U.S. patent application number 10/925734 was filed with the patent office on 2005-01-13 for high efficiency encapsulation of charged therapeutic agents in lipid vesicles.
This patent application is currently assigned to Inex Pharmaceuticals Corporation. Invention is credited to Ansell, Steven M., Cullis, Pieter, Debeyer, Dan, Harasym, Troy, Hope, Michael J., Klimuk, Sandra K., Scherrer, Peter, Semple, Sean C..
Application Number | 20050008689 10/925734 |
Document ID | / |
Family ID | 25323456 |
Filed Date | 2005-01-13 |
United States Patent
Application |
20050008689 |
Kind Code |
A1 |
Semple, Sean C. ; et
al. |
January 13, 2005 |
High efficiency encapsulation of charged therapeutic agents in
lipid vesicles
Abstract
Methods for the preparation of a lipid-nucleic acid composition
are provided. According to the methods, a mixture of lipids
containing a protonatable or deprotonatable lipid, for example an
amino lipid and a lipid such as a PEG- or Polyamide
oligomer-modified lipid is combined with a buffered aqueous
solution of a charged therapeutic agent, for example polyanionic
nucleic acids, to produce particles in which the therapeutic agent
is encapsulated in a lipid vesicle. Surface charges on the lipid
particles are at least partially neutralized to provide
surface-neutralized lipid-encapsulated compositions of the
therapeutic agents. The method permits the preparation of
compositions with high ratios of therapeutic agent to lipid and
with encapsulation efficiencies in excess of 50%.
Inventors: |
Semple, Sean C.; (Vancouver,
CA) ; Klimuk, Sandra K.; (North Vancouver, CA)
; Harasym, Troy; (Vancouver, CA) ; Hope, Michael
J.; (Vancouver, CA) ; Ansell, Steven M.;
(Vancouver, CA) ; Cullis, Pieter; (Vancouver,
CA) ; Scherrer, Peter; (Vancouver, CA) ;
Debeyer, Dan; (Vancouver, CA) |
Correspondence
Address: |
Todd A. Lorenz
Dorsey & Whitney LLP
Intellectual Property Department
Four Embarcadero Center, Suite 3400
San Francisco
CA
94111-4187
US
|
Assignee: |
Inex Pharmaceuticals
Corporation
|
Family ID: |
25323456 |
Appl. No.: |
10/925734 |
Filed: |
August 24, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10925734 |
Aug 24, 2004 |
|
|
|
09895480 |
Jun 29, 2001 |
|
|
|
09895480 |
Jun 29, 2001 |
|
|
|
09078954 |
May 14, 1998 |
|
|
|
6287591 |
|
|
|
|
09078954 |
May 14, 1998 |
|
|
|
08856374 |
May 14, 1997 |
|
|
|
Current U.S.
Class: |
424/450 ;
435/458; 514/44A |
Current CPC
Class: |
A61K 9/1272 20130101;
A61P 35/00 20180101; A61P 43/00 20180101; A61K 9/1277 20130101;
A61P 29/00 20180101; A61P 31/00 20180101; Y10T 428/2984
20150115 |
Class at
Publication: |
424/450 ;
435/458; 514/044 |
International
Class: |
A61K 048/00; A61K
009/127; C12N 015/88 |
Claims
What is claimed is:
1. A method for preparation of a composition comprising
lipid-encapsulated therapeutic agent particles, said method
comprising the steps of: (a) combining a mixture of lipids
comprising at least a first lipid component and a second lipid
component with a buffered aqueous solution of a charged therapeutic
agent to form an intermediate mixture containing lipid-encapsulated
therapeutic agent particles, said first lipid component being
selected from among lipids containing a protonatable or
deprotonatable group that has a pKa such that the lipid is in a
charged form at a first pH and a neutral form at a second pH, said
buffered solution having a pH such that the first lipid component
is in its charged form when in the buffered solution, said first
lipid component being further selected such that the charged form
is cationic when the charged therapeutic agent is anionic in the
buffered solution, and anionic when the charged therapeutic agent
is cationic in the buffered solution, and said second lipid
component being selected from among lipids that prevent particle
aggregation during lipid-therapeutic agent particle formation, and
(b) changing the pH of the intermediate mixture to neutralize at
least some exterior surface charges on said lipid-encapsulated
therapeutic agent particles to provide at least partially-surface
neutralized lipid-encapsulated therapeutic agent particles.
2. The method of claim 1, wherein the therapeutic agent is a
polyanionic nucleic acid.
3. The method of claim 2, wherein said composition consists
essentially of lipid-nucleic acid particles, said particles having
a size of from 70 nm to about 200 nm.
4. The method of claim 2, wherein said mixture of lipids in step
(a) is a mixture of lipids in alcohol.
5. The method of claim 2, wherein the first lipid component is an
amino lipid.
6. The method of claim 2, wherein the second lipid component is a
polyethylene glycol-modified or polyamide oligomer-modified
lipid.
7. The method of claim 6, wherein the second lipid component is a
PEG-Ceramide.
8. The method of claim 6, wherein the first lipid component is an
amino lipid.
9. The method of claim 2, wherein said lipids present in said lipid
mixture comprises an amino lipid having a pKa of from about 5 to
about 11, a neutral lipid, Chol and a PEG-modified or polyamide
oligomer-modified lipid.
10. The method of claim 9, wherein said lipids are present in molar
percents of about 25-45% neutral lipid, 35-55% Chol, 10-40% amino
lipid and 0.5-15% PEG-modified or polyamide oligomer-modified
lipid.
11. The method of claim 2, wherein said mixture of lipids comprises
DODAP, DSPC, Chol and PEG-CerC14.
12. The method of claim 11, wherein said lipids are present in
molar percents of about 25-45% DSPC, 35-55% Chol, 10-40% DODAP and
0.5-15% PEG-CerC14.
13. The method of claim 2, wherein said mixture of lipids comprises
DODAP, POPC, Chol and PEG-CerC14.
14. The method of claim 2, wherein said mixture of lipids comprises
DODAP, SM, Chol and PEG-CerC 14.
15. The method of claim 2, wherein said nucleic acid is an
antisense nucleic acid.
16. The method of claim 15, wherein said antisense nucleic acid
contains linkages selected from the group consisting of
phosphodiester, phosphorothioate, phosphorodithioate,
boranophosphate, phosphoroselenate and amidate linkages.
17. The method of claim 2, wherein said nucleic acid contains
exclusively phosphodiester linkages.
18. The method of claim 17, wherein said nucleic acid is an
antisense nucleic acid.
19. The method of claim 17, wherein the buffered solution comprises
10 to 50 mM citrate or phosphate buffer.
20. The method of claim 2, wherein the nucleic acid contains at
least some phosphorothioate or phosphorodithioate linkages.
21. The method of claim 20, wherein the buffered solution comprises
10 to 300 mM citrate or phosphate buffer.
22. The method of claim 2, wherein said nucleic acid is a
ribozyme.
23. The method of claim 1, wherein said composition consists
essentially of lipid-nucleic acid particles, said particles having
a size of from 70 nm to about 200 nm.
24. The method of claim 1, wherein said mixture of lipids in step
(a) is a mixture of lipids in alcohol.
25. The method of claim 1, wherein the first lipid component is an
amino lipid.
26. The method of claim 1, wherein the second lipid component is a
polyethylene glycol-modified or polyamide oligomer-modified
lipid.
27. The method of claim 26, wherein the second lipid component is a
PEG-Ceramide.
28. The method of claim 26, wherein the first lipid component is an
amino lipid.
29. The method of claim 1, wherein said lipids present in said
lipid mixture comprises an amino lipid having a pKa of from about 5
to about 11, a neutral lipid, Chol and a PEG-modified or Polyamide
oligomer-modified lipid.
30. The method of claim 29, wherein said lipids are present in
molar percents of about 25-45% neutral lipid, 35-55% Chol, 10-40%
amino lipid and 0.5-15% PEG-Ceramide.
31. The method of claim 1, wherein said mixture of lipids comprises
DODAP, DSPC, Chol and PEG-CerC14.
32. The method of claim 31, wherein said lipids are present in
molar percents of about 25-45% DSPC, 35-55% Chol, 10-40% DODAP and
0.5-15% PEG-CerC14.
33. The method of claim 1, wherein said mixture of lipids comprises
DODAP, POPC, Chol and PEG-CerC14.
34. The method of claim 1, wherein said mixture of lipids comprises
DODAP, SM, Chol and PEG-CerC14.
35. The method of claim 1, wherein the pH is changed in step (b) to
physiological pH.
36. The method of claim 1, wherein the step of changing the pH is
performed using tangential flow dialysis.
37. A composition comprising lipid-therapeutic agent particles
comprising a lipid portion and a charged therapeutic agent, said
charged therapeutic agent being encapsulated in said lipid portion,
wherein said lipid portion comprises at least a first lipid
component and a second lipid component, said first lipid component
being selected from among lipids containing a protonatable or
deprotonatable group that has a pKa such that the lipid is in a
charged form at a first pH and a neutral form at a second pH, and
said first lipid component being further selected such that the
charged form is cationic when the therapeutic agent is anionic and
anionic when the therapeutic agent is cationic, and said second
lipid component being selected from among lipids that prevent
particle aggregation during lipid-nucleic acid particle formation
and which exchange out of the lipid particle at a rate greater than
PEG-CerC20.
38. The composition according to claim 37, wherein at least some of
the protonatable or deprotonatable groups disposed on the exterior
surface of the particles have been neutralized.
39. The composition according to claim 38, wherein the therapeutic
agent is anionic.
40. The composition according to claim 39, wherein the therapeutic
agent is a polyanionic nucleic acid.
41. The composition according to claim 40, wherein the nucleic acid
is an antisense nucleic acid.
42. The composition according to claim 40, wherein at least 50% of
the nucleic acid in the composition is encapsulated within the
particle.
43. The composition of claim 40, wherein at least 90% of the
nucleic acid in the composition is encapsulated within the
particle.
44. The composition of claim 40, wherein the nucleic acid has
exclusively phosphodiester linkages.
45. The composition of according to claim 39, wherein the first
lipid component is an amino lipid.
46. The composition of claim 45, wherein the second lipid component
is a polyethylene glycol-modified or polyamide oligomer-modified
lipid.
47. The composition of claim 39, wherein the second lipid component
is a polyethylene glycol-modified or polyamide oligomer-modified
lipid.
48. A composition comprising lipid-therapeutic agent particles
comprising a lipid portion and a charged therapeutic agent, said
charged therapeutic agent being encapsulated in said lipid portion,
wherein said lipid portion comprises at least a first lipid
component and a second lipid component, said first lipid component
being selected from among lipids containing a protonatable or
deprotonatable group that has a pKa such that the lipid is in a
charged form at a first pH and a neutral form at a second pH, and
said first lipid component being further selected such that the
charged form is cationic when the therapeutic agent is anionic and
anionic when the therapeutic agent is cationic, and said second
lipid component being selected from among lipids that prevent
particle aggregation during lipid-nucleic acid particle formation,
said particles having a nucleic acid/lipid ratio of at least 10% by
weight and a size of from about 70 to about 200 nm.
49. The composition according to claim 48, wherein at least some of
the protonatable or deprotonatable groups disposed on the exterior
surface of the particles have been neutralized.
50. The composition according to claim 49, wherein the therapeutic
agent is anionic.
51. The composition according to claim 50, wherein the therapeutic
agent is a polyanionic nucleic acid.
52. The composition according to claim 51, wherein the nucleic acid
is an antisense nucleic acid.
53. The composition according to claim 50, wherein the nucleic acid
has exclusively phosphodiester linkages.
54. The composition of according to claim 53, wherein the first
lipid component is an amino lipid.
55. The composition of claim 54, wherein the second lipid component
is a polyethylene glycol-modified lipid.
56. The composition of claim 53, wherein the second lipid component
is a polyethylene glycol-modified lipid.
57. The composition of claim 53, wherein the lipid portion
comprises a neutral lipid, an amino lipid, cholesterol and
PEG-modified or polyamide oligomer-modified lipid, and wherein said
lipids are present at molar percents of about 25-45% neutral lipid,
35-55% cholesterol, 10-40% amino lipid and 0.5-15% PEG-modified or
Polyamide oligomer-modified lipid.
58. The composition of claim 53, wherein said lipid portion
comprises DODAP, DSPC, Chol and PEG-CerC14.
59. The composition of claim 58, wherein the lipids are present in
molar percents of about 25-45% DSPC, 35-55% Chol, 10-40% DODAP and
0.5-15% PEG-CerC14.
60. The composition of claim 53, wherein said lipid portion
comprises DODAP, POPC, Chol and PEG-CerC14.
61. The composition of claim 53, wherein said lipid comprises of
DODAP, SM, Chol and PEG-CerC14.
62. The composition according to claim 51, wherein at least
.sup.50% of the nucleic acid in the composition is encapsulated
within the particle.
63. The composition of claim 51, wherein at least 90% of the
nucleic acid in the composition is encapsulated within the
particle.
64. The composition of claim 51, wherein said nucleic acid is a
ribozyme.
65. The composition of according to claim 48, wherein the first
lipid component is an amino lipid.
66. The composition of claim 65, wherein the second lipid component
is a polyethylene glycol-modified or polyamide oligomer-modified
lipid.
67. The composition of claim 48, wherein the second lipid component
is a polyethylene glycol-modified. or polyamide oligomer-modified
lipid.
68. A composition in accordance with claim 48, wherein the lipid
portion comprises a neutral lipid, an amino lipid, cholesterol and
a PEG-modified or polyamide oligomer-modified lipid, and wherein
said lipids are present at molar percents of about 25-45% neutral
lipid, 35-55% cholesterol, 10-40% amino lipid and 0.5-15%
PEG-modified or polyamide oligomer-modified lipid.
69. A method for introducing a nucleic acid into a cell, comprising
contacting a cell with a lipid-nucleic acid composition prepared
according to claim 2 for a period of time sufficient to introduce
the nucleic acid into said cell.
70. A method for the treatment or prevention of a disease
characterized by aberrant expression of a gene in a mammalian
subject comprising, preparing a lipid-encapsulated therapeutic
nucleic acid particle according to the method of claim 2, wherein
the therapeutic nucleic acid component hybridizes specifically with
the aberrantly expressed gene; and administering a therapeutically
effective or prophylactic amount of the particle to the mammalian
subject, whereby expression of the aberrantly expressed gene is
reduced.
71. The method of claim 70, wherein the genesis selected from among
ICAM-1, c-myc, c-myb, ras, raf, erb-B-2, PKC-alpha, IGF-1R, EGFR,
VEGF and VEGF-R-1.
72. The method of claim 70, wherein the disease is a tumor.
73. The method of claim 70, wherein the disease is characterized by
inflammation.
74. The method of claim 70, wherein the disease is an infectious
disease.
75. The method of claim 70, wherein the therapeutically effective
amount of the particle is administered to the mammalian subject by
intravenous injection.
76. The method of claim 75, wherein the therapeutically effective
amount of the particle is administered to the mammalian subject by
intravenous injection at an injection site, and wherein the disease
is localized at a disease site distal to the injection site.
77. The method of claim 70, wherein the nucleic acid comprises
exclusively phosphodiester linkages.
78. A method of preventing expression of a disease-associated gene
in a mammalian cell comprising, preparing a lipid-therapeutic
oligonucleotide particle according to claim 2 containing an
antisense therapeutic agent; and exposing the mammalian cell to the
lipid-therapeutic oligonucleotide particle for a period of time
sufficient for the therapeutic oligonucleotide component to enter
the cell; wherein the antisense therapeutic agent has a sequence
complementary to the disease-associated gene and reduces the
production of the gene product of the disease-associated gene in
the cell.
79. A pharmaceutical composition comprising lipid-therapeutic agent
particles prepared according to claim 1 and a pharmaceutically
acceptable carrier.
80. The pharmaceutical composition according to claim 79, wherein
the therapeutic agent is a polyanionic nucleic acid.
81. The pharmaceutical composition according to claim 80, wherein
the nucleic acid is an antisense nucleic acid.
82. A method for treatment or prevention of a disease characterized
by aberrant expression of a gene in a mammalian subject comprising,
administering to mammalian subject a composition comprising
lipid-encapsulated nucleic acid particles, wherein the
lipid-encapsulated nucleic acid particles contain at least 10% by
weight of nucleic acids and the nucleic acids have exclusively
phosphodiester linkages.
83. A composition comprising lipid-encapsulated nucleic acid
particles, wherein the lipid- encapsulated nucleic acid particles
contain at least 10% by weight of nucleic acids and the nucleic
acids have exclusively phosphodiester linkages.
Description
[0001] This application is a continuation-in-part of co-pending
U.S. patent application Ser. No. 08/856,374 filed May 14, 1997,
which is incorporated herein by reference.
FIELD OF THE INVENTION
[0002] This invention relates to compositions comprising a
combination of a lipid and a therapeutic agent, particularly to
lipid-nucleic acid compositions, for in vivo therapeutic use. In
these compositions the therapeutic agent is encapsulated and
protected from degradation and clearance in serum. Additionally,
the invention provides methods of making the compositions, as well
as methods of introducing the nucleic acids into cells using the
compositions and treating disease conditions.
BACKGROUND OF THE INVENTION
[0003] Therapeutic oligonucleotides, such as antisense
oligonucleotides or ribozymes, are short segments of DNA that have
been designed to hybridize to a sequence on a specific RNA. The
resulting complex can down-regulate protein production by several
mechanisms, including inhibition of mRNA translation into protein
and/or by enhancement of RNase H degradation of the mRNA
transcripts. Consequently, therapeutic oligonucleotides have
tremendous potential for specificity of action (i.e. the
down-regulation of a specific disease-related protein). To date,
these compounds have shown promise in several in vitro and in vivo
models, including models of inflammatory disease, cancer, and HIV
(reviewed in Agrawal, Trends in Biotech. 14:376-387 (1996)).
Antisense can also effect cellular activity by hybridizing
specifically with chromosomal DNA. Advanced human clinical
assessments of several antisense drugs are currently underway.
Targets for these drugs include the genes or RNA products of c-myc,
ICAM-1, and infectious disease organisms such as cytomegalovirus,
and HIV-1.
[0004] One well known problem with the use of therapeutic
oligonucleotides having a phosphodiester internucleotide linkage is
its very short half-life in the presence of serum or within cells.
(Zelphati, O et al. 1993. Inhibition of HIV-1 Replication in
Cultured Cells with Antisense Oligonucleotides Encapsulated in
Immunoliposomes. Antisense. Res. Dev. 3:323-338; and Thierry, AR et
al. pp147-161 in Gene Regulation: Biology of Antisense RNA and DNA
(Eds. Erickson, RP and Izant, JG) 1992. Raven Press, N.Y.). No
clinical assessment currently employs the basic phosphodiester
chemistry found in natural nucleic acids, because of these and
other known problems.
[0005] This problem has been partially overcome by chemical
modifications which reduce serum or intracellular degradation.
Modifications have been tested at the internucleotide
phosphodiester bridge (i.e. using phosphorothioate,
methylphosphonate or phosphoramidate linkages), at the nucleotide
base (i.e.5-propynyl-pyrimidines), or at the sugar (i.e.
2'-modified sugars) (Uhlmann E., et al. 1997. Antisense: Chemical
Modifications. Encyclopedia of Cancer Vol. X. pp 64-81
Academic-Press Inc.). Others have attempted to improve stability
using 2'-5' sugar linkages (see U.S. Pat. No. 5,532,130). Other
changes have been attempted. However, none of these solutions have
proven entirely satisfactory, and in vivo free antisense still has
only limited efficacy. Problems remain, such as in the limited
ability of some antisense to cross cellular membranes (see,
Viassov, et al., Biochim. Biophys. Acta 1197:95-1082 (1994)) and in
the problems associated with systemic toxicity, such as
complement-mediated anaphylaxis, altered coagulatory properties,
and cytopenia (Galbraith, et al., Antisense NucL. Acid Drug Des.
4:201-206 (1994)). Further, as disclosed in U.S. patent application
Ser. No. 08/657,753 and counterpart patent application WO 97/46671,
both incorporated herein by reference, modified antisense is still
highly charged, and clearance from the circulation still takes
place within minutes.
[0006] To attempt to improve efficacy, investigators have also
employed lipid-based carrier systems to deliver chemically modified
or unmodified antisense. In Zelphati, O and Szoka, F. C. (1996) J.
Contr. Rel. 41:99-119, the authors refer to the use of anionic
(conventional) liposomes, pH sensitive liposomes, immunoliposomes,
fusogenic liposomes and cationic lipid/anti sense aggregates.
[0007] None of these compositions successfully deliver
phosphodiester antisense for in vivo therapy. In another paper,
Zelphati & Szoka note that antisense phosphodiester
oligonucleotides associated with cationic lipids have not been
active in cell culture in vitro; and that only one study has
reported the activity of phosphodiester antisense oligonucleotides
complexed to cationic lipids. The authors argue that these findings
". . . necessitate[ ] the use [of -sic] backbone-modified
oligonucleotides that are relatively resistant to both
intracellular and extracellular nucleases even if a carrier is used
to deliver the oligonucleotide into the target cell". (1997. J.
Lip. Res. 7(1):31-49 at 34). This finding is corroborated by
Bennett, CF. (1995. Intracellular Delivery of Oligonucleotides with
Cationic Liposomes. Chp 14 CRC Press) who states at p. 224 that "In
contrast, we have been unable to demonstrate inhibition of gene
expression by uniform phosphodiester oligodeoxynucleotides directed
towards a number of cellular targets in the presence of cationic
lipids."
[0008] Prior art lipid formulations of modified antisense are also
largely ineffective in vivo. They have poor encapsulation
efficiency (15% or less for passive encapsulation systems), poor
drug to lipid ratios (3% or less by weight), high susceptibility to
serum nucleases and rapid clearance from circulation (particularly
in the case of cationic lipid/antisense aggregates made from DOTMA,
trade-name LIPOFECTIN.TM.), and/or large sized particles (greater
than 100 nm), which make them unsuitable for systemic delivery to
target sites. No successful in vivo efficacy studies of
lipid-encapsulated (nuclease-resistant) modified antisense are
known in the prior art.
[0009] Two references to unique lipid-antisense compositions that
may be significantly nuclease resistant bear consideration.
Firstly, the anionic liposome (LPDII) composition of Li, S. and
Huang, L (1997. J. Lip. Res. 7(1) 63-75), which encapsulates
poly-lysine coated antisense, are said to have 60-70% encapsulation
efficiency, but suffer from a large size of around 200 nm and a low
drug to lipid ratio of 8% by weight. The effect of these particles
in vivo is unknown. Secondly, the Minimal Volume Entrapment (MVE)
technique for cardiolipin (anionic) liposomes results in the
reasonably high encapsulation efficiency of 45-65% but again the
drug:lipid.ratio remains very small, approximately 6.5% by weight
(see U.S. Pat. No. 5,665,710 to Rahman et al.; Thierry AR, and
Takle, GB. 1995, Liposomes as a Delivery System for Antisense and
Ribozyme Compounds in Delivery Strategiesfor Antisense
Oligonucleotide Therapeutics, S. Akhtar, ed, CRC Press, Boca Raton,
FL., pp. 199-221; Thierry, AR et al. pp147-161 in Gene Regulation:
Biology of Antisense RNA and DNA (Eds. Erickson, RP and Izant, JG)
1992. Raven Press, N.Y.). Note that U.S. Pat. No. 5,665,710 also
discloses encapsulation efficiencies of 60-90% for tiny, medically
useless amounts of antisense (0.1 ug), where the drug to lipid
ratio must be very low.
[0010] It is an observation of the inventors that a wide variety of
prior art lipid compositions used for conventional drugs could be
tested for efficacy in the antisense field, but the improvement
(over free antisense) for in vivo efficacy is not known. In this
regard, it is noted that although lipid compositions assertedly for
use as drug carriers were disclosed by Bailey and Cullis (U.S. Pat.
No. 5,552,155; and (1994) Biochem. 33(42):12573-12580), they did
not disclose formulations of any bioactive compounds with these
lipids, and did not suggest their utility for high efficiency
loading of polyanionic species.
[0011] What is needed in the art are improved lipid-therapeutic
oligonucleotide compositions which are suitable for therapeutic
use. Preferably these compositions would encapsulate nucleic acids
with high-efficiency, have high drug:lipid ratios, be encapsulated
and protected from degradation and clearance in serum, and/or be
suitable for systemic delivery. The present invention provides such
compositions, methods of making the compositions and methods of
introducing nucleic acids into cells using the compositions and
methods of treating diseases.
SUMMARY OF THE INVENTION
[0012] In accordance with the invention, charged therapeutic agents
are packaged into lipid-encapsulated therapeutic agent particles
using a method comprising the steps of:
[0013] (a) combining a mixture of lipids comprising at least a
first lipid component and a second lipid component with a buffered
aqueous solution of a charged therapeutic agent to form an
intermediate mixture containing lipid-encapsulated therapeutic
particles, and
[0014] (b) changing the pH of the intermediate mixture to
neutralize at least some exterior surface charges on said
lipid-nucleic acid particles to provide at least partially-surface
neutralized lipid-encapsulated therapeutic agent particles. The
first lipid component is selected from among lipids containing a
protonatable or deprotonatable group that has a pKa such that the
lipid is in a charged form at a first pH and a neutral form at a
second pH. The buffered solution has a pH such that the first lipid
component is in its charged form when in the buffered solution, and
the first lipid component is further selected such that the charged
form is cationic when the therapeutic agent is anionic in the
buffered solution and anionic when the therapeutic agent is
cationic in the buffered solution. The second lipid component being
selected from among lipids that prevent particle aggregation during
lipid-nucleic acid particle formation. The method the invention is
particularly useful for preparation of lipid-encapsulated nucleic
acids, for example antisense nucleic acids or ribozyme.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 illustrates a neutralization step which releases
surface-bound antisense from the lipid-nucleic acid compositions
according to the present invention.
[0016] FIGS. 2A and 2B illustrate certain lipid components which
are useful in the present inventive methods. FIG. 2A illustrates
several groups of amino lipids including the chemical structure of
DODAP. FIG. 2B illustrates groups of PEG-modified lipids.
[0017] FIG. 3 illustrates the influence of ethanol on the
encapsulation of antisense oligodeoxynucleotides. The liposomal
antisense compositions were prepared as described in the Examples,
with the final concentrations of antisense and lipids being 2 mg/mL
and 9.9 mg/mL, respectively. The final ethanol concentration in the
preparations was varied between 0 and 60%, vol/vol. Encapsulation
was assessed either by analyzing the pre-column and post-column
ratios of [.sup.3H]-antisense and [.sup.14C]-lipid or by
determining the total pre-column and post-column
[.sup.3H]-antisense and [.sup.14C]-lipid radioactivity.
[0018] FIG. 4 illustrates the influence of ethanol on lipid and
antisense loss during extrusion. The liposomal antisense
compositions were prepared as described for FIG. 3. The samples
were extruded ten times through three 100 nm filters as described
in "Materials and Methods". After extrusion, the filters were
analyzed for [.sup.3H]-antisense and [.sup.14C]-lipid radioactivity
by standard scintillation counting techniques. Results were
expressed as a percent of the total initial radioactivity.
[0019] FIG. 5 illustrates the influence of DODAP content on the
encapsulation of antisense oligodeoxynucleotides. A 0.6 mL aliquot
of a [.sup.3H]-phosphorothioate antisense oligodeoxynucleotide (in
300 mM citrate buffer, pH 3.80) was mixed with 0.4 mL of a 95%
ethanol solution of lipid (DSPC:CHOL:DODAP:PEG-CerC 14;
100-(55+X):45:X: 10, molar ratio) at final concentrations of2 mg/mL
and 9.9 mg/mL, respectively. The molar ratio of DODAP was varied
between 0 and 30%. The molar ratio of DSPC was adjusted to
compensate for the changes in DODAP content. Encapsulation was
assessed either by analyzing the pre-column and post-column ratios
of [.sup.3H]-antisense and [.sup.14C]-lipid or by determining the
total pre-column and post-column [.sup.3H]-antisense and
[.sup.14C]-lipid radioactivity.
[0020] FIG. 6 illustrates the influence of DODAP content on the
encapsulation of antisense oligodeoxynucleotides. Samples were
identical to those prepared in FIG. 5. In this instance, the amount
of antisense associated with the lipid was assessed by a solvent
extraction procedure as described in "Material and Methods".
Antisense was extracted into a methanol:water aqueous phase, while
the lipid was soluble in the organic (chloroform) phase. The
aqueous phase was preserved and antisense concentration was
determined by measuring the absorbance at 260 nm. This confirmed
that the antisense was associated with the lipid vesicles, and that
the [.sup.3H]-label on the antisense had not exchanged to the
lipid.
[0021] FIG. 7 illustrates the quasi-elastic light scattering
analysis of encapsulated liposomal antisense. The size distribution
of a liposomal preparation of antisense was determined by
quasi-elastic light scattering (QELS) immediately after removal of
the free antisense (A), and after storage of the preparation for 2
months at 4.degree. C. (B), using a Nicomp Model 370 sub-micron
particle sizer.
[0022] FIG. 8 illustrates the influence of the initial antisense
concentration on antisense loading in DODAP vesicles. Varying final
concentrations of a 20 mer of [.sup.3H]-phosphorothioate antisense
oligodeoxynucleotide (in 300 mM citrate buffer, pH 3.80) were mixed
with an ethanol solution of lipid (DSPC:CHOL:DODAP:PEG-CerC14;
25:45:20:10, molar ratio), 9.9 mg/mL (final concentration).
Encapsulation was assessed either by analyzing the pre-column and
post-column ratios of [.sup.3H]-antisense and [.sup.14C]-lipid or
by determining the total pre-column and post-column
[.sup.3H]-antisense and [.sup.14C]-lipid radioactivity. EPC:CHOL
liposomes containing encapsulated antisense are included for
comparison.
[0023] FIG. 9 illustrates the plasma clearance of encapsulated
antisense. Encapsulated liposomal antisense was prepared using the
ethanol-citrate procedure as described in "Material and Methods".
Initial lipid and antisense concentrations were 9.9 and 2 mg/mL,
respectively. Liposomal formulations were composed of
X:CHOL:DODAP:PEG-CerC14 (25:45:20:10), where X represents either
distearoylphosphatidylcholine (DSPC), sphingomyelin (SM), or
palmitoyloleoylphosphatidylcholine (POPC). The formulations
contained a lipid label ([.sup.14C]-cholesterylhexadecylethe- r)
and [.sup.3H]-antisense and were injected (200 .mu.L) intravenously
via the lateral tail vein of female (20-25 g) ICR mice at a lipid
dose of 120 mg/kg. Blood was recovered by cardiac puncture on
anesthetized mice. Lipid and antisense recoveries were determined
by standard scintillation counting techniques.
[0024] FIG. 10 illustrates the biodistribution of encapsulated
antisense. Encapsulated liposomal antisense was prepared using the
ethanol-citrate procedure as described in "Material and Methods".
Initial lipid and antisense concentrations were 9.9 and 2 mg/mL,
respectively. Liposomal formulations were composed of
X:CHOL:DODAP:PEG-CerC14 (25:45:20: 10), where X represents either
distearoylphosphatidylcholine (DSPC), sphingomyelin (SM), or
palmitoyloleoylphosphatidylcholine (POPC). The formulations
contained a lipid label ([.sup.14C]-cholesterylhexadecylethe- r)
and [.sup.3H]-antisense and were injected (200 .mu.L) intravenously
via the lateral tail vein of female (20-25 g) ICR mice at a lipid
dose of 120 mg/kg. Mice were terminated by cervical dislocation and
the organs were recovered and processed as described in "Materials
and Methods". Lipid and antisense recoveries were determined by
standard scintillation counting techniques.
[0025] FIG. 11 illustrates the differential release rates of
antisense in plasma. Encapsulated liposomal antisense was prepared
using the ethanol-citrate procedure as described in "Material and
Methods". Initial lipid and antisense concentrations were 9.9 and 2
mg/mL, respectively. Liposomal formulations were composed of
X:CHOL:DODAP:PEG-CerC14 (25:45:20:10), where X represents either
distearoylphosphatidylcholine (DSPC), sphingomyelin (SM), or
palmitoyloleoylphosphatidylcholine (POPC). The formulations
contained a lipid label ([.sup.14C]-cholesterylhexadecyl- ether)
and [.sup.3H]-antisense and were injected (200 .mu.L) intravenously
via the lateral tail vein of female (20-25 g) ICR mice at a lipid
dose of 120 mg/kg. Blood was recovered by cardiac puncture on
anesthetized mice. Lipid and antisense recoveries were determined
by standard scintillation counting techniques. Release rates were
determined by measuring the [3H]/[14C] ratio over time.
[0026] FIG. 12 illustrates the influence of PEG-acyl chain lengths
on plasma clearance of encapsulated antisense. Encapsulated
liposomal antisense was prepared using the ethanol-citrate
procedure as described in "Material and Methods". Initial lipid and
antisense concentrations were 9.9 and 2 mg/mL, respectively.
Liposomal formulations were composed of DSPC:CHOL:DODAP:PEG-CerC14
or C20 (25:45:20:10). The formulation contained a lipid label
([.sup.14C]-cholesterylhexadecylether) and [.sup.3H]-antisense and
were injected (200 .mu.L) intravenously via the lateral tail vein
of female (20-25 g) ICR mice at a lipid dose of 120 mg/kg. Blood
was recovered by cardiac puncture on anesthetized mice. Lipid and
antisense recoveries were determined by standard scintillation
counting techniques.
[0027] FIG. 13 illustrates the enhanced efficacy of liposomal
antisense containing DODAP-ear swelling. Inflamed mice were treated
at the time of ear challenge with a 30 mg/kg i.v. dose of either
HBS (no oligo), EPC:CHOL liposomes with entrapped PS 3082
(identified as AS 1000), POPC:CHOL:DODAP:PEG-CerC14 with entrapped
PS 3082 (identified as 4100), or DSPC:CHOL:DODAP:PEG-CerC14 with
entrapped PS 3082 (identified as 4200). Ear swelling was measured
at 24 hours after initiating inflammation using an engineer's
micrometer.
[0028] FIG. 14 illustrates the enhanced efficacy of liposomal
antisense containing DODAP-cellular infiltration. Mice received 10
.mu.Ci of [.sup.3H]-methylthymidine, i.p., 24 hours before
initiating inflammation. Inflamed mice were treated at the time of
ear challenge with a 30 mg/kg i.v. dose of either HBS (no oligo),
EPC:CHOL liposomes with entrapped PS 3082 (identified as AS 1000),
POPC:CHOL:DODAP:PEG-CerC14 with entrapped PS 3082 (identified as
4100), or DSPC:CHOL:DODAP:PEG-CerC14 with entrapped PS 3082
(identified as 4200). Cell infiltration was monitored by measuring
the radioactivity in the "challenged ear" versus the non-treated
ear. Results are expressed as the ratio of radioactivity in the
left (challenged ear) versus right ear.
[0029] FIG. 15 shows asymmetric loading of
lipid-encapsulated-nucleic acid particles in accordance with the
invention.
[0030] FIG. 16 shows clearance of lipid-encapsulated antisense
particles formulated with several amino lipids at different
levels.
[0031] FIG. 17 shows blood levels of antisense-containing particles
after repeat dosages.
[0032] FIG. 18 shows blood levels of antisense-containing particles
after repeat dosages.
[0033] FIG. 19 illustrates results of a study on the in vivo
efficacy of lipid-encapsulated antisense particles in accordance
with the invention in a mouse tumor model.
[0034] FIG. 20 shows encapsulation efficiency results for
lipid-encapsulated therapeutic agent particles in accordance with
the invention.
[0035] FIG. 21 shows results for studies on the use of murine ICAM1
in an ear inflammation model.
[0036] FIG. 22 shows results for studies on the use of murine ICAM1
in an ear inflammation model.
[0037] FIG. 23 shows results for studies on the use of murine ICAM1
in an ear inflammation model.
DETAILED DESCRIPTION OF THE INVENTION
Contents
[0038] I. Glossary
[0039] II. General
[0040] III. Methods of Preparing Liposome/Nucleic Acid
Complexes
[0041] IV. Pharmaceutical Preparations
[0042] V. Methods of Introducing the Lipid-Encapsulated Therapeutic
Agents into Cells
[0043] VI. Examples
[0044] VII. Conclusion
[0045] I. Glossary
[0046] Abbreviations and Definitions
[0047] The following abbreviations are used herein: ATTA,
N-(.omega.-N'-acetoxy-octa(14'amino-3',6',9',12'-tetraoxatetradecanoyl));
CHE, cholesteryl-hexadecylether; CHOL, cholesterol; DODAP or AL-1,
1,2-dioleoyloxy-3-dimethylaminopropane (and its protonated ammonium
form); DODMA, N-(1-(2,3-Dioleoyloxy) propyl)-N,N,-dimethyl ammonium
chloride; DSPC, distearoylphosphatidylcholine; EPC, egg
phosphatidylcholine; HBS, HEPES-buffered saline; HEPES,
N-2-hydroxyethylpiperazine-N'-2-ethanesulphonic acid; MES,
2-(N-morpholino)ethane sulfonic acid; PS 3082, murine ICAM-1
phosphorothioate oligodeoxynucleotide having the sequence:
TGCATCCCCCAGGCCACCAT (SEQ ID No. 1), NaCl, sodium chloride;
OLIGREEN.TM., a dye that becomes fluorescent when interacting with
an oligonucleotide; PEG-CerC20, polyethylene glycol coupled to a
ceramide derivative with 20 carbon acyl chain; POPC,
palmitoyloleoylphophatidylcholine; SM, sphingomyelin.
[0048] "Lipid-therapeutic agent particle" means a particle
comprising lipids and a charged (cationic or anionic) therapeutic
agent. "Lipid-therapeutic nucleic acid particle" means a particle
comprising a lipid and a therapeutic nucleic acid.
[0049] "Lipid-encapsulated therapeutic agent (nucleic acid)
particle" means a lipid-therapeutic agent particle wherein less
than 50% and preferably less than 10% of the therapeutic agent
(nucleic acid) is detectable on the external surface of the
particle or in the buffer external to the particle. In the case of
nucleic acids, the amount of encapsulated versus unencapsulated
nucleic acid can be assayed by fluorescence assays or nuclease
assays as described herein. Comparable assays can be used for other
types of therapeutic agents.
[0050] "Therapeutically effective amount" means an amount which
provides a therapeutic benefit. For antisense oligonucleotide this
means generally 0.5 to 50 mg/kg of body weight, but when delivered
in a lipid particle formulation, a below-toxic amount of lipid must
be used.
[0051] "Lipid exchange out of particle" and the rate of this
exchange is fully explained in U.S. patent application Ser. No.
08/486,214 and 08/485,608 and PCT Patent publications WO 96/10391
and WO 96/10392, which are all incorporated herein by reference.
Lipid exchange into the surrounding medium is possible for lipids
which are reversibly associated with the lipid particle membrane.
Each lipid has a characteristic rate at which it will exchange put
of a particle which depends on a variety of factors including acyl
chain length, saturation, head group size, buffer composition and
membrane composition.
[0052] "Disease site" is the site in an organism which demonstrates
or is the source of a pathology. The disease site may be focused,
as in a site of neoplasm or inflammation, or may be diffuse as in
the case of a non-solid tumor. "Administration at a site which is
distal to the disease site" means that delivery to the disease site
will require some kind of systemic delivery, either by blood or
lymph circulation, or other fluid movement inside the organism.
[0053] The term "transfection" as used herein, refers to the
introduction of polyanionic materials, particularly nucleic acids,
into cells. The polyanionic materials can be in the form of DNA or
RNA which is linked to expression vectors to facilitate gene
expression after entry into the cell. Thus the polyanionic material
or nucleic acids used in the present invention is meant to include
DNA having coding sequences for structural proteins, receptors and
hormones, as well as transcriptional and translational regulatory
elements (i.e., promoters, enhancers, terminators and signal
sequences) and vector sequences. Methods of incorporating
particular nucleic acids into expression vectors are well known to
those of skill in the art, but are described in detail in, for
example, Sambrook et al., Molecular Cloning: A Laboratory Manual
(2nd ed.), Vols. 1-3, Cold Spring Harbor Laboratory, (1989) or
Current Protocols in Molecular Biology, F. Ausubel et al., ed.
Greene Publishing and Wiley-Interscience, New York (1987), both of
which are incorporated herein by reference.
[0054] The term "physiological pH" refers to pH levels
conventionally encountered in serum or blood. In general, this will
be in the range of pH 7.2 to 7.5. Preferred protonatable or
deprotonatable lipids have a pKa such that they are substantially
neutral at this pH, i.e., a pKa of about 4 to 7 in the case of an
amino lipid.
[0055] II. General
[0056] The present invention relates to methods and compositions
for producing lipid-encapsulated therapeutic agent particles in
which charged therapeutic agents are encapsulated within a lipid
layer. The invention is applicable to both anionic and cationic
therapeutic agents, including polyanionic nucleic acids,
polyanionic proteins or peptides, cytokines and heparin, and
cationic proteins and peptides. The invention is principally
demonstrated herein with reference to polyanionic nucleic acids as
the therapeutic agent, which is a preferred embodiment, but the
same principles can be readily extended to other polyanionic or to
cationic therapeutic agents.
[0057] To evaluate the quality of a lipid/nucleic acid formulation
the following criteria, among others, may be employed:
[0058] drug to lipid ratio;
[0059] encapsulation efficiency;
[0060] nuclease resistance/serum stability; and
[0061] particle size.
[0062] High drug to lipid rations, high encapsulation efficiency,
good nuclease resistance and serum stability and controllable
particle size, generally less than 200 nm in diameter are desirable
In addition, the nature of the nucleic acid polymer is of
significance, since the modification of nucleic acids in an effort
to impart nuclease resistance adds to the cost of therapeutics
while in many cases providing only limited resistance. The present
invention provides lipid-nucleic acid particles and methods for
preparing lipid-nucleic acid formulations which are far superior to
the art according to these criteria.
[0063] Unless stated otherwise, these criteria are calculated in
this specification as follows:
[0064] drug to lipid ratio: The amount of drug (therapeutic agent)
in a defined volume of preparation divided by the amount of lipid
in the same volume. This may be on a mole per mole basis or on a
weight per weight basis, or on a weight per mole basis. For final,
administration- ready formulations, the drug: lipid ratio is
calculated after dialysis, chromatography and/or enzyme (e.g.,
nuclease) digestion has been employed to remove as much of the
external therapeutic agent (e.g., nucleic acid) as possible.
Drug:lipid ratio is a measure of potency of the formulation,
although the highest possible drug:lipid ratio is not always the
most potent formulation;
[0065] encapsulation efficiency: the drug to lipid ratio of the
starting mixture divided by the drug to lipid ratio of the final,
administration competent formulation. This is a measure of relative
efficiency. For a measure of absolute efficiency, the total amount
of therapeutic agent (nucleic acid) added to the starting mixture
that ends up in the administration competent formulation, can also
be calculated. The amount of lipid lost during the formulation
process may also be calculated. Efficiency is a measure of the
wastage and expense of the formulation;
[0066] nuclease resistance/serum stability: the ability of the
formulation to protect the nucleic acid therapeutic agents from
nuclease digestion either in an in vitro assay, or in circulation.
Several standard assays are detailed in this specification.
Encapsulated particles have much greater nuclease resistance and
serum stability than lipid-antisense aggregates such as DOTMA/DOPE
(LIPOFECTIN.TM.) formulations; and
[0067] size: the size of the particles formed. Size distribution
may be determined using quasi-elastic light scattering (QELS) on a
Nicomp Model 370 sub-micron particle sizer. Particles under 200 nm
are preferred for distribution to neo-vascularized (leaky) tissues,
such as neoplasms and sites of inflammation.
[0068] The methods and composition of the invention make use of
certain lipids which can be present in both a charged and an
uncharged form. For example, amino lipids which are charged at a pH
below the pK.sub.a of the amino group and substantially neutral at
a pH above the PK.sub.a can be used in a two-step process. First,
lipid vesicles can be formed at the lower pH with (cationic) amino
lipids and other vesicle components in the presence of nucleic
acids. In this manner the vesicles will encapsulate and entrap the
nucleic acids. Second, the surface charge of the newly formed
vesicles can be neutralized by increasing the pH of the medium to a
level above the pK.sub.a of the amino lipids present, i.e., to
physiological pH or higher. Particularly advantageous aspects of
this process include both the facile removal of any surface
adsorbed nucleic acid and a resultant nucleic acid delivery vehicle
which has a neutral surface. Liposomes or lipid particles having a
neutral surface are expected to avoid rapid clearance from
circulation and to avoid certain toxicities which are associated
with cationic liposome preparations.
[0069] It is further noted that the vesicles formed in this manner
provide formulations of uniform vesicle size with high content of
nucleic acids. Additionally, the vesicles are not aggregate
complexes, but rather are large unilamellar vesicles having a size
range of from about 70 to about 200 nm, more preferably about 90 to
about 130 nm.
[0070] Without intending to be bound by any particular theory, it
is believed that the very high efficiency of nucleic acid
encapsulation is a result of electrostatic interaction at low pH.
FIG. 1 provides an illustration of the processes described herein.
More particularly, this figure illustrates a lipid-nucleic acid
composition of amino lipids and PEG-modified lipids having
encapsulated antisense nucleic acid and surface-bound antisense
nucleic acid. At acidic pH (shown as pH 4.0), the surface is
charged and binds a portion of the antisense through electrostatic
interactions. When the external acidic buffer is exchanged for a
more neutral (pH 7.5, HBS) buffer, the surface of the lipid
particle or liposome is neutralized, resulting in release of the
antisense nucleic acid.
[0071] Encapsulation efficiency results in FIGS. 15 show a further
unexpected benefit of the invention. As shown in the figure, for
both phosphorothioate (PS-2302) and phosphodiester (PO-2302)
formulations it is possible to obtain encapsulation
efficiencies--i.e., the amount of nucleic acid that ends up on the
inside of the particle--that are greater than 50%. Phosphodiesters
achieve well over 60%, and phosphorothioates can be at least up to
80% encapsulated. The asymmetry of loading is surprising, given
that in the simplest model of loading large unilamellar vesicles
(LUV's) the therapeutic agent (nucleic acid) would be equally
likely to associate with cationic charges on the inside and outside
of the particle. A 1:1 distribution (inside to outside) would
suggest that the 50% on the outside should be removed upon
neutralization of the outside surface charges, such that 50%
efficiency would be the theoretical upper limit. Through some
unclear mechanism, however, the invention surprisingly provides an
active process whereby the majority of the therapeutic agent
(nucleic acid) ends up protected on the inside of the
particles.
[0072] III. Methods of Preparing Lipid/Therapeutic Agent (Nucleic
Acid) Formulations
[0073] In view of the above, the present invention provides methods
of preparing lipid/nucleic acid formulations. In the methods
described herein, a mixture of lipids is combined with a buffered
aqueous solution of nucleic acid to produce an intermediate mixture
containing nucleic acid encapsulated in lipid particles wherein the
encapsulated nucleic acids are present in a nucleic acid/lipid
ratio of about 10 wt % to about 20 wt %. The intermediate mixture
may optionally be sized to obtain lipid-encapsulated nucleic acid
particles wherein the lipid portions are large unilamellar
vesicles, preferably having a diameter of 70 to 200 nm, more
preferably about 90 to 130 nm. The pH is then raised to neutralize
at least a portion of the surface charges on the lipid-nucleic acid
particles, thus providing an at least partially surface-neutralized
lipid-encapsulated nucleic acid composition.
[0074] The mixture of lipids includes at least two lipid
components: a first lipid component that is selected from among
lipids which have a pKa such that the lipid is cationic at pH below
the pKa and neutral at pH above the pKa, and a second lipid
component that is selected from among lipids that prevent particle
aggregation during lipid-nucleic acid particle formation.
[0075] The first lipid component of is a lipid (or a mixture of
lipid species with similar properties) which has at least one
protonatable or deprotonatable group, such that the lipid is
charged at a first pH (cationic or anionic, depending on the nature
and pKa of the protonatable or deprotonatable group), and neutral
at a second pH, preferably at physiological pH. It will of course
be understood that the addition or removal of protons as a function
of pH is an equilibrium process, and that the reference to a
charged or a neutral lipid refers to the nature of the predominant
species and does not require that all of the lipid be present in
the charged or neutral form. Lipids which have more than one
protonatable or deprotonatable group, or which are zwiterrionic are
not excluded from use in the invention. Protonatable lipids are
particularly useful as the first lipid component of the invention
when the pKa of the protonatable group is in the range of about 4
to about 11. Most preferred is pKa of about 4 to about 7, because
these lipids will be cationic at the lower pH formulation stage,
while particles will be largely (though not completely) surface
neutralized at physiological pH around pH 7.5. One of the benefits
of this pKa is that at least some antisense stuck to the outside
surface of the particle will lose its electrostatic interaction at
physiological pH and be removed by simple dialysis; thus greatly
reducing the particle's susceptibility to clearance.
[0076] Preferred lipids with a protonatable group for use as the
first lipid component of the lipid mixture are amino lipids. As
used herein, the term "amino lipid" is meant to include those
lipids having one or two fatty acid or fatty alkyl chains and an
amino head group (including an alkylamino or dialkylamino group)
which is protonated to form a cationic lipid at physiological pH
(see FIG. 2A). In one group of embodiments, the amino lipid is a
primary, secondary or tertiary amine represented by the formula:
1
[0077] in which R.sup.1 is a C.sub.12 to C.sub.24 alkyl group which
is branched or unbranched, and saturated or unsaturated. R.sup.2 is
hydrogen or a C.sub.1 to C.sub.24 alkyl group which is also
branched or unbranched, and saturated or unsaturated (when three or
more carbons are present). R.sub.3 is hydrogen or a C.sup.1 to
C.sub.6 alkyl group. Examples of these amino lipids include, for
example, stearylamine, oleylamine, dioleylamine,
N-methyl-N,N-dioleylamine, and N,N-dimethyloleylamine.
[0078] In another group of embodiments, the amino lipid is a lipid
in which the amino head group is attached to one or more fatty acid
or fatty alkyl groups by a scaffold such as, for example, a
glycerol or propanediol moiety. Illustrative of these.amine lipids
is the formula: 2
[0079] wherein at least one and preferably both of R.sup.11 and
R.sup.12 is a C.sub.12 to C.sub.24 alkyl or acyl group which is
branched or unbranched, saturated or unsaturated. In those
embodiments in which only one of R.sup.11 or R.sup.12 is a long
chain alkyl or acyl group, the other of R.sup.11 or R.sup.12 will
be a hydrogen or lower alkyl or acyl group having from one to six
carbon atoms. The remaining groups, R.sup.13 and R.sup.14 are
typically hydrogen or C.sub.1 to C.sub.4 alkyl. In this group of
embodiments, the amino lipid can be viewed as a derivative of
3-monoalkyl or dialkylamino-1,2-propanediol. An example of a
suitable amino lipid is DODAP
(1,2-dioleoyloxy-3-dimethylamino-propane., see FIG. 2A). Other
amino lipids would include those having alternative fatty acid
groups and other dialkylamino groups, including those in which the
alkyl substituents are different (e.g., N-ethyl-N-methylamino-,
N-propyl-N-ethylamino- and the like). For those embodiments in
which R.sup.11 and R.sup.12 are both long chain alkyl or acyl
groups, they can be the same or different. In general, amino lipids
having less saturated acyl chains are more easily sized,
particularly when the complexes must be sized below about 0.3
microns, for purposes of filter sterilization. Amino lipids
containing unsaturated fatty acids with carbon chain lengths in the
range of C.sub.14 to C.sub.22 are particularly preferred. Other
scaffolds can also be used to separate the amino group and the
fatty acid or fatty alkyl portion of the amino lipid. Suitable
scaffolds are known to those of skill in the art.
[0080] Compounds that are related to DODAP that may be useful with
this invention include: 1-oleoyl-2-hydroxy-3-N,N-dimethylamino
propane; 1,2-diacyl-3-N,N-dimethylamino propane; and
1,2-didecanoyl-1-N,N-dimethyl- amino propane. Further, it is
proposed that various modifications of the DODAP or DODMA
headgroup, or any compound of the general formula: can be modified
to obtain a suitable pKa. Suitable headgroup modifications that are
useful in the instant invention include:
1 R.sup.1 R.sup.2 1 H H 2 H CH.sub.3 3 CH.sub.3 CH.sub.3 4 H
CH.sub.2CH.sub.3 5 CH.sub.3 CH.sub.2CH.sub.3 6 CH.sub.2CH.sub.3
CH.sub.2CH.sub.3 7 H CH.sub.2CH.sub.2OH 8 CH.sub.3
CH.sub.2CH.sub.2OH 9 CH.sub.2CH.sub.3 CH.sub.2CH.sub.2OH 10
CH.sub.2CH.sub.2OH CH.sub.2CH.sub.2OH 11* H
CH.sub.2CH.sub.2NH.sub.2 12* CH.sub.3 CH.sub.2CH.sub.2NH.sub.2 13*
CH.sub.2CH.sub.3 CH.sub.2CH.sub.2NH.sub.2 14* CH.sub.2CH.sub.2OH
CH.sub.2CH.sub.2NH.sub.2 15* CH.sub.2CH.sub.2NH.sub.2
CH.sub.2CH.sub.2NH.sub.2
[0081] In other embodiments, the amino lipid can be a derivative of
a naturally occurring amino lipid, for example, sphingosine.
Suitable derivatives of sphingosine would include those having
additional fatty acid chains attached to either of the pendent
hydroxyl groups, as well as alkyl groups, preferably lower alkyl
groups, attached to the amino functional group.
[0082] Other lipids which may be used as the first lipid component
of the invention include phosphine lipids (although toxicity issues
may limit their utility), and carboxylic acid lipid derivative.
These generally have a pKa of about 5 and are therefore useful with
cationic therapeutic agents.
[0083] The second lipid component is selected to improve the
formulation process by reducing aggregation of the. lipid particles
during formation. This may result from steric stabilization of
particles which prevents charge-induced aggregation during
formation. Examples of suitable lipids for this purpose include
polyethylene glycol (PEG)-modified lipids, monosialoganglioside Gm
1, and polyamide oligomers ("PAO") such as ATTA (disclosed in U.S.
patent application Ser. No. 60/073,852 and U.S. patent application
Ser. No. 60/(not yet received TT&C Attorney Docket No.
16303-005810 both assigned to the assignee of the instant invention
and incorporated herein by reference). Other compounds with
uncharged, hydrophilic, steric-barrier moieties, that prevent
aggregation during formulation, like PEG, Gm1 or ATTA, can also be
coupled to lipids for use as the second lipid component in the
methods and compositions of the invention. Typically, the
concentration of the second lipid component is about 1 to 15% (by
mole percent of lipids).
[0084] Specific examples of PEG-modified lipids (or
lipid-polyoxyethylene conjugates) that are useful in the present
invention can have a variety of "anchoring" lipid portions to
secure the PEG portion to the surface of the lipid vesicle.
Examples of suitable PEG-modified lipids include PEG-modified
phosphatidylethanolamine and phosphatidic acid (see FIG. 2B,
structures A and B), PEG-modified diacylglycerols and
dialkylglycerols (see FIG. 2B, structures C and D), PEG-modified
dialkylamines (FIG. 2B, structure E) and PEG-modified
1,2-diacyloxypropan-3-amines (FIG. 2B, structure F). Particularly
preferred are PEG-ceramide conjugates (e.g., PEG-CerCl4 or
PEG-CerC20) which are described in co-pending U.S. Pat. Ser. No.
08/486,214, incorporated herein by reference.
[0085] In embodiments where a sterically-large moiety such as PEG
or ATTA are conjugated to a lipid anchor, the selection of the
lipid anchor depends on what type of association the conjugate is
to have with the lipid particle. It is well known that
mePEG(mw2000)-diastearoylphosphatid- ylethanolamine (PEG-DSPE) will
remain associated with a liposome until the particle is cleared
from the circulation, possibly a matter of days. Other conjugates,
such as PEG-CerC20 have similar staying capacity. PEG-CerC14,
however, rapidly exchanges out of the formulation upon exposure to
serum, with a T.sub.1/2 less than 60 mins. in some assays. As
illustrated in U.S. patent application Ser. No. 08/486,214 at least
three characteristics influence the rate of exchange: length of
acyl chain, saturation of acyl chain, and size of the
steric-barrier head group. Compounds having suitable variations of
these features may be useful for the invention.
[0086] It should be noted that aggregation preventing compounds do
not necessarily require lipid conjugation to function properly.
Free PEG or free ATTA in solution may be sufficient to prevent
aggregation. If the particles are stable after formulation, the PEG
or ATTA can be dialyzed away before administration to a
patient.
[0087] In addition to the first and second lipid components, the
lipid mixture may contain additional lipid species. These
additional lipids may be, for example, neutral lipids or
sterols.
[0088] Neutral lipids, when present in the lipid mixture, can be
any of a number of lipid species which exist either in an uncharged
or neutral zwitterionic form at physiological pH. Such lipids
include, for example diacylphosphatidylcholine,
diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin,
and cerebrosides. The selection of neutral lipids for use in the
complexes herein is generally guided by consideration of, e.g.,
liposome size and stability of the liposomes in the bloodstream.
Preferably, the neutral lipid component is a lipid having two acyl
groups, (i.e., diacylphosphatidylcholine and
diacylphosphatidylethanolamine). Lipids having a variety of acyl
chain groups of varying chain length and degree of saturation are
available or may be isolated or synthesized by well-known
techniques. In one group of embodiments, lipids containing
saturated fatty acids with carbon chain lengths in the range of
C.sub.14 to C.sub.22 are preferred. In another group of
embodiments, lipids with mono or diunsaturated fatty acids with
carbon chain lengths in the range of C.sub.14 to C.sub.22 are used.
Additionally, lipids having mixtures of saturated and unsaturated
fatty acid chains can be used. Preferably, the neutral lipids used
in the present invention are DOPE, DSPC, POPC, or any related
phosphatidylcholine. The neutral lipids usefill in the present
invention may also be composed of sphingomyelin or phospholipids
with other head groups, such as serine and inositol.
[0089] The sterol component of the lipid mixture, when present, can
be any of those sterols conventionally used in the field of
liposome, lipid vesicle or lipid particle preparation. A preferred
sterol is cholesterol.
[0090] The mixture of lipids is typically a solution of lipids in
an alcoholic solvent. Hydrophilic, low molecular weight water
miscible alcohols with less than 10 carbon atoms, preferably less
than 6 carbon atoms are preferred. Typical alcohols used in this
invention are ethanol, methanol, propanol, butanol, pentanol and
ethylene glycol and propylene glycol. Particularly preferred. is
ethanol. In most embodiments, the alcohol is used in the form in
which it is commercially available. For example, ethanol can be
used as absolute ethanol (100%), or as 95% ethanol, the remainder
being water.
[0091] In one exemplary embodiment, the mixture of lipids is a
mixture of amino lipids, neutral lipids (other than an amino
lipid), a sterol (e.g., cholesterol) and a PEG-modified lipid
(e.g., a PEG-ceramide) in an alcohol solvent. In preferred
embodiments, the lipid mixture consists essentially of an amino
lipid, a neutral lipid, cholesterol and a PEG-ceramide in alcohol,
more preferably ethanol. In further preferred embodiments, the
first solution consists of the above lipid mixture in molar ratios
of about 10-35% amino lipid:25-45% neutral lipid:35-55%
cholesterol:0.5-15% PEG-ceramide. In still further preferred
embodiments, the first solution consists essentially of DODAP,
DSPC, Chol and PEG-CerC14, more preferably in a molar ratio of
about 10-35% DODAP:25-45% DSPC:35-55% Chol:0.5-15% PEG-CerC14. In
another group of preferred embodiments, the neutral lipid in these
compositions is replaced with POPC or SM.
[0092] In accordance with the invention, the lipid mixture is
combined with a buffered aqueous solution of charged therapeutic
agent, preferably nucleic acids. The buffered aqueous solution of
therapeutic agents (nucleic acids) which is combined with the lipid
mixture is typically a solution in which the buffer has a pH of
less than the pK.sub.a of the protonatable lipid in the lipid
mixture. As used herein, the term "nucleic acid" is meant to
include any oligonucleotide or polynucleotide having from 10 to
100,000 nucleotide residues. Antisense and ribozyme
oligonucleotides are particularly preferred. The term "antisense
oligonucleotide" or simply "antisense" is meant to include
oligonucleotides which are complementary to a targeted nucleic acid
and which contain from about 10 to about 50 nucleotides, more
preferably about 15 to about 30 nucleotides. The term also
encompasses antisense sequences which may not be exactly
complementary to the desired target gene. Thus, the invention can
be utilized in instances where non-target specific-activities are
found with antisense, or where an antisense sequence containing one
or more mismatches with the target sequence is the most preferred
for a particular use.
[0093] The nucleic acid that is used in a lipid-nucleic acid
particle according to this invention includes any form of nucleic
acid that is known. Thus, the nucleic acid may be a modified
nucleic acid of the type used previously to enhance nuclease
resistance and serum stability. Surprisingly, however, acceptable
therapeutic products can also be prepared using the method of the
invention to formulate lipid-nucleic acid particles from nucleic
acids which have no modification to the phosphodiester linkages of
natural nucleic acid polymers, and the use of unmodified
phosphodiester nucleic acids (i.e., nucleic acids in which all of
the linkages are phosphodiester linkages) is a preferred embodiment
of the invention. Still other nucleic acids which are useful in the
present invention include, synthetic or pre-formed poly-RNA such as
poly(TC) IC.
[0094] The nucleic acids used herein can be single-stranded DNA or
RNA, or double-stranded DNA or DNA-RNA hybrids. Examples of
double-stranded DNA include structural genes, genes including
control and termination regions, and self-replicating systems such
as plasmid DNA. Single-stranded nucleic acids include antisense
oligonucleotides (discussed above and complementary to DNA and
RNA), ribozymes and triplex-forming oligonucleotides.
[0095] In order to increase stability, some single-stranded nucleic
acids may have some or all of the nucleotide linkages substituted
with stable, non-phosphodiester linkages, including, for example,
phosphorothioate, phosphorodithioate, phosphoroselenate,
boranophosphate, methylphosphonate, or O-alkyl phosphotriester
linkages. Phosphorothioate nucleic acids (PS-oligos) are those
oligonucleotides or polynucleotides in which one of the non-bridged
oxygens of the internucleotide linkage has been replaced with
sulfur. These PS-oligos are resistant to nuclease degradation, yet
retain sequence-specific activity. Similarly, phosphorodithioate
nucleic acids are those oligonucleotides or polynucleotides in
which each of the non-bridged oxygens of the internucleotide
linkage have been replaced by a sulfur atom. These
phosphorodithioate-oligos have also proven to be more nuclease
resistant than the natural phosphodiester-linked form. Other useful
nucleic acids derivatives include those nucleic acids molecules in
which the bridging oxygen atoms (those forming the phosphoester
linkages) have been replaced with --S--, --NH--, --CH.sub.2-- and
the like. Preferably, the alterations to the antisense or other
nucleic acids used will not completely affect the negative charges
associated with the nucleic acids. Thus, the present invention
contemplates the use of antisense and other nucleic acids in which
a portion of the linkages are replaced with, for example, the
neutral methyl phosphonate or phosphoramidate linkages. When
neutral linkages are used, preferably less than 80% of the nucleic
acid linkages are so substituted, more preferably less than
50%.
[0096] Those skilled in the art will realize that for in vivo
utility, such as therapeutic efficacy, a reasonable rule of thumb
is that if a thioated version of the sequence works in the free
form, that encapsulated particles of the same sequence, of any
chemistry, will also be efficacious. Encapsulated particles may
also have a broader range of iii vivo utilities, showing efficacy
in conditions and models not known to be otherwise responsive to
antisense therapy. Those skilled in the art know that applying this
invention they may find old models which now respond to antisense
therapy. Further, they may revisit discarded antisense sequences or
chemistries and find efficacy by employing the invention.
[0097] Therapeutic antisense sequences (putatively target specific)
known to work with this invention include the following:
2 Trivial Name: Gene Target, Chemistry and Sequence PS-3082 murine
ICAM-1 (Intracellular Adhesion Molecule-1) (phosphorothioate)
TGCATCCCCCAGGCCACCAT (SEQ ID. No 1) PO-3082 murine ICAM-1
(phosphodiester) TGCATCCCCCAGGCCACCAT (SEQ ID. No 1) PS-2302 human
ICAM-1 (phosphorothioate) GCCCAAGCTGGCATCCGTCA (SEQ ID. No 2)
PO-2302 human ICAM-1 (phosphodiester) GCCCAAGCTGGCATCCGTCA (SEQ ID.
No 2) PS-8997 human ICAM-1 (phosphorothioate) GCCCAAGCTGGCATCCGTCA
(SEQ ID. No 2) PO-8997 human ICAM-1 (phosphodiester)
GCCCAAGCTGGCATCCGTCA (SEQ ID. No 2) US3 human erb-B-2 gene
(phosphodiester or phosphorothioate) GGT GCT CAC TGC GGC (SEQ ID.
No 3) LR-3280 human c-myc gene (phosphorothioate) AAC GTT GAG GGG
CAT (SEQ ID. No 4) Inx-6298 human c-myc gene (phosphodiester) AAC
GTT GAG GGG CAT (SEQ ID. No 4) Inx-6295 human c-myc gene
(phosphodiester or phosphorothioate) T AAC GTT GAG GGG CAT (SEQ ID.
No 5) LR-3001 human c-myb gene (phosphodiester or phosphorothioate)
TAT GCT GTG CCG GGG TCT TCG GGC (SEQ ID. No 6) c-myb human c-myb
gene (phosphodiester or phosphorothioate) GTG CCG GGG TCT TCG GGC
(SEQ ID. No 7) IGF-1R human IGF-1R (Insulin Growth Factor 1 -
Receptor) (phosphodiester or phosphorothioate) GGA CCC TCC TCC GGA
GCC (SEQ ID. No 8) LR-42 human IGF- 1R (phosphodiester or
phosphorothioate) TCC TCC GGA GCC AGA CTT (SEQ ID. No 9) EGFR human
EGFR (Epidermal Growth Factor Receptor) (phosphodiester or
phosphorothioate) CCG TGG TCA TGC TCC (SEQ ID. No 10) VEGF human
VEGF (Vascular Endothelial Growth Factor) gene (phosphodiester or
phosphorothioate) CAG CCT GGC TCA CCG CCT TGG (SEQ ID. No 11)
PS-4189 murine PKC-alpha (Phosphokinase C - alpha) gene
(phosphodiester or phosphorothioate) CAG CCA TGG TTC CCC CCA AC
(SEQ ID. No 12) PS-3521 human PKC-alpha (phosphodiester or
phosphorothioate) GTT CTC GCT GGT GAG TTT CA (SEQ ID. No 13) Bcl-2
human bcl-2 gene (phosphodiester or phosphorothioate) TCT CCC AgC
gTg CgC CAT (SEQ ID. No 14) ATG-AS human c-raf-1 protein kinase
(phosphodiester or phosphorothioate) GTG CTC CAT TGA TGC (SEQ ID.
No 15) VEGF-R1 human VEGF-R-1 (Vascular Endothelial Growth Factor
Receptor 1) ribozyme GAG UUG CUG AUG AGG CCG AAA GGC CGA AAG UCU G
(SEQ ID. No 16)
[0098] Using these sequences, the invention provides a method for
the treatment of a diseases, including tumors, characterized by
aberrant expression of a gene in a mammalian subject. The method
comprises the steps of preparing a lipid-encapsulated therapeutic
nucleic acid particle according to the methods as described herein,
where the therapeutic nucleic acid component hybridizes
specifically with the aberrantly expressed gene; and administering
a therapeutically effective amount of the resulting particle to the
mammalian subject. These sequences are, of course, only
representative of the possible therapeutic oligonucleotide
compounds that can be delivered using the invention. It is well
known that, depending on the target gene, antisense that hybridizes
to any part of the target gene, such as coding regions, introns,
the 5' untranslated region (5'UTR), start of translation, or 3'UTR
may have therapeutic utility. Therefore, the sequences listed above
are only exemplary of antisense. Furthermore, all the alternative
chemistries that have been proposed (i.e. see Background) can be
tested with the invention to determine efficacy along with all
types of ribozymes. In short, the compounds listed above represent
the broad class of therapeutic 5-50 mer oligonucleotides of various
chemistries which are useful with this invention. Other
oligonucleotides which are useful include all those which have
previously demonstrated efficacy in the free form.
[0099] While the invention is generally described and exemplified
with regard to antisense oligonucleotides, other nucleic acids can
be formulated and administered to a subject for the purpose of
repairing or enhancing the expression of a cellular protein.
Accordingly, the nucleic acid can be an expression vector, cloning
vector or the like which is often a plasmid designed to be able to
replicate in a chosen host cell. Expression vectors may replicate
autonomously, or they may replicate by being inserted into the
genome of the host cell, by methods well known in the art. Vectors
that replicate autonomously will have an origin of replication or
autonomous replicating sequence (ARS) that is finctional in the
chosen host cell(s). Often, it is desirable for a vector to be
usable in more than one host cell, e.g., in E. coli for cloning and
construction, and in a mammalian cell for expression.
[0100] Additionally, the nucleic acid can carry a label (e.g.,
radioactive label, fluorescent label or colorimetric label) for the
purpose of providing clinical diagnosis relating to the presence or
absence of complementary nucleic acids. Accordingly, the nucleic
acids, or nucleotide polymers, can be polymers of nucleic acids
including genomic DNA, cDNA, mRNA or oligonucleotides containing
nucleic acid analogs, for example, the antisense derivatives
described in a review by Stein, et al., Science 261:1004-1011
(1993) and in U.S. Pat. Nos. 5,264,423 and 5,276,019, the
disclosures of which are incorporated herein by reference. Still
further, the nucleic acids may encode transcriptional and
translational regulatory sequences including promoter sequences and
enhancer sequences.
[0101] The nucleic acids used in the present invention will also
include those nucleic acids in which modifications have been made
in one or more sugar moieties and/or in one or more of the
pyrimidine or purine bases. Examples of sugar modifications include
replacement of one or more hydroxyl groups with halogens, alkyl
groups, amines, azido groups or functionalized as ethers or esters.
Additionally, the entire sugar may be replaced with sterically and
electronically similar structures, including aza-sugars and
carbocyclic sugar analogs. Modifications in the purine or
pyrimidine base moiety include, for example, alkylated purines and
pyrimidines, acylated purines or pyrimidines, or other heterocyclic
substitutes known to those of skill in the art. As with the
modifications to the phosphodiester linkages discussed above, any
modifications to the sugar or the base moieties should also act to
preserve at least a portion of the negative charge normally
associated with the nucleic acid. In particular, modifications will
preferably result in retention of at least 10% of the overall
negative charge, more preferably over 50% of the negative charge
and still more preferably over 80% of the negative charge
associated with the nucleic acid.
[0102] The nucleic acids used in the present method can be isolated
from natural sources, obtained from such sources as ATCC or GenBank
libraries or prepared by synthetic methods. Synthetic nucleic acids
can be prepared by a variety of solution or solid phase methods.
Generally, solid phase synthesis is preferred. Detailed
descriptions of the procedures for solid phase synthesis of nucleic
acids by phosphite-triester, phosphotriester, and H-phosphonate-
chemistries are widely available. See, for example, Itakura, U.S.
Pat. No. 4,401,796; Caruthers, et al., U.S. Pat. Nos. 4,458,066 and
4,500,707; Beaucage, et al., Tetrahedron Lett., 22:1859-1862
(1981); Matteucci, et al., J Am. Chem. Soc., 103:3185-3191 (1981);
Caruthers, et al., Genetic Engineering, 4:1-17 (1982); Jones,
chapter 2, Atkinson, et al., chapter 3, and Sproat, et aL, chapter
4, in Oligonucleotide Synthesis: A Practical Approach, Gait (ed.),
IRL Press, Washington D.C. (1984); Froehler, et al., Tetrahedron
Lett., 27:469-472 (1986); Froehler, et al., Nucleic Acids Res.,
14:5399-5407 (1986); Sinha, et al. Tetrahedron Lett., 24:5843-5846
(1983); and Sinha, et al., Nucl. Acids Res., 12:4539-4557 (1984)
which are incorporated herein by reference.
[0103] As noted above, the solution of therapeutic agent (nucleic
acids) comprises an aqueous buffer. Preferred buffers (in the case
of anionic therapeutic agents) are those which provide a pH of less
than the pK.sub.a of the first lipid component. Examples of
suitable buffers include citrate, phosphate, acetate, and MES. A
particularly preferred buffer is citrate buffer. Preferred buffers
will be in the range of 1-1000 mM of the anion, depending on the
chemistry of the oligonucleotide being encapsulated, and
optimization of buffer concentration may be significant to
achieving high loading levels (See. FIGS. 15 and 20).
Alternatively, pure water acidified to pH 5-6 with chloride,
sulfate or the like may be useful. In this case, it may be suitable
to add 5% glucose, or another non-ionic solute which will balance
the osmotic potential across the particle membrane when the
particles are dialyzed to remove ethanol, increase the pH, or mixed
with a.pharmaceutically acceptable carrier such as normal saline.
The amount of therapeutic agent (nucleic acid) in buffer can vary,
but will typically be from about 0.01 mg/mL to about 200 mg/mL,
more preferably from about 0.5 mg/mL to about 50 mg/mL.
[0104] The mixture of lipids and the buffered aqueous solution of
therapeutic agent (nucleic acids) is combined to provide an
intermediate mixture. The intermediate mixture is typically a
mixture of lipid particles having encapsulated therapeutic agent
(nucleic acids). Additionally, the intermediate mixture may also
contain some portion of therapeutic agent (nucleic acids) which are
attached to the surface of the lipid particles (liposomes or lipid
vesicles) due to the ionic attraction of the negatively-charged
nucleic acids and positively-charged lipids on the lipid particle
surface (the amino lipids or other lipid making up the protonatable
first lipid component are positively charged in a buffer having a
pH of less than the pK.sub.a of the protonatable group on the
lipid). In one group of preferred embodiments, the mixture of
lipids is an alcohol solution of lipids and the volumes of each of
the solutions is adjusted so that upon combination, the resulting
alcohol content is from about 20% by volume to about 45% by volume.
The method of combining the mixtures can include any of a variety
of processes, often depending upon the scale of formulation
produced. For example, when the total volume is about 10-20 mL or
less, the solutions can be combined in a test tube and stirred
together using a vortex mixer. Large-scale processes can be carried
out in suitable production scale glassware.
[0105] Optionally, the lipid-encapsulated therapeutic agent
(nucleic acid) complexes which are produced by combining the lipid
mixture and the buffered aqueous solution of therapeutic agents
(nucleic acids) can be sized to achieve a desired size range and
relatively narrow distribution of lipid particle sizes. Preferably,
the compositions provided herein will be sized to a mean diameter
of from about 70 to about 200 nm, more preferably about 90 to about
130 nm. Several techniques are available for sizing liposomes to a
desired size. One sizing method is described in U.S. Pat. No.
4,737,323, incorporated herein by reference. Sonicating a liposome
suspension either by bath or probe sonication produces a
progressive size reduction down to small unilamellar vesicles
(SUVs) less than about 0.05 microns in size. Homogenization is
another method which relies on shearing energy to fragment large
liposomes into smaller ones. In a typical homogenization procedure,
multilamellar vesicles are recirculated through a standard emulsion
homogenizer until selected liposome sizes, typically between about
0.1 and 0.5 microns, are observed. In both methods, the particle
size distribution can be monitored by conventional laser-beam
particle size determination. For the methods herein, extrusion is
used to obtain a uniform vesicle size.
[0106] Extrusion of liposome compositions through a small-pore
polycarbonate membrane or an asymmetric ceramic membrane results in
a relatively well-defined size distribution. Typically, the
suspension is cycled through the membrane one or more times until
the desired liposome complex size distribution is achieved. The
liposomes may be extruded through successively smaller-pore
membranes, to achieve a gradual reduction in liposome size. In some
instances, the lipid-nucleic acid compositions which are formed can
be used without any sizing.
[0107] The present invention further comprises a step of
neutralizing at least some of the surface charges on the lipid
portions of the lipid-nucleic acid compositions. By at least
partially neutralizing the surface charges, unencapsulated
antisense or other nucleic acid is freed from the lipid particle
surface and can be removed from the composition using conventional
techniques. Preferably, unencapsulated and surface adsorbed nucleic
acids is removed from the resulting compositions through exchange
of buffer solutions. For example, replacement of a citrate buffer
(pH about 4.0, used for forming the compositions) with a
HEPES-buffered saline (HBS pH about 7.5) solution, results in the
neutralization of liposome surface and antisense release from the
surface. The released antisense can then be removed via
chromatography using standard methods, and then switched into a
buffer with a pH above the pKa of the lipid used.
[0108] In other aspects, the present invention provides
lipid-encapsulated nucleic acid compositions, preferably prepared
by the methods recited above. Accordingly, preferred compositions
are those having the lipid ratios and nucleic acid preferences
noted above.
[0109] In still other aspects, the present invention contemplates
reversed-charge methods in which the lipid portion of the complex
contains certain anionic lipids and the component which is
encapsulated is a positively charged therapeutic agent. One example
of a positively charged agent is a positively charged peptide or
protein. In essentially an identical manner, liposome-encapsulated
protein is formed at a pH above the pKa of the anionic lipid, then
the surface is neutralized by exchanging the buffer with a buffer
of lower pH (which would also release surface-bound peptide or
protein).
[0110] IV. Pharmaceutical Preparations
[0111] The lipid-nucleic acid compositions prepared by the above
methods can be administered either alone or in mixture with a
physiologically-acceptable carrier (such as physiological saline or
phosphate buffer) selected in accordance with the route of
administration and standard pharmaceutical practice.
[0112] Pharmaceutical compositions comprising the lipid-nucleic
acid compositions of the invention are prepared according to
standard techniques and further comprise a pharmaceutically
acceptable carrier. Generally, normal saline will be employed as
the pharmaceutically acceptable carrier. Other suitable carriers
include, e.g., water, buffered water, 0.9% saline, 0.3% glycine,
and the like, including glycoproteins for enhanced stability, such
as albumin, lipoprotein, globulin, etc. In compositions comprising
saline or other salt containing carriers, the carrier is preferably
added following lipid particle formation. Thus, after the
lipid-nucleic acid compositions are formed, the compositions can be
diluted into pharmaceutically acceptable carriers such as normal
saline. The resulting pharmaceutical preparations may be sterilized
by conventional, well known sterilization techniques. The aqueous
solutions can then be packaged for use or filtered under aseptic
conditions and lyophilized, the lyophilized preparation being
combined with a sterile aqueous solution prior to administration.
The compositions may contain pharmaceutically acceptable auxiliary
substances as required to approximate physiological conditions,
such as pH adjusting and buffering agents, tonicity adjusting
agents and the like, for example, sodium acetate, sodium lactate,
sodium chloride, potassium chloride, calcium chloride, etc.
Additionally, the lipidic suspension may include lipid-protective
agents which protect lipids against free-radical and
lipid-peroxidative damages on storage. Lipophilic free-radical
quenchers, such as a-tocopherol and water-soluble iron-specific
chelators, such as ferrioxamine, are suitable.
[0113] The concentration of lipid-nucleic acid complexes in the
pharmaceutical formulations can vary widely, i.e., from less than
about 0.01%, usually at or at least about 0.05-5% to as much as 10
to 30% by weight and will be selected primarily by fluid volumes,
viscosities, etc., in accordance with the particular mode of
administration selected. For example, the concentration may be
increased to lower the fluid load associated with treatment. This
may be particularly desirable in patients having
atherosclerosis-associated congestive heart failure or severe
hypertension. Alternatively, complexes composed of irritating
lipids may be diluted to low concentrations to lessen inflammation
at the site of administration. In one group of embodiments, the
nucleic acid will have an attached label and will be used for
diagnosis (by indicating the presence of complementary nucleic
acid). In this instance, the amount of complexes administered will
depend upon the particular label used, the disease state being
diagnosed and the judgement of the clinician but will generally be
between about 0.01 and about 50 mg per kilogram of body weight,
preferably between about 0.1 and about 5 mg/kg of body weight.
[0114] As noted above, the lipid-therapeutic agent (nucleic acid)
compositions of the invention include polyethylene glycol
(PEG)-modified phospholipids, PEG-ceramide, or ganglioside
G.sub.M1-modified lipids or other lipids effective to prevent or
limit aggregation. Addition of such components does not merely
prevent complex aggregation, however, it may also provides a means
for increasing circulation lifetime and increasing the delivery of
the lipid-nucleic acid composition to the target tissues.
[0115] The present invention also provides lipid-nucleic acid
compositions in kit form. The kit will typically be comprised of a
container which is compartmentalized for holding the various
elements of the kit. The kit will contain the compositions of the
present inventions, preferably in dehydrated or concentrated form,
with instructions for their rehydration or dilution and
administration. In still other embodiments, the
lipid-encapsulated-therapeutic agent (nucleic acid) particles will
have a targeting moiety attached to the surface of the lipid
particle. Methods of attaching targeting moieties (e.g.,
antibodies, proteins, small molecule mimetics, vitamins,
oligosaccharides and hyaluronic acid) to lipids (such as those used
in the present compositions) are known to those of skill in the
art.
[0116] Dosage for the lipid-nucleic acid compositions will depend
on the ratio of nucleic acid to lipid and the administrating
physician's opinion based on age, weight, and condition of the
patient.
[0117] V. Methods of Introducing Lipid-Encapsulated Therapeutic
Agents into Cells
[0118] The lipid-therapeutic agent compositions of the invention
can be used for introduction of those therapeutic agents into
cells. In the case of nucleic acid-containing compositions, the
composition of the invention are useful for the introduction of
nucleic acids, preferably plasmids, antisense and ribozymes into
cells. Accordingly, the present invention also provides methods for
introducing a therapeutic agent such as a nucleic acid into a cell.
The methods are carried out in vitro or in vivo by first forming
the compositions as described above, then contacting the
compositions with the target cells for a period of time sufficient
for transfection to occur.
[0119] The compositions of the present invention can be adsorbed to
almost any cell type. Once adsorbed, the complexes can either be
endocytosed by a portion of the cells, exchange lipids with cell
membranes, or fuse with the cells. Transfer or incorporation of the
nucleic acid portion of the complex can take place via any one of
these pathways. In particular, when fusion takes place, the
liposome membrane is integrated into the cell membrane and the
contents of the liposome combine with the intracellular fluid.
Contact between the cells and the lipid-nucleic acid compositions,
when carried out in vitro, will take place in a biologically
compatible medium. The concentration of compositions can vary
widely depending on the particular application, but is generally
between about 1 .mu.mol and about 10 mmol. Treatment of the cells
with the lipid-nucleic acid compositions will generally be carried
out at physiological temperatures (about 37.degree. C.) for periods
of time of from about 1 to 6 hours, preferably of from about 2 to 4
hours. For in vitro applications, the delivery of nucleic acids can
be to any cell grown in culture, whether of plant or animal origin,
vertebrate or invertebrate, and of any tissue or type. In preferred
embodiments, the cells will be animal cells, more preferably
mammalian cells, and most preferably human cells.
[0120] In one group of preferred embodiments, a lipid-nucleic acid
particle suspension is added to 60-80% confluent plated cells
having a cell density of from about 10.sup.3 to about 10.sup.5
cells/mL, more preferably about 2'10.sup.4 cells/mL. The
concentration of the suspension added to the cells is preferably of
from about 0.01 to 0.2 .mu.g/mL, more preferably about 0.1
.mu.g/mL.
[0121] Typical applications include using well known transfection
procedures to provide intracellular delivery of DNA or mRNA
sequences which code for therapeutically useful polypeptides. In
this manner, therapy is provided for genetic diseases by supplying
deficient or absent gene products (i.e., for Duchenne's dystrophy,
see Kunkel, et al., Brit. Med. Bull. 45(3):630-643 (1989), and for
cystic fibrosis, see Goodfellow, Nature 341:102-103 (1989)). Other
uses for the compositions of the present invention include
introduction of antisense oligonucleotides in cells (see, Bennett,
et aL, Mol. Pharm. 41:1023-1033 (1992)).
[0122] Alternatively, the compositions of the present invention can
also be used for the transfection of cells in vivo, using methods
which are known to those of skill in the art. In particular, Zhu,
et al., Science 261:209-211 (1993), incorporated herein by
reference, describes the intravenous delivery of cytomegalovirus
(CMV)-chloramphenicol acetyltransferase (CAT) expression plasmid
using DOTMA-DOPE complexes. Hyde, et al., Nature 362:250-256
(1993), incorporated herein by reference, describes the delivery of
the cystic fibrosis transmembrane conductance regulator (CFTR) gene
to epithelia of the airway and to alveoli in the lung of mice,
using liposomes. Brigham, et al., Am. J. Med. Sci. 298:278-281
(1989), incorporated herein by reference, describes the in vivo
transfection of lungs of mice with a functioning prokaryotic gene
encoding the intracellular enzyme, chloramphenicol
acetyltransferase (CAT). Thus, the compositions of the invention
can be used in the treatment of infectious diseases.
[0123] For in vivo administration, the pharmaceutical compositions
are preferably administered parenterally, i.e., intraarticularly,
intravenously, intraperitoneally, subcutaneously, or
intramuscularly. More preferably, the pharmaceutical compositions
are administered intravenously or intraperitoneally by a bolus
injection. For example, see Stadler, et al., U.S. Pat. No.
5,286,634, which is incorporated herein by reference. Intracellular
nucleic acid delivery has also been discussed in Straubringer, et
al., METHODS IN ENZYMOLOGY, Academic Press, New York. 101:512-527
(1983); Mannino, et al., Biotechniques 6:682-690 (1988); Nicolau,
et al., Crit. Rev. Ther. Drug Carrier Syst. 6:239-271 (1989), and
Behr, Acc. Chem. Res. 26:274-278 (1993). Still other methods of
administering lipid-based therapeutics are described in, for
example, Rahman et al., U.S. Patent No. 3,993,754; Sears, U.S. Pat.
No. 4,145,410, Papahadjopoulos et al., U.S. Pat. No. 4,235,871;
Schneider, U.S. Pat. No. 4,224,179; Lenk et al., U.S. Pat. No.
4,522,803; and Fountain et al., U.S. Pat. No. 4,588,578.
[0124] In other methods, the pharmaceutical preparations may be
contacted with the target tissue by direct application of the
preparation to the tissue. The application may be made by topical,
"open" or "closed" procedures. By "topical", it is meant the direct
application of the pharmaceutical preparation to a tissue exposed
to the environnent, such as the skin, oropharynx, external auditory
canal, and the like. "Open" procedures are those procedures which
include incising the skin of a patient and directly visualizing the
underlying tissue to which the pharmaceutical preparations are
applied. This is generally accomplished by a surgical procedure,
such as a thoracotomy to access the lungs, abdominal laparotomy to
access abdominal viscera, or other direct surgical approach to the
target tissue. "Closed" procedures are invasive procedures in which
the internal target tissues are not directly visualized, but
accessed via inserting instruments through small wounds in the
skin. For example, the preparations may be administered to the
peritoneum by needle lavage. Likewise, the pharmaceutical
preparations may be administered to the meninges or spinal cord by
infusion during a lumbar puncture followed by appropriate
positioning of the patient as commonly practiced for spinal
anesthesia or metrazamide imaging of the spinal cord.
Alternatively, the preparations may be administered through
endoscopic devices.
[0125] The lipid-nucleic acid compositions can also be administered
in an aerosol inhaled into the lungs (see, Brigham, et al., Am. J.
Sci. 298(4):278-281 (1989)) or by direct injection at the site of
disease (Culver, HUMAN GENE THERAPY, MaryAnn Liebert, Inc.,
Publishers, New York. pp.70-71 (1994)).
[0126] The methods of the present invention may be practiced in a
variety of hosts. Preferred hosts include mammalian species, such
as humans, non-human primates, dogs, cats, cattle, horses, sheep,
and the like.
[0127] VI. Examples
[0128] Materials and Methods:
[0129] Lipids
[0130] Distearoylphosphatidylcholine (DSPC), sphingomyelin (SM),
and palmitoyloleoylphosphatidylcholine (POPC) were purchased from
Northern Lipids (Vancouver, Canada).
1,2-dioleoyloxy-3-dimethylammoniumpropane (DODAP or AL-1) was
synthesized by Dr. Steven Ansell (Inex Pharmaceuticals) or,
alternatively, was purchased from Avanti Polar Lipids. Cholesterol
was purchased from Sigma Chemical Company (St. Louis, Mo., USA).
PEG-ceramides were synthesized by Dr. Zhao Wang at Inex
Pharmaceuticals Corp. using procedures described in PCT WO
96/40964, incorporated herein by reference. [.sup.3H] or
[.sup.14C]-CHE was purchased from NEN (Boston, Mass., USA). All
lipids were >99% pure.
[0131] Buffers and Solvents
[0132] Ethanol (95%), methanol, chloroform, citric acid, HEPES and
NaCl were all purchased from commercial suppliers.
[0133] Synthesis and Purification of Phosphorothioate Antisense
[0134] PS 3082, a 20 mer phosphorothioate antisense
oligodeoxynucleotide, was synthesized, purified and donated by ISIS
Pharmaceuticals (Carlsbad, Calif., USA). The sequence for this
oligo is: TGCATCCCCCAGGCCACCAT. (Seq ID No 1) The details of the
synthesis and purification can be found elsewhere (see, Stepkowski,
et al., J. Immunol. 153:5336-5346 (1994)).
[0135] Preparation of Liposomal Antisense
[0136] Lipid stock solutions were prepared in 95% ethanol at 20
mg/mL (PEG-Ceramides were prepared at 50 mg/mL). DSPC, CHOL, DODAP,
PEG-CerC14 (25:45:20:10, molar ratio), 13 .mu.mol total lipid, were
added to a 13.times.100 mm test tube containing trace amounts of
[.sup.14C]-cholesterylhexadecylether. The final volume of the lipid
mixture was 0.4 mL. In some experiments, SM or POPC was substituted
for DSPC. A 20 mer antisense oligodeoxynucleotide, PS 3082 (2 mg),
and trace amounts of [.sup.3H]-PS 3082 were dissolved in 0.6 mL of
300 mM citric acid, pH 3.8 in a separate 13.times.100 mm test tube.
The antisense solution was warmed to 65.degree. C. and the lipids
(in ethanol) were slowly added, mixing constantly. The resulting
volume of the mixture was 1.0 mL and contained 13 .mu.mol total
lipid, 2 mg of antisense oligodeoxynucleotide, and 38% ethanol,
vol/vol. The antisense-lipid mixture was subjected to 5 cycles of
freezing (liquid nitrogen) and thawing (65.degree. C.), and
subsequently was passed 10X through three stacked 100 nm filters
(Poretics) using a pressurized extruder apparatus with a
thermobarrel attachment (Lipex Biomembranes). The temperature and
pressure during extrusion were 65.degree. C. and 300-400 psi
(nitrogen), respectively. The extruded preparation was diluted with
1.0 mL of 300 mM citric acid, pH 3.8, reducing the ethanol content
to 20%. The preparation was immediately applied to a gel filtration
column. Alternatively, the extruded sample was dialyzed (12 000-14
000 MW cutoff; SpectraPor) against several liters of 300 mM citrate
buffer, pH 3.8 for 3-4 hours to remove the excess ethanol. The
sample was subsequently dialyzed against HBS, pH 7.5, for 12-18
hours to neutralize the DODAP and release any antisense that was
associated with the surface of the vesicles. The free antisense was
removed from the encapsulated liposomal antisense by gel exclusion
chromatography as described below.
[0137] Gel Filtration Chromatography
[0138] A 20.times.2.5 cm glass column containing Biogel A15m,
100-200 mesh, was equilibrated in HEPES-buffered saline (HBS; 20 mM
HEPES, 145 mM NaCl, pH 7.5). The 2.0 mL liposomal antisense
preparation was applied to the column and allowed to drain into the
gel bed under gravity. The column was eluted with HBS at a flow
rate of 50 mL/hr. Column fractions (1.0 mL) were collected and
analyzed for radioactivity using standard liquid scintillation
counting techniques. The fractions were pooled based on the levels
of [.sup.14C]-CHE present in the fraction. The size distribution of
the pooled liposomal antisense was determined using a NICOMP Model
370 Sub-micron particle sizer and was typically 110.+-.30 nm.
[0139] Ion Exchange Chromatography
[0140] As an alternative to gel filtration chromatography, samples
were sometimes dialyzed first in 300 mM citrate, pH 3.80, for 2-3
hours to remove residual ethanol, followed by at least a 12 hour
dialysis in HBS, to exchange the external citrate for HBS and
remove residual ethanol. The sample was applied to a 1.5.times.8 cm
DEAE-Sepharose.RTM. column equilibrated in HBS. Free
oligonucleotide binds to the DEAE with very high affinity. The peak
containing the lipid was pooled, concentrated, and analyzed for
antisense content, as described below.
[0141] Assessment of Antisense Encapsulation
[0142] Antisense encapsulation was typically assessed by dual label
([.sup.3H]-antisense and [.sup.14C]-lipid) liquid scintillation
counting after gel filtration chromatography to separate the free
and encapsulated antisense. Antisense encapsulation was evaluated
by summing the total [.sup.3H]-antisense radioactivity associated
with the lipid peak and dividing by the total [.sup.3H]-antisense
radioactivity. Alternatively, the [.sup.3H]/[.sup.14C] ratio was
determined before and after (i.e., in the pooled lipid peak) gel
filtration chromatography. Antisense encapsulation was also
assessed by measuring the absorbance of the sample at 260 nm,
preceded by a Bligh and Dyer extraction of the antisense from the
lipid, as described below.
[0143] Extraction of the Antisense
[0144] The antisense was extracted from the lipid according to the
procedure outlined by Bligh and Dyer (Bligh, et al., Can. J
Biochem. Physiol. 37:911-917 (1959)). Briefly, up to 250 .mu.L of
aqueous sample was added to a 13.times.100 mm glass test tube,
followed by the addition of 750 .mu.L of chloroform:methanol
(1:2.1, vol/vol), 250 .mu.L of chloroform, and 250 .mu.L of
distilled water. The sample was mixed after each addition. The
sample was centrifuged for 10 min. at 3000 rpm, resulting in a
clear two-phase separation. The aqueous phase (top) was removed
into a new 13.times.100 mm test tube. An aliquot (500 .mu.L) of
this phase was diluted with 500 .mu.L of distilled water, mixed,
and the absorbance at 260 nm was assessed using a
spectrophotometer. In some instances, the organic phase (bottom)
was washed with 250 .mu.L of methanol, centrifuged for 10 min. at
3000 rpm, and the upper phase removed and discarded. This was
repeated 3 times. The washed organic phase was assessed for
phospholipid content according to the method of Fiske and Subbarrow
(Fiske, et al., J Biol. Chem. 66:375-400 (1925)).
[0145] OLIGREEN Assay
[0146] A fluorescent dye binding assay for quantifying single
stranded oligonucleotide in aqueous solutions was established using
a Biolumin.TM. 960 fluorescent plate reader (Molecular Dynamics,
Sunnyvale, Calif., USA). Briefly, aliquots of encapsulated
oligonucleotide were diluted in HEPES buffered saline (HBS; 20mM
HEPES, 145mM NaCl, pH 7.5). A 10 .mu.L aliquot of the diluted
sample was added to 100 .mu.L of a 1:200 dilution of Oligreen.TM.
reagent, both with and without 0.1% of Triton X-100 detergent. An
oligo standard curve was prepared with and without 0.1% Triton
X-100 for quantification of encapsulated oligo. Fluorescence of the
OLIGREEN.TM.-antisense complex was measured using excitation and
emission wavelengths of 485 nm and 520 nm, respectively. Surface
associated antisense was determined by comparing the fluorescence
measurements in the absence and presence of detergent.
[0147] Ear Inflammation Model and Efficacy Studies
[0148] Sensitization and Elicitation of Contact Sensitivity
[0149] Mice were sensitized by applying 25 .mu.L of 0.5%
2,4-dinitro-1-fluorobenzene (DNFB) in acetone:olive oil (4:1) to
the shaved abdominal wall for two consecutive days. Four days after
the second application, mice were challenged on the dorsal surface
of the left ear with 10 .mu.L of 0.2% DNFB in acetone:olive oil
(4:1). Mice received no treatment on the contralateral (right) ear.
In some cases, control mice received 10 .mu.L of vehicle on the
dorsal surface of the left ear.
[0150] Evaluation of Ear Swelling
[0151] Ear thickness was measured immediately prior to ear
challenge, and at various time intervals after DNFB challenge,
using an engineer's micrometer (Mitutoyo, Tokyo, Japan). Increases
in ear thickness measurements were determined by subtracting the
pre-challenge from post-challenge measurements.
[0152] The progression of ear inflammation over a 3 day period for
ICR (outbred) mice is indicated in FIGS. 12 and 13. Erythema was
evident almost immediately after ear challenge and gradually
declined in intensity over the remainder of the study. ICR mice
exhibited peak ear thickness at 24 hours after the induction of ear
inflammation. Maximal ear thickness measurements were found to be
170.times.10.sup.-4 inches, corresponding to a 70% increase in ear
thickness. Although ear swelling gradually declines at 48 and 72
hours after inflammation initiation, ear measurements still have
not returned to baseline thickness levels (90-100.times.10.sup.-4
inches).
[0153] The mouse in vivo experimental systems in this specification
were selected in part because of their high degree of correlation
to human disease conditions. The mouse ear inflammation model ,
which can be treated using methods and compositions of the
invention, is well known to be an excellent model for human
allergic contact dermatitis and other disease conditions. The.
control therapeutic used in this model is a corticosteroid which
demonstrates efficacy both in the mouse model and in related human
disease conditions.
[0154] The mouse B16 tumor model, a fast growing melanoma, which
can be treated using methods and compositions of the invention, is
a standard, widely used experimental system. This tumor model can
be successfully treated using vinca alkaloids, such as vincristine
or vinblastine, which are known to be efficacious against human
tumors as well.
[0155] Treatments which demonstrate utility in the mouse models of
this invention are excellent candidates for testing against human
disease conditions, at similar dosages and administration
modalities.
EXAMPLE 1
[0156] This example illustrates the effects of ethanol on the
encapsulation of antisense.
[0157] A 20 mer of [.sup.3H]-phosphorothioate antisense
oligodeoxynucleotide (in 300 mM citrate buffer, pH 3.80) was mixed
with an ethanol solution of lipid (DSPC:CHOL:DODAP: PEG-CerC14;
25:45:20:10, molar ratio) at final concentrations of 2 mg/mL and
9.9 mg/mL, respectively. The final ethanol concentration in the
preparations was varied between 0 and 60%, vol/vol. The samples
were extruded ten times through three 100 mn filters as described
in "Materials and Methods". The samples were dialyzed for 2-3 hours
in 300 mM citrate buffer, pH 3.80, to remove a majority of the
excess ethanol. The samples were switched to HEPES-buffered saline
(HBS), pH 7.50, and dialyzed for a minimum of 12 hours to replace
the external citrate buffer with HBS. This renders the majority of
DODAP in the outer bilayer neutral, and will release any surface
bound antisense. Non-encapsulated antisense was then removed from
the liposomal antisense by DEAE-sepharose chromatography as
described in "Material and Methods". Encapsulation was assessed
either by analyzing the pre-column and post-column ratios of
[.sup.3H]-antisense and [.sup.14C]-lipid or by determining the
total pre-column and post-column [.sup.3H]-antisense and
[.sup.14C]-lipid radioactivity.
[0158] In another experiment, the formulations were prepared as
described. After extrusion, the filters were analyzed for
[.sup.3H]-antisense and [.sup.14C]-lipid radioactivity by standard
scintillation counting techniques. Results were expressed as a
percent of the total initial radioactivity.
[0159] FIG. 3 demonstrates the effects of ethanol on the
encapsulation of antisense at pH 3.8. The encapsulation efficiency
of phosphorothioate antisense increases in a near linear manner up
to a final ethanol concentration of 50%, vol/vol. At an ethanol
content greater than 50%, a large amount of
aggregation/precipitation is observed. The effect of ethanol on
vesicle formation can be further observed by monitoring both lipid
and antisense loss on the filters during extrusion (FIG. 4). At low
ethanol contents, extrusion is slow and the proportion of lipid and
antisense loss is the same, suggesting that the losses are due to
the formation of large complexes which get trapped on the filter.
At ethanol contents of 30 and 40%, extrusion is very quick and
losses of both lipid and antisense are minimal. As the ethanol
content is increased above 40%, the loss of antisense becomes
disproportionally high relative to the lipid. This can be
attributed to the insolubility of DNA in high concentrations of
alcohol. Furthermore, in the presence of ethanol, PEG is required
to prevent aggregation and fusion of the vesicles (results not
shown).
EXAMPLE 2
[0160] This example illustrates the effects of DODAP on the
encapsulation of antisense, and further illustrates the effect of
initial antisense concentration on the compositions.
[0161] Having demonstrated that ethanol can greatly facilitate the
preparation of lipid vesicles containing entrapped antisense, the
next step was to examine the influence of DODAP (AL-1) content on
the encapsulation of antisense (FIG. 5). Accordingly, a 0.6 mL
aliquot of a [.sup.3H]-phosphorothioate antisense
oligodeoxynucleotide (in 300 mM citrate buffer, pH 3.80) was mixed
with 0.4 mL of a 95% ethanol solution of lipid
(DSPC:CHOL:DODAP:PEG-CerC14; 100-(55+X):45:X:10, molar ratio) at
final concentrations of 2 mg/mL and 9.9 mg/mL, respectively. The
molar ratio of DODAP was varied between 0 and 30%. The molar ratio
of DSPC was adjusted to compensate for the changes in DODAP
content. The samples were extruded ten times through three 100 nm
filters as described in "Materials and Methods", and were dialyzed
for 2-3 hours in 300 mM citrate buffer, pH 3.80', to remove a
majority of the excess ethanol. The samples were switched to
HEPES-buffered saline (HBS), pH 7.50, and dialyzed for a minimum of
12 hours to replace the external citrate buffer with HBS.
Non-encapsulated antisense was then removed from the liposomal
antisense by DEAE-sepharose chromatography as described in
"Material and Methods". Encapsulation was assessed either by
analyzing the pre-column and post-column ratios of
[.sup.3H]-antisense and [.sup.14C]-lipid or by determining the
total pre-column and post-column [.sup.3H]-antisense and
[.sup.14C]-lipid radioactivity. As seen in FIG. 5, antisense
encapsulation increased significantly between 5-20% DODAP. At DODAP
contents greater than 20-25%, extrusion of the vesicles became more
difficult suggesting the formation of complexes. At DODAP
concentration of 40 and 50%, extrusion of the lipid/antisense
mixture took hours compared to minutes for a lipid composition
containing 20% DODAP. To verify that the antisense was indeed
associated with the lipid and that the observed encapsulation was
not due to exchange of the [.sup.3H]-label from the antisense onto
the lipid, the antisense was extracted from the lipid using a Bligh
and Dyer extraction. Using this technique, the antisense, which is
soluble in the aqueous phase, was separated from the lipid (soluble
in the organic phase) and quantified by measuring the absorbance at
260 nm (FIG. 6). While this method can underestimate the antisense
concentration, the technique substantiated that the observed
association of antisense with the lipid was not an artifact.
[0162] In yet another experiment, varying concentrations of a 20
mer of [.sup.3H]-phosphorothioate, antisense oligodeoxynucleotide
(in 300 mM citrate buffer, pH 3.80) were mixed with an ethanol
solution of lipid (DSPC:CHOL:DODAP:PEG-CerC14; 25:45:20:10, molar
ratio), 9.9 mg/mL (final concentration). The samples were extruded
and dialyzed twice as described above. Non-encapsulated antisense
was then removed from the liposomal antisense by DEAE-sepharose
chromatography as described in "Material and Methods".
Encapsulation was assessed either by analyzing the pre-column and
post-column ratios of [.sup.3H]-antisense and [.sup.14C]-lipid or
by determining the total pre-column and post-column
[.sup.3H]-antisense and [.sup.14C]-lipid radioactivity. EPC:CH
liposomes containing encapsulated antisense are included for
comparison.
[0163] Optimization of the drug:lipid ratio was accomplished by
increasing the initial antisense concentration that was mixed with
9.8 mg total lipid (DSPC:CHOL:DODAP:PEG-CerC14; 25:45:20:10) (FIG.
8). Drug:lipid ratios of up to 0.25, w/w, were obtained using 10
mg/mL of antisense in the preparation. However, the increased
drug:lipid ratio was accompanied by a decrease in encapsulation
efficiency, therefore a compromise must be made between optimizing
the drug:lipid ratio and encapsulation efficiency. In comparison,
antisense encapsulated by hydration of a dry lipid film (i.e.
EPC:CHOL) in the absence of cationic lipid typically yields low
encapsulation efficiencies (<12-15%) and drug:lipid ratios
(<0.1, w/w). Consequently, significant quantities of antisense
are wasted during the encapsulation procedure.
EXAMPLE 3
[0164] This example illustrates the properties of the liposomal
antisense formulations provided in the Materials and Methods
above.
[0165] The size distribution of a liposomal preparation of
antisense was determined by quasi-elastic light scattering (QELS)
immediately after removal of the free antisense (A), and after
storage of the preparation for 2 months at 4.degree. C. (B), using
a Nicomp Model 370 sub-micron particle sizer. A 0.6 mL aliquot of a
[.sup.3H]-phosphorothioate antisense oligodeoxynucleotide (in 300
mM citrate buffer, pH 3.80) was mixed with 0.4 mL of a 95% ethanol
solution of lipid (DSPC:CHOL:DODAP:PEG-CerC14; 25:45:20:10, molar
ratio) at final concentrations of 2 mg/mL and 9.9 mg/mL,
respectively. The sample was extruded ten times through three 100
nm filters as described in "Materials and Methods", and dialyzed
for 2-3 hours in 300 mM citrate buffer, pH 3.80, to remove a
majority of the excess ethanol. The sample was switched to
HEPES-buffered saline (HBS), pH 7.50, and dialyzed for a minimum of
12 hours to replace the external citrate buffer with HBS.
Non-encapsulated antisense was then removed from the liposomal
antisense by DEAE-sepharose chromatography as described in
"Material and Methods".
[0166] The size distribution and storage stability of antisense
preparations described herein is demonstrated in FIG. 7. The size
distribution of a standard DSPC:CHOL:DODAP: PEG-CerC14
(25:45:20:10) preparation containing a 2 mg/mL initial antisense
concentration was analyzed immediately after column chromatography
to remove any free antisense. A very homogenous distribution is
observed after preparation (119.+-.32 nm). This size distribution
remained stable for at least 2 months after storage at 4.degree. C.
(119.+-.32 nm).
EXAMPLE 4
[0167] This example illustrates the clearance pharmacokinetics,
biodistribution and biological activity of an encapsulated murine
ICAM-1 phosphorothioate antisense oligodeoxynucleotide.
[0168] 4.1 Plasma Clearance
[0169] Encapsulated liposomal antisense was prepared using the
ethanol-citrate procedure as described in "Material and Methods".
Initial lipid and antisense concentrations were 9.9 and 2 mg/mL,
respectively. Liposomal formulations were composed of
X:CHOL:DODAP:PEG-CerC14 (25:45:20:10), where X represents either
distearoylphosphatidylcholine (DSPC), sphingomyelin (SM), or
palmitoyloleoylphosphatidylcholine (POPC). The formulations
contained a lipid label ([.sup.14C]-cholesterylhexadecyl- ether)
and [.sup.3H]-antisense and were injected (200 .mu.L) intravenously
via the lateral tail vein of female (20-25 g) ICR mice at a lipid
dose of 120 mg/kg. Blood was recovered by cardiac puncture on
anesthetized mice. Lipid and antisense recoveries were determined
by standard scintillation counting techniques.
[0170] The plasma clearance of three formulations,
DSPC:CHOL:DODAP:PEG-Cer- C14, SM:CHOL:DODAP:PEG-CerC14, and
POPC:CHOL:DODAP:PEG-CerC14, of encapsulated antisense were examined
in inflamed ICR mice (FIG. 9). The circulation time was longest for
the DSPC version of the formulation.
[0171] 4.2 Organ Accumulation
[0172] Liposomal antisense compositions were prepared and
administered to mice as outlined in the preceding section. Mice
were terminated by cervical dislocation and the organs were
recovered and processed as described in "Materials and Methods".
Lipid and antisense recoveries were determined by standard
scintillation counting techniques.
[0173] Organ accumulation of the various formulations was typical
of previously described liposome clearance patterns, with the RES
organs, principally the liver and spleen, being responsible for the
majority of clearance (FIG. 10). One interesting observation is
that the liver and spleen clearance account for only 40-45% of the
total clearance of the "DSPC" formulation, suggesting that a
significant population of vesicles is accumulating in another organ
system or is being excreted.
[0174] 4.3 Stability.
[0175] Liposomal antisense compositions were prepared and
administered to mice as outlined in the preceding section. Blood
was recovered by cardiac puncture on anesthetized mice. Lipid and
antisense recoveries were determined by standard scintillation
counting techniques. Release rates were determined by measuring the
[3H]/[14C] ratio over time.
[0176] The stability of the formulations was also assessed by
measuring the ratio of antisense and lipid recovery in the blood at
various times (FIG. 11). A ratio of 1.0 suggests that the antisense
and the lipid are staying together in the circulation. The "DSPC"
formulation showed little deviation from a ratio of 1.0 over 24 h,
suggesting that it is very stable in the circulation. The "POPC"
formulation dropped to a ratio of 0.6 after 2 h, while the ratio
for the "SM" formulation decreased more slowly, reaching 0.6 after
12 h in the circulation. These results indicate that it may be
possible to deliberately alter the antisense release rates by
modifying the lipid composition.
[0177] 4.4 PEG-Acyl Influence on Circulation Half-life of Single
Dose of Thioate Antisense
[0178] Encapsulated lipid-encapsulated anfisense was prepared using
the ethanol-citrate procedure as described in "Material and
Methods". Initial lipid and antisense concentrations were 9.9 and 2
mg/mL, respectively. Liposomal formulations were composed of
DSPC:CHOL:DODAP:PEG-CerC14 or C20 (25:45:20:10). The formulation
contained a lipid label ([.sup.14C]-cholesterylhexadecylether) and
[.sup.3H]-antisense and were injected (200 .mu.L) intravenously via
the lateral tail vein of female (20-25 g) ICR mice at a lipid dose
of 120 mg/kg. Blood was recovered by cardiac puncture on
anesthetized mice. Lipid and antisense recoveries were determined
by standard scintillation counting techniques.
[0179] The influence of PEG-acyl chain length on clearance rates of
a DSPC:CHOL:DODAP:PEG-Cer formulation was investigated using
PEG-CerC14 and PEG-CerC20 (FIG. 12). The inclusion of PEG-CerC20 in
the formulation resulted in enhanced circulation times over the
PEG-CerC14. This corresponds to in vitro data suggesting that the
C14 version of the PEG is exchanged much more rapidly out of the
vesicle than the C20 version.
[0180] 4.5 In vivo Efficacy of Single Dose of Lipid Encapsulated
ICAM-1 (phosphorothioate) Antisense
[0181] The efficacy of PS-3082 encapsulated in various lipid
formulations containing DODAP was tested in an ear inflammation
model using ICR mice.
[0182] Inflamed mice were treated at the time of ear challenge with
a 30 mg/kg i.v. dose of either HBS (no oligo), EPC:CHOL liposomes
with entrapped PS-3082 (identified as AS 1000),
POPC:CHOL:DODAP:PEG-CerC14 with entrapped PS-3082 (identified as AS
4100), or DSPC:CHOL:DODAP:PEG-CerC14 with entrapped PS-3082
(identified as AS 4200). Ear swelling was measured at 24 hours
after initiating inflammation using an engineer's micrometer.
[0183] Ear swelling measurements were made 24 hours after
initiating inflammation in mice treated i.v. at the time of ear
challenge with either HBS (control), PS-3082 encapsulated in
EPC:CHOL vesicles (30 mg/kg dose of oligo), PS-3082 encapsulated in
POPC:CHOL:DODAP:PEG-CerC14 vesicles (30 mg/kg dose of oligo), or
PS-3082 encapsulated in DSPC:CHOL:DODAP:PEG-CerC14 vesicles (30
mg/kg dose of oligo) (FIG. 13). The "DSPC" formulation resulted in
the greatest efficacy, exhibiting only 10% increase in ear swelling
over pre-challenge values. A similar trend was observed for
cellular infiltration into the "challenged" ear versus the
non-treated ear (FIG. 14).
[0184] In another evaluation, mice received 10 .mu.Ci of
[.sup.3H]-methylthymidine, i.p., 24 hours before initiating
inflammation. Inflamed mice were treated at the time of ear
challenge with a 30 mg/kg i.v. dose of either HBS (no oligo),
EPC:CHOL liposomes with entrapped PS-3082 (identified as AS 1000),
POPC:CHOL:DODAP:PEG-CerC14 with entrapped PS-3082 (identified as AS
4100), or DSPC:CHOL:DODAP:PEG-CerC14 with entrapped PS-3082
(identified as AS 4200). Cell infiltration was monitored by
measuring the radioactivity in the "challenged ear" versus the
non-treated ear. Results are expressed as the ratio of
radioactivity in the left (challenged ear) versus right ear.
[0185] 4.6 In vivo Efficacy of single Dose of Lipid Encapsulated
ICAM-1 (phosphodiester) Antisense
[0186] This experiment demonstrates the in vivo efficacy of a
phosphodiester antisense oligodeoxynucleotide encapsulated in lipid
particles according to the invention. In specific, the
phosphodiester was targeted to the ICAM-1 gene in an ear
inflammation model.
3!Group? Test Sample Drug? Dose? Time Point 1 control inflammation
- HBS 200 .mu.l 24 hr 2 corticosteroid 200 .mu.l 24 hr 3 empty
vesicles 200 .mu.l 24 hr 4 PS-3082 200 .mu.l 24 hr 5 PO-3082 200
.mu.l 24 hr
[0187] Antisense Sample Preparation:
[0188] Antisense was encapsulated using the standard methods of
Examples 5-9, using the phosphodiester modification. The
phosphodiester formulation used 10-50 mM citrate (preferably 20 mM
citrate), pH 4.0 instead of 300 mM citrate, pH 4.0 preferred for
phosphorothioates. Empty vesicles consisted of lipid components
only. Corticosteroid (either Halobetasol propionate 0.05% by weight
(Westwood Squibb, Montreal) or Dexamethasone (50 ug dissolved in
4:1 acetone:olive oil)) was applied topically in a thin film to
cover the surface of the ear 15 minutes after ear challenge.
[0189] Inflammation and Dosing:
[0190] Mouse ear inflammation was induced using DNFB as described
above in Materials and Methods. Female ICR mice (6-8 weeks old)
received intravenous tail vein injections of antisense (200 .mu.l).
Antisense doses for the phosphorothioate and phosphodiester
antisense were adjusted to be 20-30 mg/kg. 6 mice were tested with
each formulation. Administration occurred 15 min. after the
application of 0.2% DNFB to the mouse ear. Ear measurements were
made on anaesthetized mice 24 hours after treatment (unless shown
otherwise) and prior to termination. Mice are terminated by
cervical dislocation and the ears are removed around the pinna.
Ears are then weighted, digested (Solvable) and analyzed for
radioactivity by liquid scintillation counting. Ears were analyzed
for 1) Ear edema--based on the increase in ear thickness due to ear
swelling. Calculated by subtracting pre-ear thickness values from
post-ear thickness values FIG. 21. 2) Cell infiltration - based on
radioactivity accumulated in the inflamed (right) ear vs. the
control (left) ear FIG. 22; and 3) Ear weights--left ear versus
right ear (measurement of edema) FIG. 23.
[0191] Results:
[0192] The controls consisting of buffer alone (HBS) or Empty
Vesicles alone demonstrated no efficacity. Topical corticosteroid
demonstrates its known excellent efficacity by reducing
inflammation to below pre-challenge levels. Both the
phosphorothioate and phosphodiester antisense show excellent
efficacy through a systemic delivery administration, reducing the
degree of inflammation by around 70% and 85%, respectively. Thus,
it is possible to administer the compositions of the invention at a
site where the disease site is distal to the site of the
injection.
[0193] 4.7 In vivo Efficacy of US3 Antisense (Tumor Window
Model)
[0194] In this example, the anti-tumor activity of lipid
encapsulated US3, an antisense oligonucleotide directed at the
erb-B-2 gene, has been demonstrated in an in vivo human breast
tumor model.
[0195] The human breast carcinoma line MDA-MB-453 was implanted in
a mouse tumor window model according to the method of Wu, N. Z.,
Da, D., Rudoll, T. L., Needham, D., Whorton, R. & Dewhirst, M.
W. 1993. Increased microvascular permeability contributes to
preferential accumulation of Stealth liposomes in tumor tissue.
Cancer Research 53: 3765-3770; and Dewhirst, M. W., Tso, C. Y.,
Oliver, R., Gustafson, C. S., Secomb, T. W., & Gross, J. F.
1989. Morpholigic and hemodynamic comparison of tumor and healing
normal tissue microvasculature. Int. J. Radiat. Oncol. Biol. Phys.
17: 91-99. See also Dewhirst, MW., and Needham, D. 1995.
Extravasation of Stealth Liposomes into Tumors: Direct Measurement
of Accumulation and Vascular Permeability using a Skin Flap Window
Chamber. In Stealth Liposomes (Eds. Lasic, D. and Martin, F.) CRC
Press.
[0196] The lipid-antisense formulation consists of
disteroylphosphatidylch- oline (DSPC, 25 mol%), cholesterol (Chol,
45 mol %), dioleoylphosphatidyldiaminopropane, (DODAP, or AL1, 20
mol %) and PEG-ceramide (C14 chain length, 10 mol %). For some
experiments detailed below, proportions and constituents were
altered, but the method of preparation remained the same. Lipids
were dissolved in ethanol at 20 mg/ml (PEG-ceramide at 50 mg/ml).
Routinely, 1 to 2 .mu.Ci .sup.14C-cholesterylhexadecylether was
added as a lipid radiolabel. Lipids were mixed in the correct
proportions in ethanol to a final concentration of 10 mg in 400
.mu.l. The lipid mixture was then added dropwise to
phosphorothioated antisense (US3: anti-human erb-B-2 GGT GCT CAC
TGC GGC (SEQ ID. No 3) dissolved in 300 mM citrate buffer pH 4.0
(600 .mu.l to make a final volume of 1 ml). The antisense was used
at a variety of concentrations, but the optimum concentration for
maximum encapsulation efficiency and drug:lipid ratio was
determined to be 0.5 mg/ml final. During the addition, the solution
becomes opaque. The DODAP is positively charged at pH 4.0
(pKa=6.53) and so attracts the negatively charged DNA molecules.
The mixture was subjected to five cycles of freezing in liquid
N.sub.2 and thawing at 65.degree. C. followed by extrusion through
100 nm filters ten times at 65.degree. C.
[0197] After extrusion, two methods can be used for removal of the
external antisense. Firstly, the liposomes are diluted 2:1 with
citrate (to reduce ethanol content to 20%) then applied to a
Bio-Gel A18M 100-200 mesh column equilibrated with HBS. The column
profiles shown in this report were generated in this manner.
Alternatively, the liposomes are dialysed 2 h against citrate to
remove ethanol, the overnight against HBS to increase the external
pH. The resulting mixture is then applied to a DEAE cation exchange
column to remove external oligo. This method was the routine method
used for sample preparation for in vivo studies. Antisense
concentrations were routinely determined by A260 measurements.
Lipid concentrations were determined by scintillation counting
after spiking initial mixture with a known concentration of .sup.3H
or .sup.14C cholesterylhexadecyl ether, or by HPLC. Encapsulation
efficiency was determined by division of the final drug to lipid
ratio by the initial drug to lipid ratio.
[0198] In vivo efficacy evaluation: When the tumor in the window
has reached a diameter of 2-3 mm, treatment with free or
TCS-encapsulated US3 oligonucleotide is initiated. Treatment
consists of a 200 ul intravenous administration (tail vein) of
either free US3 or TCS-encapsulated US3 on a 3 administrations/week
schedule and an antisense dose of 10 mg/kg/administration. Tumor
size is monitored 3 times per week by microscopy. Results: The
TCS-encapsulated US3 oligonucleotide was very effective at
preventing the growth, or causing extensive size reduction, of the
MDA-MB-453 human breast carcinoma in the window model. In contrast,
unencapsulated oligonucleotide was ineffective at inhibiting tumor
growth.
[0199] 4.8 In vivo Clearance of Various Formulations Using
Alternative Amino Lipids: DODAP or DODMA
[0200] Antisense particle formulations were prepared according to
Example 2, with the following modifications: In assay#l and #2, 25%
AL-1 (hydrochloride salt of DODAP) and 25% free base DODAP were
employed, respectively, with a concomitant reduction in the amount
of DSPC. Assay#3, 4 and 5 employed 30%, 25% and 20% DODMA (free
base (prepared at Inex Pharmaceuticals Corp., Burnaby BC)),
respectively, again with a concomitant reduction of DSPC.
[0201] Both the encapsulation efficiency and in vivo clearance of
the formulations were studied. There was no significant difference
between the encapsulation or clearance of the free base or HCl salt
of DODAP. Decreasing DODMA concentration (30, 25, 20%) severely
decreased the encapsulation efficiency of PS-2302 (91%, 43%, 35%)
and likewise the Drug/Lipid ratio of the resulting formulation.
[0202] In the clearance study outlined in FIG. 16, DODMA
formulations demonstrated slightly higher rates of clearance than
25% DODAP or AL-1, although all formulations appear to be retained
in the circulation to a degree which is suitable for human
therapeutics.
[0203] 4.9 PEG-acyl Influence on Clearance Rate of Repeat Doses of
Encapsulated EGF-R Phosphorothioate Antisense
[0204] Lipid -encapsulated antisense was prepared using the
ethanol-citrate procedure as described above, with changes to molar
ratios of components as indicated. Initial lipid and antisense
concentrations were about 9.9 and 2 mg/mL, respectively. DODAP
containing formulations had drug:lipid ratios of 0.15 (+/-) 0.05.
Passive encapsulation systems had drug:lipid ratios of 0.03. Nine
different liposomal formulations were prepared, using standard
techniques, in the following molar ratios:
4 Steric Barrier Antisense Formu- DSPC Chol DODAP Derivatized Lipid
(EGF-R lation (mol %) (mol %) (mol %) (name: mol %) 2 mg/ml) 1 55
45 Nil Nil Empty 2 50 45 Nil ATTA8-DSPE: 5 Empty 3 50 45 Nil
ATTA8-DSPE: 5 AS 4 20 45 30 ATTA8-DSPE: 5 AS 5 20 45 30 PEG-DSPE: 5
AS 6 25 45 25 PEG-CerC14: 5 Empty 7 25 45 25 PEG-CerC14: 5 AS 8 25
45 25 PEG-CerC20: 5 Empty 9 25 45 25 PEG-CerC20: 5 AS
[0205] Antisense ("AS") used was fully pbosphorothioated EGFR
(anti-human Epidermal Growth Factor Receptor) CCG TGG TCA TGC TCC
(SEQ ID. No 10) (prepared by Hybridon, Inc.)
[0206] PEG-CerC14 is PEG(mw2000)-Ceramide with 14 carbon acyl
chain.
[0207] PEG-CerC20 is PEG(mw2000)-Ceramide with 20 carbon acyl
chain.
[0208] PEG-DSPE is
PEG(mw2000)-1,2-distearoyl-sn-glycero-3-phosphoethanola- mine
ATTA8-DSPE is
N-(.omega.-N'-acetoxy-octa(14'amino-3',6',9',12'-tetrao-
xatetradecanoyl))-1,2-distearoyl-sn-glycero-3-phosphoethanolamine
(molec weight about 2660). Synthesis of ATTA8-DSPE is fully
disclosed in U.S. Provisional Pat. Application Ser. No. 60/073,852,
filed 23-Dec. -1997 and U.S. Provisional Pat. Application filed
2-Feb-1998 (Attorney Docket No.: TT&C 16303-005810) both
assigned to the assignee of the instant invention and incorporated
herein by reference.
[0209] Each formulation contained a lipid label
([.sup.14C]-cholesterylhex- adecylether) and [.sup.3H]-antisense,
as described in Example 4.4, above. All samples were prepared in
300 mM citrate pH 4.0 containing 40% ethanol and extruded 10X
through 100 nm filters. Formulations contained phosphorothioate
antisense and lipid or empty lipid alone. Samples were dialyzed in
HBS (20 mM Hepes, 145 mM NaCl, pH 7.45) to remove ethanol and
citrate. Sample lipid concentrations were adjusted such that the
injected lipid dose will be 1.8 .mu.mol/mouse/week (5-10 mg AS per
kg mouse/week). Samples were filtered (0.22 .mu.m) prior to
injection.
[0210] In this experiment female (20-25g) ICR mice (6-8 weeks old)
were divided into 9 groups of 6, plus other control groups. Each
group received four injections of the same formulation. All
injections were 200 .mu.L intravenous (via the lateral tail vein)
at a lipid dose of 120 mg/kg. Mice were dosed every week for 3
weeks (4 injections). At 4 weeks, certain groups (treated with
lipid and antisense) were given an injection of empty lipid
carriers of varying composition to evaluate whether there is rapid
clearance of the carrier in the absence of antisense. Blood (25
.mu.l, pipettor) was collected 1 h post-injection each week for 3
weeks by tail nicks. Mice were weighed each week to estimate blood
volume (8.0 ml whole blood/100 g body weight). Blood was placed in
a glass scintillation vial containing 200 .mu.l of 5% EDTA.
Solvable (500 .mu.l) was added and the blood was digested for 3 h
at 65.degree. C. Samples were decolorized by the addition of 100
.mu.l 70% hydrogen peroxide. Samples were analyzed for
radioactivity by liquid scintillation counting. At the end of 4
weeks, mice were terminated by CO.sub.2 inhalation or cervical
dislocation preceded by general anesthesia.
[0211] The results of this experiment are shown in FIG. 17. For all
formulations not containing antisense ("empty liposomes") repeat
dosages demonstrated circulation times reasonably consistent with
the first dosage. However, when antisense is used in the
formulation, it was surprisingly found that the acyl chain length
of the lipid derivatized to the steric barrier (i.e. ATTA or PEG)
moiety demonstrates a profound effect on clearance rates. Repeat
dosages of PEG-CerC20, PEG-DSPE and ATTA8-DSPE formulations are
rapidly cleared from the circulation compared to the first dosage,
whereas the PEG-CerC14 formulation is reasonably consistent with
the first dosage. Similar results are demonstrated in FIG. 18. The
formulations were identical to those of FIG. 17, with the
additional formulation of empty vesicles using the same lipids as
formulations 4 and 5.
[0212] Without intending to be bound by any particular theory of
action, it is suggested by these results that lipids like the
PEG-CerC14 lipid, a lipid which exchanges out of the liposome
membrane with a T1/2 on the order of minutes (i.e. 1-60mins) in
blood provides a tremendous benefit over lipids like PEG-CerC20,
PEG-DSPE and ATTA8-DSPE which do not exchange out, where repeat
dosing of a lipid-formulated compound, such as a therapeutic
compound or diagnostic compound, is required. The mammalian blood
clearance response may not recognize these as foreign antigens if
the derivatized lipid is removed expeditiously from the liposome
surface when in circulation. However, when the derivatized-lipid
remains with the formulation for extended periods, a clearance
response is invoked, which causes rapid clearance upon repeat
dosing. This data suggests that any lipid derivatized with a steric
barrier molecule that exchanges out of the liposome membrane faster
than PEG-CerC20, PEG-DSPE or ATTA8-DSPE will be superior for use in
repeat dosing. For example ATTA8-DMPE, or PEG-CerC8 to C18 all
being exchangeable, will have improved circulation characteristics
upon repeat administration.
[0213] Taken together, it will be evident to one skilled in the
art, that on the basis of these teachings, any diagnostic or
therapeutic agent that may be delivered in a lipid formulation
comprising a steric-barrier derivatized lipid, such as a PEG-lipid
or ATTA-lipid, should be tested with both a long and short
acyl-chain anchors, in order to determine which formulation is best
for repeat dosings.
[0214] Further, without intending to be bound by any theory of
action, the invention herein may prove to be particularly useful
when the bioactive agent being delivered is a non-cytotoxic agent.
Cytotoxic agents kill those cells which clear long circulating
(i.e. PEG-DSPE) liposomes. This ensures that repeat dosings will
not be rapidly cleared, because the cells responsible (usually
macrophages) do not survive. In these situations, the acyl-chain
length may not be significant. However, where the bioactive agent
is non-cytotoxic, such as in the case of antisense drugs
(regardless of chemistry or target), plasmids, proteins, etc., and
many conventional drugs, the invention will be useful for repeat
dosing.
[0215] 4.10 In vivo Efficacy of Repeat Doses of Encapsulated
Phosphorothioate C-myc Antisense in an Oncology Model.
[0216] In vivo efficacy of repeat injections of using formulations
of the invention are shown in a mouse tumor system in FIG. 19. This
experiment demonstrated efficacy of the antisense formulated
according to the invention in a human oncology model, and showed
the importance of PEG-acyl chain length on the efficacy of repeat
dosings.
[0217] Lipid-antisense Particle Formulation:
[0218] Formulations were prepared as described in these
Examples.
5 Steric Barrier Derivatized Antisense Formu- DSPC Chol DODAP Lipid
(c-myc lation (mol %) (mol %) (mol %) (name: mol %) 2 mg/ml) HBS
Empty Buffer AS4200 25 45 25 PEG-CerC14: 5 LR-3280 (c-myc) AS4204
25 45 25 PEG-CerC20: 5 LR-3280 (c-myc) AS4204 25 45 25 PEG-CerC20:
5 c-myc SCR (c-myc SCR) AS4204 25 45 25 PEG-CerC20: 5 PS-2302
(PS-2302) AS4204 25 45 25 PEG-CerC20: 5 PS-3208 (PS-3082) c-myc
LR-3280 c-myc c-myc SCR SCR PS-2302 PS-2302 PS-3082 PS-3082 AS4200
(no 25 45 25 PEG-CerC14: 5 Empty antisense) AS4204 (no 25 45 25
PEG-CerC20: 5 Empty antisense)
[0219] Antisense used were:
6 LR-3280: human c-myc gene (phosphorothioate) AAC GTT GAG GGG CAT
(SEQ ID. No 4) c-myc SCR: GAA CGG AGA CGG TTT (SEQ ID. No 17)
PS-2302 human ICAM-1 (phosphorothioate) GCCCAAGCTGGCATCCGTCA (SEQ
ID. No 2) PS-3082 murine ICAM-1 (Intracellular Adhesion Molecule-1)
(phosphorothioate) TGCATCCCCCAGGCCACCAT (SEQ ID. No 1)
[0220] Formulations were diluted in filtered HBS, pH 7.6 to achieve
required antisense dose (i.e. lipid dose decreases as well).
Samples were filtered (0.22 .mu.m) prior to injection. External
buffer was HBS (20 mM Hepes, 145 mM NaCl, pH 7.6). Free antisense
was dissolved in HBS and adjusted to the required dose by A260
(Extinction coefficients: active and control c-myc=30.6,
PS-2302=32.8, PS-3082=33.6).
[0221] Tumour Inoculum:
[0222] B 16/BL6 murine melanoma cells were maintained in culture in
MEM media supplemented with 10% FBS. On day 0 of the study,
3.times.10.sup.5 cells were injected sub-cutaneously (s.c.) into
the dorsal flank (injection volume: 50 .mu.l) of female C57BL/6
mice (20-23 g). Typically, 15% extra mice will be injected so
non-spheroidal tumours or mice in which no tumours are observed can
be excluded from the study. Tumours were allowed to grow for a
period of 5-7 days until tumors reached 50-100 mm.sup.3 prior to
initiating treatments with test samples/controls.
[0223] Treatment:
[0224] On the day of first treatment mice with acceptable tumours
were randomly grouped with 5 animals per group. Treatment began
when tumours were 50-100 mm.sup.3. Mice were dosed every other day
for a total of 7 doses. Administrations were via intravenous tail
vein injections (200 ul). Initial drug:lipid ratio of formulation
was 0.20 (w/w) and the final drug:lipid ratio (0.14) was held
constant; consequently, the lipid concentration varied as samples
were diluted to the desired antisense concentration. The antisense
dose was 10 mg/kg.
[0225] Endpoints:
[0226] Primary tumour volume was measured using calipers. Length
(mm) and width (mm) measurements were made every other day (on
non-injection days) for the duration of the study. Tumour height
measurements (mm) were made when feasible. Tumour volumes were
calculated using the following formulas:
Tumour Volume (mm.sup.3)=(L.times.W.sup.2)/2 #1
Tumour Volume (mm.sup.3)=(L.times.W.times.H).times..pi./6 #2
[0227] Mice were euthanized when tumour volumes reach 10% of body
weight or on the first signs of ulceration. Mouse weights were
recorded every day during the dosing portion of the study. On
termination, all tumours were excised, weighed, observed by FACS
analysis or by Northern/Western analysis. Mice were euthanized by
CO.sub.2 inhalation or cervical dislocation preceded by general
anesthesia.
[0228] Results:
[0229] FIG. 9 shows weights of tumors excised and weighed at day 18
for all groups treated with antisense at 10 mg/kg/dose compared
with empty lipid controls. Tumour sizes for the AS4200(c-myc) group
exhibited the best efficacy and were very consistent with only
small ranges in tumour volumes observed (285-451 mm.sup.3). The
group treated with free c-myc also resulted in smaller tumours but
exhibited more variability in tumour volume (156-838 mm.sup.3). The
encapsulated c-myc controls (c-myc SCR/PS-2302/PS-3082),
AS4204(c-myc), empty lipid carriers, and free antisense controls,
however, showed no inhibitory effect on tumor volumes over the 18
days when compared to HBS controls.
[0230] c-myc expression in tumor tissue was also evaluated by FACS.
A correlation between tumour size and c-myc protein expression was
detected (data not shown).
[0231] To determine the importance of the stability of the
PEG-polymers, PEG-acyl chain length was evaluated using
formulations containing PEG-CerC14 and PEG-CerC20. Interestingly,
the formulation containing the PEG-CerC20 (AS4204) showed no
apparent efficacy at any of the doses studied. The PEG-CerC14
formulation (AS4200) showed a dose response. The difference
observed between the PEG-CerC14 and PEG-CerC20 formulations may
reflect the rapid clearance phenomenon that has been observed in
other models.
[0232] To establish the tolerability of free and encapsulated
antisense, mouse weights were measured on a daily basis during the
treatment phase of the study. No significant changes in mouse
weights for either free. or encapsulated formulations were apparent
over the course of the dosing phase or throughout the study.
EXAMPLE 5
[0233] This example illustrates a high efficiency formulation
according to Example 2, but instead of phosphorothioate antisense,
employing 1) a phosphodiester antisense compound having exclusively
phosphodiester internucleotide linkages (PO-2302 anti-human ICAM-1
GCCCAAGCTGGCATCCGTCA (SEQ ID. No 1)) prepared by Inex
Pharmaceuticals (USA), Inc., Hayward Calif.) or 2) ribozyme
molecule to VEGF-R-1 (human Vascular Endothelial Growth Factor
Receptor 1) comprising a modified RNA sequence of GAG UUG CUG AUG
AGG CCG AAA GGC CGA AAG UCU G (SEQ ID. No 16).
[0234] A 15 mer of [.sup.3H]-phosphodiester antisense
oligodeoxynucleotide (PO-2302) in citrate buffer, pH 3.80
(experiments ranged from 10-1000 mM citrate) was mixed with an
ethanol solution of lipid (DSPC:CHOL:DODAP:PEG-CerC14; 25:45:20:10,
molar ratio) at final concentrations of 2 mg/mL and 9.9 mg/mL,
respectively. The final ethanol concentration in the 1 ml
preparation was 38% vol/vol. The sample was extruded ten times
through three 100 nm filters as described in "Materials and
Methods". The sample was dialyzed for 2-3 hours in citrate buffer,
pH 3.80 (same molarity as experiment), to remove a majority of the
excess ethanol. The samples were switched to HEPES-buffered saline
(HBS), pH 7.50, and dialyzed for a minimum of 12 hours to replace
the external citrate buffer with HBS. Non-encapsulated antisense
was removed either by this regular dialysis, tangential flow
dialysis, or chromatography. Encapsulation was assessed either by
analyzing the pre-column and post-colu rn ratios of
[.sup.3H]-antisense and [.sup.14C]-lipid or by determining the
total pre-column and post-column [.sup.3H]-antisense and
[.sup.14C]-lipid radioactivity.
[0235] FIG. 15 illustrates results. Encapsulation efficiency was
over 50% across the 10-50 mM citrate range, and all final
(administration ready) drug:lipid ratios were greater than 10% by
weight. Parallel experiments varying citrate concentration were
conducted with phosphorothioate antisense PS-2302. Results are also
above 50% encapsulation, and in fact show a higher encapsulation
efficiency than phosphodiesters, particularly at higher citrate
concentrations.
[0236] This experiment was repeated using 20mM citrate instead of
300 mM citrate to encapsulate the ribozyme molecule to VEGF-R-1
(human Vascular Endothelial Growth Factor Receptor 1) GAG TUG CUG
AUG AGG CCG AAA GGC CGA AAG UCU G (SEQ ID. No 16). FIG. 20 shows
the encapsulation efficiency of the ribozyme at was over 50%,
approximately the same as the phosphodiester.
EXAMPLE 6
[0237] This example illustrates a high efficiency formulation as in
Example 5, but replacing DODAP with an alternative protonatable
lipid. Typically, the preparation for the alternative will be
X:DSPC:CHOL:PEG-CerC 14 at 20:25:45:10 molar ratio where X can be
DODAC, OA, DODMA or any other lipid suitable for the invention.
[0238] Materials: distearoylphosphatidylcholine, DSPC; cholesterol,
CHOL (both from Northern Lipids, Vancouver, BC);
N,N-dioleyl-N,N-dimethylammon- ium chloride, DODAC; Oleylamine, OA
(prepared by Steve Ansell, Inex); N-(1-(2,3-Dioleoyloxy)
propyl)-N,N,-dimethyl ammonium chloride, DODMA(Avanti Polar Lipids,
Alabaster AB, chloride salt prepared by Steve Ansell, INEX);
poly(ethylene glycol)2000 coupled to a ceramide derivative with 14
carbon acyl chains, PEG-CerC14 (Zhou Wang, INEX Pharmaceuticals);
13.times.100 mm glass tube; filter sterilized 300 mM citrate
buffer, pH 3.9-4.0 (use a 0.2 .mu.m filter). Fully thioated c-myc
antisense (INEX (USA), Hayward Calif.), Anhydrous Ethanol
(Commercial Alcohols, Toronto, On), Citric acid, Monobasic Sodium
phosphate, Dibasic Sodium phosphate, Sodium hydroxide, HEPES (BDH,
Mississauga On). Deionized water, Chloroform, Methanol,
Oligreen.TM. oligonucleotide reagent (Molecular Probes, Eugene Or),
Sodium chloride, Triton X-100, alcohol dehydrogenase reagent kit,
(Sigma Chemical Co., St Louis Mo.),
[0239] Lipid stock solutions were made in 100% ethanol with the
working concentrations of the lipids which is as follows:
[0240] DSPC, 20 mg/ml; CHOL, 20 mg/ml (not very soluble above this
concentration); DODMA, 20 mg/ml; PEG-CerC14; 50 mg/ml.
[0241] To prepare stock solutions of antisense, the antisense
molecules were dissolved in the filtered 300 mM citrate buffer at a
concentration of 3.33 mg/ml. Lipids were mixed in the desired
proportions in a 13.times.100 mm glass tube to achieve a final
volume of 0.4 ml of lipids using 100% ethanol as listed in table 1,
below:
7TABLE 1 Proportional mixture of lipids in a 13 .times. 100 mm
glass test tube. Stock Vol of Stock Lipid Mol % M. Wt. mg .mu.mol
(mg/ml) (.mu.l) DODMA 20 652.6 1.69 2.60 20 84.5 DSPC 25 790 2.57
3.25 20 115 CHOL 45 386.7 2.26 5.85 20 113.1 PEG-CerC14 10 2600
3.38 1.30 50 67.6 100 9.9 13.00 380.2
[0242] In a separate 13.times.100 mm glass tube, 0.6 ml of
antisense at 3.33 mg/ml was added. The pH of this solution should
be 3.9-4.0. (NOTE: the antisense concentration is NOT determined by
weight but rather by measuring absorbance at 260 nm). The lipid
mixture solution was warmed to 65 .degree. C. for about 2 minutes.
The antisense tube was vortexed and during this time, using a
Pasteur pipette, the lipids (in ethanol) were added slowly in a
dropwise manner. The mixture will get "cloudy" and some bubbles may
be observed due to the ethanol, butno aggregates should be present.
The resulting volume of the antisense-lipid mixture was 1.0 ml with
a 10 mg (13 umol) total lipid at 13 .mu.mols, 2 mg of antisense,
and 38% ethanol, vol/vol. It can be expected that the pH to rise to
about 4.4.
[0243] The antisense-lipid mixture was subjected to 5 (five) cycles
of freezing in liquid nitrogen and thawing at 65.degree. C. in a
waterbath. After each thaw, the mixture was vortexed briefly.
Subsequently, the mixture was passed 10 times through three stacked
100 nm polytcarbonate filters (Poretics) or extruded using a
pressurized extruder apparatus with a thermobarrel attachment
(Lipex Biomembranes). The temperature and nitrogen pressure during
extrusion were 65.degree. C. and no more than 200 psi to 300 psi,
respectively. Each pass should take no more than 2 minutes and is
vortexed after each pass.
[0244] After extrusion, the mixture was dialyzed in a dialysis
tubing (3500 Mwt cutoff; SpectraPor) for 1 hour in 300 mM citrate
at pH 3.9-4.0, removing the ethanol. The mixture was transferred
into 5 L of HBS buffer at pH 7.5 and allowed to further dialyze to
a minimum of 12 hours, to neutralize the DODMA and release any
surface bound antisense associated with the vesicles.
Alternatively, tangential flow dialysis, ion
exchange-chromatography or gel filtration chromatography can be
used to process the extruded antisense-lipid mixture to an
administration ready preparation.
EXAMPLE 7
[0245] This example illustrates a high efficiency formulation as in
Example 5, but replacing DSPC with SM to generate a preparation of
DODAP:SM:CHOL:PEG-CerC14 at 20:25:45:10 molar ratio. Antisense is
processed with the formulation for a standard 1.0 ml volume, which
can be scaled up proportionately as required.
[0246] Materials: Sphingomyelin SM; cholesterol, CHOL;
dimethylaminopropane, DODAP; polyethylene glycol coupled to a
ceramide derivative with 14 carbon acyl chains, PEG-CerC14;
13.times.100 mm glass tube; filter sterilized 300 mM citrate
buffer, pH 3.9-4.0 (use a 0.2 .mu.m filter).
[0247] Lipid stock solutions were made in 100% ethanol with the
working concentrations of the lipids which is as follows:
[0248] SM, 20 mg/ml; CHOL, 20 mg/ml (not very soluble above this
concentration); DODAP, 20 mg/ml; PEG-CerC14; 50 mg/ml.
[0249] To prepare stock solutions of antisense, the antisense
molecules were dissolved in the filtered 300 mM citrate buffer at a
concentration of 3.33 mg/ml. Lipids were mixed in the desired
proportions in a 13.times.100 mm glass tube to achieve a final
volume of 0.4 ml of lipids using 100% ethanol as listed in Table 2,
below:
8TABLE 2 Proportional mixture of lipids in a 13 .times. 100 mm
glass test tube. Stock Vol of Stock Lipid Mol % M. Wt. mg .mu.mol
(mg/ml) (.mu.l) DODAP 20 684.5 1.78 2.60 20 89.0 SM 25 703 2.30
3.27 20 115 CHOL 45 386.7 2.26 5.85 20 113.1 PEG-CerC14 10 2600
3.38 1.30 50 67.6 100 9.72 13.02 384.7
[0250] In a separate 13.times.100 mm glass tube, 0.6 ml of
antisense at 3.33 mg/ml was added. The pH of this solution should
be 3.9-4.0. (NOTE: the antisense concentration is NOT determined by
weight but rather by measuring absorbance at 260 mn). The lipid
mixture solution was warmed to 65.degree. C. for about 2 minutes.
The antisense tube was vortexed and during this time, using a
Pasteur pipette, the lipids (in ethanol) were added slowly in a
dropwise manner. The mixture will get "cloudy" and some bubbles may
be observed due to the ethanol, but no aggregates should be
present. The resulting volume of the antisense-lipid mixture was
1.0 ml with a 10 mg (13 umol) total lipid at 13 .mu.mols, 2 mg of
antisense, and 38% ethanol, vol/vol. It can be expected that the pH
to rise to about 4.4.
[0251] The antisense-lipid mixture was subjected to 5 (five) cycles
of freezing in liquid nitrogen and thawing at 65.degree. C. in a
waterbath. After each thaw, the mixture was vortexed briefly.
Subsequently, the mixture was passed 10 times through three stacked
100 nm polytcarbonate filters (Poretics) or extruded using a
pressurized extruder apparatus with a thermobarrel attachment
(Lipex Biomembranes). The temperature and nitrogen pressure during
extrusion were 65 .degree. C. and no more than 200 psi to 300 psi,
respectively. Each pass should take no more than 2 minutes and is
vortexed after each pass.
[0252] After extrusion, the mixture was dialyzed in a dialysis
tubing (3500 Mwt cutoff; SpectraPor) for 1 hour in 300 mM citrate
at pH 3.9-4.0, removing the ethanol. The mixture was transferred
into 5 L of HBS buffer at pH 7.5 and allowed to further dialyze to
a minimum of 12 hours, to neutralize the DODAP and release any
surface bound antisense associated with the vesicles.
Alternatively, tangential flow dialysis, ion
exchange-chromatography or gel filtration chromatography can be
used to process the extruded antisense-lipid mixture to an
administration ready preparation.
EXAMPLE 8
[0253] This example illustrates a high efficiency formulation as in
Example 5, but replacing PEG-CerC14 with ATTA8-DSPE to prepare
DODAP:DSPC:CHOL:ATTA8-DSPE at 40:10:45:5 molar ratio of antisense
formulation.
[0254] Materials: distearoylphosphatidylcholine, DSPC; cholesterol,
CHOL; dimethylaminopropane, DODAP; N-(.omega.-N'-acetoxy-octa(l
4'amino-3',6',9',12'-tetraoxatetradecanoyl))-1,2-distearoyl-sn-glycero-3--
phosphoethanolamine, ATTA8-DSPE; 13.times.100 mm glass tube; filter
sterilized 300 mM citrate buffer, pH 3.9-4.0 (use a 0.2 .mu.m
filter).
[0255] Lipid stock solutions were made in 100% ethanol with the
working concentrations of the lipids which is as follows:
[0256] DSPC, 20 mg/ml; CHOL, 20 mg/ml (not very soluble above this
concentration); DODAP, 20 mg/ml; ATTA8-DSPE; 50 mg/ml.
[0257] To prepare stock solutions of antisense, the antisense
molecules were dissolved in the filtered 300 mM citrate buffer at a
concentration of 3.33 mg/ml. Lipids were mixed in the desired
proportions in a 13.times.100 mm glass tube to achieve a final
volume of 0.4 ml of lipids using 100% ethanol as listed in Table 3,
below:
9TABLE 3 Proportional mixture of lipids in a 13 .times. 100 mm
glass test tube. Stock Vol of Stock Lipid Mol % M. Wt. mg .mu.mol
(mg/ml) (.mu.l) DODAP 40 684.5 4.16 6.08 20 208 DSPC 10 790 1.2
1.52 20 60 CHOL 45 386.7 2.6 6.72 20 130 ATTA8- 5 2638 2.0 0.76 50
40 DSPE 100 10.26 15.1 438
[0258] In a separate 13.times.100 mm glass tube, 0.6 ml of
antisense at 3.33 mg/ml was added. The pH of this solution should
be 3.9-4.0. (NOTE: the antisense concentration is NOT determined by
weight but rather by measuring the absorbance at 260 nm). The lipid
mixture solution was warmed to 65.degree. C. for about 2 minutes.
The antisense tube was vortexed and during this time, using a
Pasteur pipette, the lipids (in ethanol) were added slowly in a
dropwise manner. The mixture will get "cloudy" and some bubbles may
be observed due to the ethanol, but no aggregates should be
present. The resulting volume of the antisense-lipid mixture was
1.0 ml with a 10 mg (13 umol) total lipid at 13 .mu.mols, 2 mg of
antisense, and 38% ethanol, vol/vol. It can be expected that the pH
to rise to about 4.4.
[0259] The antisense-lipid mixture was subjected to 5 (five) cycles
of freezing in liquid nitrogen and thawing at 65.degree. C. in a
waterbath. After each thaw, the mixture was vortexed briefly.
Subsequently, the mixture was passed 10 times through three stacked
100 nm polytcarbonate filters (Poretics) or extruded using a
pressurized extruder apparatus with a thermobarrel attachment
(Lipex Biomembranes). The temperature and nitrogen pressure during
extrusion were 65.degree. C. and no more than 200 psi to 300 psi,
respectively. Each pass should take no more than 2 minutes and is
vortexed after each pass.
[0260] After extrusion, the mixture was dialyzed in a dialysis
tubing (3500 Mwt cutoff; SpectraPor) for 1 hour in 300 mM citrate
at pH 3.9-4.0, removing the ethanol. The mixture was transferred
into 5 L of HBS buffer at pH 7.5 and allowed to further dialyze to
a minimum of 12 hours, to neutralize the DODAP and release any
surface bound antisense associated with the vesicles.
Alternatively, tangential flow dialysis, ion
exchange-chromatography or gel filtration chromatography can be
used to process the extruded antisense-lipid mixture to an
administration ready preparation.
EXAMPLE 9
[0261] This example illustrates use of tangential flow dialysis to
clean up a large scale (>50 ml) preparation of extruded
antisense-lipid mixture to obtain an administration ready
preparation. Tangential Flow Diafiltration has been shown to be
useful in four functions in the formulation process 1) buffer
exchange, 2) removal of ethanol, 3) removal of unencapsulated
antisense and 4) concentration of the formulation. Using TF it is
demonstrated that it is possible to efficiently exchange these
components using only 10-15 sample volumes with a single buffer
system at a very significant reduction in the process time.
[0262] Materials for Tangential Flow Dialysis:
[0263] Microcross Sampler.TM. Tangential Flow column (Microgon,
Laguna Hills, Cailf.) Masterflex.TM. console drive and Easyload.TM.
Pump head (Cole-Parmer, Vernon Hills Ill.), Extruder (Lipex
Biomembranes, Vancouver BC), Polycarbonate membranes, 100 .mu.m,
(AMD Manufacturing, Mississauga On).
[0264] Antisense (c-myc) is prepared by dissolving in 300 mM Na
Citrate buffer to a final concentration of 4.17 mg/ml for c-myc as
verified by absorbance at 260 nm. The antisense stock solution is
typically warmed to 65.degree. C. for 2 minutes to dissolve and to
remove secondary structure. AS4200 consists of DODAP
:DSPC:CHOL:PEG-CER-14 at the percent mol ratio of 25:20:45:10 and
the lipids are aliquoted from stock solutions to a total
concentration of 10 mg/0.400 ml in anhydrous ethanol. In this study
50-60 ml scale formulations were produced. Thus 20-24 ml of the
ethanolic lipid solution is added dropwise, at room temperature,
using a peristaltic pump at 1 ml/nin into 30-36 ml of the AS
solution which is stirring in a 100 ml round bottom flask with a 2
cm magnet stir bar (Stirrer setting 2-3). After mixing, the
lipid/antisense suspension was pipetted into a 100 ml extruder
prepared with 2-3, 100 .mu.m polycarbonate membranes and
pre-equilibrated at 65.degree. C. The suspension was extruded using
ten passes at .about.300 psi. After extrusion the formulation was
processed using tangential flow diafiltration.
[0265] Tangential Flow Ultrafiltration.
[0266] A 230 cm.sup.2 Microcross tangential flow cartridge (50 kDa
cut off) was attached to a Masterflex peristaltic pump, sample
reservoir and buffer reservoir using Tygon tubing. The tubing
length was adjusted so that the total circuit of tubing, pump and
TF cartridge had a total dead volume of 30 ml. To this system a 60
ml sample reservoir was attached. The sample was loaded into the
tubing and reservoir by running the peristaltic pump at a low
speed. After loading, the system was closed and the pump speed
gradually increased to the pump maximum (approx. 100 ml/min) until
the initial TF cartridge inlet pressure was 12-15 psi and the
outlet pressure was 8-11 psi. When the system pressure stabilized,
both the filtrate outlet and the buffer reservoir were opened.
Opening these valves allowed filtrate to flow out of the cartridge
at .about.10-15 ml/min while wash buffer (i.e. PBS, pH 7.5) was
being collected. For a 50-60 ml formulation 700-900 ml of buffer
was used to "wash" the sample. Fractions (10 ml) of the filtrate
were collected for analysis of ethanol removal, pH, and antisense.
After diafiltration was completed the wash buffer reservoir was
closed and with the pump continuing to run, filtrate was allowed to
flow, concentrating the sample, typically reducing the preparation
volume to the tubing dead volume (30-35 ml). The sample was
collected from the system and the tubing and column were washed
with 15 ml wash buffer to remove any remaining formulation.
[0267] Antisense Quantification.
[0268] Antisense concentration was normally determined by measuring
absorbance at 260 nm as outlined in the current protocol. Briefly,
antisense stock solutions were quantified by diluting 1:500 in
MilliQ water and measuring absorbance. TF filtrate fractions were
diluted 1:10 in MilliQ water and absorbance was measured. Antisense
in suspension with lipids was measured by adding 10 .mu.l of the
suspension to 250 .mu.l MilliQ water. A monophase was created by
adding 750 .mu.l CHCl.sub.3/MeOH (2.1:1) and 100 .mu.l MeOH.
Immediately after vortexing the mixture the absorbance was measured
at 260 nm. In each case the extinction coefficient for the given
antisense was multiplied by the dilution factor to determine the
antisense concentration.
[0269] Lipid Quantification.
[0270] As outlined in the current protocol, 50 .mu.l aliquots of
the lipid/antisense suspension was diluted with 100 .mu.l MilliQ
water and submitted for analysis by HPLC. The percent encapsulation
efficiency of the formulation is determined by dividing the
Drug/Lipid ratio of the finished product by the initial Drug/Lipid
ratio formed when the lipid and antisense stock solutions are
mixed.
[0271] Ethanol Assay.
[0272] Ethanol in the TF filtrate was determined using an alcohol
dehydrogenase reagent kit supplied by Sigma Chemical Co.
[0273] DEAE Sephadex chromatography.
[0274] A suspension of the processed formulation was loaded onto a
1.times.10 cm column of DEAE sephadex equilibrated in 20 mM PBS, pH
7.5. After eluting through the column the formulation was collected
into a sterile falcon tube. The volume, antisense and lipid
concentration were measured to determine recovery.
[0275] Particle Size.
[0276] The particle size of the formulation was measured by QELS
using a Nicomp Particle sizer, (Nicomp, Santa Barbara, Calif.) and
particle sizes are reported in the particle mode with volume
weighing.
10 Results of Large Scale Preparations: Initial Initial Final Final
Lipid Antisense Lipid Antisense Content Content Content Content
Initial Final Encaps. Assay (mg/ml) (mg/ml) (mg/ml) (mg/ml)
Drug:Lipid Drug:Lipid Effic. A 10.581 1.936 14.604 1.681 0.183
0.115 63% B 8.727 2.284 7.926 1.008 0.262 0.127 48% C 11.06 2.97
2.69 0.556 0.286 0.207 77%
EXAMPLE 10
[0277] Phosphodiester and phosphorothioate antisense
oligonucleotides encapsulated according to the methods in Example 2
and 5-9 were examined for their relative susceptibility to nuclease
digestion by serum or S1 nuclease. Protection of the
phosphodiester-linked oligonucleotide was significantly higher in
serum when encapsulated as opposed to the free, raising the
T.sub.1/2 of degradation from 10 mins to at least 8 h. Free
phosphorothioate oligodeoxynucleotide showed significant breakdown
in serum within 30 minutes, however encapsulated phosphorothioate
oligodeoxynucleotide did not show any sign of degradation even
after 24 h incubation in serum. In vivo data agrees with these
findings, showing no sign of degradation of the encapsulated
phosphorothioate antisense until 8 h.
[0278] As a positive control, the free phosphodiester and
phosphorothioate antisense were subjected to very potent levels of
S1 nuclease (100U/50.mu.g) (1U of S1 nuclease will digest 1 ug DNA
per minute at 37.degree. C). The enzyme completely digested the
free phosphodiester and phosphorothioate within seconds after its
addition. The encapsulated phosphodiester under the same conditions
was over 90% intact at 24 h, and the encapsulated phosphorothioate
was fully intact at 24 h.
[0279] The experiments were conducted as described in the
specification, or modified as follows.
[0280] S1 Nuclease Digestion.
[0281] 50 .mu.g aliquots containing free, encapsulated, or
encapsulated+0.5% Triton X100 were aliquoted into 1.5 ml eppendorf
tubes. To the tubes were added 10 .mu.l 10X S1 nuclease buffer,
dH2O (to make final volume 100 .mu.l), and, just prior to
digestion, 100U of S1 nuclease to each eppendorf tube. The tubes
were sealed with parafilm and incubated at 55.degree. C. A sample
of the free, encapsulated, or encapsulated+0.5% Triton X100 not
digested by nuclease (standard) was frozen in liquid nitrogen in an
eppendorf tube and stored at -20.degree. C. At each desired time
point, an aliquot of each sample was collected, added to GDP buffer
containing proteinase K (133 .mu.g/ml) and immediately frozen in
liquid nitrogen in order to stop the reaction. Once all of the time
points were collected, the samples were incubated at 55.degree. C.
in a waterbath to activate proteinase K enabling it to denature any
remaining S1 nuclease. Proteinase K digested samples were applied
to polyacrylamide gels, described below, to assess levels of S1
nuclease degradation
[0282] Normal Murine/Human Serum Digestion.
[0283] 50 .mu.g of the free, encapsulated, or encapsulated+0.5%
Triton X100 was aliquoted into 1.5 ml eppendorf tubes. To the tubes
we added 45 .mu.l normal murine/human serum, dH2O (to make final
volume 50 .mu.l), to each eppendorf tube. The tubes were sealed
with parafilm and incubated at 37.degree. C. A sample of the free,
encapsulated, or encapsulated+0.5% Triton X100 not digested by
nuclease (standard) was frozen in liquid nitrogen in an eppendorf
tube and stored at -20.degree. C. Aliquots were taken at various
time points, added to GDP buffer containing proteinase K (133
.mu.g/ml) and immediately frozen in liquid nitrogen to stop the
reaction. Once all of the time points were collected, the samples
were incubated at 55*C in a waterbath to activate proteinase K
enabling it to denature any remaining exonuclease. Proteinase K
digested samples were applied to polyacrylamide gels to assess
levels of exonuclease degradation Micrococcal Nuclease. An
alternative standard nuclease assay not employed in the present
experiment is the assay disclosed by Rahman et al. U.S. Pat. No.
5,665,710, wherein nucleic acid/lipid particles are incubated for
30 mins at 37.degree. C. in presence of an excess of micrococcal
nuclease in 1 mM CaCl.sub.2.
[0284] Polyacrylamide Gel Electrophoresis (PAGE).
[0285] Prepared 14 cm .times.16 cm .times.7.5 mm polyacrylamide
(15% or 20%) gels in 7M urea and TBE. Approximately 300 ng of
sample (at each time point) and standard were aliquoted into
eppendorf tubes. An equivalent volume of 2X loading buffer was
added to each sample. The samples were then heated in a waterbath
to 90.degree. C. for 3 min to reduce secondary structures and then
applied to the gel. The loaded gel was electrophoresed at 600V for
10 min (to sharpen the band) and then at 300V for the duration of
the gel. The gel was incubated in 1X SyberGreen I stain in TBE for
a minimum of 15 min and then photographed while illuminated under
UV light (3.5 sec exposure, 4.5 aperture).
[0286] VII. Conclusion
[0287] As discussed above, the present invention provides methods
of preparing lipid-encapsulated therapeutic agent (nucleic acid)
compositions in which the therapeutic agent (nucleic acid) portion
is encapsulated in large unilamellar vesicles at a very high
efficiency. Additionally, the invention provides compositions
prepared by the method, as well as methods of introducing
therapeutic agents (nucleic acids) into cells. The compositions are
surprisingly efficient in transfecting cells, both in vivo and in
vitro.
[0288] All publications, patents and patent applications mentioned
in this specification are herein incorporated by reference into the
specification to the same extent as if each individual publication,
patent or patent application was specifically and individually
indicated to be incorporated herein by reference.
[0289] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
Sequence CWU 1
1
* * * * *