U.S. patent application number 10/842965 was filed with the patent office on 2005-01-13 for phosphodiesterase 10.
Invention is credited to Loughney, Kate.
Application Number | 20050009062 10/842965 |
Document ID | / |
Family ID | 22126229 |
Filed Date | 2005-01-13 |
United States Patent
Application |
20050009062 |
Kind Code |
A1 |
Loughney, Kate |
January 13, 2005 |
Phosphodiesterase 10
Abstract
The present invention provides novel human PDE10 polypeptides,
polynucleotides encoding the polypeptides, expression constructs
comprising the polynucleotides, host cells transformed with the
expression constructs; methods for producing PDE10 polypeptides;
antisense polynucleotides; and antibodies specifically
immunoreactive with the PDE10 polypeptides. The invention further
provides methods to identify binding partners of PDE 10, and more
particularly, binding partners that modulate PDE10 enzyme
activity.
Inventors: |
Loughney, Kate; (Seattle,
WA) |
Correspondence
Address: |
MARSHALL, GERSTEIN & BORUN LLP
6300 SEARS TOWER
233 S. WACKER DRIVE
CHICAGO
IL
60606
US
|
Family ID: |
22126229 |
Appl. No.: |
10/842965 |
Filed: |
May 11, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10842965 |
May 11, 2004 |
|
|
|
10034015 |
Dec 20, 2001 |
|
|
|
6734003 |
|
|
|
|
10034015 |
Dec 20, 2001 |
|
|
|
09256000 |
Feb 23, 1999 |
|
|
|
6350603 |
|
|
|
|
60075508 |
Feb 23, 1998 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/196; 435/320.1; 435/325; 435/69.1; 514/252.16; 530/388.26;
536/23.2 |
Current CPC
Class: |
A61K 38/00 20130101;
C12N 9/16 20130101; A61P 43/00 20180101 |
Class at
Publication: |
435/006 ;
435/196; 435/069.1; 435/320.1; 435/325; 536/023.2; 530/388.26;
514/252.16 |
International
Class: |
C12Q 001/68; C07H
021/04; C12N 009/16; A61K 031/519; C07K 016/40 |
Claims
1. A purified and isolated PDE10 polypeptide.
2.-33. (Canceled)
Description
[0001] This application claims priority of U.S. Provisional
Application No. 60/075,508, filed Feb. 23, 1998.
FIELD OF THE INVENTION
[0002] The present invention relates generally to a novel
phosphodiesterase (PDE) designated PDE10. Depending on nomenclature
used, PDE10 is also referred to as PDE9.
BACKGROUND OF THE INVENTION
[0003] Phosphodiesterases (PDEs) hydrolyze 3', 5' cyclic
nucleotides to their respective nucleoside 5' monophosphates. The
cyclic nucleotides cAMP and cGMP are synthesized by adenylyl and
guanylyl cyclases, respectively, and serve as second messengers in
a number of cellular signaling pathways. The duration and strength
of the second messenger signal is a function of the rate of
synthesis and the rate of hydrolysis of the cyclic nucleotide.
[0004] Multiple families of PDEs have been identified. The
nomenclature system includes first a number that indicates the PDE
family. To date, nine families (PDE1-9) are known which are
classified by: (i) primary structure; (ii) substrate preference;
(iii) response to different modulators; (iv) sensitivity to
specific inhibitors; and (v) modes of regulation [Loughney and
Ferguson, in Phosphodiesterase Inhibitors, Schudt, et al. (Eds.),
Academic Press New York, N.Y. (1996) pp. 1-19]. The number
indicating the family is followed by a capital letter, indicating a
distinct gene, and the capital letter followed by a second number,
indicating a specific splice variant or a specific transcript that
utilizes a unique transcription initiation site.
[0005] The amino acid sequences of all mammalian PDEs identified to
date include a highly conserved region of approximately 270 amino
acids located in the carboxy terminal half of the protein
[Charbonneau, et al., Proc. Natl. Acad. Sci. (USA) 83:9308-931,2
(1986)]. The conserved domain includes the catalytic site for cAMP
and/or cGMP hydrolysis and two putative zinc binding sites as well
as family specific determinants [Beavo, Physiol. Rev. 75:725-748
(1995); Francis, et al., J. Biol. Chem. 269:22477-22480 (1994)].
The amino terminal regions of the various PDEs are highly variable
and include other family specific determinants such as: (i)
calmodulin binding sites (PDE1); (ii) non-catalytic cyclic GMP
binding sites (PDE2, PDE5, PDE6); (iii) membrane targeting sites
(PDE4); (iv) hydrophobic membrane association sites (PDE3); and (v)
phosphorylation sites for either the calmodulin-dependent kinase II
(PDE1), the cAMP-dependent kinase (PDE1, PDE3, PDE4), or the cGMP
dependent kinase (PDE5) [Beavo, Physiol. Rev. 75:725-748 (1995);
Manganiello, et al., Arch. Biochem. Acta 322:1-13 (1995); Conti, et
al., Physiol. Rev. 75:723-748 (1995)].
[0006] Members of the PDE1 family are activated by
calcium-calmodulin. Three genes have been identified; PDE1A and
PDE1B preferentially hydrolyze cGMP while PDE1C has been shown to
exhibit a high affinity for both cAMP and cGMP. The PDE2 family is
characterized as being specifically stimulated by cGMP [Loughney
and Ferguson, supra]. Only one gene has been identified, PDE2A, the
enzyme product of which is specifically inhibited by
erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA). Enzymes in the PDE3
family are specifically inhibited by cGMP. Two genes are known,
PDE3A and PDE3B, both having high affinity for both cAMP and cGMP,
although the V.sub.max for cGMP hydrolysis is low enough that cGMP
functions as a competitive inhibitor for cAMP hydrolysis. PDE3
enzymes are specifically inhibited by milrinone and enoximone
[Loughney and Ferguson, supra]. The PDE4 family effects cAMP
hydrolysis and includes four genes, PDE4A, PDE4B, PDE4C, and PDE4D,
each having multiple splice variants. Members of this family are
specifically inhibited by the anti-depressant drug rolipram.
Members of PDE5 family bind cGMP at non-catalytic sites and
preferentially hydrolyze cGMP. Only one gene, PDE5A, has been
identified. The photoreceptor PDE6 enzymes specifically hydrolyze
cGMP [Loughney and Ferguson, supra]. Genes include PDE6A and PDE6B
(the protein products of which dimerize and bind two copies of a
smaller .gamma. inhibitory subunit to form rod PDE), in addition to
PDE6C which associates with three smaller proteins to form cone
PDE. The PDE7 family effects cAMP hydrolysis but, in contrast to
the PDE4 family, is not inhibited by rolipram [Loughney and
Ferguson, supra]. Only one gene, PDE7A, has been identified. The
PDE8 family has been shown to hydrolyze both cAMP and cGMP and is
insensitive to inhibitors specific for PDEs 1-5. Depending on
nomenclature used, PDE8 is also referred to as PDE10, but is
distinct from PDE10 described herein. The PDE9 family
preferentially hydrolyzes cAMP and is not sensitive to inhibition
by rolipram, a PDE4-specific inhibitor, or isobutyl methyl xanthine
(IBMX), a non-specific PDE inhibitor. Depending on nomenclature
used, PDE9 is also referred to as PDE8, but is distinct from PDE8
mentioned above. To date, two genes have been identified in the
PDE9 family.
[0007] Specific and non-specific inhibitors of the various PDE
protein families have been shown to be effective in treating
disorders attributable, in part, to aberrant levels of cAMP or
cGMP. For example, the PDE4-specific inhibitor rolipram, mentioned
above as an anti-depressant, inhibits lipopolysaccharide-induced
expression of TNF.alpha. and has been effective in treating
multiple sclerosis in an animal model. Other PDE4-specific
inhibitors are being investigated for use as anti-inflammatory
therapeutics, and efficacy in attenuating the late asthmatic
response to allergen challenge has been demonstrated [Harbinson, et
al., Eur. Respir. J. 10:1008-1014 (1997)]. Inhibitors specific for
the PDE3 family have been approved for treatment of congestive
heart failure. PDE5 inhibitors are currently being evaluated for
treatment of penile erectile dysfunction [Boolell, et al., Int. J.
Impotence Res. 8:47-50 (1996)]. Non-specific inhibitors, such as
theophylline and pentoxifylline, are currently used in the
treatment of respiratory and vascular disorders, respectively.
[0008] Given the importance of cAMP and cGMP in intracellular
second messenger signaling, there thus exists an ongoing need in
the art to identify additional PDE species. Identification of
heretofore unknown families of PDEs, and genes and splice variants
thereof, will provide additional pharmacological approaches to
treating conditions in which cyclic nucleotide pathways are
aberrant, as well as conditions in which modulation of
intracellular cAMP and/or cGMP levels in certain cell types is
desirable. Identification of family-specific and enzyme-specific
inhibitors will permit development of therapeutic and prophylactic
agents which act on desired cell types expressing PDEs and/or
particular metabolic pathways regulated by cyclic nucleotide
monophosphate steady-state concentrations.
SUMMARY OF THE INVENTION
[0009] In brief, the prevent invention provides purified and
isolated PDE10 polypeptides. Preferred polypeptides comprise the
amino acid sequence selected from the group consisting of SEQ ID
NO: 2, SEQ ID NO: 18, SEQ ID NO: 20 and SEQ ID NO: 22.
[0010] The invention also provides polynucleotides encoding
polypeptides of the invention. A preferred polynucleotide comprises
the sequence set forth in SEQ ID NO: 1. Polynucleotides of the
invention include polynucleotides encoding a human PDE10
polypeptide selected from the group consisting of: a) the
polynucleotide according to SEQ ID NO: 1, 18, 20 or 22; b) a DNA
which hybridizes under moderately stringent conditions to the
non-coding strand of the polynucleotide of (a); and c) a DNA which
would hybridize to the non-coding strand of the polynucleotide of
(a) but for the redundancy of the genetic code. Polynucleotides of
the invention comprise any one of the polynucleotide set out in SEQ
ID NO: 18, SEQ ID NO: 20, and SEQ ID NO: 22, as well as fragments
thereof. The invention provide polynucleotides which are DNA
molecules. DNA molecules include cDNA, genomic DNA, and wholly or
partially chemically synthesized DNA molecule. The invention also
provides antisense polynucleotides which specifically hybridizes
with the complement of a polynucleotide of the invention.
[0011] The invention also provides expression constructs comprising
a polynucleotide of the invention, host cells transformed or
transfected with an expression construct of the invention, and
methods for producing a PDE10 polypeptide comprising the steps of:
a) growing the host cell of the invention under conditions
appropriate for expression of the PDE10 polypeptide and b)
isolating the PDE10 polypeptide from the host cell or the medium of
its growth.
[0012] The invention further provides antibodies specifically
immunoreactive with a polypeptide of the invention. Preferably, the
antibody is a monoclonal antibody. The invention also provides
hybridomas which produces an antibody of the invention.
Anti-idiotype antibody specifically immunoreactive with the
antibody of the invention are also contemplated.
[0013] The invention also provides methods to identify a specific
binding partner compound of a PDE10 polypeptide comprising the
steps of: a) contacting the PDE10 polypeptide with a compound under
conditions which permit binding between the compound and the PDE10
polypeptide; b) detecting binding of the compound to the PDE10
polypeptide; and c) identifying the compound as a specific binding
partner of the PDE10 polypeptide. Preferably, methods of the
invention identify specific binding partners that modulate activity
of the PDE10 polypeptide. In one aspect, the methods identify
compounds that inhibits activity of the PDE10 polypeptide. In
another aspect, the methods identify compounds that enhance
activity of the PDE10 polypeptide.
[0014] The invention also provides methods to identify a specific
binding partner compound of the PDE10 polynucleotide of the
invention comprising the steps of: a) contacting the PDE1.0
polynucleotide with a compound under conditions which permit
binding between the compound and the PDE10 polynucleotide; b)
detecting binding of the compound to the PDE10 polynucleotide; and
c) identifying the compound as a specific binding partner of the
PDE10 polynucleotide. Preferably, the methods identify specific
binding partner compounds that modulate expression of a PDE10
polypeptide encoded by the PDE10 polynucleotide. In one aspect,
method of the invention identify compounds that inhibit expression
of the PDE10 polypeptide. In another aspect, methods of the
invention identify compounds that enhance expression of the PDE10
polypeptide.
[0015] Binding partner compounds identified by methods of the
invention are also contemplated, as are compositions comprising the
compound. The invention further comprehends use of binding partner
compounds of the invention in production of medicaments for the
treatment of PDE10-related disorders.
DETAILED DESCRIPTION OF THE INVENTION
[0016] The present invention provides polypeptides and underlying
polynucleotides for a novel PDE family designated PDE10. The PDE10
family is distinguished from previously known PDE families in that
it shows a lower degree of sequence homology than would be expected
for a member of a known family of PDEs and it is not sensitive to
inhibitors that are known to be specific for previously identified
PDE families. Outside of the catalytic region of the protein, PDE10
shows little homology to other known PDEs. Even over the catalytic
region, PDE10 amino acid sequence identity is less than 40% when
compared with the same region in known PDEs. The invention includes
both naturally occurring and non-naturally occurring PDE10
polynucleotides and polypeptide products thereof. Naturally
occurring PDE10 products include distinct gene and, polypeptide
species within the PDE10 family; these species include those which
are expressed within cells of the same animal as well as
corresponding species homologs expressed in cells of other animals.
Within each PDE10 species, the invention further provides splice
variants encoded by the same polynucleotide but which arise from
distinct mRNA transcripts. Non-naturally occurring PDE10 products
include variants of the naturally occurring products such as
analogs (i.e., wherein one or more amino acids are added,
substituted, or deleted) and those PDE10 products which include
covalent modifications (i.e., fusion proteins, glycosylation
variants, and the like).
[0017] The present invention provides novel purified and isolated
polynucleotides (e.g., DNA sequences and RNA transcripts, both
sense and complementary antisense strands, including splice
variants thereof) encoding human PDE10s. DNA sequences of the
invention include genomic and cDNA sequences as well as wholly or
partially chemically synthesized DNA sequences. Genomic DNA of the
invention comprises the protein coding region for a polypeptide of
the invention and includes allelic variants of the preferred
polynucleotide of the invention. Genomic DNA of the invention is
distinguishable from genomic DNAs encoding polypeptides other than
PDE10 in that it includes the PDE10 coding region as defined by
PDE10 cDNA of the invention. The invention therefore provides
structural, physical, and functional characterization for genomic
PDE10 DNA. Allelic variants are known in the art to be modified
forms of a wild type gene sequence, the modification resulting from
recombination during chromosomal segregation or exposure to
conditions which give rise to genetic mutation. Allelic variants,
like wild type genes, are inherently naturally occurring sequences
(as opposed to non-naturally occurring variants which arise from in
vitro manipulation). "Synthesized," as used herein and is
understood in the art, refers to purely chemical, as opposed to
enzymatic, methods for producing polynucleotides. "Wholly"
synthesized DNA sequences are therefore produced entirely by
chemical means, and "partially" synthesized DNAs embrace those
wherein only portions of the resulting DNA were produced by
chemical means. A preferred DNA sequence encoding a human PDE10
polypeptide is set out in SEQ ID NO: 1. The worker of skill in the
art will readily appreciate that the preferred DNA of the invention
comprises a double stranded molecule, for example the molecule
having the sequence set forth in SEQ ID NO: 1 along with the
complementary molecule (the "non-coding strand" or "complement")
having a sequence deducible from the sequence of SEQ ID NO: 1
according to Watson-Crick base paring rules for DNA. Also preferred
are polynucleotides encoding the PDE10 polypeptide of SEQ ID NO:
2.
[0018] The disclosure of a full length polynucleotide encoding a
PDE10 polypeptide makes readily available to the worker of ordinary
skill in the art every possible fragment of the full length
polynucleotide. The invention therefore provides fragments of
PDE10-encoding polynucleotides of the invention comprising at least
10 to 20, and preferably at least 15, nucleotides, however, the
invention comprehends fragments of various lengths. Preferably,
fragment polynucleotides of the invention comprise sequences unique
to the PDE10-encoding polynucleotide sequence, and therefore
hybridize under stringent or preferably moderate conditions only
(i.e., "specifically") to polynucleotides encoding PDE10, or PDE10
polynucleotide fragments containing the unique sequence.
Polynucleotide fragments of genomic sequences of the invention
comprise not only sequences unique to the coding region, but also
include fragments of the full length sequence derived from introns,
regulatory regions, and/or other non-translated sequences.
Sequences unique to polynucleotides of the invention are
recognizable through sequence comparison to other known
polynucleotides, and can be identified through use of alignment
programs made available in public sequence databases.
[0019] The invention also provides fragment polynucleotides that
are conserved in one or more polynucleotides encoding members of
the PDE10 family of polypeptides. Such fragments include sequences
characteristic of the family of PDE10 polynucleotides, and are also
referred to as "signature sequences." The conserved signature
sequences are readily discernable following simple sequence
comparison of polynucleotides encoding members of the PDE10 family.
Fragments of the invention can be labeled in a manner that permits
their detection, and radioactive and non-radioactive labeling are
comprehended. Fragment polynucleotides are particularly useful as
probes for detection of full length or other fragment PDE10
polynucleotides. One or more fragment polynucleotides can be
included in kits that are used to detect the presence of a
polynucleotide encoding PDE10, or used to detect variations in a
polynucleotide sequence encoding PDE10.
[0020] The invention further embraces species homologs, preferably
mammalian, of the human PDE10 DNA. The polynucleotide sequence
information provided by the invention makes possible the
identification and isolation of polynucleotides encoding related
mammalian PDE10 molecules by well known techniques including
Southern and/or Northern hybridization, and polymerase chain
reaction (PCR). Examples of related polynucleotides include human
and non-human genomic sequences, including allelic variants, as
well as polynucleotides encoding polypeptides homologous to PDE10
and structurally related polypeptides sharing one or more
biological, immunological, and/or physical properties of PDE10.
[0021] The invention also embraces DNA sequences encoding PDE10
species which hybridize under moderately stringent conditions to
the non-coding strands, or complements, of the polynucleotide in
any one of SEQ ID NOs: 1, 18, 20, and 22. DNA sequences encoding
PDE10 polypeptides which would hybridize thereto but for the
redundancy of the genetic code are contemplated by the invention.
Exemplary moderate hybridization conditions are as follows:
hybridization at 65.degree. C. in 3.times.SSC, 0.1% Sarkosyl, and
20 mM sodium phosphate, pH 6.8, and washing at 65.degree. C. in
2.times.SSC with 0.1% SDS. Exemplary high stringency conditions
would include a final wash in 0.2.times.SSC/0.1% SDS, at 65.degree.
C. to 75.degree. C. It is understood in the art that conditions of
equivalent stringency can be achieved through variation of
temperature and buffer, or salt concentration as described Ausebel,
et al. (Eds.), Protocols in Molecular Biology, John Wiley &
Sons (1994), pp. 6.0.3 to 6.4.10. Modifications in hybridization
conditions can be empirically determined or precisely calculated
based on the length and the percentage of guanosine/cytosine (GC)
base pairing of the probe. The hybridization conditions can be
calculated as described in Sambrook, et al., (Eds.), Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press:
Cold Spring Harbor, N.Y. (1989), pp. 9.47 to 9.51.
[0022] Autonomously replicating recombinant expression
constructions such as plasmid and viral DNA vectors incorporating
PDE10 sequences are also provided. Expression constructs wherein
PDE10-encoding polynucleotides are operatively-linked to an
endogenous or exogenous expression control DNA sequence and a
transcription terminator are also provided.
[0023] According to another aspect of the invention, host cells are
provided, including procaryotic and eucaryotic cells, either stably
or transiently transformed with DNA sequences of the invention in a
manner which permits expression of PDE10 polypeptides of the
invention. Expression systems of the invention include bacterial,
yeast, fungal, viral, invertebrate, and mammalian cells systems.
Host cells of the invention are a valuable source of immunogen for
development of antibodies specifically immunoreactive with PDE10.
Host cells of the invention are also conspicuously useful in
methods for large scale production of PDE10 polypeptides wherein
the cells are grown in a suitable culture medium and the desired
polypeptide products are isolated from the cells or from the medium
in which the cells are grown by, for example, immunoaffinity
purification.
[0024] Knowledge of PDE10 DNA sequences allows for modification of
cells to permit, or increase, expression of endogenous PDE10. Cells
can be modified (e.g., by homologous recombination) to provide
increased PDE10 expression by replacing, in whole or in part, the
naturally occurring PDE10 promoter with all or part of a
heterologous promoter so that the cells express PDE10 at higher
levels. The heterologous promoter is inserted in such a manner that
it is operatively-linked to PDE10 encoding sequences. See, for
example, PCT International Publication No. WO 94/12650, PCT
International Publication No. WO 92/20808, and PCT International
Publication No. WO 91/09955. The invention also comprehends that,
in addition to heterologous promoter DNA, amplifiable marker DNA
(e.g., ada, dhfr, and the multifunctional CAD gene which encodes
carbamyl phosphate synthase, aspartate transcarbamylase, and
dihydroorotase) and/or intron DNA may be inserted along with the
heterologous promoter DNA. If linked to the PDE10 coding sequence,
amplification of the marker DNA by standard selection methods
results in co-amplification of the PDE10 coding sequences in the
cells.
[0025] The DNA sequence information provided by the present
invention also makes possible the development through, e.g.
homologous recombination or "knock-out" strategies [Capecchi,
Science 244:1288-1292 (1989)], of animals that fail to express
functional PDE10 or that express a variant of PDE10. Such animals
are useful as models for studying the in vivo activities of PDE10
and modulators of PDE10.
[0026] The invention also provides purified and isolated mammalian
PDE10 polypeptides as set out in SEQ ID NOs: 2, 19, 21, and 23.
Presently preferred is a PDE10 polypeptide comprising the amino
acid sequence set out in SEQ ID NO: 2. The invention embraces PDE10
polypeptides encoded by a DNA selected from the group consisting
of: a) the DNA sequence set out in SEQ ID NOs:1, 18, 20, or 22; b)
a DNA molecule which hybridizes under stringent conditions to the
noncoding strand of the protein coding portion of (a); and c) a DNA
molecule that would hybridize to the DNA of (a) but for the
degeneracy of the genetic code. The invention also embraces
polypeptide fragments of the sequences set out in SEQ ID NOs: 2,
19, 21, or 23 wherein the fragments maintain biological or
immunological properties of a PDE10 polypeptide. Preferred
polypeptide fragments display antigenic properties unique to or
specific for the PDE10 family of polypeptides. Fragments of the
invention can be prepared by any the methods well known and
routinely practiced in the art, having the desired biological and
immunological properties.
[0027] The invention embraces polypeptides have at least 99%, at
least 95%, at least 90%, at least 85%, at least 80%, at least 75%,
at least 70%, at least 65%, at least 60%, at least 55% and at least
50% identity and/or homology to the preferred PDE10 polypeptide on
the invention. Percent amino acid sequence "identity" with respect
to the preferred polypeptide of the invention is defined herein as
the percentage of amino acid residues in the candidate sequence
that are identical with the residues in the PDE10 sequence after
aligning both sequences and introducing gaps, if necessary, to
achieve the maximum percent sequence identity, and not considering
any conservative substitutions as part of the sequence identity.
Percent sequence "homology" with respect to the preferred
polypeptide of the invention is defined herein as the percentage of
amino acid residues in the candidate sequence that are identical
with the residues in the PDE10 sequence after aligning the
sequences and introducing gaps, if necessary, to achieve the
maximum percent sequence identity, and also considering any
conservative substitutions as part of the sequence identity.
Conservative substitutions can be defined as set out below.
[0028] PDE10 polypeptides of the invention may be isolated from
natural cell sources or may be chemically synthesized, but are
preferably produced by recombinant procedures involving host cells
of the invention. Use of various host cells is expected to provide
for such post-translational modifications (e.g., glycosylation,
truncation, lipidation, and phosphorylation) as may be needed to
confer optimal biological activity on recombinant expression
products of the invention. PDE10 products of the invention may be
full length polypeptides, biologically or immunologically active
fragments, or variants thereof which retain specific PDE10
biological or immunological activity. Variants may comprise PDE10
polypeptide analogs wherein one or more of the specified (i.e.,
naturally encoded) amino acids is deleted or replaced or wherein
one or more non-specified amino acids are added: (1) without loss
of one or more of the biological activities or immunological
characteristics specific for PDE10; or (2) with specific
disablement of a particular biological activity of PDE10.
[0029] Variant products of the invention include mature PDE10
products i.e., PDE10 products wherein leader or signal sequences
are removed, and having additional, non-naturally occurring, amino
terminal residues. PDE10 products having an additional methionine
residue at position -1 (Met.sup.-1-PDE10) are contemplated, as are
PDE10 products having additional methionine and lysine residues at
positions -2 and -1 (Met.sup.-2-Lys.sup.-1-PDE10). Variants of
these types are particularly useful, for recombinant protein
production in bacterial cell types.
[0030] The invention also embraces PDE10 variants having additional
amino acid residues that result from use of specific expression
systems. For example, use of commercially available vectors that
express a desired polypeptide such as a glutathione-S-transferase
(GST) fusion product provide the desired polypeptide having an
additional glycine residue at position -1 as a result of cleavage
of the GST component from the desired polypeptide. Variants which
result from expression in other vector systems are also
contemplated.
[0031] Variant polypeptides include those wherein conservative
substitutions have been introduced by modification of
polynucleotides encoding polypeptides of the invention.
Conservative substitutions are recognized in the art to classify
amino acids according to their related physical properties and can
be defined as set out in Table I (from WO 97/09433, page 10,
published Mar. 13, 1997 (PCT/GB96/02197, filed Sep. 6, 1996).
1TABLE I Conservative Substitutions I SIDE CHAIN CHARACTERISTIC
AMINO ACID Aliphatic Non-polar G A P I L V Polar-uncharged C S T M
N Q Polar-charged D E K R Aromatic H F W Y Other N Q D E
[0032] Alternatively, conservative amino acids can be grouped as
defined in Lehninger, [Biochemistry, Second Edition; Worth
Publishers, Inc. NY:N.Y. (1975), pp.71-77] as set out in Table
II.
2TABLE II Conservative Substitutions II SIDE CHAIN CHARACTERISTIC
AMINO ACID Non-polar (hydrophobic) A. Aliphatic: A L I V P B.
Aromatic: F W C. Sulfur-containing: M D. Borderline: G
Uncharged-polar A. Hydroxyl: S T Y B. Amides: N Q C. Sulfhydryl: C
D. Borderline: G Positively Charged (Basic): K R H Negatively
Charged (Acidic): D E
[0033] The invention further embraces PDE10 products modified to
include one or more water soluble polymer attachments. Particularly
preferred are PDE10 products covalently modified with polyethylene
glycol (PEG) subunits. Water soluble polymers may be bonded at
specific positions, for example at the amino terminus of the PDE10
products, or randomly attached to one or more side chains of the
polypeptide.
[0034] Also comprehended by the present invention are antibodies
(e.g., monoclonal and polyclonal antibodies, single chain
antibodies, chimeric antibodies, human antibodies CDR-grafted
antibodies, or otherwise "humanized" antibodies, antigen binding
antibody domains including Fab, Fab', F(ab').sub.2, F.sub.v, or
single variable domains, and the like) and other binding proteins
specific for PDE10 products or fragments, thereof. Specific binding
proteins can be developed using isolated or recombinant PDE10
products, PDE10 variants, or cells expressing such products. The
term "specific for" indicates that the variable regions of the
antibodies recognize and bind PDE10 polypeptides exclusively (i.e.,
able to distinguish PDE10 polypeptides from the superfamily of PDE
polypeptides despite sequence identity, homology, or similarity
found in the family of polypeptides), but may also interact with
other proteins (for example, S. aureus protein A or other
antibodies in ELISA techniques) through interactions with sequences
outside the variable region of the antibodies, and in particular,
in the constant region of the molecule. Screening assays to
determine binding specificity of an antibody of the invention are
well known and routinely practiced in the art. For a comprehensive
discussion of such assays, see Harlow et al. (eds), Antibodies: A
Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring
Harbor, N.Y. (1988), Chapter 6. Antibodies that recognize and bind
fragments of the PDE10 polypeptides of the invention are also
contemplated, provided that the antibodies are first and foremost
specific for, as defined above, PDE10 polypeptides. As with
antibodies that are specific for full length PDE10 polypeptides,
antibodies of the invention that recognize PDE10 fragments are
those which can distinguish PDE10 polypeptides from the superfamily
of PDE polypeptides despite inherent sequence identity, homology,
or similarity found in the family of proteins.
[0035] Binding proteins are useful for purifying PDE10 products and
detection or quantification of PDE10 products in fluid and tissue
samples using known immunological procedures. Binding proteins are
also manifestly useful in modulating (i.e., blocking, inhibiting or
stimulating) biological activities of PDE10, especially those
activities involved in signal transduction. Anti-idiotypic
antibodies specific for anti-PDE10 antibodies are also
contemplated.
[0036] The scientific value of the information contributed through
the disclosures of DNA and amino acid sequences of the present
invention is manifest. As one series of examples, knowledge of the
sequence of a cDNA for PDE10 makes possible through use of Southern
hybridization or polymerase chain reaction (PCR) the identification
of genomic DNA sequences encoding PDE10 and PDE10 expression
control regulatory sequences such as promoters, operators,
enhancers, repressors, and the like. DNA/DNA hybridization
procedures carried out with DNA sequences of the invention under
moderately to highly stringent conditions are likewise expected to
allow the isolation of DNAs encoding allelic variants of PDE10;
allelic variants are known in the art to include structurally
related proteins sharing one or more of the biochemical and/or
immunological properties specific to PDE10. Similarly, non-human
species genes encoding proteins homologous to PDE10 can also be
identified by Southern and/or PCR analysis and useful in animal
models for PDE10-related disorders. As an alternative,
complementation studies can be useful for identifying other human
PDE10 products as well as non-human proteins, and DNAs encoding the
proteins, sharing one or more biological properties of PDE10.
Polynucleotides of the invention are also useful in hybridization
assays to detect the capacity of cells to express PDE10.
Polynucleotides of the invention may also be the basis for
diagnostic methods useful for identifying a genetic alteration(s)
in a PDE10 locus that underlies a disease state or states.
[0037] The DNA and amino acid sequence information provided by the
present invention also makes possible the systematic analysis of
the structure and function of PDE10s. DNA and amino acid sequence
information for PDE10 also permits identification of binding
partner compounds with which a PDE10 polypeptide or polynucleotide
will interact. Binding partner compounds include proteins and
non-protein compounds such as small molecules. Agents that modulate
(i.e., increase, decrease, or block) PDE10 activity or expression
may be identified by incubating a putative, modulator with a PDE10
polypeptide or polynucleotide and determining the effect of the
putative modulator on PDE10 phosphodiesterase activity or
expression. The selectivity of a compound that modulates the
activity of the PDE10 can be evaluated by comparing its binding
activity on the PDE10 to its activity on other PDE enzymes. Cell
based methods, such as di-hybrid assays to identify DNAs encoding
binding compounds and split hybrid assays to identify inhibitors of
PDE10 polypeptide interaction with a known binding polypeptide, as
well as in vitro methods, including assays wherein a PDE10
polypeptide, PDE10 polynucleotide, or a binding partner are
immobilized, and solution assays are contemplated under the
invention.
[0038] Selective modulators may include, for example, antibodies
and other proteins or peptides which specifically bind to a PDE10
polypeptide or a PDE10-encoding nucleic acid, oligonucleotides
which specifically bind to a PDE10, polypeptide or a PDE10 gene
sequence, and other non-peptide compounds (e.g., isolated or
synthetic organic and inorganic molecules) which specifically react
with a PDE10 polypeptide or underlying nucleic acid. Mutant PDE10
polypeptides which affect the enzymatic activity or cellular
localization of the wild-type PDE10 polypeptides are also
contemplated by the invention. Presently preferred targets for the
development of selective modulators include, for example: (I)
regions of the PDE10 polypeptide which contact other proteins
and/or localize the PDE10 polypeptide within a cell, (2) regions of
the PDE10 polypeptide which bind substrate, (3) cyclic
nucleotide-binding site(s) of the PDE10 polypeptide, (4)
phosphorylation site(s) of the PDE10 polypeptide and (5) regions of
the PDE10 polypeptide which are involved in multimerization of
PDE10 subunits. Still other selective modulators include those that
recognize specific PDE10 encoding and regulatory polynucleotide
sequences. Modulators of PDE10 activity may be therapeutically
useful in treatment of a wide range of diseases and physiological
conditions in which PDE activity is known to be involved.
[0039] PDE10 polypeptides of the invention are particularly
amenable to use in high throughput screening assays to identify
binding partners, and preferably modulators. Cell based assays are
contemplated, including yeast based assay systems as well as
mammalian cell expression systems as described in Jayawickreme and
Kost, Curr. Opin. Biotechnol. 8:629-634(1997). Alternatively,
automated and minaturized high throughput screening (HTS) assays,
such as high density free format high density screening, as
described in Houston and Banks, Curr. Opin. Biotehcnol. 8:734-740
(1997). Combinatorial libraries are particularly useful in high
throughput screening assays.
[0040] There are a number of different libraries used for the
identification of small molecule modulators, including, (1)
chemical libraries, (2) natural product libraries, and (3)
combinatorial libraries comprised of random peptides,
oligonucleotides or organic molecules.
[0041] Chemical libraries consist of structural analogs of known
compounds or compounds that are identified as "hits" or "leads" via
natural product screening. Natural product libraries are
collections of microorganisms, animals, plants, or marine organisms
which are used to create mixtures for screening by: (1)
fermentation and extraction of broths from soil, plant or marine
microorganisms or (2) extraction of plants or marine organisms.
Natural product libraries include polyketides, non-ribosomal
peptides, and variants (non-naturally occurring) variants thereof.
For a review, see Science 282:63-68 (1998). Combinatorial libraries
are composed of large numbers of peptides, oligonucleotides, or
organic compounds as a mixture. They are relatively easy to prepare
by traditional automated synthesis methods, PCR, cloning or
proprietary synthetic methods. Of particular interest are peptide
and oligonucleotide combinatorial libraries. Still other libraries
of interest include protein, peptidomimetic, multiparallel
synthetic collection, recombinatorial, and polypeptide libraries.
For a review of combinatorial chemistry and libraries created
therefrom, see Myers, Curr. Opion. Biotechnol. 8:701-707 (1997).
Identification of modulators through use of the various libraries
described herein permits modification of the candidate "hit" (or
"lead") to optimize the capacity of the "hit" to modulate
activity.
[0042] Also made available by the invention are anti-sense
polynucleotides which recognize and hybridize to polynucleotides
encoding PDE10. Full length and fragment anti-sense polynucleotides
are provided. The worker of ordinary skill will appreciate that
fragment anti-sense molecules of the invention include (i) those
which specifically recognize and hybridize to PDE10 RNA (as
determined by sequence comparison of DNA encoding PDE10 to DNA
encoding other known molecules) as well as (ii) those which
recognize and hybridize to RNA encoding variants in the PDE10
family of proteins. Antisense polynucleotides that hybridize to RNA
encoding other members of the PDE10 family of proteins are also
identifiable through sequence comparison to identify
characteristic, or signature, sequences for the family of
molecules. Anti-sense polynucleotides are particularly relevant to
regulating expression of PDE10 by those cells expressing PDE10
mRNA.
[0043] Antisense nucleic acids (preferably 10 to 20 base pair
oligonucleotides) capable of specifically binding to PDE10
expression control sequences or PDE10 RNA are introduced into cells
(e.g., by a viral vector or colloidal dispersion system such as a
liposome). The antisense nucleic acid binds to the PDE10 target
nucleotide sequence in the cell and prevents transcription or
translation of the target sequence. Phosphorothioate and
methylphosphonate antisense oligonucleotides are specifically
contemplated for therapeutic use according to the invention. The
antisense oligonucleotides may be further modified by
poly-L-lysine, transferrin polylysine, or cholesterol moieties at
the 5' end.
[0044] The invention further comprehends methods to modulate PDE10
expression through use of ribozymes. For a review, see Gibson and
Shillitoe, Mol. Biotech. 7:125-137 (1997). Ribozyme technology can
be utilized to inhibit translation of PDE10 mRNA in a sequence
specific manner through (i) the hybridization of a complementary
RNA to a target mRNA and (ii) cleavage of the hybridized mRNA
through nuclease activity inherent to the complementary strand.
Ribozymes can identified by empirical methods but more preferably
are specifically designed based on accessible sites on the target
mRNA [Bramlage, et al., Trends in Biotech 16:434-438 (1998).]
Delivery of ribozymes to target cells can be accomplished using
either exogenous or endogenous delivery techniques well known and
routinely practiced in the art. Exogenous delivery methods can
include use of targeting liposomes or direct local injection.
Endogenous methods include use of viral vectors and non-viral
plasmids.
[0045] Ribozymes can specifically modulate expression of PDE10 when
designed to be complementary to regions unique to a polynucleotide
encoding PDE10. "Specifically modulate" therefore is intended to
mean that ribozymes of the invention recognizes only a
polynucleotide encoding PDE10. Similarly, ribozymes can be designed
to modulate expression of all or some of the PDE10 family of
proteins. Ribozymes of this type are designed to recognize
polynucleotide sequences conserved in all or some of the
polynucleotides which encode the family of proteins.
[0046] The invention further embraces methods to modulate
transcription of PDE10 through use of oligonucleotide-directed
triplet helix formation. For a review, see Lavrovsky, et al.,
Biochem. Mol. Med. 62:11-22 (1997). Triplet helix formation is
accomplished using sequence specific oligonucleotides which
hybridize to double stranded DNA in the major groove as defined in
the Watson-Crick model. Hybridization of a sequence specific
oligonucleotide can thereafter modulate activity of DNA-binding
proteins, including, for example, transcription factors and
polymerases. Preferred target sequences for hybridization include
promoter and enhancer regions to permit transcriptional regulation
of PDE10 expression. Oligonucleotides which are capable of triplet
helix formation are also useful for site-specific covalent
modification of target DNA sequences. Oligonucleotides useful for
covalent modification are coupled to various DNA damaging agents as
described in Lavrovsky, et al. [supra].
[0047] The invention comprehends mutations in the PDE10 gene that
result in loss of normal function of the PDE10 gene product and
underlie human disease states in which failure of the PDE10 is
involved. Gene therapy to restore PDE10 activity would thus be
indicated in treating those disease states. Delivery of a
functional PDE10 gene to appropriate cells is effected ex vivo, in
situ, or in vivo by use of vectors, and more particularly viral
vectors (e.g., adenovirus, adeno-associated virus, or a
retrovirus), or ex vivo by use of physical DNA transfer methods
(e.g., liposomes or chemical treatments). See, for example,
Anderson, Nature, supplement to vol. 392, no. 6679, pp.25-20
(1998). For additional reviews of gene therapy technology see
Friedmann, Science, 244: 1275-1281 (1989); Verma, Scientific
American: 68-84 (1990); and Miller, Nature, 357: 455-460 (1992).
Alternatively, it is contemplated that in other human disease
states, preventing the expression of or inhibiting the activity of
PDE10 will be useful in treating the disease states. It is
contemplated that antisense therapy or gene therapy could be
applied to negatively regulate the expression of PDE10.
[0048] Identification of modulators of PDE10 expression and/or
biological activity provides methods to treat disease states that
arise from aberrant PDE10 activity. Modulators may be prepared in
compositions for administration, and preferably include one or more
pharmaceutically acceptable carriers, such as pharmaceutically
acceptable (i.e., sterile and non-toxic) liquid, semisolid, or
solid diluents that serve as pharmaceutical vehicles, excipients,
or media. Any diluent known in the art may be used. Exemplary
diluents include, but are not limited to, polyoxyethylene sorbitan
monolaurate, magnesium stearate, methyl- and propylhydroxybenzoate,
talc, alginates, starches, lactose, sucrose, dextrose, sorbitol,
mannitol, gum acacia, calcium phosphate, mineral oil, cocoa butter,
and oil of theobroma. The modulator compositions can be packaged in
forms convenient for delivery. The compositions can be enclosed
within a capsule, sachet, cachet, gelatin, paper, or other
container. These delivery forms are preferred when compatible with
entry of the composition into the recipient organism and,
particularly, when the composition is being delivered in unit dose
form. The dosage units can be packaged, e.g., in tablets, capsules,
suppositories or cachets. The compositions may be introduced into
the subject by any, conventional method including, e.g., by
intravenous, intradermal, intramuscular, intramammary,
intraperitoneal, or subcutaneous injection; by oral, sublingual,
nasal, anal, vaginal, or transdermal delivery; or by surgical
implantation, e.g., embedded under the splenic capsule or in the
cornea. The treatment may consist of a single dose or a plurality
of doses over a period of time.
[0049] The invention also embraces use of a PDE10 polypeptide, a
PDE10 polynucleotide, or a binding partner thereof in production of
a medicament for treatment of a PDE10-related biological
disorder.
[0050] The present invention is illustrated by the following
examples relating to the isolation of a polynucleotide encoding a
PDE10 polypeptide and expression thereof. Example 1 describes
identification of an EST encoding a partial PDE10 polypeptide and
isolation of a full length PDE10-encoding clone. Example 2 relates
to Northern blot analysis of PDE10 expression. Example 3 addresses
chromosome mapping of PDE10. Example 4 describes expression and
characterization of a recombinant PDE10 polypeptide. Example 5
describes production of anti-PDE10 antibodies. Example 6 provides
an analysis of PDE10 expression using in situ hybridization.
Example 7 relates to high throughput screening to identify
inhibitors of PDE10.
EXAMPLE 1,
Identification of an EST Related to a Human PDE and Isolation of a
Full Length PDE10-Encoding Polynucleotide
[0051] Using the sequences of known human, 3', 5' cyclic nucleotide
phosphodiesterases, a search of the National Center for
Biotechnology Information (NCBI) Expressed Sequence Tags (EST)
database was undertaken in order to identify cDNA fragments that
could potentially be useful for the identification of novel
phosphodiesterase (PDE) genes. This database contains DNA sequences
representing one or both ends of cDNAs collected from a variety of
tissue sources. A single sequencing run is performed on one or both
ends of the cDNA and the quality of the DNA sequence varies
tremendously. At the time the PDE searches were performed, the EST
sequence database contained more than 600,000 cDNA sequences from a
variety of organisms.
[0052] The search for novel PDE sequences included three steps.
First, the BLASTN program available through NCBI was used to
identify DNA sequences in the EST sequence database with homology
to cDNA sequences encoding known human PDEs. The program compares a
nucleotide query sequence against a nucleotide sequence database.
The cDNA sequences of the fifteen known human PDEs were submitted
and fifteen BLASTN searches were performed; the query PDE sequences
included PDE1A3 [Loughney, et al., J. Biol. Chem. 271:796-806
(1996)], PDE1B1 [Yu, et al., Cell Signaling, 9:519-529 (1997)],
PDE1C2 [Loughney, et al., J. Biol. Chem. 271:796-806 (1996)],
PDE2A3 [Rosman, et al., Gene 191:89-95 (1997)], PDE3A [Meacci, et
al., Proc. Natl. Acad. Sci. (USA) 89:3721-3725 (1992)], PDE3B [Miki
et al., Genomics 36:476-485 (1996)], PDE4A5 [Bolger, et al., Mol.
Cell. Biol. 13:6558-6571 (1993)], PDE4B2 [Bolger, et al., Mol.
Cell. Biol. 13:6558-6571 (1993)], PDE4C [Bolger, et al., Mol. Cell.
Biol. 13:6558-6571 (1993)], PDE4D1 [Bolger, et al., Biochem. J.
328:539-548 (1997)] and PDE4D3 [Bolger, et al., Mol. Cell. Biol.
13:6558-6571 (1993)], PDE5A, PDE6A [Pittler, et al., Genomics
6:272-283 (1990)], PDE6B [Collins, et al., Genomics 13:698-704
(1992)], PDE6C [Piriev, et al., Genomics 28:429-435 (1995), and
PDE7A1 [Michaeli, et al., J. Biol. Chem. 17:12925-12932 (1993)].
The BLASTN results were examined and EST sequences that were judged
as corresponding to each of the fifteen known PDE cDNAs were
identified and collected into a table. The PDE6A and PDE6B
sequences used as queries were truncated at 3', end (removing a
portion of the 3' untranslated region) due to the presence of
repetitive elements in the 3' untranslated region of the cDNAs.
[0053] Secondly, the NCBI TBLASTN program was used to examine the
homology between the protein sequence of the fifteen known human
PDEs (as above) and the six different possible proteins encoded by
each of the EST DNA sequences. In this search, the EST sequences
are translated in the six possible reading frames and the amino
acid sequences generated are compared to the query PDE amino acid
sequences. Sequences identified as homologous at the amino acid
level were examined and any EST sequences positively identified as
corresponding to a known PDE during the BLASTN search described
above were discarded.
[0054] The third step of the search involved analyzing the
sequences that were not known PDEs. These amino acid sequences were
homologous to a known PDE but were not identified as one of the 15
known PDE genes during the BLASTN searches.
[0055] The initial BLAST searches identified three EST sequences,
designated X88347 (SEQ ID NO: 3), X88467 (SEQ ID NO: 4), and X88465
(SEQ ID NO: 5), that were obtained from an exon trapping experiment
using chromosome 21 genomic DNA and found to encode an amino acid
sequence having homology to the catalytic region of one or more of
the PDE query sequences. X88347 showed homology with the amino acid
sequences of PDE1A, 1B, 1C, 3A, 3B, 4A, 4B and 4D; X88467 showed
homology to PDE1A, 1B, 1C, 4A, 4B, 4C, and D4; and X88465 was
homologous to PDE1A and 1B amino acid sequences. At the 5'
terminus, EST X88465 was 58 nucleotides shorter than was X88467 and
was not considered further.
[0056] When X88347 was translated from nucleotides 1-222 and the
resultant protein was compared to PDE1A, the two proteins were the
same at 23 of 51 amino acid positions (45% identity). When X88467
was translated from nucleotide 3 to 155 and the resultant protein
compared to PDE1A, 15 of 36 amino acids were the same (42%
identity). Because ESTs X88347 and X88467 showed homology to two
different regions of the catalytic region of PDE1A, it seemed
possible that they represented two different exons from a novel PDE
gene.
[0057] X88347 was used as a query in a BLASTN search of the NCBI
EST database. In addition to itself, X88347 identified three other
human EST sequences with high enough homology to suggest the
sequences were derived from the same gene. EST R00718, (SEQ ID NO:
6) showed 91% identity to X88347. R00719 (SEQ ID NO: 7) represented
the 3'-end of the same cDNA as R00718. R45187 (SEQ ID NO: 8) showed
88% identity to X88347. Two mouse cDNAs were also identified;
W82786 (SEQ ID NO: 9) (91% identity) and W10517 (SEQ ID NO: 10)
appeared to represent the mouse homolog of X88347. A BLASTN search
using W10517 as probe identified another sequence H90802 (SEQ ID
NO: 11), which appeared to represent another human EST that may be
part of the human PDE gene. The several human cDNAs were not
identical to each other, and the quality of the sequencing was
poor. The cDNA represented by the R00719 and R00718 EST sequences
was obtained from the American Type Culture Collection (Rockville,
Md.) which maintains and makes publicly available deposits of ESTs
identified and sequenced by I.M.A.G.E., Lawrence Livermore National
Laboratory, (Livermore, Calif.). The cDNA had been isolated from a
fetal liver and spleen library and mapped to chromosome 21.
[0058] R00718/9 was sequenced upon receipt and found to be
consistent with the EST database sequence. The polynucleotide and
amino acids sequences for R00718/9 are set out in SEQ ID Nos: 12
and 13, respectively. The R00718/9 clone contained a 0.6 kb insert
with a poly A tail at the 3'-end. The open reading frame encoded a
protein with homology to other PDEs but did not extend to the 5'end
of the cDNA. Beginning at amino acid position 9, a QSDRE sequence
was found. Corresponding D and E residues were found within all of
the query sequences. Query sequences also included a conserved
E(F/Y) sequence located amino terminal to the conserved D and E
residues, but this sequence was not found in EST R00718/9. Instead,
the EST contained eight amino acids followed by a stop codon. The
R00718/9 cDNA appeared to diverge from the PDE query sequences in
the catalytic region and the open reading frame was not maintained.
The disrupted open reading frame may suggest the presence of an
intron that had not been removed or that the R00718/9 sequence was
joined to some unidentified extraneous polynucleotide sequence. The
gene represented by R00718/9 was designated PDE10.
[0059] In order to identify additional PDE10 sequences, a probe was
generated based on the PDE10 sequence and used to screen cDNA
libraries. First, two primers, R71S100R (SEQ ID NO: 14) and
R71A521H (SEQ ID NO: 15) were synthesized for use in PCR to amplify
a 420 nucleotide portion of the R00718/9 DNA fragment (nucleotides
130 to 550). Primer R71S100R generated an EcoRI restriction site in
the amplification product (underlined below) and primer R71A521H
generated a HindIII site (also underlined below). The PCR fragment
was designed to include the region of R00718/9 homologous to other
PDEs, but not the poly A tail.
3 R71S100R (SEQ ID NO: 14) AGTCGAATTCACCGTGAGAAGTCAGAAG R71A521H
(SEQ ID NO: 15) GTCAAAGCTTACATGGTCTTGTGGTGCC
[0060] The PCR reaction contained 50 pg R00719 cDNA, 10 ng/.mu.l
each primer, 0.2 mM dNTP, 1.times.PCR buffer (Perkin-Elmer), 2 mM
MgCl.sub.2, and 1.25 U Taq polymerase (Perkin-Elmer). The reaction
was first maintained at 94.degree. C. for four minutes, after which
thirty cycles of one minute 94.degree. C., two minutes 50.degree.
C., and four minutes at 72.degree. C. were performed. The PCR
fragment was purified using low melting point agarose gel
electrophoresis.
[0061] For library screening, the PCR fragment was labeled with
.sup.32P with a random priming kit (Boehringer Mannheim) according
to manufacturer's instructions and used to screen 10.sup.6 cDNAs
from a human heart cDNA library (Stratagene, La Jolla, Calif.),
5.times.10.sup.5 cDNAs from a human hippocampal cDNA library
(Clontech, Palo Alto, Calif.), and 7.5.times.10.sup.5 cDNAs from a
human fetal brain cDNA library (Stratagene). Hybridization was
carried out overnight in buffer containing 3.times.SSC, 0.1%
Sarkosyl, 20 mM sodium phosphate, pH 6.8, 10.times. Denhardt's
solution, and 50 .mu.g/ml salmon sperm DNA at 65.degree. C. Eleven
positives were obtained from the fetal brain library and three from
the hippocampal library. Partial sequencing led to the selection of
one, FB79c, for further characterization. The polynucleotide and
deduced amino acid sequences for FB79c are set out in SEQ ID NOs:
16 and 17, respectively.
[0062] FB79c contained a 1.3 kb insert; the 3'end of FB79c extended
further than that of R00718/9 and contained 12 adenosine residues
of the poly A tail of R00718/9, an EcoRI site (GGAATTC), an
additional fifty-nine nucleotides and a poly A sequence. At the
5'end, the sequence for FB79c differed from that of R00718/9
beginning at, and continuing 5' of, nucleotide 121 of R00718/9
(corresponding to nucleotide 744 of FB79c). The open reading frame
in FB79c (encoding a protein with homology to the query PDEs) did
not extend to the 5'end of the cDNA but ended in a stop codon at
nucleotide 104.
[0063] A sequence within the FB79c DNA located upstream of the
point of divergence from R00718/9 (but within the portion of the
open reading frame with homology to the other PDEs) was the region
chosen for a probe in subsequent library screening. The isolated
sequence selected was a 0.36 kb EcoRI fragment extending from
nucleotide 308 to nucleotide 671 of FB79c and was used to screen
1.75.times.10.sup.6 cDNAs from the fetal brain cDNA library
(Stratagene). More than twenty cDNAs were identified and twelve
were subjected to partial restriction mapping and DNA sequencing.
More extensive sequencing on six of them led to the selection of
clones FB76.2 and FB68.2 for complete sequencing. The
polynucleotide and amino acid sequences for clone FB76.2 are set
out in SEQ ID NOs: 18 and 19, respectively, and the polynucleotide
and amino acid sequences for clone FB68.2 are set out in SEQ ID
NOs. 20 and 21, respectively.
[0064] FB76.2 contained a 1.9 kb cDNA insert; the 3'end of the cDNA
stopped one nucleotide short of the poly A tail found in clone
FB79c and the sequence diverged from FB79c 5' of nucleotide 109 in
clone FB79c (corresponding to nucleotide 715 in FB76.2). The open
reading frame in the FB76.2 sequence that encoded a protein with
homology to the PDE query sequences extended to the 5'end of the
cDNA and the first methionine was encoded beginning at nucleotide
74. Assuming this residue to be the initiating methionine, the open
reading frame of FB76.2 encoded a 533 amino acid protein with a
predicted molecular weight of 61,708 Da.
[0065] Clone FB68.2 contained a 2 kb cDNA insert. At the 3'end, it
extended to the poly A tail found in the FB79c sequence and the
open reading frame extended to the 5'end of the cDNA. FB68.2
differed from FB76.2 by the presence of an additional internal 180
nucleotides (nucleotides 225 to 404 of FB68.2) following
corresponding nucleotide 335 of FB76.2. Since the number of
additional nucleotides in the FB68.2 insertion was divisible by
three, it did not alter the reading frame as compared to FB76.2.
The position of the insert with respect to maintaining the same
reading frame suggested that the sequence might represent an exon
found in some, but not all, PDE10 cDNAs. Alternatively, the
additional sequence could be an intron that had not been removed
from the FB68.2 cDNA.
[0066] Because the FB76.2 and FB68.2 differed from each other,
additional PDE10 DNAs were obtained and analyzed to more accurately
define the PDE10 nucleotide sequence. A 5' 0.3 kb EcoRI fragment of
FB76.2 (corresponding to nucleotides 1 to 285) was isolated and
used as a probe to screen 7.5.times.10.sup.5 cDNAs from the fetal
brain cDNA library. Thirty seven positives were obtained, of which
nineteen were first characterized with respect to fragment size
(insert) that hybridized to the 0.3 kb EcoRI probe. Eight of the
nineteen clones were subsequently characterized by partial
sequencing. Two clones, FB93a and FB94a, contained 0.5 kb and 1.6
kb EcoRI fragments, respectively, that hybridized and were chosen
for complete sequencing. The polynucleotide and amino acid
sequences for clone FB93a are set out in SEQ ID NOs: 22 and 23,
respectively, and the polynucleotide and amino acid sequences for
clone FB94a are set out in SEQ ID NOs 1 and 2, respectively.
[0067] FB93a contained a 1.5 kb insert which did not extend to the
3'end of FB76.2 but was ninety nucleotides longer than FB76.2 at
the 5'end. The additional nucleotides encoded a stop codon
beginning at position 47 which was in reading frame with the first
methionine in FB76.2 described above (nucleotide 164 in FB93a). The
position of the stop codon indicated the presence of a complete
open reading frame and that FB76.2 probably represented a full
length cDNA. Like FB76.2, FB93a did not contain the 180 nucleotide
insert that was present in FB68.2.
[0068] FB94a contained a 1.5 kb cDNA insert and the 3'end extended
almost 0.1 kb beyond the stop codon. The first methionine was
encoded beginning at nucleotide 26, and assuming this residue to be
the initiating methionine, FB94a encoded a 466 amino acid protein
with a predicted molecular weight of 54,367 Da. FB194a differed
from FB76.2 and FB93a by absence of a 149 nucleotide region which,
if consistent with the sequences for FB76.2 and FB93a, would have
been located after nucleotide 42. The absence of the 149 nucleotide
sequence produced a putative initiator methionine that is in a
different reading frame than that found in FB76.2 and FB93a. Like
FB76.2 and FB93a, FB94a did not contain the 180 nucleotide region
found in FB68.2.
[0069] A search of the EST data base with the FB94a and FB93a
sequences identified yet another possible sequence for a PDE10
cDNA. The sequence of EST A158.300 lacked both the 149 nucleotide
and the 180 nucleotide sequences discussed above. In addition,
A158300 also lacked 55 nucleotides immediately 3' to the 180
nucleotide region as found in the FB68.2 sequence. The open reading
frame in A158300 extended to the 5'end and the first methionine
corresponded to the same one used by FB76.2 and FB93a. The presence
of the additional 55 nucleotide deletion from A158300 resulted in a
different reading frame fir the sequence between the site where the
149 nucleotides were deleted and the site where the 180 nucleotides
were deleted.
[0070] The sequence information for PDE10 derived from these cDNA
sequences can be summarized as follows. There is a 149 nucleotide
sequence found in some clones. (sequences FB76.2, FB93a, FB68.2)
but not in all (sequences FB94a, A158300). The 149 nucleotide
sequence is followed by a 44 nucleotide region that is present in
all the PDE10 cDNAs analyzed to date. Following the 44 nucleotide
region is a sequence of 235 nucleotides in length. The region can
be present in its entirety (as found in the sequence for FB68.2) or
without the first 180 nucleotides (as observed in sequences FB76.2
and FB93a). As still another alternative, the whole region can be
removed (as found in the sequence for A158300). These possibilities
predict six different mRNA structures, four of which have been
isolated.
[0071] The presence or absence of the 149 nucleotide region may
reflect the presence or absence of an exon, and the presence of all
or some of the 235 nucleotide region may reflect alternative
3'splice acceptor site usage. As an alternative, it is also
possible that the 235 nucleotide region represents two separate
exons of 180 and 55 nucleotides in length. The presence or absence
of the 149 nucleotide sequence alters the reading frame of the
encoded protein as does the presence or absence of the 55
nucleotide sequence.
[0072] A number of single nucleotide differences have been observed
in comparison of the various PDE10 cDNAs. R00718/9 has a cytosine
at nucleotide position 155 whereas the other cDNAs have a thymidine
at this position; this difference represented a silent change as
proline is encoded by both sequences. R00718/9 also has a cytosine
at position 161 whereas the other cDNAs have an adenosine at the
same position; this difference also represented a silent change as
both sequences encode alanine. FB94a has a guanosine at position
1383 whereas the other cDNAs have an adenosine at this position; as
a consequence of the difference, FB94a encodes a glycine rather
than a glutamic acid at that position. FB76.2 has an adenosine
rather than a cytosine at position 1809; the difference does not
effect an amino acid difference since the nucleotide position is
located in the 3' untranslated region. FB79c also has one less
adenosine in the string of nucleotides between 1204 and 1215 than
do the other cDNAs; this difference is also within the 3'
untranslated region.
[0073] In comparison of a predicted PDE10 amino acid sequence with
other known PDEs indicated that most, but not all, of the amino
acids that are conserved among the query sequences were also found
in PDE10. Comparison of the PDE10 catalytic region to PDE4A, PDE5A,
and PDE7A revealed 32%, 30% and 34% identity, respectively.
EXAMPLE 2
Northern Blot
[0074] In order to determine which cell and tissue types express
PDE10, Northern blot analysis was carried out using a commercially
prepared multi-tissue Northern blot (Clontech, Palo Alto, Calif.).
The probe was a EcoRI/BclI fragment of the FB76.2 corresponding to
nucleotides 0.1 to 883. Hybridization conditions were as previously
described [Loughney et al., supra, (1996)].
[0075] Results indicated a 2.2 to 2.4 kb band which was strongest
in kidney, present in heart, pancreas, and placenta, and weakest in
brain, lung, skeletal muscle and liver. The band was fairly wide in
placenta suggesting that it might contain a number of mRNAs of
slightly different sizes.
EXAMPLE 3
Chromosome Mapping
[0076] As mentioned above, the X88347, X88467, and X88465 ESTs were
identified with an exon trapping procedure using DNA from
chromosome 21 [Chen et al. 1996]. X88467 was identified as a new
sequence with homology to a mouse calcium-, calmodulin-dependent
phosphodiesterase Q01065 aa 52-103. XD88347 was identified to be
the same as EST R00718 and similar to Drosophila cAMP dependent
phosphodiesterase P12252. Both of these sequences were placed in a
category described as having strong homology to known protein
sequences.
[0077] A search of the Sequence Tagged Sites (STS) database at NCBI
revealed homology of the 3'-end of PDE10 to STS WI-13322 which has
been mapped to region 220.72 cr. from the top of chromosome 21. The
cDNA that this STS was derived from begins at nucleotide 1899 of
FB68.2, does not have the poly A tail and extends further 3' than
FB68.2. It seems likely that this STS sequence represents a PDE10A
transcript to which no poly (A.sup.+) tail has been added or a
PDE10A transcript that uses an alternative site for poly (A.sup.+)
addition. STS WI-13322 was placed on a Whitehead map of chromosome
21 near SGC35805, which is derived from the gene for the
cystathionine beta-synthase (CBS). CBS has been mapped to
chromosome 21 at 21q22.3. [Avramopoulos, et al, Hum. Genet.
90:566-568 (1993); Munke et al., Hum. Genet. 0.42:550-559
(1988)].
[0078] A number of different genetic diseases map to this region of
chromosome 21, for example, Down syndrome [Delabar, et al., Eur. J.
Hum. Genet. 1:114-124(1993)]. It is not clear that PDE10A falls
within the Down syndrome critical region (DSCR) but it is possible
that genes elsewhere on chromosome 21 also contribute to Down
syndrome [Korenberg, et al., Proc. Natl. Acad. Sci. (USA)
91:4997-5001 (1994)]. As another example, a locus involved in
bipolar affective disorder in some families has been mapped to 21
q22.3 [Vallada, et al., J. Affect. Disord. 41:217-221 (1996)].
Other examples include Knobloch syndrome, characterized by myopia
and retinal degeneration and detachment [Sertie, et al., Hum. Mol.
Genet. 5:843-847 (1996)], and one or more genes responsible for
congenital recessive deafness (DFNB8, DFNB10) [Veske, et al., Hum.
Mol. Genet. 5:165168 (1996); Bonne-Tamir, et al., Am. J. Hum.
Genet. 58:1254-1259 (1996)]. PDE10A may play a role in any or all
of these disease states.
EXAMPLE 4
Expression and Characterization of PDE10
[0079] The entire open reading frame of the PDE10 cDNA (clone
FB94a) was placed into a yeast ADH vector including the alcohol
dehydrogenase promoter. The construct was built in two steps.
[0080] The 5'end was generated using PCR and FB94a DNA as template.
PCR was carried out using the 5' primer below (SEQ ID NO: 25) in
combination with 3' primer R71A3 (SEQ ID NO: 26). The 5' primer
includes an NcoI site (underlined in SEQ ID NO: 25 below) and the
initiating methionine codon of FB94a is in bold. The 5' primer also
adds a FLAG.RTM. epitope tag (Eastman Kodak, Rochester, N.Y.) to
the amino terminus of the encoded protein; the FLAG.RTM. tag is an
epitope (SEQ ID NO: 24) recognized by the monoclonal antibody M2
(Eastman Kodak).
4 FLAG .RTM. TAG (SEQ ID NO: 24) Asp-Tyr-Lys-Asp-Asp-Asp-As- p-Lys
5'Primer (SEQ ID NO: 25) TAGACCATGGACTACAAGGACGACGA-
TGACAAGATGGACGCATTCAGAAGCACT R71A3 (SEQ ID NO: 26)
CGAGGAGTCAACTTCTTG
[0081] PCR was carried out using 5 .mu.l each primer (100 .mu.g/ml
stock), 5 .mu.l 10.times. buffer (Perkin Elmer), 5 .mu.l 10.times.
nucleotides (2 mM stock), 3 .mu.l MgCl.sub.2 (25 mM stock), FB94a
DNA, and 0.3 .mu.l Taq polymerase (Perkin Elmer) in a reaction
volume of 50 .mu.l. After incubating the reaction mixture at
94.degree. C. for four minutes, 30 cycles of one minute at
94.degree. C., two minutes at 50.degree. C., and four minutes at
72.degree. C. were carried out. The PCR product was cleaved with
NcoI and HincII and purified using agarose gel electrophoresis. The
3'sequence of PDE10 was isolated as a HincII/EcoRI fragment cleaved
from FB94a and purified by agarose gel electrophoresis. The two
fragments were combined and ligated into a NcoI/EcoRI-digested
Bluescript.RTM. vector (Stratagene, La Jolla, Calif.), previously
modified by the insertion of the ADH promoter previously removed
from a YEpC-PADH2d vector [Price et al. Meth. Enzymol. 185:308-315
(1990)] as a SacI/NcoI fragment, to generate plasmid PDE10-1. New
junctions and sequence generated by PCR were verified by
sequencing.
[0082] In the second step of plasmid construction, the SacI/SalI
fragment from PDE10-1 containing the ADH promoter and PDE10 open
reading frame was purified by two rounds of agarose gel
electrophoresis and ligated into SacI/SalI cut YEpC-PADH2
vector.
[0083] Following transformation into BJ2-54, a yeast strain lacking
endogenous PDE activity, a colony was selected, streaked out on
SC-leu plates and a single colony carrying the PDE10 construct was
chosen for further characterization. Following overnight growth in
SC-leu media the culture was diluted 1:250 in fresh SC-leu and
grown overnight at 30.degree. C. until it reached a density of
10.sup.7 cells/ml. The cells were collected by centrifugation,
washed once with YEP 3% glycerol media, resuspended in YEP
containing 3% glycerol, and grown at 30.degree. C. for another 24
hours. The cells were harvested by centrifugation, washed with
water, and frozen at -70.degree. C. until use. Prior to use, an
aliquot of the yeast extract was analyzed by SDS PAGE. A protein
specific to yeast carrying the PDE10 expression construct that
migrated on the SDS PAGE gels with the expected mobility (55.5 kDa)
was observed by Coomassie blue staining.
[0084] Yeast cells (1.times.10.sup.10) were thawed with 200
.mu.g/ml each of pepstatin A, leupeptin, and aprotinin 1 mM DTT,
and 20 .mu.g/ml calpain inhibitors (I and II). Two hundred .mu.l of
glass beads (0.5 mm, acid washed) were added, and the mixture was
vortexed for eight cycles of 30 seconds each. Samples were cooled
for 4.5 minutes at 4.degree. C. between cycles. After lysis, 0.8 ml
lysis buffer was added, the lysate separated from the beads, and
the lysate centrifuged for 30 minutes at 100,000.times.g in a
Beckman TL-100 tabletop centrifuge. The supernatant was aliquoted,
frozen in dry ice/ethanol, and stored at -70.degree. C.
[0085] Kinetic assays were performed on a BIOMEK.RTM. 1000
programmable robotic station (Beckman Instruments). The range of
final substrate concentration was 0.2 to 1000 .mu.M for cAMP and
0.6-2000 nM for cGMP. The highest nucleotide concentration
contained 1 to 1.5 million Cerenkov counts of .sup.32P-labeled
substrate per assay. The enzyme preparation was initially diluted
1:500 (cAMP as substrate) or 1:50,000 (cGMP as substrate). The
enzyme dilution buffer consisted of 25 mM Tris-HCl pH 8.9, 5 .mu.M
ZnSO.sub.4 5 mM MgCl.sub.2, 1.0 mM DTT, 100 mM NaCl and 0.1 mg/ml
BSA (Calbiochem; fatty acid free). Activity at each substrate
concentration was derived from a linear fit of successive four-fold
enzyme dilutions across the plate.
[0086] Assays were performed at 30.degree. C. for 15 minutes. After
12 minutes, 5 .mu.l snake venom from Crotalus atrox (15, mg/ml
protein) was added to each reaction. Assays were stopped by
addition 200 .mu.l of charcoal suspension (25 mg/ml activated
charcoal in 0.1 M monobasic potassium phosphate). The plate was
centrifuged at 2600 rpm, and 200 .mu.l of each supernatant was
transferred into Microbeta.RTM. counting plates and counted on a
WALLAC Microbeta.RTM. by Cerenkov counting. Data were evaluated
with a predesigned Microsoft Excel.RTM. Spreadsheet, and the
kinetic parameters were fitted to a Michaelis-Menton model using
the program Table Curve.RTM. from Jandel Scientific.
[0087] Results indicated that the K.sub.m for cGMP hydrolysis was 5
(.+-.1) nM and the K.sub.m for cAMP hydrolysis was 160 (.+-.30)
.mu.M. In the extract, cGMP hydrolytic activity was determined to
be 0.035 (.+-.0.01) .mu.mol/min/mg, while cAMP hydrolysis was
measured to be 0.52 (.+-.0.06) .mu.mol/min/mg. Thus, although PDE10
had much greater affinity for cGMP, the V.sup.max for cAMP was
15-fold greater.
[0088] In order to distinguish PDE10 from other PDE families, a
panel of PDE inhibitors with activities against defined PDE
families was tested for PDE10 inhibition using cAMP as a substrate.
The results of the assay are set out in Table 1 below.
5TABLE 1 PDE10 Inhibition with Isozyme-specific PDE Inhibitors
Target PDE10 Target Family Inhibitor Family IC.sub.50 (.mu.M)
IC.sub.50 (.mu.M) SCH46642 PDE1 14 0.2.sup.5 EHNA PDE2 477
0.8.sup.2 Cilostamide PDE3 100 0.04-0.9.sup.3 Rolipram PDE4 529
0.18-0.5.sup.4 DMPPO PDE5 9 0.003.sup.1 IBMX non-specific 59
2-20.sup.1 .sup.1Coste and Grodin, Biochem. Pharmacol. 50:1577-1585
(1995). .sup.2Podzuweit, et al. Cell. Signaling 7:733-738 (1995)
.sup.3Manganiello et al., in Isoenzymes of Cyclic Nucleotide
Phosphodiesterases, Beavo and Houslay (Eds.), John Wiley and Sons,
Ltd. , pp. 87-116 (1990) .sup.4Bolger et al., Mol. Cell. Biol.
13:6558-6571 (1993) .sup.5Ahn, et al., Abstract from the 9th
International Conference on Second Messengers and Phosphoproteins,
Nashville, TN, 1995, p. 86.
[0089] The results further distinguish PDE10 from PDEs in families
1 through in that specific inhibitors for enzymes in those families
are significantly less effective in inhibiting PDE10.
EXAMPLE 5
Production of Anti-PDE10 Antibodies
[0090] A GST fusion protein was produced in E. coli to provide an
antigen for generation of monoclonal antibodies to PDE10. An EcoRI
fragment from FB76.2 (nucleotides 280 through 1829 in SEQ ID NO:
18) was inserted into the EcoRI site of pGEX3X (Pharmacia) and the
resultant construct was transformed in the E. coli strain XL1 Blue.
A GST-PDE10 fusion protein including 464 amino acids from PDE10 was
expressed from this construct following induction with IPTG. The
fusion protein was isolated using SDS-PAGE, the band of appropriate
size excised from the gel following staining with cold 0.4 M KCl,
and the protein obtained from the acrylamide by electroelution. The
elution product was dialyzed against PBS and concentrated using
Centriprep 10 and Centricon columns (Amicon, Beverly Mass.) prior
to being injected into mice.
[0091] On day 0, four Balb/c mice were pre-bled and immunized by
subcutaneous injection with a panel of antigens including 30
.mu.g/mouse GST-PDE10 fusion protein in complete Freund's adjuvant
in 200 .mu.l total volume. The same injections were repeated at
weeks three and nine in incomplete Freund's adjuvant. Ten days
after the last immunization, test bleeds were obtained and screened
by antigen capture ELISA and Western analysis.
[0092] In the ELISA, Immulon.RTM. 4 plates (Dynex, Cambridge,
Mass.) were coated at 4.degree. C. with 50 .mu.l/well of a solution
containing 2 .mu.g/ml GST-PDE10 in 50 mM carbonate buffer, pH 9.6.
Plates were blocked with 0.5% fish skin gelatin (Sigma) for 30
minutes and 50 .mu.l serum diluted in PBS with 0.5% Tween.RTM. 20
(PBST) was added. Serum dilutions ranged from 1:100 to 1:102,400
and were obtained by a series of doubling dilutions. After
incubation at 37.degree. C. for 30 minutes and washing three times
with PBST, 5.0 .mu.l of horseradish peroxidase-conjugated goat
anti-mouse IgG(fc) antibody. (Jackson) (diluted 1:10000 in PBST)
was added. Plates were incubated as above and washed four times
with PBST. Antibody was detected with addition of tetramethyl
benzidine (Sigma Chemical, St. Louis, Mo.) and the color reaction
was stopped after five minutes with the addition of 50 .mu.l of 15%
H.sub.2SO.sub.4. Absorbance at 0.450 nM was measured on a plate
reader.
[0093] For Western analysis, SDS-PAGE gels were run with
approximately 10 .mu.g yeast PDE10 extract and approximately 200 ng
of gel-purified GST-PDE10 and the proteins were transferred to
Immobilon-PVDF. A standard enhanced chemiluminescence (ECL) Western
blot protocol was performed using BioRad goat anti-mouse IgG
horseradish peroxidase as the secondary antibody.
[0094] In preparation of hybridomas, splenocytes from mice giving a
positive result from the ELISA and/or Western blotting protocols
above, were fused to NS-1 cells in a ratio of 5:1 by standard
methods using polyethylene glycol 1500 (Boehringer Mannheim)
[Harlow and Lane, Antibodies, a Laboratory Manual, Cold Spring
Harbor Laboratory, p.211 (1988)]. The fused cells were resuspended
in 200 ml RPMI containing 15% FBS, 100 mM sodium hypoxanthine, 0.4
mM aminopterin, 16 mM thymidine (HAT) (Gibco), 25 units/ml IL-6
(Boehringer Mannheim) and 1.5.times.10.sup.6 murine thymocytes/ml
and dispensed into ten 96-well flat bottom tissue culture plates
(Corning, United Kingdom) at 200 .mu.l/well. Cells were fed on days
2, 4, and 6 post fusion by aspirating approximately 100 .mu.l from
each well with an 18 G needle (Becton Dickinson) and adding 100
.mu.l/well plating medium described above except containing 10
units/ml IL-6 and lacking thymocytes. On days 9 to 12, supernatants
from the fusion wells were screened by antigen capture ELISA using
GST and GST-PDE10 and by ECL Western analysis as described
above.
[0095] A positive signal of the expected size was obtained on both
lanes of the Western blot using mouse blood and monoclonal
antibodies with reactivity to the yeast recombinant protein were
obtained in the subsequent fusion.
EXAMPLE 6
Analysis of PDE10 Expression by In Situ Hybridization
[0096] Expression of PDE10 was examined in tissue sections by in
situ hybridization as described below.
[0097] Preparation of Probe
[0098] An EcoRI/PstI restriction enzyme fragment from the cDNA
FB93a (corresponding to nucleotides 370 through 978 in SEQ ID NO:
22) was subcloned into a Bluescript.RTM. vector (Stratagene, La
Jolla, Calif.) to generate an expression plasmid designated
PDE10A3A. The plasmid was digested with EcoRI and transcribed with
T3 polymerase to generate an antisense probe. A sense probe was
generated by digestion the plasmid with BamHI and transcribing with
T7 polymerase. The PDE10 templates were transcribed using a RNA
Transcription kit (Stratagene, La Jolla, Calif.) in a reaction
containing 5 .mu.l of 5.times. transcription buffer (Stratagene),
30 mM DTT (Stratagene), 0.8 mM each ATP, CTP, GTP (10 mM
(Stratagene), 40 U RNase Block II (Stratagene), 12.5 U T3 or T7
polymerase (Stratagene), and 300 ng linearized plasmid template, 50
.mu.Ci .sup.35S-UTP (greater than 1000 Ci/mmol, Amersham, Arlington
Heights, Ill.). The mixture was incubated at 37.degree. C. for one
hour after which the template DNA was removed by addition of 1
.mu.l of RNase-free DNase I (Stratagene) and incubation for 15
minutes at 37.degree. C. The probe was hydrolyzed to approximately
250 nucleotides in length to facilitate tissue penetration by
adding 4 .mu.l 1 M NaHCO.sub.3 and 6 .mu.l 1 M Na.sub.2CO.sub.3 for
22 minutes at 60.degree. C. and the reaction mixture was
neutralized by addition of 25 .mu.l of a solution containing 100
.mu.l 3 M sodium acetate, 5 .mu.l acetic acid (VWR, So. Plainfield,
N.J.), and 395 .mu.l dH.sub.2O. A Quick Spin G50 RNA column
(5'.fwdarw.3' Inc., Boulder, Colo.) was prepared according to the
manufacturer's suggested protocol. The probe was placed in the
center of the column and the column centrifuged for four minutes at
1,000 rpm in a desk top centrifuge. The column flow-through was
mixed with 50 .mu.l dH.sub.2O, 2 .mu.l of a 10 mg/ml tRNA solution,
10 .mu.l 3 M sodium acetate, and 200 .mu.l 100%, ethanol (VWR) and
the resulting mixture was incubated at -20.degree. C. overnight.
The probe solution was microfuged for 15 minutes at 4.degree. C.,
the supernatant was removed, and the pellet was resuspended in 40
.mu.l 1.times.TBE containing 1 .mu.l of 0.1 M DTT. The probe was
stored at -70.degree. C. until the in situ hybridization assay was
performed.
[0099] Preparation of Tissue Samples and In Situ Hybridization
[0100] Tissues (National Disease Research Interchange,
Philadelphia, Pa. and Cooperative Human Tissue Network,
Philadelphia, Pa.) were sectioned at 6 .mu.m and placed on
Superfrost Plus slides (VWR). Sections were fixed for 20 minutes
at, 4.degree. C. in 4% paraformaldehyde (Sigma, St. Louis, Mo.).
The slides were rinsed in three changes of 1.times. calcium-,
magnesium-free phosphate buffered saline (CMF-PBS), dehydrated with
three successive washes with 70% ethanol, 95% ethanol and 100%
ethanol, and dried, for 30 minutes at room temperature. The slides
were placed in 70% formamide (J.T. Baker) in 2.times.SSC for two
minutes at 70.degree. C., rinsed in 2.times.SSC at 4.degree. C.,
dehydrated through 70%, 95% and 100% ethanol washes, and dried for
30 minutes at room temperature.
[0101] A prehybridization step was performed by placing the slides
in an airtight box containing a piece of filter paper saturated
with buffer containing 50% formamide (J.T. Baker) in 4.times.SSC.
Each section was covered with 100 .mu.l of rHB2 buffer consisting
of 10% dextran sulfate (Sigma), 50% formamide (J.T. Baker,
Phillpsburg, N.J.), 100 mM DTT (Boehringer Mannheim, Indianapolis,
Ind.), 0.3 M NaCl (Sigma), 20 mM Tris, pH 7.5, 5 mM EDTA (Sigma),
and 1.times. Denhardt's solution (Sigma) and the slides were
incubated at 42.degree. C. for two hours. The probe, as described
above, was prepared by mixing 4.times.10' cpm/tissue section with 5
.mu.l of a 10 mg/ml tRNA solution per section and heating the
mixture at 95.degree. C. for three minutes. Ice cold rHB2 buffer
was added to bring the final volume to 20 .mu.l/section. The
probe-containing solution (20 .mu.l/section) was added to 100 .mu.l
rHB2 buffer previously applied. The slides were incubated at
55.degree. C. for 12 to 16 hours. Following hybridization, the
slides were washed once in 4.times.SSC containing 10 mM DTT for one
hour at room temperature; once in 50% deionized formamide (J.T.
Baker), 1.times.SSC, and 1 mM DTT for 40 minutes at 60.degree. C.
once in 2.times.SSC for 30 minutes at room temperature, and once in
0.1.times.SSC for 30 minutes at room temperature. The sections were
dehydrated through 70%, 95%, and 100% ethanol washes and air dried
for 30 minutes. The slides were dipped in Kodak NTB2 nuclear
emulsion, dried for one to three hours at room temperature in the
dark, and stored in the dark at 4.degree. C. with desiccant until
time of development. The slides were developed in 4.degree. C.
Kodak Dektol.RTM. developer for two minutes, dipped four times in
4.degree. C. dH.sub.2O, and placed in 4.degree. C. Kodak fixer for
ten minutes. The slides were rinsed in dH.sub.2O and a standard
hematoxylin and eosin (H&E) stain was performed as follows.
[0102] The slides were rinsed in dH.sub.2O and stained with
hematoxylin and eosin by transfer of the slides through a series of
the following steps: five minutes in formaldehyde/alcohol (100 ml
formaldehyde, 900 ml 80% ethanol); three rinses in water for a
total of two minutes; five minutes in 0.75% Harris hematoxylin
(Sigma); three rinses in water for a total of two minutes; one dip
in 1% HCl/50% ethanol; one rinse in water; four dips in 1% lithium
carbonate; ten minutes in tap water; two minutes in 0.5%, eosin
(Sigma); three rinses in water for a total of two minutes; two
minutes in 70% ethanol; three one-minute rinses in 95% ethanol; two
one-minute rinses in 00% ethanol; and two two-minute rinses in
xylene. Slides were mounted with cytoseal 60 (Stephens Scientific,
Riverdale, N.J.).
[0103] The signals obtained with an antisense PDE10 probe were
compared to the control signals generated by a sense PDE10 probe
and any signal specific, to the antisense probe was assumed to
represent PDE10 expression. PDE10 signal was detected throughout
much of the cerebellum, with very strong signal in the Purkinje
cells.
EXAMPLE 7
High Throughput Screening for PDE10 Inhibitors
[0104] In an attempt to identify specific inhibitors, PDE10 was
screened against a chemical library containing compounds of known
structure. Initial screening was performed on pools of compounds
(22 compounds per pool) with each compound present at 4.6 .mu.M.
Pools which inhibited PDE10 activity by greater than 50% were
selected and the individual compounds in the pool were screened at
a concentration of 20 .mu.M. IC.sub.50 values were determined for
compounds that inhibited enzyme activity.
[0105] An extract was prepared from Saccharomyces cerevisiae strain
BJ2-54 (described in Example 4) lacking endogenous PDE activity and
having PDE10 at an activity of 49 mmol cGMP hydrolyzed/min/ml with
32 nM cGMP. The extract was diluted 1:21,000-fold for use in the
assay. Dilution buffer included 25 mM Tris, pH 8.0, 0.1 mM DTT, 5.0
mM MgCl.sub.2, 100 mM NaCl, 5 .mu.M ZnSO.sub.4 and 100 .mu.g/ml
BSA. PDE assay buffer (5.times.) contained 200 mM Tris, pH 8.0, 5
mM EGTA, 25 mM MgCl.sub.2 and 0.5 mg/ml BSA. Just prior to
screening. 5.times.PDE assay buffer, deionized water, and
5'-nucleosidase (stock solution 15 mg/ml snake venom
5'-nucleosidase in 20 mM Tris, pH 8.0) were mixed at ratios of
4:4:1 to make Assay Reagent Mix.
[0106] A Packard MultiPROBE.RTM. was used to add 45 .mu.l of the
Assay Reagent Mix and 20 .mu.l of the chemical compound pools. A
BIOMEK.RTM. 1000 (See Example 4) was used to add 20 .mu.l of PDE10
extract diluted as described above and 20 .mu.l .sup.32P-cGMP (ICN,
specific activity 250 .mu.Ci/mmol, diluted to 0.4 .mu.Ci/ml, 16 nM,
in deionized water). Final cGMP concentration in the assay was 0.08
.mu.Ci/ml, 3.2 nM. Ten minutes after addition of .sup.32P-cGMP, 140
.mu.l of 25 mg/ml charcoal (in 0.1 M NaH.sub.2PO.sub.4) was added
to stop the reaction. After a 20 minute incubation at room
temperature, the assay plates were centrifuged for five minutes at
3,500 rpm in a Beckman GS-6R centrifuge. A BIOMEK.RTM. 1000 was
used to transfer 140 .mu.l of the supernatant to a Wallac counting
plate and Cerenkov radiation was measured in a Wallac MicroBeta
Counter.
[0107] Several compounds that merit further investigation were
found to inhibit enzyme activity.
[0108] Numerous modifications and variations in the invention as
set forth in the above illustrative examples are expected to occur
to those skilled in the art. Consequently only such limitations as
appear in the appended claims should be placed on the invention.
Sequence CWU 1
1
26 1 1548 DNA Homo sapiens CDS (26)..(1423) 1 cccaaggcca tctacctgga
catcg atg gac gca ttc aga agc act ccg tac 52 Met Asp Ala Phe Arg
Ser Thr Pro Tyr 1 5 aaa gtg aga cct gtg gcc atc aag caa ctc tcc gag
aga gaa gaa tta 100 Lys Val Arg Pro Val Ala Ile Lys Gln Leu Ser Glu
Arg Glu Glu Leu 10 15 20 25 atc cag agc gtg ctg gcg cag gtt gca gag
cag ttc tca aga gca ttc 148 Ile Gln Ser Val Leu Ala Gln Val Ala Glu
Gln Phe Ser Arg Ala Phe 30 35 40 aaa atc aat gaa ctg aaa gct gaa
gtt gca aat cac ttg gct gtc cta 196 Lys Ile Asn Glu Leu Lys Ala Glu
Val Ala Asn His Leu Ala Val Leu 45 50 55 gag aaa cgc gtg gaa ttg
gaa gga cta aaa gtg gtg gag att gag aaa 244 Glu Lys Arg Val Glu Leu
Glu Gly Leu Lys Val Val Glu Ile Glu Lys 60 65 70 tgc aag agt gac
att aag aag atg agg gag gag ctg gcg gcc aga agc 292 Cys Lys Ser Asp
Ile Lys Lys Met Arg Glu Glu Leu Ala Ala Arg Ser 75 80 85 agc agg
acc aac tgc ccc tgt aag tac agt ttt ttg gat aac cac aag 340 Ser Arg
Thr Asn Cys Pro Cys Lys Tyr Ser Phe Leu Asp Asn His Lys 90 95 100
105 aag ttg act cct cga cgc gat gtt ccc act tac ccc aag tac ctg ctc
388 Lys Leu Thr Pro Arg Arg Asp Val Pro Thr Tyr Pro Lys Tyr Leu Leu
110 115 120 tct cca gag acc atc gag gcc ctg cgg aag ccg acc ttt gac
gtc tgg 436 Ser Pro Glu Thr Ile Glu Ala Leu Arg Lys Pro Thr Phe Asp
Val Trp 125 130 135 ctt tgg gag ccc aat gag atg ctg agc tgc ctg gag
cac atg tac cac 484 Leu Trp Glu Pro Asn Glu Met Leu Ser Cys Leu Glu
His Met Tyr His 140 145 150 gac ctc ggg ctg gtc agg gac ttc agc atc
aac cct gtc acc ctc agg 532 Asp Leu Gly Leu Val Arg Asp Phe Ser Ile
Asn Pro Val Thr Leu Arg 155 160 165 agg tgg ctg ttc tgc gtc cac gac
aac tac aga aac aac ccc ttc cac 580 Arg Trp Leu Phe Cys Val His Asp
Asn Tyr Arg Asn Asn Pro Phe His 170 175 180 185 aac ttc cgg cac tgc
ttc tgc gtg gcc cag atg atg tac agc atg gtc 628 Asn Phe Arg His Cys
Phe Cys Val Ala Gln Met Met Tyr Ser Met Val 190 195 200 tgg ctc tgc
agt ctc cag gag aag ttc tca caa acg gat atc ctg atc 676 Trp Leu Cys
Ser Leu Gln Glu Lys Phe Ser Gln Thr Asp Ile Leu Ile 205 210 215 cta
atg aca gcg gcc atc tgc cac gat ctg gac cat ccc ggc tac aac 724 Leu
Met Thr Ala Ala Ile Cys His Asp Leu Asp His Pro Gly Tyr Asn 220 225
230 aac acg tac cag atc aat gcc cgc aca gag ctg gcg gtc cgc tac aat
772 Asn Thr Tyr Gln Ile Asn Ala Arg Thr Glu Leu Ala Val Arg Tyr Asn
235 240 245 gac atc tca ccg ctg gag aac cac cac tgc gcc gtg gcc ttc
cag atc 820 Asp Ile Ser Pro Leu Glu Asn His His Cys Ala Val Ala Phe
Gln Ile 250 255 260 265 ctc gcc gag cct gag tgc aac atc ttc tcc aac
atc cca cct gat ggg 868 Leu Ala Glu Pro Glu Cys Asn Ile Phe Ser Asn
Ile Pro Pro Asp Gly 270 275 280 ttc aag cag atc cga cag gga atg atc
aca tta atc ttg gcc act gac 916 Phe Lys Gln Ile Arg Gln Gly Met Ile
Thr Leu Ile Leu Ala Thr Asp 285 290 295 atg gca aga cat gca gaa att
atg gat tct ttc aaa gag aaa atg gag 964 Met Ala Arg His Ala Glu Ile
Met Asp Ser Phe Lys Glu Lys Met Glu 300 305 310 aat ttt gac tac agc
aac gag gag cac atg acc ctg ctg aag atg att 1012 Asn Phe Asp Tyr
Ser Asn Glu Glu His Met Thr Leu Leu Lys Met Ile 315 320 325 ttg ata
aaa tgc tgt gat atc tct aac gag gtc cgt cca atg gaa gtc 1060 Leu
Ile Lys Cys Cys Asp Ile Ser Asn Glu Val Arg Pro Met Glu Val 330 335
340 345 gca gag cct tgg gtg gac tgt tta tta gag gaa tat ttt atg cag
agc 1108 Ala Glu Pro Trp Val Asp Cys Leu Leu Glu Glu Tyr Phe Met
Gln Ser 350 355 360 gac cgt gag aag tca gaa ggc ctt cct gtg gca ccg
ttc atg gac cga 1156 Asp Arg Glu Lys Ser Glu Gly Leu Pro Val Ala
Pro Phe Met Asp Arg 365 370 375 gac aaa gtg acc aag gcc aca gcc cag
att ggg ttc atc aag ttt gtc 1204 Asp Lys Val Thr Lys Ala Thr Ala
Gln Ile Gly Phe Ile Lys Phe Val 380 385 390 ctg atc cca atg ttt gaa
aca gtg acc aag ctc ttc ccc atg gtt gag 1252 Leu Ile Pro Met Phe
Glu Thr Val Thr Lys Leu Phe Pro Met Val Glu 395 400 405 gag atc atg
ctg cag cca ctt tgg gaa tcc cga gat cgc tac gag gag 1300 Glu Ile
Met Leu Gln Pro Leu Trp Glu Ser Arg Asp Arg Tyr Glu Glu 410 415 420
425 ctg aag cgg ata gat gac gcc atg aaa gag tta cag aag aag act gac
1348 Leu Lys Arg Ile Asp Asp Ala Met Lys Glu Leu Gln Lys Lys Thr
Asp 430 435 440 agc ttg acg tct ggg gcc acc gag aag tcc aga ggg aga
agc aga gat 1396 Ser Leu Thr Ser Gly Ala Thr Glu Lys Ser Arg Gly
Arg Ser Arg Asp 445 450 455 gtg aaa aac agt gaa gga gac tgt gcc
tgaggaaagc ggggggcgtg 1443 Val Lys Asn Ser Glu Gly Asp Cys Ala 460
465 gctgcagttc tggacgggct ggccgagctg cgcgggatcc ttgtgcaggg
aagagctgcc 1503 ctgggcacct ggcaccacaa gaccatgttt tctaagaacc atttt
1548 2 466 PRT Homo sapiens 2 Met Asp Ala Phe Arg Ser Thr Pro Tyr
Lys Val Arg Pro Val Ala Ile 1 5 10 15 Lys Gln Leu Ser Glu Arg Glu
Glu Leu Ile Gln Ser Val Leu Ala Gln 20 25 30 Val Ala Glu Gln Phe
Ser Arg Ala Phe Lys Ile Asn Glu Leu Lys Ala 35 40 45 Glu Val Ala
Asn His Leu Ala Val Leu Glu Lys Arg Val Glu Leu Glu 50 55 60 Gly
Leu Lys Val Val Glu Ile Glu Lys Cys Lys Ser Asp Ile Lys Lys 65 70
75 80 Met Arg Glu Glu Leu Ala Ala Arg Ser Ser Arg Thr Asn Cys Pro
Cys 85 90 95 Lys Tyr Ser Phe Leu Asp Asn His Lys Lys Leu Thr Pro
Arg Arg Asp 100 105 110 Val Pro Thr Tyr Pro Lys Tyr Leu Leu Ser Pro
Glu Thr Ile Glu Ala 115 120 125 Leu Arg Lys Pro Thr Phe Asp Val Trp
Leu Trp Glu Pro Asn Glu Met 130 135 140 Leu Ser Cys Leu Glu His Met
Tyr His Asp Leu Gly Leu Val Arg Asp 145 150 155 160 Phe Ser Ile Asn
Pro Val Thr Leu Arg Arg Trp Leu Phe Cys Val His 165 170 175 Asp Asn
Tyr Arg Asn Asn Pro Phe His Asn Phe Arg His Cys Phe Cys 180 185 190
Val Ala Gln Met Met Tyr Ser Met Val Trp Leu Cys Ser Leu Gln Glu 195
200 205 Lys Phe Ser Gln Thr Asp Ile Leu Ile Leu Met Thr Ala Ala Ile
Cys 210 215 220 His Asp Leu Asp His Pro Gly Tyr Asn Asn Thr Tyr Gln
Ile Asn Ala 225 230 235 240 Arg Thr Glu Leu Ala Val Arg Tyr Asn Asp
Ile Ser Pro Leu Glu Asn 245 250 255 His His Cys Ala Val Ala Phe Gln
Ile Leu Ala Glu Pro Glu Cys Asn 260 265 270 Ile Phe Ser Asn Ile Pro
Pro Asp Gly Phe Lys Gln Ile Arg Gln Gly 275 280 285 Met Ile Thr Leu
Ile Leu Ala Thr Asp Met Ala Arg His Ala Glu Ile 290 295 300 Met Asp
Ser Phe Lys Glu Lys Met Glu Asn Phe Asp Tyr Ser Asn Glu 305 310 315
320 Glu His Met Thr Leu Leu Lys Met Ile Leu Ile Lys Cys Cys Asp Ile
325 330 335 Ser Asn Glu Val Arg Pro Met Glu Val Ala Glu Pro Trp Val
Asp Cys 340 345 350 Leu Leu Glu Glu Tyr Phe Met Gln Ser Asp Arg Glu
Lys Ser Glu Gly 355 360 365 Leu Pro Val Ala Pro Phe Met Asp Arg Asp
Lys Val Thr Lys Ala Thr 370 375 380 Ala Gln Ile Gly Phe Ile Lys Phe
Val Leu Ile Pro Met Phe Glu Thr 385 390 395 400 Val Thr Lys Leu Phe
Pro Met Val Glu Glu Ile Met Leu Gln Pro Leu 405 410 415 Trp Glu Ser
Arg Asp Arg Tyr Glu Glu Leu Lys Arg Ile Asp Asp Ala 420 425 430 Met
Lys Glu Leu Gln Lys Lys Thr Asp Ser Leu Thr Ser Gly Ala Thr 435 440
445 Glu Lys Ser Arg Gly Arg Ser Arg Asp Val Lys Asn Ser Glu Gly Asp
450 455 460 Cys Ala 465 3 225 DNA Homo sapiens misc_feature 130 N =
A, T, G, or C 3 agcgaccgtg agaagtcaga aggccttcct gtggaaccgt
tcatggaccg agacaaagtg 60 accaaggcca cagcccagat tgggttcatc
aagtttgccc tgatcccaat gtttgaaaca 120 gtgaccaagn tcttccccat
ggttgaggag atcatgctgc agccactttg ggaatcccga 180 gatcgntacg
aggagctgaa gcggntagat gacgccatga aagag 225 4 158 DNA Homo sapiens
misc_feature 12 N = A, T, G, or C 4 gtaccagatc antgcccgca
cagagctggc ggtccgntac aatgacatct caccgttgga 60 gnaaccacca
ctgcgccgtg gccttccaga tcctcgccga gcctgagtgn aacatcttct 120
ccaacatccc acctgatggg ttcaagcaga tccgacag 158 5 98 DNA Homo sapiens
misc_feature 14 N = A, T, G, or C 5 gagaacacca ctgngccgtg
gncttccaga tcctcgccga gcctgagtgn aacatcttct 60 ccaacatccc
acctgatggg ttcaagcaga tccgacag 98 6 418 DNA Homo sapiens
misc_feature 1 N = A, T, G, or C 6 nggttaactg gcgcatcttg tctttctctg
agaacagcga tctggttatg gggcatttct 60 gtctctaatg tcactgtctg
ctgcattccc tgcagagcga ccgtgagaag tcagaaggcc 120 ttcccgtggc
cccgttcatg gaccgagaca aagtgaccaa ggccacagcc caggattggg 180
tttcatcaag tttgtcctga tcccaatgtt tgaaacagtg accaagctct tccccatggg
240 ttgagggaga ttcatgctgg cagccanttt ggggaatccc gaggattcgc
tacgagggag 300 cttgaagcgg gattaggatg gacggccatg gaaaggagtt
ttacaggaag gnaggatttg 360 acagttttga agttttgggg gggccaccga
ggaagttccn ggaggaggag naggcaga 418 7 428 DNA Homo sapiens
misc_feature 1 N = A, T, G, or C 7 nagaaaaaag tgaacaaaat ggttcttaga
aaacatggtc ttgtggtgcc aggtgcccag 60 ggagctcttc cctgcacaag
gntcccgcgc antcggccag cccgtccaga actgcagcca 120 cgccccccgn
tttcctcagg cacagtctcc ttcactgttt ttcacatctc tgcttctctc 180
tctggacttc tcggtggccc cagacgtcaa gctgtcagtc ttcttctgta actctttcat
240 gggcgtcatc tatccgcttc agctcctcgt aggcgatctc ggggattccc
aaagtgggct 300 gcagcatgat cttcctcaac catggggggg aggagcttgg
ggcactngtt ttcaaaaatt 360 gggggatcag gggacaaact ttgattggan
cccatnttgg ggcttttggg cctttggggc 420 aatttttg 428 8 438 DNA Homo
sapiens misc_feature 63 N = A, T, G, or C 8 tttttttttt ttttttttgt
atcagtgaac aaaatggttc ttagaaaaca tggtcttgtg 60 gtnccaggtg
cccagggagc tcttccctgc acaaggancc cgcgcantcg gccagcccgt 120
ccagaactgc agccacgccc cccgttttcc tcaggcacag tctccttcac tgtttttcac
180 atctctgntt ctctctctgg ganttntcgg tgggccccag aacgtcaagc
tgtcagtntt 240 cttctgtaac tntttcatgg gcgtcatcta tccgtttcag
cttcctcgta ggcgatnttg 300 gggattccca aagtgggctg gcagcatgga
tcttcctcaa accatggggg gaaggagttt 360 gggtcaattn ttttcaaaac
attgggggnt cagggacaaa attttgatgg aaacccaatt 420 tgggggntgt gggccttg
438 9 262 DNA Mus musculus 9 gagaattttg actacagcaa cgaggagcac
ctgaccctgc tgaagatgat tctcataaaa 60 tgctgtgata tctccaatga
agtccgtccc atggaggtgg cagaatcgtg ggtggactgt 120 ttactggaag
aatattttat gcagagtgac cgtgagaagt ccgaagcctt cctgtggccc 180
cattcatgga ccgagacaaa gtgaccaaag caacagccca aattgggttc atcaagtttg
240 tcctgatccc aatgtttgaa ac 262 10 250 DNA Mus musculus 10
gagaattttg actacagcaa cgaggagcac ctgaccctgc tgaagatgat tctcataaaa
60 tgctgtgata tctccaatga agtccgtccc atggaggtgg cagaatcgtg
ggtggactgt 120 ttactggaag aatattttat gcagagtgac cgtgagaagt
ccgaagcctt cctgtggccc 180 attcatggac cgagacaaag tgaccaaagc
aacagccaaa ttgggttcat caagtttgtc 240 tgtccaatgt 250 11 459 DNA Homo
sapiens misc_feature 155 N = A, T, G, or C 11 attaatcttg gccactgaca
tggcaagaca tgcagaaatt atggattctt tcaaagagaa 60 aatggagaat
tttgactaca gcaacgagga gcacatgacc ctggtgagtg gcttattctg 120
cctgggtggg cagccaggcg gttgggctgg cgaanaggtt catccatcca gctcacactg
180 gaagccaaga agctgaaatt attagtcttc ttggaacaag gtgtctataa
atctggtttt 240 caaggtcatg actcttacta ggaaagtccg ggcagggcct
ccctcctgat gggtcctcct 300 tcatggtcag aggcagcatt ctcccattcc
tccatctctt ttgggatttt gaaggagata 360 aagtggggtg aaggccgtgc
attctcgctc tgnttttcca gagaattaaa accagttttc 420 ccttgaaggc
acagccccag cntggcattt tgaaagttg 459 12 599 DNA Homo sapiens CDS
(99)..(443) 12 tggccctcga ggccaagaat tcggcacgag tggttaactg
gcgcatcttg tctttctctg 60 agaacagcga tctggttatg gggcatttct gtctctaa
tgt cac tgt ctg ctg cat 116 Cys His Cys Leu Leu His 1 5 tcc ctg cag
agc gac cgt gag aag tca gaa ggc ctt ccc gtg gcc ccg 164 Ser Leu Gln
Ser Asp Arg Glu Lys Ser Glu Gly Leu Pro Val Ala Pro 10 15 20 ttc
atg gac cga gac aaa gtg acc aag gcc aca gcc cag att ggg ttc 212 Phe
Met Asp Arg Asp Lys Val Thr Lys Ala Thr Ala Gln Ile Gly Phe 25 30
35 atc aag ttt gtc ctg atc cca atg ttt gaa aca gtg acc aag ctc ttc
260 Ile Lys Phe Val Leu Ile Pro Met Phe Glu Thr Val Thr Lys Leu Phe
40 45 50 ccc atg gtt gag gag atc atg ctg cag cca ctt tgg gaa tcc
cga gat 308 Pro Met Val Glu Glu Ile Met Leu Gln Pro Leu Trp Glu Ser
Arg Asp 55 60 65 70 cgc tac gag gag ctg aag cgg ata gat gac gcc atg
aaa gag tta cag 356 Arg Tyr Glu Glu Leu Lys Arg Ile Asp Asp Ala Met
Lys Glu Leu Gln 75 80 85 aag aag act gac agc ttg acg tct ggg gcc
acc gag aag tcc aga gag 404 Lys Lys Thr Asp Ser Leu Thr Ser Gly Ala
Thr Glu Lys Ser Arg Glu 90 95 100 aga agc aga gat gtg aaa aac agt
gaa gga gac tgt gcc tgaggaaagc 453 Arg Ser Arg Asp Val Lys Asn Ser
Glu Gly Asp Cys Ala 105 110 115 ggggggcgtg gctgcagttc tggacgggct
ggccgagctg cgcgggatcc ttgtgcaggg 513 aagagctgcc ctgggcacct
ggcaccacaa gaccatgttt tctaagaacc attttgttca 573 ctgatacaaa
aaaaaaaaaa aaaaaa 599 13 115 PRT Homo sapiens 13 Cys His Cys Leu
Leu His Ser Leu Gln Ser Asp Arg Glu Lys Ser Glu 1 5 10 15 Gly Leu
Pro Val Ala Pro Phe Met Asp Arg Asp Lys Val Thr Lys Ala 20 25 30
Thr Ala Gln Ile Gly Phe Ile Lys Phe Val Leu Ile Pro Met Phe Glu 35
40 45 Thr Val Thr Lys Leu Phe Pro Met Val Glu Glu Ile Met Leu Gln
Pro 50 55 60 Leu Trp Glu Ser Arg Asp Arg Tyr Glu Glu Leu Lys Arg
Ile Asp Asp 65 70 75 80 Ala Met Lys Glu Leu Gln Lys Lys Thr Asp Ser
Leu Thr Ser Gly Ala 85 90 95 Thr Glu Lys Ser Arg Glu Arg Ser Arg
Asp Val Lys Asn Ser Glu Gly 100 105 110 Asp Cys Ala 115 14 28 DNA
Artificial Sequence Description of Artificial Sequence primer 14
agtcgaattc accgtgagaa gtcagaag 28 15 28 DNA Artificial Sequence
Description of Artificial Sequence primer 15 gtcaaagctt acatggtctt
gtggtgcc 28 16 1303 DNA Homo sapiens CDS (107)..(1066) 16
agtgactcta ctttgtgaaa atgtgaaact tcgtgtaggt actcagtaaa tcagtaaatt
60 cttactaacg ttagccccca gcctagctat ggagggtgca tgctga gcc ctg gag
115 Ala Leu Glu 1 cac atg tac cac gac ctc ggg ctg gtc agg gac ttc
agc atc aac cct 163 His Met Tyr His Asp Leu Gly Leu Val Arg Asp Phe
Ser Ile Asn Pro 5 10 15 gtc acc ctc agg agg tgg ctg ttc tgc gtc cac
gac aac tac aga aac 211 Val Thr Leu Arg Arg Trp Leu Phe Cys Val His
Asp Asn Tyr Arg Asn 20 25 30 35 aac ccc ttc cac aac ttc cgg cac tgc
ttc tgc gtg gcc cag atg atg 259 Asn Pro Phe His Asn Phe Arg His Cys
Phe Cys Val Ala Gln Met Met 40 45 50 tac agc atg gtc tgg ctc tgc
agt ctc cag gag aag ttc tca caa acg 307 Tyr Ser Met Val Trp Leu Cys
Ser Leu Gln Glu Lys Phe Ser Gln Thr 55 60 65 gat atc ctg atc cta
atg aca gcg gcc atc tgc cac gat ctg gac cat 355 Asp Ile Leu Ile Leu
Met Thr Ala Ala Ile Cys His Asp Leu Asp His 70 75 80 ccc ggc tac
aac aac acg tac cag atc aat gcc cgc aca gag ctg gcg 403 Pro Gly Tyr
Asn Asn Thr Tyr Gln Ile Asn Ala Arg Thr Glu Leu Ala 85 90 95 gtc
cgc tac aat gac atc tca ccg ctg gag aac cac cac tgc gcc gtg 451 Val
Arg Tyr Asn Asp Ile Ser Pro Leu Glu Asn His His Cys Ala Val 100 105
110
115 gcc ttc cag atc ctc gcc gag cct gag tgc aac atc ttc tcc aac atc
499 Ala Phe Gln Ile Leu Ala Glu Pro Glu Cys Asn Ile Phe Ser Asn Ile
120 125 130 cca cct gat ggg ttc aag cag atc cga cag gga atg atc aca
tta atc 547 Pro Pro Asp Gly Phe Lys Gln Ile Arg Gln Gly Met Ile Thr
Leu Ile 135 140 145 ttg gcc act gac atg gca aga cat gca gaa att atg
gat tct ttc aaa 595 Leu Ala Thr Asp Met Ala Arg His Ala Glu Ile Met
Asp Ser Phe Lys 150 155 160 gag aaa atg gag aat ttt gac tac agc aac
gag gag cac atg acc ctg 643 Glu Lys Met Glu Asn Phe Asp Tyr Ser Asn
Glu Glu His Met Thr Leu 165 170 175 ctg aag atg att ttg ata aaa tgc
tgt gat atc tct aac gag gtc cgt 691 Leu Lys Met Ile Leu Ile Lys Cys
Cys Asp Ile Ser Asn Glu Val Arg 180 185 190 195 cca atg gaa gtc gca
gag cct tgg gtg gac tgt tta tta gag gaa tat 739 Pro Met Glu Val Ala
Glu Pro Trp Val Asp Cys Leu Leu Glu Glu Tyr 200 205 210 ttt atg cag
agc gac cgt gag aag tca gaa ggc ctt cct gtg gca ccg 787 Phe Met Gln
Ser Asp Arg Glu Lys Ser Glu Gly Leu Pro Val Ala Pro 215 220 225 ttc
atg gac cga gac aaa gtg acc aag gcc aca gcc cag att ggg ttc 835 Phe
Met Asp Arg Asp Lys Val Thr Lys Ala Thr Ala Gln Ile Gly Phe 230 235
240 atc aag ttt gtc ctg atc cca atg ttt gaa aca gtg acc aag ctc ttc
883 Ile Lys Phe Val Leu Ile Pro Met Phe Glu Thr Val Thr Lys Leu Phe
245 250 255 ccc atg gtt gag gag atc atg ctg cag cca ctt tgg gaa tcc
cga gat 931 Pro Met Val Glu Glu Ile Met Leu Gln Pro Leu Trp Glu Ser
Arg Asp 260 265 270 275 cgc tac gag gag ctg aag cgg ata gat gac gcc
atg aaa gag tta cag 979 Arg Tyr Glu Glu Leu Lys Arg Ile Asp Asp Ala
Met Lys Glu Leu Gln 280 285 290 aag aag act gac agc ttg acg tct ggg
gcc acc gag aag tcc aga gag 1027 Lys Lys Thr Asp Ser Leu Thr Ser
Gly Ala Thr Glu Lys Ser Arg Glu 295 300 305 aga agc aga gat gtg aaa
aac agt gaa gga gac tgt gcc tgaggaaagc 1076 Arg Ser Arg Asp Val Lys
Asn Ser Glu Gly Asp Cys Ala 310 315 320 ggggggcgtg gctgcagttc
tggacgggct ggccgagctg cgcgggatcc ttgtgcaggg 1136 aagagctgcc
ctgggcacct ggcaccacaa gaccatgttt tctaagaacc attttgttca 1196
ctgatacaaa aaaaaaaaag gaattcatga tgctgtacag aattttattt ttaaactgtc
1256 ttttaaataa tatattctta tacggaaaaa aaaaaaaaaa aaaaaaa 1303 17
320 PRT Homo sapiens 17 Ala Leu Glu His Met Tyr His Asp Leu Gly Leu
Val Arg Asp Phe Ser 1 5 10 15 Ile Asn Pro Val Thr Leu Arg Arg Trp
Leu Phe Cys Val His Asp Asn 20 25 30 Tyr Arg Asn Asn Pro Phe His
Asn Phe Arg His Cys Phe Cys Val Ala 35 40 45 Gln Met Met Tyr Ser
Met Val Trp Leu Cys Ser Leu Gln Glu Lys Phe 50 55 60 Ser Gln Thr
Asp Ile Leu Ile Leu Met Thr Ala Ala Ile Cys His Asp 65 70 75 80 Leu
Asp His Pro Gly Tyr Asn Asn Thr Tyr Gln Ile Asn Ala Arg Thr 85 90
95 Glu Leu Ala Val Arg Tyr Asn Asp Ile Ser Pro Leu Glu Asn His His
100 105 110 Cys Ala Val Ala Phe Gln Ile Leu Ala Glu Pro Glu Cys Asn
Ile Phe 115 120 125 Ser Asn Ile Pro Pro Asp Gly Phe Lys Gln Ile Arg
Gln Gly Met Ile 130 135 140 Thr Leu Ile Leu Ala Thr Asp Met Ala Arg
His Ala Glu Ile Met Asp 145 150 155 160 Ser Phe Lys Glu Lys Met Glu
Asn Phe Asp Tyr Ser Asn Glu Glu His 165 170 175 Met Thr Leu Leu Lys
Met Ile Leu Ile Lys Cys Cys Asp Ile Ser Asn 180 185 190 Glu Val Arg
Pro Met Glu Val Ala Glu Pro Trp Val Asp Cys Leu Leu 195 200 205 Glu
Glu Tyr Phe Met Gln Ser Asp Arg Glu Lys Ser Glu Gly Leu Pro 210 215
220 Val Ala Pro Phe Met Asp Arg Asp Lys Val Thr Lys Ala Thr Ala Gln
225 230 235 240 Ile Gly Phe Ile Lys Phe Val Leu Ile Pro Met Phe Glu
Thr Val Thr 245 250 255 Lys Leu Phe Pro Met Val Glu Glu Ile Met Leu
Gln Pro Leu Trp Glu 260 265 270 Ser Arg Asp Arg Tyr Glu Glu Leu Lys
Arg Ile Asp Asp Ala Met Lys 275 280 285 Glu Leu Gln Lys Lys Thr Asp
Ser Leu Thr Ser Gly Ala Thr Glu Lys 290 295 300 Ser Arg Glu Arg Ser
Arg Asp Val Lys Asn Ser Glu Gly Asp Cys Ala 305 310 315 320 18 1887
DNA Homo sapiens CDS (74)..(1672) 18 ctcccccgcc tcccgcggcg
gctggcgtcg ggaaagtaca gtaaaaagtc cgagtgcagc 60 cgccgggcgc agg atg
gga tcc ggc tcc tcc agc tac cgg ccc aag gcc 109 Met Gly Ser Gly Ser
Ser Ser Tyr Arg Pro Lys Ala 1 5 10 atc tac ctg gac atc gat gga cgc
att cag aag gta atc ttc agc aag 157 Ile Tyr Leu Asp Ile Asp Gly Arg
Ile Gln Lys Val Ile Phe Ser Lys 15 20 25 tac tgc aac tcc agc gac
atc atg gac ctg ttc tgc atc gcc acc ggc 205 Tyr Cys Asn Ser Ser Asp
Ile Met Asp Leu Phe Cys Ile Ala Thr Gly 30 35 40 ctg cct cgg aac
acg acc atc tcc ctg ctg acc acc gac gac gcc atg 253 Leu Pro Arg Asn
Thr Thr Ile Ser Leu Leu Thr Thr Asp Asp Ala Met 45 50 55 60 gtc tcc
atc gac ccc acc atg ccc gcg aat tca gaa cgc act ccg tac 301 Val Ser
Ile Asp Pro Thr Met Pro Ala Asn Ser Glu Arg Thr Pro Tyr 65 70 75
aaa gtg aga cct gtg gcc atc aag caa ctc tcc gag aga gaa gaa tta 349
Lys Val Arg Pro Val Ala Ile Lys Gln Leu Ser Glu Arg Glu Glu Leu 80
85 90 atc cag agc gtg ctg gcg cag gtt gca gag cag ttc tca aga gca
ttc 397 Ile Gln Ser Val Leu Ala Gln Val Ala Glu Gln Phe Ser Arg Ala
Phe 95 100 105 aaa atc aat gaa ctg aaa gct gaa gtt gca aat cac ttg
gct gtc cta 445 Lys Ile Asn Glu Leu Lys Ala Glu Val Ala Asn His Leu
Ala Val Leu 110 115 120 gag aaa cgc gtg gaa ttg gaa gga cta aaa gtg
gtg gag att gag aaa 493 Glu Lys Arg Val Glu Leu Glu Gly Leu Lys Val
Val Glu Ile Glu Lys 125 130 135 140 tgc aag agt gac att aag aag atg
agg gag gag ctg gcg gcc aga agc 541 Cys Lys Ser Asp Ile Lys Lys Met
Arg Glu Glu Leu Ala Ala Arg Ser 145 150 155 agc agg acc aac tgc ccc
tgt aag tac agt ttt ttg gat aac cac aag 589 Ser Arg Thr Asn Cys Pro
Cys Lys Tyr Ser Phe Leu Asp Asn His Lys 160 165 170 aag ttg act cct
cga cgc gat gtt ccc act tac ccc aag tac ctg ctc 637 Lys Leu Thr Pro
Arg Arg Asp Val Pro Thr Tyr Pro Lys Tyr Leu Leu 175 180 185 tct cca
gag acc atc gag gcc ctg cgg aag ccg acc ttt gac gtc tgg 685 Ser Pro
Glu Thr Ile Glu Ala Leu Arg Lys Pro Thr Phe Asp Val Trp 190 195 200
ctt tgg gag ccc aat gag atg ctg agc tgc ctg gag cac atg tac cac 733
Leu Trp Glu Pro Asn Glu Met Leu Ser Cys Leu Glu His Met Tyr His 205
210 215 220 gac ctc ggg ctg gtc agg gac ttc agc atc aac cct gtc acc
ctc agg 781 Asp Leu Gly Leu Val Arg Asp Phe Ser Ile Asn Pro Val Thr
Leu Arg 225 230 235 agg tgg ctg ttc tgc gtc cac gac aac tac aga aac
aac ccc ttc cac 829 Arg Trp Leu Phe Cys Val His Asp Asn Tyr Arg Asn
Asn Pro Phe His 240 245 250 aac ttc cgg cac tgc ttc tgc gtg gcc cag
atg atg tac agc atg gtc 877 Asn Phe Arg His Cys Phe Cys Val Ala Gln
Met Met Tyr Ser Met Val 255 260 265 tgg ctc tgc agt ctc cag gag aag
ttc tca caa acg gat atc ctg atc 925 Trp Leu Cys Ser Leu Gln Glu Lys
Phe Ser Gln Thr Asp Ile Leu Ile 270 275 280 cta atg aca gcg gcc atc
tgc cac gat ctg gac cat ccc ggc tac aac 973 Leu Met Thr Ala Ala Ile
Cys His Asp Leu Asp His Pro Gly Tyr Asn 285 290 295 300 aac acg tac
cag atc aat gcc cgc aca gag ctg gcg gtc cgc tac aat 1021 Asn Thr
Tyr Gln Ile Asn Ala Arg Thr Glu Leu Ala Val Arg Tyr Asn 305 310 315
gac atc tca ccg ctg gag aac cac cac tgc gcc gtg gcc ttc cag atc
1069 Asp Ile Ser Pro Leu Glu Asn His His Cys Ala Val Ala Phe Gln
Ile 320 325 330 ctc gcc gag cct gag tgc aac atc ttc tcc aac atc cca
cct gat ggg 1117 Leu Ala Glu Pro Glu Cys Asn Ile Phe Ser Asn Ile
Pro Pro Asp Gly 335 340 345 ttc aag cag atc cga cag gga atg atc aca
tta atc ttg gcc act gac 1165 Phe Lys Gln Ile Arg Gln Gly Met Ile
Thr Leu Ile Leu Ala Thr Asp 350 355 360 atg gca aga cat gca gaa att
atg gat tct ttc aaa gag aaa atg gag 1213 Met Ala Arg His Ala Glu
Ile Met Asp Ser Phe Lys Glu Lys Met Glu 365 370 375 380 aat ttt gac
tac agc aac gag gag cac atg acc ctg ctg aag atg att 1261 Asn Phe
Asp Tyr Ser Asn Glu Glu His Met Thr Leu Leu Lys Met Ile 385 390 395
ttg ata aaa tgc tgt gat atc tct aac gag gtc cgt cca atg gaa gtc
1309 Leu Ile Lys Cys Cys Asp Ile Ser Asn Glu Val Arg Pro Met Glu
Val 400 405 410 gca gag cct tgg gtg gac tgt tta tta gag gaa tat ttt
atg cag agc 1357 Ala Glu Pro Trp Val Asp Cys Leu Leu Glu Glu Tyr
Phe Met Gln Ser 415 420 425 gac cgt gag aag tca gaa ggc ctt cct gtg
gca ccg ttc atg gac cga 1405 Asp Arg Glu Lys Ser Glu Gly Leu Pro
Val Ala Pro Phe Met Asp Arg 430 435 440 gac aaa gtg acc aag gcc aca
gcc cag att ggg ttc atc aag ttt gtc 1453 Asp Lys Val Thr Lys Ala
Thr Ala Gln Ile Gly Phe Ile Lys Phe Val 445 450 455 460 ctg atc cca
atg ttt gaa aca gtg acc aag ctc ttc ccc atg gtt gag 1501 Leu Ile
Pro Met Phe Glu Thr Val Thr Lys Leu Phe Pro Met Val Glu 465 470 475
gag atc atg ctg cag cca ctt tgg gaa tcc cga gat cgc tac gag gag
1549 Glu Ile Met Leu Gln Pro Leu Trp Glu Ser Arg Asp Arg Tyr Glu
Glu 480 485 490 ctg aag cgg ata gat gac gcc atg aaa gag tta cag aag
aag act gac 1597 Leu Lys Arg Ile Asp Asp Ala Met Lys Glu Leu Gln
Lys Lys Thr Asp 495 500 505 agc ttg acg tct ggg gcc acc gag aag tcc
aga gag aga agc aga gat 1645 Ser Leu Thr Ser Gly Ala Thr Glu Lys
Ser Arg Glu Arg Ser Arg Asp 510 515 520 gtg aaa aac agt gaa gga gac
tgt gcc tgaggaaagc ggggggcgtg 1692 Val Lys Asn Ser Glu Gly Asp Cys
Ala 525 530 gctgcagttc tggacgggct ggccgagctg cgcgggatcc ttgtgcaggg
aagagctgcc 1752 ctgggcacct ggcaccacaa gaccatgttt tctaagaacc
attttgttca ctgataaaaa 1812 aaaaaaaaaa ggaattcatg atgctgtaca
gaattttatt tttaaactgt cttttaaata 1872 atatattctt atacg 1887 19 533
PRT Homo sapiens 19 Met Gly Ser Gly Ser Ser Ser Tyr Arg Pro Lys Ala
Ile Tyr Leu Asp 1 5 10 15 Ile Asp Gly Arg Ile Gln Lys Val Ile Phe
Ser Lys Tyr Cys Asn Ser 20 25 30 Ser Asp Ile Met Asp Leu Phe Cys
Ile Ala Thr Gly Leu Pro Arg Asn 35 40 45 Thr Thr Ile Ser Leu Leu
Thr Thr Asp Asp Ala Met Val Ser Ile Asp 50 55 60 Pro Thr Met Pro
Ala Asn Ser Glu Arg Thr Pro Tyr Lys Val Arg Pro 65 70 75 80 Val Ala
Ile Lys Gln Leu Ser Glu Arg Glu Glu Leu Ile Gln Ser Val 85 90 95
Leu Ala Gln Val Ala Glu Gln Phe Ser Arg Ala Phe Lys Ile Asn Glu 100
105 110 Leu Lys Ala Glu Val Ala Asn His Leu Ala Val Leu Glu Lys Arg
Val 115 120 125 Glu Leu Glu Gly Leu Lys Val Val Glu Ile Glu Lys Cys
Lys Ser Asp 130 135 140 Ile Lys Lys Met Arg Glu Glu Leu Ala Ala Arg
Ser Ser Arg Thr Asn 145 150 155 160 Cys Pro Cys Lys Tyr Ser Phe Leu
Asp Asn His Lys Lys Leu Thr Pro 165 170 175 Arg Arg Asp Val Pro Thr
Tyr Pro Lys Tyr Leu Leu Ser Pro Glu Thr 180 185 190 Ile Glu Ala Leu
Arg Lys Pro Thr Phe Asp Val Trp Leu Trp Glu Pro 195 200 205 Asn Glu
Met Leu Ser Cys Leu Glu His Met Tyr His Asp Leu Gly Leu 210 215 220
Val Arg Asp Phe Ser Ile Asn Pro Val Thr Leu Arg Arg Trp Leu Phe 225
230 235 240 Cys Val His Asp Asn Tyr Arg Asn Asn Pro Phe His Asn Phe
Arg His 245 250 255 Cys Phe Cys Val Ala Gln Met Met Tyr Ser Met Val
Trp Leu Cys Ser 260 265 270 Leu Gln Glu Lys Phe Ser Gln Thr Asp Ile
Leu Ile Leu Met Thr Ala 275 280 285 Ala Ile Cys His Asp Leu Asp His
Pro Gly Tyr Asn Asn Thr Tyr Gln 290 295 300 Ile Asn Ala Arg Thr Glu
Leu Ala Val Arg Tyr Asn Asp Ile Ser Pro 305 310 315 320 Leu Glu Asn
His His Cys Ala Val Ala Phe Gln Ile Leu Ala Glu Pro 325 330 335 Glu
Cys Asn Ile Phe Ser Asn Ile Pro Pro Asp Gly Phe Lys Gln Ile 340 345
350 Arg Gln Gly Met Ile Thr Leu Ile Leu Ala Thr Asp Met Ala Arg His
355 360 365 Ala Glu Ile Met Asp Ser Phe Lys Glu Lys Met Glu Asn Phe
Asp Tyr 370 375 380 Ser Asn Glu Glu His Met Thr Leu Leu Lys Met Ile
Leu Ile Lys Cys 385 390 395 400 Cys Asp Ile Ser Asn Glu Val Arg Pro
Met Glu Val Ala Glu Pro Trp 405 410 415 Val Asp Cys Leu Leu Glu Glu
Tyr Phe Met Gln Ser Asp Arg Glu Lys 420 425 430 Ser Glu Gly Leu Pro
Val Ala Pro Phe Met Asp Arg Asp Lys Val Thr 435 440 445 Lys Ala Thr
Ala Gln Ile Gly Phe Ile Lys Phe Val Leu Ile Pro Met 450 455 460 Phe
Glu Thr Val Thr Lys Leu Phe Pro Met Val Glu Glu Ile Met Leu 465 470
475 480 Gln Pro Leu Trp Glu Ser Arg Asp Arg Tyr Glu Glu Leu Lys Arg
Ile 485 490 495 Asp Asp Ala Met Lys Glu Leu Gln Lys Lys Thr Asp Ser
Leu Thr Ser 500 505 510 Gly Ala Thr Glu Lys Ser Arg Glu Arg Ser Arg
Asp Val Lys Asn Ser 515 520 525 Glu Gly Asp Cys Ala 530 20 1967 DNA
Homo sapiens CDS (2)..(1741) 20 c tac ctg gac atc gat gga cgc att
cag aag gta atc ttc agc aag tac 49 Tyr Leu Asp Ile Asp Gly Arg Ile
Gln Lys Val Ile Phe Ser Lys Tyr 1 5 10 15 tgc aac tcc agc gac atc
atg gac ctg ttc tgc atc gcc acc ggc ctg 97 Cys Asn Ser Ser Asp Ile
Met Asp Leu Phe Cys Ile Ala Thr Gly Leu 20 25 30 cct cgg aac acg
acc atc tcc ctg ctg acc acc gac gac gcc atg gtc 145 Pro Arg Asn Thr
Thr Ile Ser Leu Leu Thr Thr Asp Asp Ala Met Val 35 40 45 tcc atc
gac ccc acc atg ccc gcg aat tca gaa cgc act ccg tac aaa 193 Ser Ile
Asp Pro Thr Met Pro Ala Asn Ser Glu Arg Thr Pro Tyr Lys 50 55 60
gtg aga cct gtg gcc atc aag caa ctc tcc gct gat gtc gag gac aag 241
Val Arg Pro Val Ala Ile Lys Gln Leu Ser Ala Asp Val Glu Asp Lys 65
70 75 80 aga acc aca agc cgt ggc cag tct gct gag aga cca ctg agg
gac aga 289 Arg Thr Thr Ser Arg Gly Gln Ser Ala Glu Arg Pro Leu Arg
Asp Arg 85 90 95 cgg gtt gtg ggc ctg gag cag ccc cgg agg gaa gga
gca ttt gaa agt 337 Arg Val Val Gly Leu Glu Gln Pro Arg Arg Glu Gly
Ala Phe Glu Ser 100 105 110 gga cag gta gag ccc agg ccc aga gag ccc
cag ggc tgc tac cag gaa 385 Gly Gln Val Glu Pro Arg Pro Arg Glu Pro
Gln Gly Cys Tyr Gln Glu 115 120 125 ggc cag cgc atc cct cca gag aga
gaa gaa tta atc cag agc gtg ctg 433 Gly Gln Arg Ile Pro Pro Glu Arg
Glu Glu Leu Ile Gln Ser Val Leu 130 135 140 gcg cag gtt gca gag cag
ttc tca aga gca ttc aaa atc aat gaa ctg 481 Ala Gln Val Ala Glu Gln
Phe Ser Arg Ala Phe Lys Ile Asn Glu Leu 145 150 155 160 aaa gct gaa
gtt gca aat cac ttg gct gtc cta gag aaa cgc gtg gaa 529 Lys Ala Glu
Val Ala Asn His Leu Ala Val Leu Glu Lys Arg Val Glu 165 170 175 ttg
gaa gga cta
aaa gtg gtg gag att gag aaa tgc aag agt gac att 577 Leu Glu Gly Leu
Lys Val Val Glu Ile Glu Lys Cys Lys Ser Asp Ile 180 185 190 aag aag
atg agg gag gag ctg gcg gcc aga agc agc agg acc aac tgc 625 Lys Lys
Met Arg Glu Glu Leu Ala Ala Arg Ser Ser Arg Thr Asn Cys 195 200 205
ccc tgt aag tac agt ttt ttg gat aac cac aag aag ttg act cct cga 673
Pro Cys Lys Tyr Ser Phe Leu Asp Asn His Lys Lys Leu Thr Pro Arg 210
215 220 cgc gat gtt ccc act tac ccc aag tac ctg ctc tct cca gag acc
atc 721 Arg Asp Val Pro Thr Tyr Pro Lys Tyr Leu Leu Ser Pro Glu Thr
Ile 225 230 235 240 gag gcc ctg cgg aag ccg acc ttt gac gtc tgg ctt
tgg gag ccc aat 769 Glu Ala Leu Arg Lys Pro Thr Phe Asp Val Trp Leu
Trp Glu Pro Asn 245 250 255 gag atg ctg agc tgc ctg gag cac atg tac
cac gac ctc ggg ctg gtc 817 Glu Met Leu Ser Cys Leu Glu His Met Tyr
His Asp Leu Gly Leu Val 260 265 270 agg gac ttc agc atc aac cct gtc
acc ctc agg agg tgg ctg ttc tgc 865 Arg Asp Phe Ser Ile Asn Pro Val
Thr Leu Arg Arg Trp Leu Phe Cys 275 280 285 gtc cac gac aac tac aga
aac aac ccc ttc cac aac ttc cgg cac tgc 913 Val His Asp Asn Tyr Arg
Asn Asn Pro Phe His Asn Phe Arg His Cys 290 295 300 ttc tgc gtg gcc
cag atg atg tac agc atg gtc tgg ctc tgc agt ctc 961 Phe Cys Val Ala
Gln Met Met Tyr Ser Met Val Trp Leu Cys Ser Leu 305 310 315 320 cag
gag aag ttc tca caa acg gat atc ctg atc cta atg aca gcg gcc 1009
Gln Glu Lys Phe Ser Gln Thr Asp Ile Leu Ile Leu Met Thr Ala Ala 325
330 335 atc tgc cac gat ctg gac cat ccc ggc tac aac aac acg tac cag
atc 1057 Ile Cys His Asp Leu Asp His Pro Gly Tyr Asn Asn Thr Tyr
Gln Ile 340 345 350 aat gcc cgc aca gag ctg gcg gtc cgc tac aat gac
atc tca ccg ctg 1105 Asn Ala Arg Thr Glu Leu Ala Val Arg Tyr Asn
Asp Ile Ser Pro Leu 355 360 365 gag aac cac cac tgc gcc gtg gcc ttc
cag atc ctc gcc gag cct gag 1153 Glu Asn His His Cys Ala Val Ala
Phe Gln Ile Leu Ala Glu Pro Glu 370 375 380 tgc aac atc ttc tcc aac
atc cca cct gat ggg ttc aag cag atc cga 1201 Cys Asn Ile Phe Ser
Asn Ile Pro Pro Asp Gly Phe Lys Gln Ile Arg 385 390 395 400 cag gga
atg atc aca tta atc ttg gcc act gac atg gca aga cat gca 1249 Gln
Gly Met Ile Thr Leu Ile Leu Ala Thr Asp Met Ala Arg His Ala 405 410
415 gaa att atg gat tct ttc aaa gag aaa atg gag aat ttt gac tac agc
1297 Glu Ile Met Asp Ser Phe Lys Glu Lys Met Glu Asn Phe Asp Tyr
Ser 420 425 430 aac gag gag cac atg acc ctg ctg aag atg att ttg ata
aaa tgc tgt 1345 Asn Glu Glu His Met Thr Leu Leu Lys Met Ile Leu
Ile Lys Cys Cys 435 440 445 gat atc tct aac gag gtc cgt cca atg gaa
gtc gca gag cct tgg gtg 1393 Asp Ile Ser Asn Glu Val Arg Pro Met
Glu Val Ala Glu Pro Trp Val 450 455 460 gac tgt tta tta gag gaa tat
ttt atg cag agc gac cgt gag aag tca 1441 Asp Cys Leu Leu Glu Glu
Tyr Phe Met Gln Ser Asp Arg Glu Lys Ser 465 470 475 480 gaa ggc ctt
cct gtg gca ccg ttc atg gac cga gac aaa gtg acc aag 1489 Glu Gly
Leu Pro Val Ala Pro Phe Met Asp Arg Asp Lys Val Thr Lys 485 490 495
gcc aca gcc cag att ggg ttc atc aag ttt gtc ctg atc cca atg ttt
1537 Ala Thr Ala Gln Ile Gly Phe Ile Lys Phe Val Leu Ile Pro Met
Phe 500 505 510 gaa aca gtg acc aag ctc ttc ccc atg gtt gag gag atc
atg ctg cag 1585 Glu Thr Val Thr Lys Leu Phe Pro Met Val Glu Glu
Ile Met Leu Gln 515 520 525 cca ctt tgg gaa tcc cga gat cgc tac gag
gag ctg aag cgg ata gat 1633 Pro Leu Trp Glu Ser Arg Asp Arg Tyr
Glu Glu Leu Lys Arg Ile Asp 530 535 540 gac gcc atg aaa gag tta cag
aag aag act gac agc ttg acg tct ggg 1681 Asp Ala Met Lys Glu Leu
Gln Lys Lys Thr Asp Ser Leu Thr Ser Gly 545 550 555 560 gcc acc gag
aag tcc aga gag aga agc aga gat gtg aaa aac agt gaa 1729 Ala Thr
Glu Lys Ser Arg Glu Arg Ser Arg Asp Val Lys Asn Ser Glu 565 570 575
gga gac tgt gcc tgaggaaagc ggggggcgtg gctgcagttc tggacgggct 1781
Gly Asp Cys Ala 580 ggccgagctg cgcgggatcc ttgtgcaggg aagagctgcc
ctgggcacct ggcaccacaa 1841 gaccatgttt tctaagaacc attttgttca
ctgatacaaa aaaaaaaaaa ggaattcatg 1901 atgctgtaca gaattttatt
tttaaactgt cttttaaata atatattctt atacggaaaa 1961 aaaaaa 1967 21 580
PRT Homo sapiens 21 Tyr Leu Asp Ile Asp Gly Arg Ile Gln Lys Val Ile
Phe Ser Lys Tyr 1 5 10 15 Cys Asn Ser Ser Asp Ile Met Asp Leu Phe
Cys Ile Ala Thr Gly Leu 20 25 30 Pro Arg Asn Thr Thr Ile Ser Leu
Leu Thr Thr Asp Asp Ala Met Val 35 40 45 Ser Ile Asp Pro Thr Met
Pro Ala Asn Ser Glu Arg Thr Pro Tyr Lys 50 55 60 Val Arg Pro Val
Ala Ile Lys Gln Leu Ser Ala Asp Val Glu Asp Lys 65 70 75 80 Arg Thr
Thr Ser Arg Gly Gln Ser Ala Glu Arg Pro Leu Arg Asp Arg 85 90 95
Arg Val Val Gly Leu Glu Gln Pro Arg Arg Glu Gly Ala Phe Glu Ser 100
105 110 Gly Gln Val Glu Pro Arg Pro Arg Glu Pro Gln Gly Cys Tyr Gln
Glu 115 120 125 Gly Gln Arg Ile Pro Pro Glu Arg Glu Glu Leu Ile Gln
Ser Val Leu 130 135 140 Ala Gln Val Ala Glu Gln Phe Ser Arg Ala Phe
Lys Ile Asn Glu Leu 145 150 155 160 Lys Ala Glu Val Ala Asn His Leu
Ala Val Leu Glu Lys Arg Val Glu 165 170 175 Leu Glu Gly Leu Lys Val
Val Glu Ile Glu Lys Cys Lys Ser Asp Ile 180 185 190 Lys Lys Met Arg
Glu Glu Leu Ala Ala Arg Ser Ser Arg Thr Asn Cys 195 200 205 Pro Cys
Lys Tyr Ser Phe Leu Asp Asn His Lys Lys Leu Thr Pro Arg 210 215 220
Arg Asp Val Pro Thr Tyr Pro Lys Tyr Leu Leu Ser Pro Glu Thr Ile 225
230 235 240 Glu Ala Leu Arg Lys Pro Thr Phe Asp Val Trp Leu Trp Glu
Pro Asn 245 250 255 Glu Met Leu Ser Cys Leu Glu His Met Tyr His Asp
Leu Gly Leu Val 260 265 270 Arg Asp Phe Ser Ile Asn Pro Val Thr Leu
Arg Arg Trp Leu Phe Cys 275 280 285 Val His Asp Asn Tyr Arg Asn Asn
Pro Phe His Asn Phe Arg His Cys 290 295 300 Phe Cys Val Ala Gln Met
Met Tyr Ser Met Val Trp Leu Cys Ser Leu 305 310 315 320 Gln Glu Lys
Phe Ser Gln Thr Asp Ile Leu Ile Leu Met Thr Ala Ala 325 330 335 Ile
Cys His Asp Leu Asp His Pro Gly Tyr Asn Asn Thr Tyr Gln Ile 340 345
350 Asn Ala Arg Thr Glu Leu Ala Val Arg Tyr Asn Asp Ile Ser Pro Leu
355 360 365 Glu Asn His His Cys Ala Val Ala Phe Gln Ile Leu Ala Glu
Pro Glu 370 375 380 Cys Asn Ile Phe Ser Asn Ile Pro Pro Asp Gly Phe
Lys Gln Ile Arg 385 390 395 400 Gln Gly Met Ile Thr Leu Ile Leu Ala
Thr Asp Met Ala Arg His Ala 405 410 415 Glu Ile Met Asp Ser Phe Lys
Glu Lys Met Glu Asn Phe Asp Tyr Ser 420 425 430 Asn Glu Glu His Met
Thr Leu Leu Lys Met Ile Leu Ile Lys Cys Cys 435 440 445 Asp Ile Ser
Asn Glu Val Arg Pro Met Glu Val Ala Glu Pro Trp Val 450 455 460 Asp
Cys Leu Leu Glu Glu Tyr Phe Met Gln Ser Asp Arg Glu Lys Ser 465 470
475 480 Glu Gly Leu Pro Val Ala Pro Phe Met Asp Arg Asp Lys Val Thr
Lys 485 490 495 Ala Thr Ala Gln Ile Gly Phe Ile Lys Phe Val Leu Ile
Pro Met Phe 500 505 510 Glu Thr Val Thr Lys Leu Phe Pro Met Val Glu
Glu Ile Met Leu Gln 515 520 525 Pro Leu Trp Glu Ser Arg Asp Arg Tyr
Glu Glu Leu Lys Arg Ile Asp 530 535 540 Asp Ala Met Lys Glu Leu Gln
Lys Lys Thr Asp Ser Leu Thr Ser Gly 545 550 555 560 Ala Thr Glu Lys
Ser Arg Glu Arg Ser Arg Asp Val Lys Asn Ser Glu 565 570 575 Gly Asp
Cys Ala 580 22 1457 DNA Homo sapiens CDS (164)..(1453) 22
ggctcccggg cgtcccgggc ccggtggcgg cgcggctgtg gttggctgag cgccgcgggc
60 cgccccccgc ccgccccctc ccctgctccc ctcccccgcc tcccgcggcg
gctggcgtcg 120 ggaaagtaca gtaaaaagtc cgagtgcagc cgccgggcgc agg atg
gga tcc ggc 175 Met Gly Ser Gly 1 tcc tcc agc tac cgg ccc aag gcc
atc tac ctg gac atc gat gga cgc 223 Ser Ser Ser Tyr Arg Pro Lys Ala
Ile Tyr Leu Asp Ile Asp Gly Arg 5 10 15 20 att cag aag gta atc ttc
agc aag tac tgc aac tcc agc gac atc atg 271 Ile Gln Lys Val Ile Phe
Ser Lys Tyr Cys Asn Ser Ser Asp Ile Met 25 30 35 gac ctg ttc tgc
atc gcc acc ggc ctg cct cgg aac acg acc atc tcc 319 Asp Leu Phe Cys
Ile Ala Thr Gly Leu Pro Arg Asn Thr Thr Ile Ser 40 45 50 ctg ctg
acc acc gac gac gcc atg gtc tcc atc gac ccc acc atg ccc 367 Leu Leu
Thr Thr Asp Asp Ala Met Val Ser Ile Asp Pro Thr Met Pro 55 60 65
gcg aat tca gaa cgc act ccg tac aaa gtg aga cct gtg gcc atc aag 415
Ala Asn Ser Glu Arg Thr Pro Tyr Lys Val Arg Pro Val Ala Ile Lys 70
75 80 caa ctc tcc gag aga gaa gaa tta atc cag agc gtg ctg gcg cag
gtt 463 Gln Leu Ser Glu Arg Glu Glu Leu Ile Gln Ser Val Leu Ala Gln
Val 85 90 95 100 gca gag cag ttc tca aga gca ttc aaa atc aat gaa
ctg aaa gct gaa 511 Ala Glu Gln Phe Ser Arg Ala Phe Lys Ile Asn Glu
Leu Lys Ala Glu 105 110 115 gtt gca aat cac ttg gct gtc cta gag aaa
cgc gtg gaa ttg gaa gga 559 Val Ala Asn His Leu Ala Val Leu Glu Lys
Arg Val Glu Leu Glu Gly 120 125 130 cta aaa gtg gtg gag att gag aaa
tgc aag agt gac att aag aag atg 607 Leu Lys Val Val Glu Ile Glu Lys
Cys Lys Ser Asp Ile Lys Lys Met 135 140 145 agg gag gag ctg gcg gcc
aga agc agc agg acc aac tgc ccc tgt aag 655 Arg Glu Glu Leu Ala Ala
Arg Ser Ser Arg Thr Asn Cys Pro Cys Lys 150 155 160 tac agt ttt ttg
gat aac cac aag aag ttg act cct cga cgc gat gtt 703 Tyr Ser Phe Leu
Asp Asn His Lys Lys Leu Thr Pro Arg Arg Asp Val 165 170 175 180 ccc
act tac ccc aag tac ctg ctc tct cca gag acc atc gag gcc ctg 751 Pro
Thr Tyr Pro Lys Tyr Leu Leu Ser Pro Glu Thr Ile Glu Ala Leu 185 190
195 cgg aag ccg acc ttt gac gtc tgg ctt tgg gag ccc aat gag atg ctg
799 Arg Lys Pro Thr Phe Asp Val Trp Leu Trp Glu Pro Asn Glu Met Leu
200 205 210 agc tgc ctg gag cac atg tac cac gac ctc ggg ctg gtc agg
gac ttc 847 Ser Cys Leu Glu His Met Tyr His Asp Leu Gly Leu Val Arg
Asp Phe 215 220 225 agc atc aac cct gtc acc ctc agg agg tgg ctg ttc
tgc gtc cac gac 895 Ser Ile Asn Pro Val Thr Leu Arg Arg Trp Leu Phe
Cys Val His Asp 230 235 240 aac tac aga aac aac ccc ttc cac aac ttc
cgg cac tgc ttc tgc gtg 943 Asn Tyr Arg Asn Asn Pro Phe His Asn Phe
Arg His Cys Phe Cys Val 245 250 255 260 gcc cag atg atg tac agc atg
gtc tgg ctc tgc agt ctc cag gag aag 991 Ala Gln Met Met Tyr Ser Met
Val Trp Leu Cys Ser Leu Gln Glu Lys 265 270 275 ttc tca caa acg gat
atc ctg atc cta atg aca gcg gcc atc tgc cac 1039 Phe Ser Gln Thr
Asp Ile Leu Ile Leu Met Thr Ala Ala Ile Cys His 280 285 290 gat ctg
gac cat ccc ggc tac aac aac acg tac cag atc aat gcc cgc 1087 Asp
Leu Asp His Pro Gly Tyr Asn Asn Thr Tyr Gln Ile Asn Ala Arg 295 300
305 aca gag ctg gcg gtc cgc tac aat gac atc tca ccg ctg gag aac cac
1135 Thr Glu Leu Ala Val Arg Tyr Asn Asp Ile Ser Pro Leu Glu Asn
His 310 315 320 cac tgc gcc gtg gcc ttc cag atc ctc gcc gag cct gag
tgc aac atc 1183 His Cys Ala Val Ala Phe Gln Ile Leu Ala Glu Pro
Glu Cys Asn Ile 325 330 335 340 ttc tcc aac atc cca cct gat ggg ttc
aag cag atc cga cag gga atg 1231 Phe Ser Asn Ile Pro Pro Asp Gly
Phe Lys Gln Ile Arg Gln Gly Met 345 350 355 atc aca tta atc ttg gcc
act gac atg gca aga cat gca gaa att atg 1279 Ile Thr Leu Ile Leu
Ala Thr Asp Met Ala Arg His Ala Glu Ile Met 360 365 370 gat tct ttc
aaa gag aaa atg gag aat ttt gac tac agc aac gag gag 1327 Asp Ser
Phe Lys Glu Lys Met Glu Asn Phe Asp Tyr Ser Asn Glu Glu 375 380 385
cac atg acc ctg ctg aag atg att ttg ata aaa tgc tgt gat atc tct
1375 His Met Thr Leu Leu Lys Met Ile Leu Ile Lys Cys Cys Asp Ile
Ser 390 395 400 aac gag gtc cgt cca atg gaa gtc gca gag cct tgg gtg
gac tgt tta 1423 Asn Glu Val Arg Pro Met Glu Val Ala Glu Pro Trp
Val Asp Cys Leu 405 410 415 420 tta gag gaa tat ttt atg cag agc gac
cgt gaga 1457 Leu Glu Glu Tyr Phe Met Gln Ser Asp Arg 425 430 23
430 PRT Homo sapiens 23 Met Gly Ser Gly Ser Ser Ser Tyr Arg Pro Lys
Ala Ile Tyr Leu Asp 1 5 10 15 Ile Asp Gly Arg Ile Gln Lys Val Ile
Phe Ser Lys Tyr Cys Asn Ser 20 25 30 Ser Asp Ile Met Asp Leu Phe
Cys Ile Ala Thr Gly Leu Pro Arg Asn 35 40 45 Thr Thr Ile Ser Leu
Leu Thr Thr Asp Asp Ala Met Val Ser Ile Asp 50 55 60 Pro Thr Met
Pro Ala Asn Ser Glu Arg Thr Pro Tyr Lys Val Arg Pro 65 70 75 80 Val
Ala Ile Lys Gln Leu Ser Glu Arg Glu Glu Leu Ile Gln Ser Val 85 90
95 Leu Ala Gln Val Ala Glu Gln Phe Ser Arg Ala Phe Lys Ile Asn Glu
100 105 110 Leu Lys Ala Glu Val Ala Asn His Leu Ala Val Leu Glu Lys
Arg Val 115 120 125 Glu Leu Glu Gly Leu Lys Val Val Glu Ile Glu Lys
Cys Lys Ser Asp 130 135 140 Ile Lys Lys Met Arg Glu Glu Leu Ala Ala
Arg Ser Ser Arg Thr Asn 145 150 155 160 Cys Pro Cys Lys Tyr Ser Phe
Leu Asp Asn His Lys Lys Leu Thr Pro 165 170 175 Arg Arg Asp Val Pro
Thr Tyr Pro Lys Tyr Leu Leu Ser Pro Glu Thr 180 185 190 Ile Glu Ala
Leu Arg Lys Pro Thr Phe Asp Val Trp Leu Trp Glu Pro 195 200 205 Asn
Glu Met Leu Ser Cys Leu Glu His Met Tyr His Asp Leu Gly Leu 210 215
220 Val Arg Asp Phe Ser Ile Asn Pro Val Thr Leu Arg Arg Trp Leu Phe
225 230 235 240 Cys Val His Asp Asn Tyr Arg Asn Asn Pro Phe His Asn
Phe Arg His 245 250 255 Cys Phe Cys Val Ala Gln Met Met Tyr Ser Met
Val Trp Leu Cys Ser 260 265 270 Leu Gln Glu Lys Phe Ser Gln Thr Asp
Ile Leu Ile Leu Met Thr Ala 275 280 285 Ala Ile Cys His Asp Leu Asp
His Pro Gly Tyr Asn Asn Thr Tyr Gln 290 295 300 Ile Asn Ala Arg Thr
Glu Leu Ala Val Arg Tyr Asn Asp Ile Ser Pro 305 310 315 320 Leu Glu
Asn His His Cys Ala Val Ala Phe Gln Ile Leu Ala Glu Pro 325 330 335
Glu Cys Asn Ile Phe Ser Asn Ile Pro Pro Asp Gly Phe Lys Gln Ile 340
345 350 Arg Gln Gly Met Ile Thr Leu Ile Leu Ala Thr Asp Met Ala Arg
His 355 360 365 Ala Glu Ile Met Asp Ser Phe Lys Glu Lys Met Glu Asn
Phe Asp Tyr 370 375 380 Ser Asn Glu Glu His Met Thr Leu Leu Lys Met
Ile Leu Ile Lys Cys 385 390 395 400 Cys Asp Ile Ser Asn Glu Val Arg
Pro Met Glu Val Ala Glu Pro Trp 405 410 415 Val Asp Cys Leu Leu Glu
Glu Tyr Phe Met Gln Ser Asp Arg
420 425 430 24 8 PRT Artificial Sequence Description of Artificial
Sequence FLAG epitope 24 Asp Thr Lys Asp Asp Asp Asp Lys 1 5 25 54
DNA Artificial Sequence Description of Artificial Sequence primer
25 tagaccatgg actacaagga cgacgatgac aagatggacg cattcagaag cact 54
26 18 DNA Artificial Sequence Description of Artificial Sequence
primer 26 cgaggagtca acttcttg 18
* * * * *