U.S. patent application number 10/920820 was filed with the patent office on 2005-01-13 for methods and compositions for diagnosing and treating disorders involving angiogenesis.
Invention is credited to Sheppard, Michael G., Tong, Xiao.
Application Number | 20050009144 10/920820 |
Document ID | / |
Family ID | 22855000 |
Filed Date | 2005-01-13 |
United States Patent
Application |
20050009144 |
Kind Code |
A1 |
Tong, Xiao ; et al. |
January 13, 2005 |
Methods and compositions for diagnosing and treating disorders
involving angiogenesis
Abstract
The present invention relates to polynucleotides associated with
angiogenesis-related disorders. The present invention also relates
to canine endostatin genes, novel genes associated with
angiogenesis-related disorders, such as cancer. The invention
encompasses endostatin nucleic acids, recombinant DNA molecules,
cloned genes or degenerate variants thereof, endostatin gene
products and antibodies directed against such gene products,
cloning vectors containing mammalian endostatin gene molecules, and
hosts that have been genetically engineered to express such
molecules. The invention further relates to methods for the
identification of compounds that modulate the expression of
endostatin genes and gene products and to using such compounds as
therapeutic agents in the treatment of angiogenesis-related
disorders, e.g., cancer. The invention also relates to methods for
the diagnostic evaluation, genetic testing and prognosis of
angiogenesis-related disorders, e.g., cancer, and to methods and
compositions for the treatment these disorders.
Inventors: |
Tong, Xiao; (East Brunswick,
NJ) ; Sheppard, Michael G.; (Victoria, AU) |
Correspondence
Address: |
Kohn & Associates, PLLC
Suite 410
30500 Northwestern Hwy.
Farmington Hills
MI
48334
US
|
Family ID: |
22855000 |
Appl. No.: |
10/920820 |
Filed: |
August 17, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10920820 |
Aug 17, 2004 |
|
|
|
09938391 |
Aug 24, 2001 |
|
|
|
6803211 |
|
|
|
|
60227924 |
Aug 25, 2000 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/226; 435/320.1; 435/325; 514/13.3; 514/15.1; 514/16.4;
514/16.6; 514/19.3; 514/19.6; 514/19.8; 514/20.8; 514/7.9; 514/9.8;
536/23.2; 800/8 |
Current CPC
Class: |
A61P 17/02 20180101;
A61P 9/00 20180101; A61P 27/06 20180101; A01K 2217/05 20130101;
A61P 15/00 20180101; A61P 29/00 20180101; A61P 19/02 20180101; A61P
7/00 20180101; C07K 14/47 20130101; A61P 43/00 20180101; A61P 27/02
20180101; A61P 19/08 20180101; A61P 35/04 20180101; A61P 35/00
20180101; A61P 31/00 20180101; C07K 14/78 20130101; A61P 9/10
20180101; A61P 17/06 20180101; A61P 35/02 20180101; G01N 2333/78
20130101; A61P 37/06 20180101; A61K 38/00 20130101; A61P 25/00
20180101; A61P 17/00 20180101 |
Class at
Publication: |
435/069.1 ;
514/012; 435/226; 435/320.1; 435/325; 536/023.2; 800/008 |
International
Class: |
A01K 067/00; A61K
038/17; C07H 021/04; C12N 009/64 |
Claims
1-11. (Cancelled)
12. A transgenic, non-human animal which has been genetically
engineered to contain a transgene comprising a nucleic acid
selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3,
an isolated nucleic acid molecule that encodes an endostatin
consisting of SEQ ID NO: 2, and an isolated nucleic acid molecule
that encodes and endostatin consisting of SEQ ID NO: 4.
13. The transgenic, non-human animal of claim 12, wherein the
transgene is expressed.
14. An isolated polypeptide comprising an amino acid sequence of:
a) SEQ ID NO: 2; or b) SEQ ID NO: 4.
15. The antibody which binds to the isolated polypeptide of claim
14.
16. An isolated polypeptide comprising an amino acid sequence
encoded by an isolated nucleic acid molecule, which hybridizes
under highly stringent conditions to the complement of a nucleic
acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:
3, an isolated nucleic acid molecule that encodes an endostatin
consisting of SEQ ID NO: 2, and an isolated nucleic acid molecule
that encodes and endostatin consisting of SEQ ID NO: 4.
17. An isolated polypeptide comprising an amino acid sequence
encoded by an isolated nucleic acid molecule, which hybridizes
under moderately stringent conditions to the complement of a
nucleic acid selected from the group consisting of SEQ ID NO: 1,
SEQ ID NO: 3, an isolated nucleic acid molecule that encodes an
endostatin consisting of SEQ ID NO: 2, and an isolated nucleic acid
molecule that encodes and endostatin consisting of SEQ ID NO:
4.
18. An isolated fusion polypeptide comprising a fusion peptide and
an amino acid sequence of: a) SEQ ID NO: 2; or b) SEQ ID NO: 4.
19. An isolated fusion polypeptide comprising a fusion peptide and
an amino acid sequence encoded by an isolated nucleic acid
molecule, which hybridizes under highly stringent conditions to the
complement of a nucleic acid selected from the group consisting of
SEQ ID NO: 1, SEQ ID NO: 3, an isolated nucleic acid molecule that
encodes an endostatin consisting of SEQ ID NO: 2, and an isolated
nucleic acid molecule that encodes and endostatin consisting of SEQ
ID NO: 4.
20. An isolated fusion polypeptide comprising a fusion peptide and
an amino acid sequence encoded by an isolated nucleic acid
molecule, which hybridizes under moderately stringent conditions to
the complement of a nucleic acid selected from the group consisting
of SEQ ID NO: 1, SEQ ID NO: 3, an isolated nucleic acid molecule
that encodes an endostatin consisting of SEQ ID NO: 2, and an
isolated nucleic acid molecule that encodes and endostatin
consisting of SEQ ID NO: 4.
21. A method for treating an angiogenesis-related disorder in a
subject comprising administering to the subject a compound which
modulates the function, activity and/or expression of an endostatin
sequence in the subject.
22. The method of claim 21, wherein the compound enhances or
increases the function, activity and/or expression of the
endostatin sequence.
23. The methods of any one of claims 21-22, wherein the compound is
selected from the group consisting of a small organic molecule, an
antibody, a ribozyme or an antisense molecule.
24. The method of any one of claims 21-22, wherein the
angiogenesis-related disorder is selected from the group consisting
of cancer; angiogenesis-dependent cancer, comprising solid tumors,
blood born tumors such as leukemias, and tumor metastases; benign
tumors, comprising hemangiomas, acoustic neuromas, neurofibromas,
trachomas, and pyogenic granulomas; rheumatoid arthritis;
psoriasis; ocular angiogenic diseases, comprising diabetic
retinopathy, retinopathy of prematurity, macular degeneration,
corneal graft rejection, neovascular glaucoma, retrolental
fibroplasia, rubeosis; Osler-Webber Syndrome; myocardial
angiogenesis; plaque neovascularization; telangiectasia;
hemophiliac joints; angiofibroma; wound granulation; corornary
collaterals; cerebral collaterals; arteriovenous malformations;
ischemic limb angiogenesis; diabetic neovascularization; macular
degeneration; fractures; vasculogenesis; hematopoiesis; ovulation;
menstruation; and placentation.
25. The method of claim 21, wherein the endostatin sequence encodes
an amino acid sequence comprising: a) SEQ ID NO: 2; or b) SEQ ID
NO: 4.
26. The method of claim 21, wherein the subject is a dog.
27. A method for identifying a compound which modulates expression
of an endostatin sequence comprising: a) contacting a test compound
to a cell that expresses an endostatin sequence; b) measuring a
level of endostatin sequence expression in the cell; c) comparing
the level of endostatin sequence expression in the cell in the
presence of the test compound to a level of endostatin sequence
expression in the cell in the absence of the test compound, wherein
if the level of endostatin sequence expression in the cell in the
presence of the test compound differs from the level of expression
of the endostatin sequence in the cell in the absence of the test
compound, a compound that modulates expression of an endostatin
sequence is identified.
28. The method of claim 27, wherein the endostatin sequence is
endogenously expressed within the cell.
29. The method of claim 27, wherein the endostatin sequence encodes
an amino acid sequence comprising: a) SEQ ID NO: 2; or b) SEQ ID
NO: 4.
30. The method of claim 27, wherein the endostatin sequence
comprises: a) a nucleic acid as shown in SEQ ID NO: 1; or b) a
nucleic acid as shown in SEQ ID NO: 3.
31. A method for identifying a compound which modulates activity of
an endostatin sequence product comprising: a) contacting a test
compound to a cell that expresses an endostatin sequence product;
b) measuring a level of endostatin sequence product in the cell; c)
comparing the level of endostatin sequence product activity in the
cell in the presence of the test compound to a level of endostatin
sequence product activity in the cell in the absence of the test
compound, wherein if the level of endostatin sequence product
activity in the cell in the presence of the test compound differs
from the level of endostatin sequence product activity in the cell
in the absence of the test compound, a compound that modulates
activity of an endostatin sequence product is identified.
32. The method of claim 31, wherein the endostatin sequence product
comprises: a) SEQ ID NO: 2; or b) SEQ ID NO: 4.
33. A method for modulating the activity and/or expression of an
endostatin sequence in a cell comprising administering to the cell
a compound which modulates the activity and/or expression of an
endostatin sequence in the cell.
34. The method of claim 33, wherein the compound is selected from
the group consisting of a small organic molecule, an antibody, a
ribozyme or an antisense molecule.
35. The method of claim 33, wherein the endostatin sequence encodes
an amino acid sequence comprising: a) SEQ ID NO: 2; or b) SEQ ID
NO: 4.
36. The method of claim 33, wherein the endostatin sequence
comprises: a) a nucleic acid as shown in SEQ ID NO: 1; or b) a
nucleic acid as shown in SEQ ID NO: 3.
Description
INTRODUCTION
[0001] The present invention relates to polynucleotide sequences
which are shown herein to be associated with the regulation of
angiogenesis. More specifically, the present invention relates to
novel polynucleotide sequences which encode the angiogenesis
inhibitor endostatin, and more particularly, the canine
angiogenesis inhibitor. The invention encompasses endostatin
nucleic acids, recombinant DNA molecules, cloned genes and
degenerate variants thereof, vectors containing such endostatin
nucleic acids, and hosts that have been genetically engineered to
express and/or contain such molecules. The invention further
relates to endostatin gene products and antibodies directed against
such gene products. The invention further relates to methods for
the identification of compounds that modulate the expression,
synthesis and activity of such endostatin nucleic acids, and to
methods of using compounds such as those identified herein as
therapeutic agents in the treatment of angiogenesis-related
disorders, including, but not limited to, cancer. The invention
also relates to methods for the diagnostic evaluation, genetic
testing and prognosis of an angiogenesis-related disorder,
including, but not limited to, cancer.
BACKGROUND OF THE INVENTION
[0002] Angiogenesis, defined as the growth or sprouting of new
blood vessels from existing vessels, is a complex process that
primarily occurs during embryonic development. Under normal
physiological conditions in adults, angiogenesis takes place only
in very restricted situations such as hair growth and wounding
healing (Auerbach, W. and Auerbach, R., 1994, Pharmacol Ther
63(3):265-3 11; Ribatti et al.,1991, Haematologica 76(4):3 11-20;
Risau, 1997, Nature 386(6626):67 1-4). Unregulated angiogenesis has
gradually been recognized to be responsible for a wide range of
disorders, including, but not limited to, cancer, cardiovascular
disease, rheumatoid arthritis, psoriasis and diabetic retinopathy
(Folkman, 1995, Nat Med 1(1):27-31; Isner, 1999, Circulation
99(13): 1653-5; Koch, 1998, Arthritis Rheum 41(6):951-62; Walsh,
1999, Rheumatology (Oxford) 38(2):103-12; Ware and Simons, 1997,
Nat Med 3(2): 158-64). Of particular interest is the observation
that angiogenesis is required by solid tumors for their growth and
metastases (Folkman, 1986, Cancer Res, 46(2) 467-73. Folkman 1990,
J Natl. Cancer Inst., 82(1) 4-6, Folkman, 1992, Semin Cancer Biol
3(2):65-71; Zetter, 1998, Annu Rev Med 49:407-24). A tumor usually
begins as a single aberrant cell which can proliferate only to a
size of a few cubic millimeters due to the distance from available
capillary beds, and it can stay `dormant` without further growth
and dissemination for a long period of time. Some tumor cells then
switch to the angiogenic phenotype to activate endothelial cells,
which proliferate and mature into new capillary blood vessels.
These newly formed blood vessels not only allow for continued
growth of the primary tumor, but also for the dissemination and
recolonization of metastatic tumor cells. The precise mechanisms
that control the angiogenic switch is not well understood, but it
is believed that neovascularization of tumor mass results from the
net balance of a multitude of angiogenesis stimulators and
inhibitors (Folkman, 1995, Nat Med 1(1):27-31).
[0003] One of the most potent angiogenesis inhibitors is endostatin
identified by O'Reilly and Folkman (O'Reilly et al., 1997, Cell
88(2):277-85; O'Reilly et al., 1994, Cell 79(2):3 15-28). Its
discovery was based on the phenomenon that certain primary tumors
can inhibit the growth of distant metastases. O'Reilly and Folkman
hypothesized that a primary tumor initiates angiogenesis by
generating angiogenic stimulators in excess of inhibitors. However,
angiogenic inhibitors, by virtue of their longer half life in the
circulation, reach the site of a secondary tumor in excess of the
stimulators. The net result is the growth of primary tumor and
inhibition of secondary tumor. Endostatin is one of a growing list
of such angiogenesis inhibitors produced by primary tumors. It is a
proteolytic fragment of a larger protein: endostatin is a 20 kDa
fragment of collagen XVIII (amino acid H1132-K1315 in murine
collagen XVIII). Endostatin has been shown to specifically inhibit
endothelial cell proliferation in vitro and block angiogenesis in
vivo. More importantly, administration of endostatin to
tumor-bearing mice leads to significant tumor regression, and no
toxicity or drug resistance has been observed even after multiple
treatment cycles (Boehm et al., 1997, Nature 390(6658):404-407).
The fact that endostatin targets genetically stable endothelial
cells and inhibits a variety of solid tumors makes it a very
attractive candidate for anticancer therapy (Fidler and Ellis,
1994, Cell 79(2):185-8; Gastl et al., 1997, Oncology 54(3): 177-84;
van Hinsbergh et al., 1999, Ann Oncol 10 Suppl 4:60-3). In
addition, angiogenesis inhibitors have been shown to be more
effective when combined with radiation and chemotherapeutic agents
(Klement, 2000, J. Clin Invest, 105(8) R15-24. Browder, 2000,
Cancer Res. 6-(7) 1878-86, Arap et al., 1998, Science
279(5349):377-80; Mauceri et al., 1998, Nature
394(6690):287-91).
[0004] Cancer is not only devastating to humans, but is also the
most common cause of natural death in dogs. (Bronson, 1982, Am J
Vet Res, 43(11) 2057-9). Dogs develop tumors twice as frequently as
humans and it has been reported that 45-50% of dogs that live to 10
years or older die of cancer; regardless of age, and that 23% of
dogs that present for necropsy died of cancer(Bronson, 1982, Am J
Vet Res, 43(11) 2057-9). Surgical removal of the tumor is the most
common treatment, but the prognosis for invasive/metastatic tumor
is very poor, with median survival time ranging from weeks to
months. Other treatments, such as radiation therapy and
chemotherapy, have only very limited success (Bostock, 1986, Br Vet
J 142(6):506-15; Bostock, 1986, Br Vet J 142(1):1-19; MacEwen,
1990, Cancer Metastasis Rev 9(2): 125-36). Thus, more effective
treatments for angiogenic diseases, such as, for example, canine
cancers, are necessary.
SUMMARY OF THE INVENTION
[0005] The present invention encompasses novel nucleotide sequences
that are associated with angiogenesis related disorders, e.g.,
cancer. The invention more specifically relates to nucleotide
sequences that encode endostatin. In addition, endostatin nucleic
acids, recombinant DNA molecules, cloned genes or degenerate
variants thereof are provided herein. The invention also provides
vectors, including expression vectors, containing endostatin
nucleic acid molecules, and hosts that have been genetically
engineered to express and/or contain such endostatin gene
products.
[0006] The invention further relates to novel endostatin gene
products and to antibodies directed against such gene products, or
variants or fragments thereof.
[0007] The invention further relates to methods for modulation of
endostatin-mediated processes and for the treatment of disorders
involving angiogenesis, such as cancer, including the amelioration
or prevention of at least one symptom of the disorders, wherein
such methods comprise administering a compound which modulates the
expression of an endostatin gene and/or the synthesis or activity
of an endostatin gene product. In one embodiment, the invention
relates to methods for the use of a novel endostatin gene product
or fragment, analog, or mimetic thereof, or an antibody or antibody
fragment directed against an endostatin gene product, to treat or
ameliorate a symptom of such disorders.
[0008] Such disorders include, but are not limited to,
angiogenesis-dependent cancer, including, for example, solid
tumors, blood born tumors such as leukemias, and tumor metastases;
benign tumors, for example hemangiomas, acoustic neuromas,
neurofibromas, trachomas, and pyogenic granulomas; rheumatoid
arthritis; psoriasis; ocular angiogenic diseases, for example,
diabetic retinopathy, retinopathy of prematurity, macular
degeneration, corneal graft rejection, neovascular glaucoma,
retrolental fibroplasia, rubeosis; Osler-Webber Syndrome;
myocardial angiogenesis; plaque neovascularization; telangiectasia;
hemophiliac joints; angiofibroma; wound granulation; corornary
collaterals; cerebral collaterals; arteriovenous malformations;
ischemic limb angiogenesis; diabetic neovascularization; macular
degeneration; fractures; vasculogenesis; hematopoiesis; ovulation;
menstruation; and placentation.
[0009] The invention further relates to methods for modulation of
endostatin-mediated processes and for the treatment of disorders
involving abnormal stimulation of endothelial cells, including the
amelioration or prevention of at least one symptom of the
disorders, wherein such methods comprise administering a compound
which modulates the expression of an endostatin gene and/or the
synthesis or activity of an endostatin gene product. In one
embodiment, the invention relates to methods for the use of a novel
endostatin gene product or fragment, analog, or mimetic thereof, or
an antibody or antibody fragment directed against an endostatin
gene product, to treat or ameliorate a symptom of such
disorders.
[0010] The endothelial cell proliferation inhibiting proteins of
the present invention are useful in the treatment of disease of
excessive or abnormal stimulation of endothelial cells. These
diseases include, but are not limited to, intestinal adhesions,
atherosclerosis, scleroderma, and hypertrophic scars, i.e.,
keloids. They are also useful in the treatment of diseases that
have angiogenesis as a pathologic consequence such as cat scratch
disease (Rochele minalia quintosa) and ulcers (Helobacter
pylori).
[0011] The invention further relates to methods for blocking
interactions between endostatin and its respective receptors with
analogs that act as receptor antagonists. These antagonists may
promote endothelialization and vascularization. Such effects may be
desirable in situations including, but not limited to, inadequate
vascularization of the uterine endometrium and associated
infertilty, wound repair, healing of cuts and incisions, treatment
of vascular problems in diabetics, especially retinal and
peripheral vessels, promotion of vascularization in transplanted
tissue including muscle and skin, promotion of vascularization of
cardiac muscle especially following transplantation of a heart or
heart tissue and after bypass surgery, promotion of vascularization
of solid and relatively avascular tumors for enhanced cytotoxin
delivery, and enhancement of blood flow to the nervous system,
including but not limited to the cerebral cortex and spinal
cord.
[0012] The term "endostatin-related disorder" as used herein,
refers to disorders involving an endostatin gene or gene product,
or an aberrant level of endostatin gene expression, gene product
synthesis and/or gene product activity, respectively, relative to
levels found in normal, unaffected, unimpaired individuals, levels
found in clinically normal individuals, and/or levels found in a
population whose levels represent baseline, average endostatin
levels.
[0013] The term "endostatin-mediated process" as used herein,
includes processes dependent and/or responsive, either directly or
indirectly, to the level of expression, gene product synthesis
and/or gene product activity of endostatin genes.
[0014] In another embodiment, such methods can comprise modulating
the level of expression or the activity of an endostatin gene
product in a cell such that the endostatin-mediated process or the
disorder is treated, e.g., a symptom is ameliorated. In another
embodiment, such methods can comprise supplying a nucleic acid
molecule encoding an endostatin gene product to increase the level,
expression or activity of the endostatin gene product within the
cell such that the endostatin-mediated process or the disorder is
treated, e.g., a symptom is ameliorated. The nucleic acid molecule
encoding the endostatin gene product can encode a mutant endostatin
gene product with increased activity or expression levels.
[0015] The invention still further relates to methods for
modulation of endostatin-mediated processes or the treatment of
endostatin-related disorders, such as cancer, including, but not
limited to, disorders resulting from endostatin gene mutations,
and/or an abnormal levels of endostatin expression or activity and
disorders involving one or more endostatin genes or gene products,
wherein treatment includes the amelioration or prevention of at
least one symptom of such disorders. In one embodiment, such
methods can comprise supplying a mammal in need of treatment with a
nucleic acid molecule encoding an unimpaired endostatin gene
product such that the unimpaired endostatin gene product is
expressed and the disorder is treated, e.g., a symptom is
ameliorated. In another embodiment, such methods can comprise
supplying a mammal in need of treatment with a cell comprising a
nucleic acid molecule that encodes an unimpaired endostatin gene
product such that the cell expresses the unimpaired endostatin gene
product and the disorder is treated, e.g., a symptom is
ameliorated. In yet another embodiment, such methods comprise
supplying a mammal in need of treatment with a modulatory compound,
such as, for example, a small molecule, peptide or antibody that is
capable of modulating the activity of an endostatin gene or gene
product.
[0016] In addition, the present invention is directed to methods
that utilize endostatin gene sequences and/or endostatin gene
product sequences for the diagnostic evaluation, genetic testing
and/or prognosis of angiogenesis-related disorders, such as cancer.
For example, the invention relates to methods for diagnosing
angiogenesis-related disorders, e.g., cancer, wherein such methods
can comprise measuring endostatin gene expression in a patient
sample, or detecting an endostatin mutation that correlates with
the presence or development of such a disorder, in the genome of a
mammal suspected of exhibiting such a disorder.
[0017] The present invention also is directed to utilizing the
endostatin gene sequences and/or gene products as markers for
mapping of the human chromosome.
[0018] The invention still further relates to methods for
identifying compounds capable of modulating the expression of an
endostatin gene and/or the synthesis or activity of an endostatin
gene product, wherein such methods comprise contacting a compound
with a cell that expresses such an endostatin gene, measuring the
levels of endostatin gene expression, gene product expression or
gene product activity, and comparing such levels to the levels of
endostatin gene expression, gene product, or gene product activity
produced by the cell in the absence of such compound, such that if
the level obtained in the presence of the compound differs from
that obtained in its absence, a compound capable of modulating the
expression of the endostatin gene and/or the synthesis or activity
of the endostatin gene product has been identified.
Definitions
[0019] As used herein, the following terms shall have the
abbreviations indicated.
[0020] BAC: bacterial artificial chromosome
[0021] bp: base pair(s)
[0022] dbEST: expressed sequence tag data base (National Center for
Biotechnology Information)
[0023] EST: expressed sequence tag
[0024] RT-PCR: reverse transcriptase PCR
[0025] SSCP: single-stranded conformational polymorphism
[0026] SNP: single nucleotide polymorphism
[0027] YAC: yeast artificial chromosome
BRIEF DESCRIPTION OF THE FIGURES
[0028] FIG. 1: RT-PCR analysis of dog liver RNA. FIG. 1 shows
results of an amplification reaction of dog liver RNA. A region of
canine collagen XVIII which contains endostatin (pro-endo) were
specifically amplified. The positions of PCR products of expected
size are indicated by an arrow.
[0029] FIG. 2: The nucleotide sequence of canine pro-endostatin
(SEQ ID NO:1).
[0030] FIG. 3: The amino acid sequence of canine pro-endostatin
translated from the sequence of FIG. 2 (SEQ ID NO:2). The region
corresponding to endostatin is in bold (amino acid residues
47-230). The stop codon is indicated by *.
[0031] FIG. 4: The nucleotide sequence of canine endostatin (SEQ ID
NO:3).
[0032] FIG. 5: The amino acid sequence of canine endostatin
translated from the sequence of FIG. 4 (SEQ ID NO:4). The stop
codon is indicated by *.
[0033] FIG. 6: An amino acid alignment of endostatin from canine,
chicken, human and mouse. The program used is Lasergene MegAlign,
aligned by Clustal method (DNA Star Inc., Madision, Wis.).
[0034] FIG. 7: Immunofluorescence analysis of canine and murine
endostatin. 293 cells were transfected with HA-tagged canine
endostatin (ca-endo) and murine endostatin (mu-endo). The cells
were stained with antibody against the HA epitope and TRITC
conjugated secondary antibody.
[0035] FIG. 8: Immunoblot analysis of 293 cells transfected with
HA-tagged canine endostatin (ca-endo) and murine endostatin
(mu-endo). Intracellular proteins from cell lysates and secreted
proteins from culture supernatants (sup) were run on SDS-PAGE and
analyzed by immunoblot using HA antibody and alkaline phosphatase
conjugated secondary antibody.
[0036] FIG. 9: Endothelial Cell Proliferation Assay. The figure
shows a summary of inhibition of endothelial cell proliferation by
HA-tagged canine endostatin (HA-ca-endo) and murine endostatin
(HA-mu-endo). 293 cells were transfected with angiogenesis
inhibitors or green fluorescent protein (GFP) as control. The
supernatants were harvested 48 hours post transfection and
incubated with bFGF stimulated CPAE bovine endothelial cells or 293
cells for 72 hours. The total numbers of cells were counted and
plotted. Four independent experiments were carried out and each
experiment was done in duplicate.
[0037] FIG. 10: Endothelial Cell Proliferation Assay. The figure
shows a summary of inhibition of endothelial cell proliferation by
untagged canine endostatin (ca-endo). 293 cells were transfected
with angiogenesis inhibitors or green fluorescent protein (GFP) as
control. The supernatants were harvested 48 hours post transfection
and incubated with bFGF stimulated CPAE bovine endothelial cells or
293 cells for 72 hours. The total numbers of cells were counted and
plotted. Three independent experiments were carried out and each
experiment was done in duplicate.
DETAILED DESCRIPTION OF THE INVENTION
[0038] Compositions and methods relating to nucleic acid sequences
associated with disorders involving angiogenesis are described
herein. Novel genes which are associated with angiogenesis-related
disorders have been identified. Such genes encode endostatin. In
particular, described below are endostatin nucleic acid molecules,
as well as vectors comprising these molecules, host cells
engineered to contain and/or express such molecules, endostatin
gene products, and antibodies that specifically recognize such gene
products. Also described are various uses of these nucleic acids,
polypeptides, and antibodies, as well as methods for their
detection. For example, methods for the use of these molecules for
modulation of angiogenesis-related processes and for treatment of
angiogenesis-related disorders, such as cancer, are described.
Screening assays for compounds that interact with an endostatin
gene or gene product, or modulate endostatin gene or gene product
activity also are described below. Methods of treatment of an
angiogenesis-related disorder using the compositions of the
invention and compositions identified by the methods of the
invention are further described. Finally, pharmaceutical
compositions for use with the compositions of the invention are
described.
[0039] Endostatin nucleic acid molecules are described in this
section. Unless otherwise stated, the term "endostatin nucleic
acid" refers collectively to the sequences described herein.
[0040] The endostatin nucleic acid molecules of the invention
include:
[0041] (a) a nucleic acid molecule containing the DNA sequence of
endostatin (FIG. 4 (SEQ ID NO:3)) and fragments thereof;
[0042] (b) a nucleic acid molecule comprising an endostatin nucleic
acid sequence (e.g., the nucleic acid sequences depicted in FIG. 2
(SEQ ID NO:1)) or a fragment thereof;
[0043] (c) a nucleic acid molecule that encodes an endostatin gene
product;
[0044] (d) a nucleic acid molecule that comprises at least one exon
of an endostatin gene;
[0045] (e) a nucleic acid molecule that comprises endostatin gene
sequences of upstream untranslated regions, intronic regions,
and/or downstream untranslated regions, or fragments thereof, of
the endostatin nucleotide sequences in (b) above;
[0046] (f) a nucleic acid molecule comprising the novel endostatin
sequences disclosed herein that encodes mutants of the endostatin
gene products in which all or a part of one or more of the domains
is deleted or altered, as well as fragments thereof;
[0047] (g) nucleic acid molecules that encode fusion proteins
comprising an endostatin gene product, or a fragment thereof, fused
to a heterologous polypeptide;
[0048] (h) nucleic acid molecules within the endostatin genes
described in b), above (e.g., primers), or within chromosomal
nucleotide sequences flanking the endostatin gene, which can be
utilized as part of the methods of the invention for identifying
and diagnosing individuals at risk for, or exhibiting an
angiogenesis-related disorder, such as cancer, or can be used for
mapping human chromosomes; and;
[0049] (i) nucleic acid molecules within the endostatin genes
described in b), above, or within chromosomal nucleotide sequences
flanking the endostatin genes, which correlate with an
angiogenesis-related disorder, such as cancer.
[0050] The endostatin nucleotide sequences of the invention further
include nucleotide sequences corresponding to the nucleotide
sequences of (a)-(i) above wherein one or more of the exons, or
fragments thereof, have been deleted.
[0051] The endostatin nucleotide sequences of the invention also
include nucleotide sequences greater than 20, 30, 40, 50, 60, 70,
80, 90, 100, or more base pairs long that have at least 85%, 90%,
95%, 98%, or more nucleotide sequence identity to the endostatin
nucleotide sequences of (a)-(i) above, with the proviso that the
endostatin is not chicken, human, or mouse endostatin.
[0052] The endostatin nucleotide sequences of the invention further
include nucleotide sequences that encode polypeptides having at
least 85%, 90%, 95%, 98%, or higher amino acid sequence identity to
the polypeptides encoded by the endostatin nucleotide sequences of
(a)-(i) above.
[0053] To determine the percent identity of two amino acid
sequences or of two nucleic acids, the sequences are aligned for
optimal comparison purposes (e.g., gaps can be introduced in the
sequence of a first amino acid or nucleic acid sequence for optimal
alignment with a second amino or nucleic acid sequence). The amino
acid residues or nucleotides at corresponding amino acid positions
or nucleotide positions are then compared. When a position in the
first sequence is occupied by the same amino acid residue or
nucleotide as the corresponding position in the second sequence,
then the molecules are identical at that position. The percent
identity between the two sequences is a function of the number of
identical positions shared by the sequences (i.e., % identity=# of
identical overlapping positions/total # of overlapping
positions.times.100%). In one embodiment, the two sequences are the
same length.
[0054] The determination of percent identity between two sequences
can also be accomplished using a mathematical algorithm. A
preferred, non-limiting example of a mathematical algorithm
utilized for the comparison of two sequences is the algorithm of
Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. USA 87:2264-2268,
modified as in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci.
USA 90:5873-5877. Such an algorithm is incorporated into the NBLAST
and XBLAST programs of Altschul, et al., 1990, J. Mol. Biol.
215:403-410. BLAST nucleotide searches can be performed with the
NBLAST program, score=100, wordlength=12 to obtain nucleotide
sequences homologous to a nucleic acid molecules of the invention.
BLAST protein searches can be performed with the XBLAST program,
score=50, wordlength=3 to obtain amino acid sequences homologous to
a protein molecules of the invention. To obtain gapped alignments
for comparison purposes, Gapped BLAST can be utilized as described
in Altschul et al., 1997, Nucleic Acids Res.25:3389-3402.
Alternatively, PSI-Blast can be used to perform an iterated search
which detects distant relationships between molecules (Altschul et
al., 1997, supra). When utilizing BLAST, Gapped BLAST, and
PSI-Blast programs, the default parameters of the respective
programs (e.g., XBLAST and NBLAST) can be used (see
http://www.ncbi.nlm.nih.gov). Another preferred, non-limiting
example of a mathematical algorithm utilized for the comparison of
two sequences is the algorithm of Karlin and Altschul, 1990, Proc.
Natl. Acad. Sci. USA 87:2264-2268, modified as in Karlin and
Altschul, 1993, Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an
algorithm is incorporated into the NBLAST and XBLAST programs of
Altschul, et al., 1990, J. Mol. Biol. 215:403-410. BLAST nucleotide
searches can be performed with the NBLAST program, score=100,
wordlength=12 to obtain nucleotide sequences homologous to a
nucleic acid molecules of the invention. BLAST protein searches can
be performed with the XBLAST program, score=50, wordlength=3 to
obtain amino acid sequences homologous to a protein molecules of
the invention. To obtain gapped alignments for comparison purposes,
Gapped BLAST can be utilized as described in Altschul et al., 1997,
Nucleic Acids Res.25:3389-3402. Alternatively, PSI-Blast can be
used to perform an iterated search which detects distant
relationships between molecules (Altschul et al., 1997, supra).
When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the
default parameters of the respective programs (e.g., XBLAST and
NBLAST) can be used (see http://www.ncbi.nlm.nih.gov). Another
preferred, non-limiting example of a mathematical algorithm
utilized for the comparison of sequences is the algorithm of Myers
and Miller, 1988, CABIOS 4:11-17. Such an algorithm is incorporated
into the ALIGN program (version 2.0) which is part of the GCG
sequence alignment software package. When utilizing the ALIGN
program for comparing amino acid sequences, a PAM120 weight residue
table, a gap length penalty of 12, and a gap penalty of 4 can be
used.
[0055] The percent identity between two sequences can be determined
using techniques similar to those described above, with or without
allowing gaps. In calculating percent identity, typically only
exact matches are counted.
[0056] The endostatin nucleotide sequences of the invention further
include: (a) any nucleotide sequence that hybridizes to an
endostatin nucleic acid molecule of the invention under stringent
conditions, e.g., hybridization to filter-bound DNA in 6.times.
sodium chloride/sodium citrate (SSC) at about 45.degree. C.
followed by one or more washes in 0.2.times.SSC/0.1% SDS at about
50-65.degree. C., or (b) under highly stringent conditions, e.g.,
hybridization to filter-bound nucleic acid in 6.times.SSC at about
45.degree. C. followed by one or more washes in 0.1.times.SSC/0.2%
SDS at about 68.degree. C., or under other hybridization conditions
which are apparent to those of skill in the art (see, for example,
Ausubel F. M. et al., eds., 1989, Current Protocols in Molecular
Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley
& sons, Inc., New York, at pp. 6.3.1-6.3.6 and 2.10.3).
Preferably the endostatin nucleic acid molecule that hybridizes
under conditions described under (a) and (b), above, is one that
comprises the complement of a nucleic acid molecule that encodes an
endostatin gene product. In a preferred embodiment, nucleic acid
molecules that hybridize under conditions (a) and (b), above,
encode gene products, e.g., gene products functionally equivalent
to an endostatin gene product.
[0057] Functionally equivalent endostatin gene products include
naturally occurring endostatin gene products present in the same or
different species. Functionally equivalent endostatin gene products
also include gene products that retain at least one of the
biological activities of an endostatin gene product, and/or which
are recognized by and bind to antibodies (polyclonal or monoclonal)
directed against such gene product.
[0058] Among the nucleic acid molecules of the invention are
deoxyoligonucleotides ("oligos") which hybridize under highly
stringent or stringent conditions to the endostatin nucleic acid
molecules described above. In general, for probes between 14 and 70
nucleotides in length the melting temperature (Tm) is calculated
using the formula: Tm(.degree. C.)=81.5+16.6 (log [monovalent
cations (molar)])+0.41 (% G+C)-(500/N) where N is the length of the
probe. If the hybridization is carried out in a solution containing
formamide, the melting temperature is calculated using the equation
Tm(.degree. C.)=81.5+16.6 (log[monovalent cations (molar)])+0.41(%
G+C)-(0.61% formamide)-(500/N) where N is the length of the probe.
In general, hybridization is carried out at about 20-25 degrees
below Tm (for DNA-DNA hybrids) or 10-15 degrees below Tm (for
RNA-DNA hybrids).
[0059] Exemplary highly stringent conditions may refer, e.g., to
washing in 6.times.SSC/0.05% sodium pyrophosphate at 37.degree. C.
(for about 14-base oligos), 48.degree. C. (for about 17-base
oligos), 55.degree. C. (for about 20-base oligos), and 60.degree.
C. (for about 23-base oligos).
[0060] The nucleic acid molecules of the invention further comprise
the complements of the nucleic acids described above. Such
molecules can, for example, act as antisense molecules, useful, for
example, in endostatin gene regulation, and/or as antisense primers
in amplification reactions of endostatin gene nucleic acid
sequences.
[0061] The nucleic acid sequences of the invention may be used as
part of ribozyme and/or triple helix sequences, also useful for
endostatin gene regulation. Still further, such molecules may be
used as components of diagnostic methods whereby, for example, the
presence of a particular endostatin allele involved in an
angiogenesis-related disorder, e.g., cancer, may be detected, or
whereby the methods involve mapping the human chromosomal region
spanned by the alleles.
[0062] Fragments of the endostatin nucleic acid molecules refer to
endostatin nucleic acid sequences that can be at least 10, 12, 15,
20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700,
800, 900, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000,
3250, 3500, 3750, 4000, 4250, 4500, 4750, 5000, or more contiguous
nucleotides in length. Alternatively, the fragments can comprise
sequences that encode at least 10, 20, 30, 40, 50, 100, 150, 200,
250, 300, 350, 400, 450 or more contiguous amino acid residues of
the endostatin gene products. In one embodiment, the endostatin
nucleic acid molecules encode a gene product exhibiting at least
one biological activity of a corresponding endostatin gene product,
e.g., an endostatin gene product. Fragments of the endostatin
nucleic acid molecules can refer also to endostatin exons or
introns, and, further, can refer to portions of endostatin coding
regions that encode domains of endostatin gene products.
[0063] With respect to identification and isolation of endostatin
nucleotide sequences, such sequences can be readily obtained, for
example, by utilizing standard sequencing and bacterial artificial
chromosome (BAC) technologies.
[0064] As will be appreciated by those skilled in the art, DNA
sequence polymorphisms of an endostatin gene will exist within a
population of individual organisms (e.g., within a human or canine
population). Such polymorphisms may exist, for example, among
individual organisms within a population due to natural allelic
variation. Such polymorphisms include ones that lead to changes in
amino acid sequence. As used herein, the phrase "allelic variant"
refers to a nucleotide sequence which occurs at a given locus or to
a gene product encoded by that nucleotide sequence. Such natural
allelic variations can result in 1-5%, 5-20%, or 20-50% variance in
the nucleotide sequence of a given gene. An allele is one of a
group of genes which occur alternatively at a given genetic locus.
Alternative alleles can be identified by sequencing the gene of
interest in a number of different individual organisms. This can be
readily carried out by using hybridization probes to identify the
same genetic locus in a variety of individual organisms. As used
herein, the terms "gene" and "recombinant gene" refer to nucleic
acid molecules comprising an open reading frame encoding a
polypeptide of the invention. The term can further include nucleic
acid molecules comprising upstream and/or exon/intron sequences and
structure.
[0065] With respect to the cloning of additional allelic variants
of the human endostatin gene and homologs and orthologs from other
species (e.g., guinea pig, cow, mouse, canine), the isolated
endostatin gene sequences disclosed herein may be labeled and used
to screen a cDNA library constructed from mRNA obtained from
appropriate cells or tissues (e.g., liver) derived from the
organism (e.g., guinea pig, cow, mouse, canine) of interest. The
hybridization conditions used should generally be of a lower
stringency when the cDNA library is derived from an organism
different from the type of organism from which the labeled sequence
was derived, and can routinely be determined based on, e.g.,
relative relatedness of the target and reference organisms.
[0066] Alternatively, the labeled fragment may be used to screen a
genomic library derived from the organism of interest, again, using
appropriately stringent conditions. Appropriate stringency
conditions are well known to those of skill in the art as discussed
above, and will vary predictably depending on the specific
organisms from which the library and the labeled sequences are
derived. For guidance regarding such conditions see, for example,
Sambrook, et al., 1989, Molecular Cloning, A Laboratory Manual,
Second Edition, Cold Spring Harbor Press, N.Y.; and Ausubel, et
al., 1989-1999, Current Protocols in Molecular Biology, Green
Publishing Associates and Wiley Interscience, N.Y., both of which
are incorporated herein by reference in their entirety.
[0067] Further, an endostatin gene allelic variant may be isolated
from, for example, human or canine nucleic acid, by performing PCR
using two degenerate oligonucleotide primer pools designed on the
basis of amino acid sequences within the endostatin gene products
disclosed herein. The template for the reaction may be cDNA
obtained by reverse transcription of mRNA prepared from, for
example, human or non-human cell lines or tissue known or suspected
to express a wild type or mutant endostatin gene allele (such as,
for example, liver cells). In one embodiment, the allelic variant
is isolated from an individual organism that has an
angiogenesis-mediated disorder.
[0068] The PCR product may be subcloned and sequenced to ensure
that the amplified sequences represent the sequences of an
endostatin gene nucleic acid sequence. The PCR fragment may then be
used to isolate a full length cDNA clone by a variety of methods.
For example, the amplified fragment may be labeled and used to
screen a bacteriophage cDNA library. Alternatively, the labeled
fragment may be used to isolate genomic clones via the screening of
a genomic library.
[0069] PCR technology also may be utilized to isolate full length
cDNA sequences, as well as cDNA sequences corresponding to
alternatively spliced mRNA species. For example, RNA may be
isolated, following standard procedures, from an appropriate
cellular or tissue source (i.e., one known, or suspected, to
express the endostatin gene, such as, for example, liver tissue
samples obtained through biopsy or post-mortem). A reverse
transcription reaction may be performed on the RNA using an
oligonucleotide primer specific for the most 5' end of the
amplified fragment for the priming of first strand synthesis. The
resulting RNA/DNA hybrid may then be "tailed" with guanines using a
standard terminal transferase reaction, the hybrid may be digested
with RNase H, and second strand synthesis may then be primed with a
poly-C primer. Thus, cDNA sequences upstream of the amplified
fragment may easily be isolated. For a review of cloning strategies
that may be used, see e.g., Sambrook et al., 1989, supra, or
Ausubel et al., supra.
[0070] A cDNA of an allelic, e.g., mutant, variant of the
endostatin gene may be isolated, for example, by using PCR, a
technique that is well known to those of skill in the art. In this
case, the first cDNA strand may be synthesized by hybridizing an
oligo-dT oligonucleotide to mRNA isolated from tissue known or
suspected to be expressed in an individual organism putatively
carrying a mutant endostatin allele, and by extending the new
strand with reverse transcriptase. The second strand of the cDNA is
then synthesized using an oligonucleotide that hybridizes
specifically to the 5' end of the normal gene. Using these two
primers, the product is then amplified via PCR, cloned into a
suitable vector, and subjected to DNA sequence analysis through
methods well known to those of skill in the art. By comparing the
DNA sequence of the mutant endostatin allele to that of the normal
endostatin allele, the mutation(s) responsible for the loss or
alteration of function of the mutant endostatin gene product can be
ascertained.
[0071] Alternatively, a genomic library can be constructed using
DNA obtained from an individual organism suspected of or known to
carry a mutant endostatin allele, or a cDNA library can be
constructed using RNA from a tissue known, or suspected, to express
a mutant endostatin allele. An unimpaired endostatin gene, or any
suitable fragment thereof, may then be labeled and used as a probe
to identify the corresponding mutant endostatin allele in such
libraries. Clones containing the mutant endostatin gene sequences
may then be purified and subjected to sequence analysis according
to methods well known to those of skill in the art.
[0072] Additionally, an expression library can be constructed
utilizing cDNA synthesized from, for example, RNA isolated from a
tissue known, or suspected, to express a mutant endostatin allele
in an individual organism suspected of or known to carry such a
mutant allele. In this manner, gene products made by the putatively
mutant tissue may be expressed and screened using standard antibody
screening techniques in conjunction with antibodies raised against
the normal endostatin gene product, as described, below. (For
screening techniques, see, for example, Harlow and Lane, eds.,
1988, "Antibodies: A Laboratory Manual", Cold Spring Harbor Press,
Cold Spring Harbor.)
[0073] In cases where an endostatin mutation results in an
expressed gene product with altered function (e.g., as a result of
a missense or a frameshift mutation), a polyclonal set of
anti-endostatin gene product antibodies are likely to cross-react
with the mutant endostatin gene product. Library clones detected
via their reaction with such labeled antibodies can be purified and
subjected to sequence analysis according to methods well known to
those of skill in the art.
[0074] Endostatin mutations or polymorphisms can further be
detected using PCR amplification techniques. Primers can routinely
be designed to amplify overlapping regions of the whole endostatin
sequence including the promoter regulating region. In one
embodiment, primers are designed to cover the exon-intron
boundaries such that, coding regions can be scanned for
mutations.
[0075] The invention also includes nucleic acid molecules,
preferably DNA molecules, that are the complements of the
nucleotide sequences of the preceding paragraphs.
[0076] In certain embodiments, the nucleic acid molecules of the
invention are present as part of nucleic acid molecules comprising
nucleic acid sequences that contain or encode heterologous (e.g.,
vector, expression vector, or fusion protein) sequences.
[0077] Endostatin gene products include those gene products encoded
by nucleic acid molecules comprising the endostatin gene sequences
described, above. In addition, endostatin gene products may include
proteins that represent functionally equivalent gene products. Such
an equivalent endostatin gene products may contain deletions,
including internal deletions, additions, including additions
yielding fusion proteins, or substitutions of amino acid residues
within and/or adjacent to the amino acid sequence encoded by the
endostatin gene sequences described, above, but that result in a
"silent" change, in that the change produces a functionally
equivalent endostatin gene product. Amino acid substitutions may be
made on the basis of similarity in polarity, charge, solubility,
hydrophobicity, hydrophilicity, and/or the amphipathic nature of
the residues involved. For example, nonpolar (hydrophobic) amino
acids include alanine, leucine, isoleucine, valine, proline,
phenylalanine, tryptophan, and methionine; polar neutral amino
acids include glycine, serine, threonine, cysteine, tyrosine,
asparagine, and glutamine; positively charged (basic) amino acids
include arginine, lysine, and histidine; and negatively charged
(acidic) amino acids include aspartic acid and glutamic acid.
[0078] Alternatively, where alteration of function is desired,
deletion or non-conservative alterations can be engineered to
produce altered endostatin gene products. Such alterations can, for
example, alter one or more of the biological functions of the
endostatin gene product. Further, such alterations can be selected
so as to generate endostatin gene products that are better suited
for expression, scale up, etc. in the host cells chosen. For
example, cysteine-residues can be deleted or substituted with
another amino acid residue in order to eliminate disulfide
bridges.
[0079] Peptides and/or proteins corresponding to one or more
domains of an endostatin protein, as well as fusion proteins, in
which an endostatin protein or a portion of an endostatin protein,
such as a truncated endostatin protein, or peptide or an endostatin
protein domain, is fused to an unrelated protein are also within
the scope of this invention. Such proteins and peptides can be
designed on the basis of the endostatin nucleotide sequence
disclosed, above, and/or on the basis of the endostatin amino acid
sequence disclosed herein. Fusion proteins include, but are not
limited to, IgFc fusions which stabilize the endostatin protein or
peptide and prolong half life in vivo; or fusions to any amino acid
sequence that allows the fusion protein to be anchored to the cell
membrane; or fusions of endostatin protein domains to an enzyme,
fluorescent protein, luminescent protein, or a flag epitope protein
or peptide which provides a marker function.
[0080] Endostatin proteins of the invention also include endostatin
protein sequences wherein domains encoded by at least one exon of
the cDNA sequence, or fragments thereof, have been deleted.
[0081] The endostatin protein sequences described above can include
a domain which comprises a signal sequence that targets the
endostatin gene product for secretion. As used herein, a signal
sequence includes a peptide of at least about 15 or 20 amino acid
residues in length which occurs at the N-terminus of secretory and
membrane-bound proteins and which contains at least about 70%
hydrophobic amino acid residues such as alanine, leucine,
isoleucine, phenylalanine, proline, tyrosine, tryptophan, or
valine. In a preferred embodiment, a signal sequence contains at
least about 10 to 40 amino acid residues, preferably about 19-34
amino acid residues, and has at least about 60-80%, more preferably
65-75%, and more preferably at least about 70% hydrophobic
residues. A signal sequence serves to direct a protein containing
such a sequence to a lipid bilayer.
[0082] A signal sequence of a polypeptide of the invention can be
used to facilitate secretion and isolation of the secreted protein
or other proteins of interest. Signal sequences are typically
characterized by a core of hydrophobic amino acids which are
generally cleaved from the mature protein during secretion in one
or more cleavage events. Such signal peptides contain processing
sites that allow cleavage of the signal sequence from the mature
proteins as they pass through the secretory pathway. Thus, the
invention pertains to the described endostatin polypeptides having
a signal sequence (that is, "immature" polypeptides), as well as to
the endostatin signal sequences themselves and to the endostatin
polypeptides in the absence of a signal sequence (i.e., the
"mature" endostatin cleavage products). It is to be understood that
endostatin polypeptides of the invention can further comprise
polypeptides comprising any signal sequence having characteristics
as described above and a mature endostatin polypeptide
sequence.
[0083] The endostatin polypeptides of the invention can further
comprise posttranslational modifications, including, but not
limited to, glycosylations, acetylations, myristylations, and
phosphorylations. If the native endostatin protein does not have
recognition motifs that allow such modifications, it would be
routine for one skilled in the art to introduce into an endostatin
gene nucleotide sequences that encode motifs such as enzyme
recognition signals so as to produce a modified endostatin gene
product.
[0084] The endostatin gene products, peptide fragments thereof and
fusion proteins thereof, may be produced by recombinant DNA
technology using techniques well known in the art. Thus, methods
for preparing the endostatin gene polypeptides, peptides, fusion
peptide and fusion polypeptides of the invention by expressing
nucleic acid containing endostatin gene sequences are described
herein. Methods that are well known to those skilled in the art can
be used to construct expression vectors containing endostatin gene
product coding sequences and appropriate transcriptional and
translational control signals. These methods include, for example,
in vitro recombinant DNA techniques, synthetic techniques, and in
vivo genetic recombination. See, e.g., the techniques described in
Sambrook, et al., 1989, supra, and Ausubel, et al., 1989, supra.
Alternatively, RNA capable of encoding endostatin gene product
sequences may be chemically synthesized using, for example,
synthesizers. See, e.g., the techniques described in
"Oligonucleotide Synthesis", 1984, Gait, ed., IRL Press,
Oxford.
[0085] A variety of host-expression vector systems may be utilized
to express the endostatin gene coding sequences of the invention.
Such host-expression systems represent vehicles by which the coding
sequences of interest may be produced and subsequently purified,
but also represent cells that may, when transformed or transfected
with the appropriate nucleotide coding sequences, exhibit the
endostatin gene product of the invention in situ. These include,
but are not limited to, microorganisms such as bacteria (e.g., E.
coli, B. subtilis) transformed with recombinant bacteriophage DNA,
plasmid DNA or cosmid DNA expression vectors containing endostatin
gene product coding sequences; yeast (e.g., Saccharomyces, Pichia)
transformed with recombinant yeast expression vectors containing
the endostatin gene product coding sequences; insect cell systems
infected with recombinant virus expression vectors (e.g.,
baculovirus) containing the endostatin gene product coding
sequences; plant cell systems infected with recombinant virus
expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco
mosaic virus, TMV) or transformed with recombinant plasmid
expression vectors (e.g., Ti plasmid) containing endostatin gene
product coding sequences; or mammalian cell systems (e.g., COS,
CHO, BHK, 293, 3T3) harboring recombinant expression constructs
containing promoters derived from the genome of mammalian cells
(e.g., metallothionein promoter) or from mammalian viruses (e.g.,
the adenovirus late promoter; the vaccinia virus 7.5K
promoter).
[0086] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
endostatin gene product being expressed. For example, when a large
quantity of such a protein is to be produced, for the generation of
pharmaceutical compositions of endostatin protein or for raising
antibodies to endostatin protein, for example, vectors that direct
the expression of high levels of fusion protein products that are
readily purified may be desirable. Such vectors include, but are
not limited, to the E. coli expression vector pUR278 (Ruther et
al., 1983, EMBO J. 2, 1791), in which the endostatin gene product
coding sequence may be ligated individually into the vector in
frame with the lac Z coding region so that a fusion protein is
produced; pIN vectors (Inouye and Inouye, 1985, Nucleic Acids Res.
13, 3101-3109; Van Heeke and Schuster, 1989, J. Biol. Chem. 264,
5503-5509); and the like. pGEX vectors may also be used to express
foreign polypeptides as fusion proteins with glutathione
S-transferase (GST). In general, such fusion proteins are soluble
and can easily be purified from lysed cells by adsorption to
glutathione-agarose beads followed by elution in the presence of
free glutathione. The pGEX vectors are designed to include thrombin
or factor Xa protease cleavage sites so that the cloned target gene
product can be released from the GST moiety.
[0087] In an insect system, Autographa californica, nuclear
polyhedrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. Endostatin
gene coding sequences may be cloned individually into non-essential
regions (for example the polyhedrin gene) of the virus and placed
under control of an AcNPV promoter (for example the polyhedrin
promoter). Successful insertion of endostatin gene coding sequences
will result in inactivation of the polyhedrin gene and production
of non-occluded recombinant virus (i.e., virus lacking the
proteinaceous coat coded for by the polyhedrin gene). These
recombinant viruses are then used to infect Spodoptera frugiperda
cells in which the inserted gene is expressed (e.g., see Smith, et
al., 1983, J. Virol. 46, 584; Smith, U.S. Pat. No. 4,215,051).
[0088] In mammalian host cells, a number of viral-based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, an endostatin gene coding sequence of interest
may be ligated to an adenovirus transcription/translation control
complex, e.g., the late promoter and-tripartite leader sequence.
This chimeric gene may then be inserted in the adenovirus genome by
in vitro or in vivo recombination. Insertion in a non-essential
region of the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing
endostatin gene product in infected hosts. (e.g., See Logan and
Shenk, 1984, Proc. Natl. Acad. Sci. USA 81, 3655-3659). Specific
initiation signals may also be required for efficient translation
of inserted endostatin gene product coding sequences. These signals
include the ATG initiation codon and adjacent sequences. In cases
where an entire endostatin gene, including an initiation codon and
adjacent sequences, is inserted into the appropriate expression
vector, no additional translational control signals may be needed.
In cases where only a portion of the endostatin gene coding
sequence is inserted, similar exogenous translational control
signals, including, perhaps, the ATG initiation codon, must be
provided. Furthermore, the initiation codon must be in phase with
the reading frame of the desired coding sequence to ensure
translation of the entire insert. These exogenous translational
control signals and initiation codons can be of a variety of
origins, both natural and synthetic. The efficiency of expression
may be enhanced by the inclusion of appropriate transcription
enhancer elements, transcription terminators, etc. (see Bittner, et
al., 1987, Methods in Enzymol. 153, 516-544).
[0089] In addition, a host cell strain may be chosen that modulates
the expression of the inserted sequences, or modifies and processes
the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells that possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include but are not limited to CHO, VERO, BHK, HeLa,
COS, MDCK, 293, 3T3, and W138.
[0090] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
that stably express the endostatin gene product may be engineered.
Rather than using expression vectors that contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1-2 days in an
enriched media, and then are switched to a selective media. The
selectable marker in the recombinant plasmid confers resistance to
the selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci that in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines that express the endostatin gene
product. Such engineered cell lines may be particularly useful in
screening and evaluation of compounds that affect the endogenous
activity of the endostatin gene product.
[0091] A number of selection systems may be used, including, but
not limited to, the herpes simplex virus thymidine kinase (Wigler,
et al., 1977, Cell 11, 223), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska and Szybalski, 1962, Proc.
Natl. Acad. Sci. USA 48, 2026), and adenine
phosphoribosyltransferase (Lowy, et al., 1980, Cell 22, 817) genes
can be employed in tk-, hgprt- or aprt-cells, respectively. Also,
antimetabolite resistance can be used as the basis of selection for
the following genes: dhfr, which confers resistance to methotrexate
(Wigler, et al., 1980, Natl. Acad. Sci. USA 77, 3567; O'Hare, et
al., 1981, Proc. Natl. Acad. Sci. USA 78, 1527); gpt, which confers
resistance to mycophenolic acid (Mulligan and Berg, 1981, Proc.
Natl. Acad. Sci. USA 78, 2072); neo, which confers resistance to
the aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol.
Biol. 150, 1); and hygro, which confers resistance to hygromycin
(Santerre, et al., 1984, Gene 30, 147).
[0092] Alternatively, any fusion protein may be readily purified by
utilizing an antibody specific for the fusion protein being
expressed. For example, a system described by Janknecht, et al.
allows for the ready purification of non-denatured fusion proteins
expressed in human cell lines (Janknecht, et al., 1991, Proc. Natl.
Acad. Sci. USA 88, 8972-8976). In this system, the gene of interest
is subcloned into a vaccinia recombination plasmid such that the
gene's open reading frame is translationally fused to an
amino-terminal tag consisting of six histidine residues. Extracts
from cells infected with recombinant vaccinia virus are loaded onto
Ni.sup.2+ nitriloacetic acid-agarose columns and histidine-tagged
proteins are selectively eluted with imidazole-containing
buffers.
[0093] Alternatively, the expression characteristics of an
endogenous endostatin gene within a cell, cell line, or
microorganism may be modified by inserting a heterologous DNA
regulatory element into the genome of a stable cell line or cloned
microorganism such that the inserted regulatory element is
operatively linked with the endogenous endostatin gene. For
example, an endogenous endostatin gene which is normally
"transcriptionally silent", i.e., an endostatin gene which is
normally not expressed, or is expressed only at very low levels in
a cell, cell line, or microorganism, may be activated by inserting
a regulatory element which is capable of promoting the expression
of a normally expressed gene product in that cell, cell line, or
microorganism. Alternatively, a transcriptionally silent,
endogenous endostatin gene may be activated by insertion of a
promiscuous regulatory element that works across cell types.
[0094] A heterologous regulatory element may be inserted into a
stable cell line or cloned microorganism, such that it is
operatively linked with an endogenous endostatin gene, using
techniques, such as targeted homologous recombination, which are
well known to those of skill in the art, and described e.g., in
Chappel, U.S. Pat. No. 5,272,071; PCT publication No. WO 91/06667,
published May 16, 1991.
[0095] Endostatin gene products also can be expressed in transgenic
animals. Animals of any species, including, but not limited to,
mice, rats, rabbits, guinea pigs, pigs, micro-pigs, goats, sheep,
and non-human primates, e.g., baboons, monkeys, and chimpanzees may
be used to generate endostatin transgenic animals. The term
"transgenic," as used herein, refers to animals expressing
endostatin gene sequences from a different species (e.g., mice
expressing human or canine endostatin sequences), as well as
animals that have been genetically engineered to overexpress
endogenous (i.e., same species) endostatin sequences or animals
that have been genetically engineered to no longer express
endogenous endostatin gene sequences (i.e., "knock-out" animals),
and their progeny.
[0096] Any technique known in the art may be used to introduce an
endostatin gene transgene into animals to produce the founder lines
of transgenic animals. Such techniques include, but are not limited
to, pronuclear microinjection (Hoppe and Wagner, 1989, U.S. Pat.
No. 4,873,191); retrovirus mediated gene transfer into germ lines
(van der Putten, et al., 1985, Proc. Natl. Acad. Sci., USA 82,
6148-6152); gene targeting in embryonic stem cells (Thompson, et
al., 1989, Cell 56, 313-321); electroporation of embryos (Lo, 1983,
Mol. Cell. Biol. 3, 1803-1814); and sperm-mediated gene transfer
(Lavitrano et al., 1989, Cell 57, 717-723). (For a review of such
techniques, see Gordon, 1989, Transgenic Animals, Intl. Rev. Cytol.
115, 171-229.)
[0097] Any technique known in the art may be used to produce
transgenic animal clones containing an endostatin transgene, for
example, nuclear transfer into enucleated oocytes of nuclei from
cultured embryonic, fetal or adult cells induced to quiescence
(Campbell, et al., 1996, Nature 380, 64-66; Wilmut, et al., Nature
385, 810-813).
[0098] The present invention provides for transgenic animals that
carry an endostatin transgene in all their cells, as well as
animals that carry the transgene in some, but not all their cells,
i.e., mosaic animals. The transgene may be integrated as a single
transgene or in concatamers, e.g., head-to-head tandems or
head-to-tail tandems. The transgene may also be selectively
introduced into and activated in a particular cell type by
following, for example, the teaching of Lasko et al. (Lasko, et
al., 1992, Proc. Natl. Acad. Sci. USA 89, 6232-6236). The
regulatory sequences required for such a cell-type specific
activation will depend upon the particular cell type of interest,
and will be apparent to those of skill in the art. When it is
desired that the endostatin gene transgene be integrated into the
chromosomal site of the endogenous endostatin gene, gene targeting
is preferred. Briefly, when such a technique is to be utilized,
vectors containing some nucleotide sequences homologous to the
endogenous endostatin gene are designed for the purpose of
integrating, via homologous recombination with chromosomal
sequences, into and disrupting the function of the nucleotide
sequence of the endogenous endostatin gene. The transgene may also
be selectively introduced into a particular cell type, thus
inactivating the endogenous endostatin gene in only that cell type,
by following, for example, the teaching of Gu, et al. (Gu, et al.,
1994, Science 265, 103-106). The regulatory sequences required for
such a cell-type specific inactivation will depend upon the
particular cell type of interest, and will be apparent to those of
skill in the art.
[0099] Once transgenic animals have been generated, the phenotypic
expression of the recombinant endostatin gene may be assayed
utilizing standard techniques. Initial screening may be
accomplished by Southern blot analysis or PCR techniques to analyze
animal tissues to assay whether integration of the transgene has
taken place. The level of mRNA expression of the transgene in the
tissues of the transgenic animals may also be assessed using
techniques that include, but are not limited to, Northern blot
analysis of tissue samples obtained from the animal, in situ
hybridization analysis, and RT-PCR (reverse transcriptase PCR).
Samples of endostatin gene-expressing tissue, may also be evaluated
immunocytochemically using antibodies specific for the endostatin
transgene product.
[0100] Endostatin gene products, or peptide fragments thereof, can
be prepared for a variety of uses. For example, such gene products,
or peptide fragments thereof, can be used for the generation of
antibodies, in diagnostic assays, or for mapping and the
identification of other cellular or extracellular gene products
involved in the regulation of an angiogenesis-related disorder,
such as cancer. Such endostatin gene products include, but are not
limited to, soluble derivatives such as peptides or polypeptides
corresponding to one or more domains of the endostatin gene
product, particularly endostatin gene products that are modified
such that they are deleted for one or more hydrophobic domains.
Alternatively, antibodies to the endostatin protein or
anti-idiotypic antibodies that mimic the endostatin gene product
(including Fab fragments), antagonists or agonists can be used to
treat angiogenesis-related disorders, such as cancer. In yet
another approach, nucleotide constructs encoding such endostatin
gene products can be used to genetically engineer host cells to
express such endostatin gene products in vivo; these genetically
engineered cells can function as "bioreactors" in the body
delivering a continuous supply of endostatin gene product,
endostatin peptides or soluble endostatin polypeptides.
[0101] Described herein are methods for the production of
antibodies capable of specifically recognizing one or more
endostatin gene product epitopes or epitopes of conserved variants
or peptide fragments of the gene products.
[0102] Such antibodies may include, but are not limited to,
polyclonal antibodies, monoclonal antibodies (mAbs), canine, human,
humanized or chimeric antibodies, single chain antibodies, Fab
fragments, F(ab').sub.2 fragments, fragments produced by a Fab
expression library, anti-idiotypic (anti-Id) antibodies, and
epitope-binding fragments of any of the above. Such antibodies may
be used, for example, in the detection of an endostatin gene
product in an biological sample and may, therefore, be utilized as
part of a diagnostic or prognostic technique whereby subjects may
be tested for abnormal levels of endostatin gene products, and/or
for the presence of abnormal forms of such gene products. Such
antibodies may also be utilized in conjunction with, for example,
compound screening schemes, as described below, for the evaluation
of the effect of test compounds on endostatin gene product levels
and/or activity. Additionally, such antibodies can be used in
conjunction with the gene therapy techniques described below, for
example, to evaluate the normal and/or engineered
endostatin-expressing cells prior to their introduction into the
subject.
[0103] Anti-endostatin gene product antibodies may additionally be
used as a method for the inhibition of abnormal endostatin gene
product activity. Thus, such antibodies may, be utilized as part of
treatment methods for an angiogenesis-related disorder, e.g.,
cancer.
[0104] For the production of antibodies against an endostatin gene
product, various host animals may be immunized by injection with an
endostatin gene product, or a portion thereof. Such host animals
may include, but are not limited to, rabbits, mice, and rats, to
name but a few. Various adjuvants may be used to increase the
immunological response, depending on the host species, including
but not limited to Freund's (complete and incomplete), mineral gels
such as aluminum hydroxide, surface active substances such as
lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanin, dinitrophenol, and
potentially useful human adjuvants such as BCG (bacille
Calmette-Guerin) and Corynebacterium parvum.
[0105] Polyclonal antibodies are heterogeneous populations of
antibody molecules derived from the sera of animals immunized with
an antigen, such as an endostatin gene product, or an antigenic
functional derivative thereof. For the production of polyclonal
antibodies, host animals such as those described above, may be
immunized by injection with endostatin gene product supplemented
with adjuvants as also described above.
[0106] Monoclonal antibodies, which are homogeneous populations of
antibodies to a particular antigen, may be obtained by any
technique that provides for the production of antibody molecules by
continuous cell lines in culture. These include, but are not
limited to, the hybridoma technique of Kohler and Milstein, (1975,
Nature 256, 495-497; and U.S. Pat. No. 4,376,110), the human B-cell
hybridoma technique (Kosbor et al., 1983, Immunology Today 4, 72;
Cole et al., 1983, Proc. Natl. Acad. Sci. USA 80, 2026-2030), and
the EBV-hybridoma technique (Cole et al., 1985, Monoclonal
Antibodies And Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Such
antibodies may be of any immunoglobulin class including IgG, IgM,
IgE, IgA, IgD and any subclass thereof. The hybridoma producing the
mAb of this invention may be cultivated in vitro or in vivo.
Production of high titers of mAbs in vivo makes this the presently
preferred method of production.
[0107] Additionally, recombinant antibodies, such as chimeric and
humanized monoclonal antibodies, comprising both human and
non-human portions, which can be made using standard recombinant
DNA techniques, are within the scope of the invention. A chimeric
antibody is a molecule in which different portions are derived from
different animal species, such as those having a variable region
derived from a murine mAb and a human immunoglobulin constant
region. (See, e.g., Cabilly et al., U.S. Pat. No. 4,816,567; and
Boss et al., U.S. Pat. No. 4,816397, which are incorporated herein
by reference in their entirety.) Humanized antibodies are antibody
molecules from non-human species having one or more complementarity
determining regions (CDRs) from the non-human species and a
framework region from a human immunoglobulin molecule. (See, e.g.,
Queen, U.S. Pat. No. 5,585,089, which is incorporated herein by
reference in its entirety.) Such chimeric and humanized monoclonal
antibodies can be produced by recombinant DNA techniques known in
the art, for example using methods described in PCT Publication No.
WO 87/02671; European Patent Application 184,187; European Patent
Application 171,496; European Patent Application 173,494; PCT
Publication No. WO 86/01533; U.S. Pat. No. 4,816,567; European
Patent Application 125,023; Better et al. (1988) Science
240:1041-1043; Liu et al. (1987) Proc. Natl. Acad. Sci. USA
84:3439-3443; Liu et al. (1987) J. Immunol 139:3521-3526; Sun et
al. (1987) Proc. Natl. Acad. Sci. USA 84:214-218; Nishimura et al.
(1987) Canc. Res. 47:999-1005; Wood et al. (1985) Nature
314:446-449; and Shaw et al. (1988) J. Natl. Cancer Inst.
80:1553-1559); Morrison (1985) Science 229:1202-1207; Oi et al.
(1986) Bio/Techniques 4:214; U.S. Pat. No. 5,225,539; Jones et al.
(I1986) Nature 321:552-525; Verhoeyan et al. (1988) Science
239:1534; and Beidler et al. (1988) J. Immunol. 141:4053-4060.
[0108] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Such antibodies can be
produced, for example, using transgenic mice which are incapable of
expressing endogenous immunoglobulin heavy and light chains genes,
but which can express human heavy and light chain genes. The
transgenic mice are immunized in the normal fashion with a selected
antigen, e.g., all or a portion of a polypeptide of the invention.
Monoclonal antibodies directed against the antigen can be obtained
using conventional hybridoma technology. The human immunoglobulin
transgenes harbored by the transgenic mice rearrange during B cell
differentiation, and subsequently undergo class switching and
somatic mutation. Thus, using such a technique, it is possible to
produce therapeutically useful IgG, IgA and IgE antibodies. For an
overview of this technology for producing human-antibodies,'see
Lonberg and Huszar (1995, Int. Rev. Immunol. 13:65-93). For a
detailed discussion of this technology for producing human
antibodies and human monoclonal antibodies and protocols for
producing such antibodies, see, e.g., U.S. Pat. No. 5,625,126; U.S.
Pat. No. 5,633,425; U.S. Pat. No. 5,569,825; U.S. Pat. No.
5,661,016; and U.S. Pat. No. 5,545,806. In addition, companies such
as Abgenix, Inc. (Fremont, Calif.), can be engaged to provide human
antibodies directed against a selected antigen using technology
similar to that described above.
[0109] Completely human antibodies which recognize a selected
epitope can be generated using a technique referred to as "guided
selection." In this approach a selected non-human monoclonal
antibody, e.g., a mouse antibody, is used to guide the selection of
a completely human antibody recognizing the same epitope. (Jespers
et al. (1994) Bio/technology 12:899-903).
[0110] Alternatively, techniques described for the production of
single chain antibodies (U.S. Pat. No. 4,946,778; Bird, 1988,
Science 242, 423-426; Huston, et al., 1988, Proc. Natl. Acad. Sci.
USA 85, 5879-5883; and Ward, et al., 1989, Nature 334, 544-546) can
be adapted to produce single-chain antibodies against endostatin
gene products. Single chain antibodies are formed by linking the
heavy and light chain fragments of the Fv region via an amino acid
bridge, resulting in a single chain polypeptide.
[0111] Antibody fragments that recognize specific epitopes may be
generated by known techniques. For example, such fragments include,
but are not limited to, the F(ab')2 fragments, which can be
produced by pepsin digestion of the antibody molecule and the Fab
fragments, which can be generated by reducing the disulfide bridges
of the F(ab')2 fragments. Alternatively, Fab expression libraries
may be constructed (Huse, et al., 1989, Science, 246, 1275-1281) to
allow rapid and easy identification of monoclonal Fab fragments
with the desired specificity.
[0112] Described herein are various applications of endostatin gene
sequences, endostatin gene products, including peptide fragments
and fusion proteins thereof, and of antibodies directed against
endostatin gene products and peptide fragments thereof. Such
applications include, for example, prognostic and diagnostic
evaluation of an angiogenesis-related disorder, e.g., cancer, and
the identification of subjects with a predisposition to such
disorders, as described, below, in Section. Additionally, such
applications include methods for the identification of compounds
that modulate the expression of an endostatin gene and/or the
synthesis or activity of an endostatin gene product, as described
below, and for the treatment of an angiogenesis-related disorder,
e.g. cancer, as described, below.
[0113] In addition, endostatin gene sequences and gene products,
including peptide fragments and fusion proteins thereof, and
antibodies directed against endostatin gene products and peptide
fragments thereof, have applications for purposes independent of
the role endostatin may have in angiogenesis-related disorders and
processes. For example, endostatin gene products, including peptide
fragments, as well as endostatin-specific antibodies, can be used
for construction of fusion proteins to facilitate recovery,
detection, or localization of another protein of interest. In
addition, endostatin genes and gene products can be used for
genetic mapping, i.e., refining the genetic map. For example,
antibodies specific to endostatin can be used as probes to detect
expression of human endostatin in somatic cell hybrids containing
human chromosomes, or portions of human chromosomes. Such
endostatin-specific antibodies can be used to identify cells that
contain the endostatin chromosomal region. This method can be used,
for example, to localize a gene or trait of interest to this region
of the chromosome.
[0114] Endostatin gene sequences and gene products can be used for
mapping and refining a chromosomal map. The endostatin sequence can
be used to develop new genetic markers to further refine
chromosomal intervals that are associated with various
angiogenesis-related disorders, including, but not limited to,
cancer. As will be apparent to the skilled artisan, nucleic acid
sequences within a genetic interval associated with a disease can
be scanned for new markers, such as microsatellites.
Microsatellites, also known as simple-sequence repeats (SSRs), are
hypervariable tandem-sequence repeats consisting of di-, tri-, or
tetranucleotide repeats of 1-5 nucleotides. Such microsatellites
make excellent genetic markers for linkage studies since they are
distributed ubiquitously throughout the human genome, are highly
variable in repeat length, and tend to be highly polymorphic.
Relatively common microsatellites (e.g., (CA)n dinucleotide
repeats) occur approximately every 300-500 kb. In addition to
microsatellite repeats, the region can be scanned for other types
of polymorphic sites useful for fine mapping, such as
minisatellites (9-64 nucleotide repeats), restriction fragment
length polymorphisms (RFLPs), and single nucleotide polymorphisms,
which occur much less frequently. Once a polymorphic site is
identified in a new sequence, PCR primers that flank the
polymorphic site can be synthesized and used to amplify the
microsatellite or other polymorphic site. The length of the repeat
can then determined by resolving the PCR product on a
polyacrylamide sequencing gel. Genomic DNA from human populations
can then be analyzed for the simple-sequence length polymorphisms
(SSLPs) to determine the frequency and variability of the repeat.
Once a high quality SSLP is found, linkage analysis can be
performed on an affected population to determine whether an
angiogenesis-related disorder, such as cancer, is linked to the new
marker. Other techniques, such as Southern blot hybridization and
ligase-chain reaction (LCR), can be used in addition to, or in
conjunction with, PCR-based methods to analyze polymorphisms in
genomic populations (see, Current Protocols in Human Genetics,
Dracopoli et al. (eds.) John Wiley & Sons, 1998).
[0115] In another embodiment, an endostatin gene, protein or a
fragment or domain thereof, can be used for construction of fusion
proteins. Finally, endostatin nucleic acids and gene products have
generic uses, such as supplemental sources of nucleic acids,
proteins and amino acids for food additives or cosmetic
products.
[0116] Portions or fragments of the cDNA sequences identified
herein (and the corresponding complete gene sequences) can be used
in numerous ways as polynucleotide reagents. For example, these
sequences can be used to: (i) screen for endostatin gene-specific
mutations or polymorphisms, (ii) map their respective genes on a
chromosome and, thus, locate gene regions associated with genetic
disease; (iii) identify an individual organism from a minute
biological sample (tissue typing); and (iv) aid in forensic
identification of a biological sample. These applications are
described in the subsections below.
[0117] A variety of methods can be employed to screen for the
presence of endostatin gene-specific mutations or polymorphisms
(including polymorphisms flanking an endostatin gene, e.g., ones
that cosegregate with a particular endostatin allele) and to detect
and/or assay levels of endostatin nucleic acid sequences.
[0118] Mutations or polymorphisms within or flanking the endostatin
gene can be detected by utilizing a number of techniques. Nucleic
acid from any nucleated cell, or any cell that expresses the
endostatin gene of interest, can be used as the starting point for
such assay techniques, and may be isolated according to standard
nucleic acid preparation procedures that are well known to those of
skill in the art.
[0119] Endostatin nucleic acid sequences may be used in
hybridization or amplification assays of biological samples to
detect abnormalities involving endostatin gene structure, including
point mutations, insertions, deletions, inversions, translocations
and chromosomal rearrangements. Such assays may include, but are
not limited to, Southern analyses, single-stranded conformational
polymorphism analyses (SSCP), and PCR analyses.
[0120] Diagnostic methods for the detection of endostatin
gene-specific mutations or polymorphisms can involve, for example,
contacting and incubating nucleic acids obtained from a sample,
e.g., derived from a patient sample or other appropriate cellular
source with one or more labeled nucleic acid reagents including
recombinant DNA molecules, cloned genes or degenerate variants
thereof, such as described, above, under conditions favorable for
the specific annealing of these reagents to their complementary
sequences within or flanking the endostatin gene. The diagnostic
methods of the present invention further encompass contacting and
incubating nucleic acids for the detection of single nucleotide
mutations or polymorphisms of the endostatin gene. Preferably,
these nucleic acid reagent sequences within the endostatin gene, or
chromosome nucleotide sequences flanking the endostatin gene are 15
to 30 nucleotides in length.
[0121] After incubation, all non-annealed nucleic acids are removed
from the nucleic acid:endostatin molecule hybrid. The presence of
nucleic acids that have hybridized, if any such molecules exist, is
then detected. Using such a detection scheme, the nucleic acid from
the cell type or tissue of interest can be immobilized, for
example, to a solid support such as a membrane, or a plastic
surface such as that on a microtiter plate or polystyrene beads. In
this case, after incubation, non-annealed, labeled nucleic acid
reagents of the type described above, are easily removed. Detection
of the remaining, annealed, labeled endostatin nucleic acid
reagents is accomplished using standard techniques well-known to
those in the art. The endostatin gene sequences to which the
nucleic acid reagents have annealed can be compared to the
annealing pattern expected from a normal endostatin gene sequence
in order to determine whether an endostatin gene mutation is
present.
[0122] In a preferred embodiment, endostatin mutations or
polymorphisms can be detected by using a microassay of endostatin
nucleic acid sequences immobilized to a substrate or "gene chip"
(see, e.g. Cronin et al., 1996, Human Mutation 7:244-255).
[0123] Alternative diagnostic methods for the detection of
endostatin gene-specific nucleic acid molecules (or endostatin
flanking sequences), in patient samples or other appropriate cell
sources, may involve their amplification, e.g., by PCR (the
experimental embodiment set forth in Mullis, 1987, U.S. Pat. No.
4,683,202), followed by the analysis of the amplified molecules
using techniques well known to those of skill in the art, such as,
for example, those listed above. The resulting amplified sequences
can be compared to those that would be expected if the nucleic acid
being amplified contained only normal copies of the endostatin gene
in order to determine whether an endostatin gene mutation or
polymorphism in linkage disequilibrium with a disease-causing
endostatin allele exists.
[0124] Additionally, well-known genotyping techniques can be
performed to identify individual organisms carrying endostatin gene
mutations. Such techniques include, for example, the use of
restriction fragment length polymorphisms (RFLPs), which involve
sequence variations in one of the recognition sites for the
specific restriction enzyme used.
[0125] Further, improved methods for analyzing DNA polymorphisms,
which can be utilized for the identification of endostatin
gene-specific mutations, have been described that capitalize on the
presence of variable numbers of short, tandemly repeated DNA
sequences between the restriction enzyme sites. For example, Weber
(U.S. Pat. No. 5,075,217) describes a DNA marker based on length
polymorphisms in blocks of (dC-dA)n-(dG-dT)n short tandem repeats.
The average separation of (dC-dA)n-(dG-dT)n blocks is estimated to
be 30,000-60,000 bp. Markers that are so closely spaced exhibit a
high frequency co-inheritance, and are extremely useful in the
identification of genetic mutations, such as, for example,
mutations within the endostatin gene, and the diagnosis of diseases
and disorders related to endostatin mutations.
[0126] Also, Caskey et al. (U.S. Pat. No. 5,364,759) describe a DNA
profiling assay for detecting short tri and tetra nucleotide repeat
sequences. The process includes extracting the DNA of interest,
such as the endostatin gene, amplifying the extracted DNA, and
labeling the repeat sequences to form a genotypic map of the
individual organism's DNA.
[0127] Other methods well known in the art may be used to identify
single nucleotide polymorphisms (SNPs), including biallelic SNPs or
biallelic markers which have two alleles, both of which are present
at a fairly high frequency in a population. Conventional techniques
for detecting SNPs include, e.g., conventional dot blot analysis,
SSCP analysis (see, e.g., Orita et al., 1989, Proc. Natl. Acad.
Sci. USA 86:2766-2770), denaturing gradient gel electrophoresis
(DGGE), heteroduplex analysis, mismatch cleavage detection, and
other routine techniques well known in the art (see, e.g.,
Sheffield et al., 1989, Proc. Natl. Acad. Sci. 86:5855-5892;
Grompe, 1993, Nature Genetics 5:111-117). Alternative, preferred
methods of detecting and mapping SNPs involve microsequencing
techniques wherein an SNP site in a target DNA is detecting by a
single nucleotide primer extension reaction (see, e.g., Goelet et
al., PCT Publication No. WO92/15712; Mundy, U.S. Pat. No.
4,656,127; Vary and Diamond, U.S. Pat. No. 4,851,331; Cohen et al.,
PCT Publication No. WO91/02087; Chee et al., PCT Publication No.
WO95/11995; Landegren et al., 1988, Science 241:1077-1080; Nicerson
et al., 1990, Proc. Natl. Acad. Sci. U.S.A. 87:8923-8927; Pastinen
et al., 1997, Genome Res. 7:606-614; Pastinen et al., 1996, Clin.
Chem. 42:1391-1397; Jalanko et al., 1992, Clin. Chem. 38:39-43;
Shumaker et al., 1996, Hum. Mutation 7:346-354; Caskey et al., PCT
Publication No. WO 95/00669).
[0128] The level of endostatin expression also can be determined by
first assaying for the level of gene expression. For example, RNA
from a cell type or tissue known, or suspected, to express the
endostatin gene, such as liver, may be isolated and tested
utilizing hybridization or PCR techniques such as are described,
above. The isolated cells can be derived from cell culture or from
a subject. The analysis of cells taken from culture may be a
necessary step in the assessment of cells to be used as part of a
cell-based gene therapy technique or, alternatively, to test the
effect of compounds on the expression of the endostatin gene.
[0129] In one embodiment of such a detection scheme, a cDNA
molecule is synthesized from an RNA molecule of interest (e.g., by
reverse transcription of the RNA molecule into cDNA). A sequence
within the cDNA is then used as the template for a nucleic acid
amplification reaction, such as a PCR amplification reaction, or
the like. The nucleic acid reagents used as synthesis initiation
reagents (e.g., primers) in the reverse transcription and nucleic
acid amplification steps of this method are chosen from among the
endostatin gene nucleic acid reagents described above. The
preferred lengths of such nucleic acid reagents are at least 9-30
nucleotides. For detection of the amplified product, the nucleic
acid amplification may be performed using radioactively or
non-radioactively labeled nucleotides. Alternatively, enough
amplified product may be made such that the product may be
visualized by standard ethidium bromide staining or by utilizing
any other suitable nucleic acid staining method.
[0130] Additionally, it is possible to perform such endostatin gene
expression assays in situ, i.e., directly upon tissue sections
(fixed and/or frozen) of subject tissue obtained from biopsies or
resections, such that no nucleic acid purification is necessary.
Nucleic acid reagents such as those described above, may be used as
probes and/or primers for such in situ procedures (see, for
example, Nuovo, G. J., 1992, "PCR In Situ Hybridization: Protocols
And Applications", Raven Press, NY).
[0131] Alternatively, if a sufficient quantity of the appropriate
cells can be obtained, standard Northern analysis can be performed
to determine the level of mRNA expression of the endostatin
gene.
[0132] Once the sequence (or a portion of the sequence) of a gene
has been isolated, this sequence can be used to map the location of
the gene on a chromosome. Accordingly, nucleic acid molecules
described herein, or fragments thereof, can be used to map the
location of the corresponding genes on a chromosome. The mapping of
the sequences to chromosomes is an important first step in
correlating these sequences with genes associated with disease.
[0133] Briefly, genes can be mapped to chromosomes by preparing PCR
primers (preferably 15-25 bp in length) from the sequence of a gene
of the invention. Computer analysis of the sequence of a gene of
the invention can be used to rapidly select primers that do not
span more than one exon in the genomic DNA, thus simplifying the
amplification process. These primers can then be used for PCR
screening of somatic cell hybrids containing individual human
chromosomes. Only those hybrids containing the human gene
corresponding to the gene sequences will yield an amplified
fragment. For a review of this technique, see D'Eustachio et al.,
1983, Science, 220:919-924.
[0134] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular sequence to a particular chromosome. Three
or more sequences can be assigned per day using a single thermal
cycler. Using the nucleic acid sequences of the invention to design
oligonucleotide primers, sublocalization can be achieved with
panels of fragments from specific chromosomes. Other mapping
strategies which can similarly be used to map a gene to its
chromosome include in situ hybridization (described in Fan et al.,
1990, Proc. Natl. Acad. Sci. USA 87:6223-27), pre-screening with
labeled flow-sorted chromosomes (Popp S, et al., 1993, Hum Genet.,
92(6):527-32) and pre-selection by hybridization to chromosome
specific cDNA libraries. Fluorescence in situ hybridization (FISH)
of a DNA sequence to a metaphase chromosomal spread can further be
used to provide a precise chromosomal location in one step. (For a
review of this technique, see Verma et al., Human Chromosomes: A
Manual of Basic Techniques, Pergamon Press, New York, 1988.)
[0135] Reagents for chromosome mapping can be used individually to
mark a single chromosome or a single site on that chromosome, or
panels of reagents can be used for marking multiple sites and/or
multiple chromosomes. Reagents corresponding to noncoding regions
of the genes actually are preferred for mapping purposes. Coding
sequences are more likely to be conserved within gene families,
thus increasing the chance of cross hybridizations during
chromosomal mapping.
[0136] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. (Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man, available
on-line through Johns Hopkins University Welch Medical Library).
The relationship between genes and disease, mapped to the same
chromosomal region, can then be identified through linkage analysis
(co-inheritance of physically adjacent genes), described in, e.g.,
Egeland et al.,1987, Nature 325:783-787.
[0137] Moreover, differences in the DNA sequences between
individual organisms affected and unaffected with a disease
associated with a gene of the invention can be determined. If a
mutation is observed in some or all of the affected individual
organisms but not in any unaffected individual organisms, then the
mutation is likely to be the causative agent of the particular
disease. Comparison of affected and unaffected individual organisms
generally involves first looking for structural alterations in the
chromosomes such as deletions or translocations that are visible
from chromosome spreads or detectable using PCR based on that DNA
sequence. Ultimately, complete sequencing of genes from several
individual organisms can be performed to confirm the presence of a
mutation and to distinguish mutations from polymorphisms.
[0138] The nucleic acid sequences of the present invention also can
be used to identify individual organisms from minute biological
samples. The United States military, for example, is considering
the use of restriction fragment length polymorphism (RFLP) for
identification of its personnel. In this technique, an individual
organism's genomic DNA is digested with one or more restriction
enzymes, and probed on a Southern blot to yield unique bands for
identification. This method does not suffer from the current
limitations of "Dog Tags" which can be lost, switched, or stolen,
making positive identification difficult. The sequences of the
present invention are useful as additional DNA markers for RFLP
(described in U.S. Pat. No. 5,272,057).
[0139] Furthermore, the sequences of the present invention can be
used to provide an alternative technique which determines the
actual base-by-base DNA sequence of selected portions of an
individual organism's genome. Thus, the nucleic acid sequences
described herein can be used to prepare two PCR primers from the 5'
and 3' ends of the sequences. These primers can then be used to
amplify an individual organism's DNA and subsequently sequence
it.
[0140] Panels of corresponding DNA sequences from individual
organisms, prepared in this manner, can provide unique individual
identifications, as each individual organism will have a unique set
of such DNA sequences due to allelic differences. The sequences of
the present invention can be used to obtain such identification
sequences from individual organisms and from tissue. The nucleic
acid sequences of the invention uniquely represent portions of the
human genome. Allelic variation occurs to some degree in the coding
regions of these sequences, and to a greater degree in the
noncoding regions. It is estimated that allelic variation between
individual humans occurs with a frequency of about once per each
500 bases. Each of the sequences described herein can, to some
degree, be used as a standard against which DNA from an individual
organism can be compared for identification purposes. Because
greater numbers of polymorphisms occur in the noncoding regions,
fewer sequences are necessary to differentiate individuals.
[0141] If a panel of reagents from the nucleic acid sequences
described herein is used to generate a unique identification
database for an individual, those same reagents can later be used
to identify tissue from that individual. Using the unique
identification database, positive identification of the individual
organism, living or dead, can be made from extremely small tissue
samples.
[0142] DNA-based identification techniques can also be used in
forensic biology. Forensic biology is a scientific field employing
genetic typing of biological evidence found at a crime scene as a
means for positively identifying, for example, a perpetrator of a
crime. To make such an identification, PCR technology can be used
to amplify DNA sequences taken from very small biological samples
such as tissues, e.g., hair or skin, or body fluids, e.g., blood,
saliva, or semen found at a crime scene. The amplified sequence can
then be compared to a standard, thereby allowing identification of
the origin of the biological sample.
[0143] The sequences of the present invention can be used to
provide polynucleotide reagents, e.g., PCR primers, targeted to
specific loci in the human genome, which can enhance the
reliability of DNA-based forensic identifications by, for example,
providing another "identification marker" (i.e., another DNA
sequence that is unique to a particular individual organism). As
mentioned above, actual base sequence information can be used for
identification as an accurate alternative to patterns formed by
restriction enzyme generated fragments. Sequences targeted to
noncoding regions are particularly appropriate for this use as
greater numbers of polymorphisms occur in the noncoding regions,
making it easier to differentiate individual organisms using this
technique. Examples of polynucleotide reagents include the nucleic
acid sequences of the invention or portions thereof, e.g.,
fragments derived from noncoding regions having a length of at
least 20 or 30 bases.
[0144] The nucleic acid sequences described herein can further be
used to provide polynucleotide reagents, e.g., labeled or labelable
probes which can be used in, for example, an in situ hybridization
technique, to identify a specific tissue, e.g., liver tissue. This
can be very useful in cases where a forensic pathologist is
presented with a tissue of unknown origin. Panels of such probes
can be used to identify tissue by species and/or by organ type.
[0145] Antibodies directed against unimpaired or mutant endostatin
gene products or conserved variants or peptide fragments thereof,
which are discussed, above, may also be used as diagnostics and
prognostics for an-angiogenesis-related disorder, e.g., cancer, as
described herein. Such methods may be used to detect abnormalities
in the level of endostatin gene product synthesis or expression, or
abnormalities in the structure, temporal expression, and/or
physical location of endostatin gene product. The antibodies and
immunoassay methods described below have, for example, important in
vitro applications in purifying endostatin gene products and in
assessing the efficacy of treatments for angiogenesis-related
disorders, e.g., cancer. Antibodies, or fragments of antibodies,
such as those described below, may be used to screen potentially
therapeutic compounds in vitro to determine their effects on
endostatin gene expression and endostatin peptide production. The
compounds that have beneficial effects on an angiogenesis-related
disorder, e.g., cancer, can be identified, and a therapeutically
effective dose determined.
[0146] In vitro immunoassays may also be used, for example, to
assess the efficacy of cell-based gene therapy for an
angiogenesis-related disorder, e.g., cancer. Antibodies directed
against endostatin peptides may be used in vitro to determine, for
example, the level of endostatin gene expression achieved in cells
genetically engineered to produce endostatin peptides. In the case
of intracellular endostatin gene products, such an assessment is
done, preferably, using cell lysates or extracts. Such analysis
allows for a determination of the number of transformed cells
necessary to achieve therapeutic efficacy in vivo, as well as
optimization of the gene replacement protocol.
[0147] The tissue or cell type to be analyzed will generally
include those that are known, or suspected, to express the
endostatin gene. The protein isolation methods employed herein may,
for example, be such as those described in Harlow and Lane (1988,
"Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y.). The isolated cells can be derived
from cell culture or from a subject. The analysis of cells taken
from culture may be a necessary step in the assessment of cells to
be used as part of a cell-based gene therapy technique or,
alternatively, to test the effect of compounds on the expression of
the endostatin gene.
[0148] Preferred diagnostic methods for the detection of endostatin
gene products or conserved variants or peptide fragments thereof,
may involve, for example, immunoassays wherein the endostatin gene
products or conserved variants or peptide fragments are detected by
their interaction with an anti-endostatin gene product-specific
antibody.
[0149] For example, antibodies, or fragments of antibodies, such as
those described, above, useful in the present invention may be used
to quantitatively or qualitatively detect the presence of
endostatin gene products or conserved variants or peptide fragments
thereof. This can be accomplished, for example, by
immunofluorescence techniques employing a fluorescently labeled
antibody (see below, this section) coupled with light microscopic,
flow cytometric, or fluorimetric detection. Such techniques are
especially preferred for endostatin gene products that are
expressed on the cell surface.
[0150] The antibodies (or fragments thereof) useful in the present
invention may, additionally, be employed histologically, as in
immunofluorescence or immunoelectron microscopy, for in situ
detection of endostatin gene products or conserved variants or
peptide fragments thereof. In situ detection may be accomplished by
removing a histological specimen from a subject, and applying
thereto a labeled antibody of the present invention. The antibody
(or fragment) is preferably applied by overlaying the labeled
antibody (or fragment) onto a biological sample. Through the use of
such a procedure, it is possible to determine not only the presence
of the endostatin gene product, or conserved variants or peptide
fragments, but also its distribution in the examined tissue. Using
the present invention, those of ordinary skill will readily
perceive that any of a wide variety of histological methods (such
as staining procedures) can be modified in order to achieve such in
situ detection.
[0151] Immunoassays for endostatin gene products or conserved
variants or peptide fragments thereof will typically comprise
incubating a sample, such as a biological fluid, a tissue extract,
freshly harvested cells, or lysates of cells, that have been
incubated in cell culture, in the presence of a detectably labeled
antibody capable of identifying endostatin gene products or
conserved variants or peptide fragments thereof, and detecting the
bound antibody by any of a number of techniques well-known in the
art.
[0152] The biological sample may be brought in contact with and
immobilized onto a solid phase support or carrier such as
nitrocellulose, or other solid support that is capable of
immobilizing cells, cell particles or soluble proteins. The support
may then be washed with suitable buffers followed by treatment with
the detectably labeled endostatin gene specific antibody. The solid
phase support may then be washed with the buffer a second time to
remove unbound antibody. The amount of bound label on solid support
may then be detected by conventional means.
[0153] By "solid phase support or carrier" is intended any support
capable of binding an antigen or an antibody. Well-known supports
or carriers include glass, polystyrene, polypropylene,
polyethylene, dextran, nylon, amylases, natural and modified
celluloses, polyacrylamides, gabbros, and magnetite. The nature of
the carrier can be either soluble to some extent or insoluble for
the purposes of the present invention. The support material may
have virtually any possible structural configuration so long as the
coupled molecule is capable of binding to an antigen or antibody.
Thus, the support configuration may be spherical, as in a bead, or
cylindrical, as in the inside surface of a test tube, or the
external surface of a rod. Alternatively, the surface may be flat
such as a sheet, test strip, etc. Preferred supports include
polystyrene beads. Those skilled in the art will know many other
suitable carriers for binding antibody or antigen, or will be able
to ascertain the same by use of routine experimentation.
[0154] The binding activity of a given lot of anti-endostatin gene
product antibody may be determined according to well known methods.
Those skilled in the art will be able to determine operative and
optimal assay conditions for each determination by employing
routine experimentation.
[0155] One of the ways in which the endostatin gene
peptide-specific antibody can be detectably labeled is by linking
the same to an enzyme and use in an enzyme immunoassay (EIA)
(Voller, A., "The Enzyme Linked Immunosorbent Assay (ELISA)", 1978,
Diagnostic Horizons 2, 1-7, Microbiological Associates Quarterly
Publication, Walkersville, Md.); Voller, A. et al., 1978, J. Clin.
Pathol. 31, 507-520; Butler, J. E., 1981, Meth. Enzymol. 73,
482-523; Maggio, E. (ed.), 1980, Enzyme Immunoassay, CRC Press,
Boca Raton, Fla.,; Ishikawa, E. et al., (eds.), 1981, Enzyme
Immunoassay, Kgaku Shoin, Tokyo). The enzyme which is bound to the
antibody will react with an appropriate substrate, preferably a
chromogenic substrate, in such a manner as to produce a chemical
moiety that can be detected, for example, by spectrophotometric,
fluorimetric or by visual means. Enzymes that can be used to
detectably label the antibody include, but are not limited to,
malate dehydrogenase, staphylococcal nuclease, delta-5-steroid
isomerase, yeast alcohol dehydrogenase, .beta.-glycerophosphate,
dehydrogenase, triose phosphate isomerase, horseradish peroxidase,
alkaline phosphatase, asparaginase, glucose oxidase,
.beta.-galactosidase, ribonuclease, urease, catalase,
glucose-6-phosphate dehydrogenase, glucoamylase and
acetylcholinesterase. The detection can be accomplished by
colorimetric methods that employ a chromogenic substrate for the
enzyme. Detection may also be accomplished by visual comparison of
the extent of enzymatic reaction of a substrate in comparison with
similarly prepared standards.
[0156] Detection also may be accomplished using any of a variety of
other immunoassays. For example, by radioactively labeling the
antibodies or antibody fragments, it is possible to detect
endostatin gene peptides through the use of a radioimmunoassay
(RIA) (see, for example, Weintraub, B., Principles of
Radioimmunoassays, Seventh Training Course on Radioligand Assay
Techniques, The Endocrine Society, March, 1986). The radioactive
isotope can be detected by such means as the use of a gamma counter
or a scintillation counter or by autoradiography.
[0157] It is also possible to label the antibody with a fluorescent
compound. When the fluorescently labeled antibody is exposed to
light of the proper wave length, its presence can then be detected
due to fluorescence. Among the most commonly used fluorescent
labeling compounds are fluorescein isothiocyanate, rhodamine,
phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and
fluorescamine.
[0158] The antibody can also be detectably labeled using
fluorescence emitting metals such as 152Eu, or others of the
lanthanide series. These metals can be attached to the antibody
using such metal chelating groups as diethylenetriaminepentacetic
acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
[0159] The antibody also can be detectably labeled by coupling it
to a chemiluminescent compound. The presence of the
chemiluminescent-tagged antibody is then determined by detecting
the presence of luminescence that arises during the course of a
chemical reaction. Examples of particularly useful chemiluminescent
labeling compounds are luminol, isoluminol, theromatic acridinium
ester, imidazole, acridinium salt and oxalate ester.
[0160] Likewise, a bioluminescent compound may be used to label the
antibody of the present invention. Bioluminescence is a type of
chemiluminescence found in biological systems in which a catalytic
protein increases the efficiency of the chemiluminescent reaction.
The presence of a bioluminescent protein is determined by detecting
the presence of luminescence. Important bioluminescent compounds
for purposes of labeling are luciferin, luciferase and
aequorin.
[0161] The following assays are designed to identify compounds that
bind to an endostatin gene product, proteins, e.g., intracellular
proteins or portions of proteins that interact with an endostatin
gene product, compounds that interfere with the interaction of an
endostatin gene product with intracellular proteins and compounds
that modulate the activity of an endostatin gene (i.e., modulate
the level of endostatin gene expression and/or modulate the level
of endostatin gene product activity). Assays may additionally be
utilized that identify compounds that bind to endostatin gene
regulatory sequences (e.g., promoter sequences; see e.g., Platt,
1994, J. Biol. Chem. 269, 28558-28562), and that may modulate the
level of endostatin gene expression. Compounds may include, but are
not limited to, small organic molecules, such as ones that are able
to cross the blood-brain barrier, gain entry into an appropriate
cell and affect expression of the endostatin gene or some other
gene involved in an endostatin regulatory pathway, or intracellular
proteins.
[0162] Methods for the identification of such intracellular
proteins are described, below. Such intracellular proteins may be
involved in the control and/or regulation of mood. Further, among
these compounds are compounds that affect the level of endostatin
gene expression and/or endostatin gene product activity and that
can be used in the therapeutic treatment of endostatin disorders,
e.g., cancer, as described, below.
[0163] Compounds may include, but are not limited to, peptides such
as, for example, soluble peptides, including, but not limited to,
Ig-tailed fusion peptides, and members of random peptide libraries;
(see, e.g., Lam, et al., 1991, Nature 354, 82-84; Houghten, et al.,
1991, Nature 354, 84-86), and combinatorial chemistry-derived
molecular library made of D- and/or L-configuration amino acids,
phosphopeptides (including, but not limited to members of random or
partially degenerate, directed phosphopeptide libraries; see, e.g.,
Songyang, et al., 1993, Cell 72, 767-778), antibodies (including,
but not limited to, polyclonal, monoclonal, human, humanized,
anti-idiotypic, chimerc or single chain antibodies, and FAb, F(ab
.quadrature.)2 and FAb expression library fragments, and
epitope-binding fragments thereof), and small organic or inorganic
molecules.
[0164] Such compounds may also comprise compounds, in particular
drugs or members of classes or families of drugs, known to
ameliorate or exacerbate the symptoms of an angiogenesis-related
disorder. Such compounds include, but are not limited to,
angiogenesis inhibitors: metalloproteinase inhibitors, FGF and VEGF
receptor inhibitors, COX-2 inhibitors, INF, IL-12, Taxol,
vinblastine, thalidomide etc. Preferably such compounds are
utilized in a manner (e.g., different dosage, mode of
administration, and/or co-administration with one or more
additional compounds) that differs from the manner in which such
compounds have been administered previously.
[0165] Compounds identified via assays such as those described
herein may be Useful, for example, in elaborating the biological
function of the endostatin gene product, and for ameliorating
angiogenesis-related disorders, e.g., cancer. For example,
compounds identified via such techniques can provide lead compounds
to be tested for an ability to modulate an endostatin-mediated
process and/or to ameliorate symptoms of a angiogenesis-related
disorder. Assays for testing the effectiveness of compounds,
identified by, for example, techniques such as those described
above, are discussed, below.
[0166] In vitro systems may be designed to identify compounds that
bind endostatin gene products of the invention, such as, for
example, endostatin polypeptides. Compounds identified may be
useful, for example, in modulating the activity of unimpaired
and/or mutant endostatin gene products, may be useful in
elucidating the biological function of the endostatin gene product,
may be utilized in screens for identifying compounds that disrupt
normal endostatin gene product interactions, or may in themselves
disrupt such interactions, and can provide lead compounds to be
further tested for an ability to modulate an endostatin-mediated
process and/or to ameliorate symptoms of an angiogenesis-related
disorder.
[0167] The principle of the assays used to identify compounds that
bind to endostatin gene products involves preparing a reaction
mixture of the endostatin gene product and the test compound under
conditions and for a time sufficient to allow the two components to
interact and bind, thus forming a complex that can be removed
and/or detected in the reaction mixture. These assays can be
conducted in a variety of ways. For example, one method to conduct
such an assay would involve anchoring an endostatin gene product or
the test substance onto a solid phase and detecting endostatin gene
product/test compound complexes anchored on the solid phase at the
end of the reaction. In one embodiment of such a method, the
endostatin gene product may be anchored onto a solid surface, and
the test compound, which is not anchored, may be labeled, either
directly or indirectly.
[0168] In practice, microtiter plates may conveniently be utilized
as the solid phase. The anchored component may be immobilized by
non-covalent or covalent attachments. Non-covalent attachment may
be accomplished by simply coating the solid surface with a solution
of the protein and drying. Alternatively, an immobilized antibody,
preferably a monoclonal antibody, specific for the protein to be
immobilized may be used to anchor the protein to the solid surface.
The surfaces may be prepared in advance and stored.
[0169] In order to conduct the assay, the non-immobilized component
is added to the coated surface containing the anchored component.
After the reaction is complete, unreacted components are removed
(e.g., by washing) under conditions such that any complexes formed
will remain immobilized on the solid surface. The detection of
complexes anchored on the solid surface can be accomplished in a
number of ways. Where the previously non-immobilized component is
pre-labeled, the detection of label immobilized on the surface
indicates that complexes were formed. Where the previously
non-immobilized component is not pre-labeled, an indirect label can
be used to detect complexes anchored on the surface; e.g., using a
labeled antibody specific for the previously non-immobilized
component (the antibody, in turn, may be directly labeled or
indirectly labeled with a labeled anti-Ig antibody).
[0170] Alternatively, a reaction can be conducted in a liquid
phase, the reaction products separated from unreacted components,
and complexes detected; e.g., using an immobilized antibody
specific for endostatin gene product or the test compound to anchor
any complexes formed in solution, and a labeled antibody specific
for the other component of the possible complex to detect anchored
complexes.
[0171] Any method suitable for detecting protein-protein
interactions may be employed for identifying endostatin
protein-protein interactions.
[0172] Among the traditional methods that may be employed are
co-immunoprecipitation, cross-linking and co-purification through
gradients or chromatographic columns. Utilizing procedures such as
these allows for the identification of proteins, including
intracellular proteins, that interact with endostatin gene
products. Once isolated, such a protein can be identified and can
be used in conjunction with standard techniques, to identify
proteins it interacts with. For example, at least a portion of the
amino acid sequence of a protein that interacts with the endostatin
gene product can be ascertained using techniques well known to
those of skill in the art, such as via the Edman degradation
technique (see, e.g., Creighton, 1983, "Proteins: Structures and
Molecular Principles," W.H. Freeman & Co., N.Y., pp.3449). The
amino acid sequence obtained may be used as a guide for the
generation of oligonucleotide mixtures that can be used to screen
for gene sequences encoding such proteins. Screening made be
accomplished, for example, by standard hybridization or PCR
techniques. Techniques for the generation of oligonucleotide
mixtures and the screening are well-known. (See, e.g., Ausubel,
supra, and 1990, "PCR Protocols: A Guide to Methods and
Applications," Innis, et al., eds. Academic Press, Inc., New
York).
[0173] Additionally, methods may be employed that result in the
simultaneous identification of genes that encode a protein which
interacts with an endostatin protein. These methods include, for
example, probing expression libraries with labeled endostatin
protein, using endostatin protein in a manner similar to the well
known technique of antibody probing of gt11 libraries.
[0174] One method that detects protein interactions in vivo, the
two-hybrid system, is described in detail for illustration only and
not by way of limitation. One version of this system has been
described (Chien, et al., 1991, Proc. Natl. Acad. Sci. USA,
88:9578-9582) and is commercially available from Clontech (Palo
Alto, Calif.).
[0175] Briefly, utilizing such a system, plasmids are constructed
that encode two hybrid proteins: one consists of the DNA-binding
domain of a transcription activator protein fused to the endostatin
gene product and the other consists of the transcription activator
protein's activation domain fused to an unknown protein that is
encoded by a cDNA that has been recombined into this plasmid as
part of a cDNA library. The DNA-binding domain fusion plasmid and
the cDNA library are transformed into a strain of the yeast
Saccharomyces cerevisiae that contains a reporter gene (e.g., HBS
or lacZ) whose regulatory region contains the transcription
activator's binding site. Either hybrid protein alone cannot
activate transcription of the reporter gene: the DNA-binding domain
hybrid cannot because it does not provide activation function and
the activation domain hybrid cannot because it cannot localize to
the activator's binding sites. Interaction of the two hybrid
proteins reconstitutes the functional activator protein and results
in expression of the reporter gene, which is detected by an assay
for the reporter gene product.
[0176] The two-hybrid system or related methodology may be used to
screen activation domain libraries for proteins that interact with
the "bait" gene product. By way of example, and not by way of
limitation, endostatin gene products may be used as the bait gene
product. Total genomic or cDNA sequences are fused to the DNA
encoding an activation domain. This library and a plasmid encoding
a hybrid of a bait endostatin gene product fused to the DNA-binding
domain are co-transformed into a yeast reporter strain, and the
resulting transformants are screened for those that express the
reporter gene. For example, and not by way of limitation, a bait
endostatin gene sequence, such as the open reading frame of the
endostatin gene, can be cloned into a vector such that it is
translationally fused to the DNA encoding the DNA-binding domain of
the GAL4 protein. These colonies are purified and the library
plasmids responsible for reporter gene expression are isolated. DNA
sequencing is then used to identify the proteins encoded by the
library plasmids.
[0177] A cDNA library of the cell line from which proteins that
interact with the bait endostatin gene product can be made using
methods routinely practiced in the art. According to the particular
system described herein, for example, the cDNA fragments can be
inserted into a vector such that they are translationally fused to
the transcriptional activation domain of GAL4. This library can be
co-transformed along with the bait endostatin gene-GAL4 fusion
plasmid into a yeast strain that contains a lacZ gene driven by a
promoter that contains GAL4 activation sequence. A cDNA encoded
protein, fused to GAL4 transcriptional activation domain, that
interacts with bait endostatin gene product will reconstitute an
active GAL4 protein and thereby drive expression of the HIS3 gene.
Colonies that express HIS3 can be detected by their growth on petri
dishes containing semi-solid agar based media lacking histidine.
The cDNA can then be purified from these strains, and used to
produce and isolate the bait endostatin gene-interacting protein
using techniques routinely practiced in the art.
[0178] Endostatin gene products of the invention may, in vivo,
interact with one or more macromolecules, including cellular or
extracellular macromolecules, such as proteins. Such macromolecules
may include, but are not limited to, other proteins, such as
cellular receptors, or nucleic acid molecules and those proteins
identified via methods such as those described, above. For example,
the endostatin gene product may interact with a receptor as a
peptide hormone or neuropeptide. For purposes of this discussion,
the macromolecules are referred to herein as "binding partners".
Compounds that disrupt endostatin binding in this way may be useful
in regulating the activity of the endostatin gene product,
especially mutant endostatin gene products. For example, such
compounds may interfere with the interaction of the endostatin gene
product, with its receptor. Such compounds may include, but are not
limited to, molecules such as peptides, and the like, as described,
for example, above, which would be capable of gaining access to an
endostatin gene product.
[0179] The basic principle of the assay systems used to identify
compounds that interfere with the interaction between the
endostatin gene product and its binding partner or partners
involves preparing a reaction mixture containing the endostatin
gene product, and the binding partner under conditions and for a
time sufficient to allow the two to interact and bind, thus forming
a complex. In order to test a compound for inhibitory activity, the
reaction mixture is prepared in the presence and absence of the
test compound. The test compound may be initially included in the
reaction mixture, or may be added at a time subsequent to the
addition of the endostatin gene product and its binding partner.
Control reaction mixtures are incubated without the test compound
or with a placebo. The formation of any complexes between the
endostatin gene protein and the binding partner is then detected.
The formation of a complex in the control reaction, but not in the
reaction mixture containing the test compound, indicates that the
compound interferes with the interaction of the endostatin gene
protein and the interactive binding partner. Additionally, complex
formation within reaction mixtures containing the test compound and
normal endostatin gene protein may also be compared to complex
formation within reaction mixtures containing the test compound and
a mutant endostatin gene protein. This comparison may be important
in those cases wherein it is desirable to identify compounds that
disrupt interactions of mutant but not normal endostatin gene
proteins.
[0180] The assay for compounds that interfere with the interaction
of the endostatin gene products and binding partners can be
conducted in a heterogeneous or homogeneous format. Heterogeneous
assays involve anchoring either the endostatin gene product or the
binding partner onto a solid phase and detecting complexes anchored
on the solid phase at the end of the reaction. In homogeneous
assays, the entire reaction is carried out in a liquid phase. In
either approach, the order of addition of reactants can be varied
to obtain different information about the compounds being tested.
For example, test compounds that interfere with the interaction
between the endostatin gene products and the binding partners,
e.g., by competition, can be identified by conducting the reaction
in the presence of the test substance; i.e., by adding the test
substance to the reaction mixture prior to or simultaneously with
the endostatin gene protein and interactive intracellular binding
partner. Alternatively, test compounds that disrupt preformed
complexes, e.g., compounds with higher binding constants that
displace one of the components from the complex, can be tested by
adding the test compound to the reaction mixture after complexes
have been formed. The various formats are described briefly
below.
[0181] In a heterogeneous assay system, either the endostatin gene
product or the interactive binding partner, is anchored onto a
solid surface, while the non-anchored species is labeled, either
directly or indirectly. In practice, microtiter plates are
conveniently utilized. The anchored species may be immobilized by
non-covalent or covalent attachments. Non-covalent attachment may
be accomplished simply by coating the solid surface with a solution
of the endostatin gene product or binding partner and drying.
Alternatively, an immobilized antibody specific for the species to
be anchored may be used to anchor the species to the solid surface.
The surfaces may be prepared in advance and stored.
[0182] In order to conduct the assay, the partner of the
immobilized species is exposed to the coated surface with or
without the test compound. After the reaction is complete,
unreacted components are removed (e.g., by washing) and any
complexes formed will remain immobilized on the solid surface. The
detection of complexes anchored on the solid surface can be
accomplished in a number of ways. Where the non-immobilized species
is pre-labeled, the detection of label immobilized on the surface
indicates that complexes were formed. Where the non-immobilized
species is not pre-labeled, an indirect label can be used to detect
complexes anchored on the surface; e.g., using a labeled antibody
specific for the initially non-immobilized species (the antibody,
in turn, may be directly labeled or indirectly labeled with a
labeled anti-Ig antibody). Depending upon the order of addition of
reaction components, test compounds that inhibit complex formation
or that disrupt preformed complexes can be detected.
[0183] Alternatively, the reaction can be conducted in a liquid
phase in the presence or absence of the test compound, the reaction
products separated from unreacted components, and complexes
detected; e.g., using an immobilized antibody specific for one of
the binding components to anchor any complexes formed in solution,
and a labeled antibody specific for the other partner to detect
anchored complexes. Again, depending upon the order of addition of
reactants to the liquid phase, test compounds that inhibit complex
or that disrupt preformed complexes can be identified.
[0184] In an alternate embodiment of the invention, a homogeneous
assay can be used. In this approach, a preformed complex of the
endostatin gene protein and the interactive binding partner is
prepared in which either the endostatin gene product or its binding
partners is labeled, but the signal generated by the label is
quenched due to complex formation (see, e.g., U.S. Pat. No.
4,109,496 by Rubenstein which utilizes this approach for
immunoassays). The addition of a test substance that competes with
and displaces one of the species from the preformed complex will
result in the generation of a signal above background. In this way,
test substances that disrupt a endostatin gene protein/binding
partner interaction can be identified.
[0185] In a particular embodiment, the endostatin gene product can
be prepared for immobilization using recombinant DNA techniques
described above. For example, the endostatin coding region can be
fused to a glutathione-S-transferase (GST) gene using a fusion
vector, such as pGEX-5X-1, in such a manner that its binding
activity is maintained in the resulting fusion protein. The
interactive binding partner can be purified and used to raise a
monoclonal antibody, using methods routinely practiced in the art
and described above. This antibody can be labeled with the
radioactive isotope 125I, for example, by methods routinely
practiced in the art. In a heterogeneous assay, e.g., the
GST-endostatin fusion protein can be anchored to
glutathione-agarose beads. The interactive binding partner can then
be added in the presence or absence of the test compound in a
manner that allows interaction and binding to occur. At the end of
the reaction period, unbound material can be washed away, and the
labeled monoclonal antibody can be added to the system and allowed
to bind to the complexed components. The interaction between the
endostatin gene protein and the interactive binding partner can be
detected by measuring the amount of radioactivity that remains
associated with the glutathione-agarose beads. A successful
inhibition of the interaction by the test compound will result in a
decrease in measured radioactivity.
[0186] Alternatively, the GST-endostatin gene fusion protein and
the interactive binding partner can be mixed together in liquid in
the absence of the solid glutathione-agarose beads. The test
compound can be added either during or after the species are
allowed to interact. This mixture can then be added to the
glutathione-agarose beads and unbound material is washed away.
Again the extent of inhibition of the endostatin gene
product/binding partner interaction can be detected by adding the
labeled antibody and measuring the radioactivity associated with
the beads.
[0187] In another embodiment of the invention, these same
techniques can be employed using peptide fragments that correspond
to the binding domains of the endostatin protein and/or the
interactive or binding partner (in cases where the binding partner
is a protein), in place of one or both of the full length proteins.
Any number of methods routinely practiced in the art can be used to
identify and isolate the binding sites. These methods include, but
are not limited to, mutagenesis of the gene encoding one of the
proteins and screening for disruption of binding in a
co-immunoprecipitation assay. Compensating mutations in the gene
encoding the second species in the complex can then be selected.
Sequence analysis of the genes encoding the respective proteins
will reveal the mutations that correspond to the region of the
protein involved in interactive binding. Alternatively, one protein
can be anchored to a solid surface using methods described in this
section, above, and allowed to interact with and bind to its
labeled binding partner, which has been treated with a proteolytic
enzyme, such as trypsin. After washing, a short, labeled peptide
comprising the binding domain may remain associated with the solid
material, which can be isolated and identified by amino acid
sequencing. Also, once the gene coding for the segments can be
engineered to express peptide fragments of the protein, which can
then be tested for binding activity and purified or
synthesized.
[0188] For example, and not by way of limitation, an endostatin
gene product can be anchored to a solid material as described,
above, in this section by making a GST-endostatin fusion protein
and allowing it to bind to glutathione agarose beads. The
interactive binding partner obtained can be labeled with a
radioactive isotope, such as 35S, and cleaved with a proteolytic
enzyme such as trypsin. Cleavage products can then be added to the
anchored GST-endostatin fusion protein and allowed to bind. After
washing away unbound peptides, labeled bound material, representing
the binding partner binding domain, can be eluted, purified, and
analyzed for amino acid sequence by well-known methods. Peptides so
identified can be produced synthetically or fused to appropriate
facilitative proteins using recombinant DNA technology.
[0189] Compounds including, but not limited to, binding compounds
identified via assay techniques such as those described, above, can
be tested for the ability to ameliorate symptoms of an
angiogenesis-related disorder, e.g., angiogenesis-dependent cancer,
including, for example, solid tumors, blood born tumors such as
leukemias, and tumor metastases; benign tumors, for example
hemangiomas, acoustic neuromas, neurofibromas, trachomas, and
pyogenic granulomas; rheumatoid arthritis; psoriasis; ocular
angiogenic diseases, for example, diabetic retinopathy, retinopathy
of prematurity, macular degeneration, corneal graft rejection,
neovascular glaucoma, retrolental fibroplasia, rubeosis;
Osler-Webber Syndrome; myocardial angiogenesis; plaque
neovascularization; telangiectasia; hemophiliac joints;
angiofibroma; wound granulation; corornary collaterals; cerebral
collaterals; arteriovenous malformations; ischemic limb
angiogenesis; diabetic neovascularization; macular degeneration;
fractures; vasculogenesis; hematopoiesis; ovulation; menstruation;
placentation; intestinal adhesions; atherosclerosis; scleroderma;
hypertrophic scars, i.e., keloids; cat scratch disease (Rochele
minalia quintosa); and ulcers (Helobacter pylori). It should be
noted that the assays described herein can identify compounds that
affect endostatin gene activity by either affecting endostatin gene
expression or by affecting the level of endostatin gene product
activity. For example, compounds may be identified that are
involved in another step in the pathway in which the endostatin
gene and/or endostatin gene product is involved and, by affecting
this same pathway may modulate the effect of endostatin on the
development of an angiogenesis-related disorder such as cancer.
Such compounds can be used as part of a therapeutic method for the
treatment of the disorder.
[0190] Described below are cell-based and animal model-based assays
for the identification of compounds exhibiting such an ability to
ameliorate symptoms of an angiogenesis-related disorder, e.g.,
cancer.
[0191] First, cell-based systems can be used to identify compounds
that may act to ameliorate symptoms of an angiogenesis-related
disorder, e.g., cancer. Such cell systems can include, for example,
recombinant or non-recombinant cell, such as cell lines, that
express the endostatin gene.
[0192] In utilizing such cell systems, cells that express
endostatin may be exposed to a compound suspected of exhibiting an
ability to ameliorate symptoms of an angiogenesis-related disorder,
e.g., cancer, at a sufficient concentration and for a sufficient
time to elicit such an amelioration of such symptoms in the exposed
cells. After exposure, the cells can be assayed to measure
alterations in the expression of the endostatin gene, e.g., by
assaying cell lysates for endostatin mRNA transcripts (e.g., by
Northern analysis) or for endostatin gene products expressed by the
cell; compounds that modulate expression of the endostatin gene are
good candidates as therapeutics. Alternatively, the cells are
examined to determine whether one or more cellular phenotypes
associated with an angiogenesis-related disorder, e.g., cancer, has
been altered to resemble a more normal or unimpaired, unaffected
phenotype, or a phenotype more likely to produce a lower incidence
or severity of disorder symptoms.
[0193] In addition, animal-based systems or models for an
angiogenesis-related disorder, e.g., cancer, may be used to
identify compounds capable of ameliorating symptoms of the
disorder. Such animal-based systems or models may include, for
example, transgenic mice, e.g., mice that have been genetically
engineered to express exogenous or endogenous endostatin sequences
or, alternatively, to no longer express endogenous endostatin gene
sequences (i.e., "knock-out" mice). Such animal models may be used
as test substrates for the identification of drugs,
pharmaceuticals, therapies and interventions that may be effective
in treating such disorders. For example, animal models may be
exposed to a compound suspected of exhibiting an ability to
ameliorate symptoms, at a sufficient concentration and for a
sufficient time to elicit such an amelioration of symptoms of an
angiogenesis-related disorder, e.g., cancer, in the exposed
animals. The response of the animals to the exposure may be
monitored by assessing the reversal of such symptoms.
[0194] With regard to intervention, any treatments that reverse any
aspect of symptoms of an angiogenesis-related disorder, e.g.,
cancer, should be considered as candidates for human therapeutic
intervention in such a disorder. Dosages of test agents may be
determined by deriving dose-response curves, as discussed in,
below.
[0195] A variety of methods can be employed for the diagnostic and
prognostic evaluation of angiogenesis-related disorders, such as
cancer, and for the identification of subjects having a
predisposition to such disorders.
[0196] Such methods may, for example, utilize reagents such as the
endostatin gene nucleotide sequences described above, and
antibodies directed against endostatin gene products, including
peptide fragments thereof, as described, above. Specifically, such
reagents may be used, for example, for:
[0197] (1) the detection of the presence of endostatin gene
mutations, or the detection of either over- or under-expression of
endostatin gene mRNA relative to the state of an
angiogenesis-related disorder, such as cancer;
[0198] (2) the detection of either an over- or an under-abundance
of endostatin gene product relative to the unaffected state;
and
[0199] (3) the detection of an aberrant level of endostatin gene
product activity relative to the unaffected state.
[0200] Endostatin gene nucleotide sequences can, for example, be
used to diagnose an angiogenesis-related disorder using, for
example, the techniques for endostatin mutation detection described
above.
[0201] The methods described herein may be performed, for example,
by utilizing pre-packaged diagnostic kits comprising at least one
specific endostatin gene nucleic acid or anti-endostatin gene
antibody reagent described herein, which may be conveniently used,
e.g., in clinical settings, to diagnose subjects exhibiting
abnormalities of an angiogenesis-related disorder, e.g.,
cancer.
[0202] For the detection of endostatin mutations, any nucleated
cell can be used as a starting source for genomic nucleic acid. For
the detection of endostatin gene expression or endostatin gene
products, any cell type or tissue in which the endostatin gene is
expressed may be utilized.
[0203] Nucleic acid-based detection techniques are described,
above. Peptide detection techniques are described, above.
[0204] The methods described herein can furthermore be utilized as
diagnostic or prognostic assays to identify subjects having or at
risk of developing a disease or disorder associated with aberrant
expression or activity of a polypeptide of the invention. For
example, the assays described herein, such as the preceding
diagnostic assays or the following assays, can be utilized to
identify a subject having or at risk of developing a disorder
associated with aberrant expression or activity of a polypeptide of
the invention. Alternatively, the prognostic assays can be utilized
to identify a subject having or at risk for developing such a
disease or disorder. Thus, the present invention provides a method
in which a test sample is obtained from a subject and a polypeptide
or nucleic acid (e.g., mRNA, genomic DNA) of the invention is
detected, wherein the presence of the polypeptide or nucleic acid
is diagnostic for a subject having or at risk of developing a
disease or disorder associated with aberrant expression or activity
of the polypeptide. As used herein, a "test sample" refers to a
biological sample obtained from a subject of interest. For example,
a test sample can be a biological fluid (e.g., serum), cell sample,
or tissue.
[0205] Furthermore, the prognostic assays described herein can be
used to determine whether a subject can be administered an agent
(e.g., an agonist, antagonist, peptidomimetic, protein, peptide,
nucleic acid, small molecule, or other drug candidate) to treat a
disease or disorder associated with aberrant expression or activity
of a polypeptide of the invention. For example, such methods can be
used to determine whether a subject can be effectively treated with
a specific agent or class of agents (e.g., agents of a type which
decrease activity of the polypeptide). Thus, the present invention
provides methods for determining whether a subject can be
effectively treated with an agent for a disorder associated with
aberrant expression or activity of a polypeptide of the invention
in which a test sample is obtained and the polypeptide or nucleic
acid encoding the polypeptide is detected (e.g., wherein the:
presence of the polypeptide or nucleic acid is diagnostic for a
subject that can be administered the agent to treat a disorder
associated with aberrant expression or activity of the
polypeptide).
[0206] The methods of the invention also can be used to detect
genetic lesions or mutations in a gene of the invention, thereby
determining if a subject with the lesioned gene is at risk for a
disorder characterized aberrant expression or activity of a
polypeptide of the invention. In preferred embodiments, the methods
include detecting, in a sample of cells from the subject, the
presence or absence of a genetic lesion or mutation characterized
by at least one of an alteration affecting the integrity of a gene
encoding the polypeptide of the invention, or the mis-expression of
the gene encoding the polypeptide of the invention. For example,
such genetic lesions or mutations can be detected by ascertaining
the existence of at least one of: 1) a deletion of one or more
nucleotides from the gene; 2) an addition of one or more
nucleotides to the gene; 3) a substitution of one or more
nucleotides of the gene; 4) a chromosomal rearrangement of the
gene; 5) an alteration in the level of a messenger RNA transcript
of the gene; 6) an aberrant modification of the gene, such as of
the methylation pattern of the genomic DNA; 7) the presence of a
non-wild type splicing pattern of a messenger RNA transcript of the
gene; 8) a non-wild type level of a the protein encoded by the
gene; 9) an allelic loss of the gene; and 10) an inappropriate
post-translational modification of the protein encoded by the gene.
As described herein, there are a large number of assay techniques
known in the art which can be used for detecting lesions in a
gene.
[0207] In certain embodiments, detection of the lesion involves the
use of a probe/primer in a polymerase chain reaction (PCR) (see,
e.g., U.S. Pat. Nos. 4,683,195 and 4,683,202), such as anchor PCR
or RACE PCR, or, alternatively, in a ligation chain reaction (LCR)
(see, e.g., Landegran et al. (1988) Science 241:1077-1080; and
Nakazawa et al. (1994) Proc. Natl. Acad. Sci. USA 91:360-364), the
latter of which can be particularly useful for detecting point
mutations in a gene (see, e.g., Abravaya et al. (1995) Nucleic
Acids Res. 23:675-682). This method can include the steps of
collecting a sample of cells from a subject, isolating nucleic acid
(e.g., genomic, mRNA or both) from the cells of the sample,
contacting the nucleic acid sample with one or more primers which
specifically hybridize to the selected gene under conditions such
that hybridization and amplification of the gene (if present)
occurs, and detecting the presence or absence of an amplification
product, or detecting the size of the amplification product and
comparing the length to a control sample. It is anticipated that
PCR and/or LCR may be desirable to use as a preliminary
amplification step in conjunction with any of the techniques used
for detecting mutations described herein.
[0208] Alternative amplification methods include: self sustained
sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci.
USA 87:1874-1878), transcriptional amplification system (Kwoh, et
al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta
Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), or any
other nucleic acid amplification method, followed by the detection
of the amplified molecules using techniques well known to those of
skill in the art. These detection schemes are especially useful for
the detection of nucleic acid molecules if such molecules are
present in very low numbers.
[0209] In an alternative embodiment, mutations in a selected gene
from a sample cell can be identified by alterations in restriction
enzyme cleavage patterns. For example, sample and control DNA is
isolated, amplified (optionally), digested with one or more
restriction endonucleases, and fragment length sizes are determined
by gel electrophoresis and compared. Differences in fragment length
sizes between sample and control DNA indicates mutations in the
sample DNA. Moreover, the use of sequence specific ribozymes (see,
e.g., U.S. Pat. No. 5,498,531) can be used to score for the
presence of specific mutations by development or loss of a ribozyme
cleavage site.
[0210] In other embodiments, genetic mutations can be identified by
hybridizing a sample and control nucleic acids, e.g., DNA or RNA,
to high density arrays containing hundreds or thousands of
oligonucleotides probes (Cronin et al., 1996, Human Mutation
7:244-255; Kozal et al., 1996, Nature Medicine 2:753-759). For
example, genetic mutations can be identified in two-dimensional
arrays containing light-generated DNA probes as described in Cronin
et al., supra. Briefly, a first hybridization array of probes can
be used to scan through long stretches of DNA in a sample and
control to identify base changes between the sequences by making
linear arrays of sequential overlapping probes. This step allows
the identification of point mutations. This step is followed by a
second hybridization array that allows the characterization of
specific mutations by using smaller, specialized probe arrays
complementary to all variants or mutations detected. Each mutation
array is composed of parallel probe sets, one complementary to the
wild-type gene and the other complementary to the mutant gene.
[0211] In yet another embodiment, any of a variety of sequencing
reactions known in the art can be used to directly sequence the
selected gene and detect mutations by comparing the sequence of the
sample nucleic acids with the corresponding wild-type (control)
sequence. (Examples of sequencing reactions include those based on
techniques developed by Maxim and Gilbert, 1977, Proc. Natl. Acad.
Sci. USA 74:560 or Sanger, 1977, Proc. Natl. Acad. Sci. USA
74:5463). It is also contemplated that any of a variety of
automated sequencing procedures can be utilized when performing the
diagnostic assays (1995, Bio/Techniques 19:448), including
sequencing by mass spectrometry (see, e.g., PCT Publication No. WO
94/16101; Cohen et al., 1996, Adv. Chromatogr. 36:127-162; and
Griffin et al., 1993, Appl. Biochem. Biotechnol. 38:147-159).
[0212] Other methods for detecting mutations in a selected gene
include methods in which protection from cleavage agents is used to
detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes (Myers
et al., 1985, Science 230:1242). In general, the technique of
mismatch cleavage entails providing heteroduplexes formed by
hybridizing (labeled) RNA or DNA containing the wild-type sequence
with potentially mutant RNA or DNA obtained from a tissue sample.
The double-stranded duplexes are treated with an agent which
cleaves single-stranded regions of the duplex such as which will
exist due to basepair mismatches between the control and sample
strands. RNA/DNA duplexes can be treated with RNase to digest
mismatched regions, and DNA/DNA hybrids can be treated with S1
nuclease to digest mismatched regions. In other embodiments, either
DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or
osmium tetroxide and with piperidine in order to digest mismatched
regions. After digestion of the mismatched regions, the resulting
material is then separated by size on denaturing polyacrylamide
gels to determine the site of mutation. (See, e.g., Cotton et al.,
1988, Proc. Natl. Acad. Sci. USA 85:4397; Saleeba et al., 1992,
Methods Enzymol. 217:286-295.) In a preferred embodiment, the
control DNA or RNA can be labeled for detection.
[0213] In still another embodiment, the mismatch cleavage reaction
employs one or more proteins that recognize mismatched base pairs
in double-stranded DNA (so called "DNA mismatch repair enzymes") in
defined systems for detecting and mapping point mutations in cDNAs
obtained from samples of cells. For example, the mutY enzyme of E.
coli cleaves A at G/A mismatches and the thymidine DNA glycosylase
from HeLa cells cleaves T at G/T mismatches (Hsu et al., 1994,
Carcinogenesis 15:1657-1662). According to an exemplary embodiment,
a probe based on a selected sequence, e.g., a wild-type sequence,
is hybridized to a cDNA or other DNA product from a test cell(s).
The duplex is treated with a DNA mismatch repair enzyme, and the
cleavage products, if any, can be detected from electrophoresis
protocols or the like. (See, e.g., U.S. Pat. No. 5,459,039.)
[0214] In other embodiments, alterations in electrophoretic
mobility will be used to identify mutations in genes. For example,
SSCP may be used to detect differences in electrophoretic mobility
between mutant and wild type nucleic acids (Orita et al., 1989,
Proc. Natl. Acad. Sci. USA 86:2766; see also Cotton, 1993, Mutat.
Res. 285:125-144; Hayashi, 1992, Genet. Anal. Tech. Appl. 9:73-79).
Single-stranded DNA fragments of sample and control nucleic acids
will be denatured and allowed to renature. The secondary structure
of single-stranded nucleic acids varies according to sequence, and
the resulting alteration in electrophoretic mobility enables the
detection of even a single base change. The DNA fragments may be
labeled or detected with labeled probes. The sensitivity of the
assay may be enhanced by using RNA (rather than DNA), in which the
secondary structure is more sensitive to a change in sequence. In a
preferred embodiment, the subject method utilizes heteroduplex
analysis to separate double stranded heteroduplex molecules on the
basis of changes in electrophoretic mobility (Keen et al., 1991,
Trends Genet. 7:5).
[0215] In yet another embodiment, the movement of mutant or
wild-type fragments in polyacrylamide gels containing a gradient of
denaturant is assayed using denaturing gradient gel electrophoresis
(DGGE) (Myers et al., 1985, Nature 313:495). When DGGE is used as
the method of analysis, DNA will be modified to insure that it does
not completely denature, for example by adding a GC clamp of
approximately 40 bp of high-melting GC-rich DNA by PCR. In a
further embodiment, a temperature gradient is used in place of a
denaturing gradient to identify differences in the mobility of
control and sample DNA (Rosenbaum and Reissner, 1987, Biophys.
Chem. 265:12753).
[0216] Examples of other techniques for detecting point mutations
include, but are not limited to, selective oligonucleotide
hybridization, selective amplification, or selective primer
extension. For example, oligonucleotide primers may be prepared in
which the known mutation is placed centrally and then hybridized to
target DNA under conditions which permit hybridization only if a
perfect match is found (Saiki et al., 1986, Nature 324:163; Saiki
et al., 1989, Proc. Natl. Acad. Sci. USA 86:6230). Such allele
specific oligonucleotides are hybridized to PCR amplified target
DNA or a number of different mutations when the oligonucleotides
are attached to the hybridizing membrane and hybridized with
labeled target DNA.
[0217] Alternatively, allele specific amplification technology
which depends on selective PCR amplification may be used in
conjunction with the instant invention. Oligonucleotides used as
primers for specific amplification may carry the mutation of
interest in the center of the molecule (so that amplification
depends on differential hybridization) (Gibbs et al., 1989, Nucleic
Acids Res. 17:2437-2448) or at the extreme 3' end of one primer
where, under appropriate conditions, mismatch can prevent or reduce
polymerase extension (Prossner, 1993, Tibtech 11:238). In addition,
it may be desirable to introduce a novel restriction site in the
region of the mutation to create cleavage-based, detection
(Gasparini et al., 1992, Mol. Cell Probes 6:1). It is anticipated
that in certain embodiments amplification may also be performed
using Taq ligase for amplification (Barany, 1991, Proc. Natl. Acad.
Sci. USA 88:189). In such cases, ligation will occur only if there
is a perfect match at the 3' end of the 5' sequence making it
possible to detect the presence of a known mutation at a specific
site by looking for the presence or absence of amplification.
[0218] The methods described herein may be performed, for example,
by utilizing pre-packaged diagnostic kits comprising at least one
probe nucleic acid or antibody reagent described herein, which may
be conveniently used, e.g., in clinical settings to diagnose
subjects exhibiting symptoms or family history of a disease or
illness involving a gene encoding a polypeptide of the invention.
Furthermore, any cell type or tissue, preferably peripheral blood
leukocytes, in which the polypeptide of the invention is expressed
may be utilized in the prognostic assays described herein.
[0219] The invention further provides kits that facilitate the use
and/or detection of endostatin genes and gene products described
herein. The kits described herein may be conveniently used, e.g.,
in clinical settings to diagnose subjects exhibiting symptoms or
family history of a disease or illness involving a gene encoding a
polypeptide of the invention. Furthermore, any cell type or tissue
in which the polypeptide of the invention is expressed may be
utilized in the prognostic assays described herein.
[0220] In one embodiment, a diagnostic test kit for identifying
cells or tissues which mis-express endostatin genes or gene
products is provided. In this embodiment, a diagnostic kit is
provided, with one or more containers comprising an
oligonucleotide, e.g., a detectably labeled oligonucleotide, which
hybridizes to a nucleic acid sequence encoding a polypeptide of the
invention. In another embodiment, a kit is provided, with one or
more containers comprising a pair of primers useful for amplifying
a nucleic acid molecule encoding a polypeptide of the invention. In
various other embodiments, the kit can also comprise, e.g., a
buffering agent, a preservative, or a protein stabilizing agent.
The kit also can comprise components necessary for detecting the
detectable agent (e.g., an enzyme or a substrate). The kit also can
contain a control sample or a series of control samples which can
be assayed and compared to the test sample. Each component of the
kit is usually enclosed within an individual container and all of
the various containers are within a single package along with
instructions for observing whether the tested subject is suffering
from, or is at risk of developing, a disorder associated with
aberrant expression of the polypeptide. Such a kit can be used, for
example, to measure the levels of a nucleic acid molecule encoding
the protein in a sample of cells from a subject, e.g., detecting
mRNA levels or determining whether a gene encoding the protein has
been mutated or deleted.
[0221] In another embodiment, the invention provides kits for
detecting the presence of a polypeptide or nucleic acid of the
invention in a biological sample (a test sample). Such kits can be
used to determine if a subject is suffering from or is at increased
risk of developing a disorder associated with aberrant expression
of a polypeptide of the invention as discussed, for example, in
sections above relating to uses of the sequences of the invention.
In this embodiment, a kit is provided, with one or more containers
comprising: (1) a first antibody (e.g., attached to a solid
support) which binds to a polypeptide of the invention; and,
optionally, (2) a second, different antibody which binds to either
the polypeptide or the first antibody and is conjugated to a
detectable agent. Such kits can be used to determine if a subject
is suffering from, or is at increased risk of, an
angiogenesis-related disorder, such as cancer.
[0222] Described below are methods and compositions whereby an
endostatin-mediated process can be modulated and/or whereby an
angiogenesis-related disorder, e.g., cancer, may be treated.
[0223] For example, such methods can comprise administering
compounds which modulate the expression of an endostatin gene
and/or the synthesis or activity of an endostatin gene product so
that the process is modulated or a symptom of the disorder is
ameliorated.
[0224] Alternatively, in those instances whereby the
angiogenesis-related disorder, e.g., cancer, results from
endostatin gene mutations that lower or abolish endostatin
activity, respectively, such methods can comprise supplying a
mammal with a nucleic acid molecule encoding an unimpaired
endostatin gene product such that an unimpaired endostatin gene
product is expressed and symptoms of the disorder are
ameliorated.
[0225] In another embodiment of methods for the treatment of
mammalian angiogenesis-related disorder, e.g., cancer, resulting
from endostatin gene mutations, such methods can comprise supplying
a mammal with a cell comprising a nucleic acid molecule that
encodes an unimpaired endostatin gene product such that the cell
expresses the unimpaired endostatin gene product and symptoms of
the disorder are ameliorated.
[0226] In cases in which a loss of normal endostatin gene product
function results in the development of an angiogenesis-related
disorder phenotype, e.g., cancer, an increase in endostatin gene
product activity would facilitate progress towards an asymptomatic
state in individual organisms exhibiting a deficient level of
endostatin gene expression and/or endostatin gene product activity.
Methods for enhancing the expression or synthesis of endostatin can
include, for example, methods such as those described below.
[0227] Alternatively, symptoms of angiogenesis-related disorder
phenotype, e.g., cancer, may be ameliorated by administering a
compound that decreases the level of endostatin gene expression
and/or endostatin gene product activity. Methods for inhibiting or
reducing the level of endostatin synthesis or expression can
include, for example, methods such as those described below.
[0228] In one embodiment of treatment methods, the compounds
administered do not comprise compounds, in particular drugs,
reported to ameliorate or exacerbate the symptoms of an
angiogenesis-related disorder. If such treatment methods do
comprise such compounds, preferably such compounds are utilized in
a manner (e.g., different dosage, mode of administration, and/or
co-administration with one or more additional compounds) that
differs from the manner in which such compounds have been
administered previously.
[0229] In another embodiment, symptoms of a disorder described
herein, e.g., cancer, may be ameliorated by endostatin protein
therapy methods, e.g., decreasing or increasing the level and/or
activity of endostatin using the endostatin protein, fusion
protein, and peptide sequences described above, or by the
administration of proteins or protein fragments (e.g., peptides)
which interact with an endostatin gene or gene product and thereby
inhibit or potentiate its activity.
[0230] Such protein therapy may include, for example, the
administration of a functional endostatin protein or fragments of
an endostatin protein (e.g., peptides) which represent functional
endostatin domains.
[0231] In one embodiment, endostatin fragments or peptides
representing a functional endostatin binding domain are
administered to an individual organism such that the peptides bind
to an endostatin binding protein, e.g., an endostatin receptor.
Such fragments or peptides may serve to inhibit endostatin activity
in an individual organism by competing with, and thereby
inhibiting, binding of endostatin to the binding protein, thereby
ameliorating symptoms of a disorder described herein.
Alternatively, such fragments or peptides may enhance endostatin
activity in an individual organism by mimicking the function of
endostatin in vivo, thereby ameliorating the symptoms of a disorder
described herein.
[0232] The proteins and peptides which may be used in the methods
of the invention include synthetic (e.g., recombinant or chemically
synthesized) proteins and peptides, as well as naturally occurring
proteins and peptides. The proteins and peptides may have both
naturally occurring and non-naturally occurring amino acid residues
(e.g., D-amino acid residues) and/or one or more non-peptide bonds
(e.g., imino, ester, hydrazide, semicarbazide, and azo bonds). The
proteins or peptides may also contain additional chemical groups
(i.e., functional groups) present at the amino and/or carboxy
termini, such that, for example, the stability, bioavailability,
and/or inhibitory activity of the peptide is enhanced. Exemplary
functional groups include hydrophobic groups (e.g. carbobenzoxyl,
dansyl, and t-butyloxycarbonyl, groups), an acetyl group, a
9-fluorenylmethoxy-carbonyl group, and macromolecular carrier
groups (e.g., lipid-fatty acid conjugates, polyethylene glycol, or
carbohydrates) including peptide groups.
[0233] In another embodiment, symptoms of certain
angiogenesis-related disorders, such as cancer, may be ameliorated
by decreasing the level of endostatin gene expression and/or
endostatin gene product activity by using endostatin gene sequences
in conjunction with well-known antisense, gene "knock-out,"
ribozyme and/or triple helix methods to decrease the level of
endostatin gene expression. Among the compounds that may exhibit
the ability to modulate the activity, expression or synthesis of
the endostatin gene, including the ability to ameliorate the
symptoms of an angiogenesis-related disorder, e.g., cancer, are
antisense, ribozyme, and triple helix molecules. Such molecules may
be designed to reduce or inhibit either unimpaired, or if
appropriate, mutant target gene activity. Techniques for the
production and use of such molecules are well known to those of
skill in the art.
[0234] Antisense RNA and DNA molecules act to directly block the
translation of mRNA by hybridizing to targeted mRNA and preventing
protein translation. Antisense approaches involve the design of
oligonucleotides that are complementary to a target gene mRNA. The
antisense oligonucleotides will bind to the complementary target
gene mRNA transcripts and prevent translation. Absolute
complementarity, although preferred, is not required.
[0235] A sequence "complementary" to a portion of an RNA, as
referred to herein, means a sequence having sufficient
complementarity to be able to hybridize with the RNA, forming a
stable duplex; in the case of double-stranded antisense nucleic
acids, a single strand of the duplex DNA may thus be tested, or
triplex formation may be assayed. The ability to hybridize will
depend on both the degree of complementarity and the length of the
antisense nucleic acid. Generally, the longer the hybridizing
nucleic acid, the more base mismatches with an RNA it may contain
and still form a stable duplex (or triplex, as the case may be).
One skilled in the art can ascertain a tolerable degree of mismatch
by use of standard procedures to determine the melting point of the
hybridized complex.
[0236] In one embodiment, oligonucleotides complementary to
non-coding regions of the endostatin gene could be used in an
antisense approach to inhibit translation of endogenous endostatin
mRNA. Antisense nucleic acids should be at least six nucleotides in
length, and are preferably oligonucleotides ranging from 6 to about
50 nucleotides in length. In specific aspects the oligonucleotide
is at least 10 nucleotides, at least 17 nucleotides, at least 25
nucleotides or at least 50 nucleotides.
[0237] Regardless of the choice of target sequence, it is preferred
that in vitro studies are first performed to quantitate the ability
of the antisense oligonucleotide to inhibit gene expression. It is
preferred that these studies utilize controls that distinguish
between antisense gene inhibition and nonspecific biological
effects of oligonucleotides. It is also preferred that these
studies compare levels of the target RNA or protein with that of an
internal control RNA or protein. Additionally, it is envisioned
that results obtained using the antisense oligonucleotide are
compared with those obtained using a control oligonucleotide. It is
preferred that the control oligonucleotide is of approximately the
same length as the test oligonucleotide and that the nucleotide
sequence of the oligonucleotide differs from the antisense sequence
no more than is necessary to prevent specific hybridization to the
target sequence.
[0238] The oligonucleotides can be DNA or RNA or chimeric mixtures
or derivatives or modified versions thereof, single-stranded or
double-stranded. The oligonucleotide can be modified at the base
moiety, sugar moiety, or phosphate backbone, for example, to
improve stability of the molecule, hybridization, etc. The
oligonucleotide may include other appended groups such as peptides
(e.g., for targeting host cell receptors in vivo), or agents
facilitating transport across the cell membrane (see, e.g.,
Letsinger, et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86,
6553-6556; Lemaitre, et al., 1987, Proc. Natl. Acad. Sci. 84,
648-652; PCT Publication No. WO88/09810, published Dec. 15, 1988)
or the blood-brain barrier (see, e.g., PCT Publication No.
WO89/10134, published Apr. 25, 1988), hybridization-triggered
cleavage agents (see, e.g., Krol et al., 1988, BioTechniques 6,
958-976) or intercalating agents (see, e.g., Zon, 1988, Pharm. Res.
5, 539-549). To this end, the oligonucleotide may be conjugated to
another molecule, e.g., a peptide, hybridization triggered
cross-linking agent, transport agent, hybridization-triggered
cleavage agent, etc.
[0239] The antisense oligonucleotide may comprise at least one
modified base moiety which is selected from the group including but
not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xanthine, 4-acetylcytqsine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomet-
hyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine,
3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopenteny- ladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
[0240] The antisense oligonucleotide may also comprise at least one
modified sugar moiety selected from the group including but not
limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.
[0241] In yet another embodiment, the antisense oligonucleotide
comprises at least one modified phosphate backbone selected from
the group consisting of a phosphorothioate, a phosphorodithioate, a
phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a
methylphosphonate, an alkyl phosphotriester, and a formacetal or
analog thereof.
[0242] In yet another embodiment, the antisense oligonucleotide is
an .alpha.-anomeric oligonucleotide. An .alpha.-anomeric
oligonucleotide forms specific double-stranded hybrids with
complementary RNA in which, contrary to the usual .beta.-units, the
strands run parallel to each other (Gautier, et al., 1987, Nucl.
Acids Res. 15, 6625-6641). The oligonucleotide is a
2'-O-methylribonucleotide (Inoue, et al., 1987, Nucl. Acids Res.
15, 6131-6148), or a chimeric RNA-DNA analogue (Inoue, et al.,
1987, FEBS Lett. 215, 327-330).
[0243] Oligonucleotides of the invention may be synthesized by
standard methods known in the art, e.g. by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides may be synthesized by the method of Stein, et al.
(1988, Nucl. Acids Res. 16, 3209), methylphosphonate
oligonucleotides can be prepared by use of controlled pore glass
polymer supports (Sarin, et al., 1988, Proc. Natl. Acad. Sci.
U.S.A. 85, 7448-7451), etc.
[0244] While antisense nucleotides complementary to the target gene
coding region sequence could be used, those complementary to the
transcribed, untranslated region are most preferred.
[0245] Antisense molecules should be delivered to cells that
express the target gene in vivo. A number of methods have been
developed for delivering antisense DNA or RNA to cells; e.g.,
antisense molecules can be injected directly into the tissue site,
or modified antisense molecules, designed to target the desired
cells (e.g., antisense linked to peptides or antibodies that
specifically bind receptors or antigens expressed on the target
cell surface) can be administered systemically.
[0246] However, it is often difficult to achieve intracellular
concentrations of the antisense sufficient to suppress translation
of endogenous mRNAs. Therefore a preferred approach utilizes a
recombinant DNA-construct in which the antisense oligonucleotide is
placed under the control of a strong pol III or pol II promoter.
The use of such a construct to transfect target cells in the
subject will result in the transcription of sufficient amounts of
single stranded RNAs that will form complementary base pairs with
the endogenous target gene transcripts and thereby prevent
translation of the target gene mRNA. For example, a vector can be
introduced e.g., such that it is taken up by a cell and directs the
transcription of an antisense RNA. Such a vector can remain
episomal or become chromosomally integrated, as long as it can be
transcribed to produce the desired antisense RNA. Such vectors can
be constructed by recombinant DNA technology methods standard in
the art. Vectors can be plasmid, viral, or others known in the art,
used for replication and expression in mammalian cells. Expression
of the sequence encoding the antisense RNA can be by any promoter
known in the art to act in mammalian, preferably human cells. Such
promoters can be inducible or constitutive. Such promoters include
but are not limited to: the SV40 early promoter region I(Benoist
and Chambon, 1981, Nature 290, 304-310), the promoter contained in
the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et
al., 1980, Cell 22, 787-797), the herpes thymidine kinase promoter
(Wagner, et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78,
1441-1445), the regulatory sequences of the metallothionein gene
(Brinster, et al., 1982, Nature 296, 3942), etc. Any type of
plasmid, cosmid, YAC or viral vector can be used to prepare the
recombinant DNA construct which can be introduced directly into the
tissue site. Alternatively, viral vectors can be used that
selectively infect the desired tissue, in which case administration
may be accomplished by another route (e.g., systemically).
[0247] Ribozyme molecules designed to catalytically cleave target
gene mRNA transcripts can also be used to prevent translation of
target gene mRNA and, therefore, expression of target gene product.
(See, e.g., PCT International Publication WO90/11364, published
Oct. 4, 1990; Sarver, et al., 1990, Science 247, 1222-1225).
[0248] Ribozymes are enzymatic RNA molecules capable of catalyzing
the specific cleavage of RNA. (For a review, see Rossi, 1994,
Current Biology 4, 469-471). The mechanism of ribozyme action
involves sequence specific hybridization of the ribozyme molecule
to complementary target RNA, followed by an endonucleolytic
cleavage event. The composition of ribozyme molecules must include
one or more sequences complementary to the target gene mRNA, and
must include the well known catalytic sequence responsible for mRNA
cleavage. For this sequence, see, e.g., U.S. Pat. No. 5,093,246,
which is incorporated herein by reference in its entirety.
[0249] While ribozymes that cleave mRNA at site specific
recognition sequences can be used to destroy target gene mRNAs, the
use of hammerhead ribozymes is preferred. Hammerhead ribozymes
cleave mRNAs at locations dictated by flanking regions that form
complementary base pairs with the target mRNA. The sole requirement
is that the target mRNA have the following sequence of two bases:
5'-UG-3'. The construction and production of hammerhead ribozymes
is well known in the art and is described more fully in Myers,
1995, Molecular Biology and Biotechnology: A Comprehensive Desk
Reference, VCH Publishers, New York, (see especially FIG. 4, page
833) and in Haseloff and Gerlach, 1988, Nature, 334, 585-591, which
is incorporated herein by reference in its entirety.
[0250] Preferably the ribozyme is engineered so that the cleavage
recognition site is located near the 5' end of the target gene
mRNA, i.e., to increase efficiency and minimize the intracellular
accumulation of non-functional mRNA transcripts.
[0251] The ribozymes of the present invention also include RNA
endoribonucleases (hereinafter "Cech-type ribozymes") such as the
one that occurs naturally in Tetrahymena thermophila (known as the
IVS, or L-19 IVS RNA) and that has been extensively described by
Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224,
574-578; Zaug and Cech, 1986, Science, 231, 470-475; Zaug, et al.,
1986, Nature, 324, 429-433; published International patent
application No. WO 88/04300 by University Patents Inc.; Been and
Cech, 1986, Cell, 47, 207-216). The Cech-type ribozymes have an
eight base pair active site which hybridizes to a target RNA
sequence whereafter cleavage of the target RNA takes place. The
invention encompasses those Cech-type ribozymes which target eight
base-pair active site sequences that are present in the target
gene.
[0252] As in the antisense approach, the ribozymes can be composed
of modified oligonucleotides, (e.g., for improved stability,
targeting, etc.) and should be delivered to cells that express the
target gene in vivo. A preferred method of delivery involves using
a DNA construct "encoding" the ribozyme under the control of a
strong constitutive pol III or pol II promoter, so that transfected
cells will produce sufficient quantities of the ribozyme to destroy
endogenous target gene messages and inhibit translation. Because
ribozymes, unlike antisense molecules, are catalytic, a lower
intracellular concentration is required for efficiency.
[0253] Endogenous target gene expression can also be reduced by
inactivating or "knocking out" the target gene or its promoter
using targeted homologous recombination (e.g., see Smithies, et
al., 1985, Nature 317, 230-234; Thomas and Capecchi, 1987, Cell 51,
503-512; Thompson, et al., 1989, Cell 5, 313-321; each of which is
incorporated by reference herein in its entirety). For example, a
mutant, non-functional target gene (or a completely unrelated DNA
sequence) flanked by DNA homologous to the endogenous target gene
(either the coding regions or regulatory regions of the target
gene) can be used, with or without a selectable marker and/or a
negative selectable marker, to transfect cells that express the
target gene in vivo. Insertion of the DNA construct, via targeted
homologous recombination, results in inactivation of the target
gene. Such approaches are particularly suited in the agricultural
field where modifications to ES (embryonic stem) cells can be used
to generate animal offspring with an inactive target gene (e.g.,
see Thomas and Capecchi, 1987 and Thompson, 1989, supra). However
this approach can be adapted for use in humans provided the
recombinant DNA constructs are directly administered or targeted to
the required site in vivo using appropriate viral vectors.
[0254] Alternatively, endogenous target gene expression can be
reduced by targeting deoxyribonucleotide sequences complementary to
the regulatory region of the target gene (i.e., the target gene
promoter and/or enhancers) to form triple helical structures that
prevent transcription of the target gene in target cells in the
body. (See generally, Helene, 1991, Anticancer Drug Des., 6(6),
569-584; Helene, et al., 1992, Ann. N.Y. Acad. Sci., 660, 27-36;
and Maher, 1992, Bioassays 14(12), 807-815).
[0255] Nucleic acid molecules to be used in triplex helix formation
for the inhibition of transcription should be single stranded and
composed of deoxynucleotides. The base composition of these
oligonucleotides must be designed to promote triple helix formation
via Hoogsteen base pairing rules, which generally require sizeable
stretches of either purines or pyrimidines to be present on one
strand of a duplex. Nucleotide sequences may be pyrimidine-based,
which will result in TAT and CGC triplets across the three
associated strands of the resulting triple helix. The
pyrimidine-rich molecules provide base complementarity to a
purine-rich region of a single strand of the duplex in a parallel
orientation to that strand. In addition, nucleic acid molecules may
be chosen that are purine-rich, for example, contain a stretch of G
residues. These molecules will form a triple helix with a DNA
duplex that is rich in GC pairs, in which the majority of the
purine residues are located on a single strand of the targeted
duplex, resulting in GGC triplets across the three strands in the
triplex.
[0256] Alternatively, the potential sequences that can be targeted
for triple helix formation may be increased by creating a so called
"switchback" nucleic acid molecule. Switchback molecules are
synthesized in an alternating 5'-3', 3'-5' manner, such that they
base pair with first one strand of a duplex and then the other,
eliminating the necessity for a sizeable stretch of either purines
or pyrimidines to be present on one strand of a duplex.
[0257] In instances wherein the antisense, ribozyme, and/or triple
helix molecules described herein are utilized to inhibit mutant
gene expression, it is possible that the technique may so
efficiently reduce or inhibit the transcription (triple helix)
and/or translation (antisense, ribozyme) of mRNA produced by normal
target gene alleles that the possibility may arise wherein the
concentration of normal target gene product present may be lower
than is necessary for a normal phenotype. In such cases, to ensure
that substantially normal levels of target gene activity are
maintained, therefore, nucleic acid molecules that encode and
express target gene polypeptides exhibiting normal target gene
activity may, be introduced into cells via gene therapy methods
such as those described, below, that do not contain sequences
susceptible to whatever antisense, ribozyme, or triple helix
treatments are being utilized. Alternatively, in instances whereby
the target gene encodes an extracellular protein, it may be
preferable to co-administer normal target gene protein in order to
maintain the requisite level of target gene activity.
[0258] Anti-sense RNA and DNA, ribozyme, and triple helix molecules
of the invention may be prepared by any method known in the art for
the synthesis of DNA and RNA molecules, as discussed above. These
include techniques for chemically synthesizing
oligodeoxyri-bonucleotides and oligoribonucleotides well known in
the art such as for example solid phase phosphoramidite chemical
synthesis. Alternatively, RNA molecules may be generated by in
vitro and in vivo transcription of DNA sequences encoding the
antisense RNA molecule. Such DNA sequences may be incorporated into
a wide variety of vectors that incorporate suitable RNA polymerase
promoters such as the T7 or SP6 polymerase promoters.
Alternatively, antisense cDNA constructs that synthesize antisense
RNA constitutively or inducibly, depending on the promoter used,
can be introduced stably into cell lines.
[0259] With respect to an increase in the level of normal
endostatin gene expression and/or endostatin gene product activity,
endostatin gene nucleic acid sequences, described above, for
example, can be utilized for the treatment of an
angiogenesis-related disorder, e.g., cancer. Such treatment can be
administered, for example, in the form of gene replacement therapy.
Specifically, one or more copies of a normal endostatin gene or a
portion of the endostatin gene that directs the production of a
endostatin gene product exhibiting normal endostatin gene function,
may be inserted into the appropriate cells within a subject, using
vectors that include, but are not limited to, adenovirus,
adeno-associated virus, herpesvirus and retrovirus vectors, in
addition to other particles that introduce DNA into cells, such as
liposomes.
[0260] Because endostatin genes can be expressed in the brain, such
gene replacement therapy techniques should be capable delivering
endostatin gene sequences to these cell types within subjects.
Thus, in one embodiment, techniques that are well known to those of
skill in the art (see, e.g., PCT Publication No. WO89/10134,
published Apr. 25, 1988) can be used to enable endostatin gene
sequences to cross the blood-brain barrier readily and to deliver
the sequences to cells in the brain. With respect to delivery that
is capable of crossing the blood-brain barrier, viral vectors such
as, for example, those described above, are preferable.
[0261] In another embodiment, techniques for delivery involve
direct administration of such endostatin gene sequences to the site
of the cells in which the endostatin gene, sequences are to be
expressed.
[0262] Additional methods that may be utilized to increase the
overall level of endostatin gene expression and/or endostatin gene
product activity include the introduction of appropriate
endostatin-expressing cells, preferably autologous cells, into a
subject at positions and in numbers that are sufficient to
ameliorate the symptoms of an angiogenesis-related disorder, e.g.,
cancer. Such cells may be either recombinant or
non-recombinant.
[0263] Among the cells that can be administered to increase the
overall level of endostatin gene expression in a subject are normal
cells, preferably liver cells, that express the endostatin
gene.
[0264] Alternatively, cells, preferably autologous cells, can be
engineered to express endostatin gene sequences, and may then be
introduced into a subject in positions appropriate for the
amelioration of the symptoms of an angiogenesis-related disorder,
e.g., cancer. Alternately, cells that express an unimpaired
endostatin gene and that are from an MHC matched individual
organism can be utilized, and may include, for example, liver
cells. The expression of the endostatin gene sequences is
controlled by the appropriate gene regulatory sequences to allow
such expression in the necessary cell types. Such gene regulatory
sequences are well known to the skilled artisan. Such cell-based
gene therapy techniques are well known to those skilled in the art,
see, e.g., Anderson, U.S. Pat. No. 5,399,349.
[0265] When the cells to be administered are non-autologous cells,
they can be administered using well known techniques that prevent a
host immune response against the introduced cells from developing.
For example, the cells may be introduced in an encapsulated form
which, while allowing for an exchange of components with the
immediate extracellular environment, does not allow the introduced
cells to be recognized by the host immune system.
[0266] Additionally, compounds, such as those identified via
techniques such as those described above, that are capable of
modulating endostatin gene product activity can be administered
using standard techniques that are well known to those of skill in
the art. In instances in which the compounds to be administered are
to involve an interaction with brain cells, the administration
techniques should include well known ones that allow for a crossing
of the blood-brain barrier.
[0267] Agents, or modulators, which have a stimulatory or
inhibitory effect on activity or expression of a polypeptide of the
invention as identified by a screening assay described herein can
be administered to individual organisms to treat (prophylactically
or therapeutically) disorders associated with aberrant activity of
the polypeptide. In conjunction with such treatment, the
pharmacogenomics (i.e., the study of the relationship between an
individual's genotype and that individual's response to a foreign
compound or drug) of the individual organism may be considered.
Differences in metabolism of therapeutics can lead to severe
toxicity or therapeutic failure by altering the relation between
dose and blood concentration of the pharmacologically active drug.
Thus, the pharmacogenomics of the individual organism permits the
selection of effective agents (e.g., drugs) for prophylactic or
therapeutic treatments based on a consideration of the individual
organism's genotype. Such pharmacogenomics can further be used to
determine appropriate dosages and therapeutic regimens.
Accordingly, the activity of a polypeptide of the invention,
expression of a nucleic acid of the invention, or mutation content
of a gene of the invention in an individual organism can be
determined to thereby select appropriate agent(s) for therapeutic
or prophylactic treatment of the individual organism.
[0268] Pharmacogenomics deals with clinically significant
hereditary variations in the response to drugs due to altered drug
disposition and abnormal action in affected individual organisms.
See, e.g., Linder (1997) Clin. Chem. 43(2):254-266. In general, two
types of pharmacogenetic conditions can be differentiated. Genetic
conditions transmitted as a single factor altering the way drugs
act on the body are referred to as "altered drug action." Genetic
conditions transmitted as single factors altering the way the body
acts on drugs are referred to as "altered drug metabolism". These
pharmacogenetic conditions can occur either as rare defects or as
polymorphisms. For example, glucose-6-phosphate dehydrogenase
deficiency (G6PD) is a common inherited enzymopathy in which the
main clinical complication is haemolysis after ingestion of oxidant
drugs (anti-malarials, sulfonamides, analgesics, nitrofurans) and
consumption of fava beans.
[0269] As an illustrative embodiment, the activity of drug
metabolizing enzymes is a major determinant of both the intensity
and duration of drug action. The discovery of genetic polymorphisms
of drug metabolizing enzymes (e.g., N-acetyltransferase 2 (NAT 2)
and cytochrome P450 enzymes CYP2D6 and CYP2C19) has provided an
explanation as to why some subjects do not obtain the expected drug
effects or show exaggerated drug response and serious toxicity
after taking the standard and safe dose of a drug. These
polymorphisms are expressed in two phenotypes in the population,
the extensive metabolizer (EM) and poor metabolizer (PM). The
prevalence of PM is different among different populations. For
example, the gene coding for CYP2D6 is highly polymorphic and
several mutations have been identified in PM, which all lead to the
absence of functional CYP2D6. Poor metabolizers of CYP2D6 and
CYP2C19 quite frequently experience exaggerated drug response and
side effects when they receive standard doses. If a metabolite is
the active therapeutic moiety, a PM will show no therapeutic
response, as demonstrated for the analgesic effect of codeine
mediated by its CYP2D6-formed metabolite morphine. The other
extreme are the so called ultra-rapid metabolizers who do not
respond to standard doses. Recently, the molecular basis of
ultra-rapid metabolism has been identified to be due to CYP2D6 gene
amplification.
[0270] Thus, the activity of a polypeptide of the invention,
expression of a nucleic acid encoding the polypeptide, or mutation
content of a gene encoding the polypeptide in an individual
organism can be determined to thereby select appropriate agent(s)
for therapeutic or prophylactic treatment of the individual
organism. In addition, pharmacogenetic studies can be used to apply
genotyping of polymorphic alleles encoding drug-metabolizing
enzymes to the identification of an individual organism's drug
responsiveness phenotype. This knowledge, when applied to dosing or
drug selection, can avoid adverse reactions or therapeutic failure
and thus enhance therapeutic or prophylactic efficiency when
treating a subject with a modulator of activity or expression of
the polypeptide, such as a modulator identified by one of the
exemplary screening assays described herein.
[0271] Monitoring the influence of agents (e.g., drugs, compounds)
on the expression or activity of a polypeptide of the invention
(e.g., the ability to modulate aberrant cell proliferation
chemotaxis, and/or differentiation) can be applied not only in
basic drug screening, but also in clinical trials. For example, the
effectiveness of an agent, as determined by a screening assay as
described herein, to increase gene expression, protein levels or
protein activity, can be monitored in clinical trials of subjects
exhibiting decreased gene expression, protein levels, or protein
activity. Alternatively, the effectiveness of an agent, as
determined by a screening assay, to decrease gene expression,
protein levels or protein activity, can be monitored in clinical
trials of subjects exhibiting increased gene expression, protein
levels, or protein activity. In such clinical trials, expression or
activity of a polypeptide of the invention and preferably, that of
other polypeptide that have been implicated in for example, a
cellular proliferation disorder, can be used as a marker of the
immune responsiveness of a particular cell.
[0272] For example, and not by way of limitation, genes, including
those of the invention, that are modulated in cells by treatment
with an agent (e.g., compound, drug or small molecule) which
modulates activity or expression of a polypeptide of the invention
(e.g., as identified in a screening assay described herein) can be
identified. Thus, to study the effect of agents on cellular
proliferation disorders, for example, in a clinical trial, cells
can be isolated and RNA prepared and analyzed for the levels of
expression of a gene of the invention and other genes implicated in
the disorder. The levels of gene expression (i.e., a gene
expression pattern) can be quantified by Northern blot analysis or
RT-PCR, as described herein; or alternatively by measuring the
amount of protein produced, by one of the methods as described
herein, or by measuring the levels of activity of a gene of the
invention or other genes. In this way, the gene expression pattern
can serve as a marker, indicative of the physiological response of
the cells to the agent. Accordingly, this response state may be
determined before, and at various points during, treatment of the
individual organism with the agent.
[0273] In a preferred embodiment, the present invention provides a
method for monitoring the effectiveness of treatment of a subject
with an agent (e.g., an agonist, antagonist, peptidomimetic,
protein, peptide, nucleic acid, small molecule, or other drug
candidate identified by the screening assays described herein)
comprising the steps of (i) obtaining a pre-administration sample
from a subject prior to administration of the agent; (ii) detecting
the level of the polypeptide or nucleic acid of the invention in
the preadministration sample; (iii) obtaining one or more
post-administration samples from the subject; (iv) detecting the
level the of the polypeptide or nucleic acid of the invention in
the post-administration samples; (v) comparing the level of the
polypeptide or nucleic acid of the invention in the
pre-administration sample with the level of the polypeptide or
nucleic acid of the invention in the post-administration sample or
samples; and (vi) altering the administration of the agent to the
subject accordingly. For example, increased administration of the
agent may be desirable to increase the expression or activity of
the polypeptide to higher levels than detected, i.e., to increase
the effectiveness of the agent. Alternatively, decreased
administration of the agent may be desirable to decrease expression
or activity of the polypeptide to lower levels than detected, i.e.,
to decrease the effectiveness of the agent.
[0274] The compounds of this invention can be formulated and
administered to inhibit a variety of angiogenesis-related disorders
by any means that produces contact of the active ingredient with
the agents site of action in the body of a mammal. They can be
administered by any conventional means available for use in
conjunction with pharmaceuticals, either as individual therapeutic
active ingredients or in a combination of therapeutic active
ingredients. They can be administered alone, but are generally
administered with a pharmaceutical carrier selected on the basis of
the chosen route of administration and standard pharmaceutical
practice.
[0275] The dosage administered will be a therapeutically effective
amount of the compound sufficient to result in amelioration of
symptoms of the angiogenesis-related disorder and will, of course,
vary depending upon known factors such as the pharmacodynamic
characteristics of the particular active ingredient and its mode
and route of administration; age, sex, health and weight of the
recipient; nature and extent of symptoms; kind of concurrent
treatment, frequency of treatment and the effect desired.
[0276] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD50 (the dose
lethal to 50% of the population) and the ED50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD50/ED50. Compounds which exhibit
large therapeutic indices are preferred. While compounds that
exhibit toxic side effects may be used, care should be taken to
design a delivery system that targets such compounds to the site of
affected tissue in order to minimize potential damage to uninfected
cells and, thereby, reduce side effects.
[0277] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of such compounds lies preferably within a range
of circulating concentrations that include the ED50 with little or
no toxicity. The dosage may vary within this range depending upon
the dosage form employed and the route of administration utilized.
For any compound used in the method of the invention, the
therapeutically effective dose can be estimated initially from cell
culture assays. A dose may be formulated in animal models to
achieve a circulating plasma concentration range that includes the
IC50 (i.e., the concentration of the test compound which achieves a
half-maximal inhibition of symptoms) as determined in cell culture.
Such information can be used to more accurately determine useful
doses in humans. Levels in plasma may be measured, for example, by
high performance liquid chromatography.
[0278] Specific dosages may also be utilized for antibodies.
Typically, the preferred dosage is 0.1 mg/kg to 100 mg/kg of body
weight (generally 10 mg/kg to 20 mg/kg), and if the antibody is to
act in the brain, a dosage of 50 mg/kg to 100 mg/kg is usually
appropriate. If the antibody is partially human or fully human, it
generally will have a longer half-life within the human body than
other antibodies. Accordingly, lower dosages of partially human and
fully human antibodies is often possible. Additional modifications
may be used to further stabilize antibodies. For example,
lipidation can be used to stabilize antibodies and to enhance
uptake and tissue penetration (e.g., into the brain). A method for
lipidation of antibodies is described by Cruikshank et al. ((1997)
J. Acquired Immune Deficiency Syndromes and Human Retrovirology
14:193).
[0279] A therapeutically effective amount of protein or polypeptide
(i.e., an effective dosage) ranges from about 0.001 to 30 mg/kg
body weight, preferably about 0.01 to 25 mg/kg body weight, more
preferably about 0.1 to 20 mg/kg body weight, and even more
preferably about 1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7
mg/kg, or 5 to 6 mg/kg body weight.
[0280] Moreover, treatment of a subject with a therapeutically
effective amount of a protein, polypeptide or antibody can include
a single treatment or, preferably, can include a series of
treatments. In a preferred example, a subject is treated with
antibody, protein, or polypeptide in the range of between about 0.1
to 20 mg/kg body weight, one time per week for between about 1 to
10 weeks, preferably between 2 to 8 weeks, more preferably between
about 3 to 7 weeks, and even more preferably for about 4, 5 or 6
weeks.
[0281] The present invention further encompasses agents which
modulate expression or activity. An agent may, for example, be a
small molecule. For example, such small molecules include, but are
not limited to, peptides, peptidomimetics, amino acids, amino acid
analogs, polynucleotides, polynucleotide analogs, nucleotides,
nucleotide analogs, organic or inorganic compounds (i.e,. including
heteroorganic and organometallic compounds) having a molecular
weight less than about 10,000 grams per mole, organic or inorganic
compounds having a molecular weight less than about 5,000 grams per
mole, organic or inorganic compounds having a molecular weight less
than about 1,000 grams per mole, organic or inorganic compounds
having a molecular weight less than about 500 grams per mole, and
salts, esters, and other pharmaceutically acceptable forms of such
compounds.
[0282] It is understood that appropriate doses of small molecule
agents depends upon a number of factors known to those or ordinary
skill in the art, e.g., a physician. The dose(s) of the small
molecule will vary, for example, depending upon the identity, size,
and condition of the subject or sample being treated, further
depending upon the route by which the composition is to be
administered, if applicable, and the effect which the practitioner
desires the small molecule to have upon the nucleic acid or
polypeptide of the invention. Exemplary doses include milligram or
microgram amounts of the small molecule per kilogram of subject or
sample weight (e.g., about 1 microgram per kilogram to about 500
milligrams per kilogram, about 100 micrograms per kilogram to about
5 milligrams per kilogram, or about 1 microgram per kilogram to
about 50 micrograms per kilogram.
[0283] Pharmaceutical compositions for use in accordance with the
present invention may be formulated in conventional manner using
one or more physiologically acceptable carriers or excipients.
[0284] Thus, the compounds and their physiologically acceptable
salts and solvates may be formulated for administration by
inhalation or insulation (either through the mouth or the nose) or
oral, buccal, parenteral or rectal administration.
[0285] For oral administration, the pharmaceutical compositions may
take the form of, for example, tablets or capsules prepared by
conventional means with pharmaceutically acceptable excipients such
as binding agents (e.g., pregelatinised maize starch,
polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers
(e.g., lactose, microcrystalline cellulose or calcium hydrogen
phosphate); lubricants (e.g., magnesium stearate, talc or silica);
disintegrants (e.g., potato starch or sodium starch glycolate); or
wetting agents (e.g., sodium lauryl sulphate). The tablets may be
coated by methods well known in the art. Liquid preparations for
oral administration may take the form of, for example, solutions,
syrups or suspensions, or they may be presented as a dry product
for constitution with water or other suitable vehicle before use.
Such liquid preparations may be prepared by conventional means with
pharmaceutically acceptable additives such as suspending agents
(e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible
fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous
vehicles (e.g., almond oil, oily esters, ethyl alcohol or
fractionated vegetable oils); and preservatives (e.g., methyl or
propyl-p-hydroxybenzoates or sorbic acid). The preparations may
also contain buffer salts, flavoring, coloring and sweetening
agents as appropriate.
[0286] Preparations for oral administration may be suitably
formulated to give controlled release of the active compound.
[0287] For buccal administration the compositions may take the form
of tablets or lozenges formulated in conventional manner.
[0288] For administration by inhalation, the compounds for use
according to the present invention are conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebulizer, with the use of a suitable propellant, egg.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g. gelatin for use in an inhaler or insulator may
be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
[0289] The compounds may be formulated for parenteral
administration by injection, e.g., by bolus injection or continuous
infusion. Formulations for injection may be presented in unit
dosage form, e.g., in ampoules or in multi-dose containers, with an
added preservative. The compositions may take such forms as
suspensions, solutions or emulsions in oily or aqueous vehicles,
and may contain formulatory agents such as suspending, stabilizing
and/or dispersing agents. Alternatively, the active ingredient may
be in powder form for constitution with a suitable vehicle, e.g.,
sterile pyrogen-free water, before use. In general, water, a
suitable oil, saline, aqueous dextrose (glucose), and related sugar
solutions and glycols such as propylene glycol or polyethylene
glycols are suitable carriers for parenteral solutions. Solutions
for parenteral administration contain preferably a water soluble
salt of the active ingredient, suitable stabilizing agents and, if
necessary, buffer substances. Antioxidizing agents such as sodium
bisulfate, sodium sulfite or ascorbic acid, either alone or
combined, are suitable stabilizing agents. Also used are citric
acid and its salts and sodium ethylenediaminetetraacetic acid
(EDTA). In addition, parenteral solutions can contain preservatives
such as benzalkonium chloride, methyl- or propyl-paraben and
chlorobutanol. Suitable pharmaceutical carriers are described in
Remington's Pharmaceutical Sciences, a standard reference text in
this field.
[0290] The compounds may also be formulated in rectal compositions
such as suppositories or retention enemas, e.g., containing
conventional suppository bases such as cocoa butter or other
glycerides.
[0291] In addition to the formulations described previously, the
compounds may also be formulated as a depot preparation. Such long
acting formulations may be administered by implantation (for
example subcutaneously or intramuscularly) or by intramuscular
injection. Thus, for example, the compounds may be formulated with
suitable polymeric or hydrophobic materials (for example as an
emulsion in an acceptable oil) or ion exchange resins, or as
sparingly soluble derivatives, for example, as a sparingly soluble
salt.
[0292] Additionally, standard pharmaceutical methods can be
employed to control the duration of action. These are well known in
the art and include control release preparations and can include
appropriate macromolecules, for example polymers, polyesters,
polyamino acids, polyvinyl, pyrolidone, ethylenevinylacetate,
methyl cellulose, carboxymethyl cellulose or protamine sulfate. The
concentration of macromolecules as well as the methods of
incorporation can be adjusted in order to control release.
[0293] Additionally, the agent can be incorporated into particles
of polymeric materials such as polyesters, polyamino acids,
hydrogels, poly (lactic acid) or ethylenevinylacetate copolymers.
In addition to being incorporated, these agents can also be used to
trap the compound in microcapsules.
[0294] The compositions may, if desired, be presented in a pack or
dispenser device which may contain one or more unit dosage forms
containing the active ingredient. The pack may for example comprise
metal or plastic foil, such as a blister pack. The pack or
dispenser device may be accompanied by instructions for
administration.
[0295] Useful pharmaceutical dosage forms, for administration of
the compounds of this invention can be illustrated as follows:
[0296] Capsules: Capsules are prepared by filling standard
two-piece hard gelatin capsulates each with the desired amount of
powdered active ingredient, 175 milligrams of lactose, 24
milligrams of talc and 6 milligrams magnesium stearate.
[0297] Soft Gelatin Capsules: A mixture of active ingredient in
soybean oil is prepared and injected by means of a positive
displacement pump into gelatin to form soft gelatin capsules
containing the desired amount of the active ingredient. The
capsules are then washed and dried.
[0298] Tablets: Tablets are prepared by conventional procedures so
that the dosage unit is the desired amount of active ingredient.
0.2 milligrams of colloidal silicon dioxide, 5 milligrams of
magnesium stearate, 275 milligrams of microcrystalline cellulose,
11 milligrams of cornstarch and 98.8 milligrams of lactose.
Appropriate coatings may be applied to increase palatability or to
delay absorption.
[0299] Injectable: A parenteral composition suitable for
administration by injection is prepared by stirring 1.5% by weight
of active ingredients in 10% by volume propylene glycol and water.
The solution is made isotonic with sodium chloride and
sterilized.
[0300] Suspension: An aqueous suspension is prepared for oral
administration so that each 5 millimeters contain 100 milligrams of
finely divided active ingredient, 200 milligrams of sodium
carboxymethyl cellulose, 5 milligrams of sodium benzoate, 1.0 grams
of sorbitol solution U.S.P. and 0.025 millimeters of vanillin.
[0301] Gene Therapy Administration: Where appropriate, the gene
therapy vectors can be formulated into preparations in solid,
semisolid, liquid or gaseous forms such as tablets, capsules,
powders, granules, ointments, solutions, suppositories, injections,
inhalants, and aerosols, in the usual ways for their respective
route of administration. Means known in the art can be utilized to
prevent release and absorption of the composition until it reaches
the target organ or to ensure timed-release of the composition. A
pharmaceutically acceptable form should be employed which does not
ineffectuate the compositions of the present invention. In
pharmaceutical dosage forms, the compositions can be used alone or
in appropriate association, as well as in combination, with other
pharmaceutically active compounds.
[0302] Accordingly, the pharmaceutical composition of the present
invention may be delivered via various routes and to various sites
in an animal body to achieve a particular effect (see, e.g.,
Rosenfeld et al. (1991), supra; Rosenfeld et al., Clin. Res., 3
9(2), 31 1A (1991 a); Jaffe et al., supra; Berkner, supra). One
skilled in the art will recognize that although more than one route
can be used for administration, a particular route can provide a
more immediate and more effective reaction than another route.
Local or systemic delivery can be accomplished by administration
comprising application or instillation of the formulation into body
cavities, inhalation or insulation of an aerosol, or by parenteral
introduction, comprising intramuscular, intravenous, peritoneal,
subcutaneous, intradermal, as well as topical administration.
[0303] The compositions of the present invention can be provided in
unit dosage form wherein each dosage unit, e.g., a teaspoonful,
tablet, solution, or suppository, contains a predetermined amount
of the composition, alone or in appropriate combination with other
active agents. The term "unit dosage form" as used herein refers to
physically discrete units suitable as unitary dosages for human and
animal subjects, each unit containing a predetermined quantity of
the compositions of the present invention, alone or in combination
with other active agents, calculated in an amount sufficient to
produce the desired effect, in association with a pharmaceutically
acceptable diluent, carrier, or vehicle, where appropriate. The
specifications for the unit dosage forms of the present invention
depend on the particular effect to be achieved and the particular
pharmacodynamics associated with the pharmaceutical composition in
the particular host.
[0304] Accordingly, the present invention also provides a method of
transferring a therapeutic gene to a host, which comprises
administering the vector of the present invention, preferably as
part of a composition, using any of the aforementioned routes of
administration or alternative routes known to those skilled in the
art and appropriate for a particular application. The "effective
amount" of the composition is such as to produce the desired effect
in a host which can be monitored using several end-points known to
those skilled in the art. Effective gene transfer of a vector to a
host cell in accordance with the present invention to a host cell
can be monitored in terms of a therapeutic effect (e.g. alleviation
of some symptom associated with the particular disease being
treated) or, further, by evidence of the transferred gene or
expression of the gene within the host (e.g., using the polymerase
chain reaction in conjunction with sequencing, Northern or Southern
hybridizations, or transcription assays to detect the nucleic acid
in host cells, or using immunoblot analysis, antibody-mediated
detection, mRNA or protein half-life studies, or particularized
assays to detect protein or polypeptide encoded by the transferred
nucleic acid, or impacted in level or function due to such
transfer).
[0305] These methods described herein are by no means
all-inclusive, and further methods to suit the specific application
will be apparent to the ordinary skilled artisan. Moreover, the
effective amount of the compositions can be further approximated
through analogy to compounds known to exert the desired effect.
[0306] Furthermore, the actual dose and schedule can vary depending
on whether the compositions are administered in combination with
other pharmaceutical compositions, or depending on individual
differences in pharmacokinetics, drug disposition, and metabolism.
Similarly, amounts can vary in in vitro applications depending on
the particular cell line utilized (e.g., based on the number of
adenoviral receptors present on the cell surface, or the ability of
the particular vector employed for gene transfer to replicate in
that cell line). Furthermore, the amount of vector to be added per
cell will likely vary with the length and stability of the
therapeutic gene inserted in the vector, as well as also the nature
of the sequence, and is particularly a parameter which needs to be
determined empirically, and can be altered due to factors not
inherent to the methods of the present invention (for instance, the
cost associated with synthesis). One skilled in the art can easily
make any necessary adjustments in accordance with the exigencies of
the particular situation.
[0307] The following examples are offered by way of example, and
are not intended to limit the scope of the invention in any
manner.
EXAMPLES
Identification and Cloning of Endostatin Genes
[0308] In the Example presented in this section, studies are
described that identify novel canine genes, referred to herein as
endostatin, which are involved in angiogenesis-related disorders,
e.g., cancer.
Materials And Methods
[0309] 1. Isolation of RNA from dog liver tissue. 50 mg of dog
liver tissue was disrupted and homogenized by rotor-stator
homogenizer (Kontes, Vineland, N.J.) and total RNA was purified
using Rneasy Mini Kit following instructions from manufacturer
(Qiagen Inc., Santa Clarita, Calif.). 30 .mu.g of RNA was isolated
and was suspended in H20 at 0.5 .mu.g/.mu.l.
[0310] 2. RT-PCR amplification and cloning of a region of canine
collagen XVIII encompassing endostatin. Endostatin is a C-terminal
fragment of collagen XVIII (amino acid H1132-K1315 in murine
collagen XVIII). A pair of primers were designed to amplify a
region of canine collagen XVIII cDNA based on consensus sequences
from human (Accession No. L22548), mouse (Accession No. U03714) and
chicken (Accession No. AF083440). The 5' primer:
CCCTGGCGGGCAGATGACATCCTGGCC (SEQ ID NO:5) corresponding to
nucleotide #766-792 of murine partial collagen XVIII cDNA the 3'
primer: CTCTTTGGCTTCCTTTTATTTCTTGAGGATTACAT (SEQ ID NO:6),
corresponding to nucleotide #1569-1603 of murine partial collagen
XVIII cDNA were used for the amplification reaction. The RT-PCR
reaction was performed using Titan One Tube RT-PCR Kit from
Boehringer Mannheim GmbH (Germany). 0.5 ug of dog liver RNA was
denatured at 68.degree. C. for 2 minutes. The reverse transcription
reaction was performed at 50.degree. C. for 30 minutes, and the PCR
program was: hold at 94.degree. C. for 3 minutes, followed by 35
cycles of 30 seconds at 94.degree. C., 30 seconds at 55.degree. C.,
1.5 minutes at 68.degree. C. and 5 minutes of extension at
68.degree. C. The PCR products were analyzed by
electrophoresis.
[0311] The PCR products were cloned into Eukaryotic TA cloning
vector pCR 3.1 (Invitrogen, Carlsbad, Calif.) following
manufacturer's instructions and designated as pCR3.
1-pro-ca-endostatin (pCR3.1 E:UC25432), deposited with the American
Type Culture Collection (ATCC), Manassas, Va. 20110-2209, USA under
Patent Deposit Designation PTA 2096. Three independent clones
containing inserts of the expected size (0.8 kb) were sequenced
(Advanced Genetic Analysis Center, St. Paul, Minn.). The sequences
were assembled and analyzed using DNAStar (DNAStar Inc. Madison,
Wis.).
[0312] 3. Subcloning of HA-tagged canine endostatin. The exact
fragment of canine collagen XVIII corresponding to endostatin was
subcloned into pDisplay vector by RT-PCR amplification of dog liver
RNA using primers: 5' primer-CTAGAGATCTCACACCCACCAGGACTTCCAGC, 3'
primer-CGTAGTCGACCTACTTGGA- GAAGGAGGTCATGAC. To facilitate cloning,
two restriction enzyme sites Bgl II (5' primer) and Sal I (3'
primer) were incorporated into the primer sequences as shown by
underline. The insert was fused in-frame to the signal peptide and
HA epitope sequences present in the vector. The stop codon TAG
(shown in bold) of endostatin was included in the 3' primer to
terminate translation, therefore the vector-encoded PDGFR
transmembrane domain downstream of the insert would not be
translated in the final plasmid construct,
pDisplay-HA-ca-endostatin (PdisplayE:UC25433), deposited with the
ATCC under Patent Deposit Designation PTA-2097.
[0313] 4. Subcloning of canine endostatin (without HA tag). Canine
endostatin was subcloned into pSecTag2 B vector by RT-PCR
amplification of dog liver RNA using primers: 5'
primer-GATTAAGCTTCACACCCACCAGGACTTCCAG- CT (SEQ ID NO:7), 3'
primer-CTGAGAATTCCTACTTGGAGMGGAGGTCATGAC (SEQ ID NO:8). To
facilitate cloning, two restriction enzyme sites Hind III (5'
primer) and EcoR I (3' primer) were incorporated into the primer
sequences as shown by underline. The insert was fused in-frame to
the signal peptide sequences present in the vector. The stop codon
TAG (shown in bold) of endostatin was included in the 3' primer to
terminate translation. The final plasmid construct was designated
pSecTag2-ca-endostatin (pSecTag2E:UC 25434) deposited with the ATCC
under Patent Deposit Designation PTA-2098.
[0314] 5. Cloning of murine endostatin. In order to compare the
anti-angiogenesis activity of cloned canine endostatin to that of
its murine counterpart, cDNAs encoding murine endostatin were
RT-PCR amplified from mouse liver RNA and cloned into pDisplay
vector. The primers used for amplifying murine endostatin were:
5'-CTAGAGATCTCATACTCATCAGGACTTTCAGC (SEQ ID NO:9),
3'-GCTAGTCGACCTATTTGGAGAAAGAGGTCATG (SEQ ID NO:10). The flanking
restriction sites Bgl II (5' primer) and Sal I (3' primer) are
underlined and the stop codon is shown in bold. The resultant
plasmid was designated as pDisplay-HA-mu-endostatin (Accession No.
U03714).
Results
[0315] The cDNAs encoding a fragment of canine collagen XVIII which
contains the coding region of endostatin were amplified by RT-PCR
from dog liver mRNA using primers designed from consensus sequences
from several species. The nucleotide sequence of pro-endostatin is
shown in FIG. 2 (SEQ ID NO:1), and the predicted amino acid
sequence is shown in FIG. 3 (SEQ ID NO:2). The region corresponding
to endostatin based on homology is in bold in FIG. 3 and the exact
nucleotide sequence and predicated amino acid sequence of canine
endostatin (184 amino acids) is shown in FIG. 4 (SEQ ID NO:3) and
FIG. 5 (SEQ ID NO:4) respectively. FIG. 6 shows the alignment of
all known amino acid sequences of endostatin, and the degree of
homology between canine endostatin and that of human, mouse and
chicken is 84%, 83% and 76% respectively.
Expression of Endostatin Genes
[0316] In the Example presented in this section, studies are
described that identify methods to express and assay the novel
canine endostatin genes.
Materials And Methods
[0317] 1. Transfection of endostatin. Human 293 cells grown in 6
well plate were transfected with 2.5 ug of plasmids encoding canine
or murine endostatin using CalPhos Mammalian Transfection Kit
(CLONTECH Laboratories, Inc., Palo Alto, Calif.).
[0318] 2. Detection of endostatin by immunofluorescence. 2 days
post-transfection, cells were fixed in 4% paraformaldehyde,
permeablized in 0.05% Triton X100, and blocked in 1% goat serum
(all chemicals from Sigma, St. Louis, Miss.). HA.11 (BabCO,
Richmond, Calif.), a monoclonal antibody against HA epitope was
used at 1:500 dilution to stain the cells, and TR1TC conjugated
anti-mouse IgG (Sigma) was used at 1:1,000 for detection. The
immunofluorescent cells were visualized under Nikon TE 300
microscope.
[0319] 3. Detection of endostatin by immunoblot analysis. 2 days
post-transfection, cells were harvested by lysis in Tris-Glycine
SDS Sample Buffer (NOVEX, San Diego, Calif.). The culture
supernatants were harvested by centrifugation at 3000 rpm for 15
minutes. The proteins were separated by 4-20% SDS-PAGE and
transferred to PVDF membrane (NOVEX, San Diego, Calif.). For
immunoblot analysis, HA antibody against HA epitope were diluted
1:500 and incubated with the blot for 1.5 hours. After incubating
for 30 minutes with alkaline phosphatase conjugated anti-mouse IgG
(1:10,00, Boehringer Mannheim, Indianapolis, Ind.), the bound
antibody was detected using phosphatase substrate BCIP/NBT (KPL,
Gaithersburg, Md.).
[0320] 4. Endothelial cell proliferation assay. The
anti-proliferative effect of cloned canine endostatin was tested
using bovine pulmonary artery endothelial cells (C-PAE, ATCC,
Manassas, Va.). The cells (104 cells/well) were plated in 24-well
collagen I-coated plates (Collaborative Biomedical Products,
Bedford, Mass.) in OptiMEM (GIBCO BRL, Rockville, Md.) with 2%
fetal bovine serum (Nova-Tech Inc., Grand Island, Nev.).
[0321] 5. After 24 hour incubation, the medium was replaced with
conditioned medium from transfected 293 cells supplemented with 1
ng/ml bFGF (Collaborative Biomedical Products, Bedford, Mass.). The
cells were trypsinized 48 hours later and viable cells were counted
using trypan blue staining and hemacytometer. The results were
analyzed using Prizm 2.01 (Graphpad Software Inc., San Diego,
Calif.).
Results
[0322] Expression of canine endostatin. The cDNAs encoding canine
endostatin were subcloned into mammalian expression vector
pDisplay. Because endostatin is a fragment of a secreted protein
and normally circulates in the blood, the proteins were fused,
in-frame at the N-terminus to the murine 1 g k-chain leader
sequence which directs the protein to the secretory pathway,
followed by fusion to hemagglutinin A epitope tag (HA) which allows
for detection of expressed protein. Human 293 cells were
transfected with plasmids encoding signal sequence and HA-tagged
endostatin from dog and mouse, the cells were harvested 48 hours
post transfection for analysis. FIG. 7 shows the results of
immunofluorescent assay. The staining patterns of endostatin are
characteristic of perinuclear endoplasmic reticulum and
trans-Golgi, consistent with the notion that this protein is
directed to the secretory pathway.
[0323] 1. The expression of endostatin was further studied by
immunoblot analysis. The expression of transfected endostatin was
detected from both cell lysates (FIG. 8, lane 2 and 4) and culture
supernatants (FIG. 8, lane 6 and 8). Several forms of intracellular
endostatin with molecular weights ranging 20-25 kDa (FIG. 8, lane 2
and 4) exist. These are likely intermediates of protein maturation
since only one discrete band was seen in the secreted form.
[0324] 2. Inhibition of endothelial cell proliferation. One unique
feature of endostatin is its ability to specifically inhibit
endothelial cell proliferation (0.quadrature.Reilly et al., 1997,
Cell 88(2):277-85; O.quadrature.Reilly et al., 1994, Cell 79(2):3
15-28). Bovine pulmonary artery endothelial cells (CPAE cells)
(Dhanabal et al., 1999) were stimulated with basic fibroblast
growth factor (bFGF) in the presence or absence of endostatin
proteins produced from conditioned media from transfected 293
cells. The proliferation rate was normalized against control cells
which were treated with bFGF and conditioned media from green
fluorescent protein (GFP) transfected cells. The results from four
independent experiments were summarized in FIG. 9. CPAE cells
proliferated slowly without bFGF activation (38% of that of
control). The addition of HA-tagged canine endostatin inhibited the
stimulating effect of bFGF with CPAE cells proliferating at 53% of
that of control respectively. The inhibitory activity seen with
HA-tagged canine endostatin was comparable to that with the murine
proteins (both at 57% level of controls). The differences in
proliferation rate between control and each treated group were all
statistically significant (P<0.05). In contrast, treatment with
endostatin did not inhibit proliferation of the epithelial 293
cells, suggesting that the inhibitory effect of endostatin is
specific to endothelial cells. Similar results were obtained using
untagged canine endostatin (FIG. 10). The addition of canine
endostatin specifically inhibited the stimulating effect of bFGF
with CPAE cells proliferating at 59% of that of control. The
differences in the proliferation rate between control and each
treated group were all statistically significant (P<0.005,
n=3).
Discussion
[0325] Here the cloning of the canine angiogenesis inhibitor
endostatin is reported. It shares approximately 80% homology with
its human and murine counterparts. To facilitate secretion of
cloned proteins, a signal sequence from mouse 1 g k-chain was fused
to the N-terminus of endostatin. Immunofluorescent studies and
immunoblot assays confirmed that the proteins were localized to the
secretory pathway and secreted into conditioned media. Canine
endostatin was also shown to specifically inhibit endothelial cell
proliferation at a level comparable to its murine counterpart.
[0326] Mouse endostatin has been shown to inhibit the growth of a
wide variety of primary and metastatic tumors. Furthermore, the
treatment with endostatin can be repeated many times without
inducing drug resistance or side effects. Since these angiogenesis
inhibitors are directed at a novel target (endothelial cells), they
can also be conveniently combined with other cancer therapies such
as surgery, chemotherapy, radiation therapy and immunotherapy to
achieve superior therapeutic effects. These properties have made
endostatin a very attractive candidate for treating canine cancers,
where a safe, efficacious, and broad-spectrum therapy is very much
in need. However, the successful application of endostatin as a
cancer therapy probably will involve repeated, continuing treatment
in order to achieve long-term tumor suppression and dormancy (Boehm
et al., 1997, Nature 390(6658):404-407). The cloning and
identification of canine endostatin allows for the treatment of dog
tumors using specie-specific angiogenesis inhibitors, thereby
minimizing the risk of evoking immune responses under repeated
administration. Finally, spontaneous canine tumors are very similar
to their human correlates in histopathologic and biologic behavior
(MacEwen, 1990, Cancer Metastasis Rev 9(2): 125-36), therefore
experimental results obtained from canine tumors will also provide
valuable information for human cancer biology and treatment.
[0327] The present invention is not to be limited in scope by the
specific embodiments described herein, which are intended as single
illustrations of individual aspects of the invention, and
functionally equivalent methods and components are within the scope
of the invention. Indeed, various modifications of the invention,
in addition to those shown and described herein will become
apparent to those skilled in the art from the foregoing description
and accompanying drawings. Such modifications are intended to fall
within the scope of the appended claims.
[0328] All publications and patent applications mentioned in this
specification are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
Sequence CWU 1
1
15 1 829 DNA CANINE 1 ccctggcggg cagatgacat cctggccggc cccccgcgcc
tgctggaccc ccagccctac 60 cccggggccc cgcaccacgg ctcctacgtg
cacttccagc cggctcgccc cactggtggg 120 cccgtccaca cccacaccca
cacccaccag gacttccagc tggtgctgca cctggtggcc 180 ctgaacagcc
cgcagccggg cggcatgcga ggcatccggg gagcggactt ccagtgcttc 240
cagcaggcgc gcgccgcggg gctggccggc accttccggg ccttcctgtc gtcgcggctg
300 caggacctct acagcatcgt gcgccgcgcc gaccgcaccg gggtgcccgt
cgtcaacctc 360 agggacgagg tgctcttccc cagctgggag gccttattct
cgggctccga gggccagctg 420 aagcccgggg cccgcatctt ctctttcgac
ggcagagatg tcctgcagca ccccgcctgg 480 ccccggaaga gcgtgtggca
cggctccgac cccagcgggc gccgcctgac cgacagctac 540 tgcgagacgt
ggcggacgga ggccccggcg gccaccgggc aggcgtcgtc gctgctggcg 600
ggcaggctgc tggagcagga ggccgcgagc tgccgccacg ccttcgtggt gctctgcatc
660 gagaacagcg tcatgacctc cttctccaag tagggccgcg cggcccacgg
acaggcgggg 720 gagggggcgc ccgcaggagc atccgccgcc ccgggggggc
ctggccggga cgcttgcctg 780 caccgtcacg tttaatgtaa tcctcaagaa
ataaaaggaa gccaaagag 829 2 230 PRT CANINE 2 Pro Trp Arg Ala Asp Asp
Ile Leu Ala Gly Pro Pro Arg Leu Leu Asp 1 5 10 15 Pro Gln Pro Tyr
Pro Gly Ala Pro His His Gly Ser Tyr Val His Phe 20 25 30 Gln Pro
Ala Arg Pro Thr Gly Gly Pro Val His Thr His Thr His Thr 35 40 45
His Gln Asp Phe Gln Leu Val Leu His Leu Val Ala Leu Asn Ser Pro 50
55 60 Gln Pro Gly Gly Met Arg Gly Ile Arg Gly Ala Asp Phe Gln Cys
Phe 65 70 75 80 Gln Gln Ala Arg Ala Ala Gly Leu Ala Gly Thr Phe Arg
Ala Phe Leu 85 90 95 Ser Ser Arg Leu Gln Asp Leu Tyr Ser Ile Val
Arg Arg Ala Asp Arg 100 105 110 Thr Gly Val Pro Val Val Asn Leu Arg
Asp Glu Val Leu Phe Pro Ser 115 120 125 Trp Glu Ala Leu Phe Ser Gly
Ser Glu Gly Gln Leu Lys Pro Gly Ala 130 135 140 Arg Ile Phe Ser Phe
Asp Gly Arg Asp Val Leu Gln His Pro Ala Trp 145 150 155 160 Pro Arg
Lys Ser Val Trp His Gly Ser Asp Pro Ser Gly Arg Arg Leu 165 170 175
Thr Asp Ser Tyr Cys Glu Thr Trp Arg Thr Glu Ala Pro Ala Ala Thr 180
185 190 Gly Gln Ala Ser Ser Leu Leu Ala Gly Arg Leu Leu Glu Gln Glu
Ala 195 200 205 Ala Ser Cys Arg His Ala Phe Val Val Leu Cys Ile Glu
Asn Ser Val 210 215 220 Met Thr Ser Phe Ser Lys 225 230 3 555 DNA
CANINE 3 cacacccacc aggacttcca gctggtgctg cacctggtgg ccctgaacag
cccgcagccg 60 ggcggcatgc gaggcatccg gggagcggac ttccagtgct
tccagcaggc gcgcgccgcg 120 gggctggccg gcaccttccg ggccttcctg
tcgtcgcggc tgcaggacct ctacagcatc 180 gtgcgccgcg ccgaccgcac
cggggtgccc gtcgtcaacc tcagggacga ggtgctcttc 240 cccagctggg
aggccttatt ctcgggctcc gagggccagc tgaagcccgg ggcccgcatc 300
ttctctttcg acggcagaga tgtcctgcag caccccgcct ggccccggaa gagcgtgtgg
360 cacggctccg accccagcgg gcgccgcctg accgacagct actgcgagac
gtggcggacg 420 gaggccccgg cggccaccgg gcaggcgtcg tcgctgctgg
cgggcaggct gctggagcag 480 gaggccgcga gctgccgcca cgccttcgtg
gtgctctgca tcgagaacag cgtcatgacc 540 tccttctcca agtag 555 4 184 PRT
CANINE 4 His Thr His Gln Asp Phe Gln Leu Val Leu His Leu Val Ala
Leu Asn 1 5 10 15 Ser Pro Gln Pro Gly Gly Met Arg Gly Ile Arg Gly
Ala Asp Phe Gln 20 25 30 Cys Phe Gln Gln Ala Arg Ala Ala Gly Leu
Ala Gly Thr Phe Arg Ala 35 40 45 Phe Leu Ser Ser Arg Leu Gln Asp
Leu Tyr Ser Ile Val Arg Arg Ala 50 55 60 Asp Arg Thr Gly Val Pro
Val Val Asn Leu Arg Asp Glu Val Leu Phe 65 70 75 80 Pro Ser Trp Glu
Ala Leu Phe Ser Gly Ser Glu Gly Gln Leu Lys Pro 85 90 95 Gly Ala
Arg Ile Phe Ser Phe Asp Gly Arg Asp Val Leu Gln His Pro 100 105 110
Ala Trp Pro Arg Lys Ser Val Trp His Gly Ser Asp Pro Ser Gly Arg 115
120 125 Arg Leu Thr Asp Ser Tyr Cys Glu Thr Trp Arg Thr Glu Ala Pro
Ala 130 135 140 Ala Thr Gly Gln Ala Ser Ser Leu Leu Ala Gly Arg Leu
Leu Glu Gln 145 150 155 160 Glu Ala Ala Ser Cys Arg His Ala Phe Val
Val Leu Cys Ile Glu Asn 165 170 175 Ser Val Met Thr Ser Phe Ser Lys
180 5 27 DNA MURINE 5 ccctggcggg cagatgacat cctggcc 27 6 35 DNA
MURINE 6 ctctttggct tccttttatt tcttgaggat tacat 35 7 33 DNA CANINE
7 gattaagctt cacacccacc aggacttcca gct 33 8 34 DNA CANINE 8
ctgagaattc ctacttggag aaggaggtca tgac 34 9 32 DNA MURINE 9
ctagagatct catactcatc aggactttca gc 32 10 32 DNA MURINE 10
gctagtcgac ctatttggag aaagaggtca tg 32 11 184 PRT CHICKEN 11 His
Val His Gln Asp Phe Gln Pro Ala Leu His Leu Val Ala Leu Asn 1 5 10
15 Thr Pro Leu Ser Gly Gly Met Arg Gly Ile Arg Gly Ala Asp Phe Gln
20 25 30 Cys Phe Gln Gln Ala Arg Gln Val Gly Leu Ala Gly Thr Phe
Arg Ala 35 40 45 Phe Leu Ser Ser Arg Leu Gln Asp Leu Tyr Ser Ile
Val Arg Arg Ala 50 55 60 Asp Arg Thr Ala Val Pro Ile Val Asn Leu
Arg Asp Glu Val Leu Phe 65 70 75 80 Ser Asn Trp Glu Ala Leu Phe Thr
Gly Ser Glu Ala Pro Leu Arg Ala 85 90 95 Gly Ala Arg Ile Leu Ser
Phe Asp Gly Arg Asp Ile Leu Gln Asp Ser 100 105 110 Ala Trp Pro Gln
Lys Ser Ile Trp His Gly Ser Asp Ala Lys Gly Arg 115 120 125 Arg Leu
Pro Glu Ser Tyr Cys Glu Ala Trp Arg Thr Asp Glu Arg Gly 130 135 140
Thr Ser Gly Gln Ala Ser Ser Leu Ser Ser Gly Lys Leu Leu Glu Gln 145
150 155 160 Ser Ala Ser Ser Cys Gln His Ala Phe Val Val Leu Cys Ile
Glu Asn 165 170 175 Ser Phe Met Thr Ala Ala Lys Lys 180 12 183 PRT
HUMAN 12 His Ser His Arg Asp Phe Gln Pro Val Leu His Leu Val Ala
Leu Asn 1 5 10 15 Ser Pro Leu Ser Gly Gly Met Arg Gly Ile Arg Gly
Ala Asp Phe Gln 20 25 30 Cys Phe Gln Gln Ala Arg Ala Val Gly Leu
Ala Gly Thr Phe Arg Ala 35 40 45 Phe Leu Ser Ser Arg Leu Gln Asp
Leu Tyr Ser Ile Val Arg Arg Ala 50 55 60 Asp Arg Ala Ala Val Pro
Ile Val Asn Leu Lys Asp Glu Leu Leu Phe 65 70 75 80 Pro Ser Trp Glu
Ala Leu Phe Ser Gly Ser Glu Gly Pro Leu Lys Pro 85 90 95 Gly Ala
Arg Ile Phe Ser Phe Asp Gly Lys Asp Val Leu Arg His Pro 100 105 110
Ile Trp Pro Gln Lys Ser Val Trp His Gly Ser Asp Pro Asn Gly Arg 115
120 125 Arg Leu Thr Glu Ser Tyr Cys Glu Thr Trp Arg Thr Glu Ala Pro
Ser 130 135 140 Ala Thr Gly Gln Ala Ser Ser Leu Leu Gly Gly Arg Leu
Leu Gly Gln 145 150 155 160 Ser Ala Ala Ser Cys His His Ala Tyr Ile
Val Leu Cys Ile Glu Asn 165 170 175 Ser Phe Met Thr Ala Ser Lys 180
13 184 PRT MURINE 13 His Thr His Gln Asp Phe Gln Pro Val Leu His
Leu Val Ala Leu Asn 1 5 10 15 Thr Pro Leu Ser Gly Gly Met Arg Gly
Ile Arg Gly Ala Asp Phe Gln 20 25 30 Cys Phe Gln Gln Ala Arg Ala
Val Gly Leu Ser Gly Thr Phe Arg Ala 35 40 45 Phe Leu Ser Ser Arg
Leu Gln Asp Leu Tyr Ser Ile Val Arg Arg Ala 50 55 60 Asp Arg Gly
Ser Val Pro Ile Val Asn Leu Lys Asp Glu Val Leu Ser 65 70 75 80 Pro
Ser Trp Asp Ser Leu Phe Ser Gly Ser Gln Gly Gln Leu Gln Pro 85 90
95 Gly Ala Arg Ile Phe Ser Phe Asp Gly Arg Asp Val Leu Arg His Pro
100 105 110 Ala Trp Pro Gln Lys Ser Val Trp His Gly Ser Asp Pro Ser
Gly Arg 115 120 125 Arg Leu Met Glu Ser Tyr Cys Glu Thr Trp Arg Thr
Glu Thr Thr Gly 130 135 140 Ala Thr Gly Gln Ala Ser Ser Leu Leu Ser
Gly Arg Leu Leu Glu Gln 145 150 155 160 Lys Ala Ala Ser Cys His Asn
Ser Tyr Ile Val Leu Cys Ile Glu Asn 165 170 175 Ser Phe Met Thr Ser
Phe Ser Lys 180 14 32 DNA CANINE 14 ctagagatct cacacccacc
aggacttcca gc 32 15 34 DNA CANINE 15 cgtagtcgac ctacttggag
aaggaggtca tgac 34
* * * * *
References