U.S. patent application number 10/921710 was filed with the patent office on 2005-01-27 for wsx receptor agonist antibodies.
Invention is credited to Carter, Paul J., Chiang, Nancy Y., Kim, Kyung Jin, Matthews, William, Rodrigues, Maria L..
Application Number | 20050019325 10/921710 |
Document ID | / |
Family ID | 34084322 |
Filed Date | 2005-01-27 |
United States Patent
Application |
20050019325 |
Kind Code |
A1 |
Carter, Paul J. ; et
al. |
January 27, 2005 |
WSX receptor agonist antibodies
Abstract
The WSX receptor and antibodies which bind thereto (including
agonist and neutralizing antibodies) are disclosed, including
various uses therefor. Uses for WSX ligands (e.g., anti-WSX
receptor agonist antibodies or OB protein) in hematopoiesis are
also disclosed.
Inventors: |
Carter, Paul J.; (San
Francisco, CA) ; Chiang, Nancy Y.; (San Francisco,
CA) ; Kim, Kyung Jin; (Los Altos, CA) ;
Matthews, William; (Woodside, CA) ; Rodrigues, Maria
L.; (South San Francisco, CA) |
Correspondence
Address: |
KNOBBE MARTENS OLSON & BEAR LLP
2040 MAIN STREET
FOURTEENTH FLOOR
IRVINE
CA
92614
US
|
Family ID: |
34084322 |
Appl. No.: |
10/921710 |
Filed: |
August 18, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10921710 |
Aug 18, 2004 |
|
|
|
08779457 |
Jan 7, 1997 |
|
|
|
08779457 |
Jan 7, 1997 |
|
|
|
08667197 |
Jun 20, 1996 |
|
|
|
60064855 |
Jan 8, 1996 |
|
|
|
Current U.S.
Class: |
424/144.1 ;
435/7.2; 530/388.22 |
Current CPC
Class: |
G01N 33/6893 20130101;
C07K 14/721 20130101; C07K 2317/24 20130101; C07K 14/72 20130101;
C07K 2319/00 20130101; C07K 2319/02 20130101; G01N 2500/00
20130101; C07K 14/715 20130101; G01N 33/6863 20130101; A61K 38/00
20130101; G01N 2800/042 20130101; G01N 33/6869 20130101 |
Class at
Publication: |
424/144.1 ;
435/007.2; 530/388.22 |
International
Class: |
A61K 039/395; G01N
033/53; G01N 033/567; C07K 016/28 |
Claims
What is claimed is:
1. An agonist antibody which specifically binds to a receptor
having a WSX motif, wherein said receptor comprises an
extracellular domain, wherein the extracellular domain comprises
the extracellular domain sequence within SEQ ID NO: 2.
2. The antibody of claim 1 which specifically binds to a human
receptor having a WSX motif.
3. The antibody of claim 2 which specifically binds to a human
receptor variant 13.2.
4. The antibody of claim 1 which binds a receptor with a WSX motif
with a Kd of no more than about 1.times.10.sup.-8M.
5. The antibody of claim 4 which binds a receptor with a WSX motif
with a Kd of no more than about 1.times.10.sup.-9M.
6. The antibody of claim 2 which also binds to murine receptor with
a WSX motif.
7. The antibody of claim 1 which has an IC50 in a KIRA ELISA of
about 0.5 micrograms/ml or less.
8. The antibody of claim 7 which has an IC50 in a KIRA ELISA of
about 0.2 micrograms/ml or less.
9. The antibody of claim 8 which has an IC50 in a KIRA ELISA of
about 0.1 micrograms/ml or less.
10. The antibody of claim 1 which has biological characteristics of
antibody 2D7 (ATCC Accession Number HB-12249).
11. The antibody of claim 10 which binds to the epitope on a
receptor, with a WSX motif, bound by antibody 2D7.
12. The antibody of claim 10 which has complementarity determining
region (CDR) residues from antibody 2D7.
13. The antibody of claim 1 which has the biological
characteristics of antibody 1G4 (ATCC Accession Number
HB-12243).
14. The antibody of claim 13 which binds to the epitope on a
receptor, with a WSX motif, bound by antibody 1 G4.
15. The antibody of claim 13 which has complementarity determining
region (CDR) residues from antibody 1 G4.
16. The antibody of claim 1 which has the biological
characteristics of antibody 1E11 (ATCC Accession Number
HB-12248).
17. The antibody of claim 16 which binds to the epitope on WSX
receptor bound by antibody 1E11.
18. The antibody of claim 16 which has complementarity determining
region (CDR) residues from antibody 1E11.
19. The antibody of claim 1 which has the biological
characteristics of antibody 1C11 (ATCC Accession Number
HB-12250).
20. The antibody of claim 19 which binds to the epitope on WSX
receptor bound by antibody 1C11.
21. The antibody of claim 19 which has complementarity determining
region (CDR) residues from antibody 1C11.
22. The antibody of claim 1 comprising hypervariable region
residues of clone 3 antibody (SEQ ID NO:48).
23. The antibody of claim 1 comprising hypervariable region
residues of clone 4 antibody (SEQ ID NO:49).
24. The antibody of claim 1 comprising hypervariable region
residues of clone 17 antibody (SEQ ID NO:50).
25. The antibody of claim 1 which is a monoclonal antibody.
26. The antibody of claim 1 which is a hum an antibody.
27. The antibody of claim 1 which is a humanized antibody.
28. The antibody of claim 1 which is a n antibody fragment.
29. The antibody fragment of claim 28 which is an F(ab').sub.2.
30. A composition comprising the antibody of claim 1 and a
physiologically acceptable carrier.
31. The composition of claim 30 which is sterile.
32. The composition of claim 31 which is lyophilized.
33. The composition of claim 30 further comprising a cytokine.
34. A method for activating a WSX receptor comprising exposing the
WSX receptor to an amount of the antibody of claim 1 which is
effective for activating the WSX receptor.
35. A method for enhancing proliferation or differentiation of a
cell comprising the WSX receptor comprising exposing the cell to an
amount of the antibody of claim 1 which is effective for enhancing
proliferation or differentiation of the cell.
36. An isolated nucleic acid molecule encoding the antibody of
claim 1.
37. A vector comprising the nucleic acid molecule of claim 36.
38. A host cell comprising the nucleic acid molecule of claim
36.
39. A method of producing an agonist antibody which specifically
binds to the WSX receptor comprising culturing the host cell of
claim 38 and recovering the antibody from the cell culture.
40. A method for identifying an antibody which decreases body
weight or fat-depot weight or food intake in an obese animal,
comprising the steps of: (a) producing agonist antibodies which
specifically bind to the extracellular domain of a receptor having
a WSX motif comprising the extracellular domain sequence within SEQ
ID NO: 2; and (b) selecting an agonist antibody produced in step
(a) which has the ability to decrease body weight or fat-depot
weight or food intake in an obese animal.
41. The method of claim 40 wherein said obese animal is an ob/ob
mouse.
42. The method of claim 40 wherein said antibodies produced in step
(a) specifically bind to and activates human receptor variant 13.2
(SEQ ID NO: 2).
43. The method of claim 40 wherein said antibodies produced in step
(a) bind to the extracellular domain of said receptor having a WSX
motif with a Kd of no more than about 1.times.10.sup.-8 M.
44. The method of claim 43 wherein said Kd is no more than about
1.times.10.sup.-9 M.
45. The method of claim 42 wherein said antibodies also bind to a
murine receptor having a WSX motif.
46. The method of claim 40 wherein said antibodies produced in step
(a) have an IC50 in a KIRA ELISA of about 0.5 .mu.g/ml or less.
47. The method of claim 46 wherein said antibodies have an IC50 in
a KIRA ELISA of about 0.2 .mu.g/ml or less.
48. The method of claim 47 wherein said antibodies have an IC50 in
a KIRA ELISA of about 0.2 .mu.g/ml or less.
49. The method of claim 40 wherein said antibodies produced in step
(a) have biological characteristics of an antibody selected from
the group consisting of antibodies 2D7 (ATCC Accession Number
HB-12249), 1 G4 (ATCC Accession Number HB-12243),1E11 (ATCC
Accession Number HB-12248) and 1C11 (ATCC Accession Number
HB-12250).
50. The method of claim 40 wherein said antibodies bind to the
epitope bound by an antibody selected from the group consisting of
2D7 (ATCC Accession Number HB-12249),1G4 (ATCC Accession Number
HB-12243),1E11 (ATCC Accession Number HB-12248) and 1C11 (ATCC
Accession Number HB-12250).
51. The method of claim 40 wherein said antibodies have
complementarity determining region (CDR) residues from an antibody
selected from the group consisting of 2D7 (ATCC Accession Number
HB-12249), 1 G4 (ATCC Accession Number HB-12243), 1E11 (ATCC
Accession Number HB-12248) and 1C11 (ATCC Accession Number
HB-12250).
52. The method of claim 40 wherein at least one of said antibodies
produced in step (a) comprises hypervariable region residues of
clone 3 antibody (SEQ ID NO: 48).
53. The method of claim 40 wherein at least one of said antibodies
produced in step (a) comprises hypervariable region residues of
clone 4 antibody (SEQ ID NO: 49).
54. The method of claim 40 wherein at least one of said antibodies
produced in step (a) comprises hypervariable region residues of
clone 17 antibody (SEQ ID NO: 50).
55. The method of claim 40 wherein said antibodies produced in step
(a) are monoclonal antibodies.
56. The method of claim 40 wherein at least one of said antibodies
produced in step (a) is a human antibody.
57. The method of claim 40 wherein at least one of said antibodies
produced in step (a) is a humanized antibody.
58. The method of claim 40 wherein at least one of said antibodies
produced in step (a) is an antibody fragment.
59. The method of claim 58 wherein said antibody fragment is an
F(ab').sub.2.
60. The method of claim 40 further comprising the step of
converting the antibody identified in step (c) into a composition
by admixing it with a physiologically acceptable carrier.
61. The method of claim 60 wherein said composition is sterile.
62. The method of claim 61 wherein said composition is
lyophilized.
63. The method of claim 60 wherein said composition further
comprises a cytokine.
Description
CROSS REFERENCES
[0001] This is a non-provisional application claiming priority to
U.S. application Ser. No. 08/779,457 filed Jan. 7, 1997 which is a
non-provisional application filed under 35 U.S.C. .sctn.1.53(b)
claiming priority under 35 U.S.C. .sctn.119(e) to provisional
application 60/064,855 filed Jan. 8, 1996 which was originally
filed as non-provisional Ser. No. 08/585,005 and later converted to
the provisional. This non-provisional also claims priority under 35
U.S.C. .sctn. 120 to non-provisional application Ser. No.
08/667,197 filed Jun. 20, 1996, all of which applications are
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention pertains generally to the WSX receptor
and ligands and uses for these molecules. In particular, the
invention relates to agonist antibodies which bind to and activate
the WSX receptor.
[0004] 2. Description of Related Art
[0005] Hematopoiesis
[0006] The process of blood cell formation whereby red and white
blood cells are replaced through the division of cells located in
the bone marrow is called hematopoiesis. For a review of
hematopoiesis see Dexter and Spooncer (Ann. Rev. Cell Biol.
3:423-441 (1987)).
[0007] There are many different types of blood cells which belong
to distinct cell lineages. Along each lineage, there are cells at
different stages of maturation. Mature blood cells are specialized
for different functions. For example, erythrocytes are involved in
O.sub.2 and CO.sub.2 transport; T and B lymphocytes are involved in
cell and antibody mediated immune responses, respectively;
platelets are required for blood clotting; and the granulocytes and
macrophages act as general scavengers and accessory cells.
Granulocytes can be further divided into basophils, eosinophils,
neutrophils and mast cells.
[0008] Each of the various blood cell types arises from pluripotent
or totipotent stem cells which are able to undergo self-renewal or
give rise to progenitor cells or Colony Forming Units (CFU) that
yield a more limited array of cell types. As stem cells
progressively lose their ability to self-renew, they become
increasingly lineage restricted. It has been shown that stem cells
can develop into multipotent cells (called "CFC-Mix" by Dexter and
Spooncer, supra). Some of the CFC-Mix cells can undergo renewal
whereas others lead to lineage-restricted progenitors which
eventually develop into mature myeloid cells (e.g., neutrophils,
megakaryocytes, macrophages and basophils). Similarly, pluripotent
stem cells are able to give rise to PreB and PreT lymphoid cell
lineages which differentiate into mature B and T lymphocytes,
respectively. Progenitors are defined by their progeny, e.g.,
granulocyte/macrophage colony-forming progenitor cells (GM-CFU)
differentiate into neutrophils or macrophages; primitive erythroid
burst-forming units (BFU-E) differentiate into erythroid
colony-forming units (CFU-E) which give rise to mature
erythrocytes. Similarly, the Meg-CFU, Eos-CFU and Bas-CFU
progenitors are able to differentiate into megakaryocytes,
eosinophils and basophils, respectively.
[0009] Hematopoietic growth factors (reviewed in Andrea, NEJM
330(12):839-846 (1994)) have been shown to enhance growth and/or
differentiation of blood cells via activation of receptors present
on the surface of blood progenitor cells of the bone marrow. While
some of these growth factors stimulate proliferation of restricted
lineages of blood cells, others enhance proliferation of multiple
lineages of blood cells. For example, erythropoietin (EPO) supports
the proliferation of erythroid cells, whereas interleukin-3 (IL-3)
induces proliferation of erythroid and myeloid lineages and is
therefore considered a multi-lineage factor.
[0010] In recent years, several hematopoietic growth factor
receptors have been isolated. Due to their low abundance and their
existence in both high-affinity and low-affinity forms, biochemical
characterization of these receptors has been hampered.
[0011] Cytokine receptors frequently assemble into multi-subunit
complexes. Sometimes, the .alpha. subunit of this complex is
involved in binding the cognate growth factor and the P-subunit may
contain an ability to transduce a signal to the cell. These
receptors have been assigned to three subfamilies depending on the
complexes formed. Subfamily 1 includes the receptors for
erythropoietin (EPO), granulocyte colony-stimulating factor
(G-CSF), interleukin-4 (IL-4), interleukin-7 (IL-7), growth hormone
(GH) and prolactin (PRL). Ligand binding to receptors belonging to
this subfamily is thought to result in homodimerization of the
receptor. Subfamily 2 includes receptors for IL-3,
granulocyte-macrophage colony-stimulating factor (GM-C SF),
interleukin-5 (IL-5), interleukin-6 (IL-6), leukemia inhibitory
factor (LIF), oncostatin M (OSM) and ciliary neurotrophic factor
(CNTF). Subfamily 2 receptors are heterodimers having an
.alpha.-subunit for ligand binding and .beta.-subunit (either the
shared .beta.-subunit of the IL-3, GM-CSF and IL-5 receptors or the
gp130 subunit of the IL-6, LIF, OSM and CNTF receptors) for signal
transduction. Subfamily 3 contains only the interleukin-2 (IL-2)
receptor. The .beta. and .gamma. subunits of the IL-2 receptor
complex are cytokine-receptor polypeptides which associate with the
.alpha.-subunit of the unrelated Tac antigen.
[0012] Obesity
[0013] Obesity is the most common nutritional disorder which,
according to recent epidemiologic studies, affects about one third
of all Americans 20 years of age or older. Kuczmarski et al., J.
Am. Med. Assoc. 272:205-11 (1994). Obesity is responsible fora
variety of serious health problems, including cardiovascular
disorders, type II diabetes, insulin-resistance, hypertension,
hypertriglyceridemia, dyslipoproteinemia, and some forms of cancer.
Pi-Sunyer, F., Anns. Int. Med. 119: 655-60 (1993); Colfitz, G., Am.
J. Clin. Nutr. 55:503S-507S (1992). A single-gene mutation (the
obesity or "ob" mutation) has been shown to result in obesity and
type II diabetes in mice. Friedman, Genomics 11:1054-1062
(1991).
[0014] Zhang et al., Nature 372:425-431 (1994) have recently
reported the cloning and sequencing of the mouse ob gene and its
human homologue, and suggested that the ob gene product, leptin or
OB protein, may function as part of a signalling pathway from
adipose tissue that acts to regulate the size of the body fat
depot. Parabiosis experiments performed more than 20 years ago
predicted that the genetically obese mouse containing two mutant
copies of the ob gene (ob/ob mouse) does not produce a satiety
factor which regulates its food intake, while the diabetic (db/db)
mouse produces but does not respond to a satiety factor. Coleman
and Hummal, Am. J. Physiol. 217:1298-1304 (1969); Coleman, Diabetol
9:294-98 (1973). Recent reports by three independent research teams
have demonstrated that daily injections of recombinant OB protein
inhibit food intake and reduce body weight and fat in grossly obese
ob/ob mice but not in db/db mice (Pelleymounter et al., Science
269:540-43 (1995); Halaas et al., Science 269:543-46 (1995);
Campfield et al., Science 269: 546-49 (1995)), suggesting that the
OB protein is such a satiety factor as proposed in early
cross-circulation studies.
[0015] Researchers suggest that at least one OB receptor is
localized in the brain. The identification and expression cloning
of a leptin receptor (OB-R) was reported by Tartaglia et al. Cell
83:1263-71 (1995). Various isoforms of a OB receptor are described
by Cioffi et al. Nature 2:585-89(1996). See, also, WO 96/08510.
[0016] The mouse db gene has recently been cloned (Lee et al.
Nature 379:632 (1996) and Chen et al. Cell 84:491-495 (1996)).
Previous data had suggested that the db gene encoded the receptor
for the obese (ob) gene product, leptin (Coleman et al.,
Diebetologia 9:294-8 (1973) and Coleman et al., Diebetologia
14:141-8 (1978)). It has been very recently confirmed that the
db/db mouse results from a truncated splice variant of the OB
receptor which likely renders the receptor defective in signal
transduction (Lee et al., Nature 379:632 (1996) and Chen et al.,
Cell 84: 491-495 (1996)).
SUMMARY OF THE INVENTION
[0017] This application relates to agonist antibodies which
specifically bind to the WSX receptor and mimic one or more
biological activities of naturally occurring WSX ligand, OB
protein. Preferred antibodies are those with a strong binding
affinity for human WSX receptor (e.g. having a Kd of no more than
about 1.times.10.sup.8M; and preferably no more than about
1.times.10.sup.9M). In preferred embodiments, the agonist antibody
binds to both human and murine WSX receptor.
[0018] Antibodies with defined agonistic activity in a bioassay,
the KIRA ELISA, are disclosed herein. Preferred antibodies have an
IC50 in the KIRA ELISA of about 0.5 micrograms/ml or less,
preferably about 0.2 micrograms/ml or less, and most preferably
about 0.1 micrograms/ml or less.
[0019] The agonist antibodies of interest herein may have one or
more of the biological characteristics of antibody 2D7, 1G4, 1E11
or 1C11 (see Example 13) or clones 3, 4, or 17 (see Example 14).
For example, the antibody may bind to the epitope bound by any one
of these antibodies, and/or may have some or all of the
hypervariable region residues of these antibodies.
[0020] The agonist antibody may be one which decreases body weight
and/or fat-depot weight and/or food intake in an obese mammal (e.g.
in an ob/ob mouse). The preferred agonist antibody is one which
exerts an adipose-reducing effect in an obese mammal (e.g. an ob/ob
mouse) which is in excess of that induced by a reduction in food
intake (Levin et al. Proc. Natl. Acad. Sci. USA 93:1726-1730
(1996)).
[0021] The agonist antibody may also have the property of inducing
differentiation and/or proliferation and/or survival of
hematopoietic progenitor cells. For example, the agonist antibody
may induce lymphopoiesis, erythropoiesis and/or myelopoiesis.
[0022] The invention further provides a composition comprising the
agonist antibody and a physiologically acceptable carrier. The
composition for therapeutic use is sterile and may be lyophilized.
For use in hematopoiesis, for example, the composition may further
comprise a cytokine.
[0023] In another aspect, the invention provides a method for
activating the WSX receptor which comprises exposing the WSX
receptor to an amount of an agonist anti-WSX receptor antibody
which is effective for activating the WSX receptor. The invention
further provides a method for enhancing proliferation and/or
differentiation of a cell which expresses the WSX receptor at its
cell surface comprising exposing the cell to an amount of exogenous
agonist anti-WSX receptor antibody which is effective for enhancing
proliferation and/or differentiation of the cell. In another
embodiment, the invention provides a method for decreasing body
weight and/or fat-depot weight and/or food intake in an obese
mammal (e.g. a human) comprising administering an effective amount
of the agonist antibody to the mammal. Also, the invention provides
a method for treating the medical sequelae of obesity in a mammal,
such as, e.g., arteriosclerosis, Type II diabetes, polycystic
ovarian disease, cardiovascular diseases, osteoarthritis,
dermatological disorders, hypertension, insulin resistance,
hypercholesterolemia, hypertriglyceridemia, cancer and
cholelithiasis, comprising administering an effective amount of an
agonist anti-WSX receptor antibody to the mammal. The mammal to be
treated may be one diagnosed with any one or more of these
diseases, or may be predisposed to these diseases.
[0024] In another aspect, the present invention pertains to the
discovery herein that WSX ligands, such as obesity (OB) protein,
play a role in hematopoiesis via signalling through the WSX
receptor. The role of the WSX receptor-ligand signalling pathway
appears to be at the level of the early hematopoietic precursor as
is evident by the ability of OB protein to simulate myelopoiesis,
erythropoiesis (e.g. splenic erythropoiesis) and most dramatically,
lymphopoiesis. Accordingly, WSX ligands can be used to stimulate
proliferation and/or differentiation and/or survival of
hematopoietic progenitor cells either in vitro or in vivo (e.g. for
treating hematopoietic diseases or disorders).
[0025] Thus, the invention provides a method for stimulating
proliferation and/or differentiation of a cell which expresses the
WSX receptor (especially the WSX receptor variant 13.2, which is
demonstrated herein to have the capacity to transmit a
proliferative signal) at its cell surface comprising the step of
contacting the WSX receptor with an amount of WSX ligand which is
effective for stimulating proliferation and/or OB protein
differentiation of the cell. In prefered embodiments, the cell
which is exposed to the WSX ligand is a hematopoeitic precursor,
e.g. a CD34+ cell. The WSX ligand may be OB protein or an agonist
antibody which binds to the WSX receptor. For in vivo use, the WSX
ligand of choice may be a long half-life derivative of an OB
protein, such as OB-immunoglobulin chimera and/or OB protein
modified with a nonproteinaceous polymer, such as polyethylene
glycol (PEG). The method contemplated herein may lead to an
increase in the proliferation and/or differentiation of lymphoid,
myeloid and/or erythroid blood cell lineages and encompasses both
in vitro and in vivo methods. For in vitro uses, the cell
possessing the WSX receptor may be present in cell culture. As to
in vivo methods, the cell may be present in a mammal, especially a
human (e.g. one who is suffering from decreased blood levels and
who could benefit from an increase in various blood cells).
Potential patients include those who have undergone chemo- or
radiation therapy, or bone marrow transplantation therapy. Thus,
the invention provides a method for repopulating blood cells (e.g.
erythroid, myeloid and/or lymphoid blood cells) in a mammal
comprising administering to the mammal a therapeutically effective
amount of a WSX ligand.
[0026] Mammals which may benefit from an enhancement of
lymphopoiesis include those predisposed to, or suffering from, any
ony or more of the following exemplary conditions: lymphocytopenia;
lymphorrhea; lymphostasis; immunodeficiency (e.g. HIV and AIDS);
infections (including, for example, opportunistic infections and
tuberculosis (TB)); lupus; and other disorders characterized by
lymphocyte deficiency. An effective amount of the WSX ligand can be
used in a method of immunopotentiation or to improve immune
function in a mammal.
[0027] On the other hand, WSX receptor or WSX ligand antagonists
(such as WSX receptor ECD or immunoadhesin, and WSX receptor or OB
protein neutralizing antibodies) may be used in the treatment of
those disorders wherein unacceptable lymphocyte levels are present
in the mammal, particularly where this is caused by excessive
activation of the WSX receptor. Examples of conditions in which
administration of such an antagonist may be beneficial include:
neoplastic disorders (such as Hodkin's disease; lymphosarcoma;
lymphoblastoma; lymphocytic leukemia; and lymphoma) and
lymphocytosis.
[0028] Diseases or disorders in which an increase in erythropoiesis
may be beneficial include, but are not limited to:
erythrocytopenia; erthrodegenerative disorders; erythroblastopenia;
leukoerythroblastosis; erythroclasis; thalassemia; and anemia (e.g.
hemolytic anemia, such as acquired, autoimmune, or microangiopathic
hemolytic anemia; aplastic anemia; congenital anemia, e.g.,
congenital dyserythropoietic anemia, congenital hemolytic anemia or
congenital hypoplastic anemia; dyshemopoietic anemia; Faconi's
anemia; genetic anemia; hemorrhagic anemia; hyperchromic or
hypochromic anemia; nutritional, hypoferric, or iron deficiency
anemia; hypoplastic anemia; infectious anemia; lead anemia; local
anemia; macrocytic or microcytic anemia; malignant or pernicious
anemia; megaloblastic anemia; molecular anemia; normocytic anemia;
physiologic anemia; traumatic or posthemorrhagic anemia; refractory
anemia; radiation anemia; sickle cell anemia; splenic anemia; and
toxic anemia).
[0029] Conversely, WSX receptor or WSX ligand antagonists may be
used to treat those conditions in which excessive erythrocyte
levels are present in a mammal, e.g. in neoplastic disorders such
as erythroleukemia; erythroblastosis; and erythrocythemia or
polycythemia.
[0030] An increase in myelopoiesis may be beneficial in any of the
above-mentioned diseases or disorders as well as the following
exemplary conditions: myelofibrosis; thrombocytopenia; hypoplasia;
disseminated intravascular coagulation (DIC); immune (autoimmune)
thrombocytopenic purpura (ITP); HIV induced ITP; myelodysplasia;
thrombocytotic diseases and thrombocytosis.
[0031] Antagonists of the WSX receptor-WSX ligand interaction may
also be used to treat myeloid cell-related conditions such as
malignancies (e.g. myelosarcoma, myeloblastoma, myeloma,
myeloleukemia and myelocytomatosis); myeloblastosis; myelocytosis;
and myelosis.
[0032] The method may further involve the step of exposing
hematopoeitic cells (whether they be in cell culture or in a
mammal) to one or more other cytokines (e.g. lineage-specific
cytokines) and this may lead to a synergistic enhancement of the
proliferation and/or differentiation of the cells. Exemplary
cytokines include thrombopoietin (TPO); erythropoietin (EPO);
macrophage-colony stimulating factor (M-CSF);
granulocyte-macrophage-CSF (GM-CSF); granulocyte-CSF (G-CSF);
interleukin-1 (IL-1); IL-alpha; IL-2; IL-3; IL-4; IL-5; 1L-6; IL-7;
1L-8; IL-9; IL-11; IL10; IL-12; leukemia inhibitory factor (LIF) or
kit ligand (KL). In this embodiment, exposure to the cytokine may
proceed, occur simultaneously with, or follow, exposure to the WSX
ligand. Preferably, the WSX ligand and one or more further
cytokines are administered simultaneously to the patient (where the
method is an in vivo one) and, optionally, are combined to form a
pharmaceutical composition.
[0033] For use in the above methods, the invention also provides an
article of manufacture, comprising: a container; a label on the
container; and a composition comprising an active agent within the
container; wherein the composition is effective for enhancing
proliferation and/or differentiation of cells comprising the WSX
receptor in a mammal, the label on the container indicates that the
composition can be used for enhancing proliferation and/or
differentiation of those cells and the active agent in the
composition is a WSX ligand. Optionally, the article of manufacture
includes one or more further containers which hold further
cytokine(s) in a packaged combination with the container holding
the WSX ligand.
[0034] In another embodiment, an effective amount of the WSX ligand
may be used to improve engraftment in bone marrow transplantation
or to stimulate mobilization of hematopoietic stem cells in a
mammal prior to harvesting hematopoietic progenitors from the
peripheral blood thereof.
[0035] According to a further aspect, the invention is concerned
with the WSX cytokine receptor and a soluble form of the receptor
which is the WSX receptor extracellular domain (ECD). The WSX
receptor polypeptides are optionally conjugated with, or fused to,
molecules which increase the serum half-lives thereof and can be
formulated as pharmaceutical compositions comprising the
polypeptide and a physiologically acceptable carrier.
[0036] In certain embodiments, the WSX receptor ECD may be used as
an antagonist insofar as it may bind to WSX ligand and thereby
reduce activation of endogenous WSX receptor. This may be useful in
conditions characterized by excess levels of WSX ligand and/or
excess WSX receptor activation in a mammal. WSX receptor ECD may,
for example, be used to treat metabolic disorders (e.g., anorexia
or steroid-induced truncalobesity), stem cell tumors and other
tumors which express WSX receptor.
[0037] Pharmaceutical compositions of the WSX receptor ECD may
further include a WSX ligand. Such dual compositions may be
beneficial where it is therapeutically useful to prolong the
half-life of WSX ligand and/or activate endogenous WSX receptor
directly as a heterotrimeric complex.
[0038] The invention also relates to chimeric WSX receptor
molecules, such as WSX receptor immunoadhesins (having long
half-lives in the serum of a patient treated therewith) and epitope
tagged WSX receptor. Immunoadhesins may be employed as WSX receptor
antagonists in conditions or disorders in which neutralization of
WSX receptor biological activity may be beneficial. Bispecific
immunoadhesins (combining a WSX receptor ECD with a domain of
another cytokine receptor) may form high affinity binding complexes
for WSX ligand.
[0039] The invention further provides methods for identifying a
molecule which binds to and/or activates the WSX receptor. This is
useful for discovering molecules (such as peptides, antibodies, and
small molecules) which are agonists or antagonists of the WSX
receptor. Such methods generally involve exposing an immobilized
WSX receptor to a molecule suspected of binding thereto and
determining binding of the molecule to the immobilized WSX receptor
and/or evaluating whether or not the molecule activates (or blocks
activation of) the WSX receptor. In order to identify such WSX
ligands, the WSX receptor may be expressed on the surface of a cell
and used to screen libraries of synthetic compounds and naturally
occurring compounds (e.g., endogenous sources of such naturally
occurring compounds, such as serum). The WSX receptor can also be
used as a diagnostic tool for measuring serum levels of endogenous
WSX ligand.
[0040] In a further embodiment, a method for purifying a molecule
which binds to the WSX receptor is provided. This can be used in
the commercial production and purification of therapeutically
active molecules which bind to this receptor. In the method, the
molecule of interest (generally a composition comprising one or
more contaminants) is adsorbed to immobilized WSX receptor (e.g.,
WSX receptor immunoadhesin immobilized on a protein A column). The
contaminants, by virtue of their inability to bind to the WSX
receptor, will generally flow through the column. Accordingly, it
is then possible to recover the molecule of interest from the
column by changing the elution conditions, such that the molecule
no longer binds to the immobilized receptor.
[0041] In further embodiments, the invention provides antibodies
that specifically bind to the WSX receptor. Preferred antibodies
are monoclonal antibodies which are non-immunogenic in a human and
bind to an epitope in the extracellular domain of the receptor.
Preferred antibodies bind the WSX receptor with an affinity of at
least about 106 L/mole, more preferably 107 L/mole.
[0042] Antibodies which bind to the WSX receptor may optionally be
fused to a heterologous polypeptide and the antibody or fusion
thereof may be used to isolate and purify WSX receptor from a
source of the receptor.
[0043] In a further aspect, the invention provides a method for
detecting the WSX receptor in vitro or in vivo comprising
contacting the antibody with a sample suspected of containing the
receptor and detecting if binding has occurred. Based on the
observation herein that CD34+ cells possess WSX receptor, use of
WSX antibodies for identification and/or enrichment of stem cell
populations (in a similar manner to that in which CD34 antibodies
are presently used) is envisaged.
[0044] For certain applications, it is desirable to have an agonist
antibody which can be screened for as described herein. Such
agonist antibodies are useful for activating the WSX receptor for
in vitro uses whereby enhancement of proliferation and/or
differentiation of a cell comprising the receptor is desired.
Furthermore, these antibodies may be used to treat conditions in
which an effective amount of WSX receptor activation leads to a
therapeutic benefit in the mammal treated therewith. For example,
the agonist antibody can be used to enhance survival, proliferation
and/or differentiation of a cell comprising the WSX receptor. In
particular, agonist antibodies and other WSX ligands may be used to
stimulate proliferation of stem cells/progenitor cells either in
vitro or in vivo. Other potential therapeutic applications include
the use of agonist antibodies to treat metabolic disorders (such as
obesity and diabetes) and to promote kidney, liver or lung growth
and/or repair (e.g., in renal failure).
[0045] For therapeutic applications it is desirable to prepare a
composition comprising the agonist antibody and a physiologically
acceptable carrier. Optionally, such a composition may further
comprise one or more cytokines.
[0046] In other embodiments, the antibody is a neutralizing
antibody. Such molecules can be used to treat conditions
characterized by unwanted or excessive activation of the WSX
receptor.
[0047] In addition to the above, the invention provides isolated
nucleic acid molecules, expression vectors and host cells encoding
the WSX receptor which can be used in the recombinant production of
WSX receptor as described herein. The isolated nucleic acid
molecules and vectors are also useful for gene therapy applications
to treat patients with WSX receptor defects and/or to increase
responsiveness of cells to WSX ligand.
BRIEF DESCRIPTION OF THE DRAWINGS
[0048] FIGS. 1A-H together depict the double stranded nucleotide
(SEQ ID NO:1) and deduced amino acid sequence (SEQ ID NO:2)
encoding full length human WSX receptor variant 13.2. Nucleotides
are numbered at the beginning of the sense strand. Amino acid
residues are numbered at the beginning of the amino acid sequence.
Restriction enzyme sites are depicted above the nucleotide
sequence.
[0049] FIGS. 2A-B together depict an amino acid sequence alignment
of full length human WSX receptor variants 6.4 (SEQ ID NO:3), 12.1
(SEQ ID NO:4) and 13.2, respectively. Homologous residues are
boxed. WSX receptor variants 6.4, 12.1 and 13.2 are native sequence
human WSX receptor variants which, without being bound to any one
theory, appear to be generated by alternate splicing of WSX
receptor mRNA. The putative signal peptide, transmembrane, Box 1,
Box 2, and Box 3 domains are indicated. The extracellular and
cytoplasmic domains are amino- and carboxy-terminal, respectively,
to the transmembrane domain. The Box 1-3 domains shown correspond
to the box 1-3 motifs described in Baumann et al., Mol. Cell. Biol.
14(1): 138-146 (1994).
[0050] FIGS. 3A-E together depict an alignment of the nucleotide
sequences encoding human WSX receptor variants 6.4 (SEQ ID NO:5),
12.1 (SEQ ID NO:6) and 13.2, respectively.
[0051] FIGS. 4A-B depict an alignment of the full length human WSX
receptor variant 13.2 amino acid sequence (top) with that of
partial murine WSX receptor extracellular domain sequence (bottom)
(SEQ ID NO:7) obtained as described in Example 7. The putative
murine signal peptide is marked with an arrow.
[0052] FIGS. 5A-F represent an alignment of the nucleotide
sequences encoding human WSX receptor variant 13.2 (bottom) and
partial murine WSX receptor extracellular domain (top) (SEQ ID NO:
8), respectively.
[0053] FIG. 6 is a bar graph depicting results of the thymidine
incorporation assay described in Example 5. .sup.3H-thymidine
incorporation (counts per minute, CPM) in parental Baf3 cells or
Baf3 cells electroporated with GH/WSX variant 13.2 chimera in the
presence of varying concentrations of human growth hormone (GH) is
shown.
[0054] FIG. 7 shows the human and murine oligonucleotides (SEQ ID
NOS:9-38, respectively) used for the antisense experiment described
in Example 8.
[0055] FIGS. 8 and 9 show thymidine incorporation assays in Baf-3
cells. For these assays, cells were deprived of IL-3 for 16-18
hours (in RPMI 1640 supplemented with 10% fetal calf serum (FCS)).
Cells were washed in serum free RPMI 1640 and plated at 50,000
cells per well in 0.2 mls of serum free RPMI 1640 supplemented with
the indicated concentration of human GH or human OB protein. Cells
were stimulated for 24 hours and thymidine incorporation was
determined as described (Zeigler et al. Blood 84:2422-2430 (1994)).
Assays were performed in triplicate and the results were confirmed
in three independent experiments.
[0056] In FIG. 8, GH receptor-WSX receptor variant 12.1 or 13.2
chimeric proteins were expressed in Baf-3 cells as described in
Example 5. These transfected cells and the parental Baf-3 line were
stimulated with hGH and the incorporation of titrated thymidine
determined.
[0057] In FIG. 9, Baf-3 cells were stably transfected with WSX
receptor variant 13.2. Thymidine incorporation was then determined
in these cell lines following stimulation with human OB
protein.
[0058] In FIGS. 10A-C, murine fetal liver
AA4.sup.+Sca.sup.+Kit.sup.+ (flASK) stem cells were cultured in
suspension culture or methylcellulose. In FIG. 10A, flASK cells
were cultured in suspension culture containing serum with kit
ligand (KL) or kit ligand and OB protein. Cell counts and cytospin
analyses were performed 7 days later. In FIG. 10B, flASK cells were
seeded into methylcellulose under either myeloid or lymphoid
conditions as described in Example 10. Colony counts were performed
14 days later. For colonies produced under lymphoid conditions,
FACS analysis demonstrated the vast majority of cells to be B220
positive. In FIG. 10C, flASK cells were seeded into methylcellulose
containing kit ligand. To this base media, erythropoietin (EPO) or
erythropoietin and OB protein were then added. The resultant
colonies were counted 14 days later. FACS analysis demonstrated
approximately 95% of these colonies to be TER 119 positive. All
assays were performed in triplicate and confirmed in at least three
independent experiments.
[0059] FIG. 11 illustrates methylcellulose assays to determine the
colony forming potential of db/db, ob/ob and the corresponding
wild-type marrow. 100,000 bone marrow cells were seeded into
methylcellulose and the resultant colonies counted after 14 days.
Assays were performed using both myeloid and lymphoid conditions.
Assays were performed in triplicate and the experiments were
repeated a minimum of 3 times.
[0060] FIGS. 12A-B show bone marrow cellular profiles in wild-type
misty gray homozygotes, misty gray/db heterozygotes, and homozygote
db/db mice. Overall cellularity in the db/db marrow was unchanged
compared to controls. FIG. 12A shows cellular profiles determined
using anti-B220, anti-CD43, and anti-TER119 antibodies. FIG. 12B
shows cellular profiles of the spleens from the above groups.
[0061] FIGS. 13A-C are an analysis of peripheral blood in db/db
homozygotes, db/db misty gray heterozygotes and misty gray
homozygotes. 40 microliters of peripheral blood was taken via
orbital bleed and analyzed on a Serrono Baker system 9018. All
areas described by the boxes represent the mean.+-.one standard
deviation of the two parameters.
[0062] FIG. 14 is a comparison of peripheral lymphocyte counts and
blood glucose level. Five groups of animals, misty-gray,
misty-gray/db, db/db, interferon .alpha.-tmmsgenic, and glucokinase
transgenic heterozygote mice (gLKa) were sampled via retro-orbital
bleed. Blood glucose levels in these mice were determined. All
areas described by the boxes represent the mean.+-.standard
deviation of the two parameters.
[0063] In FIGS. 15A-C, misty gray homozygotes, db/misty gray
heterozygotes, and homozygous db/db mice were subjected to
sub-lethal irradiation and the recovery kinetics of the peripheral
blood was determined via retro-orbital bleeds.
[0064] FIGS. 16A-16Q together show the nucleotide sequence (SEQ ID
NO:46) and the amino acid sequence (SEQ ID NO: 47) of the human
OB-immunoglobulin chimera in the plasmid described in of Example
11.
[0065] FIG. 17 shows binding of anti-WSX receptor agonist
antibodies to human WSX receptor. The anti-WSX receptor agonist
antibodies (2D7 and 1G4) produced as described in Example 13 and an
IgG isotope control were evaluated for their ability to bind to
human WSX receptor by capture ELISA.
[0066] FIG. 18 shows the activity of mAbs 2D7 and 1G4 as well as OB
protein in the KIRA ELISA (see Example 13). Absorbance at 490 nm
versus concentration of antibody or ligand in this assay is
shown.
[0067] FIG. 19 depicts binding of anti-WSX receptor agonist
antibodies to murine WSX receptor. The anti-WSX receptor agonist
antibodies (2D7 and 1G4) and an IgG isotope control were evaluated
for their ability to bind to murine WSX receptor by capture
ELISA.
[0068] FIGS. 20A-B show the results of epitope mapping of the
agonist anti-WSX receptor antibodies produced as described in
Example 13. FIG. 20A shows blocking ability of anti-WSX receptor
antibodies on Epitope A using biotinylated 2D7. FIG. 20B shows
blocking ability of anti-WSX receptor antibodies on Epitope B using
biotinylated 1C11. Based on the competitive binding ELISA, 2D7
bound a different epitope from 1E11, 1C11 and 1G4.
[0069] FIG. 21 depicts an alignment of the amino acid sequences of
full length human WSX receptor variant 6.4 (hWSXR) (SEQ ID NO:3)
and murine WSX receptor (mWSXR) (SEQ ID NO:51).
[0070] FIG. 22 is a standard curve for human OB protein in the KIRA
ELISA, which illustrates schematically inside the graph WSX
receptor KIRA ELISA panning with scFv phage as described in Example
14.
[0071] FIG. 23 shows the activity of clone # 3, #4 and # 17 scFv
phage from Example 14 and anti-HER2 scFv phage control in the KIRA
ELISA. Absorbance versus phage titer is shown.
[0072] FIG. 24 shows the activity of clone # 3, #4 and # 17 scFv
from Example 14, anti-HER2 scFv control (Her2 clone) and OB protein
in the KIRA ELISA. Absorbance versus antibody concentration is
shown.
[0073] FIG. 25 aligns the amino acid sequences of agonist antibody
clone #3 (3.scFv) (SEQ ID NO:48), clone #4 (4.scFv) (SEQ ID NO:49)
and clone #17 (17.scFv) (SEQ ID NO:50) obtained as described in
Example 14. Complementarity determining region (CDR) residues
according to Kabat et al., Sequences of Proteins oflmmunological
Interest. 5th Ed. Public Health Service, National Institutes of
Health, Bethesda, Md. (1991) are underlined and hypervariable loop
residues (Chothia et al., Nature 342:8767 (1989)) are in
italics.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0074] Definitions
[0075] In describing the present invention, the following terms
will be employed, and are intended to be defined as indicated
below.
[0076] The terms "WSX receptor" or "WSX receptor polypeptide" when
used herein encompass native sequence WSX receptor; WSX receptor
variants; WSX extracellular domain; and chimeric WSX receptor (each
of which is defined herein). Optionally, the WSX receptor is not
associated with native glycosylation. "Native glycosylation" refers
to the carbohydrate moieties which are covalently attached to WSX
receptor when it is produced in the mammalian cell from which it is
derived in nature. Accordingly, human WSX receptor produced in a
non-human cell is an example of a WSX receptor which is "not
associated with native glycosylation". Sometimes, the WSX receptor
is unglycosylated (e.g., as a result of being produced
recombinantly in a prokaryote).
[0077] "WSX ligand" is a molecule which binds to and activates
native sequence WSX receptor (especially WSX receptor variant
13.2). The ability of a molecule to bind to WSX receptor can be
determined by the ability of a putative WSX ligand to bind to WSX
receptor immunoadhesin (see Example 2) coated on an assay plate,
for example. The thymidine incorporation assay provides a means for
screening for WSX ligands which activate the WSX receptor.
Exemplary WSX ligands include anti-WSX receptor agonist antibodies
and OB protein (e.g., described in Zhang et al. Nature 372:425-431
(1994)).
[0078] The terms "OB protein" and "OB" are used interchangeably
herein and refer to native sequence OB proteins (also known as
"leptins") and their functional derivatives.
[0079] A "native sequence" polypeptide is one which has the same
amino acid sequence as a polypeptide (e.g., WSX receptor or OB
protein) derived from nature. Such native sequence polypeptides can
be isolated from nature or can be produced by recombinant or
synthetic means. Thus, a native sequence polypeptide can have the
amino acid sequence of naturally occurring human polypeptide,
murine polypeptide, or polypeptide from any other mammalian
species.
[0080] The term "native sequence WSX receptor" specifically
encompasses naturally-occurring truncated forms of the WSX
receptor, naturally-occurring variant forms (e.g., alternatively
spliced forms such as human WSX receptor variants 6.4, 12.1 and
13.2 described herein) and naturally-occurring allelic variants of
the WSX receptor. The preferred native sequence WSX receptor is a
mature native sequence human WSX receptor, such as human WSX
receptor variant 6.4, human WSX receptor variant 12.1 or human WSX
receptor variant 13.2 (each shown in FIGS. 2A-B). Most preferred is
mature human WSX receptor variant 13.2.
[0081] The term "native sequence OB protein" includes those OB
proteins from any animal species (e.g. human, murine, rabbit, cat,
cow, sheep, chicken, porcine, equine, etc.) as occurring in nature.
The definition specifically includes variants with or without a
glutamine at amino acid position 49, using the amino acid numbering
of Zhang et al., supra. The term "native sequence OB protein"
includes the native proteins with or without the initiating
N-terminal methionine (Met), and with or without the native signal
sequence, either in monomeric or in dimeric form. The native
sequence human and murine OB proteins known in the art are 167
amino acids long, contain two conserved cysteines, and have the
features of a secreted protein. The protein is largely hydrophilic,
and the predicted signal sequence cleavage site is at position 21,
using the amino acid numbering of Zhang et al., supra. The overall
sequence homology of the human and murine sequences is about 84%.
The two proteins show a more extensive identity in the N-terminal
region of the mature protein, with only four conservative and three
non-conservative substitutions among the residues between the
signal sequence cleavage site and the conserved Cys at position
117. The molecular weight of OB protein is about 16 kD in a
monomeric form.
[0082] The "WSX receptor extracellular domain" (ECD) is a form of
the WSX receptor which is essentially free of the transmembrane and
cytoplasmic domains of WSX receptor, i.e., has less than 1% of such
domains, preferably 0.5 to 0% of such domains, and more preferably
0.1 to 0% of such domains. Ordinarily, the WSX receptor ECD will
have an amino acid sequence having at least about 95% amino acid
sequence identity with the amino acid sequence of the ECD of WSX
receptor indicated in FIGS. 2A-B for human WSX receptor variants
6.4, 12.1 and 13.2, preferably at least about 98%, more preferably
at least about 99% amino acid sequence identity, and thus includes
WSX receptor variants as defined below.
[0083] A "variant" polypeptide means a biologically active
polypeptide as defined below having less than 100% sequence
identity with a native sequence polypeptide (e.g., WSX receptor
having the deduced amino acid sequence shown in FIGS. 1A-H for
human WSX receptor variant 13.2). Such variants include
polypeptides wherein one or more amino acid residues are added at
the N- or C-terminus of, or within, the native sequence; from about
one to thirty amino acid residues are deleted, and optionally
substituted by one or more amino acid residues; and derivatives of
the above polypeptides, wherein an amino acid residue has been
covalently modified so that the resulting product has a
non-naturally occurring amino acid. Ordinarily, a biologically
active WSX receptor variant will have an amino acid sequence having
at least about 90% amino acid sequence identity with human WSX
receptor variant 13.2 shown in FIGS. 1A-H, preferably at least
about 95%, more preferably at least about 99%. Ordinarily, a
biologically active OB protein variant will have an amino acid
sequence having at least about 90% amino acid sequence identity
with a native sequence OB protein, preferably at least about 95%,
more preferably at least about 99%.
[0084] A "chimeric" OB protein or WSX receptor is a polypeptide
comprising OB protein or full-length WSX receptor or one or more
domains thereof (e.g., the extracellular domain of the WSX
receptor) fused or bonded to heterologous polypeptide. The chimeric
WSX receptor will generally share at least one biological property
in common with human WSX receptor variant 13.2. The chimeric OB
protein will generally share at least one biological property in
common with a native sequence OB protein. Examples of chimeric
polypeptides include immunoadhesins and epitope tagged
polyeptides.
[0085] The term "WSX immunoadhesin" is used interchangeably with
the expression "WSX receptor-immunoglobulin chimera" and refers to
a chimeric molecule that combines a portion of the WSX receptor
(generally the extracellular domain thereof) with an immunoglobulin
sequence. Likewise, an "OB protein immunoadhesin" or
"OB-immunoglobulin chimera" refers to a chimeric molecule which
combines OB protein (or a portion thereof) with an immunoglobulin
sequence. The immunoglobulin sequence preferably, but not
necessarily, is an immunoglobulin constant domain. The
immunoglobulin moiety in the chimeras of the present invention may
be obtained from IgG1, IgG2, IgG3 or IgG4 subtypes, IgA, IgE, IgD
or IgM, but preferably IgG1 or IgG3.
[0086] The term "epitope tagged" when used herein refers to a
chimeric polypeptide comprising WSX receptor or OB protein fused to
a "tag polypeptide". The tag polypeptide has enough residues to
provide an epitope against which an antibody thereagainst can be
made, yet is short enough such that it does not interfere with
biological activity of the WSX receptor or OB protein. The tag
polypeptide preferably also is fairly unique so that the antibody
thereagainst does not substantially cross-react with other
epitopes. Suitable tag polypeptides generally have at least six
amino acid residues and usually between about 8-50 amino acid
residues (preferably between about 9-30 residues).
[0087] "Isolated" WSX receptor (or OB protein) means WSX receptor
(or OB protein) that has been purified from a WSX receptor (or OB
protein) source or has been prepared by recombinant or synthetic
methods and is sufficiently free of other peptides or proteins (1)
to obtain at least 15 and preferably 20 amino acid residues of the
N-terminal or of an internal amino acid sequence by using a
spinning cup sequenator or the best commercially available amino
acid sequenator marketed or as modified by published methods as of
the filing date of this application, or (2) to homogeneity by
SDS-PAGE under non-reducing or reducing conditions using Coomassie
blue or, preferably, silver stain. Homogeneity here means less than
about 5% contamination with other source proteins.
[0088] "Essentially pure" protein means a composition comprising at
least about 90% by weight of the protein, based on total weight of
the composition, preferably at least about 95% by weight.
"Essentially homogeneous" protein means a composition comprising at
least about 99% by weight of protein, based on total weight of the
composition.
[0089] "Biological property" when used in conjunction with either
"WSX receptor" or "isolated WSX receptor" means having an effector
or antigenic function or activity that is directly or indirectly
caused or performed by native sequence WSX receptor (whether in its
native or denatured conformation). Effector functions include
ligand binding; and enhancement of survival, differentiation and/or
proliferation of cells (especially proliferation of cells).
However, effector functions do not include possession of an epitope
or antigenic site that is capable of cross-reacting with antibodies
raised against native sequence WSX receptor.
[0090] "Biological property" when used in conjunction with either
"OB protein" or "isolated OB protein" means having an effector
function that is directly or indirectly caused or performed by
native sequence OB protein. Effector functions of native sequence
OB protein include WSX receptor binding and activation; and
enhancement of differentiation and/or proliferation of cells
expressing this receptor (as determined in the thymidine
incorporation assay, for example). A "biologically active" OB
protein is one which possesses a biological property of native
sequence OB protein.
[0091] A "functional derivative" of a native sequence OB protein is
a compound having a qualitative biological property in common with
a native sequence OB protein. "Functional derivatives" include, but
are not limited to, fragments of native sequence OB proteins and
derivatives of native sequence OB proteins and their fragments,
provided that they have a biological activity in common with a
corresponding native sequence OB protein. The term "derivative"
encompasses both amino acid sequence variants of OB protein and
covalent modifications thereof.
[0092] The phrase "long half-life" as used in connection with OB
derivatives, concerns OB derivatives having a longer plasma
half-life and/or slower clearance than a corresponding native
sequence OB protein. The long half-life derivatives preferably will
have a half-life at least about 1.5-times longer than a native OB
protein; more preferably at least about 2-times longer than a
native OB protein, more preferably at least about 3-time longer
than a native OB protein. The native OB protein preferably is that
of the individual to be treated.
[0093] An "antigenic function" means possession of an epitope or
antigenic site that is capable of cross-reacting with antibodies
raised against native sequence WSX receptor. The principal
antigenic function of a WSX receptor is that it binds with an
affinity of at least about 106 LImole to an antibody raised against
native sequence WSX receptor. Ordinarily, the polypeptide binds
with an affinity of at least about 10.sup.7 L/mole. The antibodies
used to define "antigenic function" are rabbit polyclonal
antibodies raised by formulating the WSX receptor in Freund's
complete adjuvant, subcutaneously injecting the formulation, and
boosting the immune response by intraperitoneal injection of the
formulation until the titer of the anti-WSX receptor or antibody
plateaus.
[0094] "Biologically active" when used in conjunction with either
"WSX receptor" or "isolated WSX receptor" means a WSX receptor
polypeptide that exhibits or shares an effector function of native
sequence WSX receptor and that may (but need not) in addition
possess an antigenic function. A principal effector function of the
WSX receptor is its ability to induce proliferation of CD34+ human
umbilical cord blood cells in the colony assay described in Example
8.
[0095] "Antigenically active" WSX receptor is defined as a
polypeptide that possesses an antigenic function of WSX receptor
and that may (but need not) in addition possess an effector
function.
[0096] "Percent amino acid sequence identity" is defined herein as
the percentage of amino acid residues in the candidate sequence
that are identical with the residues in the native sequence, after
aligning the sequences and introducing gaps, if necessary, to
achieve the maximum percent sequence identity, and not considering
any conservative substitutions as part of the sequence identity.
None of N-terminal, C-terminal, or internal extensions, deletions,
or insertions into the candidate sequence shall be construed as
affecting sequence identity or homology.
[0097] A "thyrnidine incorporation assay" can be used to screen for
molecules which activate the WSX receptor. In order to perform this
assay, IL-3 dependent Baf3 cells (Palacios et al., Cell, 41:727-734
(1985)) are stably transfected with full length native sequence WSX
receptor as described in Example 4. The WSX receptor/Baf cells so
generated are starved of IL-3 for, e.g., 24 hours in a humidified
incubator at 37.degree. C. in 5% CO.sub.2 and air. Following IL-3
starvation, the cells are plated out in 96 well culture dishes
with, or without, a test sample containing a potential agonist
(such test samples are optionally diluted) and cultured for 24
hours in a cell culture incubator. 20pt[of serum free RPMI media
containing 1 .mu.Ci of .sup.3H thymidine is added to each well for
the last 6-8 hours. The cells are then harvested in 96 well filter
plates and washed with water. The filters are then counted using a
Packard Top Count Microplate Scintillation Counter, for example.
Agonists are expected to induce a statistically significant
increase (to a P value of 0.05) in .sup.3H uptake, relative to
control. Preferred agonists leads to an increase in .sup.3H uptake
which is at least two fold of that of the control.
[0098] An "isolated" WSX receptor nucleic acid molecule is a
nucleic acid molecule that is identified and separated from at
least one contaminant nucleic acid molecule with which it is
ordinarily associated in the natural source of the WSX receptor
nucleic acid. An isolated WSX receptor nucleic acid molecule is
other than in the form or setting in which it is found in nature.
Isolated WSX receptor nucleic acid molecules therefore are
distinguished from the WSX receptor nucleic acid molecule as it
exists in natural cells. However, an isolated WSX receptor nucleic
acid molecule includes WSX receptor nucleic acid molecules
contained in cells that ordinarily express WSX receptor where, for
example, the nucleic acid molecule is in a chromosomal location
different from that of natural cells.
[0099] The expression "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, a ribosome binding site, and
possibly, other as yet poorly understood sequences. Eukaryotic
cells are known to utilize promoters, polyadenylation signals, and
enhancers.
[0100] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are contiguous, and, in the case of a
secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide adaptors or linkers are used
in accordance with conventional practice.
[0101] As used herein, the expressions "cell," "cell line," and
"cell culture" are used interchangeably and all such designations
include progeny. Thus, the words "transformants" and "transformed
cells" include the primary subject cell and cultures derived
therefrom without regard for the number of transfers. It is also
understood that all progeny may not be precisely identical in DNA
content, due to deliberate or inadvertent mutations. Mutant progeny
that have the same function or biological activity as screened for
in the originally transformed cell are included. Where distinct
designations are intended, it will be clear from the context.
[0102] The term "antibody" is used in the broadest sense and
specifically covers monoclonal antibodies, antibody compositions
with polyepitopic specificity, bispecific antibodies, diabodies,
and single-chain molecules, as well as antibody fragments (e.g.,
Fab, F(ab').sub.2, and Fv), so long as they exhibit the desired
biological activity.
[0103] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigenic site. Furthermore, in contrast to conventional
(polyclonal) antibody preparations which typically include
different antibodies directed against different determinants
(epitopes), each monoclonal antibody is directed against a single
determinant on the antigen. In addition to their specificity, the
monoclonal antibodies are advantageous in that they are synthesized
by the hybridoma culture, uncontaminated by other immunoglobulins.
The modifier "monoclonal" indicates the character of the antibody
as being obtained from a substantially homogeneous population of
antibodies, and is not to be construed as requiring production of
the antibody by any particular method. For example, the monoclonal
antibodies to be used in accordance with the present invention may
be made by the hybridoma method first described by Kohler et al.,
Nature 256:495 (1975), or may be made by recombinant DNA methods
(see, e.g., U.S. Pat. No. 4,816,567 (Cabilly et al.)). The
"monoclonal antibodies" may also be isolated from phage antibody
libraries using the techniques described in Clackson et al., Nature
352:624-628 (1991) and Marks et al., J. Mol. Biol. 222:581-597
(1991), for example.
[0104] The monoclonal antibodies herein specifically include
"chimeric" antibodies (immunoglobulins) in which a portion of the
heavy and/or light chain is identical with or homologous to
corresponding sequences in antibodies derived from a particular
species or belonging to a particular antibody class or subclass,
while the remainder of the chain(s) is identical with or homologous
to corresponding sequences in antibodies derived from another
species or belonging to another antibody class or subclass, as well
as fragments of such antibodies, so long as they exhibit the
desired biological activity (Cabilly et al., supra; Morrison et
al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)).
[0105] "Humanized" forms of non-human (e.g., murine) antibodies are
chimeric immunoglobulins, immunoglobulin chains or fragments
thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
antigen-binding subsequences of antibodies) which contain minimal
sequence derived from non-human immunoglobulin. For the most part,
humanized antibodies are human immunoglobulins (recipient antibody)
in which residues from a complementary-determining region (CDR) of
the recipient are replaced by residues from a CDR of a non-human
species (donor antibody) such as mouse, rat or rabbit having the
desired specificity, affinity, and capacity. In some instances, Fv
framework region (FR) residues of the human immunoglobulin are
replaced by corresponding non-human residues. Furthermore,
humanized antibodies may comprise residues which are found neither
in the recipient antibody nor in the imported CDR or framework
sequences. These modifications are made to further refine and
optimize antibody performance. In general, the humanized antibody
will comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all
or substantially all of the FR regions are those of a human
immunoglobulin sequence. The humanized antibody optimally also will
comprise at least a portion of an immunoglobulin constant region
(Fc), typically that of a human immunoglobulin. For further
details, see Jones et al., Nature 321:522-525 (1986); Reichmann et
al., Nature 332:323-329 (1988); and Presta, Curr. Op. Stnict. Biol.
2:593-596 (1992). The humanized antibody includes a Primatized.TM.
antibody wherein the antigen-binding region of the antibody is
derived from an antibody produced by immunizing macaque monkeys
with the antigen of interest.
[0106] The term "hypervariable region" when used herein refers to
the amino acid residues of an antibody which are responsible for
antigen-binding. The hypervariable region comprises amino acid
residues from a "complementarity determining region" or "CDR" (i.e.
residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in the light chain
variable domain and 31-35 (H1), 50-65 (H2) and 95-102 (H3) in the
heavy chain variable domain; Kabat et al., Sequences of Proteins of
Immunological Interest, 5th Ed. Public Health Service, National
Institutes of Health, Bethesda, Md. (1991)) and/or those residues
from a "hypervariable loop" (i.e. residues 26-32 (L1), 50-52 (L2)
and 91-96 (L3) in the light chain variable domain and 26-32 (H1),
53-55 (H2) and 96-101 (H3) in the heavy chain variable domain;
Chothia and Lesk J. Mol. Biol. 196:901-917 (1987)). "Framework" or
"FR" residues are those variable domain residues other than the
hypervariable region residues as herein defined.
[0107] "Non-immunogenic in a human" means that upon contacting the
polypeptide of interest in a physiologically acceptable carrier and
in a therapeutically effective amount with the appropriate tissue
of a human, no state of sensitivity or resistance to the
polypeptide of interest is demonstrable upon the second
administration of the polypeptide of interest after an appropriate
latent period (e.g., 8 to 14 days).
[0108] By "agonist antibody" is meant an antibody which is able to
activate native sequence WSX receptor. The agonist antibody of
particular interest herein is one which mimics one or more (e.g.
all) of the biological properties of naturally occurring WSX
ligand, OB protein. In preferred embodiments, the agonist antibody
has a quantitative biological property of OB protein which is
within about two orders of magnitude, and preferably within about
one order of magnitude, that of OB protein. The agonist antibody
may bind to and activate WSX receptor and thereby stimulate
proliferation and/or differentiation and/or maturation and/or
survival of a cell which expresses the WSX receptor (e.g. WSX
receptor variant 13.2). In this embodiment of the invention, the
agonist antibody may be one which enhances proliferation and/or
differentiation of a hematopoietic progenitor cell which expresses
the WSX receptor at its cell surface; enhances proliferation and/or
differentiation of lymphoid blood cell lineages; enhances
proliferation and/or differentiation of myeloid blood cell
lineages; and/or enhances proliferation and/or differentiation of
erythroid blood cell lineages. The agonist antibody may display
agonist activity upon binding to a chimeric receptor comprising the
WSX receptor extracellular domain in the KIRA ELISA. The agonist
antibody may stimulate .sup.3H uptake in the thymidine
incorporation assay using a signaling WSX receptor (see above);
decrease body weight and/or fat-depot weight and/or food intake in
an obese mammal (e.g. in the ob/ob mouse); effect Ca.sup.2+ influx
in adipocytes; and/or activate downstream signaling molecules of OB
protein.
[0109] A "neutralizing antibody" is one which is able to block or
significantly reduce an effector function of native sequence WSX
receptor or OB protein. For example, a neutralizing antibody may
inhibit or reduce WSX receptor activation by a WSX ligand as
determined in the thymidine incorporation assay or in a KIRA ELISA.
The term "cytotoxic agent" as used herein refers to a substance
that inhibits or prevents the function of cells and/or causes
destruction of cells. The term is intended to include radioactive
isotopes (e.g., I.sup.131, I.sup.125, Y.sup.90 and Re.sup.186),
chemotherapeutic agents, and toxins such as enzymatically active
toxins of bacterial, fungal, plant or animal origin, or fragments
thereof.
[0110] A "chemotherapeutic agent" is a chemical compound useful in
the treatment of cancer. Examples of chemotherapeutic agents
include Adriamycin, Doxorubicin, 5-Fluorouracil, Cytosine
arabinoside ("Ara-C"), Cyclophosphamide, Thiotepa, Taxotere
(docetaxel), Busulfan, Cytoxin, Taxol, Methotrexate, Cisplatin,
Melphalan, Vinblastine, Bleomycin, Etoposide, Ifosfamide, Mitomycin
C, Mitoxantrone, Vincreistine, Vinorelbine, Carboplatin,
Teniposide, Daunomycin, Carminomycin, Aminopterin, Dactinomycin,
Mitomycins, Esperamicins (see U.S. Pat. No. 4,675,187), Melphalan
and other related nitrogen mustards.
[0111] The term "prodrug" as used in this application refers to a
precursor or derivative form of a pharmaceutically active substance
that is less cytotoxic to tumor cells compared to the parent drug
and is capable of being enzymatically activated or converted into
the more active parent form. See, e.g., Wilman, "Prodrugs in Cancer
Chemotherapy" Biochemical Society Transactions, 14,
pp.375-382,615th Meeting Belfast (1986) and Stella et al.,
"Prodrugs: A Chemical Approach to Targeted Drug Delivery," Directed
Drug Delivery, Borchardt et al., (ed.), pp. 247-267, Humana Press
(1985). The prodrugs of this invention include, but are not limited
to, phosphate-containing prodrugs, thiophosphate-containing
prodrugs, sulfate-containing prodrugs, peptide-containing prodrugs,
D-amino acid-modified prodrugs, glycosylated prodrugs,
.beta.-lactam-containing prodrugs, optionally substituted
phenoxyacetamide-containing prodrugs or optionally substituted
phenylacetamide-containing prodrugs, 5-fluorocytosine and other
5-fluorouridine prodrugs which can be converted into the more
active cytotoxic free drug. Examples of cytotoxic drugs that can be
derivatized into a prodrug form for use in this invention include,
but are not limited to, those chemotherapeutic agents described
above.
[0112] An "antagonist" of the WSX receptor and/or OB protein is a
molecule which prevents, or interferes with, binding and/or
activation of the WSX receptor or OB protein. Such molecules can be
screened for their ability to competitively inhibit WSX receptor
activation by OB protein in the thymidine incorporation assay
disclosed herein, for example. Examples of such molecules include:
WSX receptor ECD; WSX receptor immunoadhesin; neutralizing
antibodies against WSX receptor or OB protein; small molecule and
peptide antagonists; and antisense nucleotides against the WSX
receptor or ob gene.
[0113] The phrase "enhancing proliferation of a cell" encompasses
the step of increasing the extent of growth and/or reproduction of
the cell relative to an untreated cell either in vitro or in vivo.
An increase in cell proliferation in cell culture can be detected
by counting the number of cells before and after exposure to a
molecule of interest. The extent of proliferation can be quantified
via microscopic examination of the degree of confluency. Cell
proliferation can also be quantified using the thymidine
incorporation assay described herein.
[0114] By "enhancing differentiation of a cell" is meant the act of
increasing the extent of the acquisition or possession of one or
more characteristics or functions which differ from that of the
original cell (i.e. cell specialization). This can be detected by
screening for a change in the phenotype of the cell (e.g.,
identifying morphological changes in the cell).
[0115] A "hematopoietic progenitor cell" or "primitive
hematopoietic cell" is one which is able to differentiate to form a
more committed or mature blood cell type.
[0116] "Lymphoid blood cell lineages" are those hematopoietic
precursor cells which are able to differentiate to form lymphocytes
(B-cells or T-cells). Likewise, "lymphopoeisis" is the formation of
lymphocytes.
[0117] "Erythroid blood cell lineages" are those hematopoietic
precursor cells which are able to differentiate to form
erythrocytes (red blood cells) and "erythropoeisis" is the
formation of erythrocytes.
[0118] The phrase "myeloid blood cell lineages", for the purposes
herein, encompasses all hematopoietic precursor cells, other than
lymphoid and erythroid blood cell lineages as defined above, and
"myelopoiesis" involves the formation of blood cells (other than
lymphocytes and erythrocytes).
[0119] A "CD34+ cell population" is enriched for hematopoietic stem
cells. A CD34+ cell population can be obtained from umbilical cord
blood or bone marrow, for example. Human umbilical cord blood CD34+
cells can be selected for using immunomagnetic beads sold by
Miltenyi (California), following the manufacturer's directions.
[0120] "Physiologically acceptable" carriers, excipients, or
stabilizers are ones which are nontoxic to the cell or mammal being
exposed thereto at the dosages and concentrations employed. Often
the physiologically acceptable carrier is an aqueous pH buffered
solution. Examples of physiologically acceptable carriers include
buffers such as phosphate, citrate, and other organic acids;
antioxidants including ascorbic acid; low molecular weight (less
than about 10 residues) polypeptides; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, arginine or lysine; monosaccharides, disaccharides, and
other carbohydrates including glucose, mannose, or dextrins;
chelating agents such as EDTA; sugar alcohols such as mannitol or
sorbitol; salt-forming counterions such as sodium; and/or nonionic
surfactants such as Tween, Pluronics or polyethylene glycol
(PEG).
[0121] As used herein, the term "salvage receptor binding epitope"
refers to an epitope of the Fc region of an IgG molecule (e.g.
IgG1, IgG2, IgG3, and IgG4) that is responsible for increasing the
in vivo serum half-life of the IgG molecule. Exemplary salvage
receptor binding epitope sequences include HQNLSDGK (SEQ ID NO:39);
HQNISDGK (SEQ ID NO:40); HQSLGTQ (SEQ ID NO:41); VISSHLGQ (SEQ ID
NO:42); and PKNSSMISNTP (SEQ ID NO:43).
[0122] The term "cytokine" is a generic term for proteins released
by one cell population which act on another cell as intercellular
mediators. Examples of such cytokines are lymphokines, monokines,
and traditional polypeptide hormones. Included among the cytokines
are OB protein; growth hormones such as human growth hormone,
N-methionyl human growth hormone, and bovine growth hormone;
parathyroid hormone; thyroxine; insulin; proinsulin; relaxin;
prorelaxin; glycoprotein hormones such as follicle stimulating
hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing
hormone (LH); hepatic growth factor; fibroblast growth factor;
prolactin; placental lactogen; tumor necrosis factor-.alpha. and
-.beta.; mullerian-inhibiting substance; mouse
gonadotropin-associated peptide; inhibin; activin; vascular
endothelial growth factor; integrin; thrombopoietin (TPO); nerve
growth factors such as NGF-.beta.; platelet-growth factor;
transforming growth factors (TGFs) such as TGF-.alpha. and
TGF-.beta.; insulin-like growth factor-I and -II; erythropoietin
(EPO); osteoinductive factors; interferons such as
interferon-.alpha., .beta., and -.gamma.; colony stimulating
factors (CSFs) such as macrophage-CSF (M-CSF);
granulocyte-macrophage-CSF (GM-CSF); and granulocyte-CSF (G-CSF);
interleukins (ILs) such as IL-1, IL-1a, IL-2, IL-3, IL-4, IL-5,
IL-6, IL-7, IL-8, IL-9, IL-11, IL-12; and other polypeptide factors
including leukemia inhibitory factor (LIF) and kit ligand (KL). As
used herein, the term cytokine includes proteins from natural
sources or from recombinant cell culture and biologically active
equivalents of the native sequence cytokines.
[0123] A "lineage-specific cytokine" is one which acts on
relatively committed cells in the hematopoietic cascade and gives
rise to an expansion in blood cells of a single lineage. Examples
of such cytokines include EPO, TPO, and G-CSF.
[0124] "Treatment" refers to both therapeutic treatment and
prophylactic or preventative measures. Those in need of treatment
include those already with the disorder as well as those in which
the disorder is to be prevented.
[0125] The term "obesity" is used to designate a condition of being
overweight associated with excessive bodily fat. The desirable
weight for a certain individual depends on a number of factors
including sex, height, age, overall built, etc. The same factors
will determine when an individual is considered obese. The
determination of an optimum body weight for a given individual is
well within the skill of an ordinary physician.
[0126] "Mammal" for purposes of treatment refers to any animal
classified as a mammal, including humans, domestic and farm
animals, and zoo, sports, or pet animals, such as dogs, horses,
cats, cows, etc. Preferably, the mammal is human.
[0127] By "solid phase" is meant a non-aqueous matrix to which a
reagent of interest (e.g., the WSX receptor or an antibody thereto)
can adhere. Examples of solid phases encompassed herein include
those formed partially or entirely of glass (e.g., controlled pore
glass), polysaccharides (e.g., agarose), polyacrylamides,
polystyrene, polyvinyl alcohol and silicones. In certain
embodiments, depending on the context, the solid phase can comprise
the well of an assay plate; in others it is a purification column
(e.g., an affinity chromatography column). This term also includes
a discontinuous solid phase of discrete particles, such as those
described in U.S. Pat. No. 4,275,149.
[0128] A. Modes for Carrying Out the Invention
[0129] The present invention is based on the discovery of the WSX
receptor. The experiments described herein demonstrate that this
molecule is a cytokine receptor which appears to play a role in
enhancing proliferation and/or differentiation of hematopoietic
cells. In particular, this receptor has been found to be present in
enriched human stem cell populations, thus indicating that WSX
ligands, such as agonist antibodies, may be used to stimulate
proliferation of hematopoietic stem cells/progenitor cells. Other
uses for this receptor will be apparent from the following
discussion. A description follows as to how WSX receptor or OB
proteins may be prepared.
[0130] B. Preparation of WSX Receptor or OB Protein
[0131] Techniques suitable for the production of WSX receptor or OB
protein are well known in the art and include isolating WSX
receptor or OB protein from an endogenous source of the
polypeptide, peptide synthesis (using a peptide synthesizer) and
recombinant techniques (or any combination of these techniques).
The preferred technique for production of WSX receptor or OB
protein is a recombinant technique to be described below.
[0132] Most of the discussion below pertains to recombinant
production of WSX receptor or OB protein by culturing cells
transformed with a vector containing WSX receptor or OB protein
nucleic acid and recovering the polypeptide from the cell culture.
It is further envisioned that the WSX receptor or OB protein of
this invention may be produced by homologous recombination, as
provided for in WO 91/06667, published 16 May 1991.
[0133] Briefly, this method involves transforming primary human
cells containing a WSX receptor or OB protein-encoding gene with a
construct (i.e., vector) comprising an amplifiable gene (such as
dihydrofolate reductase (DHFR) or others discussed below) and at
least one flanking region of a length of at least about 150 bp that
is homologous with a DNA sequence at the locus of the coding region
of the WSX receptor or OB protein gene to provide amplification of
the WSX receptor or OB protein gene. The amplifiable gene must be
at a site that does not interfere with expression of the WSX
receptor or OB protein gene. The transformation is conducted such
that the construct becomes homologously integrated into the genome
of the primary cells to define an amplifiable region.
[0134] Primary cells comprising the construct are then selected for
by means of the amplifiable gene or other marker present in the
construct. The presence of the marker gene establishes the presence
and integration of the construct into the host genome. No further
selection of the primary cells need be made, since selection will
be made in the second host. If desired, the occurrence of the
homologous recombination event can be determined by employing PCR
and either sequencing the resulting amplified DNA sequences or
determining the appropriate length of the PCR fragment when DNA
from correct homologous integrants is present and expanding only
those cells containing such fragments. Also if desired, the
selected cells maybe amplified at this point by stressing the cells
with the appropriate amplifying agent (such as methotrexate if the
amplifiable gene is DHFR), so that multiple copies of the target
gene are obtained. Preferably, however, the amplification step is
not conducted until after the second transformation described
below.
[0135] After the selection step, DNA portions of the genome,
sufficiently large to include the entire amplifiable region, are
isolated from the selected primary cells. Secondary mammalian
expression host cells are then transformed with these genomic DNA
portions and cloned, and clones are selected that contain the
amplifiable region. The amplifiable region is then amplified by
means of an amplifying agent if not already amplified in the
primary cells. Finally, the secondary expression host cells now
comprising multiple copies of the amplifiable region containing WSX
receptor or OB protein are grown so as to express the gene and
produce the protein.
[0136] 1. Isolation of DNA Encoding WSX Receptor or OB Protein
[0137] The DNA encoding WSX receptor or OB protein may be obtained
from any cDNA library prepared from tissue believed to possess the
WSX receptor or OB protein mRNA and to express it at a detectable
level. Accordingly, WSX receptor or OB protein DNA can be
conveniently obtained from a cDNA library prepared from mammalian
fetal liver. The WSX receptor or OB protein-encoding gene may also
be obtained from a genomic library or by oligonucleotide
synthesis.
[0138] Libraries are screened with probes (such as antibodies to
the WSX receptor or OB protein, or oligonucleotides of about 20-80
bases) designed to identify the gene of interest or the protein
encoded by it. Screening the cDNA or genomic library with the
selected probe may be conducted using standard procedures as
described in chapters 10-12 of Sambrook et al., Molecular Cloning:
A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,
1989). An alternative means to isolate the gene encoding WSX
receptor or OB protein is to use PCR methodology as described in
section 14 of Sambrook et al., supra.
[0139] A preferred method of practicing this invention is to use
carefully selected oligonucleotide sequences to screen cDNA
libraries from various human tissues, preferably human fetal liver.
The oligonucleotide sequences selected as probes should be of
sufficient length and sufficiently unambiguous that false positives
are minimized.
[0140] The oligonucleotide must be labeled such that it can be
detected upon hybridization to DNA in the library being screened.
The preferred method of labeling is to use .sup.32P-labeled ATP
with polynucleotide kinase, as is well known in the art, to
radiolabel the oligonucleotide. However, other methods may be used
to label the oligonucleotide, including, but not limited to,
biotinylation or enzyme labeling.
[0141] Amino acid sequence variants of WSX receptor or OB protein
are prepared by introducing appropriate nucleotide changes into the
WSX receptor or OB protein DNA, or by synthesis of the desired WSX
receptor or OB protein. Such variants represent insertions,
substitutions, and/or specified deletions of, residues within or at
one or both of the ends of the amino acid sequence of a naturally
occurring human WSX receptor or OB protein, such as the WSX
receptor variants shown in FIGS. 2A-B or the human OB protein of
Zhang et al., supra. Preferably, these variants represent
insertions and/or substitutions within or at one or both ends of
the mature sequence, and/or insertions, substitutions and/or
specificed deletions within or at one or both of the ends of the
signal sequence of the WSX receptor or OB protein. Any combination
of insertion, substitution, and/or specified deletion is made to
arrive at the final construct, provided that the final construct
possesses the desired biological activity as defined herein. The
amino acid changes also may alter post-translational processes of
the WSX receptor or OB protein, such as changing the number or
position of glycosylation sites, altering the membrane anchoring
characteristics, and/or altering the intracellular location of the
WSX receptor or OB protein by inserting, deleting, or otherwise
affecting the leader sequence of the WSX receptor or OB
protein.
[0142] Variations in the native sequence as described above can be
made using any of the techniques and guidelines for conservative
and non-conservative mutations set forth in U.S. Pat. No.
5,364,934. These include oligonucleotide-mediated (site-directed)
mutagenesis, alanine scanning, and PCR mutagenesis. See also, for
example, Table I therein and the discussion surrounding this table
for guidance on selecting amino acids to change, add, or
delete.
[0143] 2. Insertion of Nucleic Acid into Replicable Vector
[0144] The nucleic acid (e.g., cDNA or genomic DNA) encoding the
WSX receptor or OB protein is inserted into a replicable vector for
further cloning (amplification of the DNA) or for expression. Many
vectors are available. The vector components generally include, but
are not limited to, one or more of the following: a signal
sequence, an origin of replication, one or more marker genes, an
enhancer element, a promoter, and a transcription termination
sequence.
[0145] a. Signal Sequence Component
[0146] The WSX receptor or OB proteins of this invention may be
produced recombinantly not only directly, but also as a fusion
polypeptide with a heterologous polypeptide, which is preferably a
signal sequence or other polypeptide having a specific cleavage
site at the N-terminus of the mature protein or polypeptide. In
general, the signal sequence may be a component of the vector, or
it may be a part of the WSX receptor or OB protein DNA that is
inserted into the vector. The heterologous signal sequence selected
preferably is one that is recognized and processed (i.e., cleaved
by a signal peptidase) by the host cell. For prokaryotic host cells
that do not recognize and process the native WSX receptor or OB
protein signal sequence, the signal sequence is substituted by a
prokaryotic signal sequence selected, for example, from the group
of the alkaline phosphatase, penicillinase, lpp, or heat-stable
enterotoxin II leaders. For yeast secretion the native signal
sequence may be substituted by, e.g., the yeast invertase leader, a
factor leader (including Saccharomyces and Kluyveromyces
.alpha.-factor leaders, the latter described in U.S. Pat. No.
5,010,182 issued 23 Apr. 1991), or acid phosphatase leader, the C.
albicans glucoamylase leader (EP 362,179 published 4 Apr. 1990), or
the signal described in WO 90/13646 published 15 Nov. 1990. In
mammalian cell expression the native signal sequence (e.g., the WSX
receptor or OB protein presequence that normally directs secretion
of WSX receptor or OB protein from human cells in vivo) is
satisfactory, although other mammalian signal sequences may be
suitable, such as signal sequences from other ammal WSX receptors
or OB proteins, and signal sequences from secreted polypeptides of
the same or related species, as well as viral secretory leaders,
for example, the herpes simplex gD signal.
[0147] The DNA for such precursor region is ligated in reading
frame to DNA encoding the mature WSX receptor or OB protein.
[0148] b. Origin of Replication Component
[0149] Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more
selected host cells. Generally, in cloning vectors this sequence is
one that enables the vector to replicate independently of the host
chromosomal DNA, and includes origins of replication or
autonomously replicating sequences. Such sequences are well known
for a variety of bacteria, yeast, and viruses. The origin of
replication from the plasmid pBR322 is suitable for most
Gram-negative bacteria, the 2.mu. plasmid origin is suitable for
yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or
BPV) are useful for cloning vectors in mammalian cells. Generally,
the origin of replication component is not needed for mammalian
expression vectors (the SV40 origin may typically be used only
because it contains the early promoter).
[0150] Most expression vectors are "shuttle" vectors, i.e., they
are capable of replication in at least one class of organisms but
can be transfected into another organism for expression. For
example, a vector is cloned in E. coli and then the same vector is
transfected into yeast or mammalian cells for expression even
though it is not capable of replicating independently of the host
cell chromosome.
[0151] DNA may also be amplified by insertion into the host genome.
This is readily accomplished using Bacillus species as hosts, for
example, by including in the vector a DNA sequence that is
complementary to a sequence found in Bacillus genomic DNA.
Transfection of Bacillus with this vector results in homologous
recombination with the genome and insertion of WSX receptor or OB
protein DNA. However, the recovery of genomic DNA encoding WSX
receptor or OB protein is more complex than that of an exogenously
replicated vector because restriction enzyme digestion is required
to excise the WSX receptor or OB protein DNA.
[0152] c. Selection Gene Component
[0153] Expression and cloning vectors should contain a selection
gene, also termed a selectable marker. This gene encodes a protein
necessary for the survival or growth of transformed host cells
grown in a selective culture medium. Host cells not transformed
with the vector containing the selection gene will not survive in
the culture medium. Typical selection genes encode proteins that
(a) confer resistance to antibiotics or other toxins, e.g.,
ampicillin, neomycin, methotrexate, or tetracycline, (b) complement
auxotrophic deficiencies, or (c) supply critical nutrients not
available from complex media, e.g., the gene encoding D-alanine
racemase for Bacilli.
[0154] One example of a selection scheme utilizes a drug to arrest
growth of a host cell. Those cells that are successfully
transformed with a heterologous gene produce a protein conferring
drug resistance and thus survive the selection regimen. Examples of
such dominant selection use the drugs neomycin, mycophenolic acid
and hygromycin.
[0155] Another example of suitable selectable markers for mammalian
cells are those that enable the identification of cells competent
to take up the WSX receptor or OB protein nucleic acid, such as
DHFR or thymidine kinase. The mammalian cell transformants are
placed under selection pressure that only the transformants are
uniquely adapted to survive by virtue of having taken up the
marker. Selection pressure is imposed by culturing the
transformants under conditions in which the concentration of
selection agent in the medium is successively changed, thereby
leading to amplification of both the selection gene and the DNA
that encodes WSX receptor or OB protein. Amplification is the
process by which genes in greater demand for the production of a
protein critical for growth are reiterated in tandem within the
chromosomes of successive generations of recombinant cells.
Increased quantities of WSX receptor or OB protein are synthesized
from the amplified DNA. Other examples of amplifiable genes include
metallothionein-I and -II, preferably primate metallothionein
genes, adenosine deaminase, ornithine decarboxylase, etc.
[0156] For example, cells transformed with the DHFR selection gene
are first identified by culturing all of the transformants in a
culture medium that contains methotrexate (Mtx), a competitive
antagonist of DHFR. An appropriate host cell when wild-type DHFR is
employed is the Chinese hamster ovary (CHO) cell line deficient in
DHFR activity, prepared and propagated as described by Urlaub et
al., Proc. Natl. Acad. Sci. USA 77:4216 (1980). The transformed
cells are then exposed to increased levels of methotrexate. This
leads to the synthesis of multiple copies of the DHFR gene, and,
concomitantly, multiple copies of other DNA comprising the
expression vectors, such as the DNA encoding WSX receptor or OB
protein. This amplification technique can be used with any
otherwise suitable host, e.g., ATCC No. CCL61 CHO-K1,
notwithstanding the presence of endogenous DHFR if, for example, a
mutant DHFR gene that is highly resistant to Mtx is employed (EP
117,060).
[0157] Alternatively, host cells (particularly wild-type hosts that
contain endogenous DHFR) transformed or co-transformed with DNA
sequences encoding WSX receptor or OB protein, wild-type DHFR
protein, and another selectable marker such as aminoglycoside
3'-phosphotransferase (APH) can be selected by cell growth in
medium containing a selection agent for the selectable marker such
as an aminoglycosidic antibiotic, e.g., kanamycin, neomycin, or
G418. See U.S. Pat. No. 4,965,199.
[0158] A suitable selection gene for use in yeast is the trp1 gene
present in the yeast plasmid YRp7 (Stinchcomb et al., Nature 282:39
(1979)). The trp1 gene provides a selection marker for a mutant
strain of yeast lacking the ability to grow in tryptophan, for
example, ATCC No. 44076 or PEP4-1. Jones, Genetics 85:12 (1977).
The presence of the trp1 lesion in the yeast host cell genome then
provides an effective environment for detecting transformation by
growth in the absence of tryptophan. Similarly, Leu2-deficient
yeast strains (ATCC 20,622 or 38,626) are complemented by known
plasmids bearing the Leu2 gene.
[0159] In addition, vectors derived from the 1.6 .mu.m circular
plasmid pKD 1 can be used for transformation of Kluyveromyces
yeasts. Bianchi et al., Curr. Genet. 12:185 (1987). More recently,
an expression system for large-scale production of recombinant calf
chymosin was reported for K. lactis. Van den Berg, Bio/Technology
8:135 (1990). Stable multi-copy expression vectors for secretion of
mature recombinant human serum albumin by industrial strains of
Kluyveromyces have also been disclosed. Fleer et al.,
Bio/Technology 9:968-975 (1991).
[0160] d. Promoter Component
[0161] Expression and cloning vectors usually contain a promoter
that is recognized by the host organism and is operably linked to
the WSX receptor or OB protein nucleic acid. Promoters are
untranslated sequences located upstream (5') to the start codon of
a structural gene (generally within about 100 to 1000 bp) that
control the transcription and translation of particular nucleic
acid sequence, such as the WSX receptor or OB protein nucleic acid
sequence, to which they are operably linked. Such promoters
typically fall into two classes, inducible and constitutive.
Inducible promoters are promoters that initiate increased levels of
transcription from DNA under their control in response to some
change in culture conditions, e.g., the presence or absence of a
nutrient or a change in temperature. At this time a large number of
promoters recognized by a variety of potential host cells are well
known. These promoters are operably linked to WSX receptor or OB
protein-encoding DNA by removing the promoter from the source DNA
by restriction enzyme digestion and inserting the isolated promoter
sequence into the vector. Both the native WSX receptor or OB
protein promoter sequence and many heterologous promoters may be
used to direct amplification and/or expression of the WSX receptor
or OB protein DNA. However, heterologous promoters are preferred,
as they generally permit greater transcription and higher yields of
WSX receptor or OB protein as compared to the native WSX receptor
or OB protein promoter.
[0162] Promoters suitable for use with prokaryotic hosts include
the P-lactamase and lactose promoter systems (Chang et al., Nature
275:615 (1978); Goeddel et al., Nature 281:544 (1979)), alkaline
phosphatase, a tryptophan (trp) promoter system (Goeddel, Nucleic
Acids Res. 8:4057 (1980); EP 36,776), and hybrid promoters such as
the tac promoter. deBoer et al., Proc. Natl. Acad. Sci. USA
80:21-25 (1983). However, other known bacterial promoters are
suitable. Their nucleotide sequences have been published, thereby
enabling a skilled worker operably to ligate them to DNA encoding
WSX receptor or OB protein (Siebenlist et al., Cell 20:269 (1980))
using linkers or adaptors to supply any required restriction sites.
Promoters for use in bacterial systems also will contain a
Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding
WSX receptor or OB protein.
[0163] Promoter sequences are known for eukaryotes. Virtually all
eukaryotic genes have an AT-rich region located approximately 25 to
30 bases upstream from the site where transcription is initiated.
Another sequence found 70 to 80 bases upstream from the start of
transcription of many genes is a CXCAAT region where X may be any
nucleotide. At the 3' end of most eukaryotic genes is an AATAAA
sequence that may be the signal for addition of the poly A tail to
the 3' end of the coding sequence. All of these sequences are
suitably inserted into eukaryotic expression vectors.
[0164] Examples of suitable promoting sequences for use with yeast
hosts include the promoters for 3-phosphoglycerate kinase (Hitzeman
et al., J. Biol. Chem. 255:2073 (1980)) or other glycolytic enzymes
(Hess et al., J Adv. Enzyme Reg. 7:149 (1968); Holland,
Biochemistry 17:4900 (1978)), such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
[0165] Other yeast promoters, which are inducible promoters having
the additional advantage of transcription controlled by growth
conditions, are the promoter regions for alcohol dehydrogenase 2,
isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionein,
glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible
for maltose and galactose utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP
73,657. Yeast enhancers also are advantageously used with yeast
promoters.
[0166] WSX receptor or OB protein transcription from vectors in
mammalian host cells is controlled, for example, by promoters
obtained from the genomes of viruses such as polyoma virus, fowipox
virus (UK 2,211,504 published 5 Jul. 1989), adenovirus (such as
Adenovirus 2), bovine papilloma virus, avian sarcoma virus,
cytomegalovirus, a retrovirus, hepatitis-B virus and most
preferably Simian Virus 40 (SV40), from heterologous mammalian
promoters, e.g., the actin promoter or an immunoglobulin promoter,
from heat-shock promoters, and from the promoter normally
associated with the WSX receptor or OB protein sequence, provided
such promoters are compatible with the host cell systems.
[0167] The early and late promoters of the SV40 virus are
conveniently obtained as an SV40 restriction fragment that also
contains the SV40 viral origin of replication. Fiers et al., Nature
273:113 (1978); Mulligan et al., Science. 209:1422-1427 (1980);
Pavlakis et al., Proc. Natl. Acad. Sci. USA 78:7398-7402 (1981).
The immediate early promoter of the human cytomegalovirus is
conveniently obtained as a HindIII E restriction fragment.
Greenaway et al., Gene 18:355-360 (1982). A system for expressing
DNA in mammalian hosts using the bovine papilloma virus as a vector
is disclosed in U.S. Pat. No. 4,419,446. A modification of this
system is described in U.S. Pat. No. 4,601,978. See also Gray et
al., Nature 295:503-508 (1982) on expressing cDNA encoding immune
interferon in monkey cells; Reyes et al., Nature 297:598-601 (1982)
on expression of human .beta.-interferon cDNA in mouse cells under
the control of a thymidine kinase promoter from herpes simplex
virus; Canaani et al., Proc. Natl. Acad. Sci. USA 79:5166-5170
(1982) on expression of the human interferon .beta.1 gene in
cultured mouse and rabbit cells; and Gorman et al., Proc. Natl.
Acad. Sci. USA 79:6777-6781 (1982) on expression of bacterial CAT
sequences in CV-1 monkey kidney cells, chicken embryo fibroblasts,
Chinese hamster ovary cells, HeLa cells, and mouse NIH-3T3 cells
using the Rous sarcoma virus long terminal repeat as a
promoter.
[0168] e. Enhancer Element Component
[0169] Transcription of a DNA encoding the WSX receptor or OB
protein of this invention by higher eukaryotes is often increased
by inserting an enhancer sequence into the vector. Enhancers are
cis-acting elements of DNA, usually about from 10 to 300 bp, that
act on a promoter to increase its transcription. Enhancers are
relatively orientation and position independent, having been found
5' (Laimins et al., Proc. Natl. Acad. Sci. USA 78:993 (1981)) and
3' (Luskyet al., Mol. Cell Bio. 3:1108 (1983)) to the transcription
unit, within an intron (Banerji et al., Cell 33:729 (1983)), as
well as within the coding sequence itself. Osborne et al., Mol.
Cell Bio. 4:1293 (1984). Many enhancer sequences are now known from
mammalian genes (globin, elastase, albumin, .alpha.-fetoprotein,
and insulin). Typically, however, one will use an enhancer from a
eukaryotic cell virus. Examples include the SV40 enhancer on the
late side of the replication origin (bp 100-270), the
cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus enhancers.
See also Yaniv, Nature 297:17-18 (1982) on enhancing elements for
activation of eukaryotic promoters. The enhancer may be spliced
into the vector at a position 5' or 3' to the WSX receptor or OB
protein-encoding sequence, but is preferably located at a site 5'
from the promoter.
[0170] f. Transcription Termination Component
[0171] Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human, or nucleated cells from other
multicellular organisms) will also contain sequences necessary for
the termination of transcription and for stabilizing the mRNA. Such
sequences are commonly available from the 5' and, occasionally 3',
untranslated regions of eukaryotic or viral DNAs or cDNAs. These
regions contain nucleotide segments transcribed as polyadenylated
fragments in the untranslated portion of the mRNA encoding WSX
receptor or OB protein.
[0172] g. Construction and Analysis of Vectors
[0173] Construction of suitable vectors containing one or more of
the above-listed components employs standard ligation techniques.
Isolated plasmids or DNA fragments are cleaved, tailored, and
re-ligated in the form desired to generate the plasmids
required.
[0174] For analysis to confirm correct sequences in plasmids
constructed, the ligation mixtures are used to transform E. coli K
12 strain 294 (ATCC 31,446) and successful transformants selected
by ampicillin or tetracycline resistance where appropriate.
Plasmids from the transformants are prepared, analyzed by
restriction endonuclease digestion, and/or sequenced by the method
of Messing et al., Nucleic Acids Res. 9:309 (1981) or by the method
of Maxam et al., Methods in Enzymology 65:499 (1980).
[0175] 3. Transient Expression Vectors
[0176] Particularly useful in the practice of this invention are
expression vectors that provide for the transient expression in
mammalian cells of DNA encoding WSX receptor or OB protein. In
general, transient expression involves the use of an expression
vector that is able to replicate efficiently in a host cell, such
that the host cell accumulates many copies of the expression vector
and, in turn, synthesizes high levels of a desired polypeptide
encoded by the expression vector. Sambrook et al., supra, pp.
16.17-16.22. Transient expression systems, comprising a suitable
expression vector and a host cell, allow for the convenient
positive identification of polypeptides encoded by cloned DNAs, as
well as for the rapid screening of such polypeptides for desired
biological or physiological properties. Thus, transient expression
systems are particularly useful in the invention for purposes of
identifying analogs and variants of WSX receptor or OB protein that
are biologically active WSX receptor or OB protein.
[0177] a. Suitable Exemplary Vertebrate Cell Vectors
[0178] Other methods, vectors, and host cells suitable for
adaptation to the synthesis of WSX receptor or OB protein in
recombinant vertebrate cell culture are described in Gething et
al., Nature 293:620-625 (1981); Mantei et al., Nature 281:40-46
(1979); EP 117,060; and EP 117,058. A particularly useful plasmid
for mammalian cell culture expression of WSX receptor or OB protein
is pRK5 (EP 307,247) or pSVI6B. WO 91/08291 published 13 Jun.
1991.
[0179] 4. Selection and Transformation of Host Cells
[0180] Suitable host cells for cloning or expressing the DNA in the
vectors herein are the prokaryote, yeast, or higher eukaryote cells
described above. Suitable prokaryotes for this purpose include
eubacteria, such as Gram-negative or Gram-positive organisms, for
example, Enterobacteriaceae such as Escherichia, e.g., E. coli,
Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g.,
Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and
Shigella, as well as Bacilli such as B. subtilis and B.
licheniformis (e.g., B. licheniformis 41 P disclosed in DD 266,710
published 12 Apr. 1989), Pseudomonas such as P. aeruginosa, and
Streptomyces. One preferred E. coli cloning host is E. coli 294
(ATCC 31,446), although other strains such as E. coli B, E. coli
X1776 (ATCC 31,537), and E. coli W3110 (ATCC 27,325) are suitable.
These examples are illustrative rather than limiting. Strain W3110
is a particularly preferred host or parent host because it is a
common host strain for recombinant DNA product fermentations.
Preferably, the host cell should secrete minimal amounts of
proteolytic enzymes. For example, strain W3110 may be modified to
effect a genetic mutation in the genes encoding proteins, with
examples of such hosts including E. coli W3110 strain 27C7. The
complete genotype of 27C7 is tonA.DELTA. ptr3 phoA.DELTA.E15
.DELTA.(argF-lac)169 ompT.DELTA. degP4]kan.sup.r. Strain 27C7 was
deposited on 30 Oct. 1991 in the American Type Culture Collection
as ATCC No. 55,244. Alternatively, the strain of E. coli having
mutant periplasmic protease disclosed in U.S. Pat. No. 4,946,783
issued 7 Aug. 1990 may be employed. Alternatively still, methods of
cloning, e.g., PCR or other nucleic acid polymerase reactions, are
suitable.
[0181] In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression hosts
for WSX receptor or OB protein-encoding vectors. Saccharomyces
cerevisiae, or common baker's yeast, is the most commonly used
among lower eukaryotic host microorganisms. However, a number of
other genera, species, and strains are commonly available and
useful herein, such as Schizosaccharomyces pombe (Beach et al.,
Nature, 290:140 (1981); EP 139,383 published 2 May 1985);
Kluyveromyces hosts (U.S. Pat. No. 4,943,529; Fleer et al., supra)
such as, e.g., K lactis (MW98-8C, CBS683, CBS4574), K. fragilis
(ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC
24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906;
Van den Berg et al., supra), K. thermotolerans, and K. marxianus;
yarrowia (EP 402,226); Pichia pastoris (EP 183,070; Sreekrishna et
al., J. Basic Microbiol. 28:265-278 (1988)); Candida; Trichoderma
reesia (EP 244,234); Neurospora crassa (Case et al., Proc. Natl.
Acad. Sci. USA 76:5259-5263 (1979)); Schwanniomyces such as
Schwanniomyces occidentalis (EP 394,538 published 31 Oct. 1990);
and filamentous fungi such as, e.g., Neurospora, Penicillium,
Tolypocladium (WO 91/00357 published 10 Jan. 1991), and Aspergillus
hosts such as A. nidulans (Ballance et al., Biochem. Biophys. Res.
Commun. 112:284-289 (1983); Tilburnetal., Gene 26:205-221 (1983);
Yeltonetal., Proc. Natl. Acad. Sci. USA 81:1470-1474 (1984)) and A.
niger. Kelly et al., EMBO J. 4:475-479 (1985).
[0182] Suitable host cells for the expression of glycosylated WSX
receptor or OB protein are derived from multicellular organisms.
Such host cells are capable of complex processing and glycosylation
activities. In principle, any higher eukaryotic cell culture is
workable, whether from vertebrate or invertebrate culture. Examples
of invertebrate cells include plant and insect cells. Numerous
baculoviral strains and variants and corresponding permissive
insect host cells from hosts such as Spodoptera frugiperda
(caterpillar), Aedes aegypti (mosquito), Aedes albopictus
(mosquito), Drosophila melanogaster (fruitfly), and Bombyx mori
have been identified. See, e.g., Luckow et al., Bio/Technology
6:47-55 (1988); Miller et al., in Genetic Engineering, Setlow et
al., eds., Vol.8 (Plenum Publishing, 1986), pp. 277-279; and Maeda
et al., Nature 315:592-594 (1985). A variety of viral strains for
transfection are publicly available, e.g., the L-1 variant of
Aitographa californica NPV and the Bm-5 strain of Bombyx mori NPV,
and such viruses may be used as the virus herein according to the
present invention, particularly for transfection of Spodoptera
frugiperda cells.
[0183] Plant cell cultures of cotton, corn, potato, soybean,
petunia, tomato, and tobacco can be utilized as hosts. Typically,
plant cells are transfected by incubation with certain strains of
the bacterium Agrobacterium tumefaciens, which has been previously
manipulated to contain the WSX receptor or OB protein-encoding DNA.
During incubation of the plant cell culture with A. tumefaciens,
the DNA encoding the WSX receptor or OB protein is transferred to
the plant cell host such that it is transfected, and will, under
appropriate conditions, express the WSX receptor or OB
protein-encoding DNA. In addition, regulatory and signal sequences
compatible with plant cells are available, such as the nopaline
synthase promoter and polyadenylation signal sequences. Depicker et
al., J. Mol. Appl. Gen. 1:561 (1982). In addition, DNA segments
isolated from the upstream region of the T-DNA 780 gene are capable
of activating or increasing transcription levels of
plant-expressible genes in recombinant DNA-containing plant tissue.
EP 321,196 published 21 Jun. 1989.
[0184] However, interest has been greatest in vertebrate cells, and
propagation of vertebrate cells in culture (tissue culture) has
become a routine procedure. See, e.g., Tissue Culture, Academic
Press, Kruse and Patterson, editors (1973). Examples of useful
mammalian host cell lines are monkey kidney CV1 line transformed by
SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or
293 cells subcloned for growth in suspension culture, Graham et
al., J. Gen Virol. 36:59 (1977)); baby hamster kidney cells (BHK,
ATCC CCL 10); Chinese hamster ovary cells/-DHFR(CHO, Urlaub et al.,
Proc. Natl. Acad. Sci. USA 77:4216 (1980)); mouse sertoli cells
(TM4, Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney cells
(CV 1 ATCC CCL 70); African green monkey kidney cells (VERO-76,
ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2);
canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells
(BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75);
human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT
060562, ATCC CCL51); TR1 cells (Mather et al., Annals N.Y. Acad.
Sci. 383:44-68 (1982)); MRC 5 cells; FS4 cells; and a human
hepatoma line (Hep G2).
[0185] Host cells are transfected and preferably transformed with
the above-described expression or cloning vectors for WSX receptor
or OB protein production and cultured in conventional nutrient
media modified as appropriate for inducing promoters, selecting
transformants, or amplifying the genes encoding the desired
sequences.
[0186] Transfection refers to the taking up of an expression vector
by a host cell whether or not any coding sequences are in fact
expressed. Numerous methods of transfection are known to the
ordinarily skilled artisan, for example, CaPO.sub.4 and
electroporation. Successful transfection is generally recognized
when any indication of the operation of this vector occurs within
the host cell.
[0187] Transformation means introducing DNA into an organism so
that the DNA is replicable, either as an extrachromosomal element
or by chromosomal integrant. Depending on the host cell used,
transformation is done using standard techniques appropriate to
such cells. The calcium treatment employing calcium chloride, as
described in section 1.82 of Sambrook et al., supra, or
electroporation is generally used for prokaryotes or other cells
that contain substantial cell-wall barriers. Infection with
Agrobacterium tumefaciens is used for transformation of certain
plant cells, as described by Shaw et al., Gene 23:315 (1983) and WO
89/05859 published 29 Jun. 1989. In addition, plants may be
transfected using ultrasound treatment as described in WO 91/00358
published 10 Jan. 1991.
[0188] For mammalian cells without such cell walls, the calcium
phosphate precipitation method of Graham et al., Virology
52:456-457 (1978) is preferred. General aspects of mammalian cell
host system transformations have been described in U.S. Pat. No.
4,399,216 issued 16 Aug. 1983. Transformations into yeast are
typically carried out according to the method of Van Solingen et
al., J. Bact. 130:946 (1977) and Hsiao et al., Proc. Natl. Acad.
Sci. USA 76:3829 (1979). However, other methods for introducing DNA
into cells, such as by nuclear microinj ection, electroporation,
bacterial protoplast fusion with intact cells, or polycations,
e.g., polybrene, polyornithine, etc., may also be used. For various
techniques for transforming mammalian cells, see Keown et al.,
Methods in Enzymology 185:527-537 (1990) and Mansour et al., Nature
336:348-352 (1988).
[0189] 5. Culturing the Host Cells
[0190] Prokaryotic cells used to produce the WSX receptor or OB
protein of this invention are cultured in suitable media as
described generally in Sambrook et al., sutpra.
[0191] The mammalian host cells used to produce the WSX receptor or
OB protein of this invention may be cultured in a variety of media.
Commercially available media such as Ham's F 10 (Sigma), Minimal
Essential Medium ((MEM), Sigma), RPMI-1640 (Sigma), and Dulbecco's
Modified Eagle's Medium ((DMEM), Sigma) are suitable for culturing
the host cells. In addition, any of the media described in Ham et
al. Meth. Enz. 58:44 (1979), Barnes et al., Anal. Biochem. 102:255
(1980), U.S. Pat. Nos. 4,767,704; 4,657,866; 4,927,762; 4,560,655;
or 5,122,469; WO 90/03430; WO 87/00195; or U.S. Pat. No. Re. 30,985
may be used as culture media for the host cells. Any of these media
may be supplemented as necessary with hormones and/or other growth
factors (such as insulin, transferrin, or epidermal growth factor),
salts (such as sodium chloride, calcium, magnesium, and phosphate),
buffers (such as HEPES), nucleosides (such as adenosine and
thymidine), antibiotics (such as GENTAMYCIN.TM. drug), trace
elements (defined as inorganic compounds usually present at final
concentrations in the micromolar range), and glucose or an
equivalent energy source. Any other necessary supplements may also
be included at appropriate concentrations that would be known to
those skilled in the art. The culture conditions, such as
temperature, pH, and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0192] In general, principles, protocols, and practical techniques
for maximizing the productivity of mammalian cell cultures can be
found in Mammalian Cell Biotechnology: a Practical Approach, M.
Butler, ed. (IRL Press, 1991).
[0193] The host cells referred to in this disclosure encompass
cells in culture as well as cells that are within a host
animal.
[0194] 6. Detecting Gene Amplification/Expression
[0195] Gene amplification and/or expression may be measured in a
sample directly, for example, by conventional Southern blotting,
Northern blotting to quantitate the transcription of mRNA (Thomas,
Proc. Natl. Acad. Sci. USA 77:5201-5205 (1980)), dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Various labels may
be employed, most commonly radioisotopes, particularly .sup.32P.
However, other techniques may also be employed, such as using
biotin-modified nucleotides for introduction into a polynucleotide.
The biotin then serves as the site for binding to avidin or
antibodies, which may be labeled with a wide variety of labels,
such as radionuclides, fluorescers, enzymes, or the like.
Alternatively, antibodies may be employed that can recognize
specific duplexes, including DNA duplexes, RNA duplexes, and
DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in
turn may be labeled and the assay may be carried out where the
duplex is bound to a surface, so that upon the formation of duplex
on the surface, the presence of antibody bound to the duplex can be
detected.
[0196] Gene expression, alternatively, may be measured by
immunological methods, such as immunohistochemical staining of
tissue sections and assay ofcell culture or body fluids, to
quantitate directly the expression of gene product. With
immunohistochemical staining techniques, a cell sample is prepared,
typically by dehydration and fixation, followed by reaction with
labeled antibodies specific for the gene product coupled, where the
labels are usually visually detectable, such as enzymatic labels,
fluorescent labels, luminescent labels, and the like. A
particularly sensitive staining technique suitable for use in the
present invention is described by Hsu et al., Am. J. Clin. Path.
75:734-738 (1980).
[0197] Antibodies useful for immunohistochemical staining and/or
assay of sample fluids may be either monoclonal or polyclonal, and
may be prepared as described herein.
[0198] 7. Purification of WSX Receptor or OB Protein
[0199] WSX receptor (e.g., WSX receptor ECD) or OB protein
preferably is recovered from the culture medium as a secreted
polypeptide, although it also may be recovered from host cell
lysates. If the WSX receptor is membrane-bound, it can be released
from the membrane using a suitable detergent solution (e.g.
Triton-X 100) When WSX receptor or OB protein is produced in a
recombinant cell other than one of human origin, the WSX receptor
or OB protein is completely free of proteins or polypeptides of
human origin. However, it is necessary to purify WSX receptor or OB
protein from recombinant cell proteins or polypeptides to obtain
preparations that are substantially homogeneous as to WSX receptor
or OB protein. As a first step, the culture medium or lysate is
centrifuged to remove particulate cell debris. WSX receptor or OB
protein thereafter is purified from contaminant soluble proteins
and polypeptides, with the following procedures being exemplary of
suitable purification procedures: by fractionation on an
ion-exchange column; ethanol precipitation; reverse phase HPLC;
chromatography on silica or on a cation-exchange resin such as
DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation;
gel filtration using, for example, Sephadex G-75.TM.; and protein A
Sepharose.TM. columns to remove contaminants such as IgG.
[0200] WSX receptor or OB protein variants in which residues have
been deleted, inserted, or substituted are recovered in the same
fashion as native sequence WSX receptor or OB protein, taking
account of any substantial changes in properties occasioned by the
variation. Immunoaffinity columns such as a rabbit polyclonal
anti-WSX receptor or OB protein column can be employed to absorb
the WSX receptor or OB protein variant by binding it to at least
one remaining immune epitope.
[0201] A protease inhibitor such as phenyl methyl sulfonyl fluoride
(PMSF) also may be useful to inhibit proteolytic degradation during
purification, and antibiotics may be included to prevent the growth
of adventitious contaminants.
[0202] 8. Covalent Modifications
[0203] Covalent modifications of WSX receptor or OB protein are
included within the scope of this invention. Both native sequence
WSX receptor or OB protein and amino acid sequence variants of the
WSX receptor or OB protein may be covalently modified. One type of
covalent modification of the WSX receptor or OB protein is
introduced into the molecule by reacting targeted amino acid
residues of the WSX receptor or OB protein with an organic
derivatizing agent that is capable of reacting with selected side
chains or the N- or C-terminal residues of the WSX receptor or OB
protein.
[0204] Cysteinyl residues most commonly are reacted with
.alpha.-haloacetates (and corresponding amines), such as
chloroacetic acid or chloroacetamide, to give carboxymethyl or
carboxyamidomethyl derivatives. Cysteinyl residues also are
derivatized by reaction with bromotrifluoroacetone,
.alpha.-bromo-.beta.-(5-imidozoyl)propionic acid, chloroacetyl
phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl
2-pyridyl disulfide, p-chloromercuribenzoate,
2-chloromercuri-4-nitrophenol, or
chloro-7-nitrobenzo-2-oxa-1,3-diazole.
[0205] Histidyl residues are derivatized by reaction with
diethylpyrocarbonate at pH 5.5-7.0 because this agent is relatively
specific for the histidyl side chain. Para-bromophenacyl bromide
also is useful; the reaction is preferably performed in 0.1M sodium
cacodylate at pH 6.0.
[0206] Lysinyl and amino terminal residues are reacted with
succinic or other carboxylic acid anhydrides. Derivatization with
these agents has the effect of reversing the charge of the lysinyl
residues. Other suitable reagents for derivatizing
.alpha.-amino-containing residues include imidoesters such as
methyl picolinimidate, pyridoxal phosphate, pyridoxal,
chloroborohydride, trinitrobenzenesulfonic acid, O-methylisourea,
2,4-pentanedione, and transaminase-catalyzed reaction with
glyoxylate.
[0207] Arginyl residues are modified by reaction with one or
several conventional reagents, among them phenylglyoxal,
2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin.
Derivatization of arginine residues requires that the reaction be
performed under alkaline conditions because of the high pK.sub.a of
the guanidine functional group. Furthermore, these reagents may
react with the groups of lysine as well as with the arginine
epsilon-amino group.
[0208] The specific modification of tyrosyl residues may be made,
with particular interest in introducing spectral labels into
tyrosyl residues by reaction with aromatic diazonium compounds or
tetranitromethane. Most commonly, N-acetylimidizole and
tetranitromethane are used to form O-acetyl tyrosyl species and
3-nitro derivatives, respectively. Tyrosyl residues are iodinated
using .sup.125I or .sup.131I to prepare labeled proteins for use in
radioimmunoassay, the chloramine T method being suitable.
[0209] Carboxyl side groups (aspartyl or glutamyl) are selectively
modified by reaction with carbodiimides (R--N.dbd.C.dbd.N--R'),
where R and R' are different alkyl groups, such as
1-cyclohexyl-3-(2-morpholinyl-- 4-ethyl) carbodiimide or
1-ethyl-3-(4-azonia-4,4-dimethylpentyl) carbodiimide. Furthermore,
aspartyl and glutamyl residues are converted to asparaginyl and
glutaminyl residues by reaction with ammonium ions.
[0210] Derivatization with bifunctional agents is useful for
crosslinking WSX receptor or OB protein to a water-insoluble
support matrix or surface for use in the method for purifying
anti-WSX receptor or OB protein antibodies, and vice-versa.
Commonly used crosslinking agents include, e.g.,
1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde,
N-hydroxysuccinimide esters, for example, esters with
4-azidosalicylic acid, homobifunctional imidoesters, including
disuccinimidyl esters such as
3,3'-dithiobis(succinimidylpropionate), and bifunctional maleimides
such as bis-N-maleimido-1,8-octane. Derivatizing agents such as
methyl-3-((p-azidophenyl)dithio)propioimidate yield
photoactivatable intermediates that are capable of forming
crosslinks in the presence of light. Alternatively, reactive
water-insoluble matrices such as cyanogen bromide-activated
carbohydrates and the reactive substrates described in U.S. Pat.
Nos. 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537; and
4,330,440 are employed for protein immobilization.
[0211] Glutaminyl and asparaginyl residues are frequently
deamidated to the corresponding glutamyl and aspartyl residues,
respectively. These residues are deamidated under neutral or basic
conditions. The deamidated form of these residues falls within the
scope of this invention.
[0212] Other modifications include hydroxylation of proline and
lysine, phosphorylation of hydroxyl groups of seryl or threonyl
residues, methylation of the .alpha.-amino groups of lysine,
arginine, and histidine side chains (T. E. Creighton, Proteins:
Structure and Molecular Properties, W.H. Freeman & Co., San
Francisco, pp.79-86 (1983)), acetylationof the N-terminal amine,
and amidation of any C-terminal carboxyl group.
[0213] Another type of covalent modification of the WSX receptor or
OB protein included within the scope of this invention comprises
altering the native glycosylation pattern of the polypeptide. By
altering is meant deleting one or more carbohydrate moieties found
in native WSX receptor or OB protein, and/or adding one or more
glycosylation sites that are not present in the native WSX receptor
or OB protein.
[0214] Glycosylation of polypeptides is typically either N-linked
or O-linked. N-linked refers to the attachment of the carbohydrate
moiety to the side chain of an asparagine residue. The tripeptide
sequences asparagine-X-serine and asparagine-X-threonine, where X
is any amino acid except proline, are the recognition sequences for
enzymatic attachment of the carbohydrate moiety to the asparagine
side chain. Thus, the presence of either of these tripeptide
sequences in a polypeptide creates a potential glycosylation site.
O-linked glycosylation refers to the attachment of one of the
sugars N-aceylgalactosamine, galactose, or xylose to a
hydroxylamino acid, most commonly serine or threonine, although
5-hydroxyproline or 5-hydroxylysine may also be used.
[0215] Addition of glycosylation sites to the WSX receptor or OB
protein is conveniently accomplished by altering the amino acid
sequence such that it contains one or more of the above-described
tripeptide sequences (for N-linked glycosylation sites). The
alteration may also be made by the addition of, or substitution by,
one or more serine or threonine residues to the native WSX receptor
or OB protein sequence (for O-linked glycosylation sites). For
ease, the WSX receptor or OB protein amino acid sequence is
preferably altered through changes at the DNA level, particularly
by mutating the DNA encoding the WSX receptor or OB protein at
preselected bases such that codons are generated that will
translate into the desired amino acids. The DNA mutation(s) may be
made using methods described above and in U.S. Pat. No. 5,364,934,
supra.
[0216] Another means of increasing the number of carbohydrate
moieties on the WSX receptor or OB protein is by chemical or
enzymatic coupling of glycosides to the polypeptide. These
procedures are advantageous in that they do not require production
of the polypeptide in a host cell that has glycosylation
capabilities for N- or O-linked glycosylation. Depending on the
coupling mode used, the sugar(s) may be attached to (a) arginine
and histidine, (b) free carboxyl groups, (c) free sulfhydryl groups
such as those of cysteine, (d) free hydroxyl groups such as those
of serine, threonine, or hydroxyproline, (e) aromatic residues such
as those of phenylalanine, tyrosine, or tryptophan, or (f) the
amide group of glutamine. These methods are described in WO
87/05330 published 11 Sep. 1987, and in Aplin et al., CRC Crit.
Rev. Biochem. 259-306 (1981).
[0217] Removal of carbohydrate moieties present on the WSX receptor
or OB protein may be accomplished chemically or enzymatically.
Chemical deglycosylation requires exposure of the polypeptide to
the compound trifluoromethanesulfonic acid, or an equivalent
compound. This treatment results in the cleavage of most or all
sugars except the linking sugar (N-acetylglucosamine or
N-acetylgalactosamine), while leaving the polypeptide intact.
Chemical deglycosylation is described by Hakimuddin, et al., Arch.
Biochem. Biophys. 259:52 (1987) and by Edge et al., Anal. Biochem.
118:131 (1981). Enzymatic cleavage of carbohydrate moieties on
polypeptides can be achieved by the use of a variety of endo- and
exo-glycosidases as described by Thotakura et al., Meth. Enzymol.
138:350 (1987).
[0218] Glycosylation at potential glycosylation sites may be
prevented by the use of the compound tunicamycin as described by
Duskin et al., J. Biol. Chem. 257:3105 (1982). Tunicamycin blocks
the formation of protein-N-glycoside linkages.
[0219] Another type of covalent modification of WSX receptor or OB
protein comprises linking the WSX receptor or OB protein to one of
a variety of nonproteinaceous polymers, e.g., polyethylene glycol,
polypropylene glycol, or polyoxyalkylenes, in the manner set forth
in U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417;
4,791,192 or 4,179,337.
[0220] Since it is often difficult to predict in advance the
characteristics of a variant WSX receptor or OB protein, it will be
appreciated that some screening of the recovered variant will be
needed to select the optimal variant. A change in the immunological
character of the WSX receptor or OB protein molecule, such as
affinity for a given antibody, is also able to be measured by a
competitive-type immunoassay. The WSX receptor variant is assayed
for changes in the ability of the protein to induce cell
proliferation in the colony assay of Example 8. Other potential
modifications of protein or polypeptide properties such as redox or
thermal stability, hydrophobicity, susceptibility to proteolytic
degradation, or the tendency to aggregate with carriers or into
multimers are assayed by methods well known in the art.
[0221] 9. Epitope-Tagged WSX Receptor or OB Protein
[0222] This invention encompasses chimeric polypeptides comprising
WSX receptor or OB protein fused to a heterologous polypeptide. A
chimeric WSX receptor or OB protein is one type of WSX receptor or
OB protein variant as defined herein. In one preferred embodiment,
the chimeric polypeptide comprises a fusion of the WSX receptor or
OB protein with a tag polypeptide which provides an epitope to
which an anti-tag antibody can selectively bind. The epitope tag is
generally provided at the amino- or carboxyl-terminus of the WSX
receptor or OB protein. Such epitope-tagged forms of the WSX
receptor or OB protein are desirable as the presence thereof can be
detected using a labeled antibody against the tag polypeptide.
Also, provision of the epitope tag enables the WSX receptor or OB
protein to be readily purified by affinity purification using the
anti-tag antibody. Affinity purification techniques and diagnostic
assays involving antibodies are described later herein.
[0223] Tag polypeptides and their respective antibodies are well
known in the art. Examples include the flu HA tag polypeptide and
its antibody 12CA5 (Field et al., Mol. Cell. Biol. 8:2159-2165
(1988)); the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10
antibodies thereto (Evan et al., Molecular and Cellular Biology
5:3610-3616 (1985)); and the Herpes Simplex virus glycoprotein D
(gD) tag and its antibody. Paborsky et al., Protein Engineering
3(6):547-553 (1990). Other tag polypeptides have been disclosed.
Examples include the Flag-peptide (Hopp et al., BioTechnology
6:1204-1210 (1988)); the KT3 epitope peptide (Martin et al.,
Science 255:192-194 (1992)); an .alpha.-tubulin epitope peptide
(Skinner et al., J. Biol. Chem. 266:15163-15166 (1991)); and the T7
gene 10 protein peptide tag. Lutz-Freyermuth et al., Proc. Natl.
Acad. Sci. USA 87:6393-6397 (1990). Once the tag polypeptide has
been selected, an antibody thereto can be generated using the
techniques disclosed herein.
[0224] The general methods suitable for the construction and
production of epitope-tagged WSX receptor or OB protein are the
same as those disclosed hereinabove. WSX receptor or OB protein-tag
polypeptide fusions are most conveniently constructed by fusing the
cDNA sequence encoding the WSX receptor or OB protein portion
in-frame to the tag polypeptide DNA sequence and expressing the
resultant DNA fusion construct in appropriate host cells.
Ordinarily, when preparing the WSX receptor or OB protein-tag
polypeptide chimeras of the present invention, nucleic acid
encoding the WSX receptor or OB protein will be fused at its 3' end
to nucleic acid encoding the N-terminus of the tag polypeptide,
however 5' fusions are also possible.
[0225] Epitope-tagged WSX receptor or OB protein can be
conveniently purified by affinity chromatography using the anti-tag
antibody. The matrix to which the affinity antibody is attached is
most often agarose, but other matrices are available (e.g.
controlled pore glass or poly(styrenedivinyl)benzene). The
epitope-tagged WSX receptor or OB protein can be eluted from the
affinity column by varying the buffer pH or ionic strength or
adding chaotropic agents, for example.
[0226] 10. WSX Receptor or OB Protein Immunoadhesins
[0227] Chimeras constructed from a receptor sequence linked to an
appropriate immunoglobulin constant domain sequence
(immunoadhesins) are known in the art. Immunoadhesins reported in
the literature include fusions of the T cell receptor* (Gascoigne
et al., Proc. Natl. Acad. Sci. USA 84: 2936-2940 (1987)); CD4*
(Capon et al., Nature 337: 525-531 (1989); Traunecker et al.,
Nature 339: 68-70 (1989); Zettmeissl et al., DNA Cell Biol. USA 9:
347-353 (1990); Byrn et al., Nature 344: 667-670 (1990));
L-selectin (homing receptor) ((Watson et al., J. Cell. Biol.
110:2221-2229 (1990); Watson et al., Nature 349: 164-167 (1991));
CD44* (Aruffo et al., Cell 61: 1303-1313 (1990)); CD28* and B7*
(Linsley et al., J. Exp. Med. 173: 721-730(1991)); CTLA-4* (Lisley
et al., J. Exp. Med. 174: 561-569 (1991)); CD22* (Stamenkovic et
al., Cell 66:1133-1144 (1991)); TNF receptor (Ashkenazi et al.,
Proc. Natl. Acad. Sci. USA 88: 10535-10539 (1991); Lesslauer et
al., Eur. J. Immunol. 27: 2883-2886 (1991); Peppel et al., J. Exp.
Med. 174:1483-1489 (1991)); NP receptors (Bennett et al., J. Biol.
Chem. 266:23060-23067 (1991)); and IgE receptora* (Ridgwayetal., J.
Cell. Biol. 115:abstr. 1448 (1991)), where the asterisk (*)
indicates that the receptor is member of the immunoglobulin
superfamily.
[0228] The simplest and most straightforward immunoadhesin design
combines the binding region(s) of the "adhesin" protein with the
hinge and Fc regions of an immunoglobulin heavy chain. Ordinarily,
when preparing the WSX receptor or OB-immunoglobulin chimeras of
the present invention, nucleic acid encoding OB protein or the
extracellular domain of the WSX receptor will be fused C-terminally
to nucleic acid encoding the N-terminus of an immunoglobulin
constant domain sequence, however N-terminal fusions are also
possible. For OB-immunoglobulin chimeras, an OB protein fragment
which retains the ability to bind to the WSX receptor may be
employed.
[0229] Typically, in such fusions the encoded chimeric polypeptide
will retain at least functionally active hinge, CH2 and CH3 domains
of the constant region of an immunoglobulin heavy chain. Fusions
are also made to the C-terminus of the Fc portion of a constant
domain, or immediately N-terminal to the CH1 of the heavy chain or
the corresponding region of the light chain.
[0230] The precise site at which the fusion is made is not
critical; particular sites are well known and may be selected in
order to optimize the biological activity, secretion or binding
characteristics of the WSX receptor or OB-immunoglobulin
chimeras.
[0231] In some embodiments, the WSX receptor or OB-immunoglobulin
chimeras are assembled as monomers, or hetero- or homo-multimers,
and particularly as dimers or tetramers, essentially as illustrated
in WO 91/08298.
[0232] In a preferred embodiment, the OB protein sequence or WSX
receptor extracellular domain sequence is fused to the N-terminus
of the C-terminal portion of an antibody (in particular the Fc
domain), containing the effector functions of an immunoglobulin,
e.g. immunoglobulin G1 (IgG1). It is possible to fuse the entire
heavy chain constant region to the OB protein or WSX receptor
extracellular domain sequence. However, more preferably, a sequence
beginning in the hinge region just upstream of the papain cleavage
site (which defines IgG Fc chemically; residue 216, taking the
first residue of heavy chain constant region to be 114, or
analogous sites of other immunoglobulins) is used in the fusion. In
a particularly preferred embodiment, the OB protein or WSX receptor
amino acid sequence is fused to the hinge region, CH2 and CH3, or
the CH1, hinge, CH2 and CH3 domains of an IgG1, IgG2, or IgG3 heavy
chain. The precise site at which the fusion is made is not
critical, and the optimal site can be determined by routine
experimentation.
[0233] In some embodiments, the WSX receptor or OB-immunoglobulin
chimeras are assembled as multimers, and particularly as
homo-dimers or -tetramers. Generally, these assembled
immunoglobulins will have known unit structures. A basic four chain
structural unit is the form in which IgG, IgD, and IgE exist. A
four unit is repeated in the higher molecular weight
immunoglobulins; IgM generally exists as a pentamer of basic four
units held together by disulfide bonds. IgA globulin, and
occasionally IgG globulin, may also exist in multimeric form in
serum. In the case of multimer, each four unit may be the same or
different.
[0234] Various exemplary assembled WSX receptor or
OB-immunoglobulin chimeras within the scope herein are
schematically diagrammed below:
[0235] (a) AC.sub.L-AC.sub.L;
[0236] (b) AC.sub.H-(AC.sub.H, AC.sub.L-AC.sub.H,
AC.sub.L-V.sub.HC.sub.H, or V.sub.LC.sub.L-AC.sub.H);
[0237] (c) AC.sub.L-AC.sub.H-(AC.sub.L-AC.sub.H,
AC.sub.L-V.sub.HC.sub.H, V.sub.LC.sub.L-AC.sub.H, or
V.sub.LC.sub.L-V.sub.HC.sub.H);
[0238] (d) AC.sub.L-V.sub.HC.sub.H-(AC.sub.H, or
AC.sub.L-V.sub.HC.sub.H, or V.sub.LC.sub.L-AC.sub.H);
[0239] (e) V.sub.LC.sub.L-AC.sub.H-(AC.sub.L-V.sub.HC.sub.H, or
V.sub.LC.sub.L-AC.sub.H); and
[0240] (f) (A-Y).sub.n-(V.sub.LC.sub.L-V.sub.HC.sub.H).sub.2,
[0241] wherein
[0242] each A represents identical or different OB protein or WSX
receptor amino acid sequences;
[0243] V.sub.L is an immunoglobulin light chain variable
domain;
[0244] V.sub.H is an immunoglobulin heavy chain variable
domain;
[0245] C.sub.L is an immunoglobulin light chain constant
domain;
[0246] C.sub.H is an immunoglobulin heavy chain constant
domain;
[0247] n is an integer greater than 1;
[0248] Y designates the residue of a covalent cross-linking
agent.
[0249] In the interests of brevity, the foregoing structures only
show key features; they do not indicate joining (J) or other
domains of the immunoglobulins, nor are disulfide bonds shown.
However, where such domains are required for binding activity, they
shall be constructed as being present in the ordinary locations
which they occupy in the immunoglobulin molecules.
[0250] Alternatively, the OB protein or WSX receptor extracellular
domain sequence can be inserted between immunoglobulin heavy chain
and light chain sequences such that an immunoglobulin comprising a
chimeric heavy chain is obtained. In this embodiment, the OB
protein or WSX receptor sequence is fused to the 3' end of an
immunoglobulin heavy chain in each arm of an immunoglobulin, either
between the hinge and the CH2 domain, or between the CH2 and CH3
domains. Similar constructs have been reported by Hoogenboom et
al., Mol. Immunol., 28:1027-1037 (1991).
[0251] Although the presence of an immunoglobulin light chain is
not required in the immunoadhesins of the present invention, an
immunoglobulin light chain might be present either covalently
associated to an OB protein or WSX receptor-immunoglobulin heavy
chain fusion polypeptide, or directly fused to the WSX receptor
extracellular domain or OB protein. In the former case, DNA
encoding an immunoglobulin light chain is typically coexpressed
with the DNA encoding the OB protein or WSX receptor-immunoglobulin
heavy chain fusion protein. Upon secretion, the hybrid heavy chain
and the light chain will be covalently associated to provide an
immunoglobulin-like structure comprising two disulfide-linked
immunoglobulin heavy chain-light chain pairs. Methods suitable for
the preparation of such structures are, for example, disclosed in
U.S. Pat. No. 4,816,567 issued 28 Mar. 1989.
[0252] In a preferred embodiment, the immunoglobulin sequences used
in the construction of the immunoadhesins of the present invention
are from an IgG immunoglobulin heavy chain constant domain. For
human immunoadhesins, the use of human IgG1 and IgG3 immunoglobulin
sequences is preferred. A major advantage of using IgG 1 is that
IgG 1 immunoadhesins can be purified efficiently on immobilized
protein A. In contrast, purification of IgG3 requires protein G, a
significantly less versatile medium. However, other structural and
functional properties of immunoglobulins should be considered when
choosing the Ig fusion partner for a particular immunoadhesin
construction. For example, the IgG3 hinge is longer and more
flexible, so it can accommodate larger adhesin domains that may not
fold or function properly when fused to IgG 1. Another
consideration may be valency; IgG immunoadhesins are bivalent
homodimers, whereas Ig subtypes like IgA and IgM may give rise to
dimeric or pentameric structures, respectively, of the basic Ig
homodimer unit. For immunoadhesins designed for in vivo
application, the pharmacokinetic properties and the effector
functions specified by the Fc region are important as well.
Although IgG1, IgG2 and IgG4 all have in vivo half-lives of 21
days, their relative potencies at activating the complement system
are different. IgG4 does not activate complement, and IgG2 is
significantly weaker at complement activation than IgG1. Moreover,
unlike IgG1, IgG2 does not bind to Fc receptors on mononuclear
cells or neutrophils. While IgG3 is optimal for complement
activation, its in vivo half-life is approximately one third of the
other IgG isotypes. Another important consideration for
immunoadhesins designed to be used as human therapeutics is the
number of allotypic variants of the particular isotype. In general,
IgG isotypes with fewer serologically-defined allotypes are
preferred. For example, IgG1 has only four serologically-defined
allotypic sites, two of which (G1m and 2) are located in the Fc
region; and one of these sites G1m1, is non-immunogenic. In
contrast, there are 12 serologically-defined allotypes in IgG3, all
of which are in the Fc region; only three of these sites (G3 m5, 11
and 21) have one allotype which is nonimmunogenic. Thus, the
potential immunogenicity of a y3 immunoadhesin is greater than that
of a .gamma.1 immunoadhesin.
[0253] With respect to the parental immunoglobulin, a useful
joining point isjust upstream of the cysteines of the hinge that
form the disulfide bonds between the two heavy chains. In a
frequently used design, the codon for the C-terminal residue of the
WSX receptor or OB protein part of the molecule is placed directly
upstream of the codons for the sequence DKTHTCPPCP (SEQ ID NO:44)
of the IgG1 hinge region.
[0254] The general methods suitable for the construction and
expression of immunoadhesins are the same as those disclosed
hereinabove with regard to WSX receptor and OB protein.
Immunoadhesins are most conveniently constructed by fusing the cDNA
sequence encoding the WSX receptor or OB protein portion in-frame
to an Ig cDNA sequence. However, fusion to genomic Ig fragments can
also be used (see, e.g., Gascoigne et al., Proc. Natl. Acad. Sci.
USA, 84:2936-2940 (1987); Aruffo et al., Cell 61:1303-1313 (1990);
Stamenkovic et al., Cell 66:1133-1144 (1991)). The latter type of
fusion requires the presence of Ig regulatory sequences for
expression. cDNAs encoding IgG heavy-chain constant regions can be
isolated based on published sequence from cDNA libraries derived
from spleen or peripheral blood lymphocytes, by hybridization or by
polymerase chain reaction (PCR) techniques. The cDNAs encoding the
WSX receptor or OB protein and Ig parts of the immunoadhesin are
inserted in tandem into a plasmid vector that directs efficient
expression in the chosen host cells. For expression in mammalian
cells, pRK5-based vectors (Schall et al., Cell 61:361-370 (1990))
and CDM8-based vectors (Seed, Nature 329:840 (1989)) can be used.
The exact junction can be created by removing the extra sequences
between the designed junction codons using oligonucleotide-directed
deletional mutagenesis (Zoller et al., NucleicAcids Res. 10:6487
(1982); Capon et al., Nature 337:525-531 (1989)). Synthetic
oligonucleotides can be used, in which each half is complementary
to the sequence on either side of the desired junction; ideally,
these are 36 to 48-mers. Alternatively, PCR techniques can be used
to join the two parts of the molecule in-frame with an appropriate
vector.
[0255] The choice of host cell line for the expression of the
immunoadhesin depends mainly on the expression vector. Another
consideration is the amount of protein that is required. Milligram
quantities often can be produced by transient transfections. For
example, the adenovirus EIA-transformed 293 human embryonic kidney
cell line can be transfected transiently with pRK5-based vectors by
a modification of the calcium phosphate method to allow efficient
immunoadhesin expression. CDM8-based vectors can be used to
transfect COS cells by the DEAE-dextran method (Aruffo et al., Cell
61:1303-1313 (1990); Zettmeissl et al., DNA Cell Biol. US 9:347-353
(1990)). If larger amounts of protein are desired, the
immunoadhesin can be expressed after stable transfection of a host
cell line. For example, a pRK5-based vector can be introduced into
Chinese hamster ovary (CHO) cells in the presence of an additional
plasmid encoding dihydrofolate reductase (DHFR) and conferring
resistance to G418. Clones resistant to G418 can be selected in
culture; these clones are grown in the presence of increasing
levels of DHFR inhibitor methotrexate; clones are selected, in
which the number of gene copies encoding the DHFR and immunoadhesin
sequences is co-amplified. If the immunoadhesin contains a
hydrophobic leader sequence at its N-terminus, it is likely to be
processed and secreted by the transfected cells. The expression of
immunoadhesins with more complex structures may require uniquely
suited host cells; for example, components such as light chain or J
chain may be provided by certain myeloma or hybridoma cell hosts
(Gascoigne et al., 1987, supra, Martin et al., J. Virol.
67:3561-3568 (1993)).
[0256] Immunoadhesins can be conveniently purified by affinity
chromatography. The suitability of protein A as an affinity ligand
depends on the species and isotype of the immunoglobulin Fc domain
that is used in the chimera. Protein A can be used to purify
immunoadhesins that are based on human .gamma.1, .gamma.2, or
.gamma.4 heavy chains (Lindmark et al., J. Immunol. Meth. 62:1-13
(1983)). Protein G is recommended for all mouse isotypes and for
human .gamma.3 (Guss et al., EMBO J. 5:1567-1575 (1986)). The
matrix to which the affinity ligand is attached is most often
agarose, but other matrices are available. Mechanically stable
matrices such as controlled pore glass or
poly(styrenedivinyl)benzene allow for faster flow rates and shorter
processing times than can be achieved with agarose. The conditions
for binding an immunoadhesin to the protein A or G affinity column
are dictated entirely by the characteristics of the Fc domain; that
is, its species and isotype. Generally, when the proper ligand is
chosen, efficient binding occurs directly from unconditioned
culture fluid. One distinguishing feature of immunoadhesins is
that, for human .gamma.1 molecules, the binding capacity for
protein A is somewhat diminished relative to an antibody of the
same Fc type. Bound immunoadhesin can be efficiently eluted either
at acidic pH (at or above 3.0), or in a neutral pH buffer
containing a mildly chaotropic salt. This affinity chromatography
step can result in an immunoadhesin preparation that is >95%
pure.
[0257] Other methods known in the art can be used in place of, or
in addition to, affinity chromatography on protein A or G to purify
immunoadhesins. Immunoadhesins behave similarly to antibodies in
thiophilic gel chromatography (Hutchens et al., Anal. Biochem.
159:217-226 (1986)) and immobilized metal chelate chromatography
(Al-Mashikhi et al., J. Dairy Sci. 71:1756-1763 (1988)). In
contrast to antibodies, however, their behavior on ion exchange
columns is dictated not only by their isoelectric points, but also
by a charge dipole that may exist in the molecules due to their
chimeric nature.
[0258] If desired, the immunoadhesins can be made bispecific. Thus,
the immunoadhesins of the present invention may combine a WSX
receptor extracellular domain and a domain, such as the
extracellular domain, of another cytokine receptor subunit.
Exemplary cytokine receptors from which such bispecific
immunoadhesin molecules can be made include TPO (or mpl ligand),
EPO, G-CSF, IL-4, IL-7, GH, PRL, IL-3, GM-CSF, IL-5, IL-6, LIF,
OSM, CNTF and IL-2 receptors. Alternatively, an OB protein domain
may be combined with another cytokine, such as those exemplified
herein, in the generation of a bispecific immunoadhesin. For
bispecific molecules, trimeric molecules, composed of a chimeric
antibody heavy chain in one arm and a chimeric antibody heavy
chain-light chain pair in the other arm of their antibody-like
structure are advantageous, due to ease of purification. In
contrast to antibody-producing quadromas traditionally used for the
production of bispecific immunoadhesins, which produce a mixture of
ten tetramers, cells transfected with nucleic acid encoding the
three chains of a trimeric immunoadhesin structure produce a
mixture of only three molecules, and purification of the desired
product from this mixture is correspondingly easier.
[0259] a. Long Half-Life Derivatives of OB Protein
[0260] Prefered OB protein functional derivatives for use in the
methods of the present invention include OB-immunoglobulin chimeras
(immunoadhesins) and other longer half-life molecules. Techniques
for generating OB protein immunoadhesins have been described above.
The prefered OB immunoadhesin is made according to the techniques
described in Example 11 below.
[0261] Other derivatives of the OB proteins, which possess a longer
half-life than the native molecules comprise the OB protein or an
OB-immunoglobulin chimera covalently bonded to a nonproteinaceous
polymer. The nonproteinaceous polymer ordinarily is a hydrophilic
synthetic polymer, i.e., a polymer not otherwise found in nature.
However, polymers which exist in nature and are produced by
recombinant or in vitro methods are useful, as are polymers which
are isolated from native sources. Hydrophilic polyvinyl polymers
fall within the scope of this invention, e.g. polyvinylalcohol and
polyvinylpyrrolidone. Particularly useful are polyalkylene ethers
such as polyethylene glycol (PEG); polyelkylenes such as
polyoxyethylene, polyoxypropylene, and block copolymers of
polyoxyethylene and polyoxypropylene (Pluronics.TM.);
polymethacrylates; carbomers; branched or unbranched
polysaccharides which comprise the saccharide monomers D-mannose,
D- and L-galactose, fucose, fructose, D-xylose, L-arabinose,
D-glucuronic acid, sialic acid, D-galacturonic acid, D-mannuronic
acid (e.g. polymannuronic acid, or alginic acid), D-glucosamine,
D-galactosamine, D-glucose and neuraminic acid including
homopolysaccharides and heteropolysaccharides such as lactose,
amylopectin, starch, hydroxyethyl starch, amylose, dextrane
sulfate, dextran, dextrins, glycogen, or the polysaccharide subunit
of acid mucopolysaccharides, e.g. hyaluronic acid; polymers of
sugar alcohols such as polysorbitol and polymannitol; heparin or
heparon. The polymer prior to cross-linking need not be, but
preferably is, water soluble, but the final conjugate must be water
soluble. In addition, the polymer should not be highly immunogenic
in the conjugate form, nor should it possess viscosity that is
incompatible with intravenous infusion or injection if it is
intended to be administered by such routes.
[0262] Preferably the polymer contains only a single group which is
reactive. This helps to avoid cross-linking of protein molecules.
However, it is within the scope herein to optimize reaction
conditions to reduce cross-linking, or to purify the reaction
products through gel filtration or chromatographic sieves to
recover substantially homogenous derivatives.
[0263] The molecular weight of the polymer may desirably range from
about 100 to 500,000, and preferably is from about 1,000 to 20,000.
The molecular weight chosen will depend upon the nature of the
polymer and the degree of substitution. In general, the greater the
hydrophilicity of the polymer and the greater the degree of
substitution, the lower the molecular weight that can be employed.
Optimal molecular weights will be determined by routine
experimentation.
[0264] The polymer generally is covalently linked to the OB protein
or to the OB-immunoglobulin chimera though a multifunctional
crosslinking agent which reacts with the polymer and one or more
amino acid or sugar residues of the OB protein or OB-immunoglobulin
chimera to be linked. However, it is within the scope of the
invention to directly crosslink the polymer by reacting a
derivatized polymer with the hybrid, or via versa.
[0265] The covalent crosslinking site on the OB protein or
OB-immunoglobulin chimera includes the N-terminal amino group and
epsilon amino groups found on lysine residues, as well as other
amino, imino, carboxyl, sulfhydryl, hydroxyl or other hydrophilic
groups. The polymer may be covalently bonded directly to the hybrid
without the use of a multifunctional (ordinarily bifunctional)
crosslinking agent. Covalent binding to amino groups is
accomplished by known chemistries based upon cyanuric chloride,
carbonyl diimidazole, aldehyde reactive groups (PEG alkoxide plus
diethyl acetal of bromoacetaldehyde; PEG plus DMSO and acetic
anhydride, or PEG chloride plus the phenoxide of
4-hydroxybenzaldehyde, succinimidyl active esters, activated
dithiocarbonate PEG, 2,4,5-trichlorophenylcloroformate or
P-nitrophenylcloroformate activated PEG). Carboxyl groups are
derivatized by coupling PEG-amine using carbodiimide.
[0266] Polymers are conjugated to oligosaccharide groups by
oxidation using chemicals, e.g. metaperiodate, or enzymes, e.g.
glucose or galactose oxidase (either of which produces the aldehyde
derivative of the carbohydrate), followed by reaction with
hydrazide or amino derivatized polymers, in the same fashion as is
described by Heitzmann et al., P.N.A. S. 71:3537-41 (1974) or Bayer
et al., Methods in Enzymology 62:310 (1979), for the labeling of
oligosaccharides with biotin or avidin. Further, other chemical or
enzymatic methods which have been used heretofore to link
oligosaccharides are particularly advantageous because, in general,
there are fewer substitutions than amino acid sites for
derivatization, and the oligosaccharide products thus will be more
homogenous. The oligosaccharide substituents also are optionally
modified by enzyme digestion to remove sugars, e.g. by
neuraminidase digestion, prior to polymer derivatization.
[0267] The polymer will bear a group which is directly reactive
with an amino acid side chain, or the N- or C-terminus of the
polypeptide linked, or which is reactive with the multifunctional
cross-linking agent. In general, polymers bearing such reactive
groups are known for the preparation of immobilized proteins. In
order to use such chemistries here, one should employ a water
soluble polymer otherwise derivatized in the same fashion as
insoluble polymers heretofore employed for protein immobilization.
Cyanogen bromide activation is a particularly useful procedure to
employ in crosslinking polysaccharides.
[0268] "Water soluble" in reference to the starting polymer means
that the polymer or its reactive intermediate used for conjugation
is sufficiently water soluble to participate in a derivatization
reaction.
[0269] "Water soluble" in reference to the polymer conjugate means
that the conjugate is soluble in physiological fluids such as
blood.
[0270] The degree of substitution with such a polymer will vary
depending upon the number of reactive sites on the protein, whether
all or a fragment of the protein is used, whether the protein is a
fusion with a heterologous protein (e.g. an OB-immunoglobulin
chimera), the molecular weight, hydrophilicity and other
characteristics of the polymer, and the particular protein
derivatization sites chosen. In general, the conjugate contains
about from 1 to 10 polymer molecules, while any heterologous
sequence may be substituted with an essentially unlimited number of
polymer molecules so long as the desired activity is not
significantly adversely affected. The optimal degree of
cross-linking is easily determined by an experimental matrix in
which the time, temperature and other reaction conditions are
varied to change the degree of substitution, after which the
ability of the conjugates to function in the desired fashion is
determined.
[0271] The polymer, e.g. PEG, is cross-linked by a wide variety of
methods known per se for the covalent modification of proteins with
nonproteinaceous polymers such as PEG. Certain of these methods,
however, are not preferred for the purposes herein. Cyanuronic
chloride chemistry leads to many side reactions, including protein
cross-linking. In addition, it may be particularly likely to lead
to inactivation of proteins containing sulfhydryl groups. Carbonyl
diimidazole chemistry (Beauchamp et al., Anal Biochem. 131:25-33
(1983)) requires high pH (>8.5), which can inactivate proteins.
Moreover, since the "activated PEG" intermediate can react with
water, a very large molar excess of "activated PEG" over protein is
required. The high concentrations of PEG required for the carbonyl
diimidazole chemistry also led to problems in purification, as both
gel filtration chromatography and hydrophilic interaction
chromatography are adversely affected. In addition, the high
concentrations of "activated PEG" may precipitate protein, a
problem that per se has been noted previously (Davis, U.S. Pat. No.
4,179,337). On the other hand, aldehyde chemistry (Royer, U.S. Pat.
No. 4,002,531) is more efficient since it requires only a 40-fold
molar excess of PEG and a 1-2 hr incubation. However, the manganese
dioxide suggested by Royer for preparation of the PEG aldehyde is
problematic "because of the pronounced tendency of PEG to form
complexes with metal-based oxidizing agents" (Harris et al., J.
Polym. Sci. Polym. Chem. Ed. 22:341-52 (1984)). The use of a
Moffatt oxidation, utilizing DMSO and acetic anhydride, obviates
this problem. In addition, the sodium borohydride suggested by
Royer must be used at high pH and has a significant tendency to
reduce disulfide bonds. In contrast, sodium cyanoborohydride, which
is effective at neutral pH and has very little tendency to reduce
disulfide bonds is preferred.
[0272] Functionalized PEG polymers to modify the OB protein or
OB-immunoglobulin chimeras of the present invention are available
from Shearwater Polymers, Inc. (Huntsville, Ala.). Such
commercially available PEG derivatives include, but are not limited
to, amino-PEG, PEG amino acid esters, PEG-hydrazide, PEG-thiol,
PEG-succinate, carboxymethylated PEG, PEG-propionic acid, PEG amino
acids, PEG succinimidyl succinate, PEG succinimidyl propionate,
succinimidyl ester of carboxymethylated PEG, succinimidyl carbonate
of PEG, succinimidyl esters of amino acid PEGs,
PEG-oxycarbonylimidazole, PEG-nitrophenyl carbonate, PEG tresylate,
PEG-glycidyl ether, PEG-aldehyde, PEG vinylsulfone, PEG-maleimide,
PEG-orthopyridyl-disulfide, heterofunctional PEGs, PEG vinyl
derivatives, PEG silanes, and PEG phospholides. The reaction
conditions for coupling these PEG derivatives will vary depending
on the protein, the desired degree of PEGylation, and the PEG
derivative utilized. Some factors involved in the choice of PEG
derivatives include: the desired point of attachment (lysine or
cysteine), hydrolytic stability and reactivity of the derivatives,
stability, toxicity and antigenicity of the linkage, suitability
for analysis, etc. Specific instructions for the use of any
particular derivative are available from the manufacturer.
[0273] The long half-life conjugates of this invention are
separated from the unreacted starting materials by gel filtration.
Heterologous species of the conjugates are purified from one
another in the same fashion. The polymer also may be
water-insoluble, as a hydrophilic gel.
[0274] The conjugates may also be purified by ion-exchange
chromatography. The chemistry of many of the electrophilically
activated PEG's results in a reduction of amino group charge of the
PEGylated product. Thus, high resolution ion exchange
chromatography can be used to separate the free and conjugated
proteins, and to resolve species with different levels of
PEGylation. In fact, the resolution of different species (e.g.
containing one or two PEG residues) is also possible due to the
difference in the ionic properties of the unreacted amino
acids.
[0275] C. Therapeutic Uses for the WSX Receptor
[0276] The WSX receptor and WSX receptor gene are believed to find
therapeutic use for administration to a mammal in the treatment of
diseases characterized by a decrease in hematopoietic cells.
Examples of these diseases include: anemia (including macrocytic
and aplastic anemia); thrombocytopenia; hypoplasia; disseminated
intravascular coagulation (DIC); myelodysplasia; immune
(autoimmune) thrombocytopenic purpura (ITP); and HIV induced ITP.
Additionally, these WSX receptor molecules may be useful in
treating myeloproliferative thrombocytotic diseases as well as
thrombocytosis from inflammatory conditions and in iron deficiency.
WSX receptor polypeptide and WSX receptor gene which lead to an
increase in hematopoietic cell proliferation may also be used to
enhance repopulation of mature blood cell lineages in cells having
undergone chemo- or radiation therapy or bone marrow
transplantation therapy. Generally, the WSX receptor molecules are
expected to lead to an enhancement of the proliferation and/or
differentiation (but especially proliferation) of primitive
hematopoietic cells. Other potential therapeutic applications for
WSX receptor and WSX receptor gene include the treatment of obesity
and diabetes and for promoting kidney, liver and lung growth and/or
repair (e.g. in renal failure). WSX receptor can also be used to
treat obesity-related conditions, such as type II adult onset
diabetes, infertility, hypercholesterolemia, hyperlipidemia,
cardiovascular disease and hypertension.
[0277] The WSX receptor may be administered alone or in combination
with cytokines (such as OB protein), growth factors or antibodies
in the above-identified clinical situations. This may facilitate an
effective lowering of the dose of WSX receptor. Suitable dosages
for such additional molecules will be discussed below.
[0278] Administration of WSX receptor to a mammal having depressed
levels of endogenous WSX receptor or a defective WSX receptor gene
is contemplated, preferably in the situation where such depressed
levels lead to a pathological disorder, or where there is lack of
activation of the WSX receptor. In these embodiments where the full
length WSX receptor is to be administered to the patient, it is
contemplated that the gene encoding the receptor may be
administered to the patient via gene therapy technology.
[0279] In gene therapy applications, genes are introduced into
cells in order to achieve in vivo synthesis of a therapeutically
effective genetic product, for example for replacement of a
defective gene. "Gene therapy" includes both conventional gene
therapy where a lasting effect is achieved by a single treatment,
and the administration of gene therapeutic agents, which involves
the one time or repeated administration of a therapeutically
effective DNA or mRNA. Antisense RNAs and DNAs can be used as
therapeutic agents for blocking the expression of certain genes in
vivo. It has already been shown that short antisense
oligonucleotides can be imported into cells where they act as
inhibitors, despite their low intracellular concentrations caused
by their restricted uptake by the cell membrane. (Zamecnik et al.,
Proc. Natl. Acad. Sci. USA, 83:4143-4146 (1986)). The
oligonucleotides can be modified to enhance their uptake, e.g., by
substituting their negatively charged phosphodiester groups by
uncharged groups.
[0280] There are a variety of techniques available for introducing
nucleic acids into viable cells. The techniques vary depending upon
whether the nucleic acid is transferred into cultured cells in
vitro, or in vivo in the cells of the intended host. Techniques
suitable for the transfer of nucleic acid into mammalian cells in
vitro include the use of liposomes, electroporation,
microinjection, cell fusion, DEAE-dextran, the calcium phosphate
precipitation method, etc. The currently preferred in vivo gene
transfer techniques include transfection with viral (typically
retroviral) vectors and viral coat protein-liposome mediated
transfection (Dzau et al., Trends in Biotechnology 11:205-210
(1993)). In some situations it is desirable to provide the nucleic
acid source with an agent that targets the target cells, such as an
antibody specific for a cell surface membrane protein or the target
cell, a ligand for a receptor on the target cell, etc. Where
liposomes are employed, proteins which bind to a cell surface
membrane protein associated with endocytosis may be used for
targeting and/or to facilitate uptake, e.g. capsid proteins or
fragments thereof tropic for a particular cell type, antibodies for
proteins which undergo internalization in cycling, and proteins
that target intracellular localization and enhance intracellular
half-life. The technique of receptor-mediated endocytosis is
described, for example, by Wu et al., J. Biol. Chem. 262:4429-4432
(1987); and Wagner et al., Proc. Natl. Acad. Sci. USA 87:3410-3414
(1990). For review of the currently known gene marking and gene
therapy protocols see Anderson et al., Science 256:808-813
(1992).
[0281] The invention also provides antagonists of WSX receptor
activation (e.g. WSX receptor ECD, WSX receptor immunoadhesins and
WSX receptor antisense nucleic acid; neutralizing antibodies and
uses thereof are discussed in section E below). Administration of
WSX receptor antagonist to a mammal having increased or excessive
levels of endogenous WSX receptor activation is contemplated,
preferably in the situation where such levels of WSX receptor
activation lead to a pathological disorder.
[0282] In one embodiment, WSX receptor antagonist molecules may be
used to bind endogenous ligand in the body, thereby causing
desensitized WSX receptors to become responsive to WSX ligand,
especially when the levels of WSX ligand in the serum exceed normal
physiological levels. Also, it may be beneficial to bind endogenous
WSX ligand which is activating undesired cellular responses (such
as proliferation of tumor cells). Potential therapeutic
applications for WSX antagonists include for example, treatment of
metabolic disorders (e.g., anorexia, cachexia, steroid-induced
truncalobesity and other wasting diseases characterized by loss of
appetite, diminished food intake or body weight loss), stem cell
tumors and other tumors which express WSX receptor.
[0283] Pharmaceutical compositions of the WSX receptor ECD may
further include a WSX ligand. Such dual compositions may be
beneficial where it is therapeutically useful to prolong half-life
of WSX ligand, and/or activate endogenous WSX receptor directly as
a heterotrimeric complex.
[0284] Therapeutic formulations of WSX receptor are prepared for
storage by mixing WSX receptor having the desired degree of purity
with optional physiologically acceptable carriers, excipients, or
stabilizers (Remington's Pharmaceutical Sciences, 16th edition,
Osol, A., Ed., (1980)), in the form of lyophilized cake or aqueous
solutions. Acceptable carriers, excipients, or stabilizers are
nontoxic to recipients at the dosages and concentrations employed,
and include buffers such as phosphate, citrate, and other organic
acids; antioxidants including ascorbic acid; low molecular weight
(less than about 10 residues) polypeptides; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, arginine, or lysine; monosaccharides, disaccharides,
and other carbohydrates including glucose, mannose, or dextrins;
chelating agents such as EDTA; sugar alcohols such as mannitol or
sorbitol; salt-forming counter-ions such as sodium; and/or
non-ionic surfactants such as Tween, Pluronics.TM. or polyethylene
glycol (PEG).
[0285] The WSX receptor also may be entrapped in microcapsules
prepared, for example, by coacervation techniques or by interfacial
polymerization (for example, hydroxymethylcellulose or
gelatin-microcapsules and poly-(methylmethacylate) microcapsules,
respectively), in colloidal drug delivery systems (for example,
liposomes, albumin microspheres, microemulsions, nano-particles,
and nanocapsules), or in macroemulsions. Such techniques are
disclosed in Remington's Pharmaceutical Sciences, supra.
[0286] WSX receptor to be used for in vivo administration must be
sterile. This is readily accomplished by filtration through sterile
filtration membranes, prior to or following lyophilization and
reconstitution. WSX receptor ordinarily will be stored in
lyophilized form or in solution.
[0287] Therapeutic WSX receptor compositions generally are placed
into a container having a sterile access port, for example, an
intravenous solution bag or vial having a stopper pierceable by a
hypodermic injection needle.
[0288] The route of WSX receptor administration is in accord with
known methods, e.g., those routes set forth above for specific
indications, as well as the general routes of injection or infusion
by intravenous, intraperitoneal, intracerebral, intramuscular,
intraocular, intraarterial, or intralesional means, or sustained
release systems as noted below. WSX receptor is administered
continuously by infusion or by bolus injection. Generally, where
the disorder permits, one should formulate and dose the WSX
receptor for site-specific delivery.
[0289] Suitable examples of sustained-release preparations include
semipermeable matrices of solid hydrophobic polymers containing the
protein, which matrices are in the form of shaped articles, e.g.,
films, or microcapsules. Examples of sustained-release matrices
include polyesters, hydrogels (e.g.,
poly(2-hydroxyethyl-methacrylate) as described by Langer et al., J.
Biomed. Mater. Res. 15:167-277 (1981) and Langer, Chem. Tech.
12:98-105 (1982) orpoly(vinylalcohol)), polylactides (U.S. Pat. No.
3,773,919, EP 58,481), copolymers of L-glutamic acid andy
ethyl-L-glutamate (Sidman et al., Biopolymers 22:547-556 (1983)),
non-degradable ethylene-vinyl acetate (Langer et al., supra),
degradable lactic acid-glycolic acid copolymers such as the Lupron
Depot.TM. (injectable microspheres composed of lactic acid-glycolic
acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid (EP 133,988).
[0290] While polymers such as ethylene-vinyl acetate and lactic
acid-glycolic acid enable release of molecules for over 100 days,
certain hydrogels release proteins for shorter time periods. When
encapsulated proteins remain in the body for a long time, they may
denature or aggregate as a result of exposure to moisture at
37.degree. C., resulting in a loss of biological activity and
possible changes in immunogenicity. Rational strategies can be
devised for protein stabilization depending on the mechanism
involved. For example, if the aggregation mechanism is discovered
to be intermolecular S--S bond formation through thio-disulfide
interchange, stabilization may be achieved by modifying sulfhydryl
residues, lyophilizing from acidic solutions, controlling moisture
content, using appropriate additives, and developing specific
polymer matrix compositions.
[0291] Sustained-release WSX receptor compositions also include
liposomally entrapped WSX receptor. Liposomes containing WSX
receptor are prepared by methods known per se: DE 3,218,121;
Epstein et al., Proc. Natl. Acad. Sci. USA 82:3688-3692 (1985);
Hwang et al., Proc. Natl. Acad. Sci. USA 77:4030-4034 (1980); EP
52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese
patent application 83-118008; U.S. Pat. Nos. 4,485,045 and
4,544,545; and EP 102,324. Ordinarily the liposomes are of the
small (about 200-800 Angstroms) unilamellar type in which the lipid
content is greater than about 30 mol. % cholesterol, the selected
proportion being adjusted for the optimal WSX receptor therapy.
[0292] When applied topically, the WSX receptor is suitably
combined with other ingredients, such as carriers and/or adjuvants.
There are no limitations on the nature of such other ingredients,
except that they must be physiologically acceptable and efficacious
for their intended administration, and cannot degrade the activity
of the active ingredients of the composition. Examples of suitable
vehicles include ointments, creams, gels, or suspensions, with or
without purified collagen. The compositions also may be impregnated
into transdermal patches, plasters, and bandages, preferably in
liquid or semi-liquid form.
[0293] For obtaining a gel formulation, the WSX receptor formulated
in a liquid composition may be mixed with an effective amount of a
water-soluble polysaccharide or synthetic polymer such as PEG to
form a gel of the proper viscosity to be applied topically. The
polysaccharide that may be used includes, for example, cellulose
derivatives such as etherified cellulose derivatives, including
alkyl celluloses, hydroxyalkyl celluloses, and alkylhydroxyalkyl
celluloses, for example, methylcellulose, hydroxyethyl cellulose,
carboxymethyl cellulose, hydroxypropyl methylcellulose, and
hydroxypropyl cellulose; starch and fractionated starch; agar;
alginic acid and alginates; gum arabic; pullullan; agarose;
carrageenan; dextrans; dextrins; fructans; inulin; mannans; xylans;
arabinans; chitosans; glycogens; glucans; and synthetic
biopolymers; as well as gums such as xanthan gum; guar gum; locust
bean gum; gum arabic; tragacanth gum; and karaya gum; and
derivatives and mixtures thereof. The preferred gelling agent
herein is one that is inert to biological systems, nontoxic, simple
to prepare, and not too runny or viscous, and will not destabilize
the WSX receptor held within it.
[0294] Preferably the polysaccharide is an etherified cellulose
derivative, more preferably one that is well defined, purified, and
listed in USP, e.g., methylcellulose and the hydroxyalkyl cellulose
derivatives, such as hydroxypropyl cellulose, hydroxyethyl
cellulose, and hydroxypropyl methylcellulose. Most preferred herein
is methylcellulose.
[0295] The polyethylene glycol useful for gelling is typically a
mixture of low and high molecular weight PEGs to obtain the proper
viscosity. For example, a mixture of a PEG of molecular weight
400-600 with one of molecular weight 1500 would be effective for
this purpose when mixed in the proper ratio to obtain a paste.
[0296] The term "water soluble" as applied to the polysaccharides
and PEGs is meant to include colloidal solutions and dispersions.
In general, the solubility of the cellulose derivatives is
determined by the degree of substitution of ether groups, and the
stabilizing derivatives useful herein should have a sufficient
quantity of such ether groups per anhydroglucose unit in the
cellulose chain to render the derivatives water soluble. A degree
of ether substitution of at least 0.35 ether groups per
anhydroglucose unit is generally sufficient. Additionally, the
cellulose derivatives may be in the form of alkali metal salts, for
example, the Li, Na, K, or Cs salts.
[0297] If methylcellulose is employed in the gel, preferably it
comprises about 2-5%, more preferably about 3%, of the gel and the
WSX receptor is present in an amount of about 300-1000 mg per ml of
gel.
[0298] An effective amount of WSX receptor to be employed
therapeutically will depend, for example, upon the therapeutic
objectives, the route of administration, and the condition of the
patient. Accordingly, it will be necessary for the therapist to
titer the dosage and modify the route of administration as required
to obtain the optimal therapeutic effect. Typically, the clinician
will administer the WSX receptor until a dosage is reached that
achieves the desired effect. A typical daily dosage for systemic
treatment might range from about 1 .mu.g/kg to up to 10 mg/kg or
more, depending on the factors mentioned above. As an alternative
general proposition, the WSX receptor is formulated and delivered
to the target site or tissue at a dosage capable of establishing in
the tissue a WSX receptor level greater than about 0.1 ng/cc up to
a maximum dose that is efficacious but not unduly toxic. This
intra-tissue concentration should be maintained if possible by
continuous infusion, sustained release, topical application, or
injection at empirically determined frequencies. The progress of
this therapy is easily monitored by conventional assays.
[0299] D. Non-Therapeutic Uses for the WSX Receptor
[0300] WSX receptor nucleic acid is useful for the preparation of
WSX receptor polypeptide by recombinant techniques exemplified
herein which can then be used for production of anti-WSX receptor
antibodies having various utilities described below.
[0301] The WSX receptor (polypeptide or nucleic acid) can be used
to induce proliferation and/or differentiation of cells in vitro.
In particular, it is contemplated that this molecule may be used to
induce proliferation of stem cell/progenitor cell populations (e.g.
CD34+ cell populations obtained as described in Example 8 below).
These cells which are to be grown ex vivo may simultaneously be
exposed to other known growth factors or cytokines, such as those
described herein. This results in proliferation and/or
differentiation of the cells having the WSX receptor.
[0302] In yet another aspect of the invention, the WSX receptor may
be used for affinity purification of WSX ligand. Briefly, this
technique involves: (a) contacting a source of WSX ligand with an
immobilized WSX receptor under conditions whereby the WSX ligand to
be purified is selectively adsorbed onto the immobilized receptor;
(b) washing the immobilized WSX receptor and its support to remove
non-adsorbed material; and (c) eluting the WSX ligand molecules
from the immobilized WSX receptor to which they are adsorbed with
an elution buffer. In a particularly preferred embodiment of
affinity purification, WSX receptor is covalently attaching to an
inert and porous matrix (e.g., agarose reacted with cyanogen
bromide). Especially preferred is a WSX receptor immunoadhesin
immobilized on a protein A column. A solution containing WSX ligand
is then passed through the chromatographic material. The WSX ligand
adsorbs to the column and is subsequently released by changing the
elution conditions (e.g. by changing pH or ionic strength).
[0303] The WSX receptor may be used for competitive screening of
potential agonists or antagonists for binding to the WSX receptor.
Such agonists or antagonists may constitute potential therapeutics
for treating conditions characterized by insufficient or excessive
WSX receptor activation, respectively.
[0304] The preferred technique for identifying molecules which bind
to the WSX receptor utilizes a chimeric receptor (e.g., epitope
tagged WSX receptor or WSX receptor immunoadhesin) attached to a
solid phase, such as the well of an assay plate. Binding of
molecules which are optionally labelled (e.g., radiolabelled) to
the immobilized receptor can be evaluated.
[0305] To identify WSX receptor agonists or antagonists, the
thymidine incorporation assay can be used. For screening for
antagonists, the WSX receptor can be exposed to a WSX ligand
followed by the putative antagonist, or the WSX ligand and
antagonist can be added to the WSX receptor simultaneously, and the
ability of the antagonist to block receptor activation can be
evaluated.
[0306] The WSX receptor polypeptides are also useful as molecular
weight markers. To use a WSX receptor polypeptide as a molecular
weight marker, gel filtration chromatography or SDS-PAGE, for
example, will be used to separate protein(s) for which it is
desired to determine their molecular weight(s) in substantially the
normal way. The WSX receptor and other molecular weight markers
will be used as standards to provide a range of molecular weights.
For example, phosphorylase b (mw=97,400), bovine serum albumin (mw
68,000), ovalbumin (mw=46,000), WSX receptor (mw=44,800), trypsin
inhibitor (mw=20,100), and lysozyme (mw=14,400) can be used as mw
markers. The other molecular weight markers mentioned here can be
purchased commercially from Amersham Corporation, Arlington
Heights, Ill. The molecular weight markers are generally labeled to
facilitate detection thereof. For example, the markers may be
biotinylated and following separation can be incubated with
streptavidin-horseradish peroxidase so that the various markers can
be detected by light detection.
[0307] The purified WSX receptor, and the nucleic acid encoding it,
may also be sold as reagents for mechanism studies of WSX receptor
and its ligands, to study the role of the WSX receptor and WSX
ligand in normal growth and development, as well as abnormal growth
and development, e.g., in malignancies.
[0308] WSX receptor variants are useful as standards or controls in
assays for the WSX receptor for example ELISA, RIA, or RRA,
provided that they are recognized by the analytical system
employed, e.g., an anti-WSX receptor antibody.
[0309] E. WSX Receptor Antibody Preparation
[0310] 1. Polyclonal Antibodies
[0311] Polyclonal antibodies are generally raised in animals by
multiple subcutaneous (sc) or intraperitoneal (ip) injections of
the relevant antigen and an adjuvant. In that the preferred epitope
is in the ECD of the WSX receptor, it is desirable to use WSX
receptor ECD or a molecule comprising the ECD (e.g., WSX receptor
immunoadhesin) as the antigen for generation of polyclonal and
monoclonal antibodies. It may be useful to conjugate the relevant
antigen to a protein that is immunogenic in the species to be
immunized, e.g., keyhole limpet hemocyanin, serum albumin, bovine
thyroglobulin, or soybean trypsin inhibitor using a bifunctional or
derivatizing agent, for example, maleimidobenzoyl sulfosuccinimide
ester (conjugation through cysteine residues), N-hydroxysuccinimide
(through lysine residues), glutaraldehyde, succinic anhydride,
SOCl.sub.2, or R.sup.1N.dbd.C.dbd.NR, where R and R.sup.1 are
different alkyl groups.
[0312] Animals are immunized against the antigen, immunogenic
conjugates, or derivatives by combining 1 mg or 1 .mu.g of the
peptide or conjugate (for rabbits or mice, respectively) with 3
volumes of Freund's complete adjuvant and injecting the solution
intradermally at multiple sites. One month later the animals are
boosted with 1/5 to {fraction (1/10)} the original amount of
peptide or conjugate in Freund's complete adjuvant by subcutaneous
injection at multiple sites. Seven to 14 days later the animals are
bled and the serum is assayed for antibody titer. Animals are
boosted until the titer plateaus. Preferably, the animal is boosted
with the conjugate of the same antigen, but conjugated to a
different protein and/or through a different cross-linking reagent.
Conjugates also can be made in recombinant cell culture as protein
fusions. Also, aggregating agents such as alum are suitably used to
enhance the immune response.
[0313] 2. Monoclonal Antibodies
[0314] Monoclonal antibodies are obtained from a population of
substantially homogeneous antibodies, i.e., the individual
antibodies comprising the population are identical except for
possible naturally occurring mutations that may be present in minor
amounts. Thus, the modifier "monoclonal" indicates the character of
the antibody as not being a mixture of discrete antibodies.
[0315] For example, the monoclonal antibodies may be made using the
hybridoma method first described by Kohler et al., Nature 256:495
(1975), or may be made by recombinant DNA methods (Cabilly et al.,
supra).
[0316] In the hybridoma method, a mouse or other appropriate host
animal, such as a hamster, is immunized as hereinabove described to
elicit lymphocytes that produce or are capable of producing
antibodies that will specifically bind to the protein used for
immunization. Alternatively, lymphocytes may be immunized in vitro.
Lymphocytes then are fused with myeloma cells using a suitable
fusing agent, such as polyethylene glycol, to form a hybridoma cell
(Goding, Monoclonal Antibodies: Principles and Practice, pp.59-103
(Academic Press, 1986)).
[0317] The hybridoma cells thus prepared are seeded and grown in a
suitable culture medium that preferably contains one or more
substances that inhibit the growth or survival of the unfused,
parental myeloma cells. For example, if the parental myeloma cells
lack the enzyme hypoxanthine guanine phosphoribosyl transferase
(HGPRT or HPRT), the culture medium for the hybridomas typically
will include hypoxanthine, aminopterin, and thymidine (HAT medium),
which substances prevent the growth of HGPRT-deficient cells.
[0318] Preferred myeloma cells are those that fuse efficiently,
support stable high-level production of antibody by the selected
antibody-producing cells, and are sensitive to a medium such as HAT
medium. Among these, preferred myeloma cell lines are murine
myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse
tumors available from the Salk Institute Cell Distribution Center,
San Diego, Calif. USA, and SP-2 cells available from the American
Type Culture Collection, Rockville, Md. USA. Human myeloma ad
mouse-human heteromyeloma cell lines also have been described for
the production of human monoclonal antibodies (Kozbor, J. Immunol.
133:3001 (1984); Brodeur et al., Monoclonal Antibody Production
Techniquies and Applications, pp. 51-63 (Marcel Dekker, Inc., New
York, 1987)).
[0319] Culture medium in which hybridoma cells are growing is
assayed for production of monoclonal antibodies directed against
the antigen. Preferably, the binding specificity of monoclonal
antibodies produced by hybridoma cells is determined by
immunoprecipitation or by an in vitro binding assay, such as
radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay
(ELISA).
[0320] The binding affinity of the monoclonal antibody can, for
example, be determined by the Scatchard analysis of Munson et al.,
Anal. Biochem. 107:220 (1980).
[0321] After hybridoma cells are identified that produce antibodies
of the desired specificity, affinity, and/or activity, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods (Goding, supra). Suitable culture media for this
purpose include, for example, D-MEM or RPMI-1640 medium. In
addition, the hybridoma cells may be grown in vivo as ascites
tumors in an animal.
[0322] The monoclonal antibodies secreted by the subclones are
suitably separated from the culture medium, ascites fluid, or serum
by conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxylapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0323] DNA encoding the monoclonal antibodies is readily isolated
and sequenced using conventional procedures (e.g., by using
oligonucleotide probes that are capable of binding specifically to
genes encoding the heavy and light chains of murine antibodies).
The hybridoma cells serve as a preferred source of such DNA. Once
isolated, the DNA may be placed into expression vectors, which are
then transfected into host cells such as E. coli cells, simian COS
cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do
not otherwise produce immunoglobulin protein, to obtain the
synthesis of monoclonal antibodies in the recombinant host cells.
Review articles on recombinant expression in bacteria of DNA
encoding the antibody include Skerra et al., Ctirr. Opinion in
Imminol. 5:256-262 (1993) and Pluckthun, Immunol. Revs. 130:151-188
(1992).
[0324] In a further embodiment, antibodies or antibody fragments
can be isolated from antibody phage libraries generated using the
techniques described in McCafferty et al., Nature
348:552-554(1990). Clackson et al., Nature 352:624-628 (1991) and
Marks et al., J. Mol. Biol. 222:581-597 (1991) describe the
isolation of murine and human antibodies, respectively, using phage
libraries. Subsequent publications describe the production of high
affinity (nM range) human antibodies by chain shuffling (Mark et
al., Bio/Technology 10:779-783 (1992)), as well as combinatorial
infection and in vivo recombination as a strategy for constructing
very large phage libraries (Waterhouse et al., Nuc. Acids. Res.
21:2265-2266 (1993)). Thus, these techniques are viable
alternatives to traditional monoclonal antibody hybridoma
techniques for isolation of monoclonal antibodies.
[0325] The DNA also may be modified, for example, by substituting
the coding sequence for human heavy- and light-chain constant
domains in place of the homologous murine sequences (Cabilly et
al., supra; Morrison, et al., Proc. Nat. Acad. Sci. USA 81:6851
(1984)), or by covalently joining to the immunoglobulin coding
sequence all or part of the coding sequence for a
non-immunoglobulin polypeptide.
[0326] Typically such non-immunoglobulin polypeptides are
substituted for the constant domains of an antibody, or they are
substituted for the variable domains of one antigen-combining site
of an antibody to create a chimeric bivalent antibody comprising
one antigen-combining site having specificity for an antigen and
another antigen-combining site having specificity for a different
antigen.
[0327] Chimeric or hybrid antibodies also may be prepared in vitro
using known methods in synthetic protein chemistry, including those
involving crosslinking agents. For example, immunotoxins may be
constructed using a disulfide-exchange reaction or by forming a
thioether bond. Examples of suitable reagents for this purpose
include iminothiolate and methyl-4-mercaptobutyrimidate.
[0328] 3. Humanized and Human Antibodies
[0329] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source which is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and co-workers (Jones et al., Nature
321:522-525 (1986); Riechmann et al., Natire 332:323-327 (1988);
Verhoeyen et al., Science 239:1534-1536 (1988)), by substituting
rodent CDRs or CDR sequences for the corresponding sequences of a
human antibody. Accordingly, such "humanized" antibodies are
chimeric antibodies (Cabilly et al., supra), wherein substantially
less than an intact human variable domain has been substituted by
the corresponding sequence from a non-human species. In practice,
humanized antibodies are typically human antibodies in which some
CDR residues and possibly some FR residues are substituted by
residues from analogous sites in rodent antibodies.
[0330] The choice of human variable domains, both light and heavy,
to be used in making the humanized antibodies is very important to
reduce antigenicity. According to the so-called "best-fit" method,
the sequence of the variable domain of a rodent antibody is
screened against the entire library of known human variable-domain
sequences. The human sequence which is closest to that of the
rodent is then accepted as the human framework (FR) for the
humanized antibody (Sims et al., J. Immunol. 151:2296 (1993);
Chothia et al., J. Mol. Biol. 196:901 (1987)). Another method uses
a particular framework derived from the consensus sequence of all
human antibodies of a particular subgroup of light or heavy chains.
The same framework may be used for several different humanized
antibodies (Carter et al., Proc. Natl. Acad. Sci. USA 89:4285
(1992); Prestaetal., J. Immunol. 151:2623 (1993)).
[0331] It is further important that antibodies be humanized with
retention of high affinity for the antigen and other favorable
biological properties. To achieve this goal, according to a
preferred method, humanized antibodies are prepared by a process of
analysis of the parental sequences and various conceptual humanized
products using three-dimensional models of the parental and
humanized sequences. Three-dimensional immunoglobulin models are
commonly available and are familiar to those skilled in the art.
Computer programs are available which illustrate and display
probable three-dimensional conformational structures of selected
candidate immunoglobulin sequences. Inspection of these displays
permits analysis of the likely role of the residues in the
functioning of the candidate immunoglobulin sequence, i.e., the
analysis of residues that influence the ability of the candidate
immunoglobulin to bind its antigen. In this way, FR residues can be
selected and combined from the consensus and import sequences so
that the desired antibody characteristic, such as increased
affinity for the target antigen(s), is achieved. In general, the
CDR residues are directly and most substantially involved in
influencing antigen binding.
[0332] Alternatively, it is now possible to produce transgenic
animals (e.g., mice) that are capable, upon immunization, of
producing a full repertoire of human antibodies in the absence of
endogenous immunoglobulin production. For example, it has been
described that the homozygous deletion of the antibody heavy-chain
joining region (JH) gene in chimeric and germ-line mutant mice
results in complete inhibition of endogenous antibody production.
Transfer of the human germ-line immunoglobulin gene array in such
germ-line mutant mice will result in the production of human
antibodies upon antigen challenge. See, e.g., Jakobovits et al.,
Proc. Natl. Acad. Sci. USA 90:2551(1993); Jakobovits et al., Nature
362:255-258 (1993); Bruggermann et al., Year in Immuno. 7:33
(1993). Human antibodies can also be produced in phage-display
libraries (Hoogenboom et al., J. Mol. Biol. 227:381 (1991); Marks
et al., J. Mol. Biol. 222:581 (1991)).
[0333] 4. Bispecific Antibodies
[0334] Bispecific antibodies (BsAbs) are antibodies that have
binding specificities for at least two different antigens. BsAbs
can be used as tumor targeting or imaging agents and can be used to
target enzymes or toxins to a cell possessing the WSX receptor.
Such antibodies can be derived from full length antibodies or
antibody fragments (e.g. F(ab').sub.2 bispecific antibodies). In
accordance with the present invention, the BsAb may possess one arm
which binds the WSX receptor and another arm which binds to a
cytokine or another cytokine receptor (or .alpha. subunit thereof)
such as the receptors for TPO, EPO, G-CSF, IL-4, IL-7, GH, PRL; the
a or P subunits of the IL-3, GM-CSF, IL-5, IL-6, LIF, OSM and CNTF
receptors; or the .alpha., .beta. or .gamma. subunits of the IL-2
receptor complex. For example, the BsAb may bind both WSX receptor
and gp130.
[0335] Methods for making bispecific antibodies are known in the
art. Traditional production of full length bispecific antibodies is
based on the coexpression of two immunoglobulin heavy chain-light
chain pairs, where the two chains have different specificities
(Millstein et al., Nature 305:537-539 (1983)). Because of the
random assortment of immunoglobulin heavy and light chains, these
hybridomas (quadromas) produce a potential mixture of 10 different
antibody molecules, of which only one has the correct bispecific
structure. Purification of the correct molecule, which is usually
done by affinity chromatography steps, is rather cumbersome, and
the product yields are low. Similar procedures are disclosed in WO
93/08829, published 13 May 1993, and in Traunecker et al., EMBO J.
10:3655-3659 (1991).
[0336] According to a different and more preferred approach,
antibody variable domains with the desired binding specificities
(antibody-antigen combining sites) are fused to immunoglobulin
constant domain sequences. The fusion preferably is with an
immunoglobulin heavy chain constant domain, comprising at least
part of the hinge, CH2, and CH3 regions. It is preferred to have
the first heavy-chain constant region (CH1) containing the site
necessary for light chain binding, present in at least one of the
fusions. DNAs encoding the immunoglobulin heavy chain fusions and,
if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are co-transfected into a suitable
host organism. This provides for great flexibility in adjusting the
mutual proportions of the three polypeptide fragments in
embodiments when unequal ratios of the three polypeptide chains
used in the construction provide the optimum yields. It is,
however, possible to insert the coding sequences for two or all
three polypeptide chains in one expression vector when the
expression of at least two polypeptide chains in equal ratios
results in high yields or when the ratios are of no particular
significance.
[0337] In a preferred embodiment of this approach, the bispecific
antibodies are composed of a hybrid immunoglobulin heavy chain with
a first binding specificity in one arm, and a hybrid immunoglobulin
heavy chain-light chain pair (providing a second binding
specificity) in the other arm. It was found that this asymmetric
structure facilitates the separation of the desired bispecific
compound from unwanted immunoglobulin chain combinations, as the
presence of an immunoglobulin light chain in only one half of the
bispecific molecule provides for a facile way of separation. This
approach is disclosed in WO 94/04690 published Mar. 3, 1994. For
further details of generating bispecific antibodies see, for
example, Suresh et al., Methods in Enzymology 121:210 (1986).
[0338] Bispecific antibodies include cross-linked or
"heteroconjugate" antibodies. For example, one of the antibodies in
the heteroconjugate can be coupled to avidin, the other to biotin.
Such antibodies have, for example, been proposed to target immune
system cells to unwanted cells (U.S. Pat. No. 4,676,980), and for
treatment of HIV infection (WO 91/00360, WO 92/200373, and EP
03089). Heteroconjugate antibodies may be made using any convenient
cross-linking methods. Suitable cross-linking agents are well known
in the art, and are disclosed in U.S. Pat. No. 4,676,980, along
with a number of cross-linking techniques.
[0339] Techniques for generating bispecific antibodies from
antibody fragments have also been described in the literature. The
following techniques can also be used for the production of
bivalent antibody fragments which are not necessarily bispecific.
According to these techniques, Fab'-SH fragments can be recovered
from E. coli, which can be chemically coupled to form bivalent
antibodies. Shalaby et al., J. Exp. Med. 175:217-225 (1992)
describe the production of a fully humanized BsAb F(ab').sub.2
molecule. Each Fab' fragment was separately secreted from E. coli
and subjected to directed chemical coupling in vitro to form the
BsAb. The BsAb thus formed was able to bind to cells overexpressing
the HER2 receptor and normal human T cells, as well as trigger the
lytic activity of human cytotoxic lymphocytes against human breast
tumor targets. See also Rodrigues et al., Int. J. Cancers (Suppl.)
7:45-50 (1992).
[0340] Various techniques for making and isolating bivalent
antibody fragments directly from recombinant cell culture have also
been described. For example, bivalent heterodimers have been
produced using leucine zippers. Kostelny et al., J. Immunol.
148(5): 1547-1553 (1992). The leucine zipper peptides from the Fos
and Jun proteins were linked to the Fab' portions of two different
antibodies by gene fusion. The antibody homodimers were reduced at
the hinge region to form monomers and then re-oxidized to form the
antibody heterodimers. The "diabody" technology described by
Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993)
has provided an alternative mechanism for making BsAb fragments.
The fragments comprise a heavy-chain variable domain (V.sub.H)
connected to a light-chain variable domain (V.sub.L) by a linker
which is too short to allow pairing between the two domains on the
same chain. Accordingly, the V.sub.H and V.sub.L domains of one
fragment are forced to pair with the complementary V.sub.L and
V.sub.H domains of another fragment, thereby forming two
antigen-binding sites. Another strategy for making BsAb fragments
by the use of single-chain Fv (sFv) dimers has also been reported.
See Gruber et al., J. Immunol. 152:5368 (1994).
[0341] 5. Antibody Screening
[0342] It may be desirable to select antibodies with a strong
binding affinity for the WSX receptor. Antibody affinities may be
determined by saturation binding; enzyme-linked immunoabsorbent
assay (ELISA); and competition assays (e.g. RIA's), for example.
The antibody with a strong binding affinity may bind the WSX
receptor with a binding affinity (Kd) value of no more than about
1.times.10.sup.-7 M, preferably no more than about
1.times.10.sup.-8 M and most preferably no more than about
1.times.10.sup.-9 M (e.g. to about 1.times.10.sup.-12M).
[0343] In another embodiment, one may screen for an antibody which
binds a WSX receptor epitope of interest. For example, an antibody
which binds to the epitope bound by antibody 2D7, 1G4, 1E11 or 1C11
(see Example 13) or antibody clone #3, #4 or #17 (see Example 14)
can be identified. To screen for antibodies which bind to the
epitope on WSX receptor bound by an antibody of interest (e.g.,
those which block binding of any one of the above antibodies to WSX
receptor), a routine cross-blocking assay such as that described in
Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, Ed
Harlow and David Lane (1988), can be performed. Alternatively,
epitope mapping, e.g. as described in Champe et al., J. Biol. Chem.
270:1388-1394 (1995), can be performed to determine whether the
antibody binds an epitope of interest.
[0344] In one particularly preferred embodiment of the invention,
agonist antibodies are selected. Various methods for selecting
agonist antibodies are available. In one embodiment, one evaluates
the agonistic properties of the antibody upon binding to a chimeric
receptor comprising the WSX receptor extracellular domain in an
assay called the kinase receptor activation enzyme linked
immunoadsorbent assay (KIRA ELISA) described in WO95/14930
(expressly incorporated herein by reference).
[0345] To perform the KIRA ELISA, a chimeric receptor comprising
the extracellular domain of the WSX receptor and the transmembrane
and intracellular domain of Rse receptor (Mark et al., Journal of
Biological Chemistry 269(14):10720-10728 (1994)) with a
carboxyl-terminal herpes simplex virus glycoprotein D (gD) tag is
produced and dp12.CHO cells are transformed therewith as described
in Example 4 of WO95/14930.
[0346] The WSX/Rse.gD transformed dpl2.CHO cells are seeded
(3.times.10.sup.4 per well) in the wells of a flat-bottom-96 well
culture plate in 100 .mu.l media and cultured overnight at
37.degree. C. in 5% CO.sub.2. The following morning the well
supernatants are removed and various concentrations of the antibody
are added to separate wells. The cells are stimulated at 37.degree.
C. for 30 min., the well supernatants are decanted. To lyse the
cells and solubilize the chimeric receptors, 100 .mu.l of lysis
buffer is added to each well. The plate is then agitated gently on
a plate shaker (Bellco Instruments, Vineland, N.J.) for 60 min. at
room temperature.
[0347] While the cells are being solubilized, an ELISA microtiter
plate (Nunc Maxisorp, Inter Med, Denmark) coated overnight at
4.degree. C. with the 5B6 monoclonal anti-gD antibody (5.0 .mu.g/ml
in 50 mM carbonate buffer, pH 9.6, 100 .mu.l/well) is decanted and
blocked with 150 .mu.l/well of Block Buffer for 60 min. at room
temperature. After 60 minutes, the anti-gD 5B6 coated plate is
washed 6 times with wash buffer (PBS containing 0.05% TWEEN 20.TM.
and 0.01% thimerosal).
[0348] The lysate containing solubilized WSX/Rse.gD from the
cell-culture microtiter well is transferred (85 .mu.l/well) to
anti-gD 5B6 coated and blocked ELISA well and is incubated for 2 h
at room temperature. The unbound WSX/Rse.gD is removed by washing
with wash buffer and 100 .mu.l of biotinylated 4G10
(anti-phosphotyrosine) diluted 1:18000 in dilution buffer (PBS
containing 0.5% BSA, 0.05% Tween-20, 5 mM EDTA, and 0.01%
thimerosal), i.e. 56 ng/ml is added to each well. After incubation
for 2 h at room temperature the plate is washed and HRPO-conjugated
streptavidin (Zymed Laboratories, S. San Francisco, Calif.) is
added to each well. The plate is incubated for 30 minutes at room
temperature with gentle agitation. The free avidin-conjugate is
washed away and 100 .mu.l freshly prepared substrate solution
(tetramethyl benzidine (TMB); 2-component substrate kit; Kirkegaard
and Perry, Gaithersburg, Md.) is added to each well. The reaction
is allowed to proceed for 10 minutes, after which the color
development is stopped by the addition of 100 .mu.l/well 1.0 M
H.sub.3PO.sub.4. The absorbance at 450 nm is read with a reference
wavelength of 650 nm (ABS.sub.450/650), using a vmax plate reader
(Molecular Devices, Palo Alto, Calif.) controlled with a Macintosh
Centris 650 (Apple Computers, Cupertino, Calif.) and DeltaSoft
software (BioMetallics, Inc, Princeton, N.J.).
[0349] Those antibodies which have an IC50 in the KIRA ELISA of
about 0.5 .mu.g/ml or less (e.g. from about 0.5 .mu.g/ml to about
0.001 .mu.g/ml), preferably about 0.2 .mu.g/ml or less and most
preferably about 0.1 .mu.g/ml or less are preferred agonists.
[0350] In another embodiment, one screens for antibodies which
activate downstream signaling molecules for OB protein. For
example, the ability of the antibody to activate Signal Transducers
and Activators of Transcription (STATs) can be assessed. The
agonist antibody of interest may stimulate formation of STAT-1 and
STAT-3 complexes, for example. To screen for such antibodies, the
assay described in Rosenblum et al. Endocrinology 137(11):5178-5181
(1996) may be performed.
[0351] Alternatively, an antibody which stimulates proliferation
and/or differentiation of hematopoietic cells can be selected. For
example, the hematopoiesis assays of Example 10 below can be
performed. For example, murine fetal liver flASK stem cells may be
isolated from the midgestational fetal liver as described in
Zeigler et al., Blood 84:2422-2430 (1994) and studied in stem cell
suspension culture or methylcellulose assays. For the stem cell
suspension cultures, twenty thousand of the fLASK cells are seeded
in individual wells in a 12 well format in DMEM 4.5/F12 media
supplemented with 10% heat inactivated fetal calf serum (Hyclone,
Logan, Utah) and L-glutamine. Growth factors are added at the
following concentrations: kit ligand (KL) at 25 ng/mL,
interleukin-3 (L-3) at 25 ng/mL, interleukin-6 (IL-6) at 50 ng/mL,
G-CSF at 100 ng/mL, GM-CSF at 100 ng/mL, EPO at 2U/mL,
interleukin-7 (IL-7) at 100 ng/mL (all growth factors from R and D
Systems, Minneapolis, Minn.). The agonist antibody is then added
and the ability of the antibody to expand the flASK cells grown in
suspension culture is assessed. Methylcellulose assays are
performed as previously described (Zeiger et al., supra). Briefly,
methylcellulose colony assays are performed using "complete"
methylcellulose or pre-B methylcellulose medium (Stem Cell
Technologies, Vancouver, British Columbia, Canada) with the
addition of 25 ng/mL KL (R and D Systems, Minneapolis, Minn.).
Cytospin analyses of the resultant colonies are performed as
previously described in Zeigler et al. The ability of the agonist
antibody to augment myeloid, lymphoid and erythroid colony
formation is assessed. Also, the effect of the agonist antibody on
the murine bone marrow stem cell population; Lin.sup.loSca.sup.+
may be evaluated.
[0352] One may select an agonist antibody which induces a
statistically significant decrease in body weight and/or fat-depot
weight and/or food intake in an obese mammal (e.g. in an ob/ob
mouse). Methods for screening for such molecules are described in
Levin et al. Proc. Natl. Acad. Sci. USA 93:1726-1730 (1996), for
example. Preferred agonist antibodies are those which exert
adipose-reducing effects in an obese mammal, such as the ob/ob
mouse, which are in excess of those induced by reductions in food
intake.
[0353] The antibody of interest herein may have the hypervariable
region residues of one of the antibodies in Examples 13 and 14.
Also, the invention encompasses "affinity matured" forms of these
antibodies in which hypervariable region residues of these
antibodies have been modified. Such affinity matured antibodies
will preferably have a biological activity which is the same as or
better than that of the original antibody. The affinity matured
antibody may have from about 1-10, e.g. 5-10 deletions, insertions
or substitutions (but preferably substitutions) in the
hypervariable regions thereof. One useful procedure for generating
affinity matured antibodies is called "alanine scanning
mutagenesis" (Cunningham and Wells Science 244:1081-1085 (1989)).
Here, one or more of the hypervariable region residue(s) are
replaced by alanine or polyalanine residue(s) to affect the
interaction of the amino acids with the WSX receptor. Those
hypervariable region residue(s) demonstrating functional
sensitivity to substitution are then refined by introducing further
or other mutations at or for the sites of substitution. The
ala-mutants produced this way are screened for their biological
activity as described herein. Another procedure is affinity
maturation using phage display (Hawkins et al. J. Mol. Biol.
254:889-896 (1992) and Lowman et al. Biochemistry
30(45):10832-10837 (1991)). Briefly, several hypervariable region
sites (e.g. 6-7 sites) are mutated to generate all possible amino
substitutions at each site. The antibody mutants thus generated are
displayed in a monovalent fashion from filamentous phage particles
as fusions to the gene III product of M13 packaged within each
particle. The phage-displayed mutants are then screened for their
biological activity (e.g. binding affinity).
[0354] 6. Antibody Modifications
[0355] It may be desirable to tailor the antibody for various
applications. Exemplary antibody modifications are described
here.
[0356] In certain embodiments of the invention, it may be desirable
to use an antibody fragment, rather than an intact antibody. In
this case, it may be desirable to modify the antibody fragment in
order to increase its serum half-life. This may be achieved, for
example, by incorporation of a salvage receptor binding epitope
into the antibody fragment. See WO96/32478 published Oct. 17, 1996.
Alternatively, the antibody may be conjugated to a nonproteinaceous
polymer, such as those described above for the production of long
half-life derivatives of OB protein.
[0357] Where the antibody is to be used to treat cancer for
example, various modifications of the antibody (e.g. of a
neutralizing antibody) which enhance the effectiveness of the
antibody for treating cancer are contemplated herein. For example,
it may be desirable to modify the antibody of the invention with
respect to effector function. For example cysteine residue(s) may
be introduced in the Fc region, thereby allowing interchain
disulfide bond formation in this region. The homodimeric antibody
thus generated may have improved internalization capability and/or
increased complement-mediated cell killing and antibody-dependent
cellular cytotoxicity (ADCC). See Caron et al., J. Exp Med.
176:1191-1195 (1992) and Shopes, B. J. Immunol. 148:2918-2922
(1992). Homodimeric antibodies with enhanced anti-tumor activity
may also be prepared using heterobifunctional cross-linkers as
described in Wolff et al. Cancer Research 53:2560-2565 (1993).
Alternatively, an antibody can be engineered which has dual Fc
regions and may thereby have enhanced complement lysis and ADCC
capabilities. See Stevenson et al. Anti-Cancer Drug Design
3:219-230 (1989). The invention also pertains to immunoconjugates
comprising the antibody described herein conjugated to a cytotoxic
agent such as a chemotherapeutic agent, toxin (e.g. an
enzymatically active toxin of bacterial, fungal, plant or animal
origin, or fragments thereof), or a radioactive isotope (i.e., a
radioconjugate).
[0358] Chemotherapeutic agents useful in the generation of such
immunoconjugates have been described above. Enzymatically active
toxins and fragments thereof which can be used include diphtheria A
chain, nonbinding active fragments of diphtheria toxin, exotoxin A
chain (from Pseudomonas aeriginosa), ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites Fordii proteins, dianthin
proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S),
momordica charantia inhibitor, curcin, crotin, sapaonaria
officinalis inhibitor, gelonin, mitogellin, restrictocin,
phenomycin, enomycin and the tricothecenes. A variety of
radionuclides are available for the production of radioconjugate
antibodies. Examples include .sup.212Bi, .sup.131I, .sup.131In,
.sup.90Y and .sup.186Re.
[0359] Conjugates of the antibody and cytotoxic agent are made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin immunotoxin can be prepared as described in
Vitetta et al. Science 238: 1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. See WO94/11026.
[0360] In another embodiment, the antibody may be conjugated to a
"receptor" (such streptavidin) for utilization in tumor
pretargeting wherein the antibody-receptor conjugate is
adrninistered to the patient, followed by removal of unbound
conjugate from the circulation using a clearing agent and then
administration of a "ligand" (e.g. avidin) which is conjugated to a
cytotoxic agent (e.g. a radionucleotide).
[0361] The antibody may also be formulated as an immunoliposome.
Liposomes containing the antibody are prepared by methods known in
the art, such as described in Epstein et al., Proc. Natl. Acad.
Sci. USA, 82:3688 (1985); Hwang et al., Proc. Natl. Acad. Sci. USA,
77:4030 (1980); and U.S. Pat. Nos. 4,485,045 and 4,544,545.
Liposomes with enhanced circulation time are disclosed in U.S. Pat.
No. 5,013,556.
[0362] Particularly useful liposomes can be generated by the
reverse phase evaporation method with a lipid composition
comprising phosphatidylcholine, cholesterol and PEG-derivatized
phosphatidylethanolamine (PEG-PE). Liposomes are extruded through
filters of defined pore size to yield liposomes with the desired
diameter. Fab' fragments of the antibody of the present invention
can be conjugated to the liposomes as described in Martin et al. J.
Biol. Chem. 257: 286-288 (1982) via a disulfide interchange
reaction. A chemotherapeutic agent (such as Doxorubicin) is
optionally contained within the liposome. See Gabizon et al. J.
National Cancer Inst. 81(19)1484 (1989).
[0363] The antibody of the present invention may also be used in
ADEPT by conjugating the antibody to a prodrug-activating enzyme
which converts a prodrug (e.g. a peptidyl chemotherapeutic agent,
see WO81/01145) to an active anti-cancer drug. See, for example, WO
88/07378 and U.S. Pat. No. 4,975,278.
[0364] The enzyme component of the immunoconjugate useful for ADEPT
includes any enzyme capable of acting on a prodrug in such a way so
as to covert it into its more active, cytotoxic form.
[0365] Enzymes that are useful in the method of this invention
include, but are not limited to, alkaline phosphatase useful for
converting phosphate-containing prodrugs into free drugs;
arylsulfatase useful for converting sulfate-containing prodrugs
into free drugs; cytosine deaminase useful for converting non-toxic
5-fluorocytosine into the anti-cancer drug, 5-fluorouracil;
proteases, such as serratia protease, thermolysin, subtilisin,
carboxypeptidases and cathepsins (such as cathepsins B and L), that
are useful for converting peptide-containing prodrugs into free
drugs; D-alanylcarboxypeptidases, useful for converting prodrugs
that contain D-amino acid substituents; carbohydrate-cleaving
enzymes such as .beta.-galactosidase and neuraminidase useful for
converting glycosylated prodrugs into free drugs; P-lactamase
useful for converting drugs derivatized with P-lactams into free
drugs; and penicillin amidases, such as penicillin V amidase or
penicillin G amidase, useful for converting drugs derivatized at
their amine nitrogens with phenoxyacetyl or phenylacetyl groups,
respectively, into free drugs. Alternatively, antibodies with
enzymatic activity, also known in the art as "abzymes", can be used
to convert the prodrugs of the invention into free active drugs
(see, e.g., Massey, Nature 328: 457-458 (1987)). Antibody-abzyme
conjugates can be prepared as described herein for delivery of the
abzyme to a tumor cell population.
[0366] The enzymes of this invention can be covalently bound to the
antibody mutant by techniques well known in the art such as the use
of the heterobifunctional crosslinking reagents discussed above.
Alternatively, fusion proteins comprising at least the antigen
binding region of an antibody of the invention linked to at least a
functionally active portion of an enzyme of the invention can be
constructed using recombinant DNA techniques well known in the art
(see, e.g., Neuberger et al., Nature, 312: 604-608 (1984)).
[0367] In other embodiments, the antibody can be covalently
modified, with exemplary such modifications described above.
[0368] F. Therapeutic Uses for WSX Receptor Ligands and
Antibodies
[0369] The WSX ligands (e.g. OB protein and anti-WSX receptor
agonist antibodies) of the present invention are useful, in one
embodiment, for weight reduction, and specifically, in the
treatment of obesity, bulimia and other disorders associated with
the abnormal expression or function of the OB and/or WSX receptor
genes, other metabolic disorders such as diabetes, for reducing
excessive levels of insulin in human patients (e.g. to restore or
improve the insulin-sensitivity of such patients). Thus, these
molecules can be used to treat a patient suffering from excessive
food consumption and related pathological conditions such as type
II adult onset diabetes, infertility (Chehab et al. Nature
Genentics 12:318-320 (1996)), hypercholesterolemia, hyperlipidemia,
cardiovascular diseases, arteriosclerosis, polycystic ovarian
disease, osteoarthritis, dermatological disorders, insulin
resistance, hypertriglyceridemia, cancer, cholelithiasis and
hypertension.
[0370] In addition, the WSX ligands can be used for the treatment
of kidney ailments, hypertension, and lung dysfunctions, such as
emphysema.
[0371] In a further embodiment, the WSX ligands (such as agonist
WSX receptor antibodies) of the present invention can be used to
enhance repopulation of mature blood cell lineages in mammals
having undergone chemo- or radiation therapy or bone marrow
transplantation therapy. Generally, the ligands will act via an
enhancement of the proliferation and/or differentiation (but
especially proliferation) of primitive hematopoietic cells. The
ligands may similarly be useful for treating diseases characterized
by a decrease in blood cells. Examples of these diseases include:
anemia (including macrocytic and aplastic anemia);
thrombocytopenia; hypoplasia; immune (auto immune) thrombocytopenic
purpura (ITP); and HIV induced ITP. Also, the ligands may be used
to treat a patient having suffered a hemorrhage. WSX ligands may
also be used to treat metabolic disorders such as obesity and
diabetes mellitus, or to promote kidney, liver or lung growth
and/or repair (e.g., in renal failure).
[0372] The WSX receptor ligands and antibodies may be administered
alone or in concert with one or more cytokines. Furthermore, as an
alternative to adminstration of the WSX ligand protein, gene
therapy techniques (discussed in the section above entitled
"Therapeutic Uses for the WSX Receptor") are also contemplated
herein.
[0373] Potential therapeutic applications for WSX receptor
neutralizing antibodies include the treatment of metabolic
disorders (such as cachexia, anorexia and other wasting diseases
characterized by loss of appetite, diminished food intake or body
weight loss), stem cell tumors and other tumors at sites of WSX
receptor expression, especially those tumors characterized by
overexpression of WSX receptor.
[0374] For therapeutic applications, the WSX receptor ligands and
antibodies of the invention are administered to a mammal,
preferably a human, in a physiologically acceptable dosage form,
including those that may be administered to a human intravenously
as a bolus or by continuous infusion over a period of time, by
intramuscular, intraperitoneal, intra-cerobrospinal, subcutaneous,
intra-articular, intrasynovial, intrathecal, oral, topical, or
inhalation routes. The WSX receptor ligands and antibodies also are
suitably administered by intratumoral, peritumoral, intralesional,
or perilesional routes or to the lymph, to exert local as well as
systemic therapeutic effects.
[0375] Such dosage forms encompass physiologically acceptable
carriers that are inherently non-toxic and non-therapeutic.
Examples of such carriers include ion exchangers, alumina, aluminum
stearate, lecithin, serum proteins, such as human serum albumin,
buffer substances such as phosphates, glycine, sorbic acid,
potassium sorbate, partial glyceride mixtures of saturated
vegetable fatty acids, water, salts, or electrolytes such as
protamine sulfate, disodium hydrogen phosphate, potassium hydrogen
phosphate, sodium chloride, zinc salts, colloidal silica, magnesium
trisilicate, polyvinyl pyrrolidone, cellulose-based substances, and
PEG. Carriers for topical or gel-based forms of WSX receptor
antibodies include polysaccharides such as sodium
carboxymethylcellulose or methylcellulose, polyvinylpyrrolidone,
polyacrylates, polyoxyethylene-polyoxypropylene-block polymers,
PEG, and wood wax alcohols. For all administrations, conventional
depot forms are suitably used. Such forms include, for example,
microcapsules, nano-capsules, liposomes, plasters, inhalation
forms, nose sprays, sublingual tablets, and sustained-release
preparations. The WSX receptor ligand or antibody will typically be
formulated in such vehicles at a concentration of about 0.1 mg/ml
to 100 mg/ml.
[0376] Suitable examples of sustained-release preparations include
semipermeable matrices of solid hydrophobic polymers containing the
WSX receptor ligand or antibody, which matrices are in the form of
shaped articles, e.g. films, or microcapsules. Examples of
sustained-release matrices include polyesters, hydrogels (for
example, poly(2-hydroxyethyl-methacrylate) as described by Langer
et al., supra and Langer, supra, or poly(vinylalcohol),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and .gamma. ethyl-L-glutamate (Sidman et al., supra),
non-degradable ethylene-vinyl acetate (Langer et al., supra),
degradable lactic acid-glycolic acid copolymers such as the Lupron
Depot.TM. (injectable microspheres composed of lactic acid-glycolic
acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid. While polymers such as
ethylene-vinyl acetate and lactic acid-glycolic acid enable release
of molecules for over 100 days, certain hydrogels release proteins
for shorter time periods. When encapsulated WSX receptor antibodies
remain in the body for a long time, they may denature or aggregate
as a result of exposure to moisture at 37.degree. C., resulting in
a loss of biological activity and possible changes in
immunogenicity. Rational strategies can be devised for
stabilization depending on the mechanism involved. For example, if
the aggregation mechanism is discovered to be intermolecular S--S
bond formation through thio-disulfide interchange, stabilization
may be achieved by modifying sulfhydryl residues, lyophilizing from
acidic solutions, controlling moisture content, using appropriate
additives, and developing specific polymer matrix compositions.
[0377] Sustained-release WSX receptor ligand or antibody
compositions also include liposomally entrapped antibodies.
Liposomes containing the WSX receptor ligand or antibody are
prepared by methods known in the art, such as described in Epstein
et al., Proc. Natl. Acad. Sci. USA 82:3688 (1985); Hwang et al.,
Proc. Natl. Acad. Sci. USA 77:4030 (1980); and U.S. Pat. Nos.
4,485,045 and 4,544,545. Ordinarily, the liposomes are the small
(about 200-800 Angstroms) unilamelar type in which the lipid
content is greater than about 30 mol. % cholesterol, the selected
proportion being adjusted for the optimal WSX receptor ligand or
antibody therapy. Liposomes with enhanced circulation time are
disclosed in U.S. Pat. No. 5,013,556.
[0378] For the prevention or treatment of disease, the appropriate
dosage of WSX receptor ligand or antibody will depend on the type
of disease to be treated, as defined above, the severity and course
of the disease, whether the antibodies are administered for
preventive or therapeutic purposes, previous therapy, the patient's
clinical history and response to the WSX receptor ligand or
antibody, and the discretion of the attending physician. The WSX
receptor ligand or antibody is suitably administered to the patient
at one time or over a series of treatments.
[0379] Depending on the type and severity of the disease, about 1
.mu.g/kg to 15 mg/kg of WSX receptor ligand or antibody is an
initial candidate dosage for administration to the patient,
whether, for example, by one or more separate administrations, or
by continuous infusion. A typical daily dosage might range from
about 1 .mu.g/kg to 100 .mu.g/kg (e.g. 1-50 .mu.g/kg) or more,
depending on the factors mentioned above. For example, the dose may
be the same as that for other cytokines such as G-CSF, GM-CSF and
EPO. For repeated administrations over several days or longer,
depending on the condition, the treatment is sustained until a
desired suppression of disease symptoms occurs. However, other
dosage regimens may be useful. The progress of this therapy is
easily monitored by conventional techniques and assays.
[0380] When one or more cytokines are co-administered with the WSX
receptor ligand, lesser doses of the WSX ligand may be employed.
Suitable doses of a cytokine are from about 1 .mu.g/kg to about 15
mg/kg of cytokine. A typical daily dosage of the cytokine might
range from about 1 .mu.g/kg to 100 .mu.g/kg (e.g. 1-50 .mu.g/kg) or
more. For example, the dose may be the same as that for other
cytokines such as G-CSF, GM-CSF and EPO. The cytokine(s) may be
administered prior to, simultaneously with, or following
administration of the WSX ligand. The cytokine(s) and WSX ligand
may be combined to form a pharmaceutically composition for
simultaneous administration to the mammal. In certain embodiments,
the amounts of WSX ligand and cytokine are such that a synergistic
repopulation of blood cells (or synergistic increase in
proliferation and/or differentiation of hematopoietic cells) occurs
in the mammal upon administration of the WSX ligand and cytokine
thereto. In other words, the coordinated action of the two or more
agents (i.e. the WSX ligand and cytokine(s)) with respect to
repopulation of blood cells (or proliferation/differentiation of
hematopoietic cells) is greater than the sum of the individual
effects of these molecules.
[0381] For treating obesity and associated pathological conditions,
the WSX ligand may be administered in combination with other
treatments for combatting or preventing obesity. Substances useful
for this purpose include, e.g., hormones (catecholamines, glucagon,
ACTH); clofibrate; halogenate; cinchocaine; chlorpromazine;
appetite-suppressing drugs acting on noradrenergic
neurotransmitters such as mazindol and derivatives of
phenethylamine, e.g., phenylpropanolamine, diethylpropion,
phentermine, phendimetrazine, benzphetamine, amphetamine,
methamphetamine, and phenmetrazine; drugs acting on serotonin
neurotransmitters such as fenfluramine, tryptophan,
5-hydroxytryptophan, fluoxetine, and sertraline; centrally active
drugs such as naloxone, neuropeptide-Y, galanin,
corticotropin-releasing hormone, and cholecystokinin; a cholinergic
agonist such as pyridostigmine; a sphingolipid such as a
lysosphingolipid or derivative thereof (EP 321,287 published Jun.
21, 1989); thermogenic drugs such as thyroid hormone, ephedrine,
beta-adrenergic agonists; drugs affecting the gastrointestinal
tract such as enzyme inhibitors, e.g., tetrahydrolipostatin,
indigestible food such as sucrose polyester, and inhibitors of
gastric emptying such as threo-chlorocitric acid or its
derivatives; .beta.-adrenergic agonist such as isoproterenol and
yohimbine; aminophylline to increase the .beta.-adrenergic-like
effects of yohimbine, an .alpha..sub.2-adrenergic blocking drug
such as clonidine alone or in combination with a growth hormone
releasing peptide (U.S. Pat. No. 5,120,713 issued Jun. 9, 1992);
drugs that interfere with intestinal absorption such as biguanides
such as metformin and phenformin; bulk fillers such as
methylcellulose; metabolic blocking drugs such as hydroxycitrate;
progesterone; cholecystokinin agonists; small molecules that mimic
ketoacids; agonists to corticotropin-releasing hormone; an
ergot-related prolactin-inhibiting compound for reducing body fat
stores (U.S. Pat. No. 4,783,469 issued Nov. 8, 1988);
beta-3-agonists; bromocriptine; antagonists to opioid peptides;
antagonists to neuropeptide Y; glucocorticoid receptor antagonists;
growth hormone agonists; combinations thereof; etc. This includes
all drugs described by Bray and Greenway, Clinics in Endocrinol.
and Metabol., 5:455 (1976).
[0382] These adjunctive agents may be administered at the same time
as, before, or after the administration of WSX ligand and can be
administered by the same or a different administration route than
the WSX ligand.
[0383] The WSX ligand treatment may occur without, or may be
imposed with, a dietary restriction such as a limit in daily food
or calorie intake, as is desired for the individual patient.
[0384] G. Articles of Manufacture
[0385] In another embodiment of the invention, an article of
manufacture containing materials useful for the treatment of the
conditions described above is provided. The article of manufacture
comprises a container and a label. Suitable containers include, for
example, bottles, vials, syringes, and test tubes. The containers
may be formed from a variety of materials such as glass or plastic.
The container holds a composition which is effective for treating
the condition and may have a sterile access port (for example the
container may be an intravenous solution bag or a vial having a
stopper pierceable by a hypodermic injection needle). The active
agent in the composition is the WSX ligand. The label on, or
associated with, the container indicates that the composition is
used for treating the condition of choice. The article of
manufacture may further comprise a second container holding a
cytokine for co-administration with the WSX ligand. Further
container(s) may be provided with the article of manufacture which
may hold, for example, a pharmaceutically-acceptable buffer, such
as phosphate-buffered saline, Ringer's solution or dextrose
solution. The article of manufacture may further include other
materials desirable from a commercial and user standpoint,
including other buffers, diluents, filters, needles, syringes, and
package inserts with instructions for use.
[0386] H. Non-Therapeutic Uses for WSX Receptor Ligands and
Antibodies
[0387] WSX receptor ligands and antibodies may be used for
detection of and/or enrichment of hematopoietic stem
cell/progenitor cell populations in a similar manner to that in
which CD34 antibodies are presently used. For stem cell enrichment,
the WSX receptor antibodies may be utilized in the techniques known
in the art such as immune panning, flow cytometry or immunomagnetic
beads.
[0388] In accordance with one in vitro application of the WSX
ligands, cells comprising the WSX receptor are provided and placed
in a cell culture medium. Examples of such WSX-receptor-containing
cells include hematopoietic progenitor cells, such as CD34+
cells.
[0389] Suitable tissue culture media are well known to persons
skilled in the art and include, but are not limited to, Minimal
Essential Medium (MEM), RPMI-1640, and Dulbecco's Modified Eagle's
Medium (DMEM). These tissue culture medias are commercially
available from Sigma Chemical Company (St. Louis, Mo.) and GIBCO
(Grand Island, N.Y.). The cells are then cultured in the cell
culture medium under conditions sufficient for the cells to remain
viable and grow in the presence of an effective amount of WSX
ligand and, optionally, further cytokines and growth factors. The
cells can be cultured in a variety of ways, including culturing in
a clot, agar, or liquid culture.
[0390] The cells are cultured at a physiologically acceptable
temperature such as 37.degree. C., for example, in the presence of
an effective amount of WSX ligand. The amount of WSX ligand may
vary, but preferably is in the range of about 10 ng/ml to about 1
mg/ml. The WSX ligand can of course be added to the culture at a
dose determined empirically by those in the art without undue
experimentation. The concentration of WSX ligand in the culture
will depend on various factors, such as the conditions under which
the cells and WSX ligand are cultured. The specific temperature and
duration of incubation, as well as other culture conditions, can be
varied depending on such factors as, e.g., the concentration of the
WSX ligand, and the type of cells and medium.
[0391] It is contemplated that using WSX ligand to enhance cell
proliferation and/or differentiation in vitro will be useful in a
variety of ways. For instance, hematopoietic cells cultured in
vitro in the presence of WSX ligand can be infused into a mammal
suffering from reduced levels of the cells. Also, the cultured
hematopoietic cells may be used for gene transfer for gene therapy
applications. Stable in vitro cultures can be also used for
isolating cell-specific factors and for expression of endogenous or
recombinantly introduced proteins in the cell. WSX ligand may also
be used to enhance cell survival, proliferation and/or
differentiation of cells which support the growth and/or
differentiation of other cells in cell culture.
[0392] The WSX receptor antibodies of the invention are also useful
as affinity purification agents. In this process, the antibodies
against WSX receptor are immobilized on a suitable support, such a
Sephadex resin or filter paper, using methods well known in the
art. The immobilized antibody then is contacted with a sample
containing the WSX receptor to be purified, and thereafter the
support is washed with a suitable solvent that will remove
substantially all the material in the sample except the WSX
receptor, which is bound to the immobilized antibody. Finally, the
support is washed with another suitable solvent, such as glycine
buffer, pH 5.0, that will release the WSX receptor from the
antibody.
[0393] WSX receptor antibodies may also be useful in diagnostic
assays for WSX receptor, e.g., detecting its expression in specific
cells, tissues, or serum. For diagnostic applications, antibodies
typically will be labeled with a detectable moiety. The detectable
moiety can be any one which is capable of producing, either
directly or indirectly, a detectable signal. For example, the
detectable moiety may be a radioisotope, such as .sup.3H, .sup.14C,
.sup.32P, .sub.35S, or .sup.125I; a fluorescent or chemiluminescent
compound, such as fluorescein isothiocyanate, rhodamine, or
luciferin; radioactive isotopic labels, such as, e.g., .sup.125I,
.sup.32p, .sup.14c, or .sup.3H; or an enzyme, such as alkaline
phosphatase, beta-galactosidase, or horseradish peroxidase.
[0394] Any method known in the art for separately conjugating the
polypeptide variant to the detectable moiety may be employed,
including those methods described by Hunter et al., Nature 144:945
(1962); David et al., Biochemistry 13:1014 (1974); Pain et al., J.
Immunol. Meth 40:219 (1981); and Nygren, J. Histochem. and
Cytochem. 30:407 (1982).
[0395] The antibodies of the present invention may be employed in
any known assay method, such as competitive binding assays, direct
and indirect sandwich assays, and immunoprecipitation assays. Zola,
Monoclonal Antibodies: A Manual of Techniques, pp.147-158 (CRC
Press, Inc., 1987).
[0396] Competitive binding assays rely on the ability of a labeled
standard to compete with the test sample analyte for binding with a
limited amount of antibody. The amount of WSX receptor in the test
sample is inversely proportional to the amount of standard that
becomes bound to the antibodies. To facilitate determining the
amount of standard that becomes bound, the antibodies generally are
insolubilized before or after the competition, so that the standard
and analyte that are bound to the antibodies may conveniently be
separated from the standard and analyte which remain unbound.
[0397] Sandwich assays involve the use of two antibodies, each
capable of binding to a different immunogenic portion, or epitope,
of the protein to be detected. In a sandwich assay, the test sample
analyte is bound by a first antibody which is immobilized on a
solid support, and thereafter a second antibody binds to the
analyte, thus forming an insoluble three-part complex. See, e.g.,
U.S. Pat. No. 4,376,110. The second antibody may itself be labeled
with a detectable moiety (direct sandwich assays) or may be
measured using an anti-immunoglobulin antibody that is labeled with
a detectable moiety (indirect sandwich assay). For example, one
type of sandwich assay is an ELISA assay, in which case the
detectable moiety is an enzyme.
[0398] I. Deposit of Materials
[0399] The following biological materials have been deposited with
the American Type Culture Collection, 12301 Parklawn Drive,
Rockville, Md., USA (ATCC):
1 Deposit Designation ATCC No. Deposit Date Baf3/WSX E63x7 sort
ATCC CRL 12015 Jan. 10, 1996 (Baf3 cells expressing human WSX
receptor variant 13.2) 2D7 hybridoma cell line 1G4 hybridoma cell
line ATCC HB-12243 Dec. 11, 1996 1E11 hybridoma cell line 1C11
hybridoma cell line
[0400] These deposits were made under the provisions of the
Budapest Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture for 30 years from the date of deposit. Each of
the deposited cultures will be made available by ATCC under the
terms of the Budapest Treaty, and subject to an agreement between
Genentech, Inc. and ATCC, which assures (a) that access to the
culture will be available during pendency of the patent application
to one determined by the Commissioner to be entitled thereto under
37 CFR .sctn.1.14 and 35 USC .sctn.122, and (b) that all
restrictions on the availability to the public of the culture so
deposited will be irrevocably removed upon the granting of the
patent.
[0401] The assignee of the present application has agreed that if
any of the cultures on deposit should die or be lost or destroyed
when cultivated under suitable conditions, it will be promptly
replaced on notification with a viable specimen of the same
culture. Availability of the deposited cell lines is not to be
construed as a license to practice the invention in contravention
of the rights granted under the authority of any government in
accordance with its patent laws.
[0402] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
any culture deposited, since the deposited embodiment is intended
as an illustration of one aspect of the invention and any culture
that is functionally equivalent is within the scope of this
invention. The deposit of material herein does not constitute an
admission that the written description herein contained is
inadequate to enable the practice of any aspect of the invention,
including the best mode thereof, nor is it to be construed as
limiting the scope of the claims to the specific illustration that
it represents. Indeed, various modifications of the invention in
addition to those shown and described herein will become apparent
to those skilled in the art from the foregoing description and fall
within the scope of the appended claims.
[0403] J. Experimental
[0404] Below are examples of specific embodiments for carrying out
the present invention. The examples are offered for illustrative
purposes only, and are not intended to limit the scope of the
present invention in any way.
[0405] The disclosures of all publications, patents and patent
applications cited herein, whether sipra or infra, are hereby
incorporated by reference in their entirety.
EXAMPLE 1
Cloning of Human WSX Receptor
[0406] An oligonucleotide probe designated WSX.6 #1 was synthesized
based upon the T73849 EST sequence. The WSX.6 #1 probe was a 51 mer
having the following sequence:
2 5'GTCAGTCTCCCAGTTCCAGACTTGTGTGCAGTCT (SEQ ID NO:45)
ATGCTGTTCAGGTGCGC-3'.
[0407] The radiolabeled WSX.6#1 probe was used to probe
1.2.times.10.sup.6 clones from a random and oligo dT primed kgt 10
fetal liver library (Clontech, Palo Alto, Calif.). Following
hybridization at 42.degree. C. overnight, the filters were washed
at 50.degree. C. in 0.5.times.SSC and 0.1% NaDodSO.sub.4 (SDS).
From the initial screen, 10 clones were selected and upon
subsequent screening 5 individual plaque pure clones were isolated.
Of these 5 individual clones, four clones designated 1, 5, 6 and 9
were subcloned into pBSSK.sup.- (Stratagene) following EcoRI
digestion. Sequence analysis revealed clone 5 and clone 9 contained
the putative initiation methionine and signal peptide. Clone 6
(designated 6.4) contained the most 3' end sequence and
subsequently was used for further screening.
[0408] To obtain the full length gene, clone 6.4 (fragment Nsi-Hind
III) was radiolabeled and used to screen 1.2.times.10.sup.6 clones
from a .lambda.gt 10 library constructed from a hepatoma Hep3B cell
line. This screen resulted in 24 positive clones. Following PCR
analysis of the clones using .lambda.gt10 primers (F and R), the
four longest clones 12.1, 13.2, 22.3, and 24.3 were isolated. These
clones were subcloned into pBSSK using the EcoRI site, and
following examination by restriction enzyme digest, clones 12.1 and
13.2 were submitted for sequencing. DNA sequencing was performed
with the Taq dye deoxynucleotide terminator cycle sequencing kit on
an automated Applied Biosystems DNA sequencer.
[0409] The assembled contiguous sequence from all the isolated
clones encoded a consensus amino terminus for the newly identified
polypeptide designated the WSX receptor. However, sequence analysis
revealed that at least three naturally occurring variants of the
WSX receptor exist which have different cytoplasmic regions. These
variants appear to be differentially spliced at the lysine residue
at position 891. Clone 6.4 stops 5 amino acids after Lys 891. Clone
12.1 is different from 13.2 and 6.4 following Lys 891 and encodes a
putative box 2 region which is distinct from that encoded by clone
13.2. Clone 13.2 contains a potential box 1 region and following
Lys 891 encodes putative box 2 and box 3 motifs. See, Baumann et
al., Mol. Cell. Biol. 14(1):138-146 (1994).
[0410] The full length WSX gene based on the clone 13.2 cytoplasmic
region putatively encodes an 1165 amino acid transmembrane protein.
The 841 amino acid extracellular domain (ECD) contains two WSXWS
domains. The ECD is followed by a 24 amino acid transmembrane
domain and a 300 amino acid cytoplasmic region.
EXAMPLE 2
WSX Receptor Immunoadhesin
[0411] Using polymerase chain amplification, a WSX receptor
immunoadhesin was created by engineering an in-frame fusion of the
WSX receptor gene extracellular domain (WSX.ECD) with human
CH2CH3(Fc)IgG (Bennett et al., J. Biol. Chem. 266(34):23060-23067
(1991)) at the C terminus of the ECD and cloned into pBSSK
(Stratagene). For expression, the WSX-Fc was excised with ClaI and
BstEII and ligated into the pRK5.HuIF.grbhlgG Genenase I vector
(Beck et al., Molecular Immunology 31(17): 1335-1344 (1994)), to
create the plasmid pRK5.WSX-IgG Genenase I. This plasmid was
transiently transfected into 293 cells using standard calcium
phosphate transfection techniques. The transfected cells were
cultured at 37.degree. C. in 5% CO.sub.2 in DMEM F12 50:50
supplemented with 10% FBS, 100 mM HEPES (pH 7.2) and 1 mM
glutamine. The WSX receptor immunoadhesin was purified using a
ProSepA.TM. protein A column.
EXAMPLE 3
Antibody Production
[0412] In order to raise antibodies against the WSX receptor, the
WSX receptor immunoadhesin of Example 2 was used to inoculate
rabbits to raise polyclonal antibodies and mice to raise monoclonal
antibodies using conventional technology.
EXAMPLE 4
Generation of a Cell Line Expressing WSX Receptor
[0413] The nucleic acid encoding full length WSX receptor variant
13.2 was inserted in the pRKtkNeo plasmid (Holmes et al., Science
253:1278-1280 (1991)). 100 .mu.gs of the pRKtkNeo.WSX plasmid thus
generated was linearized, ethanol precipitated and resuspended in
100 .mu.L of RPMI 1640. 7.times.10.sup.6 Baf3 cells
(5.times.10.sup.5/ml) were suspended in 900 .mu.L of RPMI and added
to the linearized plasmid. Following electroporation at 325V, 1180
.mu.F using a BRL electroporation apparatus, the cells were plated
into 15 mls of RPMI 1640 containing 5% WEHI3B conditioned media and
15% serum. 48 hours later cells were selected in 2 mg/ml G418.
[0414] To obtain the Baf3/WSX cell line expressing WSX receptor
variant 13.2, the G418 selected clones were analyzed by FACS using
the rabbit polyclonal antisera raised against the WSX-Fc chimeric
protein as described above. The highest expressing clone
(designated E6) was sorted by FACS to maintain a population with a
high level of WSX receptor expression.
EXAMPLE 5
Role of WSX Receptor in Cellular Proliferation
[0415] The proliferative potentials of WSX receptor variants 13.2
and 12.1 were tested by constructing human growth hormone
receptor-WSX receptor (GH-WSX) fusions encoding chimeric proteins
consisting of the GH receptor extracellular and transmembrane
domains and the WSX receptor variant 13.2 or 12.1 intracellular
domains. These chimeric gene fusions were transfected into the IL-3
dependent cell line Baf3. The ability of the GH-WSX transfected
Baf3 cells to respond to exogenous growth hormone (GH) was tested
in a thymidine incorporation assay. As can be seen in FIGS. 6 and
8, the GH-WSX receptor variant 13.2 chimera was capable of
increasing thymidine uptake in the transfected Baf3 cells, thus
indicating the proliferative potential of the WSX receptor variant
13.2. However, WSX receptor variant 12.1 was unable to transmit a
proliferative signal in this experiment (FIG. 8).
Materials and Methods
[0416] Recombinant PCR was used to generate the chimeric receptors
containing the extracellular and transmembrane domains of the hGH
receptor and the cytoplasmic domain of either WSX receptor variant
12.1 or variant 13.2. In short, the cytoplasmic domain of either
variant 12.1 or 13.2 beginning with Arg at amino acid 866 and
extending down to amino acid 958 or amino acid 1165 respectively,
was fused in frame, by sequential PCR, to the hGH receptor
extracellular and transmembrane domain beginning with Met at amino
acid 18 and extending down to Arg at amino acid 274. The GH-WSX
chimera was constructed by first using PCR to generate the
extracellular and transmembrane domain of the human GH receptor.
The 3' end primer used for this PCR contained 20 nucleotides at the
5' end of the primer corresponding to the first 20 nucleotides of
the WSX cytoplasmic domain. The 3' end of the chimera was generated
using PCR where the 5' end primer contained the last 19 nucleotides
of the human GH receptor transmembrane domain. To generate the full
length chimera, the 5' end of the human GH receptor product was
combined with the 3' end WSX receptor cytoplasmic PCR product and
subsequently amplified to create a fusion of the two products.
[0417] This chimeric fusion was digested with ClaI and XbaI and
ligated to pRKtkNeo (Holmes et al., Science 253:1278-1280 (1991))
to create the chimeric expression vector. The IL-3 dependent cell
line Baf3 was then electroporated with this hGH/WSX chimeric
expression vector.
[0418] Briefly, 100 .mu.g of the pRKtkNeo/GH.WSX plasmid was
linearized, ethanol precipitated and resuspended in 100 .mu.L of
RPMI 1640. 7.times.10.sup.6 Baf3 cells (5.times.10.sup.5/ml) were
suspended in 900 .mu.L of RPMI and added to the linearized plasmid.
Following electroporation at 325V, 1180 .mu.F using a BRL
electroporation apparatus, the cells were plated into 15 mls of
RPMI 1640 containing 5% wehi conditioned media and 15% serum. 48
hours later, cells were selected in 2 mg/ml G418.
[0419] To obtain the Baf3/GH.WSX cell lines, the G418 selected
cells were FACS sorted using an anti-human GH mAb (3B7) at 1
.mu.g/ml. The top 10% expressing cells were selected and
expanded.
EXAMPLE 6
Expression Analysis of the WSX Receptor
[0420] The expression profile of the WSX receptor was initially
examined by Northern analysis. Northern blots of human fetal or
adult tissue mRNA were obtained from Clontech (Palo Alto, Calif.).
A transcript of approximately 6 kb was detected in human fetal
lung, liver and kidney. In the adult, low level expression was
detected in a variety of tissues including liver, placenta, lung
skeletal muscle, kidney, ovary, prostate and small intestine.
[0421] PCR analysis of human cord blood identified transcripts in
CD34+ subfraction. By PCR analysis, all three variants of the WSX
receptor were present in CD34+cells. The CD34.sup.- subfraction
appeared negative by this same PCR analysis.
[0422] By PCR analysis, both the 6.4 variant and 13.2 variant were
evident in the AA4.sup.+Sca.sup.+Kit.sup.+ (flASK) cell population
isolated from the mid-gestation fetal liver as described in Zeigler
et al., Blood 84:2422-2430 (1994). No clones containing the 12.1
variant cytoplasmic tail have been isolated from murine
tissues.
[0423] Human B cells isolated from peripheral blood using
anti-CD19/20 antibodies were also positive for short form (6.4
variant) and long from (13.2 variant) receptor mRNA expression.
[0424] The WSX receptor appears to be expressed on both progenitor
and more mature hematopoietic cells.
EXAMPLE 7
Cloning of Murine WSX Receptor
[0425] The human WSX receptor was used as a probe to isolate murine
WSX receptor. The pRKtkNeo.WSX plasmid of Example 4 was digested
using Sspl. This Sspl fragment (1624 bps) was isolated, and
radiolabelled, and used to screen a murine liver .lambda.gt10
library (Clontech). This resulted in 4 positive clones which were
isolated and sequenced after sub-cloning into pBSSK.sup.- via EcoRI
digestion. The resultant clones, designated 1, 2, 3, 4 showed
homology to the extracellular domain of the human WSX receptor; the
contiguous sequences resulting from these clones extended from the
initiation methionine to tryptophan at position 783. The overall
similarity of human WSX receptor and murine WSX receptor is 73%
over this region of the respective extracellular domains (see FIGS.
4A-B).
EXAMPLE 8
The Role of WSX Receptor in Hematopoietic Cell Proliferation
[0426] The presence of the WSX receptor in the enriched human stem
cell population CD34.sup.+ from cord blood is indicative of a
potential role for this receptor in stem cell/progenitor cell
proliferation. The proliferation of CD34.sup.+ human blood cells in
methylcellulose media (Stem Cell Technologies) was determined in
the presence or absence of WSX receptor antisense oligonucleotides.
These experiments were also repeated in the murine hematopoietic
system using AA4.sup.+ Sca.sup.+Kit.sup.+ stem cells from the
murine fetal liver. In both instances, the antisense
oligonucleotides statistically significantly inhibited colony
formation from the hematopoietic progenitor cells. See Table 1
below. The anti-proliferative effects were most pronounced using
the -20 antisense and the +85 antisense oligonucleotide constructs.
This inhibition was not lineage specific to any particular myeloid
lineage that resulted from the progenitor expansion. The principal
effect of the antisense oligonucleotides was a reduction of overall
colony numbers. The size of the individual colonies was also
reduced.
[0427] Antisense oligonucleotide experiments using both human and
murine stem cells demonstrated an inhibition of myeloid colony
formation. Although, the reduction in myelopoiesis observed in
these assays could be prevented by the additional inclusion of
G-CSF and GM-CSF in the culture medium. These data serve to
illustrate the redundancy of cytokine action in the myelopoietic
compartment.
3TABLE 1 EXPERIMENT OLIGO AVG. COLONY # % INHIBITION Human Cord
(-20)AS 32 Blood (KL) (-20)S 100 70 (-20)SCR 114 (+85)AS 80 (+85)S
123 38 (+85)SCR 138 Control 158 Human Cord (-20)AS 78 Blood (-20)S
188 54 (IL-3, IL-6, KL) (-20)SCR 151 (+85)AS 167 (+85)S 195 18
(+85)SCR 213 Control 266 Human Cord (-20)AS 42 Blood (-20)S 146 69
(KL) (-20)SCR 121 (+85)AS 123 (+85)S 162 23 (+85)SCR 156 Control
145 Murine Fetal (+84)AS 33 Liver(KL) (+84)S 86 54 (+84)SCR 57
(-20)AS 27 (-20)S 126 71 (-20)SCR 60 (-99)AS 109 (-99)S 93 0
(-99)SCR 109 Control 121 Murine Fetal (-213)AS 51 Liver (KL)
(-213)S 60 10 (-213)SCR 53 (+211)AS 58 (+211)S 54 3 (+211)SCR 66
Control 59
Materials and Methods
[0428] Human stem cells: Human umbilical cord blood was collected
in PBS/Heparin (1000 .mu./ml). The mononuclear fraction was
separated using a dextran gradient and any remaining red blood
cells lysed in 20 mM NH4 Cl. CD34.sup.+ cells were isolated using
CD34.sup.+ immunomagnetic beads (Miltenyi, Calif.). These isolated
CD34.sup.+ cells were found to be 90-97% CD34.sup.+ by FACS
analysis.
[0429] Murine stem cells: Midgestation fetal liver were harvested
and positively selected for the AA4.sup.- antigen by immune
panning. The AA4.sup.- positive fraction was then further enriched
for stem cell content by FACS isolation of the
AA4.sup.+Sca.sup.+Kit.sup.+ fraction.
[0430] Antisense experiments. Oligodeoxynucleotides were
synthesized against regions of the human or murine WSX receptors.
For each oligonucleotide chosen, antisense (AS), sense (S) and
scrambled (SCR) versions were synthesized (see FIG. 7). + or -
indicates position relative the initiation methionine of the WSX
receptor. CD34.sup.+ or AA4.sup.+Sca.sup.+Kit.sup.+ cells were
incubated at a concentration of 10.sup.3/ml in 50:50 DMEM/F 12
media supplemented with 10% FBS, L-glutamine, and GIBCO.TM. lipid
concentrate containing either sense, antisense or scrambled
oligonucleotides at a concentration of 70 .mu.g/ml. After 16 hours,
a second aliquot of the respective oligonucleotide was added (35
.mu.g/ml) and the cells incubated for a further 6 hours.
[0431] Colony assays: 5000 cells from each of the above conditions
were aliquoted into 5 ml of methylcellulose (Stem Cell
Technologies) containing kit ligand (KL) (25 ng/ml), interleukin-3
(IL-3) (25 ng/ml) and interleukin-6 (IL-6) (50 ng/ml). The
methylcellulose cultures were then incubated at 37.degree. C. for
14 days and the resultant colonies counted and phenotyped. All
assays were performed in triplicate.
EXAMPLE 9
WSX Receptor Variant 13.2 is a Receptor for OB Protein
[0432] The WSX receptor variant 13.2 has essentially the same amino
acid sequence as the recently cloned leptin (OB) receptor. See
Tartaglia et al., Cell 83:1263-1271 (1995). OB protein was able to
stimulate thymidine incorporation in Baf3 cells transfected with
WSX receptor variant 13.2 as described in Example 4 (See FIG.
9).
[0433] OB protein expression in hematopoietic cells was studied.
Oligonucleotide primers designed specifically against the OB
protein illustrated the presence of this ligand in fetal liver and
fetal brain as well as in two fetal liver stromal cell lines,
designated 10-6 and 7-4. Both of these immortalized stromal cell
lines have been demonstrated to support both myeloid and lymphoid
proliferation of stem cell populations (Zeigler et al., Blood
84:2422-2430 (1994)).
EXAMPLE 10
Role of OB Protein in Hematopoiesis
[0434] To examine the hematopoietic activity of OB protein, a
variety of in vitro assays were performed.
[0435] Murine fetal liver flASK stem cells were isolated from the
midgestational fetal liver as described in Zeigler et al., Blood
84:2422-2430 (1994) and studied in stem cell suspension culture or
methylcellulose assays. For the stem cell suspension cultures,
twenty thousand of the FLASK cells were seeded in individual wells
in a 12 well format in DMEM 4.5/F12 media supplemented with 10%
heat inactivated fetal calf serum (Hyclone, Logan, Utah) and
L-glutamine. Growth factors were added at the following
concentrations: kit ligand (KL) at 25 ng/mL, interleukin-3 (IL-3)
at 25 ng/mL, interleukin-6 (IL-6) at 50 ng/mL, G-CSF at 100 ng/mL,
GM-CSF at 100 ng/mL, EPO at 2U/mL, interleukin-7 (IL-7) at 100
ng/mL (all growth factors from R and D Systems, Minneapolis,
Minn.). OB protein was added at 100 ng/mL unless indicated
otherwise. Recombinant OB protein was produced as described in
Levin et al., Proc. Natl. Acad. Sci. (USA) 93:1726-1730 (1996).
[0436] In keeping with its ability to transduce a proliferative
signal in Baf3 cells (see previous Example), OB protein
dramatically stimulated the expansion of flASK cells grown in
suspension culture in the presence of kit ligand (FIG. 10A). The
addition of OB protein alone to these suspension cultures was
unable to effect survival of the hematopoietic stem cells (HSCs).
When a variety of hematopoietic growth factors in suspension
culture assays were tested, the main synergy of OB protein appeared
to be with KL, GM-CSF and IL-3 (Table 2). No preferential expansion
of any particular lineage was observed from cytospin analysis of
the resultant cultures.
4TABLE 2 Factor KL KL + OB protein OB protein N/A 128 +/- 9 192 +/-
13 G-CSF 131 +/- 3 177 +/- 8 30 +/- 5 GM-CSF 148 +/- 4 165 +/- 6
134 +/- 10 IL-3 189 +/- 7 187 +/- 4 144 +/- IL-6 112 +/- 4 198 +/-
5 32 +/- 3 EPO 121 +/- 3 177 +/- 8 30 +/- 6 IL-3 & IL-6 112 +/-
12 198 +/- 7 32 +/- 7 flASK stem cells were isolated. Twenty
thousand cells were plated in suspension culture with the relevant
growth factor combination. Cells were harvested and counted after 7
days. Cell numbers are presented .times.10.sup.3. Assays were
performed in triplicate and repeated in two independent
experiments.
[0437] Methylcellulose assays were performed as previously
described (Zeiger et al., supra). Briefly, methylcellulose colony
assays were performed using "complete" methylcellulose or pre-B
methylcellulose medium (Stem Cell Technologies, Vancouver, British
Columbia, Canada) with the addition of 25 ng/mL KL (R and D
Systems, Minneapolis, Minn.). Cytospin analyses of the resultant
colonies were performed as previously described in Zeigler et
al.
[0438] When these methylcellulose assays were employed, OB protein
augmented myeloid colony formation and dramatically increased
lymphoid and erythroid colony formation (FIGS. 10B and 10C) which
demonstrates that OB protein can act on very early cells of the
hematopoietic lineage. Importantly, the hematopoietic activity of
OB protein was not confined to fetal liver stem cells, the murine
bone marrow stem cell population; LinloSca+also proliferated in
response to OB protein (KL: 5 fold expansion, KL and OB protein: 10
fold expansion).
[0439] Further hematopoietic analysis of the role of the WSX
receptor was carried out by examining hematopoietic defects in the
db/db mouse.
[0440] These defects were assessed by measuring the proliferative
potential of db/db homozygous mutant marrow. Under conditions
favoring either myeloid (Humphries et al., Proc. Natl. Acad. Sci.
(USA) 78:3629-3633 (1981)) or lymphoid (McNiece et al., J Immitnol.
146:3785-90 (1991)) expansion, the colony forming potential of the
db/db marrow was significantly reduced when compared to the
wild-type control marrow (FIG. 11). This was particularly evident
when the comparison was made under pre-B methylcellulose conditions
where KL and IL-7 are used to drive lymphopoiesis (McNiece et al.,
supra). Corresponding analysis of the complementary mouse mutation
ob/ob, which is deficient in the production of OB protein (Zhang et
al., Nature 372:425-431 (1994)), also indicated that the
lymphoproliferative capacity is compromised in the absence of a
functional OB protein signalling pathway (FIG. 11). However, this
reduction was less than the reduction observed using db/db
marrow.
[0441] Analysis of the cellular profile of the db/db and wild-type
marrow revealed significant differences between the two. Overall
cellularity of the db/db marrow was unchanged. However, when
various B cell populations in the db/db marrow were examined, both
decreased levels of B220.sup.+ and B220.sup.+/CD43.sup.+ cells were
found. B220+cells represent all B cell lineages while CD43 is
considered to be expressed preferentially on the earliest cells of
the B cell hierarchy (Hardy et al., J. Exp. Med. 173:1213-25
(1991)). No differences were observed between the CD4/CD8 staining
profiles of the two groups. The TER119 (a red cell lineage marker)
population was increased in the db/db marrow (FIG. 12A).
[0442] Comparison of the spleens from the two groups revealed a
significant decrease in both tissue weight and cellularity of the
db/db mice compared to the homozygote misty gray controls
(0.063.+-.0.009 g vs. 0.037.+-.0.006 g and
1.10.times.10.sup.7.+-.1.times.10.sup.4 vs.
4.3.times.10.sup.6.+-.10.sup.3 cells>p0.05). This decreased
cellularity in the db spleen was reflected in a marked reduction in
TER119 staining (FIG. 12B). This result appears to confirm the
synergy demonstrated between OB protein and EPO and points to a
role for OB protein in the regulation of erythropoiesis.
[0443] Examination of the hematopoietic compartment of the db/db
mouse in vivo demonstrated a significant reduction in peripheral
blood lymphocytes when compared to heterozygote or wild-type
controls. Db/db mice fail to regulate blood glucose levels and
become diabetic at approximately 6-8 weeks of age; therefore,
peripheral blood counts as the animals matured were followed.
[0444] For procurement of blood samples, prior to the experiment
and at time points throughout the study, 40 .mu.L of blood was
taken from the orbital sinus and immediately diluted into 10 mL of
diluent to prevent clotting. The complete blood count from each
blood sample was measured on a Serrono Baker system 9018 blood
analyzer within 60 min. of collection. Only half the animals in
each dose group were bled on any given day, thus, each animal was
bled on alternate time points. Blood glucose levels were measured
in orbital sinus blood samples using One Touch glucose meters and
test strips (Johnson and Johnson). The results of this experiment
are shown in FIGS. 13A-C.
[0445] This analysis demonstrated that peripheral blood lymphocytes
are significantly reduced at all time points compared to control
animals and that the peripheral lymphocyte population of the db/db
mouse does not change significantly with age. FACS analysis
revealed that the decreased lymphocyte population represented a
decrease in both B220.sup.+ cells and CD4/CD8 cells. Both
erythrocyte and platelets are at wild-type levels throughout all
time periods examined. The peripheral blood lymphocyte levels in
ob/ob homozygous mutant mice were unchanged from wild-type
controls.
[0446] Hematopoietic analysis of the db/db mouse can be complicated
by the onset of diabetes. Therefore, the impact of high glucose
levels on lymphopoiesis was examined by comparing the peripheral
blood profiles and blood glucose levels in two other diabetic
models, the glucokinase knockout heterozygote mouse (Grupe et al.,
Cell 83:69-78 (1995)) and the IFN-.alpha. transgenic mouse (Stewart
et al., Science 260:1942-6 (1993)). Comparison of peripheral
lymphocytes and blood glucose in db/db mice, their appropriate
controls and the high glucose models illustrated no relationship
between blood-glucose and lymphocyte counts (FIG. 14). These
results suggest therefore that the lymphoid defects observed in the
db/db mouse are directly attributed to the hematopoietic function
of the OB protein signalling pathway.
[0447] To test the capacity of the db/db hematopoietic compartment
to respond to challenge, the db/db mice and controls were subjected
to sub-lethal irradiation C57BLKS/J db/db, C57BLKS/Jm+/db, and
C57BLKS/J+m/+m mice were subjected to sub-lethal whole body
irradiation (750 cGy, 190 cGy/min) as a single dose from a
.sup.137Cs source. Ten animals were used per experimental group.
The kinetics of hematopoietic recovery were then followed by
monitoring the peripheral blood during the recovery phase. This
experiment illustrated the inability of the db/db hematopoietic
system to fully recover the lymphopoietic compartment of the
peripheral blood 35 days post-irradiation. Platelet levels in these
mice followed the same recovery kinetics as controls, however the
reduction in erythrocytes lagged behind controls by 7-10 days. This
finding may reflect the increased TER 119 population found in the
marrow of the db/db mice (FIG. 12A).
Materials and Methods
[0448] Bone marrow, spleens and peripheral blood was harvested from
the diabetic mouse strains: C57BLKS/J db/db (mutant), C57BLKS/J
m+/db (lean heterozygote control littermate), C57BLKS/J+m/+m (lean
homozygote misty gray coat control littermate) and the obese mouse
strains: C57BL/6J-ob/ob (mutant) and the C57BL/6J-ob/+(lean
littermate control). All strains from the Jackson Laboratory, Bar
Harbor, Me. A minimum of five animals were used per experimental
group. Femurs were flushed with Hank's balanced salt solution
(HBSS) plus 2% FCS and a single cell suspension was made of the
bone marrow cells. Spleens were harvested and the splenic capsule
was ruptured and filtered through a nylon mesh. Peripheral blood
was collected through the retro-orbital sinus in phosphate buffered
saline (PBS) with 10U/mL heparin and 1 mmol EDTA and processed as
previously described. The bone marrow, splenocytes and peripheral
blood were then stained with the monoclonal antibodies against the
following antigens: B220/CD45R (Pan B cell) FITC antimouse,
TER-119/erythroid cell R-PE antimouse, CD4 (L3T4), FITC antimouse,
CD8 (Ly 3.2), FITC antimouse, and sigM (Igh-6b), FITC antimouse
(All monoclonals from Pharmigen, San Diego, Calif.). The
appropriate isotype controls were included in each experiment. For
methylcellulose assays, the bone marrow from five animals per group
was pooled and 100,000 cell aliquots from each group used for each
assay point.
EXAMPLE 11
Expression of OB-Immunoadhesin
[0449] Using protein engineering techniques, the human OB protein
was expressed as a fusion with the hinge, CH2 and CH3 domains of
IgG1. DNA constructs encoding the chimera of the human OB protein
and IgG1 Fc domains were made with the Fc region clones of human
IgG1. Human OB cDNA was obtained by PCR from human fat cell dscDNA
(Clontech Buick-Clone cDNA product). The source of the IgG1 cDNA
was the plasmid pBSSK-CH2CH3. The chimera contained the coding
sequence of the full length OB protein (amino acids 1-167 in FIG.
16) and human IgG1 sequences beginning at aspartic acid 216 (taking
amino acid 114 as the first residue of the heavy chain constant
region (Kabat et al., Sequences of Proteins of Immunological
Interest 4th ed. (1987)), which is the first residue of the IgG1
hinge after the cysteine residue involved in heavy-light chain
bonding, and ending with residues 441 to include the CH2 and CH3 Fc
domains of IgG1. There was an insert of codons for three amino
acids (GlyValThr) between the OB protein and IgG1 coding sequences.
If necessary, this short linker sequence can easily be deleted, for
example by site directed deletion mutagenesis, to create an exact
junction between the coding sequences of the OB protein and the
IgG1 hinge region. The coding sequence of the OB-IgG1 immunoadhesin
was subcloned into the pRK5-based vector pRK5tk-neo which contains
a neomycine selectable marker, for transient expression in 293
cells using the calcium phosphate technique (Suva et al., Science
237:893-896 (1987)). 293 cells were cultured in HAM's: Low Glucose
DMEM medium (50:50), containing 10% FBS and 2 mM L-Gln. For
purification of OB-IgG1 chimeras, cells were changed to serum free
production medium PS24 the day after transfection and media
collected after three days. The culture media was filtered.
[0450] The filtered 293 cell supernatant (400 ml) containing
recombinant human OB-IgG1 was made 1 mM in phenylmethylsulfonyl
fluoride and 2 .mu.g/ml in aprotinin. This material was loaded at
4.degree. C. onto a 1.times.4.5 cm Protein A agarose column (Pierce
catalog # 20365) equilibrated in 100 mM HEPES pH 8. The flow rate
was 75 ml/h. Once the sample was loaded, the column was washed with
equilibration buffer until the A.sub.280 reached baseline. The
OB-IgG1 protein was eluted with 3.5 M MgCl.sub.2+2% glycerol
(unbuffered) at a flow rate of 15 ml/h. The eluate was collected
with occasional mixing into 10 ml of 100 mM HEPES pH 8 to reduce
the MgCl.sub.2 concentration by approximately one-half and to raise
the pH. The eluted protein was then dialyzed into phosphate
buffered saline, concentrated, sterile filtered and stored either
at 4.degree. C. or frozen at -70.degree. C. The OB-IgG1
immunoadhesin prepared by this method is estimated by SDS-PAGE to
be greater than 90% pure.
EXAMPLE 12
Preparation of PEG-OB
[0451] The PEG derivatives of the human OB protein were prepared by
reaction of hOB protein purified by reverse phase chromatography
with a succinimidyl derivative of PEG propionic acid (SPA-PEG)
having a nominal molecular weight of 10 kD, which had been obtained
from Shearwater Polymers, Inc. (Huntsville, Ala.). After
purification of the hOB protein by reverse phase chromatography, an
approximately 1-2 mg/ml solution of the protein in 0.1%
trifluoroacetic acid and approximately 40% acetonitrile, was
diluted with 1/3 to 1/2 volume of 0.2 M borate buffer and the pH
adjusted to 8.5 with NaOH. SPA-PEG was added to the reaction
mixture to make 1:1 and 1:2 molar ratios of protein to SPA-PEG and
the mixture was allowed to incubate at room temperature for one
hour. After reaction and purification by gel electrophoresis or ion
exchange chromatography, the samples were extensively dialyzed
against phosphate-buffered saline and sterilized by filtration
through a 0.22 micron filter. Samples were stored at 4.degree. C.
Under these conditions, the PEG-hOB resulting from the 1:1 molar
ratio protein to SPA-PEG reaction consisted primarily of molecules
with one 10 kD PEG attached with minor amounts of the 2
PEG-containing species. The PEG-hOB from the 1:2 molar reaction
consisted of approximately equal amounts of 2 and 3 PEGs attached
to hOB, as determined by SDS gel electrophoresis. In both
reactions, small amounts of unreacted protein were also detected.
This unreacted protein can be efficiently removed by the gel
filtration or ion exchange steps as needed. The PEG derivatives of
the human OB protein can also be prepared essentially following the
aldehyde chemistry described in EP 372,752 published Jun. 13,
1990.
EXAMPLE 13
Murine Agonist Antibodies
[0452] Mice were immunized five times with 20%1 g of the WSX
receptor immunoadhesin (see Example 2 above) resuspended in MPL-TDM
(monophosphoryl lipid A/trehalose dicorynomycolate; Rabi,
Immunochemical Research Inc.) into each foot pad. Three days after
the last immunization, popliteal lymphoid cells were fused with
mouse myeloma cells, X63-Ag8.8.653 cells, using 50% polyethylene
glycol as described (Laskov et al. Cell. Immunol. 55:251
(1980)).
[0453] The initial screening of hybridoma culture supernatants was
done using a capture ELISA. For the capture ELISA, microtiter
plates (Maxisorb; Nunc, Kamstrup, Denmark) were coated with 50
.mu.l/well of 2 .mu.g/ml of goat antibodies specific to the Fc
portion of human IgG (Goat anti-hlgG-Fc; Cappel), in PBS, overnight
at 4.degree. C. and blocked with 2.times.BSA for 1 hr at room
temperature. Then, 50 .mu.l/well of 2 .mu.g/ml of WSX receptor
immunoadhesin was added to each well for 1 hr. The remaining
anti-Fc binding sites were blocked with PBS containing 3% human
serum and 10 .mu.g/ml of CD4-IgG for 1 hr. Plates were incubated
with 50 .mu.l/well of 2 .mu.g/ml of anti-WSX receptor monoclonal
antibody (or hybridoma culture supernatant) for 1 hr. Plates were
then incubated with 50 .mu.l/well of HRP-goat anti-mouse IgG. The
bound enzyme was detected by the addition of the substrate (OPD)
and the plates were read at 490 nM with an ELISA plate reader.
Between each step, plates were washed in wash buffer (PBS
containing 0.05% TWEEN 20.TM.).
[0454] Agonist antibodies were screened for using the KIRA ELISA
described in WO95/14930. A chimeric receptor comprising the
extracellular domain of the WSX receptor and the transmembrane and
intracellular domain of Rse receptor (Mark et al., Journal of
Biological Chemistry 269(14): 10720-10728 (1994)) with a
carboxyl-terminal herpes simplex virus glycoprotein D (gD) tag was
produced and dp12.CHO cells were transformed therewith as described
in Example 4 of WO95/14930.
[0455] The WSX/Rse.gD transformed dpl2.CHO cells were seeded
(3.times.10.sup.4 per well) in the wells of a flat-bottom-96 well
culture plate in 100 .mu.l media and cultured overnight at
37.degree. C. in 5% CO.sub.2. The following morning the well
supernatants were removed and various concentrations of purified
mAb were then added to separate wells. The cells were stimulated at
37.degree. C. for 30 min. and the well supernatants were decanted.
To lyse the cells and solubilize the chimeric receptors, 100 .mu.l
of lysis buffer was added to each well. The plate was then agitated
gently on a plate shaker (Bellco Instruments, Vineland, N.J.) for
60 min. at room temperature.
[0456] While the cells were being solubilized, an ELISA microtiter
plate (Nunc Maxisorp, Inter Med, Denmark) coated overnight at
4.degree. C. with the 5B6 monoclonal anti-gD antibody (5.0 .mu.g/ml
in 50 mM carbonate buffer, pH 9.6, 100 .mu.l/well) was decanted and
blocked with 150 .mu.l/well of Block Buffer containing 2% BSA for
60 min. at room temperature. After 60 minutes, the anti-gD 5B6
coated plate was washed 6 times with wash buffer (PBS containing
0.05% TWEEN 20.TM. and 0.01% thimerosal).
[0457] The lysate containing solubilized WSX/Rse.gD from the
cell-culture microtiter well was transferred (8511/well) to anti-gD
5B6 coated and blocked ELISA well and was incubated for 2 h at room
temperature. The unbound WSX/Rse.gD was removed by washing with
wash buffer and 100 .mu.l of biotinylated 4G10
(anti-phosphotyrosine) diluted 1:18000 in dilution buffer (PBS
containing 0.5% BSA, 0.05% Tween-20,5 mM EDTA, and 0.01%
thimerosal), i.e. 56 ng/ml was added to each well. After incubation
for 2 h at room temperature the plate was washed and
HRPO-conjugated streptavidin (Zymed Laboratories, S. San Francisco,
Calif.) was added to each well. The plate was incubated for 30
minutes at room temperature with gentle agitation. The free
avidin-conjugate was washed away and 100 .mu.l freshly prepared
substrate solution (tetramethyl benzidine (TMB); 2-component
substrate kit; Kirkegaard and Perry, Gaithersburg, Md.) was added
to each well. The reaction was allowed to proceed for 10 minutes,
after which the color development was stopped by the addition of
100 .mu.l/well 1.0 M H.sub.3PO.sub.4. The absorbance at 450 nm was
read with a reference wavelength of 650 nm (ABS.sub.450/650), using
a vmax plate reader (Molecular Devices, Palo Alto, Calif.)
controlled with a Macintosh Centris 650 (Apple Computers,
Cupertino, Calif.) and DeltaSoft software (BioMetallics, Inc,
Princeton, N.J.).
[0458] Four of the 25 anti-WSX receptor monoclonal antibodies
activated the chimeric WSX/Rse receptor in the KIRA ELISA. The
antibodies were designated: 2D7, 1G4, 1E11 and 1C11.
[0459] To determine whether the four agonist anti-WSX receptor mAbs
recognized the same or different epitopes, a competitive binding
ELISA was performed as described in Kim et al. J. Immunol. Method
156:9-17 (1992) using biotinylated mAbs (Bio-mAb). Bio-mAb were
prepared using N-hydroxyl succinimide as described in Antibodies, A
Laboratory Manual Cold Spring Harbor Laboratory, Eds. Harlow E. and
D. Lane, p. 341 (1988). Microtiter wells were coated with 501 of
Goat anti-hIgG-Fc and kept overnight at 4.degree. C., blocked with
2% BSA for 1 hr, and incubated with 25 .mu.l/well of human WSX
receptor immunoadhesin (1 .mu.g/ml) for 1 hr at room temperature.
After washing, a mixture of a predetermined optimal concentration
of Bio-mAb bound and a thousand-fold excess of unlabeled mAb was
added into each well. Following 1 hr incubation at room
temperature, plates were washed and the amount of Bio-mAb was
detected by the addition of HRP-streptavidin. After washing the
plates, the bound enzyme was detected by the addition of the
substrate o-phenylenediamine dihydrochloride (OPD), and the plates
were read at 490 nm with an ELISA plate reader.
[0460] The ability of the mAbs to recognize murine WSX receptor was
determined in a capture ELISA. Murine WSX receptor (FIG. 21) fused
to a gD tag (see above) was captured by an anti-gD (5B6) coated
ELISA plate. After washing, various concentrations of biotinylated
mAbs were added into each well. Biotinylated mAbs bound to murine
WSX receptor-gD were detected using HRP-streptavidin as described
above.
[0461] To determine whether the antibodies bound membrane-bound
receptor, FACS analysis was performed using 293 cells transfected
with WSX receptor. 105 WSX receptor-transfected 293 cells were
resuspended in 100 .mu.l of PBS plus 1% fetal calf serum (FSC) and
incubated with 2D7 or 1G4 hybridoma cell supernatant for 30 min on
ice. After washing, cells were incubated with 100 .mu.l of
FITC-goat anti-mouse IgG for 30 min at 4.degree. C. Cells were
washed twice and resuspended in 150 .mu.l of PBS plus 1% FCS and
analyzed by FACscan (Becton Dickinson, Mountain View, Calif.). The
antibodies 2D7 and 1G4 bound to membrane WSX receptor according to
the FACS analysis.
[0462] The properties of agonist antibodies 2D7 and 1G4 are
summarized in the following table.
5TABLE 3 mAb Isotype epitope.sup.a hWSXR.sup.b mWSXR.sup.b
Agonist.sup.c 2D7 IgG1 A +++ ++ + 1G4 IgG1 B +++ + + .sup.aThese
mAbs are shown to recognize different epitopes by competitive
binding ELISA. .sup.bThese results are determined by ELISA (hWSXR
is human WSX receptor and mWSXR is murine WSX receptor). .sup.c The
agonistic activities were determined by KIRA ELISA.
EXAMPLE 14
Human Agonist Antibodies
[0463] Single-chain Fv (scFv) fragments binding to the human WSX
receptor (hWSXR) were isolated from a large human scFv library
(Vaughan et al. Nature Biotechnology 14:309-314 (1996)) using
antigen coated on immunotubes or biotinylated antigen in
conjunction with streptavidin-coated magnetic beads (Griffiths et
al. EMBO J. 13:3245-3260 (1994); and Vaughan et al. (1996)).
Briefly, immunotubes coated overnight with 101g/ml human WSX
receptor immunoadhesin (see Example 2 above) in phosphate buffered
saline (PBS) were used for three rounds of panning. The humanized
antibody, huMAb4D5-8 (Carter et al. Proc. Natl. Acad. Sci. USA
89:4285-4289 (1992)) was used to counter-select for antibodies
binding to the Fc of the immunoadhesin. This was done by using 1
mg/ml huMAb4D5-8 in solution for the panning steps. In addition,
human WSX receptor extracellular domain (cleaved from the WSX
receptor immunoadhesin with Genenase (Carter et al. Proteins:
Structure, Function and Genetics 6:240-248 (1989)) was biotinylated
and used for three rounds of panning. Individual phage following
two or three rounds of panning were characterized by
antigen-binding ELISA (Tables 4 and 5).
6TABLE 4 Panning with human WSX receptor immunoadhesin-coated
immunotubes Phage ELISA # clones # BstNI Round hWSXR Fc
characterized fingerprints 2 74/96 0/96 74 11.sup.a 3 191/192 1/192
58 8.sup.a .sup.aTotal of 11 different clones identified.
[0464]
7TABLE 5 Panning with biotinylated human WSX receptor Phage ELISA #
clones # BstNI Round hWSXR Fc characterized fingerprints 2 8/96
0/96 8 4.sup.a 3 49/192 1/192 49 4.sup.a .sup.aTotal of 7 different
clones identified.
[0465] Clones binding to human WSX receptor were further
characterized by BstNI fingerprinting of a PCR fragment encoding
the scFv. A total of 18 clones were identified: 11 from the panning
using immunotubes and 7 from the panning using biotinylated antigen
(there was no overlap between these groups). The DNA for all 18
clones was sequenced.
[0466] Anti-huWSXR clones obtained as described above were analyzed
for agonist activity in a KIRA-ELISA assay (see above and FIG. 22)
firstly as scFv phage and then as scFv. The scFv phage were
PEG-precipitated (Carter et al., Mutagenesis: A Practical Approach,
MacPherson, M. ed. IRL Press, Oxford, UK, Chapter 1, pp 1-25
(1991)) and resuspended in PBS prior to screening. To prepare the
scFv, DNA from the clones was transformed into 33D3 cells (a
non-suppressor strain for expression of soluble protein). The cells
were planted onto 2YT/2% glucose/50 .mu.g per ml of carbenicillin
and incubated at 37.degree. C. overnight. A 5 ml culture (2YTG:
2YT, 2% glucose, 50 .mu.g/ml carbenicillin) was innoculated and
grown at 30.degree. C. overnight. The next morning, the 5 ml
culture was diluted into 500 ml 2YTG media and grown at 30.degree.
C. until OD550, 0.3. Then, the media was changed from 2YTG into
2YT/50 .mu.g/ml carbenicillin/2 mM IPTG and grown at 30.degree. C.
for 4-5 hrs for scFv production. The culture was harvested and the
cell pellet was frozen at -20.degree. C. For purification, the cell
pellet was resuspended in 10 ml shockate buffer (SOmM Tris HCl
pH8.5, 20% sucrose, 1 mM EDTA) and agitated at 4.degree. C. for 1
hr. The debris was spun down and supernatant was taken to be
purified on Ni NTA Superose (Qiagen) column. MgCl.sub.2 was added
to the supernatant to 5 mM and loaded onto 0.5 ml Ni NTA Superose
packed into a disposable columnn. The column was then washed with
2.times.5 ml wash buffer 1 (50 mM sodium phosphate, 300 mM NaCl, 25
mM imidazole pH 8.0) followed by 2.times.5 ml wash 2 buffer (50 mM
sodium phosphate, 300 mM NaCl, 50 mM imidazole pH 8.0). The scFv
was then eluted with 2.5 ml elution buffer (50 mM sodium phosphate,
300 mM NaCl, 250 mM imidazole, pH8.0). The eluted pool was buffer
exchanged into PBS with a NAP5 column (Pharmacia) and stored at
4.degree. C.
[0467] Clones #3, #4 and # 17 were found to have agonist activity
as phage and as scFv (see FIGS. 23 and 24). The sequences of these
agonist clones are shown in FIG. 25. The activity of the antibodies
as F(ab').sub.2 in the KIRA ELISA was assessed, with clone #4 and
clone # 17 showing enhanced activity as F(ab').sub.2. The ability
of the antibodies to bind murine WSX receptor in a capture ELISA
(see Example 13) was assessed. Clone #4 and clone # 17 bound murine
WSX receptor in this assay.
Sequence CWU 1
1
51 1 4102 DNA Homo sapiens 1 gaattctcga gtcgacggcg ggcgttaaag
ctctcgtggc attatccttc agtggggcta 60 ttggactgac ttttcttatg
ctgggatgtg ccttagagga ttatgggtgt acttctctga 120 agtaagatga
tttgtcaaaa attctgtgtg gttttgttac attgggaatt tatttatgtg 180
ataactgcgt ttaacttgtc atatccaatt actccttgga gatttaagtt gtcttgcatg
240 ccaccaaatt caacctatga ctacttcctt ttgcctgctg gactctcaaa
gaatacttca 300 aattcgaatg gacattatga gacagctgtt gaacctaagt
ttaattcaag tggtactcac 360 ttttctaact tatccaaaac aactttccac
tgttgctttc ggagtgagca agatagaaac 420 tgctccttat gtgcagacaa
cattgaagga aagacatttg tttcaacagt aaattcttta 480 gtttttcaac
aaatagatgc aaactggaac atacagtgct ggctaaaagg agacttaaaa 540
ttattcatct gttatgtgga gtcattattt aagaatctat tcaggaatta taactataag
600 gtccatcttt tatatgttct gcctgaagtg ttagaagatt cacctctggt
tccccaaaaa 660 ggcagttttc agatggttca ctgcaattgc agtgttcatg
aatgttgtga atgtcttgtg 720 cctgtgccaa cagccaaact caacgacact
ctccttatgt gtttgaaaat cacatctggt 780 ggagtaattt tccagtcacc
tctaatgtca gttcagccca taaatatggt gaagcctgat 840 ccaccattag
gtttgcatat ggaaatcaca gatgatggta atttaaagat ttcttggtcc 900
agcccaccat tggtaccatt tccacttcaa tatcaagtga aatattcaga gaattctaca
960 acagttatca gagaagctga caagattgtc tcagctacat ccctgctagt
agacagtata 1020 cttcctgggt cttcgtatga ggttcaggtg aggggcaaga
gactggatgg cccaggaatc 1080 tggagtgact ggagtactcc tcgtgtcttt
accacacaag atgtcatata ctttccacct 1140 aaaattctga caagtgttgg
gtctaatgtt tcttttcact gcatctataa gaaggaaaac 1200 aagattgttc
cctcaaaaga gattgtttgg tggatgaatt tagctgagaa aattcctcaa 1260
agccagtatg atgttgtgag tgatcatgtt agcaaagtta cttttttcaa tctgaatgaa
1320 accaaacctc gaggaaagtt tacctatgat gcagtgtact gctgcaatga
acatgaatgc 1380 catcatcgct atgctgaatt atatgtgatt gatgtcaata
tcaatatctc atgtgaaact 1440 gatgggtact taactaaaat gacttgcaga
tggtcaacca gtacaatcca gtcacttgcg 1500 gaaagcactt tgcaattgag
gtatcatagg agcagccttt actgttctga tattccatct 1560 attcatccca
tatctgagcc caaagattgc tatttgcaga gtgatggttt ttatgaatgc 1620
attttccagc caatcttcct attatctggc tacacaatgt ggattaggat caatcactct
1680 ctaggttcac ttgactctcc accaacatgt gtccttcctg attctgtggt
gaagccactg 1740 cctccatcca gtgtgaaagc agaaattact ataaacattg
gattattgaa aatatcttgg 1800 gaaaagccag tctttccaga gaataacctt
caattccaga ttcgctatgg tttaagtgga 1860 aaagaagtac aatggaagat
gtatgaggtt tatgatgcaa aatcaaaatc tgtcagtctc 1920 ccagttccag
acttgtgtgc agtctatgct gttcaggtgc gctgtaagag gctagatgga 1980
ctgggatatt ggagtaattg gagcaatcca gcctacacag ttgtcatgga tataaaagtt
2040 cctatgagag gacctgaatt ttggagaata attaatggag atactatgaa
aaaggagaaa 2100 aatgtcactt tactttggaa gcccctgatg aaaaatgact
cattgtgcag tgttcagaga 2160 tatgtgataa accatcatac ttcctgcaat
ggaacatggt cagaagatgt gggaaatcac 2220 acgaaattca ctttcctgtg
gacagagcaa gcacatactg ttacggttct ggccatcaat 2280 tcaattggtg
cttctgttgc aaattttaat ttaacctttt catggcctat gagcaaagta 2340
aatatcgtgc agtcactcag tgcttatcct ttaaacagca gttgtgtgat tgtttcctgg
2400 atactatcac ccagtgatta caagctaatg tattttatta ttgagtggaa
aaatcttaat 2460 gaagatggtg aaataaaatg gcttagaatc tcttcatctg
ttaagaagta ttatatccat 2520 gatcatttta tccccattga gaagtaccag
ttcagtcttt acccaatatt tatggaagga 2580 gtgggaaaac caaagataat
taatagtttc actcaagatg atattgaaaa acaccagagt 2640 gatgcaggtt
tatatgtaat tgtgccagta attatttcct cttccatctt attgcttgga 2700
acattattaa tatcacacca aagaatgaaa aagctatttt gggaagatgt tccgaacccc
2760 aagaattgtt cctgggcaca aggacttaat tttcagaagc cagaaacgtt
tgagcatctt 2820 tttatcaagc atacagcatc agtgacatgt ggtcctcttc
ttttggagcc tgaaacaatt 2880 tcagaagata tcagtgttga tacatcatgg
aaaaataaag atgagatgat gccaacaact 2940 gtggtctctc tactttcaac
aacagatctt gaaaagggtt ctgtttgtat tagtgaccag 3000 ttcaacagtg
ttaacttctc tgaggctgag ggtactgagg taacctatga ggacgaaagc 3060
cagagacaac cctttgttaa atacgccacg ctgatcagca actctaaacc aagtgaaact
3120 ggtgaagaac aagggcttat aaatagttca gtcaccaagt gcttctctag
caaaaattct 3180 ccgttgaagg attctttctc taatagctca tgggagatag
aggcccaggc attttttata 3240 ttatcagatc agcatcccaa cataatttca
ccacacctca cattctcaga aggattggat 3300 gaacttttga aattggaggg
aaatttccct gaagaaaata atgataaaaa gtctatctat 3360 tatttagggg
tcacctcaat caaaaagaga gagagtggtg tgcttttgac tgacaagtca 3420
agggtatcgt gcccattccc agccccctgt ttattcacgg acatcagagt tctccaggac
3480 agttgctcac actttgtaga aaataatatc aacttaggaa cttctagtaa
gaagactttt 3540 gcatcttaca tgcctcaatt ccaaacttgt tctactcaga
ctcataagat catggaaaac 3600 aagatgtgtg acctaactgt gtaatttcac
tgaagaaacc ttcagatttg tgttataatg 3660 ggtaatataa agtgtaatag
attatagttg tgggtgggag agagaaaaga aaccagagtc 3720 aaatttgaaa
ataattgttc caaatgaatg ttgtctgttt gttctctctt agtaacatag 3780
acaaaaaatt tgagaaagcc ttcataagcc taccaatgta gacacgctct tctattttat
3840 tcccaagctc tagtgggaag gtcccttgtt tccagctaga aataagccca
acagacacca 3900 tcttttgtga gatgtaattg ttttttcaga gggcgtgttg
ttttacctca agtttttgtt 3960 ttgtaccaac acacacacac acacacattc
ttaacacatg tccttgtgtg ttttgagagt 4020 atattatgta tttatatttt
gtgctatcag actgtaggat ttgaagtagg actttcctaa 4080 atgtttaaga
taaacagaat tc 4102 2 1165 PRT Homo sapiens 2 Met Ile Cys Gln Lys
Phe Cys Val Val Leu Leu His Trp Glu Phe Ile 1 5 10 15 Tyr Val Ile
Thr Ala Phe Asn Leu Ser Tyr Pro Ile Thr Pro Trp Arg 20 25 30 Phe
Lys Leu Ser Cys Met Pro Pro Asn Ser Thr Tyr Asp Tyr Phe Leu 35 40
45 Leu Pro Ala Gly Leu Ser Lys Asn Thr Ser Asn Ser Asn Gly His Tyr
50 55 60 Glu Thr Ala Val Glu Pro Lys Phe Asn Ser Ser Gly Thr His
Phe Ser 65 70 75 80 Asn Leu Ser Lys Thr Thr Phe His Cys Cys Phe Arg
Ser Glu Gln Asp 85 90 95 Arg Asn Cys Ser Leu Cys Ala Asp Asn Ile
Glu Gly Lys Thr Phe Val 100 105 110 Ser Thr Val Asn Ser Leu Val Phe
Gln Gln Ile Asp Ala Asn Trp Asn 115 120 125 Ile Gln Cys Trp Leu Lys
Gly Asp Leu Lys Leu Phe Ile Cys Tyr Val 130 135 140 Glu Ser Leu Phe
Lys Asn Leu Phe Arg Asn Tyr Asn Tyr Lys Val His 145 150 155 160 Leu
Leu Tyr Val Leu Pro Glu Val Leu Glu Asp Ser Pro Leu Val Pro 165 170
175 Gln Lys Gly Ser Phe Gln Met Val His Cys Asn Cys Ser Val His Glu
180 185 190 Cys Cys Glu Cys Leu Val Pro Val Pro Thr Ala Lys Leu Asn
Asp Thr 195 200 205 Leu Leu Met Cys Leu Lys Ile Thr Ser Gly Gly Val
Ile Phe Gln Ser 210 215 220 Pro Leu Met Ser Val Gln Pro Ile Asn Met
Val Lys Pro Asp Pro Pro 225 230 235 240 Leu Gly Leu His Met Glu Ile
Thr Asp Asp Gly Asn Leu Lys Ile Ser 245 250 255 Trp Ser Ser Pro Pro
Leu Val Pro Phe Pro Leu Gln Tyr Gln Val Lys 260 265 270 Tyr Ser Glu
Asn Ser Thr Thr Val Ile Arg Glu Ala Asp Lys Ile Val 275 280 285 Ser
Ala Thr Ser Leu Leu Val Asp Ser Ile Leu Pro Gly Ser Ser Tyr 290 295
300 Glu Val Gln Val Arg Gly Lys Arg Leu Asp Gly Pro Gly Ile Trp Ser
305 310 315 320 Asp Trp Ser Thr Pro Arg Val Phe Thr Thr Gln Asp Val
Ile Tyr Phe 325 330 335 Pro Pro Lys Ile Leu Thr Ser Val Gly Ser Asn
Val Ser Phe His Cys 340 345 350 Ile Tyr Lys Lys Glu Asn Lys Ile Val
Pro Ser Lys Glu Ile Val Trp 355 360 365 Trp Met Asn Leu Ala Glu Lys
Ile Pro Gln Ser Gln Tyr Asp Val Val 370 375 380 Ser Asp His Val Ser
Lys Val Thr Phe Phe Asn Leu Asn Glu Thr Lys 385 390 395 400 Pro Arg
Gly Lys Phe Thr Tyr Asp Ala Val Tyr Cys Cys Asn Glu His 405 410 415
Glu Cys His His Arg Tyr Ala Glu Leu Tyr Val Ile Asp Val Asn Ile 420
425 430 Asn Ile Ser Cys Glu Thr Asp Gly Tyr Leu Thr Lys Met Thr Cys
Arg 435 440 445 Trp Ser Thr Ser Thr Ile Gln Ser Leu Ala Glu Ser Thr
Leu Gln Leu 450 455 460 Arg Tyr His Arg Ser Ser Leu Tyr Cys Ser Asp
Ile Pro Ser Ile His 465 470 475 480 Pro Ile Ser Glu Pro Lys Asp Cys
Tyr Leu Gln Ser Asp Gly Phe Tyr 485 490 495 Glu Cys Ile Phe Gln Pro
Ile Phe Leu Leu Ser Gly Tyr Thr Met Trp 500 505 510 Ile Arg Ile Asn
His Ser Leu Gly Ser Leu Asp Ser Pro Pro Thr Cys 515 520 525 Val Leu
Pro Asp Ser Val Val Lys Pro Leu Pro Pro Ser Ser Val Lys 530 535 540
Ala Glu Ile Thr Ile Asn Ile Gly Leu Leu Lys Ile Ser Trp Glu Lys 545
550 555 560 Pro Val Phe Pro Glu Asn Asn Leu Gln Phe Gln Ile Arg Tyr
Gly Leu 565 570 575 Ser Gly Lys Glu Val Gln Trp Lys Met Tyr Glu Val
Tyr Asp Ala Lys 580 585 590 Ser Lys Ser Val Ser Leu Pro Val Pro Asp
Leu Cys Ala Val Tyr Ala 595 600 605 Val Gln Val Arg Cys Lys Arg Leu
Asp Gly Leu Gly Tyr Trp Ser Asn 610 615 620 Trp Ser Asn Pro Ala Tyr
Thr Val Val Met Asp Ile Lys Val Pro Met 625 630 635 640 Arg Gly Pro
Glu Phe Trp Arg Ile Ile Asn Gly Asp Thr Met Lys Lys 645 650 655 Glu
Lys Asn Val Thr Leu Leu Trp Lys Pro Leu Met Lys Asn Asp Ser 660 665
670 Leu Cys Ser Val Gln Arg Tyr Val Ile Asn His His Thr Ser Cys Asn
675 680 685 Gly Thr Trp Ser Glu Asp Val Gly Asn His Thr Lys Phe Thr
Phe Leu 690 695 700 Trp Thr Glu Gln Ala His Thr Val Thr Val Leu Ala
Ile Asn Ser Ile 705 710 715 720 Gly Ala Ser Val Ala Asn Phe Asn Leu
Thr Phe Ser Trp Pro Met Ser 725 730 735 Lys Val Asn Ile Val Gln Ser
Leu Ser Ala Tyr Pro Leu Asn Ser Ser 740 745 750 Cys Val Ile Val Ser
Trp Ile Leu Ser Pro Ser Asp Tyr Lys Leu Met 755 760 765 Tyr Phe Ile
Ile Glu Trp Lys Asn Leu Asn Glu Asp Gly Glu Ile Lys 770 775 780 Trp
Leu Arg Ile Ser Ser Ser Val Lys Lys Tyr Tyr Ile His Asp His 785 790
795 800 Phe Ile Pro Ile Glu Lys Tyr Gln Phe Ser Leu Tyr Pro Ile Phe
Met 805 810 815 Glu Gly Val Gly Lys Pro Lys Ile Ile Asn Ser Phe Thr
Gln Asp Asp 820 825 830 Ile Glu Lys His Gln Ser Asp Ala Gly Leu Tyr
Val Ile Val Pro Val 835 840 845 Ile Ile Ser Ser Ser Ile Leu Leu Leu
Gly Thr Leu Leu Ile Ser His 850 855 860 Gln Arg Met Lys Lys Leu Phe
Trp Glu Asp Val Pro Asn Pro Lys Asn 865 870 875 880 Cys Ser Trp Ala
Gln Gly Leu Asn Phe Gln Lys Pro Glu Thr Phe Glu 885 890 895 His Leu
Phe Ile Lys His Thr Ala Ser Val Thr Cys Gly Pro Leu Leu 900 905 910
Leu Glu Pro Glu Thr Ile Ser Glu Asp Ile Ser Val Asp Thr Ser Trp 915
920 925 Lys Asn Lys Asp Glu Met Met Pro Thr Thr Val Val Ser Leu Leu
Ser 930 935 940 Thr Thr Asp Leu Glu Lys Gly Ser Val Cys Ile Ser Asp
Gln Phe Asn 945 950 955 960 Ser Val Asn Phe Ser Glu Ala Glu Gly Thr
Glu Val Thr Tyr Glu Asp 965 970 975 Glu Ser Gln Arg Gln Pro Phe Val
Lys Tyr Ala Thr Leu Ile Ser Asn 980 985 990 Ser Lys Pro Ser Glu Thr
Gly Glu Glu Gln Gly Leu Ile Asn Ser Ser 995 1000 1005 Val Thr Lys
Cys Phe Ser Ser Lys Asn Ser Pro Leu Lys Asp Ser Phe 1010 1015 1020
Ser Asn Ser Ser Trp Glu Ile Glu Ala Gln Ala Phe Phe Ile Leu Ser
1025 1030 1035 1040 Asp Gln His Pro Asn Ile Ile Ser Pro His Leu Thr
Phe Ser Glu Gly 1045 1050 1055 Leu Asp Glu Leu Leu Lys Leu Glu Gly
Asn Phe Pro Glu Glu Asn Asn 1060 1065 1070 Asp Lys Lys Ser Ile Tyr
Tyr Leu Gly Val Thr Ser Ile Lys Lys Arg 1075 1080 1085 Glu Ser Gly
Val Leu Leu Thr Asp Lys Ser Arg Val Ser Cys Pro Phe 1090 1095 1100
Pro Ala Pro Cys Leu Phe Thr Asp Ile Arg Val Leu Gln Asp Ser Cys
1105 1110 1115 1120 Ser His Phe Val Glu Asn Asn Ile Asn Leu Gly Thr
Ser Ser Lys Lys 1125 1130 1135 Thr Phe Ala Ser Tyr Met Pro Gln Phe
Gln Thr Cys Ser Thr Gln Thr 1140 1145 1150 His Lys Ile Met Glu Asn
Lys Met Cys Asp Leu Thr Val 1155 1160 1165 3 896 PRT Homo sapiens 3
Met Ile Cys Gln Lys Phe Cys Val Val Leu Leu His Trp Glu Phe Ile 1 5
10 15 Tyr Val Ile Thr Ala Phe Asn Leu Ser Tyr Pro Ile Thr Pro Trp
Arg 20 25 30 Phe Lys Leu Ser Cys Met Pro Pro Asn Ser Thr Tyr Asp
Tyr Phe Leu 35 40 45 Leu Pro Ala Gly Leu Ser Lys Asn Thr Ser Asn
Ser Asn Gly His Tyr 50 55 60 Glu Thr Ala Val Glu Pro Lys Phe Asn
Ser Ser Gly Thr His Phe Ser 65 70 75 80 Asn Leu Ser Lys Thr Thr Phe
His Cys Cys Phe Arg Ser Glu Gln Asp 85 90 95 Arg Asn Cys Ser Leu
Cys Ala Asp Asn Ile Glu Gly Lys Thr Phe Val 100 105 110 Ser Thr Val
Asn Ser Leu Val Phe Gln Gln Ile Asp Ala Asn Trp Asn 115 120 125 Ile
Gln Cys Trp Leu Lys Gly Asp Leu Lys Leu Phe Ile Cys Tyr Val 130 135
140 Glu Ser Leu Phe Lys Asn Leu Phe Arg Asn Tyr Asn Tyr Lys Val His
145 150 155 160 Leu Leu Tyr Val Leu Pro Glu Val Leu Glu Asp Ser Pro
Leu Val Pro 165 170 175 Gln Lys Gly Ser Phe Gln Met Val His Cys Asn
Cys Ser Val His Glu 180 185 190 Cys Cys Glu Cys Leu Val Pro Val Pro
Thr Ala Lys Leu Asn Asp Thr 195 200 205 Leu Leu Met Cys Leu Lys Ile
Thr Ser Gly Gly Val Ile Phe Gln Ser 210 215 220 Pro Leu Met Ser Val
Gln Pro Ile Asn Met Val Lys Pro Asp Pro Pro 225 230 235 240 Leu Gly
Leu His Met Glu Ile Thr Asp Asp Gly Asn Leu Lys Ile Ser 245 250 255
Trp Ser Ser Pro Pro Leu Val Pro Phe Pro Leu Gln Tyr Gln Val Lys 260
265 270 Tyr Ser Glu Asn Ser Thr Thr Val Ile Arg Glu Ala Asp Lys Ile
Val 275 280 285 Ser Ala Thr Ser Leu Leu Val Asp Ser Ile Leu Pro Gly
Ser Ser Tyr 290 295 300 Glu Val Gln Val Arg Gly Lys Arg Leu Asp Gly
Pro Gly Ile Trp Ser 305 310 315 320 Asp Trp Ser Thr Pro Arg Val Phe
Thr Thr Gln Asp Val Ile Tyr Phe 325 330 335 Pro Pro Lys Ile Leu Thr
Ser Val Gly Ser Asn Val Ser Phe His Cys 340 345 350 Ile Tyr Lys Lys
Glu Asn Lys Ile Val Pro Ser Lys Glu Ile Val Trp 355 360 365 Trp Met
Asn Leu Ala Glu Lys Ile Pro Gln Ser Gln Tyr Asp Val Val 370 375 380
Ser Asp His Val Ser Lys Val Thr Phe Phe Asn Leu Asn Glu Thr Lys 385
390 395 400 Pro Arg Gly Lys Phe Thr Tyr Asp Ala Val Tyr Cys Cys Asn
Glu His 405 410 415 Glu Cys His His Arg Tyr Ala Glu Leu Tyr Val Ile
Asp Val Asn Ile 420 425 430 Asn Ile Ser Cys Glu Thr Asp Gly Tyr Leu
Thr Lys Met Thr Cys Arg 435 440 445 Trp Ser Thr Ser Thr Ile Gln Ser
Leu Ala Glu Ser Thr Leu Gln Leu 450 455 460 Arg Tyr His Arg Ser Ser
Leu Tyr Cys Ser Asp Ile Pro Ser Ile His 465 470 475 480 Pro Ile Ser
Glu Pro Lys Asp Cys Tyr Leu Gln Ser Asp Gly Phe Tyr 485 490 495 Glu
Cys Ile Phe Gln Pro Ile Phe Leu Leu Ser Gly Tyr Thr Met Trp 500 505
510 Ile Arg Ile Asn His Ser Leu Gly Ser Leu Asp Ser Pro Pro Thr Cys
515 520 525 Val Leu Pro Asp Ser Val Val Lys Pro Leu Pro Pro Ser Ser
Val Lys 530 535 540 Ala Glu Ile Thr Ile Asn Ile Gly Leu Leu Lys Ile
Ser Trp Glu Lys 545 550 555 560 Pro Val Phe Pro Glu Asn Asn Leu Gln
Phe Gln Ile Arg Tyr Gly Leu 565 570 575 Ser Gly Lys Glu Val Gln Trp
Lys Met Tyr Glu Val Tyr Asp Ala Lys 580 585 590 Ser Lys Ser Val Ser
Leu Pro Val Pro Asp Leu
Cys Ala Val Tyr Ala 595 600 605 Val Gln Val Arg Cys Lys Arg Leu Asp
Gly Leu Gly Tyr Trp Ser Asn 610 615 620 Trp Ser Asn Pro Ala Tyr Thr
Val Val Met Asp Ile Lys Val Pro Met 625 630 635 640 Arg Gly Pro Glu
Phe Trp Arg Ile Ile Asn Gly Asp Thr Met Lys Lys 645 650 655 Glu Lys
Asn Val Thr Leu Leu Trp Lys Pro Leu Met Lys Asn Asp Ser 660 665 670
Leu Cys Ser Val Gln Arg Tyr Val Ile Asn His His Thr Ser Cys Asn 675
680 685 Gly Thr Trp Ser Glu Asp Val Gly Asn His Thr Lys Phe Thr Phe
Leu 690 695 700 Trp Thr Glu Gln Ala His Thr Val Thr Val Leu Ala Ile
Asn Ser Ile 705 710 715 720 Gly Ala Ser Val Ala Asn Phe Asn Leu Thr
Phe Ser Trp Pro Met Ser 725 730 735 Lys Val Asn Ile Val Gln Ser Leu
Ser Ala Tyr Pro Leu Asn Ser Ser 740 745 750 Cys Val Ile Val Ser Trp
Ile Leu Ser Pro Ser Asp Tyr Lys Leu Met 755 760 765 Tyr Phe Ile Ile
Glu Trp Lys Asn Leu Asn Glu Asp Gly Glu Ile Lys 770 775 780 Trp Leu
Arg Ile Ser Ser Ser Val Lys Lys Tyr Tyr Ile His Asp His 785 790 795
800 Phe Ile Pro Ile Glu Lys Tyr Gln Phe Ser Leu Tyr Pro Ile Phe Met
805 810 815 Glu Gly Val Gly Lys Pro Lys Ile Ile Asn Ser Phe Thr Gln
Asp Asp 820 825 830 Ile Glu Lys His Gln Ser Asp Ala Gly Leu Tyr Val
Ile Val Pro Val 835 840 845 Ile Ile Ser Ser Ser Ile Leu Leu Leu Gly
Thr Leu Leu Ile Ser His 850 855 860 Gln Arg Met Lys Lys Leu Phe Trp
Glu Asp Val Pro Asn Pro Lys Asn 865 870 875 880 Cys Ser Trp Ala Gln
Gly Leu Asn Phe Gln Lys Arg Thr Asp Ile Leu 885 890 895 4 923 PRT
Homo sapiens 4 Met Ile Cys Gln Lys Phe Cys Val Val Leu Leu His Trp
Glu Phe Ile 1 5 10 15 Tyr Val Ile Thr Ala Phe Asn Leu Ser Tyr Pro
Ile Thr Pro Trp Arg 20 25 30 Phe Lys Leu Ser Cys Met Pro Pro Asn
Ser Thr Tyr Asp Tyr Phe Leu 35 40 45 Leu Pro Ala Gly Leu Ser Lys
Asn Thr Ser Asn Ser Asn Gly His Tyr 50 55 60 Glu Thr Ala Val Glu
Pro Lys Phe Asn Ser Ser Gly Thr His Phe Ser 65 70 75 80 Asn Leu Ser
Lys Thr Thr Phe His Cys Cys Phe Arg Ser Glu Gln Asp 85 90 95 Arg
Asn Cys Ser Leu Cys Ala Asp Asn Ile Glu Gly Lys Thr Phe Val 100 105
110 Ser Thr Val Asn Ser Leu Val Phe Gln Gln Ile Asp Ala Asn Trp Asn
115 120 125 Ile Gln Cys Trp Leu Lys Gly Asp Leu Lys Leu Phe Ile Cys
Tyr Val 130 135 140 Glu Ser Leu Phe Lys Asn Leu Phe Arg Asn Tyr Asn
Tyr Lys Val His 145 150 155 160 Leu Leu Tyr Val Leu Pro Glu Val Leu
Glu Asp Ser Pro Leu Val Pro 165 170 175 Gln Lys Gly Ser Phe Gln Met
Val His Cys Asn Cys Ser Val His Glu 180 185 190 Cys Cys Glu Cys Leu
Val Pro Val Pro Thr Ala Lys Leu Asn Asp Thr 195 200 205 Leu Leu Met
Cys Leu Lys Ile Thr Ser Gly Gly Val Ile Phe Gln Ser 210 215 220 Pro
Leu Met Ser Val Gln Pro Ile Asn Met Val Lys Pro Asp Pro Pro 225 230
235 240 Leu Gly Leu His Met Glu Ile Thr Asp Asp Gly Asn Leu Lys Ile
Ser 245 250 255 Trp Ser Ser Pro Pro Leu Val Pro Phe Pro Leu Gln Tyr
Gln Val Lys 260 265 270 Tyr Ser Glu Asn Ser Thr Thr Val Ile Arg Glu
Ala Asp Lys Ile Val 275 280 285 Ser Ala Thr Ser Leu Leu Val Asp Ser
Ile Leu Pro Gly Ser Ser Tyr 290 295 300 Glu Val Gln Val Arg Gly Lys
Arg Leu Asp Gly Pro Gly Ile Trp Ser 305 310 315 320 Asp Trp Ser Thr
Pro Arg Val Phe Thr Thr Gln Asp Val Ile Tyr Phe 325 330 335 Pro Pro
Lys Ile Leu Thr Ser Val Gly Ser Asn Val Ser Phe His Cys 340 345 350
Ile Tyr Lys Lys Glu Asn Lys Ile Val Pro Ser Lys Glu Ile Val Trp 355
360 365 Trp Met Asn Leu Ala Glu Lys Ile Pro Gln Ser Gln Tyr Asp Val
Val 370 375 380 Ser Asp His Val Ser Lys Val Thr Phe Phe Asn Leu Asn
Glu Thr Lys 385 390 395 400 Pro Arg Gly Lys Phe Thr Tyr Asp Ala Val
Tyr Cys Cys Asn Glu His 405 410 415 Glu Cys His His Arg Tyr Ala Glu
Leu Tyr Val Ile Asp Val Asn Ile 420 425 430 Asn Ile Ser Cys Glu Thr
Asp Gly Tyr Leu Thr Lys Met Thr Cys Arg 435 440 445 Trp Ser Thr Ser
Thr Ile Gln Ser Leu Ala Glu Ser Thr Leu Gln Leu 450 455 460 Arg Tyr
His Arg Ser Ser Leu Tyr Cys Ser Asp Ile Pro Ser Ile His 465 470 475
480 Pro Ile Ser Glu Pro Lys Asp Cys Tyr Leu Gln Ser Asp Gly Phe Tyr
485 490 495 Glu Cys Ile Phe Gln Pro Ile Phe Leu Leu Ser Gly Tyr Thr
Met Trp 500 505 510 Ile Arg Ile Asn His Ser Leu Gly Ser Leu Asp Ser
Pro Pro Thr Cys 515 520 525 Val Leu Pro Asp Ser Val Val Lys Pro Leu
Pro Pro Ser Ser Val Lys 530 535 540 Ala Glu Ile Thr Ile Asn Ile Gly
Leu Leu Lys Ile Ser Trp Glu Lys 545 550 555 560 Pro Val Phe Pro Glu
Asn Asn Leu Gln Phe Gln Ile Arg Tyr Gly Leu 565 570 575 Ser Gly Lys
Glu Val Gln Trp Lys Met Tyr Glu Val Tyr Asp Ala Lys 580 585 590 Ser
Lys Ser Val Ser Leu Pro Val Pro Asp Leu Cys Ala Val Tyr Ala 595 600
605 Val Gln Val Arg Cys Lys Arg Leu Asp Gly Leu Gly Tyr Trp Ser Asn
610 615 620 Trp Ser Asn Pro Ala Tyr Thr Val Val Met Asp Ile Lys Val
Pro Met 625 630 635 640 Arg Gly Pro Glu Phe Trp Arg Ile Ile Asn Gly
Asp Thr Met Lys Lys 645 650 655 Glu Lys Asn Val Thr Leu Leu Trp Lys
Pro Leu Met Lys Asn Asp Ser 660 665 670 Leu Cys Ser Val Gln Arg Tyr
Val Ile Asn His His Thr Ser Cys Asn 675 680 685 Gly Thr Trp Ser Glu
Asp Val Gly Asn His Thr Lys Phe Thr Phe Leu 690 695 700 Trp Thr Glu
Gln Ala His Thr Val Thr Val Leu Ala Ile Asn Ser Ile 705 710 715 720
Gly Ala Ser Val Ala Asn Phe Asn Leu Thr Phe Ser Trp Pro Met Ser 725
730 735 Lys Val Asn Ile Val Gln Ser Leu Ser Ala Tyr Pro Leu Asn Ser
Ser 740 745 750 Cys Val Ile Val Ser Trp Ile Leu Ser Pro Ser Asp Tyr
Lys Leu Met 755 760 765 Tyr Phe Ile Ile Glu Trp Lys Asn Leu Asn Glu
Asp Gly Glu Ile Lys 770 775 780 Trp Leu Arg Ile Ser Ser Ser Val Lys
Lys Tyr Tyr Ile His Asp His 785 790 795 800 Phe Ile Pro Ile Glu Lys
Tyr Gln Phe Ser Leu Tyr Pro Ile Phe Met 805 810 815 Glu Gly Val Gly
Lys Pro Lys Ile Ile Asn Ser Phe Thr Gln Asp Asp 820 825 830 Ile Glu
Lys His Gln Ser Asp Ala Gly Leu Tyr Val Ile Val Pro Val 835 840 845
Ile Ile Ser Ser Ser Ile Leu Leu Leu Gly Thr Leu Leu Ile Ser His 850
855 860 Gln Arg Met Lys Lys Leu Phe Trp Glu Asp Val Pro Asn Pro Lys
Asn 865 870 875 880 Cys Ser Trp Ala Gln Gly Leu Asn Phe Gln Lys Met
Phe Arg Thr Pro 885 890 895 Arg Ile Val Pro Gly His Lys Asp Leu Ile
Phe Arg Arg Cys Leu Lys 900 905 910 Ala Ala Cys Ser Leu Arg Val Ile
Thr Thr Pro 915 920 5 3004 DNA Homo sapiens misc_feature 552 n =
A,T,C or G 5 gaattccggg ttaaagctct cgtggcatta tccttcagtg gggctattgg
actgactttt 60 cttatgctgg gatgtgcctt agaggattat ggatttgcca
gttcaccctg accatcttga 120 aaataagtta tctctgatct ctgtctgtat
gttacttctc tcccctcacc aatggagaac 180 aaatgtgggc aaagtgtact
tctctgaagt aagatgattt gtcaaaaatt ctgtgtggtt 240 ttgttacatt
gggaatttat ttatgtgata actgcgttta acttgtcata tccaattact 300
ccttggagat ttaagttgtc ttgcatgcca ccaaattcaa cctatgacta cttccttttg
360 cctgctggac tctcaaagaa tacttcaaat tcgaatggac attatgagac
agctgttgaa 420 cctaagttta attcaagtgg tactcacttt tctaacttat
ccaaaacaac tttccactgt 480 tgctttcgga gtgagcaaga tagaaactgc
tccttatgtg cagacaacat tgaaggaaag 540 acatttgttt cnacagtaaa
ttctttagtt tttcaacaaa tagatgcaaa ctggaacata 600 cagtgctggc
taaaaggaga cttaaaatta ttcatctgtt atgtggagtc attatttaag 660
aatctattca ggaattataa ctataaggtc catcttttat atgttctgcc tgaagtgtta
720 gaagattcac ctctggttcc ccaaaaaggc agttttcaga tggttcactg
caattgcagt 780 gttcatgaat gttgtgaatg tcttgtgcct gtgccaacag
ccaaactcaa cgacactctc 840 cttatgtgtt tgaaaatcac atctggtgga
gtaattttcc agtcacctct aatgtcagtt 900 cagcccataa atatggtgaa
gcctgatcca ccattaggtt tgcatatgga aatcacagat 960 gatggtaatt
taaagatttc ttggtccagc ccaccattgg taccatttcc acttcaatat 1020
caagtgaaat attcagagaa ttctacaaca gttatcagag aagctgacaa gattgtctca
1080 gctacatccc tgctagtaga cagtatactt cctgggtctt cgtatgaggt
tcaggtgagg 1140 ggcaagagac tggatggccc aggaatctgg agtgactgga
gtactcctcg tgtctttacc 1200 acacaagatg tcatatactt tccacctaaa
attctgacaa gtgttgggtc taatgtttct 1260 tttcactgca tctataagaa
ggaaaacaag attgttccct caaaagagat tgtttggtgg 1320 atgaatttag
ctgagaaaat tcctcaaagc cagtatgatg ttgtgagtga tcatgttagc 1380
aaagttactt ttttcaatct gaatgaaacc aaacctcgag gaaagtttac ctatgatgca
1440 gtgtactgct gcaatgaaca tgaatgccat catcgctatg ctgaattata
tgtgattgat 1500 gtcaatatca atatctcatg tgaaactgat gggtacttaa
ctaaaatgac ttgcagatgg 1560 tcaaccagta caatccagtc acttgcggaa
agcactttgc aattgaggta tcataggagc 1620 agcctttact gttctgatat
tccatctatt catcccatat ctgagcccaa agattgctat 1680 ttgcagagtg
atggttttta tgaatgcatt ttccagccaa tcttcctatt atctggctac 1740
acaatgtgga ttaggatcaa tcactctcta ggttcacttg actctccacc aacatgtgtc
1800 cttcctgatt ctgtggtgaa gccactgcct ccatccagtg tgaaagcaga
aattactata 1860 aacattggat tattgaaaat atcttgggaa aagccagtct
ttccagagaa taaccttcaa 1920 ttccagattc gctatggttt aagtggaaaa
gaagtacaat ggaagatgta tgaggtttat 1980 gatgcaaaat caaaatctgt
cagtctccca gttccagact tgtgtgcagt ctatgctgtt 2040 caggtgcgct
gtaagaggct agatggactg ggatattgga gtaattggag caatccagcc 2100
tacacagttg tcatggatat aaaagttcct atgagaggac ctgaattttg gagaataatt
2160 aatggagata ctatgaaaaa ggagaaaaat gtcactttac tttggaagcc
cctgatgaaa 2220 aatgactcat tgtgcagtgt tcagagatat gtgataaacc
atcatacttc ctgcaatgga 2280 acatggtcag aagatgtggg aaatcacacg
aaattcactt tcctgtggac agagcaagca 2340 catactgtta cggttctggc
catcaattca attggtgctt ctgttgcaaa ttttaattta 2400 accttttcat
ggcctatgag caaagtaaat atcgtgcagt cactcagtgc ttatccttta 2460
aacagcagtt gtgtgattgt ttcctggata ctatcaccca gtgattacaa gctaatgtat
2520 tttattattg agtggaaaaa tcttaatgaa gatggtgaaa taaaatggct
tagaatctct 2580 tcatctgtta agaagtatta tatccatgat cattttatcc
ccattgagaa gtaccagttc 2640 agtctttacc caatatttat ggaaggagtg
ggaaaaccaa agataattaa tagtttcact 2700 caagatgata ttgaaaaaca
ccagagtgat gcaggtttat atgtaattgt gccagtaatt 2760 atttcctctt
ccatcttatt gcttggaaca ttattaatat cacaccaaag aatgaaaaag 2820
ctattttggg aagatgttcc gaaccccaag aattgttcct gggcacaagg acttaatttt
2880 cagaagagaa cggacattct ttgaagtcta atcatgatca ctacagatga
acccaatgtg 2940 ccaacttccc aacagtctat agagtattag aagattttta
cattttgaag aagggccgga 3000 attc 3004 6 3102 DNA Homo sapiens 6
gaattctcga gtcgacggcg ggcgttaaag ctctcgtggc attatccttc agtggggcta
60 ttggactgac ttttcttatg ctgggatgtg ccttagagga ttatgggtgt
acttctctga 120 agtaagatga tttgtcaaaa attctgtgtg gttttgttac
attgggaatt tatttatgtg 180 ataactgcgt ttaacttgtc atatccaatt
actccttgga gatttaagtt gtcttgcatg 240 ccaccaaatt caacctatga
ctacttcctt ttgcctgctg gactctcaaa gaatacttca 300 aattcgaatg
gacattatga gacagctgtt gaacctaagt ttaattcaag tggtactcac 360
ttttctaact tatccaaaac aactttccac tgttgctttc ggagtgagca agatagaaac
420 tgctccttat gtgcagacaa cattgaagga aagacatttg tttcaacagt
aaattcttta 480 gtttttcaac aaatagatgc aaactggaac atacagtgct
ggctaaaagg agacttaaaa 540 ttattcatct gttatgtgga gtcattattt
aagaatctat tcaggaatta taactataag 600 gtccatcttt tatatgttct
gcctgaagtg ttagaagatt cacctctggt tccccaaaaa 660 ggcagttttc
agatggttca ctgcaattgc agtgttcatg aatgttgtga atgtcttgtg 720
cctgtgccaa cagccaaact caacgacact ctccttatgt gtttgaaaat cacatctggt
780 ggagtaattt tccagtcacc tctaatgtca gttcagccca taaatatggt
gaagcctgat 840 ccaccattag gtttgcatat ggaaatcaca gatgatggta
atttaaagat ttcttggtcc 900 agcccaccat tggtaccatt tccacttcaa
tatcaagtga aatattcaga gaattctaca 960 acagttatca gagaagctga
caagattgtc tcagctacat ccctgctagt agacagtata 1020 cttcctgggt
cttcgtatga ggttcaggtg aggggcaaga gactggatgg cccaggaatc 1080
tggagtgact ggagtactcc tcgtgtcttt accacacaag atgtcatata ctttccacct
1140 aaaattctga caagtgttgg gtctaatgtt tcttttcact gcatctataa
gaaggaaaac 1200 aagattgttc cctcaaaaga gattgtttgg tggatgaatt
tagctgagaa aattcctcaa 1260 agccagtatg atgttgtgag tgatcatgtt
agcaaagtta cttttttcaa tctgaatgaa 1320 accaaacctc gaggaaagtt
tacctatgat gcagtgtact gctgcaatga acatgaatgc 1380 catcatcgct
atgctgaatt atatgtgatt gatgtcaata tcaatatctc atgtgaaact 1440
gatgggtact taactaaaat gacttgcaga tggtcaacca gtacaatcca gtcacttgcg
1500 gaaagcactt tgcaattgag gtatcatagg agcagccttt actgttctga
tattccatct 1560 attcatccca tatctgagcc caaagattgc tatttgcaga
gtgatggttt ttatgaatgc 1620 attttccagc caatcttcct attatctggc
tacacaatgt ggattaggat caatcactct 1680 ctaggttcac ttgactctcc
accaacatgt gtccttcctg attctgtggt gaagccactg 1740 cctccatcca
gtgtgaaagc agaaattact ataaacattg gattattgaa aatatcttgg 1800
gaaaagccag tctttccaga gaataacctt caattccaga ttcgctatgg tttaagtgga
1860 aaagaagtac aatggaagat gtatgaggtt tatgatgcaa aatcaaaatc
tgtcagtctc 1920 ccagttccag acttgtgtgc agtctatgct gttcaggtgc
gctgtaagag gctagatgga 1980 ctgggatatt ggagtaattg gagcaatcca
gcctacacag ttgtcatgga tataaaagtt 2040 cctatgagag gacctgaatt
ttggagaata attaatggag atactatgaa aaaggagaaa 2100 aatgtcactt
tactttggaa gcccctgatg aaaaatgact cattgtgcag tgttcagaga 2160
tatgtgataa accatcatac ttcctgcaat ggaacatggt cagaagatgt gggaaatcac
2220 acgaaattca ctttcctgtg gacagagcaa gcacatactg ttacggttct
ggccatcaat 2280 tcaattggtg cttctgttgc aaattttaat ttaacctttt
catggcctat gagcaaagta 2340 aatatcgtgc agtcactcag tgcttatcct
ttaaacagca gttgtgtgat tgtttcctgg 2400 atactatcac ccagtgatta
caagctaatg tattttatta ttgagtggaa aaatcttaat 2460 gaagatggtg
aaataaaatg gcttagaatc tcttcatctg ttaagaagta ttatatccat 2520
gatcatttta tccccattga gaagtaccag ttcagtcttt acccaatatt tatggaagga
2580 gtgggaaaac caaagataat taatagtttc actcaagatg atattgaaaa
acaccagagt 2640 gatgcaggtt tatatgtaat tgtgccagta attatttcct
cttccatctt attgcttgga 2700 acattattaa tatcacacca aagaatgaaa
aagctatttt gggaagatgt tccgaacccc 2760 aagaattgtt cctgggcaca
aggacttaat tttcagaaga tgttccgaac cccaagaatt 2820 gttcctgggc
acaaggactt aattttcaga agatgcttga aggcagcatg ttcgttaaga 2880
gtcatcacca ctccctaatc tcaagtaccc agggacacaa acactgcgga aggccacagg
2940 gtcctctgca taggaaaacc agagaccttt gttcacttgt ttatctgctg
accctccctc 3000 cactattgtc ctatgaccct gccaaatccc cctctgtgag
aaacacccaa gaatgatcaa 3060 taaaaaaaaa aaaaaaaaaa aaaaaagtcg
actcgagaat tc 3102 7 783 PRT Mus musculus 7 Met Met Cys Gln Lys Phe
Tyr Val Val Leu Leu His Trp Glu Phe Leu 1 5 10 15 Tyr Val Ile Ala
Ala Leu Asn Leu Ala Tyr Pro Ile Ser Pro Trp Lys 20 25 30 Phe Lys
Leu Phe Cys Gly Pro Pro Asn Thr Thr Asp Asp Ser Phe Leu 35 40 45
Ser Pro Ala Gly Ala Pro Asn Asn Ala Ser Ala Leu Lys Gly Ala Ser 50
55 60 Glu Ala Ile Val Glu Ala Lys Phe Asn Ser Ser Gly Ile Tyr Val
Pro 65 70 75 80 Glu Leu Ser Lys Thr Val Phe His Cys Cys Phe Gly Asn
Glu Gln Gly 85 90 95 Gln Asn Cys Ser Ala Leu Thr Asp Asn Thr Glu
Gly Lys Thr Leu Ala 100 105 110 Ser Val Val Lys Ala Ser Val Phe Arg
Gln Leu Gly Val Asn Trp Asp 115 120 125 Ile Glu Cys Trp Met Lys Gly
Asp Leu Thr Leu Phe Ile Cys His Met 130 135 140 Glu Pro Leu Pro Lys
Asn Pro Phe Lys Asn Tyr Asp Ser Lys Val His 145 150 155 160 Leu Leu
Tyr Asp Leu Pro Glu Val Ile Asp Asp Ser Pro Leu Pro Pro 165 170 175
Leu Lys Asp Ser Phe Gln Thr Val Gln Cys Asn Cys Ser Leu Arg Gly 180
185 190 Cys Glu Cys His Val Pro Val Pro Arg Ala Lys Leu Asn Tyr Ala
Leu 195 200
205 Leu Met Tyr Leu Glu Ile Thr Ser Ala Gly Val Ser Phe Gln Ser Pro
210 215 220 Leu Met Ser Leu Gln Pro Met Leu Val Val Lys Pro Asp Pro
Pro Leu 225 230 235 240 Gly Leu His Met Glu Val Thr Asp Asp Gly Asn
Leu Lys Ile Ser Trp 245 250 255 Asp Ser Gln Thr Met Ala Pro Phe Pro
Leu Gln Tyr Gln Val Lys Tyr 260 265 270 Leu Glu Asn Ser Thr Ile Val
Arg Glu Ala Ala Glu Ile Val Ser Ala 275 280 285 Thr Ser Leu Leu Val
Asp Ser Val Leu Pro Gly Ser Ser Tyr Glu Val 290 295 300 Gln Val Arg
Ser Lys Arg Leu Asp Gly Ser Gly Val Trp Ser Asp Trp 305 310 315 320
Ser Ser Pro Gln Val Phe Thr Thr Gln Asp Val Val Tyr Phe Pro Pro 325
330 335 Lys Ile Leu Thr Ser Val Gly Ser Asn Ala Ser Phe His Cys Ile
Tyr 340 345 350 Lys Asn Glu Asn Gln Ile Val Ser Ser Lys Gln Ile Val
Trp Trp Arg 355 360 365 Asn Leu Ala Glu Lys Ile Pro Glu Ile Gln Tyr
Ser Ile Val Ser Asp 370 375 380 Arg Val Ser Lys Val Thr Phe Ser Asn
Leu Lys Ala Thr Arg Pro Arg 385 390 395 400 Gly Lys Phe Thr Tyr Asp
Ala Val Tyr Cys Cys Asn Glu Gln Ala Cys 405 410 415 His His Arg Tyr
Ala Glu Leu Tyr Val Ile Asp Val Asn Ile Asn Ile 420 425 430 Ser Cys
Glu Thr Asp Gly Tyr Leu Thr Lys Met Thr Cys Arg Trp Ser 435 440 445
Pro Ser Thr Ile Gln Ser Leu Val Gly Ser Thr Val Gln Leu Arg Tyr 450
455 460 His Arg Cys Ser Leu Tyr Cys Pro Asp Ser Pro Ser Ile His Pro
Thr 465 470 475 480 Ser Glu Pro Lys Thr Ala Ser Tyr Arg Glu Thr Ala
Phe Met Asn Val 485 490 495 Phe Ser Ser Gln Ser Phe Tyr Tyr Leu Ala
Ile Gln Cys Gly Phe Arg 500 505 510 Ile Asn His Ser Leu Gly Ser Leu
Asp Ser Pro Pro Thr Cys Val Leu 515 520 525 Pro Asp Ser Val Val Lys
Pro Leu Pro Pro Ser Asn Val Lys Ala Glu 530 535 540 Ile Thr Val Asn
Thr Gly Leu Leu Lys Val Ser Trp Glu Lys Pro Val 545 550 555 560 Phe
Pro Glu Asn Asn Leu Gln Phe Gln Ile Arg Tyr Gly Leu Ser Gly 565 570
575 Lys Glu Ile Gln Trp Lys Thr His Glu Val Phe Asp Ala Lys Ser Lys
580 585 590 Ser Ala Ser Leu Leu Val Ser Asp Leu Cys Ala Val Tyr Val
Val Gln 595 600 605 Val Arg Cys Arg Arg Leu Asp Gly Leu Gly Tyr Trp
Ser Asn Trp Ser 610 615 620 Ser Pro Ala Tyr Thr Leu Val Met Asp Val
Lys Val Pro Met Arg Gly 625 630 635 640 Pro Glu Phe Trp Arg Lys Met
Asp Gly Asp Val Thr Lys Lys Glu Arg 645 650 655 Asn Val Thr Leu Leu
Trp Lys Pro Leu Thr Lys Asn Asp Ser Leu Cys 660 665 670 Ser Val Arg
Arg Tyr Val Val Lys His Arg Thr Ala His Asn Gly Thr 675 680 685 Trp
Ser Glu Asp Val Gly Asn Arg Thr Asn Leu Thr Phe Leu Trp Thr 690 695
700 Glu Pro Ala His Thr Val Thr Val Leu Ala Val Asn Ser Leu Gly Ala
705 710 715 720 Ser Leu Val Asn Phe Asn Leu Thr Phe Ser Trp Pro Met
Ser Lys Val 725 730 735 Ser Ala Val Glu Ser Leu Ser Ala Tyr Pro Leu
Ser Ser Ser Cys Val 740 745 750 Ile Leu Ser Trp Thr Leu Ser Pro Asp
Asp Tyr Ser Leu Leu Tyr Leu 755 760 765 Val Ile Glu Trp Lys Ile Leu
Asn Glu Asp Asp Gly Met Lys Trp 770 775 780 8 2868 DNA Mus musculus
8 gggccccccc tcgaagtcga cggtatcgat aagcttgata tcgaattccg gccgggacac
60 aggtgggaca ctcttttagt cctcaatccc tggcgcgagg ccacccaagg
caacgcagga 120 cgcagggcgt ttggggacca ggcagcagac tggggcggta
cctgcggaga gccacgcaac 180 ttctccaggc ctctgactac tttggaaact
gcccggggct gcgacatcaa ccccttaagt 240 cccggaggcg gaaagagggt
gggttggttt gaaagacaca aggaagaaaa atgtgctgtg 300 gggcgggtta
agtttcccac cctcttcccc cttcccgagc aaattagaaa caaaacaaat 360
agaaaagcca gccctccggc caaccaaagc cccaagcgga gccccaagcg gagccccagc
420 cggagcactc ctttaaaagg atttgcagcg gtgaggaaaa aaccagaccc
gaccgaggaa 480 tcgttctgca aatccaggtg tacacctctg aagaaagatg
atgtgtcaga aattctatgt 540 ggttttgtta cactgggaat ttctttatgt
gatagctgca cttaacctgg catatccaat 600 ctctccctgg aaatttaagt
tgttttgtgg accaccgaac acaaccgatg actcctttct 660 ctcacctgct
ggagccccaa acaatgcctc ggctttgaag ggggcttctg aagcaattgt 720
tgaagctaaa tttaattcaa gtggtatcta cgttcctgag ttatccaaaa cagtcttcca
780 ctgttgcttt gggaatgagc aaggtcaaaa ctgctctgca ctcacagaca
acactgaagg 840 gaagacactg gcttcagtag tgaaggcttc agtttttcgc
cagctaggtg taaactggga 900 catagagtgc tggatgaaag gggacttgac
attattcatc tgtcatatgg agccattacc 960 taagaacccc ttcaagaatt
atgactctaa ggtccatctt ttatatgatc tgcctgaagt 1020 catagatgat
tcgcctctgc ccccactgaa agacagcttt cagactgtcc aatgcaactg 1080
cagtcttcgg ggatgtgaat gtcatgtgcc agtacccaga gccaaactca actacgctct
1140 tctgatgtat ttggaaatca catctgccgg tgtgagtttt cagtcacctc
tgatgtcact 1200 gcagcccatg cttgttgtga aacccgatcc acccttaggt
ttgcatatgg aagtcacaga 1260 tgatggtaat ttaaagattt cttgggacag
ccaaacaatg gcaccatttc cgcttcaata 1320 tcaggtgaaa tatttagaga
attctacaat tgtaagagag gctgctgaaa ttgtctcagc 1380 tacatctctg
ctggtagaca gtgtgcttcc tggatcttca tatgaggtcc aggtgaggag 1440
caagagactg gatggttcag gagtctggag tgactggagt tcacctcaag tctttaccac
1500 acaagatgtt gtgtattttc cacccaaaat tctgactagt gttggatcga
atgcttcctt 1560 tcattgcatc tacaaaaacg aaaaccagat tgtctcctca
aaacagatag tttggtggag 1620 gaatctagct gagaaaatcc ctgagataca
gtacagcatt gtgagtgacc gagttagcaa 1680 agttaccttc tccaacctga
aagccaccag acctcgaggg aagtttacct atgacgcagt 1740 gtactgctgc
aatgagcagg cgtgccatca ccgctatgct gaattatacg tgatcgatgt 1800
caatatcaat atatcatgtg aaactgacgg gtacttaact aaaatgactt gcagatggtc
1860 acccagcaca atccaatcac tagtgggaag cactgtgcag ctgaggtatc
acaggtgcag 1920 cctgtattgt cctgatagtc catctattca tcctacgtct
gagcccaaaa ctgcgtctta 1980 cagagagacg gcttttatga atgtgttttc
cagccaatct ttctattatc tggctataca 2040 atgtggattc aggatcaacc
attctttagg ttcacttgac tcgccaccaa cgtgtgtcct 2100 tcctgactcc
gtagtaaaac cactacctcc atctaacgta aaagcagaga ttactgtaaa 2160
cactggatta ttgaaagtat cttgggaaaa gccagtcttt ccggagaata accttcaatt
2220 ccagattcga tatggcttaa gtggaaaaga aatacaatgg aagacacatg
aggtattcga 2280 tgcaaagtca aagtctgcca gcctgctggt gtcagacctc
tgtgcagtct atgtggtcca 2340 ggttcgctgc cggcggttgg atggactagg
atattggagt aattggagca gtccagccta 2400 tacgcttgtc atggatgtaa
aagttcctat gagagggcct gaattttgga gaaaaatgga 2460 tggggacgtt
actaaaaagg agagaaatgt caccttgctt tggaagcccc tgacgaaaaa 2520
tgactcactg tgtagtgtga ggaggtacgt ggtgaagcat cgtactgccc acaatgggac
2580 gtggtcagaa gatgtgggaa atcggaccaa tctcactttc ctgtggacag
aaccagcgca 2640 cactgttaca gttctggctg tcaattccct cggcgcttcc
cttgtgaatt ttaaccttac 2700 cttctcatgg cccatgagta aagtgagtgc
tgtggagtca ctcagtgctt atcccctgag 2760 cagcagctgt gtcatccttt
cctggacact gtcacctgat gattatagtc tgttatatct 2820 ggttattgaa
tggaagatcc ttaatgaaga tgatggaatg aagtggct 2868 9 18 DNA Artificial
Sequence Synthetic oligonucleotide sequence 9 gggttaagtt tcccaccc
18 10 18 DNA Artificial Sequence Synthetic oligonucleotide sequence
10 gggtgggaaa cttaaccc 18 11 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 11 aggatacagt gggatccc 18 12 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 12
gcccgagcac tcctttaa 18 13 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 13 ttaaaggagt gctcccgc 18 14 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 14
gagcggccct gttagata 18 15 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 15 gtatacacct ctgaagaa 18 16 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 16
ttcttcagag gtgtacac 18 17 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 17 atgcgaggct acttctat 18 18 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 18
ctctccctgg aaatttaa 18 19 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 19 ttaaatttcc agggagag 18 20 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 20
atttgaagga gttaagcc 18 21 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 21 aatttaattc aagtggta 18 22 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 22
taccagttga attaaatt 18 23 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 23 gtatcacttc ataatata 18 24 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 24
gatggtcagg gtgaactg 18 25 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 25 cagttcaccc tgaccatc 18 26 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 26
gaggcgaatg tgcggatt 18 27 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 27 cttaaatctc caaggagt 18 28 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 28
actccttgga gatttaag 18 29 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 29 aagtcttaag ccagactt 18 30 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 30
tctaaggcac atcccagc 18 31 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 31 gctgggatgt gccttaga 18 32 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 32
cgcaatgaat tgaccccc 18 33 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 33 tacttcagag aagtacac 18 34 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 34
gtgtacttct ctgaagta 18 35 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 35 gaatcacggt aactatca 18 36 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 36
cagctgtctc ataatgtc 18 37 18 DNA Artificial Sequence Synthetic
oligonucleotide sequence 37 gacattatga gacagctg 18 38 18 DNA
Artificial Sequence Synthetic oligonucleotide sequence 38
ttcgtcaagc catctgat 18 39 8 PRT Artificial Sequence Exemplary
salvage receptor binding epitope sequence 39 His Gln Asn Leu Ser
Asp Gly Lys 1 5 40 8 PRT Artificial Sequence Exemplary salvage
receptor binding epitope sequence 40 His Gln Asn Ile Ser Asp Gly
Lys 1 5 41 7 PRT Artificial Sequence Exemplary salvage receptor
binding epitope sequence 41 His Gln Ser Leu Gly Thr Gln 1 5 42 8
PRT Artificial Sequence Exemplary salvage receptor binding epitope
sequence 42 Val Ile Ser Ser His Leu Gly Gln 1 5 43 11 PRT
Artificial Sequence Exemplary salvage receptor binding epitope
sequence 43 Pro Lys Asn Ser Ser Met Ile Ser Asn Thr Pro 1 5 10 44
10 PRT Homo sapiens 44 Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5
10 45 51 DNA Artificial Sequence Synthetic oligonucleotide probe
sequence 45 gtcagtctcc cagttccaga cttgtgtgca gtctatgctg ttcaggtgcg
c 51 46 7127 DNA Homo sapiens 46 ttcgagctcg cccgacattg attattgact
agttattaat agtaatcaat tacggggtca 60 ttagttcata gcccatatat
ggagttccgc gttacataac ttacggtaaa tggcccgcct 120 ggctgaccgc
ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta 180
acgccaatag ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac
240 ttggcagtac atcaagtgta tcatatgcca agtacgcccc ctattgacgt
caatgacggt 300 aaatggcccg cctggcatta tgcccagtac atgaccttat
gggactttcc tacttggcag 360 tacatctacg tattagtcat cgctattacc
atggtgatgc ggttttggca gtacatcaat 420 gggcgtggat agcggtttga
ctcacgggga tttccaagtc tccaccccat tgacgtcaat 480 gggagtttgt
tttggcacca aaatcaacgg gactttccaa aatgtcgtaa caactccgcc 540
ccattgacgc aaatgggcgg taggcgtgta cggtgggagg tctatataag cagagctcgt
600 ttagtgaacc gtcagatcgc ctggagacgc catccacgct gttttgacct
ccatagaaga 660 caccgggacc gatccagcct ccgcggccgg gaacggtgca
ttggaacgcg gattccccgt 720 gccaagagtg acgtaagtac cgcctataga
gtctataggc ccaccccctt ggcttcgtta 780 gaacgcggct acaattaata
cataacctta tgtatcatac acatacgatt taggtgacac 840 tatagaataa
catccacttt gcctttctct ccacaggtgt ccactcccag gtccaactgc 900
acctcggttc tatcgatatg cattggggaa ccctgtgcgg attcttgtgg ctttggccct
960 atcttttcta tgtccaagct gtgcccatcc aaaaagtcca agatgacacc
aaaaccctca 1020 tcaagacaat tgtcaccagg atcaatgaca tttcacacac
gcagtcagtc tcctccaaac 1080 agaaagtcac cggtttggac ttcattcctg
ggctccaccc catcctgacc ttatccaaga 1140 tggaccagac actggcagtc
taccaacaga tcctcaccag tatgccttcc agaaacgtga 1200 tccaaatatc
caacgacctg gagaacctcc gggatcttct tcacgtgctg gccttctcta 1260
agagctgcca cttgccctgg gccagtggcc tggagacctt ggacagcctg gggggtgtcc
1320 tggaagcttc aggctactcc acagaggtgg tggccctgag caggctgcag
gggtctctgc 1380 aggacatgct gtggcagctg gacctcagcc ctgggtgcgg
ggtcaccgac aaaactcaca 1440 catgcccacc gtgcccagca cctgaactcc
tggggggacc gtcagtcttc ctcttccccc 1500 caaaacccaa ggacaccctc
atgatctccc ggacccctga ggtcacatgc gtggtggtgg 1560 acgtgagcca
cgaagaccct gaggtcaagt tcaactggta cgtggacggc gtggaggtgc 1620
ataatgccaa gacaaagccg cgggaggagc agtacaacag cacgtaccgt gtggtcagcg
1680 tcctcaccgt cctgcaccag gactggctga atggcaagga gtacaagtgc
aaggtctcca 1740 acaaagccct cccagccccc atcgagaaaa ccatctccaa
agccaaaggg cagccccgag 1800 aaccacaggt gtacaccctg cccccatccc
gggaagagat gaccaagaac caggtcagcc 1860 tgacctgcct ggtcaaaggc
ttctatccca gcgacatcgc cgtggagtgg gagagcaatg 1920 ggcagccgga
gaacaactac aagaccacgc ctcccgtgct ggactccgac ggctccttct 1980
tcctctacag caagctcacc gtggacaaga gcaggtggca gcaggggaac gtcttctcat
2040 gctccgtgat gcatgaggct ctgcacaacc actacacgca gaagagcctc
tccctgtctc 2100 cgggtaaatg agtgcgacgg ccctagagtc gacctgcaga
agcttctaga gtcgacctgc 2160 agaagcttgg ccgccatggc ccaacttgtt
tattgcagct tataatggtt acaaataaag 2220 caatagcatc acaaatttca
caaataaagc atttttttca ctgcattcta gttgtggttt 2280 gtccaaactc
atcaatgtat cttatcatgt ctggatcgat cgggaattaa ttcggcgcag 2340
caccatggcc tgaaataacc tctgaaagag gaacttggtt aggtaccttc tgaggcggaa
2400 agaaccagct gtggaatgtg tgtcagttag ggtgtggaaa gtccccaggc
tccccagcag 2460 gcagaagtat gcaaagcatg catctcaatt agtcagcaac
caggtgtgga aagtccccag 2520 gctccccagc aggcagaagt atgcaaagca
tgcatctcaa ttagtcagca accatagtcc 2580 cgcccctaac tccgcccatc
ccgcccctaa ctccgcccag ttccgcccat tctccgcccc 2640 atggctgact
aatttttttt atttatgcag aggccgaggc cgcctcggcc tctgagctat 2700
tccagaagta gtgaggaggc ttttttggag gcctaggctt ttgcaaaaag ctgttaattc
2760 gaacacgcag atgcagtcgg ggcggcgcgg tcccaggtcc acttcgcata
ttaaggtgac 2820 gcgtgtggcc tcgaacaccg agcgaccctg cagcgacccg
cttaacagcg tcaacagcgt 2880 gccgcagatc tgatcaagag acaggatgag
gatcgtttcg catgattgaa caagatggat 2940 tgcacgcagg ttctccggcc
gcttgggtgg agaggctatt cggctatgac tgggcacaac 3000 agacaatcgg
ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc 3060
tttttgtcaa gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc
3120 tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt
gtcactgaag 3180 cgggaaggga ctggctgcta ttgggcgaag tgccggggca
ggatctcctg tcatctcacc 3240 ttgctcctgc cgagaaagta tccatcatgg
ctgatgcaat gcggcggctg catacgcttg 3300 atccggctac ctgcccattc
gaccaccaag cgaaacatcg catcgagcga gcacgtactc 3360 ggatggaagc
cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc 3420
cagccgaact gttcgccagg ctcaaggcgc gcatgcccga cggcgaggat ctcgtcgtga
3480 cccatggcga tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt
tctggattca 3540 tcgactgtgg ccggctgggt gtggcggacc gctatcagga
catagcgttg gctacccgtg 3600 atattgctga agagcttggc ggcgaatggg
ctgaccgctt cctcgtgctt tacggtatcg 3660 ccgctcccga ttcgcagcgc
atcgccttct atcgccttct tgacgagttc ttctgagcgg 3720 gactctgggg
ttcgaaatga ccgaccaagc gacgcccaac ctgccatcac gagatttcga 3780
ttccaccgcc gccttctatg aaaggttggg cttcggaatc gttttccggg acgccggctg
3840 gatgatcctc cagcgcgggg atctcatgct ggagttcttc gcccaccccg
ggagatgggg 3900 gaggctaact gaaacacgga aggagacaat accggaagga
acccgcgcta tgacggcaat 3960 aaaaagacag aataaaacgc acgggtgttg
ggtcgtttgt tcataaacgc ggggttcggt 4020 cccagggctg gcactctgtc
gataccccac cgagacccca ttggggccaa tacgcccgcg 4080 tttcttcctt
ttccccaccc caacccccaa gttcgggtga aggcccaggg ctcgcagcca 4140
acgtcggggc ggcaagcccg ccatagccac gggccccgtg
ggttagggac ggggtccccc 4200 atggggaatg gtttatggtt cgtgggggtt
attcttttgg gcgttgcgtg gggtcaggtc 4260 cacgactgga ctgagcagac
agacccatgg tttttggatg gcctgggcat ggaccgcatg 4320 tactggcgcg
acacgaacac cgggcgtctg tggctgccaa acacccccga cccccaaaaa 4380
ccaccgcgcg gatttctggc gccgccggac gaactaaacc tgactacggc atctctgccc
4440 cttcttcgct ggtacgagga gcgcttttgt tttgtattgg tcaccacggc
cgagtttccg 4500 cgggaccccg gccagggcac ctgtcctacg agttgcatga
taaagaagac agtcataagt 4560 gcggcgacga tagtcatgcc ccgcgcccac
cggaaggagc tgactgggtt gaaggctctc 4620 aagggcatcg gtcgagcggc
cgcatcaaag caaccatagt acgcgccctg tagcggcgca 4680 ttaagcgcgg
cgggtgtggt ggttacgcgc agcgtgaccg ctacacttgc cagcgcccta 4740
gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca cgttcgccgg ctttccccgt
4800 caagctctaa atcgggggct ccctttaggg ttccgattta gtgctttacg
gcacctcgac 4860 cccaaaaaac ttgatttggg tgatggttca cgtagtgggc
catcgccctg atagacggtt 4920 tttcgccctt tgacgttgga gtccacgttc
tttaatagtg gactcttgtt ccaaactgga 4980 acaacactca accctatctc
gggctattct tttgatttat aagggatttt gccgatttcg 5040 gcctattggt
taaaaaatga gctgatttaa caaaaattta acgcgaattt taacaaaata 5100
ttaacgttta caattttatg gtgcaggcct cgtgatacgc ctatttttat aggttaatgt
5160 catgataata atggtttctt agacgtcagg tggcactttt cggggaaatg
tgcgcggaac 5220 ccctatttgt ttatttttct aaatacattc aaatatgtat
ccgctcatga gacaataacc 5280 ctgataaatg cttcaataat attgaaaaag
gaagagtatg agtattcaac atttccgtgt 5340 cgcccttatt cccttttttg
cggcattttg ccttcctgtt tttgctcacc cagaaacgct 5400 ggtgaaagta
aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga 5460
tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag
5520 cacttttaaa gttctgctat gtggcgcggt attatcccgt gatgacgccg
ggcaagagca 5580 actcggtcgc cgcatacact attctcagaa tgacttggtt
gagtactcac cagtcacaga 5640 aaagcatctt acggatggca tgacagtaag
agaattatgc agtgctgcca taaccatgag 5700 tgataacact gcggccaact
tacttctgac aacgatcgga ggaccgaagg agctaaccgc 5760 ttttttgcac
aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa 5820
tgaagccata ccaaacgacg agcgtgacac cacgatgcca gcagcaatgg caacaacgtt
5880 gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat
taatagactg 5940 gatggaggcg gataaagttg caggaccact tctgcgctcg
gcccttccgg ctggctggtt 6000 tattgctgat aaatctggag ccggtgagcg
tgggtctcgc ggtatcattg cagcactggg 6060 gccagatggt aagccctccc
gtatcgtagt tatctacacg acggggagtc aggcaactat 6120 ggatgaacga
aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact 6180
gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt tttaatttaa
6240 aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt
aacgtgagtt 6300 ttcgttccac tgagcgtcag accccgtaga aaagatcaaa
ggatcttctt gagatccttt 6360 ttttctgcgc gtaatctgct gcttgcaaac
aaaaaaacca ccgctaccag cggtggtttg 6420 tttgccggat caagagctac
caactctttt tccgaaggta actggcttca gcagagcgca 6480 gataccaaat
actgtccttc tagtgtagcc gtagttaggc caccacttca agaactctgt 6540
agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga
6600 taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg
cgcagcggtc 6660 gggctgaacg gggggttcgt gcacacagcc cagcttggag
cgaacgacct acaccgaact 6720 gagataccta cagcgtgagc attgagaaag
cgccacgctt cccgaaggga gaaaggcgga 6780 caggtatccg gtaagcggca
gggtcggaac aggagagcgc acgagggagc ttccaggggg 6840 aaacgcctgg
tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt 6900
tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagctggc acgacaggtt
6960 tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttacc
tcactcatta 7020 ggcaccccag gctttacact ttatgcttcc ggctcgtatg
ttgtgtggaa ttgtgagcgg 7080 ataacaattt cacacaggaa acagctatga
ccatgattac gaattaa 7127 47 397 PRT Homo sapiens 47 Met His Trp Gly
Thr Leu Cys Gly Phe Leu Trp Leu Trp Pro Tyr Leu 1 5 10 15 Phe Tyr
Val Gln Ala Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys 20 25 30
Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr 35
40 45 Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile
Pro 50 55 60 Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln
Thr Leu Ala 65 70 75 80 Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser
Arg Asn Val Ile Gln 85 90 95 Ile Ser Asn Asp Leu Glu Asn Leu Arg
Asp Leu Leu His Val Leu Ala 100 105 110 Phe Ser Lys Ser Cys His Leu
Pro Trp Ala Ser Gly Leu Glu Thr Leu 115 120 125 Asp Ser Leu Gly Gly
Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val 130 135 140 Val Ala Leu
Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln 145 150 155 160
Leu Asp Leu Ser Pro Gly Cys Gly Val Thr Asp Lys Thr His Thr Cys 165
170 175 Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe
Leu 180 185 190 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg
Thr Pro Glu 195 200 205 Val Thr Cys Val Val Val Asp Val Ser His Glu
Asp Pro Glu Val Lys 210 215 220 Phe Asn Trp Tyr Val Asp Gly Val Glu
Val His Asn Ala Lys Thr Lys 225 230 235 240 Pro Arg Glu Glu Gln Tyr
Asn Ser Thr Tyr Arg Val Val Ser Val Leu 245 250 255 Thr Val Leu His
Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 260 265 270 Val Ser
Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys 275 280 285
Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 290
295 300 Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val
Lys 305 310 315 320 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu
Ser Asn Gly Gln 325 330 335 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro
Val Leu Asp Ser Asp Gly 340 345 350 Ser Phe Phe Leu Tyr Ser Lys Leu
Thr Val Asp Lys Ser Arg Trp Gln 355 360 365 Gln Gly Asn Val Phe Ser
Cys Ser Val Met His Glu Ala Leu His Asn 370 375 380 His Tyr Thr Gln
Lys Ser Leu Ser Leu Ser Pro Gly Lys 385 390 395 48 249 PRT Homo
sapiens 48 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro
Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr
Phe Thr Gly Tyr 20 25 30 Tyr Met Tyr Trp Val Arg Gln Ala Pro Gly
Gln Gly Leu Glu Trp Met 35 40 45 Gly Trp Ile Asn Pro Asn Ser Gly
Gly Thr Asn Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Met
Thr Arg Asp Thr Ser Ile Gly Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser
Arg Leu Ser Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg
Asp Arg Tyr Tyr Gly Ser Ser Ala Tyr His Arg Gly Ser Tyr 100 105 110
Tyr Met Asp Val Trp Gly Arg Gly Thr Leu Val Thr Val Ser Ser Gly 115
120 125 Gly Gly Gly Thr Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser
Glu 130 135 140 Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln
Thr Val Arg 145 150 155 160 Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser
Tyr Tyr Ala Ser Trp Tyr 165 170 175 Gln Gln Lys Pro Gly Gln Ala Pro
Val Leu Val Ile Tyr Gly Lys Asn 180 185 190 Asn Arg Pro Ser Gly Ile
Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly 195 200 205 Asn Thr Ala Ser
Leu Thr Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala 210 215 220 Asp Tyr
Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn His Val Val Phe 225 230 235
240 Gly Gly Gly Thr Lys Leu Thr Val Leu 245 49 250 PRT Homo sapiens
49 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu
1 5 10 15 Ser Leu Lys Ile Ser Cys Gln Gly Ser Gly Phe Thr Phe Ser
Ser Tyr 20 25 30 Lys Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Met 35 40 45 Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala
Asn Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala
Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu
Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Asp Arg
Val Val Val Pro Ala Thr Ser Leu Arg Gly Gly Met 100 105 110 Asp Val
Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly 115 120 125
Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Val Leu 130
135 140 Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr
Ile 145 150 155 160 Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr
Asn Tyr Val Ser 165 170 175 Trp Tyr Gln Gln His Pro Gly Lys Ala Pro
Lys Leu Met Ile Tyr Glu 180 185 190 Gly Ser Lys Arg Pro Ser Gly Val
Ser Asn Arg Phe Ser Gly Ser Lys 195 200 205 Ser Gly Ser Thr Ala Ser
Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp 210 215 220 Glu Ala Asp Tyr
Tyr Cys Ser Ser Tyr Thr Thr Arg Ser Thr Arg Val 225 230 235 240 Phe
Gly Gly Gly Thr Lys Leu Thr Val Leu 245 250 50 241 PRT Homo sapiens
50 Gln Val Arg Leu Gln Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg
1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp
Asp Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly
Leu Glu Trp Val 35 40 45 Ser Gly Met Thr Trp Asn Ser Gly Ser Ile
Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg
Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu
Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Pro
His Asn Thr Asp Ala Phe Asp Ile Trp Gly Arg Gly 100 105 110 Thr Leu
Val Thr Val Ser Ser Gly Gly Gly Gly Pro Gly Gly Gly Gly 115 120 125
Ser Gly Gly Gly Gly Ser Asp Val Val Met Thr Gln Ser Pro Ser Phe 130
135 140 Leu Ser Ala Phe Val Gly Asp Thr Ile Thr Ile Thr Cys Arg Ala
Ser 145 150 155 160 Gln Gly Ile Tyr Asn Tyr Leu Ala Trp Tyr Gln Gln
Lys Pro Gly Lys 165 170 175 Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser
Thr Leu Gln Ser Gly Val 180 185 190 Pro Ser Arg Phe Ser Gly Ser Gly
Ser Gly Thr Glu Phe Thr Leu Thr 195 200 205 Ile Ser Ser Leu Gln Pro
Glu Asp Phe Gly Thr Tyr Tyr Cys Gln Gln 210 215 220 Leu Ile Ser Tyr
Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile 225 230 235 240 Lys
51 894 PRT Mus musculus 51 Met Met Cys Gln Lys Phe Tyr Val Val Leu
Leu His Trp Glu Phe Leu 1 5 10 15 Tyr Val Ile Ala Ala Leu Asn Leu
Ala Tyr Pro Ile Ser Pro Trp Lys 20 25 30 Phe Lys Leu Phe Cys Gly
Pro Pro Asn Thr Thr Asp Asp Ser Phe Leu 35 40 45 Ser Pro Ala Gly
Ala Pro Asn Asn Ala Ser Ala Leu Lys Gly Ala Ser 50 55 60 Glu Ala
Ile Val Glu Ala Lys Phe Asn Ser Ser Gly Ile Tyr Val Pro 65 70 75 80
Glu Leu Ser Lys Thr Val Phe His Cys Cys Phe Gly Asn Glu Gln Gly 85
90 95 Gln Asn Cys Ser Ala Leu Thr Asp Asn Thr Glu Gly Lys Thr Leu
Ala 100 105 110 Ser Val Val Lys Ala Ser Val Phe Arg Gln Leu Gly Val
Asn Trp Asp 115 120 125 Ile Glu Cys Trp Met Lys Gly Asp Leu Thr Leu
Phe Ile Cys His Met 130 135 140 Glu Pro Leu Pro Lys Asn Pro Phe Lys
Asn Tyr Asp Ser Lys Val His 145 150 155 160 Leu Leu Tyr Asp Leu Pro
Glu Val Ile Asp Asp Ser Pro Leu Pro Pro 165 170 175 Leu Lys Asp Ser
Phe Gln Thr Val Gln Cys Asn Cys Ser Leu Arg Gly 180 185 190 Cys Glu
Cys His Val Pro Val Pro Arg Ala Lys Leu Asn Tyr Ala Leu 195 200 205
Leu Met Tyr Leu Glu Ile Thr Ser Ala Gly Val Ser Phe Gln Ser Pro 210
215 220 Leu Met Ser Leu Gln Pro Met Leu Val Val Lys Pro Asp Pro Pro
Leu 225 230 235 240 Gly Leu His Met Glu Val Thr Asp Asp Gly Asn Leu
Lys Ile Ser Trp 245 250 255 Asp Ser Gln Thr Met Ala Pro Phe Pro Leu
Gln Tyr Gln Val Lys Tyr 260 265 270 Leu Glu Asn Ser Thr Ile Val Arg
Glu Ala Ala Glu Ile Val Ser Ala 275 280 285 Thr Ser Leu Leu Val Asp
Ser Val Leu Pro Gly Ser Ser Tyr Glu Val 290 295 300 Gln Val Arg Ser
Lys Arg Leu Asp Gly Ser Gly Val Trp Ser Asp Trp 305 310 315 320 Ser
Ser Pro Gln Val Phe Thr Thr Gln Asp Val Val Tyr Phe Pro Pro 325 330
335 Lys Ile Leu Thr Ser Val Gly Ser Asn Ala Ser Phe His Cys Ile Tyr
340 345 350 Lys Asn Glu Asn Gln Ile Ile Ser Ser Lys Gln Ile Val Trp
Trp Arg 355 360 365 Asn Leu Ala Glu Lys Ile Pro Glu Ile Gln Tyr Ser
Ile Val Ser Asp 370 375 380 Arg Val Ser Lys Val Thr Phe Ser Asn Leu
Lys Ala Thr Arg Pro Arg 385 390 395 400 Gly Lys Phe Thr Tyr Asp Ala
Val Tyr Cys Cys Asn Glu Gln Ala Cys 405 410 415 His His Arg Tyr Ala
Glu Leu Tyr Val Ile Asp Val Asn Ile Asn Ile 420 425 430 Ser Cys Glu
Thr Asp Gly Tyr Leu Thr Lys Met Thr Cys Arg Trp Ser 435 440 445 Pro
Ser Thr Ile Gln Ser Leu Val Gly Ser Thr Val Gln Leu Arg Tyr 450 455
460 His Arg Arg Ser Leu Tyr Cys Pro Asp Ser Pro Ser Ile His Pro Thr
465 470 475 480 Ser Glu Pro Lys Asn Cys Val Leu Gln Arg Asp Gly Phe
Tyr Glu Cys 485 490 495 Val Phe Gln Pro Ile Phe Leu Leu Ser Gly Tyr
Thr Met Trp Ile Arg 500 505 510 Ile Asn His Ser Leu Gly Ser Leu Asp
Ser Pro Pro Thr Cys Val Leu 515 520 525 Pro Asp Ser Val Val Lys Pro
Leu Pro Pro Ser Asn Val Lys Ala Glu 530 535 540 Ile Thr Val Asn Thr
Gly Leu Leu Lys Val Ser Trp Glu Lys Pro Val 545 550 555 560 Phe Pro
Glu Asn Asn Leu Gln Phe Gln Ile Arg Tyr Gly Leu Ser Gly 565 570 575
Lys Glu Ile Gln Trp Lys Thr His Glu Val Phe Asp Ala Lys Ser Lys 580
585 590 Ser Ala Ser Leu Leu Val Ser Asp Leu Cys Ala Val Tyr Val Val
Gln 595 600 605 Val Arg Cys Arg Arg Leu Asp Gly Leu Gly Tyr Trp Ser
Asn Trp Ser 610 615 620 Ser Pro Ala Tyr Thr Leu Val Met Asp Val Lys
Val Pro Met Arg Gly 625 630 635 640 Pro Glu Phe Trp Arg Lys Met Asp
Gly Asp Val Thr Lys Lys Glu Arg 645 650 655 Asn Val Thr Leu Leu Trp
Lys Pro Leu Thr Lys Asn Asp Ser Leu Cys 660 665 670 Ser Val Arg Arg
Tyr Val Val Lys His Arg Thr Ala His Asn Gly Thr 675 680 685 Trp Ser
Glu Asp Val Gly Asn Arg Thr Asn Leu Thr Phe Leu Trp Thr 690 695 700
Glu Pro Ala His Thr Val Thr Val Leu Ala Val Asn Ser Leu Gly Ala 705
710 715 720 Ser Leu Val Asn Phe Asn Leu Thr Phe Ser Trp Pro Met Ser
Lys Val 725 730 735 Ser Ala Val Glu Ser Leu Ser Ala Tyr Pro Leu Ser
Ser Ser Cys Val 740 745 750 Ile Leu Ser Trp Thr Leu Ser Pro Asp Asp
Tyr Ser Leu Leu Tyr Leu 755 760 765 Val Ile Glu Trp Lys Ile Leu Asn
Glu Asp Asp Gly Met Lys Trp Leu 770 775 780 Arg Ile Pro Ser Asn Val
Lys Lys Phe Tyr Ile His Asp Asn Phe Ile 785 790 795 800 Pro Ile Glu
Lys Tyr Gln Phe Ser Leu Tyr Pro Val Phe Met Glu Gly 805 810 815
Val
Gly Lys Pro Lys Ile Ile Asn Gly Phe Thr Lys Asp Ala Ile Asp 820 825
830 Lys Gln Gln Asn Asp Ala Gly Leu Tyr Val Ile Val Pro Ile Ile Ile
835 840 845 Ser Ser Cys Val Leu Leu Leu Gly Thr Leu Leu Ile Ser His
Gln Arg 850 855 860 Met Lys Lys Leu Phe Trp Asp Asp Val Pro Asn Pro
Lys Asn Cys Ser 865 870 875 880 Trp Ala Gln Gly Leu Asn Phe Gln Lys
Arg Thr Asp Thr Leu 885 890
* * * * *