Spt5,
and/or Spt6 may play an important role in the etiology of certain
viral diseases, including, but not limited to, Human
Immunodeficiency Virus (HIV), Hepatitis B, Hepatitis C, and Herpes
Simplex Virus (HSV). P-TEFb siRNA compositions can be used to treat
viral diseases, and in the treatment of viral infected tissue or
virus-associated tissue fibrosis. In particular, as described
herein, TEF, e.g. CDK9, CycT1, Spt4, Spt5, and/or Spt6, siRNA
compositions can be used to treat HIV infections. Also, TEF
modulators can be used in the treatment and/or diagnosis of
virus-associated carcinoma, including hepatocellular cancer.
[0166] 4. Treating HIV Infection
[0167] In one aspect, the present invention is based on the
discovery that specific reduction of TEF activity, e.g., CDK9,
CycT1, Spt4, Spt5 or Spt6 activity, in human cells is non-lethal
and can be used to control, e.g., inhibit, Tat transactivation and
HIV replication in host cells. While not wishing to be bound by
theory, one model for understanding HIV-1 gene regulation is
depicted in FIG. 1A and FIG. 11. Briefly, RNA pol II containing
nonphosphorylated C-terminal domain (CTD) of the largest subunit
(IIA) assembles on the HIV LTR promoter to form a preinitiation
complex. TFIIH binds to nonphosphorylated RNA pol II and plays a
critical role in transcription initiation and promoter clearance.
TFIIH phosphorylates the CTD of the largest subunit of RNA pol II
and assists in promoter clearance. The TFIIH complex dissociates
from TECs 30 to 50 nucleotides after initiation and is not part of
the elongation complexes. P-TEFb, composed of CDK9 and cyclin T1,
is a component of PICs, however, it may not be an active kinase at
this stage. After promoter clearance, DSIF and NELF associate with
the transcription complex during the early elongation stage. Under
standard physiological conditions and in the case of non-HIV-1 LTR
promoters, Spt5 is phosphorylated by CDK9 once DSIF/NELF associate
with the early elongation complex, and this phosphorylation of Spt5
may sufficiently support regular transcription elongation. In the
presence of DRB, the kinase activity of CDK9 is inhibited and Spt5
cannot be phosphorylated by P-TEFb. The unphosphorylated form of
Spt5 acts as a negative regulator and causes inhibition of RNA pol
II elongation. In contrast to cellular promoters, transcription
from the HIV-1 LTR promoter is not efficient and CDK9 is activated
by Tat protein. In the absence of Tat, elongation complexes which
originated at the HIV-1 promoter meet DSIF and NELF, CDK9 is unable
to efficiently phosphorylate Spt5 and, as a result, elongation is
not processive. After the transcription of a functional TAR RNA
structure, Tat binds to TAR and repositions P-TEFb in the vicinity
of the CTD of RNA pol II and Spt5. Hyperphosphorylation of the CTD
is carried out by P-TEFb after the formation of Tat-TAR-P-TEFb
complexes. In addition to CTD phosphorylation, Tat also enhances
the phosphorylation of Spt5 mediated by P-TEFb, and the
phosphorylated form of Spt5 turns DSIF into a positive regulator of
transcription elongation (Ping and Rana, J. Biol. Chem.,
276:12951-12958 (2001)). Specific reduction in P-TEFb or DSIF
activity can be achieved in a number of different ways, including
RNAi, antisense, ribozymes, or small molecules targeted to one or
both subunits of P-TEFb (e.g., CDK9 or CycT1) or DSIF (e.g., Spt4
or Spt5). Specific reduction in Spt6 activity can be achieved in a
number of different ways, including RNAi, antisense, ribozymes, or
small molecules targeted to Spt6.
[0168] 5. Treating Cancer
[0169] In another aspect, the present invention is based in part on
the discovery that specific reduction of transcription elongation
factor activity in human cells is non-lethal and can be used to
regulate the expression of genes correlated with diseases or
disorders characterized by unwanted or aberrant cellular
proliferation or differentiation, to decrease the growth of
cancerous cells, and reduce the metastatic activity of cancerous
cells. Examples of proliferative and/or differentiative disorders
include cancer, e.g., carcinomas, sarcomas, metastatic disorders or
hematopoietic neoplastic disorders, e.g., leukemias, as well as
proliferative skin disorders, e.g., psoriasis or hyperkeratosis.
Other myeloproliferative disorders include polycythemia vera,
myelofibrosis, chronic myelogenous (myelocytic) leukemia, and
primary thrombocythaemia, as well as acute leukemia, especially
erythroleukemia, and paroxysmal nocturnal haemoglobinuria.
Metastatic tumors can arise from a multitude of primary tumor
types, including but not limited to those of prostate, colon, lung,
breast and liver origin. Specific reduction in transcription
elongation factors such as P-TEFb (CDK9/CycT1), DSIF (Spt4/Spt5) or
Spt6, can be achieved in a number of different ways, including the
introduction into a cell of RNAi, antisense, ribozyme, dominant
negative mutation or sequences containing such mutation, or small
molecules targeted to the factor, e.g., one or both subunits of
P-TEFb (CDK9/CycT1), one or both subunits of DSIF (e.g., Spt5 or
Spt4) or Spt6.
[0170] VII. Methods of Introducing RNAs, Vectors, and Host
Cells
[0171] Physical methods of introducing nucleic acids include
injection of a solution containing the RNA, bombardment by
particles covered by the RNA, soaking the cell or organism in a
solution of the RNA, or electroporation of cell membranes in the
presence of the RNA. A viral construct packaged into a viral
particle would accomplish both efficient introduction of an
expression construct into the cell and transcription of RNA encoded
by the expression construct. Other methods known in the art for
introducing nucleic acids to cells may be used, such as
lipid-mediated carrier transport, chemical-mediated transport, such
as calcium phosphate, and the like. Thus the RNA may be introduced
along with components that perform one or more of the following
activities: enhance RNA uptake by the cell, inhibit annealing of
single strands, stabilize the single strands, or other-wise
increase inhibition of the target gene.
[0172] RNA may be directly introduced into the cell (i.e.,
intracellularly); or introduced extracellularly into a cavity,
interstitial space, into the circulation of an organism, introduced
orally, or may be introduced by bathing a cell or organism in a
solution containing the RNA. Vascular or extravascular circulation,
the blood or lymph system, and the cerebrospinal fluid are sites
where the RNA may be introduced.
[0173] The cell with the target gene may be derived from or
contained in any organism. The organism may a plant, animal,
protozoan, bacterium, virus, or fungus. The plant may be a monocot,
dicot or gymnosperm; the animal may be a vertebrate or
invertebrate. Preferred microbes are those used in agriculture or
by industry, and those that are pathogenic for plants or animals.
Fungi include organisms in both the mold and yeast morphologies.
Plants include arabidopsis; field crops (e.g., alfalfa, barley,
bean, com, cotton, flax, pea, rape, nice, rye, safflower, sorghum,
soybean, sunflower, tobacco, and wheat); vegetable crops (e.g.,
asparagus, beet, broccoli, cabbage, carrot, cauliflower, celery,
cucumber, eggplant, lettuce, onion, pepper, potato, pumpkin,
radish, spinach, squash, taro, tomato, and zucchini); fruit and nut
crops (e.g., almond, apple, apricot, banana, black-berry,
blueberry, cacao, cherry, coconut, cranberry, date, faJoa, filbert,
grape, grapefr-uit, guava, kiwi, lemon, lime, mango, melon,
nectarine, orange, papaya, passion fruit, peach, peanut, pear,
pineapple, pistachio, plum, raspberry, strawberry, tangerine,
walnut, and watermelon); and ornamentals (e.g., alder, ash, aspen,
azalea, birch, boxwood, camellia, carnation, chrysanthemum, elm,
fir, ivy, jasmine, juniper, oak, palm, poplar, pine, redwood,
rhododendron, rose, and rubber). Examples of vertebrate animals
include fish, mammal, cattle, goat, pig, sheep, rodent, hamster,
mouse, rat, primate, and human; invertebrate animals include
nematodes, other worms, drosophila, and other insects.
[0174] The cell having the target gene may be from the germ line or
somatic, totipotent or pluripotent, dividing or non-dividing,
parenchyma or epithelium, immortalized or transformed, or the like.
The cell may be a stem cell or a differentiated cell. Cell types
that are differentiated include adipocytes, fibroblasts, myocytes,
cardiomyocytes, endothelium, neurons, glia, blood cells,
megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils,
basophils, mast cells, leukocytes, granulocytes, keratinocytes,
chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of
the endocrine or exocrine glands.
[0175] Depending on the particular target gene and the dose of
double stranded RNA material delivered, this process may provide
partial or complete loss of function for the target gene. A
reduction or loss of gene expression in at least 50%, 60%, 70%,
80%, 90%, 95% or 99% or more of targeted cells is exemplary.
Inhibition of gene expression refers to the absence (or observable
decrease) in the level of protein and/or mRNA product from a target
gene. Specificity refers to the ability to inhibit the target gene
without manifest effects on other genes of the cell. The
consequences of inhibition can be confirmed by examination of the
outward properties of the cell or organism (as presented below in
the examples) or by biochemical techniques such as RNA solution
hybridization, nuclease protection, Northern hybridization, reverse
transcription, gene expression monitoring with a microarray,
antibody binding, enzyme linked immunosorbent assay (ELISA),
Western blotting, radioimmunoassay (RIA), other immunoassays, and
fluorescence activated cell analysis (FACS).
[0176] For RNA-mediated inhibition in a cell line or whole
organism, gene expression is conveniently assayed by use of a
reporter or drug resistance gene whose protein product is easily
assayed. Such reporter genes include acetohydroxyacid synthase
(AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta
glucoronidase (GUS), chloramphenicol acetyltransferase (CAT), green
fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase
(Luc), nopaline synthase (NOS), octopine synthase (OCS), and
derivatives thereof. Multiple selectable markers are available that
confer resistance to ampicillin, bleomycin, chloramphenicol,
gentarnycin, hygromycin, kanamycin, lincomycin, methotrexate,
phosphinothricin, puromycin, and tetracyclin. Depending on the
assay, quantitation of the amount of gene expression allows one to
determine a degree of inhibition which is greater than 10%, 33%,
50%, 90%, 95% or 99% as compared to a cell not treated according to
the present invention. Lower doses of injected material and longer
times after administration of siRNA may result in inhibition in a
smaller fraction of cells (e.g., at least 10%, 20%, 50%, 75%, 90%,
or 95% of targeted cells). Quantitation of gene expression in a
cell may show similar amounts of inhibition at the level of
accumulation of target mRNA or translation of target protein. As an
example, the efficiency of inhibition may be determined by
assessing the amount of gene product in the cell; mRNA may be
detected with a hybridization probe having a nucleotide sequence
outside the region used for the inhibitory double-stranded RNA, or
translated polypeptide may be detected with an antibody raised
against the polypeptide sequence of that region.
[0177] The RNA may be introduced in an amount which allows delivery
of at least one copy per cell. Higher doses (e.g., at least 5, 10,
100, 500 or 1000 copies per cell) of material may yield more
effective inhibition; lower doses may also be useful for specific
applications.
[0178] VIII. Methods of Treatment:
[0179] The present invention provides for both prophylactic and
therapeutic methods of treating a subject at risk of (or
susceptible to) a disorder or having a disorder associated with
aberrant or unwanted target gene expression or activity.
"Treatment", or "treating" as used herein, is defined as the
application or administration of a therapeutic agent (e.g., a siRNA
or vector or transgene encoding same) to a patient, or application
or administration of a therapeutic agent to an isolated tissue or
cell line from a patient, who has a disease or disorder, a symptom
of disease or disorder or a predisposition toward a disease or
disorder, with the purpose to cure, heal, alleviate, relieve,
alter, remedy, ameliorate, improve or affect the disease or
disorder, the symptoms of the disease or disorder, or the
predisposition toward disease.
[0180] With regards to both prophylactic and therapeutic methods of
treatment, such treatments may be specifically tailored or
modified, based on knowledge obtained from the field of
pharmacogenomics. "Pharmacogenomics", as used herein, refers to the
application of genomics technologies such as gene sequencing,
statistical genetics, and gene expression analysis to drugs in
clinical development and on the market. More specifically, the term
refers the study of how a patient's genes determine his or her
response to a drug (e.g., a patient's "drug response phenotype", or
"drug response genotype"). Thus, another aspect of the invention
provides methods for tailoring an individual's prophylactic or
therapeutic treatment with either the target gene molecules of the
present invention or target gene modulators according to that
individual's drug response genotype. Pharmacogenomics allows a
clinician or physician to target prophylactic or therapeutic
treatments to patients who will most benefit from the treatment and
to avoid treatment of patients who will experience toxic
drug-related side effects.
[0181] 1. Prophylactic Methods
[0182] In one aspect, the invention provides a method for
preventing in a subject, a disease or condition associated with an
aberrant or unwanted target gene expression or activity, by
administering to the subject a therapeutic agent (e.g., a siRNA or
vector or transgene encoding same). Subjects at risk for a disease
which is caused or contributed to by aberrant or unwanted target
gene expression or activity can be identified by, for example, any
or a combination of diagnostic or prognostic assays as described
herein. Administration of a prophylactic agent can occur prior to
the manifestation of symptoms characteristic of the target gene
aberrancy, such that a disease or disorder is prevented or,
alternatively, delayed in its progression. Depending on the type of
target gene aberrancy, for example, a target gene, target gene
agonist or target gene antagonist agent can be used for treating
the subject. The appropriate agent can be determined based on
screening assays described herein.
[0183] 2. Theratpeutic Methods
[0184] Another aspect of the invention pertains to methods of
modulating target gene expression, protein expression or activity
for therapeutic purposes. Accordingly, in an exemplary embodiment,
the modulatory method of the invention involves contacting a cell
capable of expressing target gene with a therapeutic agent (e.g., a
siRNA or vector or transgene encoding same) that is specific for
the target gene or protein (e.g., is specific for the mRNA encoded
by said gene or specifying the amino acid sequence of said protein)
such that expression or one or more of the activities of target
protein is modulated. These modulatory methods can be performed in
vitro (e.g., by culturing the cell with the agent) or,
alternatively, in vivo (e.g., by administering the agent to a
subject). As such, the present invention provides methods of
treating an individual afflicted with a disease or disorder
characterized by aberrant or unwanted expression or activity of a
target gene polypeptide or nucleic acid molecule. Inhibition of
target gene activity is desirable in situations in which target
gene is abnormally unregulated and/or in which decreased target
gene activity is likely to have a beneficial effect.
[0185] 3. Pharmacogenomics
[0186] The therapeutic agents (e.g., a siRNA or vector or transgene
encoding same) of the invention can be administered to individuals
to treat (prophylactically or therapeutically) disorders associated
with aberrant or unwanted target gene activity. In conjunction with
such treatment, pharmacogenomics (i.e., the study of the
relationship between an individual's genotype and that individual's
response to a foreign compound or drug) may be considered.
Differences in metabolism of therapeutics can lead to severe
toxicity or therapeutic failure by altering the relation between
dose and blood concentration of the pharmacologically active drug.
Thus, a physician or clinician may consider applying knowledge
obtained in relevant pharmacogenomics studies in determining
whether to administer a therapeutic agent as well as tailoring the
dosage and/or therapeutic regimen of treatment with a therapeutic
agent.
[0187] Pharmacogenomics deals with clinically significant
hereditary variations in the response to drugs due to altered drug
disposition and abnormal action in affected persons. See, for
example, Eichelbaum, M. et al. (1996) Clin. Exp. Pharmacol.
Physiol. 23(10-11): 983-985 and Linder, M. W. et al. (1997) Clin.
Chem. 43(2):254-266. In general, two types of pharmacogenetic
conditions can be differentiated. Genetic conditions transmitted as
a single factor altering the way drugs act on the body (altered
drug action) or genetic conditions transmitted as single factors
altering the way the body acts on drugs (altered drug metabolism).
These pharmacogenetic conditions can occur either as rare genetic
defects or as naturally-occurring polymorphisms. For example,
glucose-6-phosphate dehydrogenase deficiency (G6PD) is a common
inherited enzymopathy in which the main clinical complication is
haemolysis after ingestion of oxidant drugs (anti-malarials,
sulfonamides, analgesics, nitrofurans) and consumption of fava
beans.
[0188] One pharmacogenomics approach to identifying genes that
predict drug response, known as "a genome-wide association", relies
primarily on a high-resolution map of the human genome consisting
of already known gene-related markers (e.g., a "bi-allelic" gene
marker map which consists of 60,000-100,000 polymorphic or variable
sites on the human genome, each of which has two variants.) Such a
high-resolution genetic map can be compared to a map of the genome
of each of a statistically significant number of patients taking
part in a Phase II/III drug trial to identify markers associated
with a particular observed drug response or side effect.
Alternatively, such a high resolution map can be generated from a
combination of some ten-million known single nucleotide
polymorphisms (SNPs) in the human genome. As used herein, a "SNP"
is a common alteration that occurs in a single nucleotide base in a
stretch of DNA. For example, a SNP may occur once per every 1000
bases of DNA. A SNP may be involved in a disease process, however,
the vast majority may not be disease-associated. Given a genetic
map based on the occurrence of such SNPs, individuals can be
grouped into genetic categories depending on a particular pattern
of SNPs in their individual genome. In such a manner, treatment
regimens can be tailored to groups of genetically similar
individuals, taking into account traits that may be common among
such genetically similar individuals.
[0189] Alternatively, a method termed the "candidate gene
approach", can be utilized to identify genes that predict drug
response. According to this method, if a gene that encodes a drugs
target is known (e.g., a target gene polypeptide of the present
invention), all common variants of that gene can be fairly easily
identified in the population and it can be determined if having one
version of the gene versus another is associated with a particular
drug response.
[0190] As an illustrative embodiment, the activity of drug
metabolizing enzymes is a major determinant of both the intensity
and duration of drug action. The discovery of genetic polymorphisms
of drug metabolizing enzymes (e.g., N-acetyltransferase 2 (NAT 2)
and cytochrome P450 enzymes CYP2D6 and CYP2C19) has provided an
explanation as to why some patients do not obtain the expected drug
effects or show exaggerated drug response and serious toxicity
after taking the standard and safe dose of a drug. These
polymorphisms are expressed in two phenotypes in the population,
the extensive metabolizer (EM) and poor metabolizer (PM). The
prevalence of PM is different among different populations. For
example, the gene coding for CYP2D6 is highly polymorphic and
several mutations have been identified in PM, which all lead to the
absence of functional CYP2D6. Poor metabolizers of CYP2D6 and
CYP2C19 quite frequently experience exaggerated drug response and
side effects when they receive standard doses. If a metabolite is
the active therapeutic moiety, PM show no therapeutic response, as
demonstrated for the analgesic effect of codeine mediated by its
CYP2D6-formed metabolite morphine. The other extreme are the so
called ultra-rapid metabolizers who do not respond to standard
doses. Recently, the molecular basis of ultra-rapid metabolism has
been identified to be due to CYP2D6 gene amplification.
[0191] Alternatively, a method termed the "gene expression
profiling", can be utilized to identify genes that predict drug
response. For example, the gene expression of an animal dosed with
a therapeutic agent of the present invention can give an indication
whether gene pathways related to toxicity have been turned on.
[0192] Information generated from more than one of the above
pharmacogenomics approaches can be used to determine appropriate
dosage and treatment regimens for prophylactic or therapeutic
treatment an individual. This knowledge, when applied to dosing or
drug selection, can avoid adverse reactions or therapeutic failure
and thus enhance therapeutic or prophylactic efficiency when
treating a subject with a therapeutic agent, as described
herein.
[0193] Therapeutic agents can be tested in an appropriate animal
model. For example, an siRNA (or expression vector or transgene
encoding same) as described herein can be used in an animal model
to determine the efficacy, toxicity, or side effects of treatment
with said agent. Alternatively, a therapeutic agent can be used in
an animal model to determine the mechanism of action of such an
agent. For example, an agent can be used in an animal model to
determine the efficacy, toxicity, or side effects of treatment with
such an agent. Alternatively, an agent can be used in an animal
model to determine the mechanism of action of such an agent.
[0194] 4. Disease Indications
[0195] The compositions of the invention can act as novel
therapeutic agents for controlling one or more of cellular
proliferative and/or differentiative disorders, disorders
associated with bone metabolism, immune disorders, hematopoietic
disorders, cardiovascular disorders, liver disorders, viral
diseases, pain or metabolic disorders.
[0196] Examples of cellular proliferative and/or differentiative
disorders include cancer, e.g., carcinoma, sarcoma, metastatic
disorders or hematopoietic neoplastic disorders, e.g., leukemias. A
metastatic tumor can arise from a multitude of primary tumor types,
including but not limited to those of prostate, colon, lung, breast
and liver origin.
[0197] As used herein, the terms "cancer," "hyperproliferative,"
and "neoplastic" refer to cells having the capacity for autonomous
growth, i.e., an abnormal state or condition characterized by
rapidly proliferating cell growth. Hyperproliferative and
neoplastic disease states may be categorized as pathologic, i.e.,
characterizing or constituting a disease state, or may be
categorized as non-pathologic, i.e., a deviation from normal but
not associated with a disease state. The term is meant to include
all types of cancerous growths or oncogenic processes, metastatic
tissues or malignantly transformed cells, tissues, or organs,
irrespective of histopathologic type or stage of invasiveness.
"Pathologic hyperproliferative" cells occur in disease states
characterized by malignant tumor growth. Examples of non-pathologic
hyperproliferative cells include proliferation of cells associated
with wound repair.
[0198] The terms "cancer" or "neoplasms" include malignancies of
the various organ systems, such as affecting lung, breast, thyroid,
lymphoid, gastrointestinal, and genito-urinary tract, as well as
adenocarcinomas which include malignancies such as most colon
cancers, renal-cell carcinoma, prostate cancer and/or testicular
tumors, non-small cell carcinoma of the lung, cancer of the small
intestine and cancer of the esophagus.
[0199] The term "carcinoma" is art recognized and refers to
malignancies of epithelial or endocrine tissues including
respiratory system carcinomas, gastrointestinal system carcinomas,
genitourinary system carcinomas, testicular carcinomas, breast
carcinomas, prostatic carcinomas, endocrine system carcinomas, and
melanomas. Exemplary carcinomas include those forming from tissue
of the cervix, lung, prostate, breast, head and neck, colon and
ovary. The term also includes carcinosarcomas, e.g., which include
malignant tumors composed of carcinomatous and sarcomatous tissues.
An "adenocarcinoma" refers to a carcinoma derived from glandular
tissue or in which the tumor cells form recognizable glandular
structures.
[0200] The term "sarcoma" is art recognized and refers to malignant
tumors of mesenchymal derivation.
[0201] Additional examples of proliferative disorders include
hematopoietic neoplastic disorders. As used herein, the term
"hematopoietic neoplastic disorders" includes diseases involving
hyperplastic/neoplastic cells of hematopoietic origin, e.g.,
arising from myeloid, lymphoid or erythroid lineages, or precursor
cells thereof. Preferably, the diseases arise from poorly
differentiated acute leukemias, e.g., erythroblastic leukemia and
acute megakaryoblastic leukemia. Additional exemplary myeloid
disorders include, but are not limited to, acute promyeloid
leukemia (APML), acute myelogenous leukemia (AML) and chronic
myelogenous leukemia (CML) (reviewed in Vaickus, L. (1991) Crit
Rev. in Oncol./Hemotol. 11:267-97); lymphoid malignancies include,
but are not limited to acute lymphoblastic leukemia (ALL) which
includes B-lineage ALL and T-lineage ALL, chronic lymphocytic
leukemia (CLL), prolymphocytic leukemia (PLL), hairy cell leukemia
(HLL) and Waldenstrom's macroglobulinemia (WM). Additional forms of
malignant lymphomas include, but are not limited to non-Hodgkin
lymphoma and variants thereof, peripheral T cell lymphomas, adult T
cell leukemia/lymphoma (ATL), cutaneous T-cell lymphoma (CTCL),
large granular lymphocytic leukemia (LGF), Hodgkin's disease and
Reed-Stemberg disease.
[0202] In general, the compositions of the invention are designed
to target genes associated with particular disorders. Examples of
such genes associated with proliferative disorders that can be
targeted include activated ras, p53, BRCA-1, and BRCA-2. Other
specific genes that can be targeted are those associated with
amyotrophic lateral sclerosis (ALS; e.g., superoxide dismutase-1
(SOD1)); Huntington's disease (e.g., huntingtin), Parkinson's
disease (parkin), and genes associated with autosomal dominant
disorders.
[0203] The compositions of the invention can be used to treat a
variety of immune disorders, in particular those associated with
overexpression of a gene or expression of a mutant gene. Examples
of hematopoietic disorders or diseases include, but are not limited
to, autoimmune diseases (including, for example, diabetes mellitus,
arthritis (including rheumatoid arthritis, juvenile rheumatoid
arthritis, osteoarthritis, psoriatic arthritis), multiple
sclerosis, encephalomyelitis, myasthenia gravis, systemic lupus
erythematosis, autoimmune thyroiditis, dermatitis (including atopic
dermatitis and eczematous dermatitis), psoriasis, Sjogren's
Syndrome, Crohn's disease, aphthous ulcer, iritis, conjunctivitis,
keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma,
cutaneous lupus erythematosus, scleroderma, vaginitis, proctitis,
drug eruptions, leprosy reversal reactions, erythema nodosum
leprosum, autoimmune uveitis, allergic encephalomyelitis, acute
necrotizing hemorrhagic encephalopathy, idiopathic bilateral
progressive sensorineural hearing loss, aplastic anemia, pure red
cell anemia, idiopathic thrombocytopenia, polychondritis, Wegener's
granulomatosis, chronic active hepatitis, Stevens-Johnson syndrome,
idiopathic sprue, lichen planus, Graves' disease, sarcoidosis,
primary biliary cirrhosis, uveitis posterior, and interstitial lung
fibrosis), graft-versus-host disease, cases of transplantation, and
allergy such as, atopic allergy.
[0204] Examples of disorders involving the heart or "cardiovascular
disorder" include, but are not limited to, a disease, disorder, or
state involving the cardiovascular system, e.g., the heart, the
blood vessels, and/or the blood. A cardiovascular disorder can be
caused by an imbalance in arterial pressure, a malfunction of the
heart, or an occlusion of a blood vessel, e.g., by a thrombus.
Examples of such disorders include hypertension, atherosclerosis,
coronary artery spasm, congestive heart failure, coronary artery
disease, valvular disease, arrhythmias, and cardiomyopathies.
[0205] Disorders which may be treated by methods described herein
include, but are not limited to, disorders associated with an
accumulation in the liver of fibrous tissue, such as that resulting
from an imbalance between production and degradation of the
extracellular matrix accompanied by the collapse and condensation
of preexisting fibers.
[0206] Additionally, molecules of the invention can be used to
treat viral diseases, including but not limited to hepatitis B,
hepatitis C, herpes simplex virus (HSV), HIV-AIDS, poliovirus, and
smallpox virus. Molecules of the invention are engineered as
described herein to target expressed sequences of a virus, thus
ameliorating viral activity and replication. The molecules can be
used in the treatment and/or diagnosis of viral infected tissue.
Also, such molecules can be used in the treatment of
virus-associated carcinoma, such as hepatocellular cancer.
[0207] IX. Pharmaceutical Compositions
[0208] The invention pertains to uses of the above-described agents
for therapeutic treatments as described infra. Accordingly, the
modulators of the present invention can be incorporated into
pharmaceutical compositions suitable for administration. Such
compositions typically comprise the nucleic acid molecule, protein,
antibody, or modulatory compound and a pharmaceutically acceptable
carrier. As used herein the language "pharmaceutically acceptable
carrier" is intended to include any and all solvents, dispersion
media, coatings, antibacterial and antifungal agents, isotonic and
absorption delaying agents, and the like, compatible with
pharmaceutical administration. The use of such media and agents for
pharmaceutically active substances is well known in the art. Except
insofar as any conventional media or agent is incompatible with the
active compound, use thereof in the compositions is contemplated.
Supplementary active compounds can also be incorporated into the
compositions.
[0209] A pharmaceutical composition of the invention is formulated
to be compatible with its intended route of administration.
Examples of routes of administration include parenteral, e.g.,
intravenous, intradermal, subcutaneous, intraperitoneal,
intramuscular, oral (e.g., inhalation), transdermal (topical), and
transmucosal administration. Solutions or suspensions used for
parenteral, intradermal, or subcutaneous application can include
the following components: a sterile diluent such as water for
injection, saline solution, fixed oils, polyethylene glycols,
glycerine, propylene glycol or other synthetic solvents;
antibacterial agents such as benzyl alcohol or methyl parabens;
antioxidants such as ascorbic acid or sodium bisulfite; chelating
agents such as ethylenediaminetetraacetic acid; buffers such as
acetates, citrates or phosphates and agents for the adjustment of
tonicity such as sodium chloride or dextrose. pH can be adjusted
with acids or bases, such as hydrochloric acid or sodium hydroxide.
The parenteral preparation can be enclosed in ampoules, disposable
syringes or multiple dose vials made of glass or plastic.
[0210] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or
phosphate buffered saline (PBS). In all cases, the composition must
be sterile and should be fluid to the extent that easy
syringability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyetheylene glycol, and the like), and
suitable mixtures thereof. The proper fluidity can be maintained,
for example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. Prevention of the action of
microorganisms can be achieved by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
ascorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as manitol, sorbitol, sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, aluminum monostearate and
gelatin.
[0211] Sterile injectable solutions can be prepared by
incorporating the active compound in the required amount in an
appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filtered sterilization.
Generally, dispersions are prepared by incorporating the active
compound into a sterile vehicle which contains a basic dispersion
medium and the required other ingredients from those enumerated
above. In the case of sterile powders for the preparation of
sterile injectable solutions, the preferred methods of preparation
are vacuum drying and freeze-drying which yields a powder of the
active ingredient plus any additional desired ingredient from a
previously sterile-filtered solution thereof.
[0212] Oral compositions generally include an inert diluent or an
edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets. For the purpose of oral therapeutic
administration, the active compound can be incorporated with
excipients and used in the form of tablets, troches, or capsules.
Oral compositions can also be prepared using a fluid carrier for
use as a mouthwash, wherein the compound in the fluid carrier is
applied orally and swished and expectorated or swallowed.
Pharmaceutically compatible binding agents, and/or adjuvant
materials can be included as part of the composition. The tablets,
pills, capsules, troches and the like can contain any of the
following ingredients, or compounds of a similar nature: a binder
such as microcrystalline cellulose, gum tragacanth or gelatin; an
excipient such as starch or lactose, a disintegrating agent such as
alginic acid, Primogel, or corn starch; a lubricant such as
magnesium stearate or Sterotes; a glidant such as colloidal silicon
dioxide; a sweetening agent such as sucrose or saccharin; or a
flavoring agent such as peppermint, methyl salicylate, or orange
flavoring.
[0213] For administration by inhalation, the compounds are
delivered in the form of an aerosol spray from pressured container
or dispenser which contains a suitable propellant, e.g., a gas such
as carbon dioxide, or a nebulizer.
[0214] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art.
[0215] The compounds can also be prepared in the form of
suppositories (e.g., with conventional suppository bases such as
cocoa butter and other glycerides) or retention enemas for rectal
delivery.
[0216] In one embodiment, the active compounds are prepared with
carriers that will protect the compound against rapid elimination
from the body, such as a controlled release formulation, including
implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. The materials can also be
obtained commercially from Alza Corporation and Nova
Pharmaceuticals, Inc. Liposomal suspensions (including liposomes
targeted to infected cells with monoclonal antibodies to viral
antigens) can also be used as pharmaceutically acceptable carriers.
These can be prepared according to methods known to those skilled
in the art, for example, as described in U.S. Pat. No.
4,522,811.
[0217] It is especially advantageous to formulate oral or
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the subject to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the dosage unit forms
of the invention are dictated by and directly dependent on the
unique characteristics of the active compound and the particular
therapeutic effect to be achieved, and the limitations inherent in
the art of compounding such an active compound for the treatment of
individuals.
[0218] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD50 (the dose
lethal to 50% of the population) and the ED50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD50/ED50. Compounds that exhibit
large therapeutic indices are preferred. Although compounds that
exhibit toxic side effects may be used, care should be taken to
design a delivery system that targets such compounds to the site of
affected tissue in order to minimize potential damage to uninfected
cells and, thereby, reduce side effects.
[0219] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of such compounds lies preferably within a range
of circulating concentrations that include the ED50 with little or
no toxicity. The dosage may vary within this range depending upon
the dosage form employed and the route of administration utilized.
For any compound used in the method of the invention, the
therapeutically effective dose can be estimated initially from cell
culture assays. A dose may be formulated in animal models to
achieve a circulating plasma concentration range that includes the
EC50 (i.e., the concentration of the test compound which achieves a
half-maximal response) as determined in cell culture. Such
information can be used to more accurately determine useful doses
in humans. Levels in plasma may be measured, for example, by high
performance liquid chromatography.
[0220] A therapeutically effective amount of a composition
containing a compound of the invention (e.g., a siRNA, candidate
siRNA derivative, modified siRNA, etc.) (i.e., an effective dosage)
is an amount that inhibits expression of the polypeptide encoded by
the target gene by at least 30 percent. Higher percentages of
inhibition, e.g., 45, 50, 75, 85, 90 percent or higher may be
preferred in certain embodiments. Exemplary doses include milligram
or microgram amounts of the molecule per kilogram of subject or
sample weight (e.g., about 1 microgram per kilogram to about 500
milligrams per kilogram, about 100 micrograms per kilogram to about
5 milligrams per kilogram, or about 1 microgram per kilogram to
about 50 micrograms per kilogram. The compositions can be
administered one time per week for between about 1 to 10 weeks,
e.g., between 2 to 8 weeks, or between about 3 to 7 weeks, or for
about 4, 5, or 6 weeks. The skilled artisan will appreciate that
certain factors may influence the dosage and timing required to
effectively treat a subject, including but not limited to the
severity of the disease or disorder, previous treatments, the
general health and/or age of the subject, and other diseases
present. Moreover, treatment of a subject with a therapeutically
effective amount of a composition can include a single treatment or
a series of treatments.
[0221] It is furthermore understood that appropriate doses of a
composition depend upon the potency of composition with respect to
the expression or activity to be modulated. When one or more of
these molecules is to be administered to an animal (e.g., a human)
to modulate expression or activity of a polypeptide or nucleic acid
of the invention, a physician, veterinarian, or researcher may, for
example, prescribe a relatively low dose at first, subsequently
increasing the dose until an appropriate response is obtained. In
addition, it is understood that the specific dose level for any
particular subject will depend upon a variety of factors including
the activity of the specific compound employed, the age, body
weight, general health, gender, and diet of the subject, the time
of administration, the route of administration, the rate of
excretion, any drug combination, and the degree of expression or
activity to be modulated.
[0222] The pharmaceutical compositions can be included in a
container, pack, or dispenser together with instructions for
administration.
[0223] X. Knockout and/or Knockdown Cells or Organisms
[0224] A further preferred use for the siRNA molecules of the
present invention (or vectors or transgenes encoding same) is a
functional analysis to be carried out in eukaryotic cells, or
eukaryotic non-human organisms, preferably mammalian cells or
organisms and most preferably human cells, e.g cell lines such as
HeLa or 293 or rodents, e.g. rats and mice. By administering a
suitable siRNA molecules which is sufficiently complementary to a
target mRNA sequence to direct target-specific RNA interference, a
specific knockout or knockdown phenotype can be obtained in a
target cell, e.g. in cell culture or in a target organism.
[0225] Thus, a further subject matter of the invention is a
eukaryotic cell or a eukaryotic non-human organism exhibiting a
target gene-specific knockout or knockdown phenotype comprising a
fully or at least partially deficient expression of at least one
endogeneous target gene wherein said cell or organism is
transfected with at least one vector comprising DNA encoding a
siRNA molecule capable of inhibiting the expression of the target
gene. It should be noted that the present invention allows a
target-specific knockout or knockdown of several different
endogeneous genes due to the specificity of the siRNAi.
[0226] Gene-specific knockout or knockdown phenotypes of cells or
non-human organisms, particularly of human cells or non-human
mammals may be used in analytic to procedures, e.g. in the
functional and/or phenotypical analysis of complex physiological
processes such as analysis of gene expression profiles and/or
proteomes. Preferably the analysis is carried out by high
throughput methods using oligonucleotide based chips.
[0227] Using RNAi based knockout or knockdown technologies, the
expression of an endogeneous target gene may be inhibited in a
target cell or a target organism. The endogeneous gene may be
complemented by an exogenous target nucleic acid coding for the
target protein or a variant or mutated form of the target protein,
e.g. a gene or a DNA, which may optionally be fused to a further
nucleic acid sequence encoding a detectable peptide or polypeptide,
e.g an affinity tag, particularly a multiple affinity tag.
[0228] Variants or mutated forms of the target gene differ from the
endogeneous target gene in that they encode a gene product which
differs from the endogeneous gene product on the amino acid level
by substitutions, insertions and/or deletions of single or multiple
amino acids. The variants or mutated forms may have the same
biological activity as the endogeneous target gene. On the other
hand, the variant or mutated target gene may also have a biological
activity, which differs from the biological activity of the
endogeneous target gene, e.g. a partially deleted activity, a
completely deleted activity, an enhanced activity etc. The
complementation may be accomplished by compressing the polypeptide
encoded by the endogeneous nucleic acid, e.g. a fusion protein
comprising the target protein and the affinity tag and the double
stranded RNA molecule for knocking out the endogeneous gene in the
target cell. This compression may be accomplished by using a
suitable expression vector expressing both the polypeptide encoded
by the endogenous nucleic acid, e.g. the tag-modified target
protein and the double stranded RNA molecule or alternatively by
using a combination of expression vectors. Proteins and protein
complexes which are synthesized de novo in the target cell will
contain the exogenous gene product, e.g., the modified fusion
protein. In order to avoid suppression of the exogenous gene
product by the siRNAi molecule, the nucleotide sequence encoding
the exogenous nucleic acid may be altered at the DNA level (with or
without causing mutations on the amino acid level) in the part of
the sequence which so is homologous to the siRNA molecule.
Alternatively, the endogeneous target gene may be complemented by
corresponding nucleotide sequences from other species, e.g. from
mouse.
[0229] XI. Functional Genomics and/or Proteomics
[0230] Preferred applications for the cell or organism of the
invention is the analysis of gene expression profiles and/or
proteomes. In an especially preferred embodiment an analysis of a
variant or mutant form of one or several target proteins is carried
out, wherein said variant or mutant forms are reintroduced into the
cell or organism by an exogenous target nucleic acid as described
above. The combination of knockout of an endogeneous gene and
rescue by using mutated, e.g. partially deleted exogenous target
has advantages compared to the use of a knockout cell. Further,
this method is particularly suitable for identifying functional
domains of the targeted protein. In a further preferred embodiment
a comparison, e.g. of gene expression profiles and/or proteomes
and/or phenotypic characteristics of at least two cells or
organisms is carried out. These organisms are selected from: (i) a
control cell or control organism without target gene inhibition,
(ii) a cell or organism with target gene inhibition and (iii) a
cell or organism with target gene inhibition plus target gene
complementation by an exogenous target nucleic acid.
[0231] Furthermore, the RNA knockout complementation method may be
used for is preparative purposes, e.g. for the affinity
purification of proteins or protein complexes from eukaryotic
cells, particularly mammalian cells and more particularly human
cells. In this embodiment of the invention, the exogenous target
nucleic acid preferably codes for a target protein which is fused
to art affinity tag. This method is suitable for functional
proteome analysis in mammalian cells, particularly human cells.
[0232] Another utility of the present invention could be a method
of identifying gene function in an organism comprising the use of
siRNA to inhibit the activity of a target gene of previously
unknown function. Instead of the time consuming and laborious
isolation of mutants by traditional genetic screening, functional
genomics would envision determining the function of uncharacterized
genes by employing the invention to reduce the amount and/or alter
the timing of target gene activity. The invention could be used in
determining potential targets for pharmaceutics, understanding
normal and pathological events associated with development,
determining signaling pathways responsible for postnatal
development/aging, and the like. The increasing speed of acquiring
nucleotide sequence information from genomic and expressed gene
sources, including total sequences for the yeast, D. melanogaster,
and C. elegans genomes, can be coupled with the invention to
determine gene function in an organism (e.g., nematode). The
preference of different organisms to use particular codons,
searching sequence databases for related gene products, correlating
the linkage map of genetic traits with the physical map from which
the nucleotide sequences are derived, and artificial intelligence
methods may be used to define putative open reading frames from the
nucleotide sequences acquired in such sequencing projects. A simple
assay would be to inhibit gene expression according to the partial
sequence available from an expressed sequence tag (EST). Functional
alterations in growth, development, metabolism, disease resistance,
or other biological processes would be indicative of the normal
role of the EST's gene product.
[0233] The ease with which RNA can be introduced into an intact
cell/organism containing the target gene allows the present
invention to be used in high throughput screening (HTS). Solutions
containing siRNAs that are capable of inhibiting the different
expressed genes can be placed into individual wells positioned on a
microtiter plate as an ordered array, and intact cells/organisms in
each well can be assayed for any changes or modifications in
behavior or development due to inhibition of target gene activity.
The amplified RNA can be fed directly to, injected into, the
cell/organism containing the target gene. Alternatively, the siRNA
can be produced from a vector, as described herein. Vectors can be
injected into, the cell/organism containing the target gene. The
function of the target gene can be assayed from the effects it has
on the cell/organism when gene activity is inhibited. This
screening could be amenable to small subjects that can be processed
in large number, for example: arabidopsis, bacteria, drosophila,
fungi, nematodes, viruses, zebrafish, and tissue culture cells
derived from mammals. A nematode or other organism that produces a
calorimetric, fluorogenic, or luminescent signal in response to a
regulated promoter (e.g., transfected with a reporter gene
construct) can be assayed in an HTS format.
[0234] The present invention may be useful in allowing the
inhibition of essential genes. Such genes may be required for cell
or organism viability at only particular stages of development or
cellular compartments. The functional equivalent of conditional
mutations may be produced by inhibiting activity of the target gene
when or where it is not required for viability. The invention
allows addition of siRNA at specific times of development and
locations in the organism without introducing permanent mutations
into the target genome.
[0235] XII. Screening Assays
[0236] The methods of the invention are also suitable for use in
methods to identify and/or characterize potential pharmacological
agents, e.g. identifying new pharmacological agents from a
collection of test substances and/or characterizing mechanisms of
action and/or side effects of known pharmacological agents.
[0237] Thus, the present invention also relates to a system for
identifying and/or characterizing pharmacological agents acting on
at least one target protein comprising: (a) a eukaryotic cell or a
eukaryotic non-human organism capable of expressing at least one
endogeneous target gene coding for said so target protein, (b) at
least one siRNA molecule capable of inhibiting the expression of
said at least one endogeneous target gene, and (c) a test substance
or a collection of test substances wherein pharmacological
properties of said test substance or said collection are to be
identified and/or characterized. Further, the system as described
above preferably comprises: (d) at least one exogenous target
nucleic acid coding for the target protein or a variant or mutated
form of the target protein wherein said exogenous target nucleic
acid differs from the endogeneous target gene on the nucleic acid
level such that the expression of the exogenous target nucleic acid
is substantially less inhibited by the siRNA molecule than the
expression of the endogeneous target gene.
[0238] The test compounds of the present invention can be obtained
using any of the numerous approaches in combinatorial library
methods known in the art, including: biological libraries;
spatially addressable parallel solid phase or solution phase
libraries; synthetic library methods requiring deconvolution; the
`one-bead one-compound` library method; and synthetic library
methods using affinity chromatography selection. The biological
library approach is limited to peptide libraries, while the other
four approaches are applicable to peptide, non-peptide oligomer or
small molecule libraries of compounds (Lam, K. S. (1997) Anticancer
Drug Des. 12:145).
[0239] Examples of methods for the synthesis of molecular libraries
can be found in the art, for example in: DeWitt et al. (1993) Proc.
Natl. Acad Sci. U.S.A. 90:6909; Erb et al. (1994) Proc. Natl. Acad.
Sci. USA 91:11422; Zuckermann et al. (1994). J. Med. Chem. 37:2678;
Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew.
Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem.
Int. Ed. Engl. 33:2061; and in Gallop et al. (1994) J. Med Chem.
37:1233.
[0240] Libraries of compounds may be presented in solution (e.g.,
Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991)
Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556),
bacteria (Ladner U.S. Pat. No. 5,223,409), spores (Ladner U.S. Pat.
No. 409), plasmids (Cull et al. (1992) Proc Natl Acad Sci USA
89:1865-1869) or on phage (Scott and Smith (1990) Science
249:386-390); (Devlin (1990) Science 249:404-406); (Cwirla et al.
(1990) Proc. Natl. Acad Sci. 87:6378-6382); (Felici (1991) J. Mol.
Biol. 222:301-310); (Ladner supra.)).
[0241] In a preferred embodiment, the library is a natural product
library, e.g., a library produced by a bacterial, fungal, or yeast
culture. In another preferred embodiment, the library is a
synthetic compound library.
[0242] XIII. Uses of siRNA Derivatives to Induce RNAi
[0243] An siRNA derivative, introduced into cells or whole
organisms as described herein, will associate with endogenous
protein components of the RNAi pathway to bind to and target a
specific mRNA sequence for cleavage and destruction. In this
fashion, the mRNA to be targeted by the siRNA derivative will be
depleted from the cell or organism, leading to a decrease in the
concentration of the protein encoded by that mRNA in the cell or
organism.
[0244] For example, one may be seeking to discover a small molecule
that reduces the activity of a kinase whose overexpression leads to
unrestrained cell proliferation. This kinase is overexpressed in a
variety of cancer cells. A key question to be determined is whether
or not decreasing the activity of this kinase would have unexpected
deleterious effects on a cell. By expressing an siRNA derivative
that targets for destruction by the RNAi pathway the mRNA encoding
the kinase in a cell, the deleterious effects of such a potential
drug can be determined. That is, the method described here will
allow rapid assessment of the suitability of the kinase as a drug
target. One advantage of using an siRNA derivative over a
conventional siRNA is that the siRNA derivative can be more stable,
thus the effect of sustained exposure of a cell to a decrease in
expression of a targeted gene can be assessed.
[0245] RNAi provides a new approach for elucidation of gene
function. RNAi-mediated gene knockdown is useful for genome-wide
analysis of gene function as well as target validation of
potentially therapeutic genes. siRNAs are a useful tool for cell
biologists studying mammalian gene function. For example, siRNAs
are useful for the analysis of general cell biological mechanisms
such as mitosis, processing and traffic of RNA transcripts, the
formation of cellular junctions, and membrane trafficking. Reagents
that can be used for such analyses (e.g. siRNA derivatives that
have increased stability in a cell compared to their corresponding,
unmodified siRNA) have commercial value for use in such
research.
[0246] A selected gene can be knocked down by use of an siRNA and
the resultant phenotype can be observed. However, knockdown of an
essential gene could be lethal or toxic and may affect many
pathways in the cell. Therefore, in some cases it is desirable to
provide to the cell an siRNA that is not maximally efficient at
knockdown (i.e., inhibiting expression of the protein translated
from the targeted sequence). The adverse effects of an overly
efficient knockdown can be modulated by contacting the cell with an
siRNA derivative that has reduced RNAi activity compared to a
corresponding siRNA. Suitable concentrations of an siRNA derivative
used for this purpose include concentrations that do not maximally
inhibit RNAi activity and ameliorate the undesirable effect of the
siRNA. An amount of an siRNA derivative that can cause knockdown
with less efficiency than a corresponding siRNA can be determined
using the dual fluorescence assay described herein by incubating an
amount of siRNA derivative targeted to a hybrid reporter gene and
detecting the amount of inhibition of reporter gene expression. If
desired, the level of fluorescence can be compared to that in a
corresponding dual fluorescence reporter assay in which the
corresponding siRNA was used instead of the siRNA derivative. In
some cases, a useful siRNA derivative is one that inhibits RNAi by
less than 100%. For example, an siRNA derivative that is useful for
reducing the RNAi effect of an siRNA can inhibit RNAi activity by
less than, e.g., 90%, 75%, 50%, 25%, or 10%.
[0247] This invention is further illustrated by the following
examples which should not be construed as limiting. The contents of
all references, patents and published patent applications cited
throughout this application are incorporated herein by
reference.
EXAMPLES
[0248] Examples I- VII demonstrate that the status of the 5'
hydroxyl terminus of the antisense strand determines RNAi activity,
whereas a 3' terminus block is well tolerated in vivo. Isolation of
siRNA from human cells revealed that 5' hydroxyl termini of
antisense strands were phosphorylated and 3' end biotin groups were
not efficiently removed. There was no requirement for a perfect
A-form helix in siRNA for interference effects, but an A-form
structure was required for antisense-target RNA duplexes.
Strikingly, cross-linking of the siRNA duplex by psoralen did not
completely block RNA interference, indicating that complete
unwinding of the siRNA helix is not necessary for RNAi activity in
vivo. These results highlight the importance of 5' hydroxyl in the
antisense strand of siRNA, which is essential to initiate the RNAi
pathway, and suggest a model where RNA amplification by
RNA-dependent RNA polymerase is not essential for RNAi in human
cells.
Example I
Dual Fluorescence Reporter System for RNAi Analysis in Mammalian
Cells
[0249] To explore the functional anatomy of siRNA in mammalian
cells, a dual fluorescence reporter system was established using
HeLa cells as a model system. Two reporter plasmids were used:
pEGFP-C1 and pDsRed1-N1, harboring enhanced green fluorescent
protein (GFP) or coral (Discosoma spp.)-derived red fluorescent
protein (RFP), respectively. The expression of these reporter genes
was under cytomegalovirus promoter control and could be easily
visualized by fluorescence microscopy in living cells. The siRNA
sequence targeting GFP was from position 238-258 relative to the
start codon, and the RFP siRNA sequence was from position 277-297
relative to the start codon (FIG. 1A). Using lipofectamine, HeLa
cells were cotransfected with pEGFP-C1 and pDsRed1-N1 expression
plasmids and siRNA duplex, targeting either GFP or RFP.
Fluorescence imaging was used to monitor GFP and RFP expression
levels. As shown in FIG. 1B (panels a and b), mock treatment
(without siRNA) allowed efficient expression of both GFP and RFP in
living cells. Transfection of cells with siRNA duplex targeting GFP
(GFP ds) significantly reduced GFP expression (FIG. 1B, panel c),
but had no effect on RFP expression (FIG. 1B, panel d) compared
with mock-treated cells (FIG. 1B, panels a and b). By contrast,
transfection of cells with siRNA duplex targeted to RFP (RFP ds)
significantly interfered with the expression of RFP, but not GFP
(FIG. 1B, panels e and f).
[0250] To quantify RNAi effects, lysates were prepared from siRNA
duplex-treated cells at 42 hours post transfection. GFP and RFP
fluorescence in clear lysates was measured on a fluorescence
spectrophotometer. The peak at 507 nm (FIG. 1C, left panel)
represents the fluorescence intensity of GFP, and the peak at 583
nm (FIG. 1C, right panel) represents the fluorescence intensity of
RFP. GFP fluorescence intensity of GFP ds-treated cells (FIG. 1C,
left panel, green line) was only 5% of mock-treated (black line) or
RFP ds-treated cells (cyan line). In contrast to GFP fluorescence,
RFP fluorescence intensity (FIG. 1C, right panel) significantly
decreased only in cells treated with RFP ds (red line), indicating
the specificity of the RNAi effect.
[0251] To confirm these findings on RNAi effects in living
mammalian cells, Western blotting experiments were performed using
anti-GFP and anti-RFP antibodies. Analysis of immunoblots revealed
that the siRNA targeting GFP inhibited only GFP expression without
affecting RFP levels (FIG. 1E, lanes 9-14); siRNA targeting RFP was
similarly specific against RFP expression (FIG. 1F, lanes 9-14).
This RNA interference effect depended on the presence of
21-nucleotide duplex siRNA, but not of the antisense strand siRNA
(FIGS. 1E and F; compare right and left panels). These results
demonstrate a reliable and quantitative system for studying
specific RNA interference in HeLa cells.
Example II
Kinetics of RNA Interference in HeLa Cells
[0252] One of the many intriguing features of gene silencing by RNA
interference is its unusually high efficiency--a few dsRNA
molecules suffice to inactivate a continuously transcribed target
mRNA for long periods of time. It has been demonstrated in plants
(Cogoni and Macino, 1999; Dalmay et al., 2000) and worms (Grishok
et al., 2000) that this inactivation can spread throughout the
organism and is often heritable to the next generation. Mutations
in genes encoding a protein related to RdRP affect RNAi-type
processes in Neurospora (QDE-1; Cogoni and Macino, 1999), C.
elegans (EGO-1; Smardon et al., 2000) and plants ([SGS2; Mourrain
et al., 2000] and [SDE-1; Dalmay et al., 2000]). The involvement of
RdRP in amplifying RNAi has been postulated (Lipardi et al.,
2001).
[0253] To understand the kinetics of gene suppression and
persistence of RNA interference in HeLa cells, lysates were
prepared from cells cotransfected with GFP siRNA and dual
fluorescence reporter plasmids, pEGFP-C1 and pDsRed1-N1. In this
experiment, GFP was the target of the duplex siRNA, while RFP was
used as a control for transfection efficiency and specificity of
RNA interference. Emission spectra of GFP in cell lysates at
various times after transfection (FIG. 1G, Supplementary Material)
show that siRNA duplex caused an RNA interference effect as early
as 6 hours post transfection. This effect gradually increased with
time, peaking at 42 hours, then started to decrease at 66 hours
(FIG. 1G, green lines). As a control experiment, GFP expression in
the presence of antisense strand was also monitored and showed no
RNAi effects (FIG. 1G, blue lines). Thus, RNA interference can last
for at least 66 hours in HeLa cells (FIG. 1G, green lines).
[0254] To quantify the kinetics of RNA interference, the
fluorescence intensity ratio of target (GFP) to control (RFP)
fluorophore in the presence of siRNA duplex (ds) was measured and
normalized it to the ratio observed in the presence of antisense
strand siRNA (as). Normalized ratios less than 1.0 indicate
specific interference. As shown in FIG. 1D, at 6 hours post
transfection GFP duplex siRNA (green bars) inhibits 60% of GFP
expression compared to antisense strand siRNA (blue bars). RNA
interference reached its maximum (92% inhibition) at 42 hours post
transfection; only 8% of normal GFP expression was observed in
duplex siRNA-treated cells. These results show that RNA
interference can suppress target protein expression up to 66 h,
although maximum activities were observed at 42-54 h post
transfection.
Example III
Free 5' OH Groups on the Antisense Strand of the siRNA Duplex are
Required for RNA Interference In Vivo
[0255] Synthetic 21-nucleotide siRNA duplexes with 5' hydroxyl
termini and 3' overhang have been shown to specifically suppress
expression of endogenous and heterologous genes in Drosophila
extracts (Elbashir et al., 2001b) and mammalian cell lines
(Elbashir et al., 2001a). Nonetheless, native siRNA, processed by
Dicer cleavage of dsRNA, contains 5' phosphate ends (Elbashir et
al., 2001b). It has been demonstrated in vitro that Drosophila
embryo lysates contain a potent kinase activity that phosphorylates
the 5' hydroxyl termini of synthetic siRNAs (Nykanen et al., 2001).
The 5' phosphate is required on the siRNA strand that guides target
cleavage in RNA interference (Nykanen et al., 2001).
[0256] To examine the importance of 5' termini of siRNA in RNA
interference in human cells, synthetic siRNAs targeting GFP were
modified by using an amino group with a 3-carbon linker (5' N3,
FIG. 2A) to block their 5' termini. Synthetic siRNAs with this
modification lacked a hydroxyl group to be phosphorylated by
kinases in vivo. This modification could also block access to siRNA
by cellular factors that might require recognizing the 5' OH
termini. Unmodified siRNA strands were annealed with 5'-modified
strands, producing siRNA duplexes with 5' modification at only the
sense strand (5'-N3ss/as), at only the antisense strand
(ss/5'-N3as) or at both strands (5'-N3ss/5'-N3as) (FIG. 2B). RNAi
effects of these siRNA duplexes were analyzed in the dual
fluorescence reporter system as described in FIG. 1. 5'
modification of the sense strand had no effect on RNAi activity
(FIG. 3, compare panels b and c), whereas 5' modification of the
antisense strand completely abolished the RNAi effect (FIG. 3,
panels d and e; FIGS. 4A and 4B, upper panels). HeLa cells
transfected with antisense strand (as) siRNA as control showed no
RNAi activity (FIG. 3, panel a). These results demonstrate that the
5' OH in the antisense strand of the siRNA duplex is an important
determinant of RNAi activity in human cells.
Example IV
Blocking the 3' end of siRNAs has Little Effect on RNA Interference
in Vivo
[0257] To determine the effect of 3' OH groups on RNAi activity,
siRNA duplexes were synthesized containing a 3' end blocked with 3'
puromycin (3'-Pmn, FIG. 2A) or biotin instead of 3' OH groups on
the overhang deoxythymidine (FIG. 2B). These 3' end modifications
would block any processing of the siRNA duplex that required a free
3' hydroxyl group. Three combinations of siRNA duplexes were
prepared containing 3' puromycin: 3' blocked at only the sense
strand (ss3'-Pmn/as), at only the antisense strand (ss/as3'-Pmn),
or at both strands (ss3'-Pmn/as3'-Pmn) (FIG. 2B). A siRNA duplex
containing biotin at the 3'-end of antisense strand
(ss/as3'-Biotin) was also prepared. The RNAi activities of these
siRNA duplexes were analyzed in our dual fluorescence reporter
system. Results of these experiments indicate that a 3' block at
either the sense or antisense strand of siRNA duplex had little
effect on its RNA interference activity (FIG. 3, panels f-i; FIGS.
4A and 4B, middle panels). Furthermore, biotin pull out experiments
showed that the 3' end biotin groups on the antisense strand were
not efficiently removed during RNAi activities in HeLa cells (FIG.
5, see below). Modifications could be introduced in the 3'
overhangs without affecting siRNA efficacy, suggesting that RNA
interference in mammalian cells does not occur through the recently
reported RdRP-dependent degradative PCR mechanism (Lipardi et al.,
2001; Sijen et al., 2001), which requires a free 3' hydroxyl
group.
Example V
A-Form Helix of siRNA is Absolutely Required for Effective RNA
Interference In Vivo
[0258] Synthetic and native siRNAs, generated from ATP-dependent
cleavage of double strand RNA, have been proposed to act as "guide
RNAs" that target an associated nuclease complex, the RISC
(RNA-induced silencing complex), to the corresponding mRNA through
strand complementarity (Hammond et al., 2000; Nykanen et al.,
2001). How are these siRNA duplexes recognized and incorporated
into the RISC protein complex? siRNA duplexes are readily
characterized by their A-form helix, which can be distinguished
from the structures of B-form helix DNA and single-stranded RNA in
the cell. A single mismatch between a target mRNA and its guide
strand siRNA completely prevents target RNA cleavage in Drosophila
embryo lysates (Elbashir et al., 2001c). Although the mechanism of
target recognition has not been experimentally demonstrated, this
finding indicates that recognition requires exact complementarity
between the guide strand and target mRNA.
[0259] These observations raise two fundamental questions regarding
RNAi effects in vivo: (1) Is an A-form RNA helix required in the
siRNA structure? (2) Is an A-form helix recognized by proteins
after the antisense strand of siRNA duplex is hybridized with the
target mRNA? To address these questions, three siRNA duplexes were
designed containing internal bulge structures in the RNA helices
(FIG. 2B). The A-form RNA helix has a deep, narrow major groove and
a shallow, wide minor groove. More than one nucleotide bulge has
been shown to distort RNA helical structures, widening the major
groove and enhancing accessibility to its functional groups
(Neenhold and Rana, 1995; Weeks and Crothers, 1991; Weeks and
Crothers, 1993). 2-nt bulges were chosen to generate distorted
A-form helices in siRNAs. Mutant siRNA were synthesized by
introducing two extra nucleotides into the sense or antisense
strand of siRNA duplexes. Combining these mutant siRNA strands with
original siRNA sequences produced three siRNA duplexes with an
internal bulge at only the sense strand (ss-bulge/as), at only the
antisense strand (ss/as-bulge), or at both strands
(ss-bulge/as-bulge) (FIG. 2B). This design of bulge-containing
siRNAs could dissect the requirement for the A-form helix at two
different steps of RNA interference: 1) siRNA recognition by RISC,
and 2) RISC targeting of mRNA via the guiding siRNA. siRNA duplexes
with an internal bulge at only the sense strand (ss-bulge/as)
caused a structural change in the siRNA duplex (an imperfect
A-form) without affecting the complementarity between target mRNA
and the antisense strand, which acts as the guiding strand in the
RNA interference pathway. RNA interference by these siRNA duplexes
was analyzed and quantified in the dual fluorescence reporter
system as described above.
[0260] Surprisingly, the siRNA duplex containing a bulge in its
sense strand retained most of its RNA interference activity (FIG.
3, compare panels b and j; FIGS. 4A and 4B, lower panels, green
line and bars), indicating that an A-form siRNA helix is not
essential for effective RNA interference in vivo. However, bulges
in the antisense strand or both strands of duplex siRNA completely
abolished RNA interference ability (FIG. 3, panels k and 1; FIGS.
4A and 4B, lower panels, dark and light blue line and bars),
indicating that effective RNA interference in vivo absolutely
requires A-form helix formation between target mRNA and its guiding
antisense strand.
Example VI
5' OH Groups on the Antisense Strand of the siRNA Duplex are
Phosphorylated In Vivo
[0261] To analyze the phosphorylation status of the 5' termini of
siRNA and to probe the participation of siRNA 3' termini in the RNA
interference pathway in vivo, HeLa cells were transfected with
21-nt RNAs containing biotin at the 3' terminal of the antisense
strand (ss/as3'-Biotin) and isolated the biotinylated siRNA at
various times after transfection (see Experimental Procedures).
Briefly, streptavidin magnetic beads were used to pull out
biotinylated siRNAs from transfected cells, washed to remove
unbound RNA, and split into two aliquots. One aliquot was
dephosphorylated with shrimp alkaline phosphatase (SAP), and the
RNA 5' ends labeled with .sup.32P by T4 polynucleotide kinase (PNK)
reaction. The other aliquot was subjected to 5' end radiolabeling
with polynucleotide kinase without prior dephosphorylation reaction
with SAP. RNA was resolved on 20% polyacrylamide-7M urea gels and
visualized by phosphorimager analysis. Cells without siRNA
treatment showed no detectable signal after biotin pull out assay
(FIG. 5, lane 4), indicating the absence of non-specific RNA-bead
interactions. Efficient 5'-end radiolabeling was observed only when
RNA was pretreated with phosphatase (compare lanes 5-9 and 10-14),
indicating that the 5' termini of siRNA did not contain free OH
groups in vivo. Although phosphorylating with SAP and quenching the
phosphatase reaction by heating resulted in some RNA degradation,
the efficiency of the kinase reaction after SAP treatment is
obvious. These results indicate that 5' OH groups are
phosphorylated in vivo for RNAi activities.
[0262] These experiments have three key findings. First,
biotinylated-siRNA can be isolated from HeLa cells at 6 to 54 hours
post transfection (FIG. 5, lanes 5-9). The amount of isolated siRNA
decreased in a time-dependent manner, indicating the degradation of
siRNA in vivo. The dual fluorescence assays showed that RNA
interference mediated by 3' end biotinylated siRNA was as effective
as unmodified siRNA (FIG. 3, panels f and b; FIGS. 4A and 4B,
middle panel). RNA interference is seen as early as 6 hours post
siRNA transfection and can be maintained for 42 hours post
transfection. The ability to isolate biotin-RNA from cells after
RNA interference had been initiated indicates that biotin was not
removed from the RNA and rules out the possibility of siRNA 3' OH
termini involvement in the RNA interference pathway in human
cells.
[0263] Second, in this biotin pull out assay, only siRNA with 5' OH
ends can be .sup.32P-labeled by T4 PNK. As shown in FIG. 5, the
siRNA without SAP treatment was not efficiently labeled by T4 PNK
(e.g., compare lane 10 to lane 5 and lane 11 to lane 6), indicating
that the 5' termini of siRNA did not contain free OH groups in
vivo. These 5' terminal groups can be removed by alkaline
phosphatase treatment for subsequent radiolabeling (FIG. 5, lanes
5-9), indicating that the 5' termini of the siRNA had been
phosphorylated in vivo.
[0264] Third, only the antisense strand is recovered by biotin pull
out assays. siRNA duplexes were 5'-end labeled with .sup.32P by T4
PNK, heat denatured (10 min at 95.degree. C.), and analyzed on a
polyacrylamide-7M urea denaturing gel. As shown in FIG. 5 (lane 3),
two single-stranded RNA species corresponding to the sense and
biotinylated-antisense strands were observed indicating that the
siRNA duplexes were fully denatured under these conditions.
Denatured siRNA duplexes contained.apprxeq.equal molar amounts of
the sense and the antisense strands of RNA (FIG. 5, lane 3). The
cells were transfected with duplex siRNA but the major products of
the isolated siRNA (FIG. 5, lanes 5-9) by biotin pull out assay
exhibited electrophoretic moblities identical to the antisense
strand (lane 3), indicating that only biotinylated anti-sense
strands were being recovered. These results suggest that RISC melts
the duplex siRNA and separates the antisense from the sense strand
during RNA interference in vivo.
Example VII
Complete Unwinding of siRNA Duplex is not Necessary for RNA
Interference Pathway In Vivo
[0265] ATP-dependent unwinding of the siRNA duplex in the RISC has
been proposed to activate the complex to generate RISC*, which is
competent to mediate RNAi (Nykanen et al., 2001). Although
unwinding of siRNA in Drosophila embryo lysates has been
demonstrated in the presence of ATP, the efficiency of unwinding
seems low since only 5% of unwound siRNA was detected (Nykanen et
al., 2001).
[0266] To examine whether or not the siRNA duplex in human cells is
completely unwound, RNA interference experiments were performed
with siRNA duplexes covalently cross-linked by psoralen
photochemistry. Psoralens are bifunctional furocoumarins that
intercalate between the base pairs of double-stranded nucleic acids
and can photoreact with pyrimidine bases to form monoadducts and
cross-links (for review see (Cimino et al., 1985)). The structure
of the psoralen derivative,
4'-(hydroxymethyl)-4,5',8-trimethylpsoralen (HMT) used in this
study is shown in FIG. 6A. Psoralen cross-linking involves two
successive photochemical reactions that take place at the 3,4 or
4',5' double bonds of psoralen (Cimino et al., 1985). Upon long
wave UV irradiation (320-400 nm), the intercalated psoralen can
photoreact with adjacent pyrimidine bases to form either furan-side
or pyrone-side monoadducts, which are linked to only one strand of
the helix (Cimino et al., 1985). By absorbing a second photon, the
furan-side monoadducts can be driven into diadducts, which are
covalently linked to both strands of the helix (Hearst et al.,
1984; Kanne et al., 1982). Psoralen cross-link formation occurs
only when psoralen adds to adjacent and opposite pyrimidine bases
in the double helix. The reaction is primarily with uracil in
native RNAs, but reactions with cytidine have also been reported
(Lipson et al., 1988; Thompson and Hearst, 1983; Turner and Noller,
1983). Based on psoralen photoreactivity, three possible psoralen
cross-link sites in the GFP siRNA duplex are shown in FIG. 6B. Note
that there is no chance for all three sites to be cross-linked in
one RNA.
[0267] Unlike the noncross-linked ds siRNA, the two strands of the
cross-linked siRNA duplex couldn't separate from each other under
denaturing conditions so that the cross-linked siRNA duplex showed
characteristically retarded mobility in polyacryalmide gel
electrophoresis (PAGE) containing 7M urea (FIG. 6C). Cross-linking
efficiency depended on the psoralen concentration (FIG. 6C, lanes 2
and 3). To further verify the presence of cross-links in the RNA
helix and rule out the possibility of only monoadduct formation,
the psoralen cross-links were irradiated with short wave UV (254
nm), which showed photoreversal of the cross-linked bonds (FIG. 6C,
lane 4). The cross-linked siRNA duplex (FIG. 6C, lane 3, upper
band) was excised from the gel and purified. As control, the
noncross-linked siRNA that was irradiated with long wave UV (360
mn) (FIG. 6C, lane 3, lower band) was also purified by the same
method. The structures of the purified noncross-linked and psoralen
cross-linked siRNA duplexes were confirmed by PAGE containing 7M
urea (FIG. 6C, lanes 5 and 6). Fluorescence imaging of living cells
treated with cross-linked siRNA duplex showed that the siRNA
duplex's inability to separate on PAGE did not completely abolish
its RNA interference activity (FIG. 6D, ds-XL). Quantitative
analysis of GFP fluorescence intensity indicated that cross-linked
siRNA retained 30% of its RNAi activity (FIG. 6E, blue line). These
results demonstrate that a complete unwinding of the siRNA duplex
is not required for gene silencing in vivo (see Discussion).
[0268] There is a possibility that the psoralen cross-link of RNA
can be photoreversed during transfection, repaired or removed by
some unknown mechanism inside the cells, which might cause the
partial RNA interference effect in vivo observed in FIGS. 6D and
6E. To rule out this possibility, a psoralen cross-linking
experiment was performed with siRNA duplex containing biotin at the
3' end of the antisense strand. The cross-linked duplex
(ss/as3'-Biotin-XL) was isolated and purified as described above
and transfected into HeLa cells by lipofectamine. Biotinylated
siRNA was isolated from the cells 30 h post transfection by biotin
pull out assay, SAP treated and .sup.32P-labeled by T4 PNK as
described above. The biotinylated siRNA was still cross-linked
(FIG. 7, lane 7) at 30 h post transfection. When UV-irradiated (254
nm), this higher molecular weight siRNA species was converted into
two RNA species corresponding to sense and antisense strands (FIG.
7, lane 8), indicating the reversibility of the psoralen
cross-link. These results show that cross-linked siRNA duplexes can
enter the RNAi pathway.
Summary of Examples I-VII
[0269] By using a quantitative dual fluorescence-based system, the
kinetics and a number of important parameters involved in the RNAi
pathway have been dissected in cultured human cells. The results
presented in Examples I-VII highlight the role of free 5' end
hydroxyl groups and the requirement of an A-form helical structure
between the antisense strand and the target mRNA. It was also found
that a complete unwinding of the siRNA helix is not necessary to
cause RNAi effects in vivo.
[0270] The time-dependent effect of siRNA may reflect a time lag
between target mRNA degradation and the half-life of the existing
protein expressed from the target gene. This time dependence may
also indicate that the siRNAs need to be processed or assembled
into an active complex with cellular factors for effective RNA
interference.
[0271] Although RNA interference lasted at least 66 hours in HeLa
cells, quantitative analysis indicated that inhibition by siRNAs
did not persist. After reaching maximal activity at 42 hours post
transfection, RNA interference started to decrease at 54 hours,
with only 70% inhibition activity at 66 hours. It was also found
that 5-10% protein expressed from the genes targeted by siRNA
remained at 42 hours post transfection, but protein amount showed
gradual recovery to normal levels between 66 to 90 hours (3 to 4
days) post transfection (Chiu and Rana, unpublished results). The
recovery of target gene expression also indicates that RNA
interference by exogenous siRNA duplex does not exist forever in
mammalian cells. These findings suggest that the proposed
amplification system driven by RdRP and present in plants and
nematodes may not exist or has very little effect on siRNA-mediated
gene silencing in mammalian cells.
[0272] Recent studies have shown that synthetic siRNAs containing
5'-OH termini can successfully induce RNAi effects in Drosophila
embryo lysates (Elbashir et al., 2001c; Nykanen et al., 2001) and
cultured mammalian cells (Elbashir et al., 2001a). A model
involving a 5' end kinase activity necessary for RNA interference
has been proposed (Nykanen et al., 2001). However, there is no
evidence that the 5' end hydroxyl is required for in vivo
interference activity. The above results show that replacing the 5'
OH, a kinase target site, with amino groups inhibited RNAi
activity. Further isolation of siRNA by biotin pull out experiments
revealed that prior phosphatase activity was required for in vitro
5' end radiolabeling by a polynucleotide kinase. Taken together,
these results provide strong evidence for the requirement of 5' end
kinase activity for RNA interference effects in vivo.
[0273] What about a free 3' end for RNAi effects in vivo? An
RNA-directed RNA polymerase (RdRP) chain reaction, primed by siRNA,
has recently been proposed to amplify the interference effects of a
small amount of trigger RNA (reviewed in (Nishikura, 2001)).
Lipardi et al. (Lipardi et al., 2001) have shown siRNA-primed RNA
synthesis in Drosophila embryo lysates and suggested that RNAi in
Drosophila involves an RdRP where siRNA primes the conversion of
target RNA to dsRNA. Further evidence of RdRP involvement in the
RNAi pathway in C. elegans has been provided in studies (Sijen et
al., 2001) showing target RNA-templated synthesis of new dsRNA.
[0274] These studies highlight the importance of a 3' hydroxyl in
priming subsequent RdRP reactions. An RdRP homolog has not yet been
identified in the human genome, suggesting the presence of a
separate enzyme that can carry out primer-dependent replication of
an RNA template. The above results demonstrate that blocking the 3'
position did not significantly affect RNAi activity of siRNA in
human cells. Results of kinetic experiments show that the
interference effect lasted only .about.4 days, indicating the
absence of an amplification mechanism in human cells. In addition,
our biotin pull out experiments show that the 3' end biotin groups
on the antisense strand were not efficiently removed during RNAi
activities in HeLa cells. Based on these studies, a model is
proposed where RNA amplification by RNA-dependent RNA polymerase is
not essential for RNA interference in mammalian cell lines.
[0275] It is interesting to note that there was no requirement for
a perfect A-form helix in siRNA for interference effects in HeLa
cells, but an A-form structure was required for antisense-target
RNA duplexes. These results suggest an RNAi mechanism where RISC
formation does not involve perfect RNA helix recognition, but RISC*
(the asterisk indicates the active conformation of the complex)
assembly requires an A-form helical structure.
[0276] The most intriguing results were obtained by cross-linking
siRNAs and testing their interference activities in HeLa cells.
Psoralen cross-linked siRNA duplexes retained 30% of RNA
interference activity. This result can be explained by psoralen
photocross-linking chemistry. There are three possible sites in the
GFP siRNA duplex where psoralen can cross-link, yet the
cross-linking reaction is not efficient enough to create multiple
cross-links in a single given siRNA duplex (Cimino et al., 1985;
Thompson and Hearst, 1983). Thus, in the purified cross-linked
siRNA duplex population, about 1/3 had cross-linking at the site
near the 5' end of the antisense strand, about 1/3 had
cross-linking in the middle region and the rest had cross-linking
near the 3' end of the antisense strand.
[0277] It has previously been shown that accessibility to the 5'
termini of the antisense strand is required for efficient RNA
interference in vivo. 5' phosphorylation of the antisense strand is
also required for RNA interference in vitro (Nykanen et al., 2001).
The cleavage site on target mRNA has been shown to be determined by
the 5' end position of the target-recognizing siRNA (Elbashir et
al., 2001c). Based on these findings, it is suggested that
unwinding of the siRNA duplex would start from the 5' end of the
antisense strand, which sets the ruler for target mRNA cleavage. If
cross-linking occurred near the 5' end of the antisense strand, it
would completely prohibit the unwinding of the siRNA duplex and
block access to the 5' termini of the antisense strand, which would
completely abolish the RNAi effect. If cross-linking occurred in
the middle of siRNA duplex, near the cleavage site of mRNA, it is
suggested that although the siRNA duplex could still undergo some
unwinding, this cross-link might interfere with the pairing between
target mRNA and the guiding siRNA, thus also blocking the RNAi
effect. If cross-linking occurred near the 3' end of the antisense
strand, the duplex RNA could unwind, not completely but sufficient
for the antisense strand to hybridize to the target mRNA. It has
previously been shown that blocking either the 3' end of the
antisense strand or the 5' end of the sense strand has no
significant effect on its RNAi activity. It would thus be
reasonable to believe that a siRNA duplex with cross-linking near
the 3' end of the antisense strand may still be competent in RNA
interference. This hypothesis also explains the remaining 30% RNAi
activity in the psoralen-cross-linked siRNA duplex.
[0278] These results suggest a possible model for the RNAi pathway
in human cells. An RNA-protein complex containing siRNA (RISC) is
assembled without the requirement for an A-form RNA helix and/or a
free 3'-OH. The 5'-OH of the siRNA duplex is phophorylated by a
kinase. During activation of RISC to RISC*, a 5'.fwdarw.3' helicase
unwinds the RNA duplex to allow hybridization between the antisense
strand of siRNA and the target RNA. The requirement of a perfect
A-form helix at this stage strongly suggests that another protein
(or protein complex) binds this RNA duplex, either in a structural
role and/or assisting in the cleavage of mRNA. A complete unwinding
of the siRNA duplex is not required for this process, nor can this
interference activity be amplified via the 3' end. However,
unwinding of the duplex up to the cleavage site may be necessary so
that the antisense strand can form an A-form helix with the target
strand for further protein interactions. These results also argue
against the involvement of RNA amplification mechanism(s) for RNA
interference in human cells.
[0279] In summary, the above results provide new insight into the
mechanism of RNAi in mammalian cells, and guide the design of siRNA
structures useful in probing biological questions and in functional
genomic studies.
Example VIII
Improved Dual Fluorescence Assay
[0280] pDsRed2-N1 (Catalog #6973-1, BD Biosciences Clontech, Palo
Alto, Calif.) encodes DeRed2, a DsRed variant that has been
engineered for faster maturation and lower non-specific
aggregation. DsRed2, derived form it progenitor DeRed1, contains
six amino acid substitutions: A105V, I161T and S197A, which result
in the more rapid appearance of red fluorescence in transfected
cell lines and R2A, K5E and K9T, which prevent the protein from
aggregation. The extinction coefficient of DsRed2 is 43800 (M-1
cm-1) and the quantum yield is 0.55, both are showing significantly
increasing compared to DsRed1. Intensity of red fluorescence in
cells transfected with pDeRed1and pDeRed2 is shown in FIG. 8A,
siRNA targeting DsRed1-N1 can also targeting DeRed2-N1 mRNA because
the sequence are identical in the targeting region of siRNA.
[0281] In an improved dual fluorescence reporter assay, EGFP-C1
encoded enhanced green fluorescence protein (GFP), while DsRed2-N1
encoded red fluorescence protein (RFP2) as described above. Using
lipofectamine, HeLa cells were cotransfected with pEGFP-C1 and
pDsRed2-N1 expression plasmids and siRNA duplex, targeting either
GFP or RFP. To quantify RNAi effects, lysates were prepared from
siRNA duplex-treated cells at 42 hr posttransfection. GFP and RFP
fluorescence in clear lysates was measured on a fluorescence
spectrophotometer. The peak at 507 nm (FIG. 8B, left panel)
represents the fluorescence intensity of GFP, and the peak at 583
nm (FIG. 8B, right panel) represents the fluorescence intensity of
RFP. GFP fluorescence intensity of GFP ds-treated cells (FIG. 8B,
left panel, green line) was only 5% of mock-treated (black line) or
RFP ds-treated cells (blue line). In contrast to GFP fluorescence,
RFP fluorescence intensity (FIG. 8B, right panel) significantly
decreased only in cells treated with RFP ds (red line), indicating
the specificity of the RNAi effect.
[0282] Thus, by using the DsRed2-N1 plasmid for encoding RFP, a
much higher signal-to-noise ration is achieved (i.e., a 10 to
20-fold increase in signal when comparing DsRed1-N1 and DsRed2-N1).
Moreover, use of the DsRed2-N1 plasmid results in similar
fluorescent intensities for RFP as those seen for cells transfected
with EGFP-C1 (ie., GFP intensities) making comparison in the dual
fluorescence assay more practicable.
Example IX
Quantitative Analysis of RNAi Effects in HeLa Cells Transfected
with Modified Single-Stranded (Antisense Strand) siRNAs
[0283] pEGFP-C1 (as reporter), pDsRed2-N1 (as control) plasmids and
various amount of antisense strand siRNA (as) were cotransfected
into HeLa cells by lipofectamine. Cells were harvested at 42 h
after transfection. Fluorescence Intensity of GFP and RFP in total
cell lysates were detected by exciting at 488 and 568 nm,
respectively. The fluorescence intensity ratio of target (GFP) to
control (RFP) fluorophore was determined. The data are set forth in
FIG. 9A. Modified siRNAs were as follows: 2'-O-Methyl-modified as
siRNAs (as-2'-Ome, lanes 9-12), 2'-Fluoro U and C modified as
siRNAs (as-2'FU, 2'FC, lanes 13-16), as siRNAs with
phosphorothiolates modification at backbone residues (as-P--S-All,
anes 17-20) and as siRNAs with phosphorothiolates modification at
all backbone residues except the bases 9-12 (as-P--S, lanes 21-24).
The intensity ratios of GFP to RFP in various treatment were
normalized to the ratio observed in the mock treated cells. A
normalized ratio of less than 1.0 indicates a specific RNA
interference effect. For comparison, results from unmodified
antisense RNA (as, lanes 4-7) and duplex siRNA (ds, lane
2-3)-treated cells are included. These data show that single
stranded siRNA has much lower efficiency than duplex siRNA in
mediating RNAi.
[0284] Single stranded RNA corresponding to the GFP antisense
sequence with 5'-phosphate group was synthesized and purified
according to art-recognized methodologies. The fluorescence
intensity ratio of target (GFP) to control (RFP) fluorophore was
determined (FIG. 9B) in the presence of various amount of
5'-phosphorylated as siRNA (5'-P-as, lanes 7-12). For comparison,
results from unmodified antisense RNA (as, 400 nM, lane 6) and
duplex siRNA (ds, lane 2-5) -treated cells are included. These data
show that phosphorylation of single-stranded siRNA (antisense
strand) does not much improve its RNA interference activity.
Example X
Quantitative Analysis of RNAi Effects in HeLa Cells Transfected
with Modified Duplex siRNAs
[0285] Results set forth in Example II showed that RNAi effects
typically peaked between 42-54 h post transfection and targeted
gene expression started to be restored by 66 h post transfection.
To determine if the duration of RNAi could be prolonged by
increasing the half life of siRNAs, various chemical modifications
were made to nucleotides that affected siRNA stability. These
modified siRNAs were then tested in an improved dual fluorescence
reporter assay which was set forth in Example VIII. The sequence of
EGFP siRNA and EGFP mRNA, the specific mRNA cleavage site, plus the
structures of the chemically modified nucleotides are diagrammed in
FIG. 1. The specific chemical modifications, the particular siRNA
strand(s) where modifications were made, and the effect of the
chemically modified siRNA on RNAi activity are summarized in Table
1. RNAi activity of siRNAs was evaluated with eight different siRNA
concentrations (ranging from 1-200 nM). Each experiment was
completed in duplicate and repeated twice.
[0286] pEGFP-C1 (as reporter), pDsRed2-N1 (as control) plasmids and
various amount of modified siRNA were cotransfected into HeLa cells
by lipofectamine. Cells were harvested at 42 h after transfection.
Fluorescence intensity of GFP and RFP in total cell lysates were
detected by exciting at 488 and 568 nm, respectively. The
fluorescence intensity ratio of target (GFP) to control (RFP)
fluorophore was determined in the presence of modified siRNAs and
normalized to the ratio observed in the mock treated cells. A
normalized ratio of less than 1.0 indicates a specific RNA
interference effect. Data are presented in FIG. 10. For comparison,
results from unmodified duplex siRNA (ds, lane 2-5)-treated cells
are included in each panel. Unless otherwise indicated, all
residues are modified.
[0287] FIG. 10A depicts the results from cells treated with duplex
siRNA with 2'-Deoxy modification at internal residues within the
sense strand (ss-2'Deoxy/as, lanes 6-11).
[0288] An interesting result was seen by modifying the 2'OH to a
bulky methyl group to create 2'OMe nucleotides that were
incorporated into sense, antisense or both strands of EGFP siRNAs
(FIG. 19). This modification was hypothesized to improve RNAi
efficacy because 2'OMe groups are thought to increase RNA stability
by inducing an altered RNA conformation that is more resistant to
nucleases (Cummins et al., 1995). This modification is also thought
to increase RNA affinity for RNA targets and improve hybridization
kinetics (Majlessi et al., 1998). FIG. 10B depicts results from
cells treated with duplex siRNA with 2'-O-Methyl modification at
internal residues within the sense strand (ss-2'Ome/as, lanes 6-11)
or the antisense strand (ss/as-2'-Ome, lanes 12-17). Despite the
potential benefits, 2'OMe nucleotides incorporated into either the
sense or antisense strand greatly diminished EGFP gene silencing to
.about.25% or .about.16%, respectively, while double-stranded 2'OMe
modified siRNAs completely abolished RNAi (FIG. 10B and Table 1,
rows 12-14). These results suggested that the methyl group, as a
bulky group, may severely limit the interactions between siRNAs,
target mRNAs and the RNAi machinery required for successfully
mediating RNAi. It is worth noting that since the bulkiness of the
methyl group would likely be the cause of decreased RNAi activity
rather than the actual lack of the 2'OH specifically, these studies
still supported the conclusion that the 2'OH was not required for
RNAi.
[0289] The effects of modifying the 2'OH of nucleotides on RNAi
were next studied by replacing uridine and cytidine in the
antisense strand of siRNA with 2'-Fluoro-uridine (2'-FU) and
2'-Fluoro-cytidine (2'-FC), which have a fluoro- group at the 2'
position in place of the 2'OH (FIG. 19). Addition of a 2' fluoro-
group should increase the stability of the siRNA by making the
siRNAs less recognizable to RNases thereby providing siRNAs
protection from degradation. When measured in the dual fluorescence
assay, 2'FU, FC siRNAs, modified only in the sense strand (ss-2'FU,
2'-FC/as, FIG. 10C lanes 6-15), only in the antisense strand
(ss/as-2'-FU,2'-FC, FIG. 10C lanes 16-25), or in both strands
(ds-2'FU,2'FC, FIG. 10C lanes 26-35), all showed decreased EGFP
fluorescence when normalized to non-targeted RFP fluorescence that
was comparable to the normalized decrease seen with wild type
siRNAs (FIG. 10C; Table 1, rows 1-4). These results suggested that
the 2'OH was not required for RNAi and that nucleotides modified
with 2' fluoro- groups could be used in siRNA constructs to
successfully induce RNAi-mediated gene silencing.
[0290] In a final analysis of modifications that may potentially
increase siRNA stability without disrupting RNAi potency, a thioate
linkage (P--S) was integrated into the backbone of the EGFP siRNA
strand(s). P--S linkages were previously used in antisense
methodology for increasing resistance to ribonucleases (reviewed in
(Stein, 1996)) and therefore, were postulated to enhance the
stability of siRNAs. FIG. 10D depicts results from cells treated
with duplex siRNA with phosphorothiolate modification at each
backbone residue of the sense strand (ss-P--S-all/as, lanes 6-12),
antisense strand (ss/as-P--S-all, lanes 13-22) and both strands
(ds-P--S-all, lanes 23-31). FIG. 10E depicts results from cells
treated with duplex siRNA with phosphorothiolate modification at
each backbone residue of both strands except for bases 9-12 of the
antisense strand (ds-P--S, except center region, lanes 15-23). For
comparison, cells treated with duplex siRNA with phosphorothiolate
modification at each backbone residue of both strand (ds-P--S-all)
are also shown (lanes 6-14). Incorporating the P--S linkages into
the double-stranded siRNA sense strand led to moderate levels of
RNAi activity (62% inhibition), while P--S linkages in either the
antisense or both strands of the siRNAs led to just less than
.about.50% RNAi-induced inhibition (Table 1, rows 15-17). These
results suggested that the P--S modifications did not prohibit
RNAi-mediated degradation and only moderately affected the
efficiency of RNAi. Interestingly, incorporating 2'FU, FC
modifications into the antisense strand in addition to the added
P--S linkages showed lower levels of EGFP gene silencing (Table 1,
row 18), indicating that there was a synergistic effect that
decreased but did not inhibit RNAi-mediated degradation when both
the 2' F groups and the P--S linkages were incorporated into
siRNAs.
[0291] In summary, these data indicate that 2' Deoxy modifications
within the sense strand are well tolerated, whereas 2'-O-Methyl
modification is not well tolerated (either within the sense or
antisense strand). Moreover, 2'-FU and 2'-FC modifications are well
tolerated within either strand or within both strands. Note that
siRNA duplexes having every internal U and C modified with 2' F are
virtually as efficient at mediating RNAi as are their unmodified
counterparts. Also well tolerated are phosphorothioate linkages
between backbone residues of the sense and/or antisense strands.
Leaving the most internal residues unmodified in duplex siRNA
having phosphorothioate linkages between backbone residues of the
sense and antisense strands did not significantly improve the RNAi
activity.
Example XI
Kinetics fRNAi Effects of Duplex siRNA with 2'-Fluoro Uridine and
Cytidine Modification in HeLa Cells Showing Effect of Modified
siRNA is Much More Persistent than the Unmodified siRNA
[0292] To address whether increased stability seen with modified
siRNAs prolonged the duration of RNAi in vivo, RNAi, induced by
unmodified and 2'FU, FC modified double-stranded EGFP siRNAs, was
assayed in the dual fluorescence reporter assay over a period of
120 h (FIG. 11). The fluorescence intensity ratio of target (GFP)
to control (RFP) protein was determined in the presence of
unmodified double-strand (ds) RNA (blue bars) and duplex siRNA with
2'-Fluoro uridine and cytidine modification (ds-2'FU, 2'FC, cyan
bar) and normalized to the ratio observed in the presence of Mock
treated cells (red bars). A normalized ratio of less than 1.0
indicates specific RNA interference.
[0293] Although 2'FU, FC modified EGFP siRNAs were slower to show
RNAi effects by 6-18 h, maximal RNAi effects occurred by 42 h
post-transfection for both modified and unmodified siRNAs. The
maximal activity for both siRNAs was also in the same range, with
both showing .about.85-90% inhibition of GFP expression. However,
the RNAi effects observed over the period of 66-120 h revealed that
the effect of modified siRNAs was much more persistent than
unmodified siRNA. By 120 h post-transfection, the effect of
modified siRNAs still remained at .about.80% inhibition of GFP
expression while the effect of unmodified siRNAs had dropped to
less than .about.40% inhibition. These results strongly indicated
that there was a direct link between the duration of the RNAi
effects and siRNA stability in human cells. Furthermore, these
results showed conclusively that siRNAs stabilized by chemical
modifications, like the 2'FU, FC-modifications, can be used to
effectively induce and significantly prolong RNAi-mediated gene
silencing in vivo.
Example XII
Study of Duplex siRNA Stability in HeLa Cell Lysate
[0294] As the data set forth in Example X showed that siRNAs
modified with stabilizing 2'-FU, FC groups could effectively
mediate RNAi to levels comparable to wild type, it was necessary to
show that these modifications did in fact enhance siRNA stability.
To measure the stability of siRNA in cell extracts, unmodified or
modified EGFP antisense strand siRNA were 5'-labeled with
[gamma-32P] ATP by T4 polynucleotide kinases. Duplex siRNAs were
formed by annealing an equal molar ratio of unmodified or modified
sense strand siRNA with the 5 -.sup.32P labeled antisense strand.
50 pmole duplex siRNA which labeled at 5' end of the antisense
strand were incubated with 500 ug HeLa cytoplasmic extract in 50 ul
reaction mixture containing 20 mM Hepes, pH 7.9, 100 mM KCI, 10 mM
NaCl, 2 mM MgCl.sub.2, 10% glycerol. After incubation for various
times with cell extract, siRNAs were analyzed on 20% polyacrylamide
gel containing 7M Urea followed by phosphorimage analysis (Fugi).
Data are presented in FIG. 12. FIG. 12A depicts a stability
comparison of unmodified and modified antisense strand siRNA.
Unmodified single-stranded siRNA has a very short half-life in cell
extract, that is 50% of them degraded in <10 min. 2'Fluoro
modified single strand doesn't increase its half life. 2'-Ome
modification moderately increases the stability of single-stranded
siRNA while phosphorothioate modification within the backbone
maintains greater stability of the single-stranded siRNA in
extracts. FIG. 12B depicts a stability comparison of duplex siRNAs
with unmodified and modified antisense strand. Both 2'-Fluoro and
2'-Ome modification at the antisense strand of the duplex siRNA
make the duplex RNA much more stable than the unmodified one.
However, phosphorothioates modification at antisense strand of the
duplex seems only have moderate effect. This may be due to an
increased RNAse H sensitivity of hybrids formed from unmodified
sense strand and phosphorothioate modified antisense strand. FIG.
12C depicts a stability comparison of duplex siRNAs containing
modification at both strands. Modification dramatically increase
the stability of the duplex siRNA when made at both strands of the
siRNA duplex.
[0295] Results from experiments demonstrating similar results are
depicted in FIG. 12D and 12E. FIG. 12D shows the stability of the
various 2'FU, FC modified siRNAs as compared to wild type siRNAs
over time. Wild type double-stranded siRNAs showed a steady loss of
intact siRNAs over the course of the experiment, with only
.about.7% of the original concentration of intact siRNAs remaining
after 1 h in extract (FIG. 12D; dark blue line). Intact modified or
unmodified single stranded antisense siRNAs were quickly lost over
the time course and were virtually undetectable by 30 min in
extract (FIG. 12D; black and red lines). In contrast,
double-stranded siRNAs with 2'FU, FC modifications in either the
antisense strand or both strands remained predominantly intact over
the course of the experiment with .about.68 or .about.81%,
respectively, of the original siRNA population remaining intact
throughout the duration of the experiment (FIG. 12D; green and
light blue lines). These results indicated that the 2'FU, FC
modifications did indeed increase the stability of the siRNAs upon
exposure to extract and that having these modifications in both
strands provided the siRNAs with the most stability.
[0296] In a similar experiment, the stability of P--S modified EGFP
siRNAs was evaluated. Unmodified, doubled-stranded antisense siRNAs
showed about the same rate of siRNA loss as described in the above
experiment (FIG. 12E; dark blue lines). However, P--S modified
single-stranded antisense siRNAs showed a markedly increased rate
of stability over the course of the experiment, showing .about.63%
of the original siRNAs remaining intact after 1 h in extract as
compared to 0% intact for single-stranded unmodified antisense
siRNAs (FIG. 12E; black and red lines). Stability of
double-stranded siRNAs with P--S modifications in both strands was
comparable to the stability seen with the modified single-stranded
antisense strand with .about.63% of the originally siRNA population
remaining intact after 1 h (FIG. 12E; light blue lines).
Double-stranded siRNAs with P--S modifications in only the
antisense strand showed weaker but still significant stability with
.about.42% of the original siRNA population remaining intact
through to 1 h in extract (FIG. 12E; green lines). These results
showed that the P--S modifications increased the stability of the
siRNAs and most notably, increased the stability of both single and
double stranded siRNAs.
Example XIII
Quantitative Analysis of RNAi Effects of Duplex siRNAs with
2'-Fluoro Uridine and Cytidine Modifications, and 2'-Fluoro Uridine
and Cytidine Modifications in Combination with 2'-deoxy
Modifications, in HeLa Cells
[0297] Results set forth in Example X indicated that the 2'OH was
not required for RNAi and that nucleotides modified with 2'
fluoro-groups could be used in siRNA constructs to successfully
induce RNAi-mediated gene silencing. To support the conclusion that
the 2'OH was not required for RNAi, adenine and guanine
deoxynucleotides that inherently have 2'H in place of the 2'OH
(FIG. 19) were incorporated into the sense, antisense, or both
strands of 2'FU FC-modified EGFP siRNAs to determine their effect
on RNAi. This example demonstrates that 2'-OH is not required for
siRNA to enter the RNAi pathway, but that an A-form helix is
required for mRNA targeting by siRNA.
[0298] pEGFP-C1 (as reporter), pDsRed2-N1 (as control) plasmids and
various amount of modified siRNA were cotransfected into HeLa cells
by lipofectamine. Cells were harvested at 42 h after transfection.
Fluorescence intensity of GFP and RFP in total cell lysates were
detected by exciting at 488 and 568 nm, respectively. The
fluorescence intensity ratio of target (GFP) to control (RFP)
fluorophore was determined in the presence of modified siRNAs and
normalized to the ratio observed in the mock treated cells.
[0299] Modified siRNA duplexes with modifications in the antisense
strand at the 2' position of the sugar unit are set forth in FIG.
13A and consisted of the following: 2'-hydroxyl wild type (DS),
2'-deoxy modified as siRNAs (SS/AS-Deoxy), 2'-Fluoro U and C
modified as siRNAs (SS/AS-2'FU,FC), 2'-Fluoro U and C and 2'-deoxy
A and G at positions 9, 10, and 13 modified as siRNAs
(SS/AS-2'FU,FC+(9,10,13)dA, dG), 2'-Fluoro U and C and 2'-deoxy A
and G at positions 9-19 modified as siRNAs (SS/AS-2'FU,FC+(9-19)dA,
dG), 2'-Fluoro U and C and 2'-deoxy A and G at positions 1-13
modified as siRNAs (SS/AS-2'FU,FC+(1-13)dA, dG), and 2'-Fluoro U
and C and 2'-deoxy A and G modified as siRNAs (SS/AS-2'FU,FC, dA,
dG). The hypothetical cleavage site on the target mRNA is also
depicted. The data from cells treated with duplex siRNA with
modified antisense strands are set forth in FIG. 13B. A normalized
ratio of less than 1.0 indicates a specific RNA interference
effect. For comparison, results from unmodified duplex siRNA (ds,
lanes 2-6)-treated cells are included.
[0300] These data indicate that siRNA with 2'-Fluoro modifications
at uridine and cytidine (SS/AS-2'FU,FC, lanes 16-24) is as
effective as unmodified duplex siRNA in RNA interference,
indicating that 2'-OH is not required for siRNA to enter the RNAi
pathway. However, 2'-deoxy substitution in the antisense strand
completely bocked siRNA function (SS/AS-2' deoxy, lanes 7-15). In
general, mixing 2'-Fluoro modification with deoxy modification
could rescue siRNA function (FIG. 13B, lanes 25-60). When 2'FU, FC
nucleotides were incorporated into the EGFP siRNA anti-strand with
guanine and adenine deoxynucleotides at positions 9, 10, and 13,
which base pair with nucleotides lining the cleavage site, (FIG.
13A), EGFP RNAi effects were almost indistinguishable from wild
type levels (FIG. 13B, lanes 25-33; Table 1, row 5). In addition,
siRNAs that had the entire antisense strand replaced with 2'FU,
2'FC, dATP, and dGTP nucleotides still showed moderate levels of
RNAi activity at .about.42%, or .about.44% if the sense strand was
also modified with 2'FU, FC (FIG. 13B, lanes 52-60; Table 1, rows
7, 8).
[0301] FIG. 13C depicts siRNA duplexes with modifications in both
strands at the 2' position of the sugar unit, and consisted of the
following: 2'-hydroxyl wild type (DS, lanes 2-6), 2'-deoxy modified
as siRNAs (SS/AS-Deoxy, lanes 7-15), 2'-Fluoro U and C modified in
both strands (SS-2'FU,FC /AS-2'FU,FC, lanes 16-24), 2'-Fluoro U and
C modified in both strands and 2'-deoxy A and G at positions 9, 10,
and 13 within the antisense strand (SS-2'FU,FC
/AS-2'FU,FC+(9,10,13)dA, dG, lanes 25-33), 2'-Fluoro U and C
modified in both strands and 2'-deoxy A and G at positions 9-19
within the antisense strand (SS-2'FU,FC /AS-2'FU,FC+(9-19)dA, dG,
lanes 34-42), 2'-Fluoro U and C modified in both strands and
2'-deoxy A and G at positions 1-13 within the antisense strand
(SS-2'FU,FC /AS-2'FU,FC+(1-13)dA, dG, lanes 43-51), and 2'-Fluoro U
and C modified in both strands and 2'-deoxy A and G within the
antisense strand (SS-2'FU,FC /AS-2'FU,FC, dA, dG; lanes 52-60).
Results from cells treated with duplex siRNA with modifications in
both strands as set forth in FIG. 13C are depicted in FIG. 13D and
table 1, rows 6, 8, 30, 32.
[0302] All together, these results demonstrated that a 2'OH group
was not required for RNAi-mediated degradation and, even more
specifically, was not required for nucleotides base paired with
nucleotides lining the mRNA cleavage site. There was, however, a
limit on the extent to which deoxynucleotides could substitute for
ribonucleotides since replacing the entire siRNA sense strand with
deoxynucleotides decreased EGFP gene silencing to .about.38%
inhibition and replacing either the antisense strand or both
strands entirely with deoxynucleotides completely abolished EGFP
RNAi (see FIG. 10, FIG. 13 and Table 1, rows 9-11). Nonetheless,
these results collectively showed that nucleotides with either
2'F-- or 2'H groups can selectively replace ribonucleotides within
the siRNA sequence to effectively induce RNAi. These data also
further demonstrated that A form helix formed by pairing between
the antisense strand of siRNA and its target mRNA is required for
the RISC protein complex to recognize its target. Furthermore, the
data further demonstrated that the 2'OH is not required for the
RISC complex to cleave its target mRNA.
Example XIV
Quantitative Analysis of RNAi Effects of Duplex siRNAs with
N3-Methyl Uridine Modifications in HeLa Cells
[0303] Data set forth in Example V indicated that the A form helix
is required for the mechanism of RNAi, as 2 nt bulges that distort
A-form helices between antisense siRNAs and target mRNAs abolished
RNAi. To test whether the major groove of the A form helix was
required for RNAi, siRNAs were modified with N.sup.3-Methyl Uridine
(3MU) nucleotides that remove an H-bond donor at N.sup.3--H. The
structure of N.sup.3-Methyl-Uridine (3mU) is depicted in FIG. 14A.
Structurally, the bulky N.sup.3-Methyl group would jut into the
major groove of the A-form helix, potentially introducing sterical
clash between base pairs. In addition, the presence of 3MU in the
major groove may also introduce a steric clash between RNA and
RNA-interacting proteins (Saenger, 1984). Therefore, both steric
hindrance and the loss of an H-bond donor by the addition of the
N.sup.3-Methyl group should destabilize RNA-protein interactions in
the major groove.
[0304] pEGFP-C1 (as reporter), pDsRed2-N1 (as control) plasmids and
various amount of modified siRNA were cotransfected into HeLa cells
by lipofectamine. Cells were harvested at 42 h after transfection.
Fluorescence intensity of GFP and RFP in total cell lysates were
detected by exciting at 488 and 568 nm, respectively. The
fluorescence intensity ratio of target (GFP) to control (RFP)
fluorophore was determined in the presence of modified siRNAs and
normalized to the ratio observed in the mock treated cells. FIG.
14C depicts the results from cells treated with duplex siRNA having
3mU modifications within the entire antisense strand (SS/AS-3mU,
lanes 7-15), 3mU modifications within the entire antisense strand
and 2'-Fluoro modifications at uridine and cytidine bases within
the sense strand (SS-2'FU, FC/AS-3mU, lanes 16-24), and 3mU
modification at position 11 within the antisense strand
(SS/AS-(11)-3mU, lanes 25-33). The modified siRNA duplexes were
prepared by annealing modified antisense strand containing single
or multiple 3mU modifications with unmodified sense strand
(SS/AS-(11)-3mU and SS/AS-3mU) or sense strand having 2'-Fluoro
modifications (SS-2'FU, FC/AS-3mU). For comparison, results from
cells treated with unmodified duplex siRNA (ds, lane 2-6) are also
shown. 3MU modified EGFP siRNAs introduced into Hela cells
completely abolished RNAi (FIG. 14C, Table 1, rows 25). RNAi was
also abolished if only one 3MU modification was introduced
specifically at U11 of the antisense strand, which is one of the
nucleotides that base pairs with A248 of the target EGFP mRNA
cleavage site (FIGS. 14B and 14C, Table 1, row 26). These results
indicated that disrupting the functional groups of the major groove
of the A-form helix formed by the antisense strand and its target
mRNA specifically at the cleavage site inhibited RNAi. These data
also suggested that the major groove was required for mediating
RNAi and for RNA-RISC* interactions that subsequently lead to mRNA
cleavage.
Example XV
Structural Integrity of the 5' End of the Antisense Strand in
siRNA-mRNA Duplexes is More Important for Mediating RNAi than the
3' end
[0305] Data set forth in Example VII using psoralen photochemistry
suggested that complete unwinding of the siRNA duplex is not
required for RNAi in vivo because psoralen cross-linked siRNAs did
not completely abolish gene silencing. These results suggested that
a single cross-linking event occurring near the 3' end of the
antisense strand still allowed for the initial unwinding of duplex
siRNAs from the 5' end, freeing enough of the nucleotides in the
antisense strand to hybridize to the target mRNA and induce RNAi,
even if unwinding was not complete. The location of this
crosslinking site is indicated by a bar in FIG. 15A. If this were
the case, then unwinding of siRNAs must start from the 5' end of
the antisense strand, a conclusion supported by the fact that
blocking either the 3' end of the antisense siRNA strand or the 5'
end of the sense siRNA strand had no significant effect on RNAi
activity (see Examples III and IV). If this 5' to 3' unwinding
model was correct, sequences near the 3' end of the antisense siRNA
strand or 5' end of the sense siRNA strand should be changeable
without significantly interfering with RNAi.
[0306] This Example directly tests the model set forth above and
demonstrates an aysmmetric requirement for duplex siRNA structure
in RNA interference in vivo. To test this hypothesis, EGFP siRNAs
with mismatched base pairs at either the 5' (nt 1, 2) or 3' (nt 18,
19) ends were introduced into the antisense strand (FIG. 15B).
pEGFP-C1 (as reporter), pDsRed2-N1 (as control) plasmids and
various amount of modified siRNA were cotransfected into HeLa cells
by lipofectamine. Cells were harvested at 42 h after transfection.
Fluorescence intensity of GFP and RFP in total cell lysates were
detected by exciting at 488 and 568 nm, respectively. The
fluorescence intensity ratio of target (GFP) to control (RFP)
fluorophore was determined in the presence of modified siRNAs and
normalized to the ratio observed in the mock treated cells. FIG.
15C depicts results from cells treated with duplex siRNA having
mismatches located at the 3' end [SS/AS-(18,19)mm, lanes 7-14] or
5' end [SS/AS-(1,2)mm, lanes 15-22] of the antisense strand. For
comparison, results from unmodified duplex siRNA-treated cells are
also shown (ds, lane 2-6). siRNAs with mismatches near the 5' end
of the antisense strand showed only .about.35% inhibition in the
dual fluorescence reporter assay whereas mismatches at the 3' end
retained a significant level of gene silencing at .about.77% (FIG.
15C; Table 1, rows 27-28). These results strongly indicated that
the integrity at the 5' end of the antisense strand in the duplex
was functionally more important than the 3' end.
[0307] Further demonstrating this point are data set forth above in
Example XIII, wherein 2'FU, FC plus dATPs, dGTPs were incorporated
into the antisense strand siRNAs predominantly at the 5' end (nts
1-13) or predominantly at the 3' end (nts 9-19) (see FIG. 13C). In
the dual fluorescence reporter assay, predominantly 5' modified
antisense [AS-2'FU, FC+(1-13)dA, dG] EGFP siRNAs were only
moderately effective, inducing RNAi at .about.43%, or at 45% if the
sense strand was also modified to 2'FU, FC (see FIG. 13C, Table 1,
rows 29-30). However, predominantly 3' modified and 5' unmodified
antisense [AS-2'FU, FC+(9-19)dA, dG] siRNAs significantly induced
RNAi activity at .about.91%, or at 64% if the sense strand was also
modified to 2'FU, FC (see FIG. 13C, Table 1, rows 31-32). These
contrasting results suggested that the 5' region of the antisense
strand was more sensitive to modification than the 3' end. All
together, these data suggested that recognition of siRNA duplexes
by an as yet unidentified RNA helicase occurs asymmetrically with
the structure of the antisense 5' end of the duplex preferentially
distinguished from the 3' end during the initiation of
unwinding.
Example XVI
Modified siRNAs that Stabilize A-U Base Pair Interactions can
Induce RNAi
[0308] In addition to incorporating modifications that affected the
stability of siRNAs, nucleotides chemically modified to strengthen
the base pair interactions between two complementary bases were
analyzed. In theory, increasing the stability of base pair
interactions may increase the targeting efficiency of siRNAs to
target mRNA sequences. Increasing targeting efficiency may then
induce more robust RNAi effects with siRNAs that are weaker at
binding to their target sequence or have mismatched sequences, and
thus, are not showing a high degree of RNAi.
[0309] To bolster base pairing interactions, 5-Bromo-uridine
(U[5Br]), 5-Iodo-uridine (U[51]) or 2,6-Diaminopurine (DAP) (FIG.
19), which are modified nucleotides known to increase the
association constant between A-U base pairs (Saenger, 1984), were
incorporated into siRNAs and tested in the dual fluorescence report
assay. Double-stranded siRNAs having U[5Br], U[51] or DAP
modifications incorporated into the antisense strand were capable
of inducing RNAi activity at levels of .about.70% for U[5Br],
.about.59% for U[5I] and .about.51% for DAP (FIG. 16, Table 1, rows
19-21).
[0310] Interestingly, when 2'FU, FC stabilizing modifications in
the sense strand were combined with these modifications in the
antisense strand, gene silencing was not as efficient as wild type
in inducing RNAi. EGFP gene silencing was 31% for the 2'FU,
FC-modified sense siRNA base paired with U[5Br]-, .about.42% for
U[5I]-, or .about.35% for DAP-modified antisense siRNAs (Table 1,
rows 22-24). These results suggested that enhancing the
interactions between base pairs through these siRNA modifications
was a viable option for increasing mRNA targeting efficiency, but
that there was a limit to how stable the base pairing interactions
can be made before they interfere with siRNA unwinding.
Example XVII
Modified siRNAs Enter into the RNAi Pathway in HeLa Cell
Lysates.
[0311] Although the dual fluorescence reporter assay did detect
changes in EGFP gene expression with the modified siRNAs created
herein, it was possible that gene silencing was being induced by a
mechanism other than RNAi-mediated degradative pathways. This
Example demonstrates that modified siRNA enter into the RNA
interference pathway by using an in vitro RNAi assay. To test
whether the targeted mRNA was indeed being cleaved upon exposure to
modified siRNAs, an in vitro RNAi assay was performed to measure
the cleavage of a .sup.32P-cap labeled mRNA target upon incubation
with modified siRNAs and HeLa cytoplasmic extract. This in vitro
RNAi assay is well known in the art. Cleavage products were
resolved on an 8% polyacrylamide-7 M urea gel.
[0312] In this assay, 10 nM cap-labeled target RNA was incubated
with 100 nM siRNA having the following modifications within the
antisense strand: 2'-Fluoro U and C (SS/AS-2'FU,FC), 2'-Fluoro U
and C and 2'-deoxy A and G at positions 9, 10 and 13
(SS/AS-2'FU,FC+(9,10,13)dA,dG)), 2'-Fluoro U and C and 2'-deoxy at
each A and G (SS/AS-2'FU,FC+dA,dG), 2'-deoxy at each position
(SS/AS-2'-deoxy), 2'-OMe at each residue (SS/AS-2'-OMe), P--S at
each residue (SS/AS--P--S), 5-Bromo-uridine at each U
(SS/AS-U[5Br]), (5-Iodo-uridine at each U (SS/AS-U[5I]), DAP at
each purine (SS/AS-DAP), 3MU at each U (SS/AS-3MU), 3MU at position
11(SS/AS-91103MU), mismatches at position 1 and 2 (SS/AS-(1,2)mm),
mismatches at position 18 and 19 (SS/AS-(18,19)mm), 2'-Fluoro U and
C and 2'-deoxy A and G at positions 1-13
(SS/AS-2'FU,FC+(1-13)dA,dG), and 2'-Fluoro U and C and 2'-deoxy A
and G at positions 9-19 (SS/AS-2'FU,FC+(9-19)dA,dG). Reaction
products were resolved on an 8% polyacrylamide-7M urea gel.
[0313] Results from the assay are depicted in FIG. 17. The arrows
indicate the capped target RNA and the 5' cleavage product; the
resulting 3' fragment is unlabeled and is therefore invisible. Mock
treated mRNAs did not show an observable cleavage product (FIG. 17,
lane 1), but wild type and all modified siRNAs that displayed gene
silencing effects in vivo showed clearly visible cleavage products
in vitro (FIG. 17; lanes 2, 8-11,14-17). Furthermore, modified
siRNAs that did not show any marked gene silencing effects in vivo
did not show any distinct cleavage products in the in vitro assay
(FIG. 17; lanes 1, 6-7, 12-13), suggesting that the cleavage events
observed were specifically dependent on functional siRNAs. These in
vitro results provided a strong correlation between the in vivo
gene silencing observed with the modified siRNAs and target mRNA
degradation, indicating that the modified siRNAs were distinctly
targeting mRNAs for cleavage and subsequent degradation through the
in vivo RNAi pathway.
Summary of Examples VIII-XVII
[0314] By introducing various chemical modifications into siRNAs
and measuring their effects on RNAi, the above examples reveal new
insights into the mechanism of RNAi and teach new approaches for
increasing the efficacy of RNAi in vivo, e.g. in human cells.
[0315] The step-wise process of RNAi is depicted in FIG. 18. In the
first step of RNAi induction, the 5' ends of the siRNA duplex are
phosphorylated, resulting in the formation of a siRNA-RISC complex.
The data presented here showing the asymmetric nature of unwinding
then suggests an ATP-dependent event during which siRNA is unwound
from the 5' end of the antisense strand and RISC is activated.
Following RISC activation, the antisense strand of the unwound
siRNA guides the siRNA-RISC* complex to the target mRNA. The guide
antisense strand base pairs with the target mRNA, forming an A-form
helix and the RISC* protein complex recognizes the major groove of
the A-form helix, an event that occurs independently of the RNA
2'OH of the guide antisense siRNA. In the final step of this
process, the target mRNA is cleaved by RISC*, which is another
event that occurs independently of the 2'OH of the guide antisense
siRNA. RISC* is then recycled to catalyze another cleavage
event.
[0316] A. The Requirement for the A-Form Helix Supercedes the
Requirement for the 2'OH in RNAi
[0317] Several important mechanistic findings were presented here
that not only more clearly defined the mechanism of the RNAi
pathway, but will also increase the utility of RNAi in various
applications. That the 2'OH was not required for RNAi was the most
important of these results as this discovery has several important
implications for the structural and catalytic elements required for
the RNAi pathway. Remarkable functional implications were that the
RNAi machinery does not require the 2'OH for recognition of siRNAs
and the catalytic ribonuclease activity of RISC does not involve
2'OH groups of the guide antisense RNA. Another consequence of this
discovery was that a variety of chemical groups, including fluoro-
or deoxy-groups, could substitute for the 2'OH in siRNAs,
indicating that no distinguishing chemical specificity was required
for RNAi at the 2' position. These findings would suggest that
other properties of the siRNA-mRNA duplexes, such as core
structural elements, were essential for siRNA. If helical structure
was the key to RNAi induction, then the A-form helix that forms
between siRNAs and the target mRNA would indeed be required for
RNAi, as was previously shown (Chiu and Rana, 2002). Furthermore,
the 2' fluoro- or combined 2' fluoro-, deoxy modified antisense
siRNAs lacking the 2'OH would have to competently form an A-form
helix to induce RNAi as shown here. This will likely turn out to be
the case since 2' fluoro-modified RNA-RNA hybrids were previously
reported to exhibit an A-form helical conformation (Cummins et al.,
1995; Luy and Marino, 2001), lending significant merit to the idea
that helical structure strongly influences RNAi efficiency. Still
another implication of these particular results was that alternate
chemical groups at the 2' position that allow the A-form helix to
be retained but help siRNAs evade recognition by RNases can
increase siRNA stability and prolong RNAi effects induced in
vivo.
[0318] It was previously shown in C. elegans and Drosophila
extracts that completely substituting one or both siRNA strands
with deoxynucleotides abolished RNAi (Elbashir et al., 2001;
Parrish et al., 2000), and those observations were consistent with
the data presented here. The failure of true DNA-RNA hybrids to
induce RNAi most plausibly relates to the argument that structure,
and thus the A-form helix, was an essential determinant for RNAi
induction. Based on circular dichroism spectra, DNA-RNA hybrids
displayed characteristics that were intermediate between A- and
B-form helices (Cummins et al., 1995). Following the contention
that the A-form helix was an absolute requirement for RNAi
induction, 2' deoxy siRNA-mRNA target duplexes would not be
recognized by the RNAi machinery because they would not be forming
the proper A-form helical structure. Therefore, RNAi would not be
induced by DNA-RNA hybrids, as has been observed. It is also worth
mentioning that microRNAs (miRNAs) induce post-transcriptional gene
silencing (PTGS) through the same pathway as RNAi but ultimately,
only inhibit translation machinery instead of inducing RNA
degradation, the event that defines RNAi. The only observable
difference between the two mechanisms is that RNAi requires the
A-form helix but miRNA-induced PTGS does not, as miRNAs often
mismatch with their target mRNAs, forming a bulge that would
distort the helical structure. This would suggest that the
differences between the miRNA-induced silencing mechanism and
siRNA-mediated RNAi may solely be attributable to differences in
RNA-RNA helical structure, and further supported a model in which
helical structure was the sole determinant for whether RNAi was
induced.
[0319] It was also previously reported that replacement of uridine
with 2'FU, corresponding to 1/4 of the bases of long dsRNAs
elicited RNAi effects in C. elegans, while deoxycytodine
incorporated into long dsRNAs diminished RNAi effects (Parrish et
al., 2000). However, exactly where these modified nucleotides fell
within the sequence structure of RNAi-inducing siRNAs and whether
these modified nucleotides in the longer RNAs corresponded to the
mRNA cleavage site or major groove after being processed to siRNAs
was not clear. It has also been reported that siRNAs in which 3'
overhangs and two of the 3' end ribonucleotides were replaced with
deoxyribonucleotides retained RNAi activity upon exposure to
Drosophila extracts (Elbashir et al., 2001). Presumably, replacing
two of the 3' end base-paired nucleotides with deoxynucleotides
would not disrupt the overall A-form structure of the siRNA-mRNA
duplex required for RNAi and would thereby allow RNAi
induction.
[0320] Neither analyses in C. elegans or in Drosophila extracts
ascertained whether there was a distinct requirement for the 2' OH
for cleavage site recognition and the cleavage event itself during
RNAi induction. The results presented here demonstrated that
exclusively using 2'FU, FC modifications in siRNAs and selectively
substituting in deoxyribonucleotides for nucleotides base paired
with the nucleotides lining the mRNA cleavage site, or even
replacing the entire sequence of siRNA with a combination of 2'
fluoro- and 2' deoxy-nucleotides, elicited RNAi induction.
Therefore, it has now been definitively established that
recognition of the mRNA-target cleavage site and subsequent
cleavage did not require the 2'OH of the antisense siRNA to induce
RNAi. As a final point, the inhibitory RNAi effects seen with the
bulky 2'OMe modification, which was also shown previously with
Drosophila (Elbashir et al., 2001), did demonstrate that there were
steric constraints on the types of 2' modifications that would be
amenable for inducing RNAi. As 2'OMe modifications probably did not
disrupt the A-form helix of the siRNA-mRNA duplex (Cummins et al.,
1995), the methyl group may be sterically interfering with
protein-RNA interactions thereby preventing RNAi. Nevertheless,
steric constraints notwithstanding, this analysis conclusively
showed that the non-essential nature of the 2' position could very
much be exploited for improving the efficacy of RNAi in a variety
of applications.
[0321] B. Improving the Efficacy of RNAi using Chemical
Modifications
[0322] The chemical modifications analyzed improved upon the status
quo short-lived RNAi effects seen in vivo in human cells,
significantly increasing the duration of RNAi effects typically
observed. Modifications like the 2' fluoro- and P--S linkages both
increased the half-life of siRNAs upon exposure to cytoplasmic
extracts, and in vivo studies with 2'FU, FC siRNAs showed that
increasing the half life of siRNAs did in fact prolong the effects
of RNAi. This indicated that short-lived RNAi effects usually
observed in human cells were due at least in part to the
degradation of siRNAs. That the stabilizing siRNA modifications
still allowed for a substantial level of RNAi induction showed that
these modifications will be invaluable for studying the phenotypic
effects of prolonged gene-silencing in cell culture or in
increasing the long-term in vivo effects of siRNAs in clinical
applications. Interestingly, the P--S-modified, single-stranded
antisense strand did not show increased RNAi effects in the dual
fluorescence reporter assay used here (data not shown) despite
showing significantly increased stability (FIG. 3A (a)). This
suggested that stability was not the main reason why
single-stranded antisense RNAi was not as effective in inducing
RNAi as dsRNA. Nonetheless, creating P--S modifications in the
siRNA backbone showed that stabilizing the siRNA backbone did not
inhibit RNAi and signified that using chemical modifications that
stabilized phosphate linkages was a viable option for prolonging
RNAi effects.
[0323] Another option for increasing the efficacy of RNAi was
uncovered by the analysis of modifications that should enhance base
pairing interactions between antisense siRNA and targeted mRNA. DAP
is a naturally occurring nucleobase that sometimes replaces adenine
in phages like the cyanophage S-2L (Kimos et al., 1977).
Incorporation of DAP into RNA strands promotes the formation of
three Watson and Crick hydrogen bonds between DAP and uridine,
increasing the stability of interactions seen between A-U base
pairs (Luytena and Herdewijna, 1998). U[5Br] and U[5I] have also
been shown to have higher association constants when base paired to
A residues than unmodified uridine (Saenger, 1984). When any of
these modifications were incorporated into siRNAs, RNAi was still
quite efficient, indicating that modifications that stabilize base
pairing interactions can be used in designing siRNAs for various
applications. It was also notable that siRNAs with 2.degree.
Fluoro- modifications introduced into sense strands and base paired
with the DAP, U[Br] or U[5I] antisense strands had decreased RNAi
efficiency. 2' Fluoro- modifications have been shown to
significantly increase the melting temperature between base pairs
(Cummins et al., 1995). Consequently, the stabilizing effect on
base pairing interactions when both the 2' Fluoro- and DAP, U[Br]
or U[5I] modifications were present may have actually hindered the
unwinding of the siRNA duplex. If the unwinding of the siRNA was
hindered, then there would be less single antisense siRNAs
available to induce RNAi, accounting for the observed decrease in
RNAi activity.
[0324] C. Other Structural Determinants for RNAi Induction
[0325] Another structural facet of the RNAi mechanism was uncovered
using the 3MU modification which showed that the major groove of
the A-form helix was required for RNAi. This finding builds on
previous data showing that the A-form helix was required for RNAi
(Chiu and Rana, 2002). Together, these results suggested that the
specific structure of the A-form helical RNA that forms the major
groove and contains the mRNA cleavage site was important for
recognition by the RNAi machinery. Conceivably, RNA-RISC* contacts
depend on the structural integrity of the major groove for precise
interactions and ultimately, to initiate cleavage of the target. By
disrupting the major groove, RISC* may no longer be able to
interact or only weakly interacts with the siRNA-mRNA target duplex
thereby preventing mRNA cleavage. Alternatively, RISC* might still
be able to interact with the destabilized RNA helix but not
recognize the cleavage site within the major groove as the
catalytic site if the conformation of the RNA helix and more
specifically the major groove was altered.
[0326] The other structural property of siRNAs defined by these
analyses was the asymmetric nature of siRNA unwinding. Initiation
of siRNA unwinding from the 5' end was previously suggested from
the ability of single cross-linked siRNAs to still induce RNAi
(Chiu and Rana, 2002). Building on those studies by stacking
mismatched or modified nucleotides on either the 3' or 5' end of
the antisense strand to gauge the tolerance for mismatches or
modifications on one end over the other, it was shown here that
RNAi depended on the integrity of the 5', and not the 3', end of
the antisense strand of the siRNA duplex. These results suggested
that like RISC*, the RNA helicase, which has not yet been
identified, also recognizes structural properties of the siRNA
duplex as opposed to specific sequences of the RNA strands. This
recognition appears to be asymmetric with the structure of the
antisense 5' end favored over the 3' end, and is similar to how
restriction enzymes can preferentially cleave the DNA backbone
asymmetrically within a palindromic sequence. Further structural
analysis of siRNAs to pinpoint what properties of the antisense 5'
end contribute to the asymmetric nature of the duplex should help
elucidate the specific structural elements required for duplex
recognition by the RNA helicase for siRNA unwinding.
[0327] That the modified siRNAs displayed effective RNAi in vivo
and in vitro was also significant as it confirmed that the observed
gene silencing was mediated by the RNAi pathway. These results also
indicated that using chemical modifications that allow for
efficient RNAi induction should work in the design of any given
siRNA to increase its stability and capacity to specifically induce
RNAi in vivo.
Example XVIII
Peptide Modification f3' Termini of siRNA
[0328] Peptides can be linked to the 3' terminus of an siRNA. For
example, an siRNA containing NH.sub.2 groups at their 3' termini
can be synthesized using methods known in the art and as described
herein, thus producing, e.g., exocyclic amine on protected
nucleotides.
[0329] In an example of a peptide modification of a 3' terminus of
an siRNA, a Tat-derived peptide (from amino acids 47-57) was
synthesized on solid support (rink amide resin) using standard
FastMoc protocols. A cysteine residue was added to the amino
terminus of the peptide for conjugation to the RNA. All Fmoc-amino
acids, piperidine, 4-dimethylaminopyridine, dichloromethane,
N,N-dimethylforamide, 1-hydroxybenzotriazole (HOBT),
2-(1H-benzotriazo-1-yl)-1,1,3,3-tetramethy- luronium
hexafluorophosphate (HBTU), diisopropylethylamine, and HMP-linked
polystyrene resin were obtained from Applied Biosystems Division,
Perkin Elmer. Trifluoroacetic acid, 1,2-ethanedithiol, phenol,
thioanisol were from Sigma. Cleavage and deprotection of the
peptide was carried out in 2 ml of Reagent K for 6 hours at room
temperature. Reagent K contained 1.75 ml TFA, 100 .mu.L
thioanisole, 100 .mu.l water, and 50 .mu.l of ethanedithiol. After
cleavage from the resin, peptide was purified by HPLC on a Zorbax
300 SB.-C.sub.8 column. The mass of fully deprotected and purified
peptides was confirmed by FAB mass spectrometry.
[0330] siRNA containing 3'-end amino groups were synthesized.
NHS-ester-maleimide crosslinkers (Pierce) were used for conjugation
to Tat peptide (amino acids 48-57) and the conjugation reaction was
carried out according to the manufacturer's instructions. The NHS
ester moiety of the crosslinker was reacted with the RNA as
described herein. After purification on a C18 column, the
RNA-NHS-maleimide conjugate was added to the peptide that contains
Cys (0.1 M phosphate, pH 8, room temperature, 1 hour). Peptide-RNA
conjugate was purified on 7 M-urea denaturing gels.
[0331] Similar methods can be used to attached other compounds,
e.g., nanoparticle-RNA conjugates can be prepared using such
methods.
[0332] Transfection of the siRNA-peptides was carried out without
Lipofectamine.TM. or any other transfection reagents. Robust RNAi
activity was observed.
[0333] These data demonstrate that modification of the 3' terminus
of siRNA does not eliminate the ability of the siRNA derivative to
be effective for inhibiting expression of a targeted sequence.
Furthermore, such siRNA derivatives can be used directly for
transfection without the use of transfection reagents.
Example XIX
Photocleavable Biotin Modification of 3' Termini of siRNA
[0334] A novel photocleavable biotin was synthesized and attached
to the 3' terminus of an siRNA. Briefly, NHS esters of biotin (5
nmole) were conjugated to free amino groups at the 3'-end of an
siRNA duplex (1 nmole) in an aqueous solution (e.g., 0.1 M
phosphate buffer pH 8 at room temp for 1 hour). 3'-end amino RNA
was purchased from a commercial source (Dharmacon). RNA-biotin
siRNA was incubated with cell extracts and the RNA-protein complex
was isolated using avidin magnetic beads. After adding the mutant
competitive non-biotin RNA and followed by extensive washing,
RNA-protein complexes were released by long wave UV (360 nm)
treatment at room temperature. In previous methods, avidin beads
are heated with SDS to release proteins that also contain a large
number of bead-binding proteins. The present method allows the
isolation of specific siRNA-bound proteins. The structure of the
novel photocleavable biotin is shown in FIG. 20.
Experimental Procedures for Examples I-XIX
[0335] siRNA Preparation
[0336] 21-nucleotide RNAs were chemically synthesized as 2'
bis(acetoxyethoxy)-methyl ether-protected oligos by Dharmacon
(Lafayette, Colo.). Synthetic oligonucleotides were deprotected,
annealed and purified as described by the manufacturer. Successful
duplex formation was confirmed by 20% non-denaturing polyacrylamide
gel electrophoresis (PAGE). All siRNAs were stored in DEPC (0.1%
diethyl pyrocarbonate)-treated water at .about.80.degree. C. The
sequences of GFP or RFP target-specific siRNA duplexes were
designed according to the manufacturer's recommendation and
subjected to a BLAST search against the human genome sequence to
ensure that no endogenous genes of the genome were targeted.
[0337] Culture and Transfection of Cells
[0338] Hela cells were maintained at 37.degree. C. in Dulbecco's
modified Eagle's medium (DMEM, Invitrogen) supplemented with 10%
fetal bovine serum (FBS), 100 units/ml penicillin and 100 .mu.g/ml
streptomycin (Invitrogen). Cells were regularly passaged at
sub-confluence and plated 16 hr before transfection at 70%
confluency. Lipofectamine (Invitrogen)-mediated transient
cotransfections of reporter plasmids and siRNAs were performed in
duplicate 6-well plates as described by the manufacturer for
adherent cell lines. A transfection mixture containing 0.16-0.66
.mu.g pEGFP-C1 and 0.33-1.33 .mu.g pDsRed1-N1 reporter plasmids
(Clontech), various amounts of siRNA(1.0 nM-200 nM), and 10 .mu.l
lipofectamine in 1 ml serum-reduced OPTI-MEM (Invitrogen) was added
to each well. Cells were incubated in transfection mixture for 6
hours and further cultured in antibiotic-free DMEM. Cells were
treated under same conditions without siRNA for mock experiments.
At various time intervals, the transfected cells were washed twice
with phosphate buffered saline (PBS, Invitrogen), flash frozen in
liquid nitrogen, and stored at .about.80.degree. C. for reporter
gene assays.
[0339] In Vivo Fluorescence Analysis
[0340] pEGFP-C1, pDsRed1-N1 reporter plasmids and 50 nM siRNA were
cotransfected into HeLa cells by lipofectamine as described above
except that cells were cultured on 35 mm plates with glass bottoms
(MatTek Corporation, Ashland Mass.) instead of standard 6-well
plates. Fluorescence in living cells was visualized 48 hours post
transfection by conventional fluorescence microscopy (Zeiss). For
GFP and RFP fluorescence detection, FITC and CY3 filters were used,
respectively.
[0341] Dual Fluorescence Reporter Gene Assays
[0342] pEGFP-C1, pDsRed1-N1 reporter plasmids and 50 nM siRNA were
cotransfected into HeLa cells. EGFP-C1 encoded enhanced green
fluorescence protein (GFP), while DsRed1-N1 encoded red
fluorescence protein (RFP). Cells were harvested as described above
and lysed in ice-cold reporter lysis buffer (Promega) containing
protease inhibitor (complete, EDTA-free, 1 tablet/10 ml buffer,
Roche Molecular Biochemicals). After clearing the resulting lysates
by centrifugation, protein in the clear lysate was quantified by Dc
protein assay kit (Bio-Rad). 120 .mu.g of total cell lysate in 160
.mu.l reporter lysis buffer was measured by fluorescence
spectrophometry (Photo Technology International). The slit widths
were set at 4 nm for both excitation and emission. All experiments
were carried out at room temperature. Fluorescence of GFP in cell
lysates was detected by exciting at 488 nm and recording from
498-650 nm. The spectrum peak at 507 nm represents the fluorescence
intensity of GFP. Fluorescence of RFP in the same cell lysates was
detected by exciting at 568 nm and recording from 588 nm-650 nm;
the spectrum peak at 583 nm represents the fluorescence intensity
of RFP. The fluorescence intensity ratio of target (GFP) to control
(RFP) fluorophore was determined in the presence of siRNA duplex
and normalized to that observed in the presence of antisense strand
siRNA. Normalized ratios less than 1.0 indicate specific
interference.
[0343] Improved Dual Fluorescence Assay
[0344] HeLa cells were maintained at 37.degree. C. in Dulbecco's
modified Eagle's medium (DMEM, Invitrogen) supplemented with 10%
fetal bovine serum (FBS), 100 units/ml penicillin, and 100 .mu.g/ml
streptomycin (Invitrogen). Cells were regularly passaged at
subconfluence and plated 16 hr before transfection at 70%
confluency. Lipofectamine (Invitrogen)-mediated transient
cotransfections of reporter plasmids and siRNAs were performed in
duplicate 6-well plates. A transfection mixture containing 0.16
.mu.g pEGFP-C1 and 0.33 .mu.g pDsRed2-N1 reporter plasmids
(Clontech), various amount of siRNA (From 0.5 nM to 400 nM), and 10
.mu.l lipofectamine in 1 ml serum-reduced OPTI-MEM (Invitrogen) was
added to each well. Cells were incubated in transfection mixture
for 6 hr and further cultured in antibiotic-free DMEM. Cells were
treated under the same conditions without siRNA for mock
experiments. At various time intervals, the transfected cells were
washed twice with phosphate-buffered saline (PBS, Invitrogen),
flash frozen in liquid nitrogen, and stored at -80.degree. C. for
reporter gene assays.
[0345] In improved dual fluorescence reporter assay, EGFP-C1
encoded enhanced green fluorescence protein (GFP), while DsRed2-N1
encoded red fluorescence protein (RFP2). Cells were lysed in
ice-cold reporter lysis buffer (Promega) containing protease
inhibitor (complete, EDTA-free, 1 tablet/10 ml buffer, Roche
Molecular Biochemicals). After clearing the resulting lysates by
centrifugation, protein in the clear lysate was quantified by Dc
protein assay kit (Bio-Rad). 240 .mu.g of total cell lysate in 160
.mu.l reporter lysis buffer was measured by fluorescence
spectrophotometry (Photo Technology International). The slit widths
were set at 4 mn for both excitation and emission. All experiments
were carried out at room temperature. Fluorescence of GFP in cell
lysates was detected by exciting at 488 nm and recording from
498-650 nm. The spectrum peak at 507 nm represents the fluorescence
intensity of GFP. Fluorescence of RFP2 in the same cell lysates was
detected by exciting at 568 nm and recording from 588 nm-650 nm.
The spectrum peak at 583 nm represents the fluorescence intensity
of RFP2. The fluorescence intensity ratio of target (EGFP) to
control (RFP2) fluorophore was determined in the presence of siRNA
duplex and normalized to that observed in the mocked treated cells.
Normalized ratios less than 1.0 indicates specific
interference.
[0346] Western Blotting
[0347] Cell lysates were prepared from siRNA-treated cells and
analyzed as described above. Proteins in 30 .mu.g of total cell
lysate were resolved by 10% SDS--PAGE, transferred onto a
polyvinylidene difluoride membrane (PVDF membrane, Bio-Rad), and
immunoblotted with antibodies against EGFP and DsRed1-N1
(Clontech). For loading control, the same membrane was also blotted
with anti-actin actibody (Santa Cruz). Protein content was
visualized with a BM Chemiluminescence Blotting Kit (Roche
Molecular Biochemicals). The blots were exposed to x-ray film
(Kodak MR-1) for various times (between 30 s and 5 min).
[0348] Psoralen Photocross-Link of siRNA Duplex
[0349] 40 .mu.g of siRNA duplex was incubated with 132 .mu.M of a
psoralen derivative, 4'-hydroxymethyl-4,5',8-trimethylpsoralen
(HMT) in 200 .mu.l DEPC-treated water at 30.degree. C. for 30 min.
Mixtures of siRNA duplex and HMT were exposed to UV 360 nm at
4.degree. C. for 20 min, then denatured by mixing with 400 .mu.l
formamide/formaldehyde (12.5:4.5) RNA loading buffer and heating at
95.degree. C. for 15 min. Cross-linked siRNA duplex and
noncross-linked siRNA were resolved by 20% PAGE containing 7M urea
in Tris-borate-EDTA. Cross-linked siRNA duplexes appeared as a
population with retarded electrophoretic mobility compared to the
noncross-linked species. RNAs were cut from the gel and purified by
C18 reverse phase column chromatography (Waters). Purified
cross-linked dsRNA and noncross-linked dsRNA were used in dual
fluorescence reporter assays as described above, except that all
procedures were performed in the dark to avoid light effects on
psoralen. To ensure that the cross-link depended on the presence of
psoralen, part of the UV 360 nm-treated mixture was also subjected
to UV 254 nm at 4.degree. C. for 20 min. Photoreverse-cross-linked
siRNA migrated in 20% polyacrylamide-7 M urea gels with similar
mobility to the siRNA duplex without HMT treatment.
[0350] Biotin Pull Out Assay for siRNA Isolation from Human
Cells
[0351] Antisense strands of the siRNA duplex were chemically
synthesized and biotin-conjugated at the 3' end (Dharmacon,
Lafayette, Colo.). Synthetic oligonucleotides were deprotected and
annealed with the unmodified sense strand RNA to form duplex siRNA
(ss/as3'-Biotin). HeLa cells, which had been plated at 70%
confluency in 100 mm dishes, were cotransfected with duplex siRNA
(.about.600 pmole) and EGFP-C1 plasmid (1 .mu.g) by a
lipofectamine-mediated method as described above. At various times,
the transfected cells were washed twice with PBS (Invitrogen) and
flash frozen in liquid nitrogen. Low molecular weight RNA was
isolated from the cells using a Qiagen RNA/DNA mini kit.
Biotinylated siRNA was pulled out by incubating purified RNA with
streptavidin-magnetic beads (60 .mu.l) in TE buffer (10 mM
Tris-HCl, pH 8.0, 1 mM EDTA) containing 1 M NaCl at room
temperature for 3 h. The beads were washed 4 times with 200 .mu.l
TE buffer, resuspended in 100 .mu.l TE buffer and split into two
equal aliquots. To one aliquot (50 .mu.l), we added 50 units of
shrimp alkaline phosphatase (SAP, Roche Molecular Biochemicals) in
1.times. SAP buffer and incubated at 37.degree. C. for 1 h. The SAP
reaction was then stopped by heating at 65.degree. C. for 15 min
and washed 4 times with 200 .mu.l TE buffer. The other aliquot was
not treated with SAP. Aliquots of beads with or without SAP
treatment were incubated with 30 units T4 polynucleotide kinase (T4
PNK, Roche Molecular Biochemicals) in 30 .mu.l 1.times. PNK buffer
containing 0.2 mCi .gamma.-.sup.32P ATP at 37.degree. C. for 1 h.
RNA products were resolved on 20% polyacrylamide-7M urea gels and
.sup.32P-labeled RNAs were detected by phosphorimaging.
[0352] Study of Duplex siRNA Stability in HeLa Cell Lysate
[0353] Unmodified or modified EGFP antisense strand siRNA were
5'-labeled with [gamma-32P] ATP (3000 ci/mM, ICN) by T4
polynucleotide kinases (New England Biolabs) at 37 C for 1 h and
chase-kinased by adding 1 mM ATP at 37 C for 15 min. Free ATP and
Kinase enzyme were removed by Qiagen nucleotide removal kit. Duplex
siRNA were formed by annealing equal molar ratio of unmodified or
modified sense strand siRNA with the 5'-32P labeled antisese
strand. Duplex formation was confirmed by 20% polyacrylamide gel
under native condition. 50 pmole duplex siRNA which labeled at 5'
end of the antisense strand were incubated with 500 ug HeLa
cytoplasmic extract in 50ul reaction mixture containing 20 mM
Hepes, pH 7.9, 100 mM KCl, 10 mM NaCl, 2 mM MgCl 2, 10% glycerol.
At various time points, 8 .mu.l aliquots were mixed with 16 .mu.l
loading buffer (0.01% bromophenol blue, 0.01% xylene cyanol, 98%
formaldehyde and 5 mM EDTA). The products were then denatured by
heating at 95 C for 10 min and analyzed on 20% polyacrylamide gel
containing 7M Urea followed by phosphorimage analysis (Fugi).
[0354] Preparation of HeLa Cell Cytoplasmic Extract
[0355] HeLa cell cytoplasmic extract was prepared following the
Dignam protocol for isolation of HeLa cell nuclei (Dignam et al.,
1983). The cytoplasmic fraction was dialysed against cytoplasmic
extract buffer (20 mM Hepes, pH 7.9, 100 mM KCI, 200 .mu.M EDTA,
500 .mu.M DTT, 500 .mu.M PMSF, 2 mM MgCl.sub.2 10% glycerol). The
extract was stored frozen at -70.degree. C. after quick-freezing in
liquid nitrogen. The protein concentration of HeLa cytoplasmic
extract varied between 4 to 5 mg/ml as determined by using a BioRad
protein assay kit.
[0356] Preparation of Cap-Labeled Target RNA
[0357] For mapping of the target RNA cleavage, a 124 nucleotide
transcript was generated corresponding to the EGFP between
positions 195 and 297 relative to the start codon followed by the
21 nucleotide complement of the SP6 promoter sequence. The 124
nucleotide transcript was amplified from template EGFP-C1 by PCR
using the 5' primer, GCCTAATACGACTCACTATAGGA- CCTACGGCGTGCAGTGC (T7
promoter underlined), and the 3' primer,
TTGATTTAGGTGACACTATAGATGGTGCGCTCCTGGACGT (SP6 promoter underlined).
The his-tagged mammalian capping enzyme was expressed in E. coli
from a plasmid generously provided by Dr. Stewart Shuman and was
purified to homogeneity. Guanylyl transferase labeling was
performed by incubating 1 nmole transcript with 100 pmole
his-tagged mammalian capping enzyme in a 100 .mu.l capping reaction
containing 50 mM Tris-HCI (pH 8.0), 5 mM DTT, 2.5 mM MgCl.sub.2,
1U/1 RNasin Rnased inhibitor (promega) and [.alpha.-.sup.32P]GTP at
37.degree. C. for 1 hr. The reaction was chased for 30 minutes by
supplementing with unlabeled GTP to a concentration of 100 .mu.M.
Cap-labeled target RNA was resolved on a 10% polyacrylamide-7M urea
gel and was purified.
[0358] In Vitro Target RNA Cleavage Assay
[0359] siRNA-mediated target RNA cleavage in human cytoplasmic
extract was performed as described (Martinze et al., 2000, Cell
110-563) with some modifications. Cap-labeled target RNA of 124nt
was generated as set forth above. siRNA duplex was preincubated
with HeLa cytoplasmic extract for 15 minutes at 37.degree. C. prior
to addition of cap-labeled target RNA. After addition of all
components, final concentrations were 100 nM siRNA, 10 nM target
RNA, 1 mM ATP, 0.2 mM GTP, 1 U/.mu.l RNasin, 30 .mu.g/ml creatine
kinase, 25 mM creatine phosphate, and 50% S100 extract. The
cleavage reactions were further incubated for 1.5 hours and then
stopped by the addition of 8 volumes of proteinase K buffer (200 nM
Tris-HCI [pH 7.5], 25 mM EDTA, 300 mM NaCl, and 2% w/v SDS).
Proteinase K (dissolved in 50 mM Tris-HCI [pH 8.0], 5 mM
CaCl.sub.2, and 50% glycerol) was added to a final concentration of
0.6 mg/ml. Reactions were extracted with phenol/chloroform/isoamyl
alcohol (25:24:1) followed by choloroform alone, and RNA was
precipitated with three volumes of ethanol. Samples were separated
on 8% polyacrylamide-7M Urea gels.
Example XX
Specific Silencing of P-TEFb Expression by siRNA in HeLa Cells
[0360] RNAi was used to inhibit hCycT1 and CDK9 expression in
cultured human (HeLa) cell lines. The short interfering RNA (siRNA)
sequence targeting hCycT1 was from position 347 to 367 relative to
the start codon, and the CDK9 siRNA sequence was from position 258
to 278 relative to the start codon. Using lipofectamine, HeLa cells
were transfected with hCycT1 or CDK9 siRNA duplex, targeting either
hCycT1 or CDK9. To analyze RNAi effects, lysates were prepared from
siRNA duplex-treated cells at various times after transfection.
Western blot experiments were carried out using anti-hCycT1 and
anti-CDK9 antibodies. Briefly, HeLa cells were transfected with
double-stranded (ds) siRNAs targeting RFP, hCycT1, or CDK9. Cells
were also transfected with mutant siRNAs (hCycT1 mismatch or CDK9
mismatch) having 2 nucleotide mismatches between the target mRNA
and the antisense strand of siRNA at the hypothetical cleavage site
of the mRNA. Cells were harvested at various times post
transfection, their protein content resolved on 10% SDS--PAGE,
transferred onto PVDF membranes, and immunoblotted with antibodies
against hCycT1 and CDK9. Analysis of immunoblotting experiments
reveals that the siRNA targeting hCycT1inhibited hCycT1 protein
expression. siRNA targeting CDK9 was similarly specific against
CDK9 expression. This RNAi effect depended on the presence of a
21-nt duplex siRNA harboring a sequence complementary to the target
mRNA, but not on single stranded antisense strand siRNAs nor on an
unrelated control siRNA, which targeted a coral (Discosoma
spp.)-derived red fluorescent protein (RFP). As a specificity
control, cells were also transfected with mutant siRNAs (mismatched
siRNA) of hCycT1 or CDK9, which have two nucleotide mismatches
between the target mRNA and the antisense strand of siRNA at the
putative cleavage site of the mRNA. Mutant siRNAs showed no
interference activity, indicating the specificity of the RNAi
effect. Thus, the siRNAs of the present invention specifically
silence the subunits of P-TEFb in HeLa cells.
Example XXI
Specific Silencing of P-TEFb by siRNA at the mRNA Level and
Stability of CDK9
[0361] To determine the specificity of P-TEFb knockdown by siRNA at
the mRNA level, RT-PCR was performed to reveal the effect of siRNA
on the level of mRNA involved in P-TEFb expression. Briefly, HeLa
cells were transfected with hCyCT1 ds siRNA and CDK9 ds siRNA,
harvested at various times after transfection and mRNAs extracted.
One-step RT-PCR was performed, setting the specific primer for
hCyCT1 and CDK9 amplification. RT-PCR products were resolved in 1%
agarose gel and viewed by ethidium bromide staining. Transfection
of cells with siRNA duplex targeting hCyCT1 (hCyCT1 ds)
significantly reduced hCyCT1 expression, but had no effect on CDK9
mRNA.
[0362] On the other hand, transfection of cells with siRNA duplex
targeted to CDK9 (CDK9 ds) significantly interfered with the
expression of CDK9, but not hCycT1. These results suggested that
hCyCT1 knockdown did not result in decreased transcription of CDK9
mRNA. The siRNA duplex started to cause an RNAi effect as early as
6-18 hours post transfection and gradually increased with time,
peaking at 30 h, and decreased between 54-66 h. The time-dependent
effect of siRNA indicates that siRNAs need to be processed or
assembled into an active complex with cellular factors for
effective RNA interference. A time lag was also seen between the
degradation of target mRNA (starting at 6 hours post siRNA
transfection, as shown by semi-quantitative RT-PCR) and the
half-life of the existing protein expressed by the target gene,
because protein levels did not show any down-regulation until 18-30
hours post siRNA transfection. Combined with Western blot analysis,
semi-quantitative RT-PCR not only confirms the specific knockdown
of P-TEFb by siRNA at the mRNA level, but also suggests that
forming a complex with hCyCT1 is a prerequisite for maintaining the
stability of CDK9 proteins in living cells. Thus, hCycT1 siRNA
down-regulated hCyCT1 levels by the RNAi pathway, while
down-regulating CDK9 levels by promoting its degradation without
affecting its gene expression at the mRNA level. This indicates
that the use of hCyCT1 siRNA, even without added CDK9 siRNA, is
able to down regulate both P-TEFb and CDK9 activity.
Example XXII
hCyCT1 and CDK9 Knockdown are Not Lethal to Human Cells
[0363] To analyze the viability of cells subjected to P-TEFb gene
silencing, a pEGFP-C1 reporter plasmid, harboring enhanced green
fluorescent protein [GFP] under the cytomegalovirus (CMV) immediate
early promoter, plus hCycT1 and CDK9 siRNAs were co-transfected
into HeLa cells using lipofectamine. Briefly, HeLa cells were
cotransfected by Lipofectamine.TM. with pEGFP-C1 reporter (GFP)
plasmid and siRNAs. Four siRNA duplexes, including a control duplex
targeting RFP and three duplexes targeting hCycT1, CDK9, and CDK7,
were used in these experiments. Reporter gene expression was
monitored at 50 hours post transfection by fluorescence imaging in
living cells. Cellular shape and density were recorded by phase
contrast microscopy. Reporter gene (GFP) expression, driven by
cytomegalovirus (CMV) immediate early promoter, was monitored in
living cells. Cellular morphology and density were monitored by
phase contrast microscopy. GFP expression was not affected by
hCyCT1 or CDK9 knockdown. Cells with P-TEFb knockdown had normal
shape and growth rate. At 50 hours post transfection, cell density
reached .about.90% to 100% confluency.
[0364] For comparison, cells were transfected with siRNA targeting
CDK7, a well-characterized kinase required for TFIIH, an essential
transcription factor, to phosphorylate the CTD of RNA pol II at the
step of promoter clearance during initiation of transcription.
Kin28, a protein in Saccharomyces cerevisiae that is equivalent to
CDK7 in mammals, is an essential gene product that phosphorylates
Ser5 of the CTD YSPTSPS repeat region (Komarnitsky et al. (2000),
Genes Dev., 14, 2452-2460; Rodriguez et al. (2000), Mol. Cell.
Biol., 20, 104-112; Schroeder et al. (2000), Genes & Dev., 14,
2435-2440) and is required to recruit the mRNA capping enzyme to
the transcription machinery (Cho et al. (1997), Genes & Dev.,
11, 3319-3326; McCracken et al. (1997), Genes & Dev., 11,
3306-3318; McCracken et al. (1997), Nature, 385, 357-361; Yue et
al. (1997), Proc. Natl. Acad. Sci. USA, 94, 12898-12903). CDK7 is a
bifunctional enzyme in larger eukaryotes, promoting both CDK
activation and transcription (Harper and Elledge. (1998), Genes
& Dev., 12, 285-289). As expected, reduction of CDK7 levels by
RNAi led to a lower reporter (GFP) expression and an arrest in
cellular growth (FIG. 4, panel d). CDK7 knockdown cells were
smaller than control cells and showed blebbing (FIG. 4, panel h),
indicating that unlike RNAi of P-TEFb, CDK7 gene silencing had an
adverse affect on transcription, cell morphology and cell
growth.
[0365] Cellular viability was next analyzed under various siRNA
treatments. At various times after transfection, cell viability was
assessed by trypan blue exclusion (see below). Briefly, HeLa cells
were cotransfected by Lipofectamine.TM. with pEGFP-C1 reporter
(GFP) plasmid and siRNAs (see Experimental Procedures). Four siRNA
duplexes, including a control unrelated duplex and three duplexes
targeting hCyCT1, CDK9, and CDK7, were used in these experiments.
At various times after transfection, cells floating in the medium
were collected and counted in the presence of 0.2% trypan blue (see
Experimental Procedures). Cells that took up dye (stained blue)
were not viable. Over a 66 hours time course experiment, the rate
of cell death in P-TEFb (hCyCT1 or CDK9) knockdown cells was
comparable to that in control cells with unrelated siRNA treatment,
while CDK7 knockdown cells showed a significant increase in cell
death. These results indicate that P-TEFb knockdown is not lethal
to human cells, while a much more stringent threshold for CDK7 is
required to maintain cell viability and growth.
Example XXIII
hCyCT1 and CDK9 RNAi Inhibit HIV-1 Tat Transactivation in Human
Cells
[0366] A dominant paradigm for Tat up-regulation of HIV gene
expression at the level of transcription elongation revolves around
the ability of the Tat-TAR RNA complex to bind to P-TEFb and
stimulate phosphorylation of the CTD and Spt5, thereby overriding
the elongation arrest elicited by DSIF and NELF (Ping and Rana,
2001, supra; Price, 2000, supra). To test whether siRNAs that
targeted sequence elements of P-TEFb would specifically block Tat
transactivation, Magi cells were cotransfected with the Tat
expression construct pTat-RFP and hCyCT1 or CDK9 ds siRNA or as
controls, antisensehCyCT1 or CDK9 siRNA, mutant hCyCT1 or CDK9
siRNA, or non-P-TEFb duplex siRNA. Magi, a HeLa cell line harboring
a single copy of persistently transfected HIV-1
LTR-.beta.-galactosidase gene, is programmed to express the CD4
receptor and the CCR5 coreceptor for HIV-1, making them a model
cell line for measuring HIV replication (Kimpton and Emerman, 1992,
supra). It was confirmed that the HIV-1 Tat-RFP fusion protein was
expressed under control of the CMV early promoter in all
transfected cells by Western blot, using anti-RFP antibody.
[0367] Tat-RFP strongly enhanced .beta.-galactosidase gene
expression, which is under control of the HIV-1 LTR promoter in
transfected Magi cells. Tat transactivation was determined by
calculating the ratio of .beta.-galactosidase activity in pTat-RFP
transfected cells to the activity in cells without pTat-RFP
treatment. Inhibitory activity was determined by normalizing
Tat-transactivation activity to the amount of Tat-RFP protein
(represented by RFP fluorescence intensity as described in
Experimental Procedures) in the presence and absence of siRNA.
Briefly, twenty-four hours after pre-treating Magi cells with
siRNA, they were cotransfected with pTat-RFP plasmid and various
siRNAs. Cells were harvested 48 h post pTat-RFP transfection, and
activity of .beta.-galactosidase in clear cell lysates was measured
(see Experimental Procedures). Magi cells were cotransfected with
ds siRNAs targeting hCyCT1 and CDK9, with antisense (as) RNA
strands, or mutant (mm) siRNAs. GFP ds siRNA was used as an
unrelated control siRNA, while Tat ds siRNA, targeting the mRNA
encoding Tat sequence, was used as a positive control. Means.+-.SD
of two experiments are shown. Under standard experimental
conditions, Tat-RFP enhanced gene transactivation 20- to 25-fold.
This activation was strongly inhibited by cotransfecting host Magi
cells with the specific ds siRNAs targeting hCyCT1 and CDK9, but
not with antisense (as) RNA strands, mutant (mm) siRNAs or an
unrelated control siRNA.
[0368] Specific RNA interference with hCyCT1 and CDK9 expression in
Magi cells was demonstrated by Western blot analysis. Briefly, Magi
cells were co-transfected with pTat-RFP plasmid and various siRNAs.
Cells were harvested at 48 hours post transfection, resolved on 10%
SDS--PAGE, transferred onto PVDF membranes, and immunoblotted with
antibodies against hCyCT1 and CDK9. RNAi activities in Magi cells
treated with antisense (as) strands of hCyCT1 and CDK9 siRNAs,
cells treated with ds siRNA targeting hCyCT1 and CDK9, cells
treated with mutant hCyCT1 siRNA (hCyCT1 mm) or mutant CDK9 siRNA
(CDK9 mm) were examined. GFP ds siRNA was used as an unrelated
control, while Tat ds RNAi was used to target mRNA encoding Tat.
The inhibition of Tat transactivation correlated well with the
knockdown of hCycT1 and CDK9 protein levels by the hCyCT1 and CDK9
siRNAs. Syncytia formation and LTR activation were reduced in hCycT
1 ds siRNA-treated cells. From these results, it can be concluded
that siRNA targeting P-TEFb can inhibit Tat-transactivation in
human cells without affecting cellular viability, thus making siRNA
targeting P-TEFb an excellent candidate for treatment of patients
infected with HIV.
Example XXIV
hCyCT1 and CDK9 RNAi Inhibit HIV-1 Infectivity
[0369] The next question addressed was whether targeting the human
P-TEFb complex by RNAi inhibited HIV replication. To investigate
this question, HeLa-CD4-LTR/.beta.-galactosidase (Magi) cells were
transfected with homologous and mismatched siRNAs directed against
hCyCT1 or CDK9 and 16 hours later infected the Magi cells with
various concentrations of HIV.sub.NL-GFP, an infectious molecular
clone of HIV-1. HIV-1 Tat-mediated transactivation of the LTR led
to .beta.-galactosidase production that was quantified 36 hours
post-infection. Briefly, LTR/.theta.-galactosidase (Magi) cells
transfected with homologous and mismatched siRNAs directed against
CycT1or CDK9. Cells were also mock transfected without siRNA or
transfected with an unrelated ds siRNA against the RFP sequence.
Sixteen hours later, cells were infected with NL-GFP, an infectious
molecular clone of HIV-1. Cells infected with virus and not treated
with oligofectamine were examined. HIV-1 Tat-mediated
transactivation of the LTR led to .theta.-galactosidase production,
which was quantified 36 hours post-infection. Cells treated with ds
siRNA targeting GFP-Nef and targeting the mRNA encoding Tat
sequence served as positive controls. These controls previously
showed decreased levels of .beta.-galactosidase activity and viral
infectivity (Jacque et al. 2002 Nature 418:435-8).
[0370] ds siRNA directed against hCycT1 or CDK9 inhibited viral
infectivity. Doubling dilutions of the inoculums are consistent
with an 8-fold decrease in viral infectivity. Control experiments
using siRNA duplexes containing mismatched sequences (see
Experimental Procedures) and an unrelated ds siRNA against the RFP
sequence showed no antiviral activities. Consistent with our
previous results (Jacque et al., 2002, supra), siRNA targeting
GFP-Nef and Tat led to an 8-fold decrease in viral infectivity. No
significant toxicity or cell death was observed during these
experiments, suggesting further that P-TEFb knockdown was not
lethal. These results demonstrate that HIV infectivity can be
modulated by siRNAs targeting CycT1or CDK9, both components of
P-TEFb, indicating that the use of siRNA targeting either subunit
is a viable treatment for patients with HIV.
Example XXV
Method of Treating Cancer by Inhibiting P-TEFb
[0371] An intriguing finding is that genes linked to embryonic
development and showing down-regulation in P-TEFb knockdown cells
(as described above) also participate in tumorogenesis and
metastasis. Dysfunction of protein tyrosine kinases or aberrations
in key components of the signaling pathways they activate can lead
to severe pathologies such as cancer, diabetes and cardiovascular
disease. For example, overexpression of EGFR has been implicated in
mammary carcinomas, squamous carcinomas and glioblastomas
(Schlessinger (2002), Cell, 110, 669). AXL, another receptor
tyrosine kinase, was originally identified with oncogenic potential
and transforming activity in myeloid leukemia cells (Burchert et
al. (1998), Oncogene, 16, 3177-3187). Elevated TGF-beta levels can
contribute to tumor progression and metastasis (Attisano and Wrana,
2002, supra; Massague, 2000, supra). Lysyl oxidase (LOX class II),
an extracellular matrix remodeling enzyme, is up-regulated in
prostatic tumor, cutaneous and uveal cell lines (Kirschmann et al.
(2002), Cancer Res., 62, 4478-4483). Down-regulating these genes by
P-TEFb knockdown using siRNA targeting CDK9 or CycT1 thus provides
a new therapeutic strategy for inhibiting tumorigenesis and
metastasis.
[0372] Genes involved in mediating progression through the cell
cycle and as checkpoints in cancer were regulated by P-TEFb. Cyclin
G1 is the downstream target of the P53 pathway and plays a role in
G2/M arrest, damage recovery and growth promotion after cellular
stress (Kimura et al. (2001), Oncogene, 20, 3290-3300). Cyclin D, a
cell-cycle regulatory protein essential for G1/S transition, has
been identified as a potential transforming gene in lymphoma
(Motokura and Arnold (1993), Curr. Opin. Genet. Dev., 3, 5-10).
Misregulation of the activity of its partner, CDK4/6, by
overexpression of Cyclin D leads to hyperproliferative defects and
tumor progression (Ortega et al. (2002), Biochim. Biophys. Acta,
1602, 73-87). Several marker genes in cancer cells (class V) are
also regulated by P-TEFb. For example, breast cancer-specific
protein 1 (BCSG1) is overexpressed in advanced, infiltrating breast
cancer and colorectal tumors (Lu et al. (2001), Oncogene, 20,
5173-5185). Another example is soluble urokinase plasminogen
activator receptor (SUPAR), which is present in high concentrations
in cystic fluid form ovarian cancer, tumor tissue of primary breast
cancer, and gynecological cancer (Riisbro et al. (2002), Clin.
Cancer. Res., 8, 1132-1141; Wahlberg et al. (1998), Cancer Res.,
58, 3294-3298). Although the functions of these marker genes are
still unknown, their high correlation with cancer has been used for
prognosis in cancer therapy. The down-regulation of cyclin D and
cancer marker genes by P-TEFb knockdown offers a method of cancer
therapy. Briefly, a therapeutically effective amount of one of more
of the pharmaceutical compositions of the invention is administered
to a patient having a disorder characterized by unwanted or
aberrant cellular proliferation as described herein.
Example XXVI
Specific Silencing of P-TEFb In Vivo
[0373] The effect of downregulating P-TEFb in vivo is assayed by
administering siRNA targeted to CDK9 and/or CyCT1 in an animal
model. Any appropriate animal model can be used, for example,
including but not limited to, rodent cancer models such as those
available from the Mouse Models of Human Cancers Consortium (MMHCC)
Repository (NCI, Frederick, Md.); the Oncomouse.TM. as described in
U.S. Pat. Nos. 4,736,866, 5,087,571 and 5,925,803 (Taconic); or
rodent or non-human primate models of HIV infection, such as the
SCID-hu mouse.
[0374] For example, in a mouse model, the siRNA is administered
using hydrodynamic transfection as previously described (McCaffrey,
2002, supra; Liu, 1999, supra), by intravenous injection into the
tail vein (Zhang, 1999, supra); or by viral delivery (Xia, 2002,
supra). At various time points after administration of the selected
siRNA, mRNA levels for CDK9 and/or CyCT1 can be measured.
Additionally, the siRNA can be labeled, and the half-life of the
siRNA molecules can be tracked using methods known in the art.
Using electroporation, RNase III-prepared siRNA can be delivered
into the post-implantation mouse embryos. 0.03:g-0.3:g siRNA can
efficiently silence reporter gene expression in different regions
of the neural tube or other cavities of the mouse embryo (Calegari
(2002), supra). Using rapid injection of the siRNA-containing
physiological solution into the tail vein of postnatal mice,
0.5-5:g siRNA can cause 36.+-.17%-88%.+-.3% inhibition of target
gene expression. The effect of RNAi is siRNA dose-dependent and can
persist for approximately 4 days after siRNA delivery (Lewis
(2002), supra). By direct injection, 5-40:g siRNA can be used to
silencing target gene expression in the liver, which is central to
metabolism (Lewis (2002), supra; McCaffrey (2002), supra).
[0375] Any appropriate parameter can be observed to investigate the
effect of P-TEFb expression. For example, changes in gene
expression can be determined, such as changes in the expression of
any one or more of the genes listed herein. In a mouse cancer
model, appropriate parameters can include survival rates, tumor
growth, metastasis, etc. In a simian HIV model, for instance
parameters that can be determined include, but are not limited to,
infectivity, viral load, survival rates, and rates and severity of
secondary AIDS-associated illnesses.
[0376] Such models may also be useful for evaluating various gene
delivery methods and constructs, to determine those that are the
most effective, e.g., have the greatest effect, or have a desirable
half-life or toxicity profile, for instance.
Example XXVII
Specific Silencing of hSpt5 Expression by siRNA in HeLa Cells
[0377] To inhibit hSpt5 expression in a cultured human cell line
using RNAi, siRNA targeting an hSpt5 sequence from position 407 to
427 relative to the start codon was designed. Magi cells were then
transfected with hSpt5 duplex siRNA using Lipofectamine
(Invitrogen). To evaluate the effects of hSpt5 RNAi, total cell
lysates were prepared from siRNA-treated cells harvested at various
time points after transfection. hSpt5 mRNA or protein levels were
then analyzed by RT-PCR or western blot using anti-hSpt5
antibodies, respectively. These experiments showed that cells
transfected hSpt5 siRNA had significantly lowered hSpt5 mRNA and
protein expression, indicating that RNAi of hSpt5 had occurred
successfully. This knockdown effect was dependent on the presence
of a 21-nt siRNA duplex harboring a sequence complementary to the
mRNA target. Mock-treated (no siRNA), single-stranded antisense
hSpt5 siRNA, mismatched hSpt5 duplex siRNA, containing two
nucleotide mismatches between the target mRNA and siRNA antisense
strand at the putative cleavage site of the target mRNA did not
affect hSpt5 mRNA or proteins levels. This suggested that hSpt5
knockdown was specific to duplex siRNA exactly complementary to the
hSpt5 mRNA target. In evaluating either mRNA or protein levels,
human Cyclin TI (hCyCT1) was used as an internal control, showing
that the effects of hSpt5 siRNA were specific to hSpt5 and did not
effect hCyCT1 mRNA or protein levels. Taken together, these results
suggested that hSpt5 knockdown was sequence specific and led to
significantly decreased hSpt5 mRNA and proteins levels.
Example XXVIII
Specific Silencing of Spt5 by siRNA at the mRNA Level
[0378] To determine the specificity of Spt5 knockdown by siRNA at
the mRNA level, RT-PCR is used to reveal the effect of siRNA on the
level of mRNA involved in Spt5 expression. Briefly, HeLa cells are
transfected with Spt5 ds siRNA, harvested at various times after
transfection and mRNAs are extracted. One-step RT-PCR is performed,
using specific primers for Spt5 amplification. A control is run
concurrently using primers specific for another, unrelated gene,
e.g., CDK9, CycT1, or actin. RT-PCR products are resolved in 1%
agarose gel and viewed by ethidium bromide staining. Changes in
Spt5 mRNA levels with time, while the levels of mRNA of the
unrelated gene remain unaltered, indicate that the effect of the
siRNA is specific.
Example XXIX
Viability of Human Cells with Spt5 Knockdown
[0379] Cellular viability under various siRNA treatments was
analyzed by trypan blue exclusion. Knowing that the kinetics of
hSpt5 peaked at 42-54 h post-transfection, the viability of cells
during an hSpt5 knockdown time course experiment could be
evaluated. Cell viability was assessed using trypan blue exclusion
at various times after transfection of various siRNAs. During the
66 h time course experiment, the number of non-viable hSpt5
knockdown cells observed was comparable to mock-treated cells.
Cells transfected with single-stranded antisense hSpt5 siRNA or
mismatched hSpt5 duplex siRNA that did not show hSpt5 knockdown
also showed minimal changes in cell viability. The positive control
for this experiment was human capping enzyme (HCE), which is a
bifunctional triphophsatase-guanylyltransferase required for
capping mRNA (reviewed in Bentley et al., 2002 Curr Opin Cell Biol
14:336-342). HCE is very likely to be essential for cell viability
as the HCE homolog cel-1 in C. elegans is essential (Srinivasan et
al., 2003 J. Biol Chem 278:14168-14173). In contrast to hSpt5
knockdown cells, HCE knockdown cells showed a significant increase
in cell death over the course of the knockdown experiment. These
results indicated that hSpt5 knockdown was not lethal to human
cells, while a much more stringent requirement for HCE expression
was essential for cell viability.
[0380] Cell viability in vivo under siRNA treatment can also be
evaluated by fluorescence imaging. pEGFP-C1 reporter plasmid
(harboring enhanced green fluorescent protein [GFP]) and siRNAs are
cotransfected into HeLa cells using Lipofectamine.TM.. Briefly,
HeLa cells are cotransfected by Lipofectamine.TM. with pEGFP-C1
reporter (GFP) plasmid and siRNAs. In general, four siRNA duplexes,
including a control duplex targeting RFP and duplexes targeting
Spt5 are used in these experiments. Reporter gene expression is
monitored at 50 hours post transfection by fluorescence imaging in
living cells. Cellular shape and density are recorded by phase
contrast microscopy.
Example XXX
hSpt5 RNAi Inhibits HIV-1 Tat Transactivation in Human Cells
[0381] A dominant paradigm for Tat up-regulation of HIV gene
expression at the level of transcription elongation revolves around
the ability of the Tat-TAR RNA complex to bind to P-TEFb and
stimulate phosphorylation of the CTD and Spt5, thereby overriding
the elongation arrest elicited by DSIF and NELF (Ping and Rana
(2001), supra; Price (2000), supra).
[0382] To examine whether hSpt5 was required for HIV-1 Tat
transactivation in vivo, Tat transactivation during hSpt5 knockdown
in Magi cells was monitored. Magi cells are a HeLa cell line
harboring a stably integrated single copy of the HIV-15'
LTR-.beta.-galactosidase gene. These cells are also genetically
programmed to express the CD4 receptor as well as CCR5 coreceptor
for HIV-1 infection (Kimpton and Emerman, 1992 J Virol
66:2232-2239); see below). In this experiment, Magi cells were
co-transfected with Tat expression plasmid pTat-RFP and hSpt5
duplex siRNA. Co-transfection with Tat siRNA was used as a positive
control for inhibition of Tat transactivation while single-stranded
antisense hSpt5 siRNA and mismatched siRNA were used as negative
controls. Tat transactivation and protein levels were evaluated by
harvesting cells 48 h post transfection, which was within the
timeframe that hSpt5 knockdown peaked. Expression of HIV-1 Tat-RFP
under the control of the CMV early promoter was confirmed by
western blot using anti-RFP antibody and RFP fluorescence
measurement on a fluorescence spectrophotometer (data not shown).
In addition, immunoblot analysis confirmed that hSpt5 siRNA
specifically inhibited hSpt5 protein expression in the absence and
presence of HIV-1 Tat protein in Magi cells (data not shown).
[0383] Tat-RFP enhances the expression of genes that are under the
control of the HIV-1 5' LTR promoter. In this experiment, Tat
transactivation was measured by assaying the .beta.-galactosidase
activity resulting from expression of the .beta.-galactosidase gene
under the HIV-1 5' LTR promoter. To quantify the effects of various
siRNAs on HIV-1 Tat transactivation, the ratio between
.beta.-galactosidase activity in cells transfected with pTat-RFP
(with or without siRNAs) and mock-treated cells not transfected
with pTat-RFP was determined. In Magi cells, Tat-RFP strongly
stimulates the expression of .beta.-galactosidase, represented by a
13-fold increase in Tat transactivation. On the other hand, Tat
transactivation was strongly inhibited in cells transfected with
Tat siRNA, as previously shown (Surabhi and Gaynor 2002 J Virol
76:12963-12973). Tat transactivation was similarly inhibited when
cells were transfected with hSpt5 duplex siRNA, exhibiting only
.about.30% of the Tat transactivation observed with Tat-RFP alone.
Neither antisense hSpt5 siRNA nor mismatched hSpt5 siRNA showed any
effect on Tat transactivation. These results indicated hSpt5
knockdown caused by siRNA specifically targeting hSpt5 mRNA
inhibited HIV-1 Tat transactivation in human cells. These results
strongly supported an important role for hSpt5 in Tat
transactivation in vivo and suggested that RNAi of hSpt5 had the
potential to inhibit HIV-1 replication.
Example XXXI
hSpt5 siRNAs Inhibit hSpt5 Protein Expression in the Presence or
Absence of Tat Expression
[0384] Specific RNA interference with Spt5 expression in Magi cells
was demonstrated by Western blot analysis. Briefly, Magi cells were
co-transfected with pTat-RFP plasmid and various siRNAs. Cells were
harvested at 48 hours post-transfection, resolved on 10% SDS--PAGE,
transferred onto PVDF membranes, and immunoblotted with antibodies
against Spt5 or hCycT1. RNAi activities in Magi cells treated with
antisense (AS) strands of Spt5 siRNAs and in cells treated with ds
siRNA targeting Spt5 were examined. RNAi activities in cells
treated with mismatch Spt5 (hCyCT1 mm) siRNAs with two mismatches
were also examined. From the results, it can be concluded that
siRNA targeting hSpt5 can inhibit hSpt5 protein expression in the
presence or absence of Tat protein, making siRNA targeting hSpt5 an
excellent candidate compound for treatment of patients infected
with HIV.
Example XXXII
RNAi Inhibition of HIV-1 Infectivity
[0385] Since hSpt5 knockdown effectively inhibited Tat
transactivation, we next determined whether hSpt5 knockdown could
inhibit HIV-1 replication. To evaluate the effect of hSpt5
knockdown on HIV-1 replication, a double siRNA transfection
protocol was used to maximize the knockdown efficiency of hSpt5
during HIV-1 infection. Magi cells were transfected with siRNA
directed against hSpt5. Cells mock transfected without siRNA, or
transfected with single-stranded antisense hSpt5 siRNA or mismatch
hSpt5 siRNA were used as negative controls. Transfection with Nef
siRNA was used as a positive control. 24 h after the first
transfection, a second siRNA transfection was performed. 24 h
later, doubly transfected cells were infected with various
concentrations of HIV.sub.NL-GFP, an infectious molecular clone of
HIV-1. Knockdown of hSpt5 protein levels was then evaluated 48 h
post infection in doubly transfected cells. An even larger decrease
in hSpt5 protein levels was observed in doubly transfected cells as
compared to singly transfected cells, suggesting that more robust
knockdown of gene expression can be achieved using this double
transfection method.
[0386] HIV-1 Tat-mediated transactivation of the 5' LTR occurring
in cells infected with virus led to .beta.-galactosidase
production, which was also quantified 48 h post-infection. In this
single-cycle replication assay for evaluating HIV-1 replication,
.beta.-gal activity reflected the activity of reverse transcriptase
and viral replication of varying amounts of viral inoculum.
Therefore, changes in .beta.-gal activity could be directly
correlated to changes in the efficacy of HIV replication. The
positive siRNA control targeting HIV Nef showed decreased levels of
.beta.-gal activity and viral infectivity, as shown previously
(FIG. 32; (Jacque et al., 2002 Nature 418:435-438). Double-stranded
siRNA directed against hSpt5 showed a similar decrease in
.beta.-gal activity when compared with Nef knockdown. This observed
decrease was equivalent to the .beta.-gal activity measured when
using 32 times less viral inoculum with mock-treated cells,
indicating that hSpt5 knockdown had significantly reduced HIV
replication. Control experiments using hSpt5 single-stranded
antisense or mismatched duplex siRNA duplexes showed no antiviral
activities. In addition, no significant toxicity or cell death was
observed during these experiments, suggesting that hSpt5 knockdown
was not lethal even in the context of HIV-1 infection. These
results demonstrated that HIV replication was modulated by siRNAs
targeting hSpt5, further establishing an important role for hSpt5
in Tat transactivation and HIV-1 replication in vivo.
Example XXXIII
Specific Silencing of TEFs In Vivo
[0387] The effect of downregulating TEFs in vivo is assayed by
administering siRNA targeted to one or more TEFs, e.g. Spt4, Spt5,
and/or Spt6, in an animal model. The siRNA is administered using
hydrodynamic transfection as previously described (McCaffrey
(2002), supra; Liu (1999), supra), by intravenous injection into
the tail vein (Zhang (1999), supra); or by viral delivery (Xia
(2002), supra). At various time points after administration of the
selected siRNA, mRNA levels for one or more TEFs, e.g., Spt4, Spt5,
and/or Spt6 are measured. Additionally, the siRNA can be labeled,
and the half life of the siRNA molecules is tracked using methods
known in the art. Using electroporation, RNase III-prepared siRNA
can be delivered into the post-implantation mouse embryos.
0.03:g-0.3:g siRNA can efficiently silence reporter gene expression
in different regions of the neural tube or other cavities of the
mouse embryo (Calegari (2002), supra). Using rapid injection of the
siRNA-containing physiological solution into the tail vein of
postnatal mice, 0.5-5 : g siRNA can cause 36.+-.17%-88.+-.3%
inhibition of target gene expression. The effect of RNAi is siRNA
dose-dependent and can persist for approximately 4 days after siRNA
delivery (Lewis (2002), supra). By direct injection, 5-40:g siRNA
can be used to silencing target gene expression in the liver, which
is central to metabolism (Lewis (2002), supra; McCaffrey (2002),
supra).
Experimental Procedures for Examples XX-XXXIII
[0388] siRNA Preparation
[0389] Design of siRNAs Against CDK9/CycT1
[0390] The targeted region in the mRNA, and hence the sequence of
CycT1or CDK9-specific siRNA duplexes was designed following the
guidelines provided by Dharmacon (Lafayette, Colo.). Briefly,
starting 100 bases downstream of the start codon, the first AA
dimer was located and the next 19 nucleotides were then recorded
following the AA dimer. Criteria were set such that the guanosine
and cytidine content (G/C content) of the AA-N19 21 base-sequence
must be less than 70% and greater than 30%. The search continued
downstream until the conditions were met. The 21-mer sequence was
subjected to a BLAST search against the human genome/NCBI EST
library to ensure only the desired gene was targeted. The siRNA
sequence targeting hCyCT1 was from position 347-367 relative to the
start codon. The siRNA sequence targeting CDK9 was from position
258-278 relative to the start codon. siRNA sequences used in our
experiments were:
3 hCycT1 ds (5'-UCCCUUCCUGAUACUAGAAdTdT-3'); (SEQ ID NO:3) hCycT1
mm (5'-UCCCUUCCGUAUACUAGAAdTdT-3'); (SEQ ID NO:4) CDK9 ds
(5'-CCAAAGCUUCCCCCUAUAAdTdT-3'); (SEQ ID NO:5) CDK9 mm
(5'-CCAAAGCUCUCCCCUAUAAdTdT-- 3'); (SEQ ID NO:6) CDK7 ds
(5'-UUGGUCUCCUUGAUGCUUUd- TdT-3'); (SEQ ID NO:17) Tat ds
(5'-GAAACGUAGACAGCGCAGAdTdT-3'); (SEQ ID NO:18) GFP ds
(5'-GCAGCACGACUUCUUCAAGdTdT-3'); (SEQ ID NO:19) and REP ds
(5'-GUGGGAGCGCGUGAUGAACdTdT-3'). (SEQ ID NO:20)
[0391] Underlined residues represent the mismatched sequence to
their targets.
[0392] hCyCT1 contains an amino-terminal cyclin box motif (amino
acids 1-298) that is conserved in the cyclin type protein family, a
putative coiled-coil motif (amino acids 379-430) and a
histidine-rich motif (amino acids 506-530). The hCyCT1 sequence
containing amino acids 1-303 is sufficient to form complexes with
Tat-TAR and CDK9, as CDK9 binds to the cyclin box (amino acids
1-250) of CycT1. A Tat:TAR recognition motif (TRM) in the hCyCT1
sequence that spans amino acids 251-272 is necessary for forming
complex with Tat and TAR. Residues 252-260 of hCyCT1 have been
demonstrated to interact with the TAR RNA loop, suggesting that
amino acids 261-272 are involved in interaction with Tat core
domain. A critical cysteine (amino acids 261) has been identified
as a absolutely requiring residue for the Tat and hCycT1
interaction. The targeted region in the mRNA and hence the sequence
of hCyCT1 -specific siRNA duplexes can be designed targeting to the
Cyclin box region or the region for Tat-TAR interaction. Using the
guidelines provided by Dharmacon (Lafayette, Colo.) as discussed
above, other potential siRNA target sequences include the
following: relative to the start codon, the siRNA sequences
targeting hCyCT1 can be from position 238-278, 502-522, 758-778,
769-789 etc. Based on the guidelines of Dharmacon as discussed
above, additional siRNA sequences suitable for targeting CDK9 can
be from position 220-240, 258-278, 379-399relative to the start
codon.
[0393] Design of siRNAs Targeting Spt5
[0394] The targeted region in the mRNA, and hence the sequence of
Spt5-specific siRNA duplexes, was designed following the guidelines
provided by Dharmacon (Lafayette, Colo.). Briefly, beginning 100
bases downstream of the start codon, the first AA dimer was located
and then the next 19 nucleotides following the AA dimer were
recorded. Ideally, the guanosine and cytidine content (G/C content)
of the AA-N19 21 base-sequence would be less than 70% and greater
than 30%. The search was continued downstream until the conditions
were met. The 21-mer sequence was subjected to a BLAST search
against the human genome/NCBI EST library to ensure only the
desired gene was targeted. The siRNA sequence targeting hSpt5 was
from position 407-427 relative to the start codon. siRNA sequences
used in the experiments described herein were:
4 hSpt5 ds (5'-AACTGGGCGAGTATTACATGAdTdT-3'); (SEQ ID NO: 8) hSpt5
mm (5'-AACTGGGCGGATATTACATGAdTdT-3'); (SEQ ID NO: 9) Tat ds
(5'-GAAACGUAGACAGCGCAGAdTdT-- 3'); (SEQ ID NO: 18) GFP ds
(5'-GCAGCACGACUUCUUCAAG- dTdT-3'); (SEQ ID NO: 19) and RFP ds
(5'-GUGGGAGCGCGUGAUGAACdTdT-3'). (SEQ ID NO: 20)
[0395] Underlined residues represent the sequences mismatched to
their targets.
[0396] Using the guidelines provided by Dharmacon (Lafayette,
Colo.) as discussed above, other potential siRNA sequences
targeting Spt5, as well as siRNA sequences targeting Spt4 or Spt6,
can be identified.
[0397] SiRNA Synthesis and Maintenance
[0398] 21-nt RNAs were chemically synthesized as 2'
bis(acetoxyethoxy)-methyl ether-protected oligos by Dharmacon
(Lafayette, Colo.). Synthetic oligonucleotides were deprotected,
annealed to form dsRNAs and purified according to the
manufacturer's recommendation. Successful duplex formation was
confirmed by 20% non-denaturing polyacrylamide gel electrophoresis
(PAGE). All siRNAs were stored in DEPC (0.1% diethyl
pyrocarbonate)-treated water at -80.degree. C.
References
[0399] Bass, B. L. (2000). Double-stranded RNA as a template for
gene silencing. Cell 101, 235-238.
[0400] Bernstein, E., Caudy, A. A., Hammond, S. M., and Hannon, G.
J. (2001). Role for a bidentate ribonuclease in the initiation step
of RNA interference. Nature 409, 363-366.
[0401] Chiu, Y. L., and Rana, T. M. (2002). RNAi in human cells:
basic structural and functional features of small interfering RNA.
Mol. Cell 10, 549-561.
[0402] Cimino, G. D., Gamper, H. B., Isaacs, S. T., and Hearst, J.
E. (1985). Psoralens as photoactive probes of nucleic acid
structure and ftunction: organic chemistry, photochemistry, and
biochemistry. Annu Rev Biochem 54, 1151-1193.
[0403] Cogoni, C., and Macino, G. (1999). Gene silencing in
Neurospora crassa requires a protein homologous to RNA-dependent
RNA polymerase. Nature 399, 166-169.
[0404] Cogoni, C., and Macino, G. (2000). Post-transcriptional gene
silencing across kingdoms. Curr Opin Genet Dev 10, 638-643.
[0405] Dalmay, T., Hamilton, A., Rudd, S., Angell, S., and
Baulcombe, D. C. (2000). An RNA-dependent RNA polymerase gene in
Arabidopsis is required for posttranscriptional gene silencing
mediated by a transgene but not by a virus. Cell 101, 543-553.
[0406] Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983).
Accurate transcription initiation by RNA polymerase II in a soluble
extract from isolated mammalian nuclei. Nucleic Acids Res. 11,
1475-1489.
[0407] Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A.,
Weber, K., and Tuschl, T. (2001a). Duplexes of 21-nucleotide RNAs
mediate RNA interference in cultured mammalian cells. Nature 411,
494-498.
[0408] Elbashir, S. M., Lendeckel, W., and Tuschl, T. (2001b). RNA
interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev
15, 188-200.
[0409] Elbashir, S. M., Martinez, J., Patkaniowska, A., Lendeckel,
W., and Tuschl, T. (2001c). Functional anatomy of siRNAs for
mediating efficient RNAi in Drosophila melanogaster embryo lysate.
Embo J 20, 6877-6888.
[0410] Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver,
S. E., and Mello, C. C. (1998). Potent and specific genetic
interference by double-stranded RNA in Caenorhabditis elegans.
Nature 391, 806-811.
[0411] Grishok, A., Tabara, H., and Mello, C. C. (2000). Genetic
requirements for inheritance of RNAi in C. elegans. Science 287,
2494-2497.
[0412] Haaima, G., Hansen, H. F., Christensen, L., Dahl, O., and
Nielsen, P. E. (1997). Increased DNA binding and sequence
discrimination of PNA oligomers containing 2,6-diaminopurine.
Nucleic Acids Res. 25, 4639-4643.
[0413] Hamilton, A., Voinnet, O., Chappell, L., and Baulcombe, D.
(2002). Two classes of short interfering RNA in RNA silencing. EMBO
J. 21, 4671-4679.
[0414] Hamilton, A. J., and Baulcombe, D. C. (1999). A species of
small antisense RNA in posttranscriptional gene silencing in
plants. Science 286, 950-952.
[0415] Hammond, S. M., Bernstein, E., Beach, D., and Hannon, G. J.
(2000). An RNA-directed nuclease mediates post-transcriptional gene
silencing in Drosophila cells. Nature 404, 293-296.
[0416] Hammond, S. M., Caudy, A. A., and Hannon, G. J. (2001).
Post-transcriptional gene silencing by double-stranded RNA. Nat Rev
Genet 2, 110-119.
[0417] Hearst, J. E., Isaacs, S. T., Kanne, D., Rapoport, H., and
Straub, K. (1984). The reaction of the psoralens with
deoxyribonucleic acid. Q Rev Biophys 1 7, 1-44.
[0418] Kanne, D., Straub, K., Rapoport, H., and Hearst, J. E.
(1982). Psoralen-deoxyribonucleic acid photoreaction.
Characterization of the monoaddition products from
8-methoxypsoralen and 4,5'8-trimethylpsoralen. Biochemistry 21,
861-871.
[0419] Kennerdell, J. R., and Carthew, R. W. (1998). Use of
dsRNA-mediated genetic interference to demonstrate that frizzled
and frizzled 2 act in the wingless pathway. Cell 95, 1017-1026.
[0420] Ketting, R. F., and Plasterk, R. H. (2000). A genetic link
between co-suppression and RNA interference in C. elegans. Nature
404, 296-298.
[0421] Lipardi, C., Wei, Q., and Paterson, B. M. (2001). RNAi as
random degradative PCR: siRNA primers convert mRNA into dsRNAs that
are degraded to generate new siRNAs. Cell 107, 297-307.
[0422] Lipson, S. E., Cimino, G. D., and Hearst, J. E. (1988).
Structure of M1 RNA as determined by psoralen cross-linking.
Biochemistry 27, 570-575.
[0423] Matzke, M., Matzke, A. J., and Kooter, J. M. (2001). RNA:
guiding gene silencing. Science 293, 1080-1083.
[0424] Mourrain, P., Beclin, C., Elmayan, T., Feuerbach, F., Godon,
C., Morel, J. B., Jouette, D., Lacombe, A. M., Nikic, S., Picault,
N., et al. (2000). Arabidopsis SGS2 and SGS3 genes are required for
posttranscriptional gene silencing and natural virus resistance.
Cell 101, 533-542.
[0425] Neenhold, H. R., and Rana, T. M. (1995). Major groove
opening at the HIV-1 Tat binding site of TAR RNA evidenced by a
rhodium probe. Biochemistry 34, 6303-6309.
[0426] Nishikura, K. (2001). A short primer on RNAi: RNA-directed
RNA polymerase acts as a key catalyst. Cell 107, 415-418.
[0427] Nykanen, A., Haley, B., and Zamore, P. D. (2001). ATP
requirements and small interfering RNA structure in the RNA
interference pathway. Cell 107, 309-321.
[0428] Parrish, S., Fleenor, J., Xu, S., Mello, C., and Fire, A.
(2000). Functional anatomy of a dsRNA trigger: differential
requirement for the two trigger strands in RNA interference. Mol
Cell 6, 1077-1087.
[0429] Sharp, P. A. (2001). RNA interference--2001. Genes Dev 15,
485-490.
[0430] Sijen, T., Fleenor, J., Simmer, F., Thijssen, K. L.,
Parrish, S., Timmons, L., Plasterk, R. H., and Fire, A. (2001). On
the role of RNA amplification in dsRNA-triggered gene silencing.
Cell 107, 465-476.
[0431] Sijen, T., and Kooter, J. M. (2000). Post-transcriptional
gene-silencing: RNAs on the attack or on the defense? Bioessays 22,
520-531.
[0432] Smardon, A., Spoerke, J. M., Stacey, S. C., Klein, M. E.,
Mackin, N., and Maine, E. M. (2000). EGO-1 is related to
RNA-directed RNA polymerase and functions in germ-line development
and RNA interference in C. elegans. Curr Biol 10, 169-178.
[0433] Stark, G. R., Kerr, I. M., Williams, B. R., Silverman, R.
H., and Schreiber, R. D. (1998). How cells respond to interferons.
Ann Rev Biochem 67,227-264.
[0434] Thompson, J. F., and Hearst, J. E. (1983). Structure of E.
coli 16S RNA elucidated by psoralen crosslinking. Cell 32,
1355-1365.
[0435] Turner, S., and Noller, H. F. (1983). Identification of
sites of 4'-(hydroxymethyl)-4,5',8-trimethoxylpsoralen
cross-linking in Escherichia coli 23S ribosomal ribonucleic acid.
Biochemistry 22, 4159-4164.
[0436] Tuschl, T. (2001). RNA interference and small interfering
RNAs. Chembiochem Europ J Chem Biol 2, 239-245.
[0437] Tuschl, T., Zamore, P. D., Lehmann, R., Bartel, D. P., and
Sharp, P. A. (1999). Targeted mRNA degradation by double-stranded
RNA in vitro. Genes Dev 13, 3191-3197.
[0438] Waterhouse, P. M., Wang, M. B., and Finnegan, E. J. (2001).
Role of short RNAs in gene silencing. Trends Plant Sci 6,
297-301.
[0439] Weeks, K. M., and Crothers, D. M. (1991). RNA recognition by
Tat-derived peptides: Interaction in the major groove? Cell 66,
577-588.
[0440] Weeks, K. M., and Crothers, D. M. (1993). Major Groove
Accessibility of RNA. Science 261, 1574-1577.
[0441] Yang, D., Lu, H., and Erickson, J. W. (2000). Evidence that
processed small dsRNAs may mediate sequence-specific mRNA
degradation during RNAi in Drosophila embryos. Curr Biol 10,
1191-1200
[0442] Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P.
(2000). RNAi: double-stranded RNA directs the ATP-dependent
cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101,
25-33.
[0443] Hutvagner, G., and Zamore, P. D. (2002). A MicroRNA in a
Multiple-Turnover RNAi Enzyme Complex. Science 1, 1.
[0444] Kirnos, M. D., Khudyakov, I. Y., Alexandrushkina, N. I., and
Vanyushin, B. F. (1977). 2-aminoadenine is an adenine substituting
for a base in S-2L cyanophage DNA. Nature 270, 369-370.
[0445] Luy, B., and Marino, J. P. (2001). Measurement and
application of 1H-19F dipolar couplings in the structure
determination of 2'-fluorolabeled RNA. J. Biolmol. NMR 20,
39-47.
[0446] Luytena, I., and Herdewijna, P. (1998). Hybridization
properties of base-modified oligonucleotides within the double and
triple helix motif. Eur. J. Med. Chem. 33, 515-576.
[0447] Majlessi, M., Nelson, N. C., and Becker, M. M. (1998).
Advantages of 2'-O-methyl oligoribonucleotide probes for detecting
RNA targets. Nucleic Acids Res. 26, 2224-2229.
[0448] Martinez, J., Patkaniowska, A., Urlaub, H., Luhnnann, R.,
and Tuschl, T. (2002). Single-stranded antisense siRNAs guide
target RNA cleavage in RNAi. Cell 110, 563-574.
[0449] McManus, M. T., and Sharp, P. A. (2002). Gene silencing in
mammals by small interfering RNAs. Nat. Rev. Genet. 3, 737-747.
[0450] Provost, P., Dishart, D., Doucet, J., Frendewey, D.,
Samuelsson, B., and Radmark, O. (2002). Ribonuclease activity and
RNA binding of recombinant human Dicer. EMBO J. 21, 5864-5874.
[0451] Saenger, W., ed. (1984). Principles of Nucleic Acid
Structure (New York, Springer-Verlag).
[0452] Stein, C. A. (1996). Phosphorothioate antisense
oligodeoxynucleotides: questions of specificity. Trends Biotechnol.
14, 147-149.
[0453] Stein, P., Svoboda, P., Anger, M., and Schultz, R. M.
(2003). RNAi: Mammalian oocytes do it without RNA-dependent RNA
polymerase. RNA 9, 187-192.
[0454] Zamore, P. D. (2001). RNA interference: listening to the
sound of silence. Nat. Struct. Biol. 8, 746-750.
[0455] Zhang, H., Kolb, F. A., Brondani, V., Billy, E., and
Filipowicz, W. (2002). Human Dicer preferentially cleaves dsRNAs at
their termini without a requirement for ATP. EMBO J. 21,
5875-5885.
[0456] Equivalents
[0457] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
34 1 21 DNA Artificial Sequence Synthetic sequence RNA molecule
with deoxythymidines at positions 20 and 21 1 gcagcacgac uucuucaagt
t 21 2 21 DNA Artificial Sequence Synthetic sequence RNA molecule
with deoxythymidines at positions 20 and 21 2 cuugaagaag ucgugcugct
t 21 3 21 RNA Artificial Sequence siRNA target sequence 3
aagcagcacg acuucuucaa g 21 4 21 RNA Artificial Sequence siRNA
target sequence 4 aagugggagc gcgugaugaa c 21 5 21 DNA Artificial
Sequence Synthetic sequence RNA molecule with deoxythymidines at
positions 20 and 21 5 gugggagcgc gugaugaact t 21 6 21 DNA
Artificial Sequence Synthetic sequence RNA molecule with
deoxythymidines at positions 20 and 21 6 guucaucacg cgcucccact t 21
7 21 DNA Artificial Sequence Synthetic sequence RNA molecule with
deoxythymidines at positions 20 and 21 7 gcagcacgac uucuucaagt t 21
8 21 DNA Artificial Sequence Synthetic sequence RNA molecule with
deoxythymidines at positions 20 and 21 8 cuugaagaag ucgugcugct t 21
9 21 DNA Artificial Sequence Synthetic sequence RNA molecule with
deoxythymidine at positions 20 9 gcagcacgac uucuucaagt t 21 10 21
DNA Artificial Sequence Synthetic sequence RNA molecule with
deoxythymidine at positions 20 10 cuugaagaag ucgugcugct t 21 11 21
DNA Artificial Sequence Synthetic sequence RNA molecule with
deoxythymidine at position 20 and 3'-Biotin-modified deoxythymidine
at position 21 11 cuugaagaag ucgugcugct t 21 12 23 DNA Artificial
Sequence Synthetic sequence RNA molecule with deoxythymidines at
positions 22 and 23 12 gcagcacgac uguucuucaa gtt 23 13 23 DNA
Artificial Sequence Synthetic sequence RNA molecule with
deoxythymidines at positions 22 and 23 13 cuugaagaaa cgucgugcug ctt
23 14 21 DNA Artificial Sequence Synthetic sequence RNA molecule
with deoxynucleosides at positions 1-21 14 cuugaagaag ucgugcugct t
21 15 21 DNA Artificial Sequence Synthetic sequence RNA molecule
with deoxythymidines at positions 20 and 21 15 cuugaagaag
ucgugcugct t 21 16 21 DNA Artificial Sequence Synthetic sequence
RNA molecule with deoxythymidines at positions 20 and 21,
deoxyadenosine at position 9 and deoxyguanosine at positions 10 and
13 16 cuugaagaag ucgugcugct t 21 17 21 DNA Artificial Sequence
Synthetic sequence RNA molecule with deoxythymidines at positions
20 and 21, deoxyadenosine at position 9 and deoxyguanosine at
positions 10, 13, 15 and 18 17 cuugaagaag ucgugcugct t 21 18 21 DNA
Artificial Sequence Synthetic sequence RNA molecule with
deoxythymidines at positions 20 and 21, deoxyadenosine at position
5, 6, 8, 9 and deoxyguanosine at positions 4, 7, 10 and 13 18
cuugaagaag ucgugcugct t 21 19 21 DNA Artificial Sequence Synthetic
sequence RNA molecule with deoxythymidines at positions 20 and 21,
deoxyadenosine at position 5, 6, 8, 9 and deoxyguanosine at
positions 4, 7, 10, 13, 15 and 18 19 cuugaagaag ucgugcugct t 21 20
21 DNA Artificial Sequence Synthetic sequence RNA molecule with
deoxythymidines at positions 20 and 21 20 gcagcacgac uucuucaagt t
21 21 21 DNA Artificial Sequence Synthetic sequence RNA molecule
with deoxythymidines at positions 20 and 21 21 cuugaagaag
ucgugcugct t 21 22 21 DNA Artificial Sequence Synthetic sequence
RNA molecule with deoxythymidines at positions 20 and 21 22
cuugaagaag ucgugcugct t 21 23 21 DNA Artificial Sequence Synthetic
sequence RNA molecule with deoxythymidines at positions 20 and 21
23 cuugaagaag ucgugcucgt t 21 24 21 DNA Artificial Sequence
Synthetic sequence RNA molecule with deoxythymidines at positions
20 and 21 24 ucugaagaag ucgugcugct t 21 25 21 DNA Artificial
Sequence Synthetic sequence RNA molecule with deoxythymidines at
positions 20 and 21 25 ucccuuccug auacuagaat t 21 26 21 DNA
Artificial Sequence Synthetic sequence RNA molecule with
deoxythymidines at positions 20 and 21 26 ucccuuccgu auacuagaat t
21 27 21 DNA Artificial Sequence Synthetic sequence RNA molecule
with deoxythymidines at positions 20 and 21 27 ccaaagcuuc
ccccuauaat t 21 28 21 DNA Artificial Sequence Synthetic sequence
RNA molecule with deoxythymidines at positions 20 and 21 28
ccaaagcucu ccccuauaat t 21 29 23 DNA Artificial Sequence siRNA
target sequence 29 aactgggcga gtattacatg att 23 30 23 DNA
Artificial Sequence siRNA target sequence 30 aactgggcgg atattacatg
att 23 31 21 DNA Artificial Sequence Synthetic sequence RNA
molecule with two deoxythymidines at positions 20 and 21 31
uuggucuccu ugaugcuuut t 21 32 21 DNA Artificial Sequence Synthetic
sequence RNA molecule with deoxythymidines at positions 20 and 21
32 gaaacguaga cagcgcagat t 21 33 40 DNA Artificial Sequence DNA
primer 33 gcctaatacg actcactata ggacctacgg cgtgcagtgc 40 34 40 DNA
Artificial Sequence DNA primer 34 ttgatttagg tgacactata gatggtgcgc
tcctggacgt 40
* * * * *