U.S. patent application number 10/913246 was filed with the patent office on 2005-01-06 for methods and compositions for amplification of rna sequences.
Invention is credited to Kurn, Nurith.
Application Number | 20050003441 10/913246 |
Document ID | / |
Family ID | 23048664 |
Filed Date | 2005-01-06 |
United States Patent
Application |
20050003441 |
Kind Code |
A1 |
Kurn, Nurith |
January 6, 2005 |
Methods and compositions for amplification of RNA sequences
Abstract
The invention provides methods for isothermal amplification of
RNA. The methods are particularly suitable for amplifying a
plurality of RNA species in a sample. The methods employ a
composite primer, a second primer and strand displacement to
generate multiple copies of DNA products comprising sequences
complementary to an RNA sequence of interest. In another aspect,
the methods employ a single primer (which is a composite primer)
and strand displacement to generate multiple copies of DNA products
comprising sequences complementary to an RNA sequence of interest.
In some embodiments, a transcription step is included to generate
multiple copies of sense RNA of an RNA sequence of interest. The
methods are useful for preparation of nucleic acid libraries and
substrates for analysis of gene expression of cells in biological
samples. The invention also provides compositions and kits for
practicing the amplification methods, as well as methods which use
the amplification products.
Inventors: |
Kurn, Nurith; (Palo Alto,
CA) |
Correspondence
Address: |
MORRISON & FOERSTER LLP
755 PAGE MILL RD
PALO ALTO
CA
94304-1018
US
|
Family ID: |
23048664 |
Appl. No.: |
10/913246 |
Filed: |
August 5, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10913246 |
Aug 5, 2004 |
|
|
|
10100321 |
Mar 11, 2002 |
|
|
|
60274550 |
Mar 9, 2001 |
|
|
|
Current U.S.
Class: |
435/6.18 ;
435/6.1; 435/91.2 |
Current CPC
Class: |
C12Q 1/6853 20130101;
C12Q 1/6853 20130101; C12Q 2531/119 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
1-139 (canceled)
140. A composition comprising a composite primer, wherein the
composite primer comprises an RNA portion and a 3' DNA portion, and
a second primer.
141. The composition of claim 140, wherein the second primer
comprises DNA.
142. The composition of claim 141, wherein the second primer is a
random primer.
143. The composition of claim 140, wherein the second primer
comprises a fragment of the target RNA hybridized to the primer
extension product.
144. The composition of claim 140, further comprising an
RNA-dependent DNA polymerase.
145. The composition of claim 140, wherein the composite primer
further comprises a 5' region that is not hybridizable to the RNA
sequence of interest under conditions which the composite primer
hybridizes to the target RNA.
146. A composition comprising a composite primer and a second
primer that comprises a sequence that is not hybridizable to a
first primer extension product under conditions which the composite
primer hybridizes to the target RNA.
147. A composition comprising: (a) a composite primer; (b) a second
primer; and (c) a propromoter polynucleotide.
148. The composition of claim 147, wherein the second primer is a
random primer.
149. A composition comprising a complex of (a) a first primer
extension product, wherein the first primer is a composite primer
comprising an RNA portion and a 3' DNA portion; and (b) a
propromoter polynucleotide.
150. A composition comprising a complex of (a) a first primer
extension product, wherein the first primer is a composite primer
comprising an RNA portion and a 3' DNA portion; and (b) a second
primer extension product, wherein the second primer comprises
DNA.
151. A composition comprising a complex of (a) a first primer
extension product, wherein the first primer is a composite primer
comprising an RNA portion and a 3'. DNA portion; and (b) a second
primer extension product, wherein the second primer comprises a
fragment of the RNA target.
152. A composition comprising a complex of (a) a cleaved primer
extension product, wherein the primer is a composite primer
comprising an RNA portion and a 3' DNA portion; (b) a second primer
extension product; and (c) a composite primer that hybridizes to
second primer extension product.
153. The composition of claim 152, wherein the composite primer
that hybridizes to target RNA and the composite primer that
hybridizes to second primer extension product are the same.
154. The composition of claim 152, wherein the composite primer
that hybridizes to target RNA and the composite primer that
hybridizes to second primer extension product are different.
155. A reaction mixture comprising (a) a target RNA; (b) a
composite primer comprising a 3' DNA portion and an RNA portion;
(c) a second primer; and (d) a DNA polymerase.
156. The reaction mixture of claim 155, further comprising: (e) an
enzyme which cleaves RNA from an RNA/DNA hybrid.
157. The reaction mixture of claim 155, further comprising: (e) a
propromoter polynucleotide.
158-161 (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the priority benefit of the
provisional patent application U.S. Ser. No. 60/274,550, filed Mar.
9, 2001, which is incorporated by reference in its entirety.
TECHNICAL FIELD
[0002] The invention relates to the field of polynucleotide
amplification. More particularly, the invention provides methods,
compositions and kits for amplifying (i.e., making multiple copies)
RNA sequences of interest which employ an RNA/DNA composite primer,
and, optionally transcription.
BACKGROUND ART
[0003] The ability to amplify ribonucleic acid (RNA) is an
important aspect of efforts to elucidate biological processes. To
date, RNA (generally, mRNA) amplification is most commonly
performed using the reverse transcriptase-polymerase chain reaction
(RT-PCR) method and variations thereof. These methods are based on
replication of RNA by reverse transcriptase to form single stranded
DNA complementary to the RNA (cDNA), which is followed by
polymerase chain reaction (PCR) amplification to produce multiple
copies of double stranded DNA. Although these methods are most
commonly used, they have some significant drawbacks: a) the
reactions require thermocycling; b) the products are double
stranded, thus rendering them less accessible to binding to probes;
c) the reactions are prone to contamination with products of prior
amplification, thus requiring strict containment of reaction
mixtures; and d) the exponential nature of amplification of these
methods renders them prone to generate pools of products which do
not truly reflect the representation of the various RNA sequences
in the input total RNA sample, due to unequal efficiency of
amplification of different sequences, and the nature of exponential
amplification which is based on replication of amplification
products rather than on continued replication of the input target
RNAs.
[0004] Total cellular mRNA represents gene expression activity at a
defined time. Gene expression is affected by cell cycle
progression, developmental regulation, response to internal and
external stimuli and the like. The profile of expressed genes for
any cell type in an organism reflects normal or disease states,
response to various stimuli, developmental stages, cell
differentiation, and the like.
[0005] Various methods for the analysis of gene expression have
been developed in recent years. See, for example, U.S. Pat. Nos.
5,744,308; 6,143,495; 5,824,517; 5,829,547; 5,888,779; 5,545,522;
5,716,785; 5,409,818; EP 0971039A2; EP0878553A2. These include
quantification of specific mRNAs, and the simultaneous
quantification of a large number of mRNAs, as well as the detection
and quantification of patterns of expression of known and unknown
genes. The analysis of gene expression profiles is currently one of
the most powerful tools in the study of cellular differentiation
and cellular development, and in the investigation of normal and
disease states of various organisms, in particular in human. This
analysis is crucial for gene discovery, molecular medicine and drug
discovery processes.
[0006] Amplification of the total cellular mRNAs prepared from any
cell or tissue is generally critical for gene expression profiling.
Although analysis of non-amplified mRNA is feasible, a significant
amount of starting mRNA would be required. However, the total
amount of sample mRNA that is available is frequently limited by
the amount of biological sample from which it is derived.
Biological samples are often limited in amount and precious.
Moreover, the amount of the various mRNA species is not equal; some
species are more abundant than others, and these are more likely
and easier, to analyze. The ability to amplify mRNA sequences
enables the analysis of less abundant, rare mRNA species. The
ability to analyze small samples, by means of nucleic acid
amplification, is also advantageous for design parameters of large
scale screening of effector molecule libraries, for which reduction
in sample volume is a major concern both for the ability to perform
very large scale screening or ultra high throughput screening, and
in view of the limiting amounts of library components.
[0007] Therefore, there is a need for improved RNA amplification
methods that overcome drawbacks in existing methods. The invention
provided herein fulfills this need and provides additional
benefits.
[0008] All references cited herein; including patent applications
and publications, are incorporated by reference in their
entirety.
DISCLOSURE OF THE INVENTION
[0009] The invention provides methods, compositions, and kits for
RNA amplification, as well as applications of the amplification
methods.
[0010] Accordingly, in one aspect, the invention provides methods
of generating multiple copies of a polynucleotide sequence
complementary to an RNA sequence of interest, said method
comprising the steps of: (a) extending a first primer hybridized to
a target RNA with an RNA-dependent DNA polymerase, wherein the
first primer is a composite primer comprising an RNA portion and a
3' DNA portion, whereby a complex comprising a first primer
extension product and the target RNA is produced;
[0011] (b) cleaving RNA in the complex of step (b) with an enzyme
that cleaves RNA from an RNA/DNA hybrid; (c) extending a second
primer hybridized to the first primer extension product with a
DNA-dependent DNA polymerase, whereby a second primer extension
product is produced to form a complex of first and second primer
extension products; (d) cleaving RNA from the composite primer in
the complex of first and second primer extension products with an
enzyme that cleaves RNA from an RNA/DNA hybrid such that a
composite primer hybridizes to the second primer extension product,
wherein the composite primer comprises an RNA portion and a 3' DNA
portion; (e) extending the composite primer hybridized to the
second primer extension product with a DNA-dependent DNA
polymerase; whereby said first primer extension product is
displaced, and whereby multiple copies of a polynucleotide sequence
complementary to the RNA sequence of interest are generated.
[0012] In another aspect, the invention provides methods of
generating multiple copies of a polynucleotide sequence
complementary to an RNA sequence of interest, said method
comprising the steps of: (a) extending a second primer hybridized
to a first primer extension product with a DNA-dependent DNA
polymerase, wherein the first primer extension product comprises an
RNA portion at the 5' end, said first primer extension product
comprising a sequence complementary to an RNA sequence, whereby a
second primer extension product is produced to form a complex of
first and second primer extension products; (b) cleaving RNA in the
complex of first and second primer extension products with an
enzyrne that cleaves RNA from an RNA/DNA hybrid such that a
composite primer hybridizes to the second primer extension product,
wherein the composite primer comprises an RNA portion and a 3' DNA
portion; (c) extending the composite primer hybridized to the
second primer extension product with a DNA-dependent DNA
polymerase; whereby said first primer extension product is
displaced, and whereby multiple copies of a polynucleotide sequence
complementary to the RNA sequence of interest are generated. In
some embodiments of the invention, the first primer extension
product is produced by extension of a first primer hybridized to a
target RNA with a RNA-dependent DNA polymerase, wherein the first
primer is a composite primer comprising an RNA portion and a 3' DNA
portion.
[0013] In another aspect, the invention provides methods of
generating multiple copies of a polynucleotide sequence
complementary to an RNA sequence of interest, said method
comprising the steps of: (a) cleaving RNA from a complex of first
and second primer extension products with an enzyme that cleaves
RNA from an RNA/DNA hybrid such that a composite primer hybridizes
to the second primer extension product, wherein the composite
primer comprises an RNA portion and a 3' DNA portion, wherein the
first primer extension product is produced by extension of a first
primer hybridized to a target RNA with a RNA-dependent DNA
polymerase, wherein the first primer is a composite primer
comprising an RNA portion and a 3' DNA portion; (b) hybridizing a
composite primer to the second primer extension product and
extending the composite primer with a DNA-dependent DNA polymerase;
whereby said first primer extension product is displaced, and
whereby multiple copies of a polynucleotide sequence complementary
to the RNA sequence of interest are generated.
[0014] In another aspect, the invention provides methods of
generating multiple copies of a polynucleotide sequence
complementary to an RNA sequence of interest, said method
comprising the step of: extending a composite primer in a complex
comprising: (i) a complex of a first and second primer extension
products, wherein the first primer extension product is produced by
extension of a first primer hybridized to a target RNA with a
RNA-dependent DNA polymerase, wherein the first primer is a
composite primer comprising an RNA portion and a 3' DNA portion,
wherein the second primer extension product is generated by
extension of a second primer hybridized to the first primer
extension product, and wherein RNA from the complex of first and
second primer extension products is cleaved with an enzyme that
cleaves RNA from an RNA/DNA hybrid; and (ii) a composite primer,
said composite primer comprising an RNA portion and a 3' DNA
portion, wherein the composite primer is hybridized to the second
primer extension product, and wherein the composite primer may be
the same or different from the first primer; whereby said first
primer extension product is displaced, and whereby multiple copies
of a polynucleotide sequence complementary to the RNA sequence of
interest are generated.
[0015] In another aspect, the invention provides methods of
generating multiple copies of a polynucleotide sequence
complementary to an RNA sequence of interest, said method
comprising the steps of: (a) extending a composite primer
hybridized to a second primer extension product, wherein said
primer extension product (i) comprises a complement or a sequence
of a first primer extension product generated by extension of a
first primer hybridized to template RNA, wherein the first primer
is a composite primer comprising an RNA portion and a 3' DNA
portion; and (ii) is hybridized to a second primer extension
product generated by extension of a second primer hybridized to the
first primer extension product, and cleavage of RNA from the first
primer with an enzyme that cleaves RNA from an RNA/DNA hybrid;
whereby said first primer extension product is displaced, and
whereby multiple copies of a polynucleotide sequence complementary
to the RNA sequence of interest are generated.
[0016] In another aspect, the invention provides methods of
generating multiple copies of an RNA sequence of interest, said
method comprising the steps of:
[0017] hybridizing the displaced first primer extension product
from any of the methods of generating multiple copies of a
polynucleotide sequence complementary to an RNA sequence of
interest described herein, with a polynucleotide comprising a
propromoter and a region which is hybridizable to the displaced
first primer extension product under conditions which allow
transcription to occur by RNA polymerase, such that RNA transcripts
are produced comprising sequences complementary to the displaced
first primer extension product, whereby multiple copies of the RNA
sequence of interest are generated.
[0018] In another aspect, the invention provides methods of
generating multiple copies of an RNA sequence of interest, said
method comprising the steps of hybridizing a first primer extension
product from any of the methods of generating multiple copies of a
polynucleotide sequence complementary to an RNA sequence of
interest described herein, with a polynucleotide comprising a
propromoter and a region which is hybridizable to the displaced
first primer extension product under conditions which allow
transcription to occur by RNA polymerase, such that RNA transcripts
are produced comprising sequences complementary to the displaced
first primer extension product, wherein the primer extension
product is a displaced primer extension product generated by: (a)
extending a first primer hybridized to a target RNA with an
RNA-dependent DNA polymerase, wherein the first primer is a
composite primer comprising an RNA portion and a 3' DNA portion,
whereby a complex comprising a first primer extension product and
the target RNA is produced; (b) cleaving RNA in the complex of step
(b) with an enzyme that cleaves RNA from an RNA/DNA hybrid; (c)
extending a second primer hybridized to the first primer extension
product with a DNA-dependent DNA polymerase whereby a second primer
extension product is produced to form a complex of first and second
primer extension products; (d) cleaving RNA from the composite
primer in the complex of first and second primer extension products
with an enzyme that cleaves RNA from an RNA/DNA hybrid such that a
composite primer hybridizes to the second primer extension product,
wherein the composite primer comprises an RNA portion and a 3' DNA
portion; (e) extending said composite primer hybridized to the
second primer extension product with a DNA-dependent DNA
polymerase, whereby said first primer extension product is
displaced; whereby multiple copies of the RNA sequence of interest
are generated.
[0019] In another aspect, the invention provides methods of
generating multiple copies of (amplifying) a polynucleotide
sequence complementary to an RNA sequence of interest, said method
comprising the steps of: (a) hybridizing a first primer to a target
RNA, wherein the first primer is a composite primer comprising an
RNA portion and a 3' DNA portion; (b) extending the first primer
with an RNA-dependent DNA polymerase, whereby a complex comprising
a first primer extension product and the target RNA is produced;
(c) cleaving RNA in the complex of step (b) with an agent (such as
an enzyme) that cleaves RNA from an RNA/DNA hybrid; (d) hybridizing
a second primer to the first primer extension product; (e)
extending the second primer with a DNA-dependent DNA polymerase,
whereby a second primer extension product is produced to form a
complex of first and second primer extension products; (f) cleaving
RNA from the composite primer in the complex of first and second
primer extension products with an agent (such as an enzyme) that
cleaves RNA from an RNA/DNA hybrid such that a composite primer
(which may or may not be the same as the first primer) hybridizes
to the second primer extension product, wherein said composite
primer comprises an RNA portion and a 3' DNA portion; (g) extending
said composite primer of step (f) with a DNA-dependent DNA
polymerase, whereby said first primer extension product is
displaced, and whereby multiple copies of a polynucleotide sequence
complementary to the RNA sequence of interest are generated.
[0020] In some aspects, the invention provides methods of
generating multiple copies of a polynucleotide sequence
complementary to an RNA sequence of interest, said method
comprising the steps of: combining and reacting: the complex of
first and second primer extension products of step (e) described
above; a composite primer (which may or may not be the same as the
first primer) that is hybridizable to the second primer extension
product, wherein said composite primer comprises an RNA portion and
a 3' DNA portion; a DNA-dependent DNA polymerase; and an agent
(such as an enzyme) that cleaves RNA from an RNA/DNA hybrid;
wherein the mixture is incubated under conditions (which include
necessary substrates and buffer conditions) that permit primer
hybridization, RNA cleavage, and displacement of the first primer
extension product from the complex of step (e) described above when
its RNA is cleaved and a composite primer binds to the second
primer extension product in the complex.
[0021] As is clear to one skilled in the art, reference to
production of copies of an RNA sequence of interest or copies of a
polynucleotide sequence complementary to an RNA sequence of
interest refers to products that may contain, comprise or consist
of such sequences. As is evident to one skilled in the art, aspects
that refer to combining and incubating the resultant mixture also
encompasses method embodiments which comprise incubating the
various mixtures (in various combinations and/or subcombinations)
so that the desired products are formed.
[0022] In another aspect, the invention provides methods of
generating multiple copies of a polynucleotide sequence
complementary to an RNA sequence of interest comprising incubating
a reaction mixture, said reaction mixture comprising: (a) a target
RNA; (b) a first primer that is hybridizable to the target RNA,
wherein the first primer is a composite primer comprising an RNA
portion and a 3' DNA portion; (c) a second primer that is
hybridizable to an extension product of the first primer; (d) an
RNA-dependent DNA polymerase; (e) a DNA-dependent DNA polymerase;
(f) an enzyme that cleaves RNA from an RNA/DNA hybrid; wherein the
incubation is under conditions that permit primer hybridization,
extension from the first primer and the second primer to form a
complex comprising first and second primer extension products, RNA
cleavage, and displacement of the first primer extension product,
from the complex when its RNA is cleaved and a composite primer
binds to the second primer extension product in the complex and is
extended, whereby multiple copies of a polynucleotide sequence
complementary to the RNA-sequence of interest are generated.
[0023] In another aspect, the invention provides methods of
generating multiple copies of (amplifying) an RNA sequence of
interest, said method comprising the steps of: (a) hybridizing a
first primer to a target RNA, wherein the first primer is a
composite primer comprising an RNA portion and a 3' DNA portion;
(b) extending the first primer with an RNA-dependent DNA
polymerase, whereby a complex comprising a first primer extension
product and the target RNA is produced; (c) cleaving RNA in the
complex of step (b) with an agent (such as an enzyme) that cleaves
RNA from an RNA/DNA hybrid; (d) hybridizing a second primer to the
first primer extension product; (e) extending the second primer
with a DNA-dependent DNA polymerase, whereby a second primer
extension product is produced to form a complex of first and second
primer extension products; (f) cleaving RNA from the composite
primer in the complex of first and second primer extension products
with an agent (such as an enzyme) that cleaves RNA from an RNA/DNA
hybrid such that a composite primer (which may or may not be the
same as the first primer) hybridizes to the second primer extension
product, wherein said composite primer comprises an RNA portion and
a 3' DNA portion; (g) extending said composite primer of step (f)
with a DNA-dependent DNA polymerase whereby said first primer
extension product is displaced; (h) hybridizing the displaced first
primer extension product with a polynucleotide comprising a
propromoter and a region which is hybridizable to the displaced
first primer extension product under conditions which allow
transcription to occur by RNA polymerase, such that RNA transcripts
are produced comprising sequences complementary to the displaced
primer extension products, whereby multiple copies of the RNA
sequence of interest are generated In some embodiments, the
invention provides methods of generating multiple copies of an RNA
sequence of interest, said method comprising the steps of: (a)
combining: a first complex, wherein the first complex is the
complex of first and second primer extension products of step (e)
described above in this paragraph; a composite primer (which may or
may not be the same as the first primer) that is hybridizable to
the second primer extension product, wherein said composite primer
comprises an RNA portion and a 3' DNA portion; a DNA-dependent DNA
polymerase; an RNA polymerase; a propromoter polynucleotide
comprising a propromoter and a region which hybridizes to a second
primer extension product; and an agent (such as an enzyme) that
cleaves RNA from an RNA/DNA hybrid; and (b) incubating the mixture
of step (a) under conditions (which include necessary substrates
and buffer conditions) that permit primer hybridization, RNA
cleavage, displacement of the first primer extension product from
the first complex when its RNA is cleaved and a composite primer
binds to the second primer extension product in the first complex,
hybridization of the propromoter polynucleotide to the displaced
first primer extension product to form a second complex comprising
the displaced primer extension product and the propromoter
polynucleotide, and RNA transcription from said second complex.
[0024] In another aspect, the invention provides methods of
generating multiple copies of an RNA sequence of interest
comprising incubating a reaction mixture, said reaction mixture
comprising: (a) a target RNA; (b) a first primer that is
hybridizable to the target RNA, wherein the first primer is a
composite primer comprising an RNA portion and a 3' DNA portion;
(c) a second primer that is hybridizable to an extension product of
the first primer; (d) an RNA-dependent DNA polymerase; (e) a
DNA-dependent DNA polymerase; (f) an RNA polymerase; (g) a
propromoter polynucleotide comprising a propromoter and a region
which hybridizes to an extension product of the second primer; and
(h) an enzyme that cleaves RNA from an RNA/DNA hybrid; wherein the
incubation is under conditions that permit primer hybridization,
extension from the first primer and the second primer to form a
first complex comprising first and second primer extension
products, RNA cleavage, displacement of the first primer extension
product from the first complex when its RNA is cleaved and a
composite primer binds to the second primer extension product in
the first complex, hybridization of the propromoter polynucleotide
to the displaced first primer extension product to form a second
complex comprising the displaced primer extension product and the
propromoter polynucleotide, and RNA transcription from said second
complex, whereby multiple copies of the RNA sequence of interest
are generated.
[0025] In still another aspect, the invention provides methods of
generating multiple copies of (amplifying) an RNA sequence of
interest comprising incubating a reaction mixture, said reaction
mixture comprising: (a) a target RNA; (b) a first primer that is
hybridizable to the target RNA, wherein the first primer is a
composite primer comprising an RNA portion and a 3' DNA portion;
(c) a second primer that is hybridizable to an extension product of
the first primer, (d) an RNA-dependent DNA polymerase; (e) a
DNA-dependent DNA polymerase; and (f) an enzyme that cleaves RNA
from an RNA/DNA hybrid; wherein the incubation is under conditions
(which include necessary substrates and buffer conditions) that
permit primer hybridization, extension from the first primer and
the second primer to form a complex comprising first and second
primer extension products, RNA cleavage, and displacement of the
first primer extension product from the complex when its RNA is
cleaved and another first primer binds to the second primer
extension product in the complex, whereby multiple copies of a
polynucleotide sequence complementary to the RNA sequence of
interest are generated.
[0026] In another aspect, the invention provides methods of
generating multiple copies of (amplifying) an RNA sequence of
interest comprising: (a) incubating a reaction mixture, said
reaction mixture comprising: (i) a target RNA; and (ii) a first
primer that is hybridizable to a target RNA, wherein the first
primer is a composite primer comprising an RNA portion and a 3' DNA
portion; and (iii) a RNA-dependent DNA polymerase; wherein the
incubation is under conditions that permit primer hybridization and
formation of a complex comprising a first primer extension product
and the target RNA; (b) incubating a reaction mixture, said
reaction mixture comprising: (i) the complex comprising a first
primer extension product and the target RNA; and (ii) an enzyme
capable of cleaving RNA from an RNA/DNA hybrid; wherein the
incubation is under conditions that permit cleavage of RNA in the
complex comprising a first primer extension product and the target
RNA; (c) incubating a reaction mixture; said reaction mixture
comprising: (i) the first primer extension product; (ii) a second
primer that is hybridizable to the first primer extension product;
and (iii) DNA-dependent DNA polymerase; wherein the incubation is
under conditions that permit primer hybridization and formation of
a complex comprising the first primer extension product and a
second primer extension product; (d) incubating a reaction mixture,
said reaction mixture comprising: (i) the complex comprising the
first primer extension product and a second primer extension
product; (ii) an enzyme capable of cleaving RNA from an RNA/DNA
hybrid; wherein the incubation is under conditions that permit
cleavage of RNA in the complex comprising the first primer
extension product and a second primer extension product; (e)
incubating a reaction mixture, said reaction mixture comprising:
(i) a composite primer, wherein the composite primer comprises a
RNA portion and a 3' DNA portion; (ii) the cleaved complex
comprising the first primer extension product and a second primer
extension product; and (iii) DNA-dependent DNA polymerase; wherein
the incubation is under conditions that permit composite primer
hybridization, and displacement of the first primer extension
product from the complex comprising the first primer extension
product and a second primer extension product; whereby multiple
copies of a polynucleotide sequence complementary to the RNA
sequence of interest are generated.
[0027] The reaction mixtures may be combined (thus reducing the
number of incubations) in any way, with one or more reaction
mixtures above combined. Accordingly, in some embodiments, the
reaction mixtures of steps (a) and (b) are the same reaction
mixture (four incubations or incubation steps). In other
embodiments, the reaction mixtures of steps (d) and (e) are the
same reaction mixture (four incubations or incubation steps). In
still another embodiment, the reaction mixtures of steps (a) and
(b) are the same reaction mixture and the reaction mixtures of
steps (d) and (e) are the same reaction mixture (three incubations
or incubation steps). In still other embodiments, the reaction
mixtures of steps (a)-(c) are the same reaction mixture (three
incubations or incubation steps). In still another embodiment, the
reaction mixtures of steps (a)-(c) are the same reaction mixture
and the reaction mixtures of steps (d) and (e) are the same
reaction mixture (two incubations or incubation steps). In other
embodiments, the reaction mixtures of steps (a)-(d) are the same
reaction mixture (two incubations or incubation steps). In other
embodiments, the reaction mixtures of (b) and (c) are the same
reaction mixture (four incubations or incubation steps). In other
embodiments the reaction mixtures of (c) and (d) are the same
reaction mixture (four incubations or incubation steps). In yet
another embodiment, the reaction mixtures of (a)-(e) are the same
reaction mixture (one incubation). It is understood that any
combination of these incubation steps, and any single incubation
step, to the extent that the incubation is performed as part of any
of the methods described herein, fall within the scope of the
invention.
[0028] In another aspect of the invention, the methods of
generating multiple copies of (amplifying) an RNA sequence of
interest further comprise: (a) incubating a reaction mixture, said
reaction mixture comprising: (i) a copy of a polynucleotide
sequence complementary to the RNA sequence of interest; (ii) a
propromoter polynucleotide comprising a propromoter and a region
which hybridizes to the copy of a polynucleotide sequence
complementary to the RNA sequence of interest; and RNA polymerase;
and wherein the incubation is under conditions that permit
hybridization of the propromoter polynucleotide to the copy of a
polynucleotide sequence complementary to the RNA sequence of
interest to form a second complex comprising the copy of a
polynucleotide sequence complementary to the RNA sequence of
interest and the propromoter polynucleotide, and RNA transcription
from said second complex.
[0029] In yet another aspect, the invention provides methods of
generating multiple copies of (amplifying) an RNA sequence of
interest, said method comprising the steps of: (a) combining: a
target RNA; a first primer that is hybridizable to the target RNA,
wherein the first primer is a composite primer comprising an RNA
portion and a 3' DNA portion; a second primer that is hybridizable
to an extension product of the first primer; an RNA-dependent DNA
polymerase; a DNA-dependent DNA polymerase; an RNA polymerase; a
propromoter polynucleotide comprising a propromoter and a region
which hybridizes to an extension product of the second primer, and
an agent (such as an enzyme) that cleaves RNA from an RNA/DNA
hybrid; and (b) incubating the mixture of step (a) under conditions
(which includes necessary substrates and buffer conditions) that
permit primer hybridization, extension from the first primer and
the second primer to form a first complex comprising first and
second primer extension products, RNA cleavage, displacement of the
first primer extension product from the first complex when its RNA
is cleaved and another first primer binds to: the second primer
extension product in the first complex, hybridization of the
propromoter polynucleotide to the displaced first primer extension
product to form a second complex comprising the displaced primer
extension product and the propromoter polynucleotide, and RNA
transcription from said second complex, whereby multiple copies of
the RNA sequenceof interest are generated.
[0030] In yet another aspect, the invention provides methods of
generating multiple copies of (amplifying) a polynucleotide
sequence complementary to an RNA sequence of interest, said method
comprising the steps of: (a) hybridizing a primer to a target RNA,
wherein the primer is a composite primer comprising an RNA portion
and a 3' DNA portion; (b) extending the primer with an
RNA-dependent DNA polymerase, whereby a complex comprising a primer
extension product and the target RNA is produced; (c) cleaving RNA
in the complex of step (b) with an agent (such as an enzyme) that
cleaves RNA from an RNA/DNA hybrid, such that at least one fragment
of the target RNA remains hybridized to the primer extension
product; (d) extending the at least one fragment of the target RNA
with a DNA-dependent DNA polymerase, whereby a fragment extension
product comprising the sequence of interest is produced to form a
complex of primer and fragment extension products; (e) cleaving RNA
from the composite primer in the complex of primer and fragment
extension products with an agent (such as an enzyme) that cleaves
RNA from an RNA/DNA hybrid such that a composite primer (which may
or may not be the same as the first primer) hybridizes to the
fragment extension-product and repeats primer extension by strand
displacement, wherein said composite primer comprises an RNA
portion and a 3' DNA portion; whereby multiple copies of a
polynucleotide sequence complementary to the RNA sequence of
interest are generated. In some embodiments, the invention provides
methods of generating multiple copies of a polynucleotide sequence
complementary to an RNA sequence of interest, said method
comprising the steps of (a) combining: the complex of primer and
fragment extension product of step (d) described above in this
paragraph; a composite primer (which may or may not be the same as
the first primer) that is hybridizable to the fragment extension
product, wherein said-composite primer comprises an RNA portion and
a 3' DNA portion; a DNA-dependent DNA polymerase; and an agent
(such as an enzyme) that cleaves RNA from an RNA/DNA hybrid; and
(b) incubating the mixture of step (a) under conditions (which
include necessary substrates and buffer conditions) that permit
primer hybridization, RNA cleavage, and displacement of the primer
extension product from the complex of step (d): described above in
this paragraph when its RNA is cleaved and a composite primer binds
to the fragment extension product in the complex.
[0031] In yet another aspect, the invention provides methods of
generating multiple copies of (amplifying) an RNA sequence of
interest, said method comprising the steps of: (a) hybridizing a
first primer to a target RNA, wherein the first primer is a
composite primer comprising an RNA portion and a 3' DNA portion;
(b) extending the first primer with an RNA-dependent DNA
polymerase, whereby a complex comprising a first primer extension
product and the target RNA is produced; (c) cleaving the target RNA
in the complex of step (b) with an agent (such as an enzyme) that
cleaves RNA from an RNA/DNA hybrid, such that fragments of the
target RNA remains hybridized to the first primer extension
product; (d) extending the at least one fragment of the target RNA
with a DNA-dependent DNA polymerase, whereby a fragment extension
product comprising the sequence of interest is produced to form a
complex of primer and fragment extension products; (e) cleaving RNA
from the composite primer in the complex of primer and fragment
extension products with an agent (such as an enzyme) that cleaves
RNA from an RNA/DNA hybrid such that a composite primer (which may
or may not be the same as the first primer) hybridizes to the
fragment extension product and repeats primer extension by strand
displacement, wherein said composite primer comprises an RNA
portion and a 3.degree. DNA portion; (f) hybridizing a displaced
primer extension product with a polynucleotide comprising a
propromoter and a region which is hybridizable to the displaced
primer extension product under conditions which allow transcription
to occur by RNA polymerase, such that RNA transcripts are produced
comprising sequences complementary to the displaced primer
extension product, whereby multiple copies of the RNA sequence of
interest are generated. In some embodiments, the invention provides
methods of generating multiple copies of an RNA sequence of
interest, said method comprising the steps of: (a) combining: a
first complex, wherein the first complex is the complex of primer
and fragment extension product of step (d) described above in this
paragraph; a composite primer (which may or may not be the same as
the first primer) that is hybridizable to the fragment extension
product, wherein said composite primer comprises an RNA portion and
a 3' DNA portion; a DNA-dependent DNA polymerase; an RNA
polymerase; a propromoter polynucleotide comprising a propromoter
and a region which hybridizes to a second primer extension product;
and an agent (such as an enzyme) that cleaves RNA from an RNA/DNA
hybrid; and (b) incubating the mixture of step (a) under conditions
(which include necessary substrates and buffer conditions) that
permit primer hybridization, RNA cleavage, displacement of the
primer extension product from the first complex when its RNA is
cleaved and a composite primer binds to the fragment extension
product in the first complex, hybridization of the propromoter
polynucleotide to the displaced primer extension product to form a
second complex comprising the displaced primer extension product
and the propromoter polynucleotide, and RNA transcription from said
second complex.
[0032] In yet another aspect, the invention provides methods
ofgenerating multiple copies of (amplifying) a polynucleotide
sequence complementary to an RNA sequence of interest, said method
comprising the steps of: (a) combining: a target RNA; a primer that
is hybridizable to the target RNA, wherein the primer is a
composite primer comprising an RNA portion and a 3' DNA portion; an
RNA-dependent DNA polymerase; a DNA-dependent DNA polymerase; and
an agent (such as an enzyme) that cleaves RNA from an RNA/DNA
hybrid; and (b) incubating the mixture of step (a) under conditions
(which includes necessary substrates and buffer conditions) that
permit primer hybridization, RNA cleavage, wherein RNA cleavage of
a first complex comprising a target RNA and a primer extension
product is such that a fragment of the target RNA remains
hybridized to the primer extension product, primer extension from
the primer and the fragment of the target RNA to form a second
complex comprising a primer extension product and a fragment
extension product that comprises the sequence of interest, and
displacement of the primer extension product from the second
complex when its RNA is cleaved and another primer binds to the
fragment extension product in the second complex, whereby multiple
copies of a polynucleotide sequence complementary to the RNA
sequence of interest are generated.
[0033] In one other aspect, the invention provides methods of
generating multiple copies of (amplifying) an RNA sequence of
interest, said method comprising the steps of: (a) combining: a
target RNA; a primer that is hybridizable to the target RNA,
wherein the primer is a composite primer comprising an RNA portion
and a 3' DNA portion; an RNA-dependent DNA polymerase; a
DNA-dependent DNA polymerase; an RNA polymerase; a propromoter
polynucleotide; and an agent (such as an enzyme) that cleaves RNA
from an RNA/DNA hybrid; and (b) incubating the mixture of step (a)
under conditions (which includes necessary substrates and buffer
conditions) that permit primer hybridization, RNA cleavage, wherein
RNA cleavage of a first complex comprising a target RNA and a
primer extension product occurs such that a fragment of the target
RNA remains hybridized to the primer extension product, primer
extension from the primer and the fragment of the target RNA to
form a second complex comprising a primer extension product and a
fragment extension product that comprises the sequence of interest,
displacement of the primer extension product from the second
complex when its RNA is cleaved and another primer binds to the
second complex, hybridization of the propromoter polynucleotide to
a displaced primer extension product to form a third complex
comprising the displaced primer extension product and the
propromoter polynucleotide, and transcription from said third
complex, whereby multiple copies of the RNA sequence of interest
are generated.
[0034] In another aspect, the invention provides methods of
generating multiple copies of an RNA sequence of interest present
on a target RNA, said method comprising: formation of a complex of
first and second primer extension products comprising a 3' single
stranded portion according to any of the methods described herein;
(c) hybridizing a propromoter oligonucleotide to the 3' single
stranded portion described in step (b); and (d) transcription using
DNA-dependent RNA polymerase, whereby multiple copies of sense RNA
products are generated.
[0035] In another aspect, the invention provides methods of
generating multiple copies of a sequence complementary to an RNA
sequence of interest present on a target RNA and multiple copies of
an RNA sequence of interest present on a target RNA, said methods
comprising the steps of: (a) extending a first primer hybridized to
a target RNA with an RNA-dependent DNA polymerase, wherein the
first primer is a composite primer comprising an RNA portion and a
3' DNA portion, whereby a complex comprising a first primer
extension product and the target RNA is produced; (b) cleaving RNA
in the complex of step (b) with an enzyme that cleaves RNA from an
RNA/DNA hybrid; (c) extending a second primer hybridized to the
first primer extension product with a DNA-dependent DNA polymerase,
wherein the second primer is a composite primer comprising an RNA
portion and a 3' DNA portion, whereby a second primer extension
product is produced to form a complex of first and second primer
extension products; (d) cleaving RNA from the first and second
composite primers in the complex of first and second primer
extension products with an enzyme that cleaves RNA from an RNA/DNA
hybrid such that another-composite primer hybridizes to the second
primer extension product and another composite primer hybridizes to
the first primer extension product; (e) extending said composite
primers of step (d) with a DNA-dependent DNA polymerase; whereby
said first primer extension product is displaced, and whereby
multiple copies of a polynucleotide sequence complementary to the
RNA sequence of interest are generated; and whereby said second
primer extension product is displaced, and whereby multiple copies
of the RNA sequence of interest are generated.
[0036] In another aspect, the methods of generating multiple copies
of a polynucleotide sequence complementary to an RNA sequence of
interest comprise generating multiple copies of a polynucleotide
sequence complementary to of two or more different sequences of
interest.
[0037] In another aspect, the methods of generating multiple copies
of an RNA sequence of interest comprise generating multiple copies
of two or more different sequences of interest.
[0038] Various embodiments of the composite primer and second
primer used in the methods of the invention are described herein.
For example, in some embodiments, the RNA portion of a composite
primer is 5' with respect to the 3' DNA portion. In still other
embodiments, the 5' RNA portion is adjacent to the 3' DNA portion.
In some embodiments, a composite primer comprises a 5' portion (for
example, a 5' RNA portion) that is not hybridizable to a target RNA
under conditions which the composite primer hybridizes to target
RNA. In yet other embodiments, a composite primer comprises a 3'
portion (for example, a 3' DNA portion) that comprises a random
sequence. In some embodiments wherein a target RNA is mRNA, a
composite primer may comprise a poly-dT sequence. In other
embodiments, a composite primer is a random primer. In still other
embodiments, a plurality of composite primers are used for
hybridizing to the target RNA. In some embodiments, the composite
primer that hybridizes to'target RNA and the composite primer that
hybridizes to second primer extension product are the same. In some
embodiments, the composite primer that hybridizes to target RNA and
the composite primer that hybridizes to second primer extension
product are different.
[0039] In still other embodiments, the second primer is a primer
comprising DNA (in some embodiments, consisting of DNA). In other
embodiments, the second primer comprises one or more fragments of
target RNA hybridized to the first primer extension product, said
one or more fragments generated by cleaving RNA in the complex of
target RNA and first primer extension product with an enzyme that
cleaves RNA from an RNA/DNA hybrid. In other embodiments, the
second primer comprises a portion (for example, a 3' portion) that
comprises a random sequence. In yet another embodiment, the second
primer is a random primer. In some embodiments, the second primer
comprises a 5`portion that is not` hybridizable to a first primer
extension product. For the methods described herein, one or more
composite primers or second primers can be used.
[0040] The enzymes which may be used in the methods and
compositions are described herein. For example, the agent (such as
an enzyme) that cleaves RNA may be an RNaseH, and the RNA-dependent
DNA polymerase may be reverse transcriptase. The RNA-dependent DNA
polymerase may comprise an RNase H enzyme activity, or separate
enzymes may be used. Similarly, a DNA polymerase may comprise both
RNA-dependent and DNA-dependent DNA polymerase enzyme activities,
or separate enzymes may be used. A DNA-dependent DNA polymerase and
an enzyme that cleaves RNA may also be the same enzyme. A
DNA-dependent DNA polymerase, an RNA-dependent DNA polymerase, and
the enzyme that cleaves RNA can also be the same enzyme.
[0041] In some embodiments, methods of the invention are used to
generate labeled polynucleotide products (generally DNA or RNA
products). In some embodiments of methods for generating labeled
DNA products, at least one type of dNTP used is a labeled dNTP. In
some embodiments of methods for generating labeled RNA products, at
least one type of rNTP used is a labeled rNTP. In other embodiments
of methods for generating labeled DNA products, a labeled composite
primer is used.
[0042] In some aspects, a propromoter polynucleotide (for example,
a PTO) comprises a region at the 3' end which hybridizes to the
displaced primer extension product, whereby DNA polymerase
extension of displaced extension product produces a double stranded
promoter from which transcription occurs.
[0043] The methods are applicable to amplifying any RNA target,
including, for example, mRNA and ribosomal RNA. One or more steps
may be combined and/or performed sequentially (often in any order,
as long as the requisite product(s) areable to be formed), and, as
is evident, the invention includes various combinations of the
steps described herein. It is also evident, and is described
herein, that the invention encompasses methods in which the
initial, or first, step is any of the steps described herein. For
example, the methods of the invention do not require that the first
step be production of the first primer extension product from the
RNA template. Methods of the invention encompass embodiments in
which later, "downstream" steps are an initial step.
[0044] Further, in various embodiments of the invention, it is
understood that the first primer extension product comprises (a) a
sequence complementary to an RNA sequence and (b) a 5' portion,
preferably a 5' end, that is RNA. As described, this product
generally arises from primer extension of a composite primer with
an RNA portion along an RNA template. As such, reference to a first
primer extension product refers to a product comprising (a) and (b)
above.
[0045] The invention also provides methods which employ (usually,
analyze) the products of the amplification methods of the
invention, such as sequencing, detection of sequence alteration(s)
(e.g., genotyping or nucleic acid mutation detection); determining
presence or absence of a sequence of interest; gene expression
profiling; subtractive hybridization; preparation of a subtractive
hybridization probe; differential amplification; preparation of
libraries (including cDNA and differential expression libraries);
preparation of an immobilized nucleic acid (which can be a nucleic
acid immobilized on a microarray), and characterizing (including
detecting and/or quantifying) amplified nucleic acid products
generated by the methods of the invention.
[0046] In some aspects, the invention provides methods of
sequencing an RNA sequence of interest, said methods comprising
amplifying a target RNA containing the sequence of interest by the
amplification methods of the invention in the presence of a mixture
of dNTPs and dNTP analogs (which may be labeled or unlabeled), such
that primer extension is terminated upon incorporation of a DNTP
analog which may be labeled or unlabeled, and analyzing the
amplification products to determine sequence. In embodiments
wherein amplified products are RNA transcripts, the methods may
comprise (a) amplifying a target RNA containing the sequence of
interest by the amplification methods of the invention in the
presence of a mixture of rNTPs and rNTP analogs (which may be
labeled or unlabeled), such that RNA transcription is terminated
upon incorporation of an rNTP analog which may be labeled or
unlabeled; and (b) analyzing the amplification products to
determine sequence.
[0047] In some aspects, the invention provides methods of detecting
a mutation (or, in some aspects, characterizing a sequence) in a
target RNA, comprising (a) amplifying the target RNA by a method
described herein; and (b) analyzing the amplification products of
the method for single stranded conformation, wherein a difference
in conformation as compared to a reference single stranded RNA
indicates a mutation in the target RNA. In other embodiments, the
invention provides methods of detecting a mutation (or, in some
aspects, characterizing a sequence) in a target RNA comprising
analyzing amplification products of any of the methods described
herein for single stranded conformation, wherein a difference in
conformation as compared to a reference single stranded RNA
indicates a mutation in the target RNA (or, in some aspects,
characterizes the target sequence).
[0048] In another aspect, the invention provides methods of
determining presence or absence of a sequence of interest, said
methods comprising (i) amplifying a target RNA containing the
sequence of interest, said amplification comprising extending a
composite primer hybridized to cleaved complex of first and second
primer extension product prepared by any of the methods described
here, wherein the sequence of the RNA portion of the composite
primer is known, and (ii) comparing the amplification products if
any from step (i) with the amount of amplification products from a
reference template; wherein (1) production of detectably fewer
amplification products from the template as compared to the amount
of amplification products from the reference template which
comprises a region hybridizable to the RNA portion of the composite
primer indicates that the secondiprimer extension product does not
comprise a sequence hybridizable to the RNA portion of the
composite primer and is a sequence variant with respect to the
sequence hybridizable to the RNA portion of the composite primer,
or (2) production of detectably more amplification products from
the template as compared to the amount of amplification products
from the reference template which does not comprise a region which
is hybridizable to the RNA portion of the composite primer
indicates that the second primer extension product comprises a
sequence hybridizable to the RNA portion of the composite primer
and is not a sequence variant with respect to the sequence
hybridizable to the RNA portion of the composite primer.
[0049] In another aspect, the invention provides methods of
producing a nucleic acid immobilized to a substrate (which includes
methods of producing a microarray), comprising (a) amplifying a
target RNA by any of the methods described herein; and (b)
immobilizing the amplification products on a substrate. The
amplification products can be labeled or unlabeled. In other
aspects, the invention provides methods of producing a nlicroarray,
comprising (a) amplifying a target RNA by an amplification method
described herein; and (b) immobilizing the amplification products
on a substrate (which can be solid or semi-solid). In some
embodiments, microarrays are produced by immobilizing amplification
products onto a substrate to make a microarray of amplification
products. The microarray can comprise at least one amplification
product immobilized on a solid or semi-solid substrate fabricated
from a material selected from the group consisting of paper, glass,
ceramic, plastic, polystyrene, polypropylene, nylon,
polyacrylamide, nitrocellulose, silicon and other metals, and
optical fiber. An amplification product can be immobilized on the
solid or semi-solid substrate in a two imensional configuration or
a three-dimensional configuration comprising pins, rods, fibers,
tapes, threads, beads, particles, microtiter wells, capillaries,
and cylinders.
[0050] Any of the methods of the invention can be used to generate
polynucleotide (generally, DNA or RNA) products that are suitable
for characterization of an RNA sequence of interest in a sample. In
one embodiment, the invention provides methods for characterizing
(for example, detecting (presence or absence) and/or quantifying)
an RNA sequence of interest comprising: (a) amplifying a target RNA
by any of the methods described herein; and (b) analyzing the
amplification products. Step (b) of analyzing the amplification
products can be performed by any method known in the art or
described herein, for example by detecting and/or quantifying
amplification products that are hybridized to a probe. These
amplification products may or may not be labeled. Any of the
methods of the invention can be used to generate DNA or RNA
products that are labeled by incorporating labeled nucleotides
and/or labeled composite primers into appropriate step(s) of the
methods. These labeled products are particularly suitable for
quantification and/or identification by methods known in the art,
which include the use of arrays such as cDNA microarrays and
oligonucleotide arrays. In one aspect, the invention provides a
method of characterizing an RNA sequence of interest, comprising
(a) amplifying a target RNA by a method described herein to
generate labeled DNA products; and (b) analyzing the labeled DNA
products. In some embodiments, the step of analyzing DNA products
comprises determining amount of said products, whereby the amount
of the RNA sequence of interest present in a sample is
quantified.
[0051] In another aspect, the invention provides a method of
characterizing an RNA sequence of interest, comprising (a)
amplifying a target RNA by a method described herein to generate
labeled RNA products; and (b) analyzing the labeled RNA products.
In some embodiments, the step of analyzing RNA products comprises
determining amount of said products, whereby the amount of the RNA
sequence of interest present in a sample is quantified. The DNA or
RNA productscan be analyzed by, for example, contacting them with
at least one probe. In some embodiments, the at least one probe is
provided as a microarray. The microarray can comprise at least one
probe immobilized on a solid or semi-solid substrate fabricated
from a material selected from the group consisting of paper, glass,
ceramics, plastic, polypropylene, polystyrene, nylon,
polyacrylamide, nitrocellulose, silicon, other metals, and optical
fiber. A probe can be immobilized on the solid or semi-solid
substrate in a two-dimensional configuration or a three-dimensional
configuration comprising pins, rods, fibers tapes threads, beads,
particles, microtiter wells, capillaries, and cylinders.
[0052] In another aspect, the invention provides methods of
determining gene expression profile in a sample, the methods
comprising (a) amplifyingat least one RNA sequence of interest in
the sample using any of the methods described herein; and (b)
determining amount of amplification products of each RNA sequence
of interest, wherein each said amount is indicative of amount of
each RNA sequence of interest in the sample, whereby the gene
expression profile of the sample is determined.
[0053] In another aspect, the invention provides methods of
preparing a library (including cDNA and subtractive hybridization
libraries), said methods comprising: amplifying at least one RNA
sequences of interest using any of the methods described herein to
generate a single or double stranded nucleic acid product.
[0054] In another aspect, the invention provides methods of
preparing a subtractive hybridization probe, said methods
comprising generating multiple single stranded polynucleotide,
preferably DNA, copies of the complement of at least one RNA
sequences of interest from a first RNA population using any of the
methods described herein.
[0055] In another aspect, the invention provides methods of
performing subtractive hybridization, said methods comprising: (a)
generating multiple copies of the complement of at least one RNA
sequences of interest from a first RNA population using any of the
methods described herein; and (b) hybridizing the multiple copies
to a second mRNA population, whereby a subpopulation of the second
RNA population forms a complex with a DNA copy. In some embodiments
the methods further comprise: (c) cleaving RNA in the complex of
step (b) with an enzyme that cleaves RNA from an RNA/DNA hybrid;
and (d) amplifying an unhybridized subpopulation of the second mRNA
population (using any method, including the methods described
herein), whereby multiple copies of single stranded DNA
complementary to the unhybridized subpopulation of the second mRNA
population are generated.
[0056] In another aspect, the invention provides methods for
differential amplification, the methods comprising: (a) generating
multiple nucleic acid, generally DNA, copies of the complement of
at least one RNA sequence of interest from a first RNA population
using any of the methods described herein; (b) hybridizing the
multiple copies to a second mRNA population, whereby a
subpopulation of the second mRNA population forms a complex with a
DNA copy; (c) cleaving RNA in the complex of step (b) with an
enzyme that cleaves RNA from an RNA/DNA hybrid; and (d) amplifying
an unhybridized subpopulation of the second mRNA population using
any method, including those described herein, whereby multiple
copies of single stranded DNA complementary to the unhybridized
subpopulation of the second mRNA population are generated.
[0057] In another aspect, the invention provides methods for making
a library, said method comprising preparing a subtractive
hybridization probe as described herein, or differential
amplification as described herein.
[0058] Any of these applications can use any of the amplification
methods (including various components and various embodiments of
any of the components) as described herein. For example, the
composite primer used may have a 5' RNA portion, which may be
adjacent to the 3' DNA portion.
[0059] The invention also provides compositions, kits, complexes,
reaction mixtures and systems comprising various components (and
various combinations of the components) used in the amplification
methods described herein. In one aspect, for example, the invention
provides compositions comprising a composite primer, wherein the
composite primer comprises an RNA portion and a 3' DNA portion, and
a second primer, wherein the second primer is a random primer. In
some embodiments, these compositions further comprise an RNA
dependent DNA polymerase (which can be a reverse transcriptase). In
another embodiment, the invention provides a composition comprising
a composite primer and a second primer that comprises a sequence
that is not hybridizable (under conditions in which a region of
primer is hybridizable) to a composite primer extension product
(generally, but not necessarily, the use of this primer results in
generating primer extension products to which a propromoter
polynucleotide can hybridize). In some embodiments, the 5' RNA
portion of a composite primer is adjacent to its 3' DNA portion. In
still other embodiments, the 5' RNA portion of a composite primer
is about 5 to about 20 nucleotides and its 3' DNA portion: is about
5 to about 15 nucleotides. In some embodiments, the propromoter
polynucleotide is a propromoter template oligonucleotide (PTO). In
still other embodiments the invention provides a composition
comprising: (a) a composite primer; (b) a second primer (which can
be a random primer); and (c) a propromoter polynucleotide (which in
some embodiments is a PTO).
[0060] In another aspect, the invention provides compositions
comprising any of the complexes (which are generally considered as
intermediates with respect to the final amplification products)
described herein (see also the figures for exemplary schematic
depictions of these various complexes). For example, the invention
provides compositions comprising a complex of: (a) a first primer
extension strand, wherein the first primer is a composite primer
comprising an RNA portion and a 3' DNA portion; and (b) a target
RNA strand. In yet another aspect, the invention provides
compositions comprising a complex of: (a) a first primer extension
product, wherein the first primer is a composite primer comprising
an RNA portion and a 3' DNA portion; and (b) a second primer (or
fragment) extension product. In still another aspect, the invention
provides a complex of (a) a cleaved primer extension product,
wherein the primer is a composite primer comprising an RNA portion
and a 3' DNA portion; (b) a second primer (or fragment) extension
product; and (c) a composite primer.
[0061] In another aspect, the invention includes any one or more
products (including intermediates) and compositions comprising the
products (including intermediates) produced by any aspect of the
methods of the invention. The products include libraries and any
other population produced, which are generally based on the nature
of the primer(s) used in the methods described herein.
[0062] In another aspect, the invention provides reaction mixtures
(or compositions comprising reaction mixtures) which contain
various combinations of components described herein. For example,
the invention provides reaction mixtures comprising (a) a target
RNA; (b) a composite primer comprising a 3' DNA portion and an RNA
portion; (c) a second primer; and (d) a DNA polymerase. As
described herein, any of the composite primers may be in the
reaction mixture (or a plurality of composite primers), including a
composite primer that comprises a 5' RNA portion which is adjacent
to the 3' DNA portion. The reaction mixture could also further
comprise an enzyme which cleaves RNA from an RNA/DNA hybrid, such
as RNase H. A reaction mixture of the invention can also comprise a
propromoter polynucleotide (which in some embodiments is a PTO),
and/or an RNA polymerase. A reaction mixture of the invention can
also comprise (a) a displaced primer extension product (which
contains a 5' end sequence complementary to the 3' DNA portion of a
composite primer, but not sequences complementary to the RNA
portion of a composite primer); (b) a propromoter polynucleotide
(such as a PTO); and (c) an RNA polymerase.
[0063] In another aspect, the invention provides kits for
conducting the methods described herein. These kits, in suitable
packaging and generally (but not necessarily) containing suitable
instructions, contain one or more components used in the
amplification methods. For example, the invention provides kits
that comprise a composite primer comprising a 3' DNA portion and an
RNA portion (which may be 5' and may further be adjacent to the 3'
DNA portion), and a second primer (which may or may not be
separately packaged). In some embodiments, these kits further
comprise instructions for using the primers to amplify RNA. The
composite primer in the kits can be any described herein. The kits
can contain further components, such as any of (a) a propromoter
polynucleotide (such as a PTO); and (b) any of the enzymes
described herein, such as an enzyme which cleaves RNA from an
RNA/DNA hybrid (for example, RNaseH), DNA polymerase (RNA-dependent
or DNA-dependent) and RNA polymerase. Any of these kits can further
comprise instructions for using the components to amplify RNA.
[0064] In another aspect, the invention provides systems for
effecting the amplification methods described herein. For example
the invention provides systems for amplifying a target RNA,
comprising (a) a composite primer comprising a 3' DNA portion and
an RNA portion; (b) a second primer; (c) an RNA ependent DNA
polymerase; (d) a DNA-dependent DNA polymerase; and (e) an enzyme
which cleaves RNA from an RNA/DNA hybrid (such as RNaseH). The
composite primer may be any (one or more) described herein,
including a composite primer which comprises a 5' RNA portion which
is adjacent to: the 3'. DNA portion. The systems can further
comprise a propromoter polynucleotide (such as a PTO) and/or an RNA
polymerase. As described herein, systems of the invention generally
comprise one or more apparatuses appropriate for carrying out
methods of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0065] FIGS. 1A-1B show a diagrammatic representation of a linear
isothermal. RNA amplification process using a composite primer, a
second primer, and strand displacement to generate multiple copies
of single stranded DNA product comprising sequences complementary
to the target RNA.
[0066] FIGS. 2A-C show a diagrammatic representation of an enhanced
linear isothermal RNA amplification process using a composite
primer, a second primer, strand displacement and transcription to
generate multiple copies of the target RNA.
[0067] FIGS. 3A-B show a diagrammatic representation of a linear
isothermal RNA amplification process using a single composite
primer and strand displacement to generate multiple copies of
single stranded DNA product comprising sequences complementary to
the target RNA.
[0068] FIGS. 4A-B show a diagrammatic representation of an enhanced
linear isothermal RNA amplification process using a single
composite primer, strand displacement and transcription to generate
multiple copies of the target RNA.
[0069] FIG. 5 shows a diagrammatic representation of a linear
isothermal RNA amplification process using a single composite
primer containing a poly-dT sequence and strand displacement to
generate multiple-copies of single stranded DNA product comprising
sequences complementary to the target RNA.
[0070] FIG. 6 shows a diagrammatic representation of a linear
isothermal RNA amplification process using a single composite
primer containing a random sequence and strand displacement to
generate multiple copies of single stranded DNA product comprising
sequences complementary to the target RNA.
[0071] FIG. 7 shows a diagrammatic representation of an enhanced
isothermal RNA amplification process using a single composite
primer and transcription to generate multiple copies of RNA product
comprising sequences complementary to the target RNA.
[0072] FIGS. 8A-E show a diagrammatic representation of a linear
isothermal RNA amplification process using two composite primers
and strand displacement to generate multiple copies of single
stranded. DNA products comprising sequences complementary to the
target RNA and sequences identical to the target RNA.
[0073] FIG. 9 shows a photograph of a gel showing PCR products
amplified from double stranded cDNA comprising an appended defined
sequence on the second strand cDNA prepared using linear isothermal
RNA amplification.
[0074] FIG. 10 shows graphs depicting results of real-time PCR
experiments quantifying products generated using linear isothermal
RNA amplification.
MODES FOR CARRYING OUT THE INVENTION
[0075] Overview of the Invention and its Advantages
[0076] The invention discloses novel methods, compositions and kits
for amplification of RNA sequences. The methods provide for
isothermal amplification of a single RNA species or a pool of RNA
species. Some methods provide for generation of multiple copies of
DNA comprising sequences complementary to an RNA sequence of
interest. Other methods provide for generation of multiple copies
of an RNA sequence of interest. These methods are suitable for, for
example, generation of cDNA libraries and subtractive hybridization
probes. They generate single stranded DNA or RNA products which are
readily suitable for variety of uses including expression
profiling, e.g., by multiplex analysis by microarray technologies,
as well as electrophoresis-based technologies such as differential
display. The methods are amenable to automation and do not require
thermal cycling.
[0077] The methods of the invention are directed to the
amplification of one or more species of RNA, such as a pool of RNA
sequences, and are especially suitable for the amplification of all
RNA (such as mRNA) sequences in a preparation of total RNA from a
biological sample. Thus, one of the major advantages of the methods
of the invention is the ability to amplify an entire pool of
sequences, which is essential for the ability to analyze the gene
expression profile in cells, such as the cells in a biological
sample of interest. The methods of the invention may also be usedto
amplify a specific RNA sequence of interest, or a miultiplicity of
RNAs, for example, members of a family of related RNAs. The methods
of the invention also are suitable for amplifying a large
multiplicity, and most preferably all RNA (such as mRNA) sequences
in a sample.
[0078] Insofar as many mRNAs have a unique poly-A 3'-end,
amplification initiated from the 3'-end sequence of mRNAs is
commonly performed for preparation of cDNA libraries and subsequent
sequence analysis for determination of gene expression profiling or
other applications. The methods of the invention are similarly
suited for preparation of libraries of amplified 3'-portions of
mRNAs. A composite primer used in the methods of invention can be
designed to be hybridizable to a multiplicity, or all, of the mRNA
species in the sample by using random sequences, according to
methods known in the art. Alternatively, if a selected RNA or
family of related RNAs are to be amplified, the composite primer
will comprise sequence(s) hybridizable to the selected RNA or
family of related RNAs.
[0079] The methods generally comprise using specially-designed
primers, generally one or more RNA/DNA composite primers, to
generate a complex of first and second strand cDNAs that comprise a
portion with a particular characteristic (e.g., cleavable by an
enzyme). As used herein, it is understood that "cDNA" refers to a
polynucleotide primer extension product. Generally, the complex
comprises an RNA/DNA heteroduplex at an end of the double stranded
cDNA complex. The RNA/DNA heteroduplex at an end of the double
stranded cDNA complex may comprise a defined end sequence,
generally introduced by the RNA portion of the composite primer.
The composite primer according to the methods of the invention
comprises a 3'-DNA portion that generally is designed to be
hybridizable to a target RNA(s). The remaining portion(s) (such as
the 5' RNA portion) of the composite primer generally, but not
necessarily, comprises a sequence that is not hybridizable to a
target RNA (which would constitute a tail when the primer is bound
to a target RNA). Thus, and as the description herein makes clear,
reference to a primer that hybridizes to a sequence (or
hybridization template) encompasses embodiments in which at least a
portion of the primer is hybridized, as well as those embodiments
in which an entire primer is hybridized.
[0080] The double stranded cDNA complex is a substrate for linear
amplification as follows an enzyme which cleaves RNA from an
RNA/DNA hybrid (such as RNase H) cleaves RNA sequence from the
hybrid, leaving a 3'. DNA sequence on the second strand cDNA
available for binding by a composite primer which may or may not be
the same as the first composite primer. Extension of a bound
composite primer by DNA polymerase produces a primer extension
product, which displaces the previously bound cleaved first primer
extension product, whereby single stranded DNA product accumulates.
The single stranded DNA product is a copy of the complement of the
target RNA (or "antisense" DNA). This linear amplification is
referred to as "SPIA" (for Single Primer Linear Amplification), and
is described in Kurn et al., U.S. Pat. No. 6,251,639 B1.
[0081] In one aspect, the invention works as follows: a composite
RNA/DNA primer forms the basis for replication of the template RNA
The composite primer (also referred to herein as "the first
primer") hybridizes to template RNA which comprises the RNA
sequence(s) of interest, and the composite primer is extended by an
RNA-dependent DNA polymerase to form a first primer extension
product (interchangeably called "composite primer extension
product", or "first-strand cDNA"). After cleavage of the template
RNA, a second primer extension product (interchangeably called
"second-strand cDNA") is formed (as described below) in a complex
with the first primer extension product. The complex of first and
second primer extension products is composed of an RNA/DNA hybrid
at one end due to the presence of the composite primer in the first
primer extension product. An agent such as an enzyme which cleaves
RNA from an RNA/DNA hybrid (such as RNase H) cleaves RNA sequence
from the hybrid, leaving a sequence on the second primer extension
product available for binding by another composite primer, which
may or may not be the same as the first composite primer. Another
first (composite) primer extension product is produced by DNA
polymerase, which displaces the previously bound cleaved first
primer extension product, resulting in displaced cleaved first
primer extension product.
[0082] In some embodiments of the invention, the second primer
extension product is formed as follows: following cleavage of the
RNA template, a second primer is then hybridized to the first
primer extension product and extended to form a second primer
extension product in a complex with the first primer extension
product. The complex of first and second primer extension products
is composed of anRNA/DNA hybrid at one end due to the presence of
the composite primer in the first primer extension product. The
second primer is any sequence that is hybridizable to the first DNA
strand such that it is capable of being extended by a DNA
polymerase along a first primer extension product to create a
second primer extension product. Thus, in some embodiments, the
second primer is an oligonucleotide, which may or may not comprise
a random sequence (i.e., a sequence designed to be hybridizable
(under a given set of conditions) to one or more sequences in the
sample). In other embodiments, it comprises a sequence of the first
DNA strand (generally at the 3' end) that is hybridized to a
sequence in the first DNA strand (for example, a hairpin or
self-annealed structure).
[0083] In another aspect of the amplification methods, one or more
fragments of the target RNA serves as the primer of the second
primer extension product. The target RNA in the initial complex
comprising the target RNA and first primer extension product is
cleaved with an agent (such as RNase H) such that at least one
fragment of the template RNA remains hybridized to the first primer
extension product. In this aspect of the invention, one (or more)
template RNA fragment(s) serves as a second "primer" in the manner
described above, to generate a fragment extension product which has
the same function as the second primer extension product in the
amplification methods described above. A suitable RNA fragment in
the methods of the invention is long enough such that it does not
dissociate from the first strand cDNA, preferably from about 3 to
about 30, more preferably from about 5 to about 25, even more
preferably from about 10 to about 20, and most preferably from
about 12 to about 17, nucleotides in length.
[0084] In embodiments involving transcription (referred to herein
as "enhanced" methods), the second primer may further comprise a
sequence such that displaced first primer extension products (other
than the very first composite primer extension product) contain a
sequence to which a polynucleotide comprising a propromoter (also
referred to herein as "propromoter polynucleotide") is capable of
hybridizing. Hybridization of the propromoter polynucleotide to a
displaced primer extension product and extension of the 3' end of
the displaced first primer extension product (if there is an
overhang) results in a double stranded promoterregion that drives
transcription (via DNA-dependent RNA polymerase) to produce sense
RNA products. This "enhanced" approach is described in Kummet al.,
U.S. Pat. No. 6,251,639 B1.
[0085] Accordingly, the invention provides methods of producing at
least one copy of a polynucleotide sequence complementary to an RNA
sequence of interest comprising combining and reacting the
following: (a) a target RNA comprising an RNA sequence of interest;
(b) a first (composite) primer comprising an RNA portion and a 3'
DNA portion; (c) a second primer that is hybridizable to an
extension product of the composite primer; (d) an RNA-dependent DNA
polymerase; (e) a DNA-dependent DNA polymerase; (f) an agent (such
as an enzyme) that cleaves RNA from an RNA/DNA hybrid; and (g)
deoxyribonucleoside triphosphates or suitable analogs (which may or
may not be labeled). In embodiments that include transcription
(i.e., the enhanced methods), the following are also included in
the amplification reaction (either at the same time as the
components listed above or added separately): (h) a prbpromoter
polynucleotide comprising a propromoter and a region which
hybridizes to an extension product of the first primer (a displaced
primer extension product); (i) an RNA polymerase; and (j)
ribonucleoside triphosphates or suitable analogs (which may or may
not be labeled). The combination is subjected to suitable
conditions for primer hybridization, extension of primers, RNA
cleavage, and displacement of the first primer extension product
when its RNA is cleaved and another first primer binds in the site
vacated by the cleaved RNA. In embodiments that include
transcription, conditions employed are also suitable for
hybridization of the propromoter polynucleotide to the displaced
cleaved first primer extension product, extension of the 3' end of
the cleaved first primer extension product (if necessary) to
generate a double-stranded promoter region, and RNA transcription
driven by the promoter. As described and exemplified herein, the
above-described reaction mixture may be subdivided into two or more
different reaction mixtures for separate, generally sequential,
incubations that correspond to different aspects of the
amplification process (see, for example, Example 1).
[0086] In another aspect of the amplification methods, fragments of
the target RNA serves as a primer of second DNA strand synthesis.
The target RNA in the initial complex comprising the target RNA and
composite primer extension product is cleaved with an enzyme (such
as RNaseH) such that at least one fragment of the template RNA
remains hybridized to the composite primer extension product. In
this aspect of the invention, one (or more) template RNA
fragment(s) serves as a second "primer" in the manner described
above, to generate a fragment extension product which has the same
function as the second primer extension product in the
amplification methods described above.
[0087] In some embodiments, the invention provides methods of
producing at least one copy of a polynucleotide sequence
complementary to an RNA sequence of interest comprising combining
and reacting the following: (a) complex of first and second primer
extension products; (b) a first (composite) primer comprising an
RNA portion and a 3' DNA portion; (c) a DNA-dependent DNA
polymerase; (d) an agent (such as an enzyme) that cleaves RNA from
an RNA/DNA hybrid; and (e) deoxyribonucleoside triphosphates or
suitable analogs (which may or may not be labeled). In embodiments
that include transcription, the following are also included in the
amplification reaction (either at the same time as the components
listed above or added separately): (f) a propromoter polynucleotide
comprising a propromter and a region which hybridizes to an
extension product of the first primer (a displaced primer extension
product); (g) an RNA polymerase; and (h) ribonucleoside
triphosphates or suitable analogs (which mayor may not be labeled).
The combination is subjected to suitable conditions for primer
hybridization, extension of primers, RNA cleavage, and displacement
of the first primer extension product when its RNA is cleaved and
another first primer binds in the site on the second primer
extension product vacated by the cleaved RNA. In embodiments that
include transcription, conditions employed are also suitable for
hybridization of the propromoter polynucleotide to the displaced
first primer extension product, extension of the 3' end of the
first primer extension product (if necessary) to generate a
double-stranded promoter region, and RNA transcription driven by
the promoter.
[0088] In another aspect, the invention provides methods of
producing single stranded antisense and sense DNA copies of an RNA
sequence of interest using a first composite primer, a second
composite primer (termed the "reverse composite" primer), and a
target RNA fragment. The method involves the following: (a)
formation of a double stranded cDNA comprising a RNA-DNA
heteroduplex at each end of the double stranded cDNA; and
(b)-linear amplification of first strand (sense) cDNA and second
strand (antisense) cDNA by primer extension from two composite
primers and strand displacement. Single stranded first and second
strand cDNA product is produced. This product is useful in, e.g.,
producing cDNA libraries. As is evident, in this aspect of the
invention, the second primer extension product is primed by a
composite primer.
[0089] The methods of the invention include methods using the
amplified products (so-called "applications"). In some embodiments,
the invention provides methods of sequencing RNA sequences. For
sequencing methods based on methods described herein wherein the
amplified product is DNA, the appropriate dNTPs, or analogs
thereof, which may be labeled or unlabeled, are used. For
sequencing methods based on methods described herein wherein the
amplified product is RNA, the appropriate rNTPs, or analogs
thereof, which may be labeled or unlabeled, may be used.
[0090] In other embodiments, the invention provides methods of
detecting nucleic acid sequence mutations. In one embodiment, the
amplified products are used to detect and/or identify single strand
conformation polymorphisms in a target polynucleotide.
[0091] The invention provides methods to characterize (for example,
detect presence or absence of and/or quantify) an RNA sequence of
interest by generating DNA or RNA products using amplification
methods of the invention, and analyzing the products by
detection/quantification methods such as those based on array
technologies or solution phase technologies. These amplified
products may be labeled or unlabeled.
[0092] In yet another embodiment, the invention provides methods
for immobilizing nucleic acids, including methods for generating
microarrays of nucleic acids (DNA or RNA) using amplified products
of the amplification methods of the invention.
[0093] In another embodiment, the invention provides methods of
generating cDNA libraries, methods of generating subtractive
hybridization probes, and methods of generating subtractive
hybridization libraries.
[0094] Various methods for the detection and quantification of gene
expression levels have been developed in recent years. For example,
microarrays, in which either defined cDNAs or oligonucleotides are
immobilized at discrete locations on, for example, solid or
semi-solid substrates, or on defined particles, enable the
detection and/or quantification of the expression of a multitude of
genes in a given specimen.
[0095] Using these previously known methods to detect presence of
absence of and/or quantify multiple mRNA species in a sample, which
in turn is used as a measure of gene expression profiling,
generally requires direct labeling of cDNA, which requires a large
amount of input total RNA, in part because mRNA represents only a
small subset of the total RNA pool. Thus, when using total RNA
preparations from a given cell or tissue sample, the analysis of
gene expression in the sample using methods such as arrays requires
a substantial amount of input RNA, which generally ranges from 50
to 200 .mu.g. Similarly, 2 to 5 .mu.g of mRNA purified from a total
RNA preparation would generally be required for a single analysis
of gene expression profiling using array technologies. This is a
clear limitation of methods such as those based on array
technology, insofar as the number of cells, or size of tissue
specimen required is very large, and these cells or tissue
specimens are often scarcely available for testing or are too
precious. This limitation is especially severe in the study of
clinical specimens, where the cells to be studied are rare and/or
difficult to cultivate in vitro, and in high throughput screening
of libraries of effector molecules. Also, previous
transcription-based methods of amplification of mRNA (described in,
for example, Lockhart et al, Nature Biotechnology (1996), 14,
1675-1680); van Gelder et al., U.S. Pat. No. 5,716,785), are
limited to the amplification efficiency of DNA-dependent RNA
polymerases and some of these methods require multiple steps.
Moreover, the process by which the polymerase promoter sequence is
incorporated is prone to result in non-specific amplification.
[0096] The methods of the invention offer the ability to
efficiently amplify mRNA under conditions that provide for high
specificity of target amplification and which is generally
reflective of the distribution in the input RNA. Thus, the utility
of the detection/quantification methods which can be used with the
amplification products of the invention, such as those based on the
powerful array technology, real time PCR, quantitative TaqMan,
quantitative PCR using molecular beacons and the like, should be
greatly enhanced.
[0097] The linear aspect of the amplification methods of the
invention significantly increases the specificity of target
amplification. Since generation of multiple copies of a sequence of
interest is not dependent nor based on cyclical, exponential,
amplification of amplification products, the specificity of
products obtained is greatly enhanced. The distribution of the
various species of amplified products is generally reflective of
the distribution in the input RNA.
[0098] The methods of the invention do not require thermocycling
and all of the steps can be performed isothermally, although the
various steps may be carried out a different temperatures. This
feature provides numerous advantages, including facilitating
automation and adaptation for high through-put procedures. The
isothermal reaction is faster than that afforded by thermal cycling
and is suitable for performing the methods of the invention in
miniaturized devices.
[0099] The intermediate double stranded cDNA complex comprising an
RNA/DNA heteroduplex provides a substrate for linear amplification.
Cleavage of the RNA portion of the RNA/DNA heteroduplex permits
further amplification without the need to denature the double
stranded cDNA intermediate complex. Moreover, since the cleaved
double stranded cDNA complex is mostly double stranded, it is less
likely that the secondary structure of a single stranded template
will interfere with subsequence amplification.
[0100] Finally, most of the methods of the invention produce
products that are single stranded, thus rendering them more
accessible to binding to probes, either in a homogeneous manner,
i.e. in solution, or binding to probes immobilized on solid
supports. The double stranded products of the methods of the
invention are useful for, e.g., production of cDNA libraries.
[0101] The ability to efficiently amplify mRNA (or any other
desired RNA species or population) under conditions that provides
for high specificity of target amplification and which will
generally not alter the representation of the various mRNA species
in the preparation, will greatly enhance the utility of the
detection/quantification methods such as those based on the
powerful array technology.
[0102] General Techniques
[0103] The practice of the invention will employ, unless otherwise
indicated, conventional techniques of molecular biology (including
recombinant techniques), microbiology, cell biology, biochemistry,
and immmunology, which are within the skill of the art. Such
techniques are explained fully in the literature, such as,
"Molecular Cloning: A Laboratory Manual", second edition (Sambrook
et al., 1989); "Oligonucleotide Synthesis" (M. J. Gait, ed., 1984);
"Animal Cell Culture" (R. I. Freshney, ed., 1987); "Methods in
Enzymology" (Academic Press, Inc.); "Current Protocols in Molecular
Biology" (F. M. Ausubel et al., eds., 1987, and periodic updates);
"PCR: The Polymerase Chain Reaction", (Mullis et al., eds.,
1994).
[0104] Primers, oligonucleotides and polynucleotides employed in
the invention can be generated using standard techniques known in
the art.
[0105] Definitions
[0106] A "target sequence," "target nucleic acid," or "target RNA,"
as used herein, is a polynucleotide comprising a sequence of
interest, for which amplification is desired. The target sequence
may be known or not known, in terms of its actual sequence. In some
instances, the terms "target," "template," and variations thereof,
are used interchangeably.
[0107] "Amplification," or "amplifying", as used herein, generally
refers to the process of producing multiple copies of a desired
sequence. "Multiple copies." mean at least 2 copies. A "copy" does
not necessarily mean perfect sequence complementarity or identity
to the template sequence. For example, copies can include
nucleotide analogs such as deoxyinosine, intentional sequence
alterations (such as sequence alterations introduced through a
primer comprising a sequence that is hybridizable, but not
complementary, to the template, or a non-target sequence introduced
through a primer), and/or sequence errors that occur during
amplification. "Amplifying" a sequence may generally refer to
making copies of a sequence or its complement, with the
understanding that, as stated above, copying does not necessarily
mean perfect sequence complementarity or identity with respect to
the template sequence.
[0108] "Polynucleotide," or "nucleic acid," as used interchangeably
herein, refer to polymers of nucleotides of any length, and include
DNA and RNA. The nucleotides can be deoxyribonucleotides,
ribonucleotides, modified nucleotides or bases, and/or their
analogs, or any substrate that can be incorporated into a polymer
by DNA or RNA polymerase. A polynucleotide may comprise modified
nucleotides, such as methylated nucleotides and their analogs. If
present, modification to the nucleotide structure may be imparted
before or after assembly of the polymer. The sequence of
nucleotides may be interrupted by non-nucleotide components. A
polynucleotide may be further modified after polymerization, such
as by conjugation with a labeling component. Other types of
modifications include, for example, "caps", substitution of one or
more of the naturally occurring nucleotides with an analog,
internucleotide modifications such as, for example, those with
uncharged linkages (e.g., methyl phosphonates, phosphotriesters,
phosphoamidates, cabamates, etc.) and with charged linkages (e.g.,
phosphorothioates, phosphorodithioates, etc.), those containing
pendant moieties, such as, for example, proteins (e.g., nucleases,
toxins, antibodies, signal peptides, ply-L-lysine, etc.), those
with intercalators (e.g., acridine, psoralen, etc.), those
containing chelators (e.g., metals, radioactive metals, boron,
oxidative metals, etc.), those containing alkylators, those with
modified linkages (e.g., alpha anomeric nucleic acids, etc.), as
well as unmodified forms of the polynucleotide(s). Further, any of
the hydroxyl groups ordinarily presentin the sugars may be
replaced, for example, by phosphonate groups, phosphate groups,
protected by standard protecting groups, or activated to prepare
additional linkages to additional nucleotides, or may be conjugated
to solid supports. The 5' and 3' terminal OH can be phosphorylated
or substituted with amines or organic capping groups moieties of
from 1 to 20 carbon atoms. Other hydroxyls may also be derivatized
to standard protecting groups. Polynucleotides can also contain
analogous forms of ribose or deoxyribose sugars that are generally
known in the art, including, for example, 2'-O-methyl-, 2'-O-allyl,
2'-fluoro- or 2'-azido-ribose, carbocyclic sugar analogs,
.alpha.-anomeric sugars, epimeric sugars such as arabinose, xyloses
or lyxoses, pyranose sugars, furanose sugars, sedoheptuloses,
acyclic analogs and abasic nucleoside analogs such as methyl
riboside. One or more phosphodiester linkages may be replaced by
alternative linking groups. These alternative linking groups
include, but are not limited to, embodiments wherein phosphateis
replaced by P(O)S("thioate"), P(S)S ("dithioate"), "(O)NR.sub.2
("amidate"), P(O)R, P(O)OR', CO or CH.sub.2 ("formacetal"), in
which each R or R' is independently H or substituted or
unsubstituted alkyl (1-20 C) optionally containing an ether (--O--)
linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not
all linkages in a polynucleotide need be identical. The preceding
description applies to all polynucleotides referred to herein,
including RNA and DNA.
[0109] A "labeled dNTP," or "labeled rNTP," as used herein, refers,
respectively, to a dNTP or rNTP, or analogs thereof, that is
directly or indirectly attached with a label. For example, a
"labeled" dNTP or rNTP, may be directly labeled with, for example,
a dye and/or a detectable moiety, such as a member of a specific
binding pair (such as biotin-avidin). A "labeled" dNTP or rNTP, may
also be indirectly labeled by its attachment to, for example, a
moiety to which a label is/can be attached. A DNTP or rNTP, may
comprise a moiety (for example, an amine group) to which a label
may be attached following incorporation of the dNTP or rNTP into an
extension product. Useful labels in the present invention include
fluorescent dyes (e.g., fluorescein isothiocyanate, Texas red,
rhodamine, green fluorescent protein and the like), radioisotopes
(e.g., .sup.3H, .sup.35S, .sup.32P, .sup.33P, .sup.125I, or
.sup.14C), enzymes (e.g., LacZ, horseradish peroxidase, alkaline
phosphatase,), digoxigenin, and colorimetric labels such as
colloidal gold or colored glass orplastic (e.g., polystyrene,
polypropylene, latex, etc.) beads. Various anti-ligands and ligands
can beiused (as labels themselves or as a means for attaching a
label). In the case of a ligand that has a natural anti-ligand,
such as biotin, thyroxine and cortisol, the ligand can be used in
conjunction with labeled anti-ligands.
[0110] The "type" of dNTP or rNTP, as used herein, refers to the
particular base of a nucleotide, namely adenine, cytosine, thymine,
uridine, or guanine.
[0111] "Oligonucleotide," as used herein, generally refers to
short, generally single stranded, generally synthetic
polynucleotides that are generally, but not necessarily, less than
about 200 nucleotides in length. Oligonucleotides in the invention
include the composite primer and propromoter polynucleotide (such
as the PTO). The terms "oligonucleotide" and "polynucleotide" are
not mutually exclusive. The description above for polynucleotides
is equally and fully applicable to oligonucleotides.
[0112] A "primer," as used herein, refers to a nucleotide sequence,
generally with a free 3'-OH group, that hybridizes with a template
sequence such as a target RNA, or a primer extension product) and
is capable of promoting polymerization of a polynucleotide
complementary to the template. A "primer" can be, for example, an
oligonucleotide. It can also be, for example, a sequence of the
template (such as a primer extension product or a fragment of the
template created following RNase cleavage of a template-DNA
complex) that is hybridized to a sequence in the template itself
(for example, as a hairpin loop), and that is capable of promoting
nucleotide polymerization. Thus, a primer can be an exogenous
(e.g., added) primer or an endogenous (e.g., template fragment)
primer.
[0113] A "random primer," as used herein, is a primer that
comprises a sequence that is designed not necessarily based on a
particular or specific sequence in a sample, but rather is based on
a statistical expectation (or an empirical observation) that the
sequence of the random primer is hybridizable (under a given set of
conditions) to one or more sequences in the sample. The sequence of
a random primer (or its complement) may or may not be
naturally-occurring, or may or may not be present in a pool of
sequences in a sample of interest. The amplification of a plurality
of RNA species in a single reaction mixture would generally, but
not necessarily, employ a multiplicity, preferably a large
multiplicity, of random primers. As is well understood in the art,
a "random primer" can also refer to a primer that is a member of a
population of primers (a plurality of random primers) which
collectively are designed to hybridize to a desired and/or a
significant number of target sequences. A random primer may
hybridize at a plurality of sites on a nucleic acid sequence. The
use of random primers provides a method for generating primer
extension products complementary to a target polynucleotide which
does not require prior knowledge of the exact sequence of the
target.
[0114] "Protopromoter sequence," and "propromoter sequence," as
used herein, refer to a single-stranded DNA sequence region which,
in double-stranded form is capable of mediating RNA transcription.
In some contexts, "protopromoter sequence," "protopromoter,"
"propromoter sequence," "propromoter," "promoter sequence," and
"promote" are used interchangeably.
[0115] A "propromoter polynucleotide," as used herein, refers to a
polynucleotide comprising a propromoter sequence. Example of a
propromoter polynucleotide is a propromoter template
oligonucleotide (PTO).
[0116] "Propromoter template oligonucleotide (PTO)" and "promoter
template oligonucleotide (PTO)" as used herein, refer to an
oligonucleotide that comprises a propromoter sequence and a
portion, generally a 3' portion, that is hybridizable (under a
given set of conditions) to the 3' region of a primer extension
product. The propromoter sequence and the hybridizable portion may
be the same, distinct or overlapping nucleotides of an
oligonucleotide.
[0117] To "inhibit" is to decrease or reduce an activity, function,
and/or amount as compared to a reference.
[0118] A "complex" is an assembly of components. A complex may or
may not be stable and may be directly or indirectly detected. For
example, as is described herein, given certain components of a
reaction, and the type of product(s) of the reaction, existence of
a complex can be inferred. For purposes of this invention, a
complex is generally an intermediate with respect to the final
amplification product(s). An example of a complex is a nucleic acid
duplex comprising a first primer extension product and a second
primer extension product.
[0119] A "portion" or "region," used interchangeably herein, of a
polynucleotide or oligonucleotide is a contiguous sequence of 2 or
more bases. In other embodiments, a region or portion is at least
about any of 3, 5, 10, 15, 20, 25 contiguous nucleotides.
[0120] A region, portion, or sequence which is "adjacent" to
another sequence directly abuts that region, portion, or sequence.
For example, an RNA portion which is adjacent to a 5' DNA portion
of a composite primer directly abuts that region. For an
illustration of this example, see FIGS. 1A and 2A.
[0121] A "reaction mixture" is an assemblage of components, which,
under suitable conditions, react to form a complex (which may be an
intermediate) and/or a product(s).
[0122] "A", "an" and "the", and the like, unless otherwise
indicated include plural forms. "A" fragment means one or more
fragments.
[0123] "Comprising" means including.
[0124] Conditions that "allow" an event to occur or conditions that
are "suitable" for an event to occur, such as hybridization, strand
extension, and the like, or "suitable" conditions are conditions
that do not prevent such events from occurning. Thus, these
conditions permit, enhance, facilitate, and/or are conducive to the
event. Such conditions, known in the art and described herein,
depend upon, for example, the nature of the nucleotide sequence,
temperature, and buffer conditions. These conditions also depend on
what event is desired, such as hybridization, cleavage, strand
extension or transcription.
[0125] Sequence "mutation," as used herein, refers to any sequence
alteration in a sequence of interest in comparison to a reference
sequence. A reference sequence can be a wild type sequence or a
sequence to which one wishes to compare a sequence of interest. A
sequence mutation includes single nucleotide changes, or
alterations of more than one nucleotide in a sequence, due to
mechanisms such as substitution, transversion, deletion or
insertion. Single nucleotide polymorphism (SNP) is also a sequence
mutation as used herein.
[0126] "Single stranded conformation polymorphism," and "SSCP," as
used herein, generally refer to the specific conformation of a
single stranded nucleic acid as is affected by its specific nucleic
acid sequence. Alteration of the sequence of the single stranded
polynucleotide, such as single nucleotide substitution, deletions'
or insertions, result in change, or polymorphism, of the
conformation of the single stranded polynucleotide. The
conformation of the polynucleotide is generally detectable,
identifiable and/or distinguishable using methods known in the art,
such as electrophoretic mobility as measured by gel electrophoresis
capillary electrophoresis, and/or susceptibility to endonuclease
digestion.
[0127] "Microarray" and "array," as used interchangeably herein,
comprise a surface with an array, preferably ordered array, of
putative binding (e.g., by hybridization) sites for a biochemical
sample (target) which often has undetermined characteristics. In a
preferred embodiment, a: microarray refers to an assembly of
distinct polynucleotide or oligonucleotide probes immobilized at
defined positions on a substrate. Arrays are formed on substrates
fabricated with materials such as paper, glass, plastic (e.g.,
polypropylene, nylon, polystyrene), polyacrylamide, nitrocellulose,
silicon, optical fiber or any other suitable solid or semi-solid
support, and configured in a planar (e.g., glass plates, silicon
chips) or three-dimensional (e.g., pins, fibers, beads, particles,
microtiter wells, capillaries) configuration. Probes forming the
arrays may be attached to the substrate by any nunber ofways
including (i) in situ synthesis (e.g., high-density oligonucleotide
arrays) using photolithographic techniques (see, Fodor et al.,
Science (1991), 251:767-773; Pease et al., Proc. Natl. Acad. Sci.
U.S.A. (1994), 91:5022-5026; Lockhart et al., Nature Biotechnology
(1996), 14:1675; U.S. Pat. Nos. 5,578,832; 5,556,752; and
5,510,270); (ii) spotting/printing at medium to low-density (e.g.,
cDNA probes) on glass, nylon or nitrocellulose (Schena et al,
Science (1995), 270:467-470, DeRisi et al, Nature Genetics (1996),
14:457-460; Shalon et al., Genome Res. (1996), 6:639-645; and
Schena et al., Proc. Natl. Acad. Sci. U.S.A. (1995),
93:10539-11286); (iii) by masking (Maskos and Southern, Nuc. Acids.
Res. (1992), 20:1679-1684) and (iv) by dot-blotting on a nylon or
nitrocellulose hybridization membrane (see, e.g., Sambrook et al.,
Eds., 1989, Molecular Cloning: A Laboratory Manual, 2nd ed., Vol.
1-3, Cold Spring Harbor Laboratory (Cold Spring Harbor, N.Y.)).
Probes may also be noncovalently immobilized on the substrate by
hybridization to anchors, by means of magnetic beads, or in a fluid
phase such as in microtiter wells or capillaries. The probe
molecules are generally nucleic acids such as DNA, RNA, PNA, and
cDNA but may also include proteins, polypeptides, oligosaccharides,
cells, tissues and any permutations thereof which can specifically
bind the target molecules.
[0128] The term "3'" generally refers to a region or position in a
polynucleotide or oligonucleotide 3' (downstream) from another
region or position in the same polynucleotide or
oligonucleotide.
[0129] The term "5'" generally refers to a region or position in a
polynucleotide or oligonucleotide 5' (upstream) from another region
or position in the same polynucleotide or oligonucleotide.
[0130] The term "3'-DNA portion," "3'-DNA region," "3'-RNA
portion," and "3'-RNA region," refer to the portion or region of a
polynucleotide or oligonucleotide located towards the 3' end of the
polynucleotide or oligonucleotide, and may or may not include the
3' most nucleotide(s) or moieties attached to the 3' most
nucleotide of the same polynucleotide or oligonucleotide. The 3'
most nucleotide(s) can be preferably from about 1 to about 50, more
preferably from about 10 to about 40, even more preferably from
about 20 to about 30 nucleotides.
[0131] The term "5'-DNA portion," "5'-DNA region," "5'-RNA
portion," and "5'-RNA region," refer to the portion or region of a
polynucleotide or oligonucleotide located towards the 5' end of the
polynucleotide or oligonucleotide, and may or may not include the
5' most nucleotide(s) or moieties attached to the. 5' most
nucleotide of the same polynucleotide or oligonucleotide. The 5'
most nucleotide(s) can be preferably from about 1 to about 50, more
preferably from about 10 to about 40, even more preferably from
about 20 to about 30 nucleotides.
[0132] As is well understood by those skilled in the art, a "tail"
sequence of a primer is a sequence not hybridizable to the target
sequence under conditions in which other region(s) or portion(s) of
the primer hybridizes to the target.
[0133] "Absent" or "absence" of product, and "lack of detection of
product" as used herein includes insignificant, or de minimus
levels, generally due to lack of significant accumulation of
product due to cycling.
[0134] Amplification Methods of the Invention
[0135] The following are examples of the amplification methods of
the invention. It is understood that various other embodiments may
be practiced, given the general description provided above. For
example, reference to using a composite primer means that any of
the composite primers described herein may be used.
[0136] In one aspect of the invention, a method for; generating
multiple copies (amplifying) of a polynucleotide (DNA) sequence
complementary to an RNA sequence of interest using a composite
primer and a second primer is provided. In this method, isothermal
linear nucleic acid sequence amplification is achieved using two
primers (a composite primer and a second primer) and strand
displacement. In some embodiments, a transcription step is included
(i.e., an "enhanced" method), and amplified product in the form of
sense RNA is produced.
[0137] In another aspect of the invention, a method for generating
multiple copies (amplifying) of a DNA sequence complementary to an
RNA sequence of interest using a single primer (which is a
composite primer) is provided. In this method, isothermal linear
nucleic acid amplification is achieved using a single composite
primer, a fragment of target RNA (which serves as an endogenous
primer), and strand displacement. In some embodiments, a
transcription step is included (i.e., the "enhanced" method), and
amplified product in the form ofsense RNA is produced.
[0138] As described herein, the amplification methods of the
invention may further include a transcription step. If a primer
extension product that is to be transcribed comprises a propromoter
sequence, a double stranded promoter region is generally generated
by hybridizing a polynucleotide comprising a propromoter (also
referred to herein as "propromoter polynucleotide") to the primer
extension product. If a primer extension product does not comprise
a desired propromoter sequence, the transcription step is generally
dependent on the incorporation of an RNA polymerase propromoter
sequence, by use of a propromoter polynucleotide such as a promoter
sequence oligonucleotide (PTO). A propromoter polynucleotide such
as the PTO can serve as a template for extension of a single
stranded primer extension product and formation of a partial duplex
comprising a double stranded promoter at one end. The ability to
hybridize the single stranded product to the propromoter
polynucleotide (such as a PTO) is generally achieved by creating a
primer extension product with a defined 3' end sequence, which is
complementary to the 3' end sequence of the propromoter
polynucleotide.
[0139] One aspect of the methods of the invention includes the
design of primers which are able to hybridize to RNA sequences,
such as a plurality of RNA sequences, for initiation of primer
extension and production of amplification substrates and
products.
[0140] Linear Nucleic Acid Sequence Amplification Using a Composite
Primer and a Second Primer
[0141] The invention provides methods of amplifying an RNA sequence
of interest by using a composite primer and a second primer, and
strand displacement. Amplification by these methods is linear and
can be achieved isothermally. In embodiments that do not include a
transcription step, amplified products are single stranded DNA
comprising: sequences complementary to the RNA sequence of interest
in the target RNA. In embodiments that include transcription,
amplified products are sense RNA copies of the RNA sequence of
interest in the target RNA.
[0142] A schematic description of one embodiment of the composite
primer, second primer and strand displacement-based methods of the
invention is given in FIGS. 1A-B and 2A-C. FIGS. 1A-B illustrate a
non-enhanced linear method. FIGS. 2A-C illustrate an enhanced
(i.e., including a transcription step) method. The methods involve
the following steps: (a) formation of a second strand cDNA which is
the same sense as the input RNA; (b) linear amplification of the
complement of a second strand cDNA strand by primer extension (from
a composite primer) along the second strand cDNA and strand
displacement; and, in the enhanced method, (c) transcription of the
product of the linear amplification step to produce multiple copies
of sense RNA products. As illustrated, all steps are isothermal,
although the temperatures for each of the steps may or may not be
the same.
[0143] The embodiment illustrated in FIGS. 1A-B employs two
oligonucleotides: a composite primer, (labeled 1), used for the
amplification; and a second primer (labeled 2), used for the
formation of the sense complement DNA (cDNA) (interchangeably
called "second primer extension product" or "second strand cDNA).
The embodiment illustrated in FIGS. 2A-C employs three
oligonucleotides: a composite primer, (labeled 1), used for the
amplification; a second primer (labeled 2), used for the formation
of the second strand (sense) cDNA; and a polynucleotide comprising
a propromoter sequence of a DNA-dependent RNA polymerase, i.e., a
promoter template oligonucleotide (PTO) (labeled 3).
[0144] The 3' portion of the composite primer can be designed in
any of a number of ways (in terms of sequence), depending on which
type, class, population, and/or species of RNA is desired to be
amplified. In some embodiments, the 3' portion of composite primer
1, as illustrated in FIGS. 1 and 2, comprises a sequence
complementary to the poly-A tail of mRNA, and may further comprise
additional random sequences (generally not complementary to a
poly-A sequence) at the 3' end of the 3' portion. In other
embodiments, the 3' portion of composite primer 1 is a random
primer comprising sequences which are hybridizable to a
multiplicity of RNA species (which may range from 2 or more to many
hundred or thousands or more). Random primers are known in the art,
for example, they have been used extensively in the preparation of
cDNA libraries using PCR-based procedures. As is well understood in
the art, a "random primer" can refer to a primer that is a member
of a population of primers (a plurality of random primers) which
collectively are designed to hybridize to a desired and/or a
significant number of target sequences. A random primer may
hybridize at a plurality of sites on a nucleic acid sequence.
[0145] In other embodiments, the 3' portion of composite primer 1
can comprise a sequence complementary or hybridizable to a specific
RNA or family of RNAs (or portions thereof).
[0146] In some embodiments as illustrated in FIGS. 1 and 2, the 5'
portion of composite primer 1 can be a sequence not hybridizable to
the target sequence (under conditions in which the 3' portion
hybridizes to RNA target), e.g., a sequence forming a "tail" when
the primer is hybridized to a target. This "tail" sequence
generally is incorporated into the first primer extension product
(first strand cDNA), and the complement of this tail will be
incorporated at the 3' end of the second primer extension product
(second strand cDNA). Accordingly, in some embodiments, composite
primer 1 is a mixtures of composite primers which comprise the same
5' RNA portion and a multiplicity of 3' DNA portions selected to
amplify a multiplicity (which can be small to very large) of RNA
sequences of interest. In other embodiments, the 5' portion of the
composite primer 1 can be hybridizable to the target RNA. Although
FIGS. 1 and 2 depict a 3' portion hybridized to the target sequence
that is a DNA portion and a 5' portion non hybridized to the target
that is an RNA portion, it is understood that DNA portions can
comprise part of a "tail" and conversely that RNA portions can be
hybridizable to target RNA. For example, the 5' RNA portion of a
composite primer may be partially hybridizable and partially
nonhybridizable, or the DNA portion of a composite primer may be
partially hybridizable and partially nonhybridizable, or both.
[0147] As illustrated in these figures, the composite primer 1
comprises a DNA portion, A, at its 3' end, and an RNA portion, B,
at its 5' end. As discussed herein, it is also possible to employ a
composite primer in which the 3' DNA portion is followed, in the
direction of its 5', by an RNA portion, which is followed by a
portion which is DNA. The length of each of these sections is
generally determined for maximum efficiency of the amplification.
Only the two-portion (i.e., 3'-DNA-RNA-5') composite primer is
shown in FIGS. 1A-B and FIGS. 2A-C.
[0148] Primer 2 as illustrated in FIGS. 1A-B and 2A-C can be, but
is not necessarily, composed of DNA and can comprise two sections
(interchangeably called "portions" or "regions"). The 3' portion,
F, of primer 2 can be selected for random priming of many, most
and/or all possible mRNA sequences in a biological sample. Random
primers are known in the art, for example, they have been used
extensively in the preparation of cDNA libraries using PCR-based
procedures. The 5' portion, E, of primer 2 can be a sequence which
is not complementary and not substantially hybridizable to a
specific target sequence, i.e., it would not hybridize (under
conditions in which the 3' portion hybridizes to RNA target) and
would constitute a tail. The "tail" sequence would generally be
incorporated into the second primer extension product, and the 3'
end sequence of the DNA product of the linear amplification steps
would generally comprise the complement of this sequence. In other
embodiments, if enhanced amplification is not desired (as described
below), the 5' end portion, E, of primer 2 can be hybridizable to
the target sequence in the first primer extension product.
[0149] As illustrated in FIGS. 2A-C, a promoter template
oligonucleotide, 3 (PTO), can be designed as follows: the 3'
portion is the same as portion E of primer 2. This design enables
the PTO to hybridize to the 3' end of the linear amplification
product. The 5'-most portion of the PTO is a promoter sequence for
a DNA-dependent RNA polymerase, which, as described above, is used
in certain (namely, the "enhanced" method) embodiments of the
amplification methods of the invention. Generally, the sequence
between these two sections is designed for optimal transcription by
the polymerase of choice. Criteria for selection and design of this
sequence are known in the art.
[0150] For convenience, only one first primer extension product
(first strand cDNA) and second strand primer extension product
(second strand cDNA) are described and illustrated in FIGS. 1 and
2. It is understood that the methods of the invention are useful
not only for producing large amounts of one specific nucleic acid
sequence, but also for amplifying simultaneously more than one
different specific nucleic acid sequence located on the same or
different target nucleic acid molecules. For example, the methods
of the invention are useful for amplifying all mRNA in a sample, or
for amplifying a multiplicity of specific RNA species or family of
RNA species in a sample.
[0151] As illustrated in FIGS. 1A-B in one embodiment the process
of the amplification methods of the invention resulting in
generation of DNA products comprising sequences complementary to an
RNA sequence(s) of interest based on RNA is as follows:
[0152] A) Formation of a Double Stranded cDNA Substratefor Linear
Amplification
[0153] 1. Primer 1 binds to an RNA species in a sample by
hybridization of the random sequence portion A (which can be based
at least in part on the poly-A sequence of the mRNA), to form
complex I (FIG. 1A).
[0154] 2. A reverse transcriptase, (indicated as "RT"), extends the
hybridized primer I along the target RNA strand to which it is
hybridized, to form an RNA/DNA duplex. RNase H degrades the target
RNA strand of the hybrid duplex to generated a single stranded
first strand cDNA (labeled "II"). The 5' end of II is primer 1.
[0155] 3. Primer 2 binds to first strand cDNA, II, by hybridization
of sequence F, to form complex III.
[0156] 4. Primer 2 is extended along the cDNA strand II by a DNA
polymerase to form a double stranded product (labeled "IV"). Primer
extension along the 5' RNA portion of II by an RNA-dependent DNA
polymerase such as a reverse transcriptase results in formation of
an RNA/DNA hybrid portion at one end of complex IV.
[0157] 5. RNase H degrades the RNA portion of the RNA/DNA hybrid at
one end of complex IV, to create a partial double stranded complex
(labeled "V") with a 3' DNA single stranded end, which has a
sequence which is the complement of portion B of the composite
primer 1. The RNase H activity may be supplied by the RNA-dependent
DNA polymerase (such as reverse transcriptase) or may be provided
in a separate enzyme. Reverse transcriptases useful for this method
may or may not have RNase H activity.
[0158] B) Isothermal Linear Amplification
[0159] 1. Primer 1 binds to complex V by hybridization of the RNA
portion, B, to the single stranded DNA end, which is complementary
to it, to form complex VI. The 3' DNA sequence of primer 1 is not
hybridized.
[0160] 2. The 3' end of bound primer 1 in complex VI, and the 5'
end of the DNA strand immediately upstream are the same, and would
compete for hybridization to the opposite strand. Without wishing
to be bound by theory, the high affinity of the DNA polymerase to
hybridized 3' end of a primer would be expected to push the
equilibrium of the two competing structures towards hybridization
of the 3' end of the new primer and displacement of the 5' end of
the previous primer extension product (labeled "VII"). Primer
extension along the second strand (sense) cDNA strand results in
displacement of the previous second primer extension product (VII),
and replicates the E sequence of primer 2 to form complex VIII.
[0161] 3. Complex VIII has, at one end, an RNA/DNA hybrid composed
of sequence B and its complement. The RNA segment of the hybrid is
degraded by RNase H, to form complex IX, which results in the
formation of a single stranded. 3' end to which a new primer 1 can
be bound by its 5' B portion.
[0162] 4. The process of hybridization of the 3' end sequence A of
the bound primer 1, by displacement of the 5'-most end of the
previous primer extension product in the duplex, primer extension
and displacement of the previous product continues as shown in
FIGS. 1A-B, and results in the accumulation of multiple copies of
anti-sense single stranded DNA products (labeled "XII"). These
products have at their 3' ends a sequence-complementary to portion
E of primer 2, and at their 5' ends a sequence substantially
identical (generally, identical) to sequence A of the composite
primer. Kurn, U.S. Pat. No. 6,251,639 B1.
[0163] One embodiment of the enhanced method is illustrated in
FIGS. 2A-C. In this embodiment, subsequent to the generation of DNA
product comprising complementary sequences of an RNA sequence of
interest, the following steps are performed.
[0164] C) Transcription of the DNA Products
[0165] 1. A PTO (see FIG. 2C), binds to DNA product XII by
hybridization of its 3' end sequence to the 3' end sequence of DNA
product XII to form complex XIII. The 3' end of the PTO is
preferably, but not necessarily, blocked so that it cannot be
extended by a DNA polymerase.
[0166] 2. DNA polymerase extends the 3' end of product XII in
complex XIII, along the PTO template to form complex XIV comprising
a double stranded promoter sequence at one end.
[0167] 3. DNA-dependent RNA polymerase binds to the double stranded
promoter in complex XIV to transcribe the anti-sense single
stranded DNA product to yield multiple copies of sense RNA products
(labeled "XV"). Multiple species of product XV would represent
multiple copies of multiple sequences from a pool of input RNA.
Kurn, U.S. Pat. No. 6,251,639 B1.
[0168] The methods of the invention may be used for generation of
multiple copies of a plurality of RNA sequences in the sample. For
example the composite primer can comprise a poly-dT sequence, which
would be expected to hybridize to the poly-A tails of all mRNA is a
sample, or the composite primer can generally comprise at least a
3' portion that is hybridizable to random or partially random
sequences (e.g. comprising a poly-dT sequence and a random
sequence, which would be expected to hybridize to the beginning of
the poly-A tails of mRNAs). In another aspect, the methods of the
invention may be used for generation of multiple copies of a
specific RNA species or class of RNA species (e.g., a family or
superfamily of RNA species). In this latter case, the composite
primer generally comprises a 3'-portion which is complementary to a
sequence of a specific RNA target (or family of RNA targets). The
5'-RNA portion of the composite primer may or may not be related to
the specific RNA target sequence, and may or may not hybridize to
the RNA target, for example, it may form a tail as further
described herein.
[0169] Although only one composite primer is described in the
embodiments above, it is understood that a different composite
primer may be used in step (b), above. The different composite
primer comprises sequences hybridizable to the single stranded DNA
portion of the complex IX, described above. The second composite
primer may further comprise sequences hybridizable to a portion of
the second primer extension product sequences immediately 5' to the
single stranded DNA portion of complex IX. The second composite
primer generally comprises overlapping sequences with the first
composite primer. The second composite primer is hybridized to the
second primer extension product and extended by primer extension.
Cleavage of the DNA-RNA heteroduplex by RNAse permits binding of
another second composite primer, extension and strand displacement,
whereby multiple copies of the single stranded product are
produced.
[0170] For convenience, only one first primer extension product
(first strand cDNA) and second strand primer extension product
(second strand cDNA) are described and illustrated in FIGS. 1 and
2. It is understood that the methods of the invention are useful
not only for producing large amounts of one specific nucleic acid
sequence, but also for amplifying simultaneously more than one
different specific nucleic acid sequence located on the same or
different target nucleic acid molecules. For example, the methods
of the invention are useful for amplifying all mRNA in a sample, or
for amplifying a multiplicity of specific RNA species (in which
case a multiplicity of first composite primer each comprising a 3'
portion hybridizable to specific sequences of specific RNA species
could be used) or family of RNA species in a sample.
[0171] Linear Nucleic Acid Sequence Amplification Using a Single
Composite Primer and a Target RNA Fragment
[0172] The invention also provides methods of amplifying an RNA
sequence of interest by using a single primer (which is a composite
primer), a target RNA fragment, and strand displacement.
Amplification by these methods is linear and can be achieved
isothermally. In embodiments that do not include a transcription
step, amplified products are DNA comprising sequences complementary
to the RNA sequence of interest in the target RNA. In embodiments
that include transcriptions amplified products are sense RNA copies
of the RNA sequence of interest in the target RNA.
[0173] A schematic description of a non-enhanced (linear)
embodiment of the single composite primer and strand
displacement-based methods of the invention is provided in FIGS.
3A-B. The method involves the following steps: (a) primer extension
to form an RNA/DNA heteroduplex of a target RNA and a first strand
cDNA; (b) incomplete degradation of the RNA target of the
heteroduplex to form a complex of the first strand cDNA and at
least one RNA fragment that can in turn serve as a primer, (c)
formation of a second strand cDNA that is of the same sense as the
input target RNA; (d) linear amplification of the complement of a
second strand DNA by primer extension (from a composite primer)
along the second strand cDNA and strand displacement to produce
multiple copies of antisense single stranded DNA products. As
illustrated, all steps are isothermal, although the temperatures
for each of the steps may or may not be the same. A schematic
description of an embodiment of enhanced single composite primer
and strand displacement-based methods of the invention is provided
in FIGS. 4A-B. The method involves the following steps: (a) primer
extension to form an RNA/DNA heteroduplex of a target RNA and a
first strand cDNA; (b) incomplete degradation of the RNA target of
the heteroduplex to form a complex of the first strand cDNA and
atleast one RNA fragment that can in turn serve as a primer; (c)
formation of a second strand cDNA that is of the same sense as the
input target RNA; (d) linear amplification of the complement of a
second strand DNA by primer extension (from a composite primer)
along the second strand cDNA and strand displacement to produce
multiple copies of antisense single stranded DNA products and (e)
transcription of the product of the linear amplification step to
produce multiple copies of sense RNA products.
[0174] A composite primer, as described herein, is used for the
amplification in these methods. As illustrated in FIGS. 3A and 4A,
the single (composite) primer (labeled "1") can be composed of a
3'-DNA portion (labeled "A") which is complementary to a sequence
on the target RNA, and a 5'-RNA portion (labeled "B") which
comprises a non-target related sequence (i.e., it is not
complementary/hybridizable (under a given set of conditions) to a
sequence on the target RNA). The 3'-DNA portion of the composite
primer may comprise poly-dT nucleotides, which would render it
complementary/hybridizable (under a given set of conditions) to the
poly-A 3' end of mRNA derived from a eukaryotic cell.
[0175] A composite primer that is hybridized to a target RNA is
extended by an RNA-dependent DNA polymerase, such as a reverse
transcriptase, to form an RNA/DNA heteroduplex of the target RNA
and a first strand cDNA. Degradation of the target RNA of the
heteroduplex is then achieved using a ribonuclease such as RNase H,
to form a complex of the first strand cDNA and one or more RNA
fragments (oligonucleotides). The RNase H activity may be supplied
by the RNA-dependent DNA polymerase (such as reverse transcriptase)
or may be provided in a separate enzyme. Reverse transcriptases
useful for this method may or may not have RNase H activity. The
fragments are a result of incomplete degradation of the target RNA
in the heteroduplex. These fragments function as primers for a
DNA-dependent DNA polymerase to form the second strand cDNA.
Okayama.& Berg, Molecular and Cell Biology (1982), 2:161; and
Gubler & Hoffman, Gene (1983), 25:263. Reverse transcriptase
then extends the 3'-end of the second strand cDNA in the duplex
along the 5'-RNA sequence of the composite primer extension product
(the first strand cDNA), to form an RNA/DNA heteroduplex at the end
of the double stranded cDNA product.
[0176] The heteroduplex at the end of the double stranded cDNA is a
substrate for RNase H. The RNase H degrades the 5'-RNA portion of
the first strand cDNA, to create a site for hybridization of the
composite primer, which hybridizes by its 5'-RNA portion to the
3'-end of the second strand cDNA in the duplex cDNA. The 3' DNA
portion of the new primer displaces the 5' end of the first strand
cDNA, by hybridization to its complementary sequence on the second
strand cDNA. A DNA polymerase with strong strand displacement
activity then extends the new primer along the second strand cDNA,
and displaces the previously formed cDNA product. An RNase H
degrades the 5'-portion of the new primer extension product in the
heteroduplex, to create a free site for hybridization of a new
composite primer, thus resulting in continuous linear amplification
of the target sequence and generation of multiple copies of single
stranded DNA product which is anti sense to the target RNA
sequence.
[0177] As depicted in FIGS. 4A-B, and as is evident from the
description herein, the single composite primer amplification
methods can also include a transcription step employing a
propromoter polynucleotide in the same manner as that described
with respect to the enhanced methods of amplification using a
composite primer and a second primer.
[0178] The methods of the invention may be used for generation of
multiple copies of a plurality of RNA sequences in the sample or of
a specific RNA species or group of species. In the latter cases,
the composite primer generally comprises a 3'-portion which is
complementary and/or hybridizable to a sequence of a specific RNA
target or group of targets (e.g., homologous RNA targets or targets
that are members of a family or superfamily of sequences). For
example, the primer may comprise a collection of primer sequences,
such as where more than one target sequence exists.
[0179] Another application of the methods of the invention is in
detection of variant regions flanking a common sequence. By
designing a first composite primer that recognizes a commonly
shared sequence, single stranded DNA or RNA product is produced
that contains not only the common region recognized by the primer,
but also 5'-flanking sequence useful in detecting sequence
variants. Thus, for example, single stranded DNA or RNA product can
be produced from limited amounts of clinical material to allow
pathogen-specific sequences (such as those distinguishing viral
types) to be identified, genetic polymorphisms to be detected, or
alternate splicing variants to be characterized, all in accordance
with standard techniques. In other embodiments, single stranded DNA
or RNA product is produced that contains not only the common region
recognized by the primer, e.g., a conserved or functional sequence
motif, but also 5'-flanking sequences permitting identification of
groups of RNA species comprising similar sequence motifs.
[0180] The 5'-RNA portion of the composite primer may or may not be
related to the specific RNA target sequence, and may or may not
hybridize to the RNA target. Methods of the invention using
"tailed" composite primers are described further herein.
[0181] Linear mRNA Amplification Using a Single Composite Primer
and a Target RNA Fragment
[0182] As is described herein, total mRNA may be amplified using a
composite primer comprising a poly(T) of sufficient length to
hybridize with substantially an entire population of messages
(i.e., poly(T)n, wherein n is typically from about 5 to 50 or
more). FIG. 5 exemplifies a schematic description of a non-enhanced
embodiment of the strand displacement-based methods of the
invention comprising use of a single composite primer comprising a
3'-DNA portion comprising a poly-dT sequence, and further
comprising a random sequence 3' the poly-dT sequence. Composite
primer 1 further comprises a 5'-RNA portion that is not
substantially hybridizable to the RNA target sequences (i.e. a tail
under conditions in which the poly-dT sequence hybridizes).
Optionally, a second composite primer may be used as described
below.
[0183] The method involves the following steps: (a) primer
extension to form an RNA/DNA heteroduplex of a target RNA and a
first strand cDNA; (b) formation of a second primer extension
product (second strand cDNA) that is of the same sense as the input
target RNA. The second primer extension product generally comprises
a 3'-portion that is complementary to the 5'-RNA portion of the
composite primer (i.e., the tail); (c) linear amplification of the
complement of the second strand cDNA by primer extension (from a
composite primer) and strand displacement to produce multiple
copies of antisense single stranded DNA products (that are
complementary to the RNA sequence of interest).
[0184] FIG. 6 exemplifies a schematic description of an
non-enhanced embodiment of the strand displacement-based methods of
the invention comprising use of a single composite primer
comprising a 3'-DNA portion comprising a random sequence and
further comprising a 5'-RNA portion that is not substantially
hybridizable to the RNA target sequences (i.e. a tail under
conditions in which the random sequence hybridizes). Optionally, a
second composite primer may be used as described below.
[0185] The method involves the following steps: (a) primer
extension to form RNA/DNA heteroduplexes of a target RNA and a
first strand cDNA; (b) formation of second primer extension
products (second strand cDNA) that is of the same sense as the
input target RNA. The second primer extension product generally
comprises a 3'-portion that is complementary to the 5'-RNA portion
of the composite primer (i.e., the tail); (c) linear amplification
of the sense DNA strand by primer extension from a composite primer
and strand displacement to produce multiple copies of antisense
single stranded DNA products that are complementary to the RNA
sequence of interest.
[0186] As illustrated in these embodiments, all steps are
isothermal, although the temperatures for each of the steps may or
may not be the same. It is understood that various other
embodiments may be practiced, given the general description
provided above. It is further understood that the formation of a
second primer extension product may be accomplished by any method
known in the art or described herein (e.g., extension of a
hybridized second primer or RNA fragment).
[0187] As is evident from the description herein, the amplification
methods can also include a transcription step employing a
propromoter polynucleotide in the same manner as that described
with respect to the enhanced methods of amplification using a
composite primer and a second primer. The single stranded RNA
products of the enhanced methods of amplification would generally
comprise a 3'-region that is complementary to the 5'-RNA portion of
the first composite primer.
[0188] FIG. 7 exemplifies a schematic description of an enhanced
embodiment of the strand displacement-based methods of the
invention comprising use of (a) a single composite primer
comprising a 3'-DNA portion comprising a random sequence and
further comprising a 5'-RNA portion that is not substantially
hybridizable to the RNA target sequences (i.e. a tail under
conditions in which the random-sequence hybridizes); and (b) a
propromoter oligonucleotide). Optionally, a second composite primer
may be used as described herein.
[0189] The method involves the following steps: (a) primer
extension to form RNA/DNA heteroduplexes of a target RNA and a
first strand cDNA; (b) formation of second primer extension
products (second strand cDNA) that is of the same sense as the
input target RNA and cleavage of RNA present in a RNA/DNA
heteroduplex by an agent (such as RNase H) capable of cleaving RNA
present in an RNA/DNA heteroduplex, whereby a double stranded
complex of first and second primer extension product comprising a
3' single stranded portion is generated (complex IX in FIG. 8,
which correspond to complex 1.times. as illustrated in FIG. 1); and
(c) a PTO binds to double stranded product 1.times. to fomm complex
X, as shown in FIG. 8. DNA polymerase extends the 3' end of the
second primer extension product in complex XIII, along the PTO
template to form complex XI comprising a double stranded promoter
sequence at one end; and (d) transcription using DNA-dependent RNA
polymerase to produce multiple copies of sense RNA products. As
illustrated, all steps are isothermal, although the temperatures
for each of the steps may or may not be the same.
[0190] As illustrated in FIG. 8, a promoter template
oligonucleotide, 3 (PTO), can be designed as follows: the 3'
portion is the same as the 5' RNA portion of the first composite
primer (that hybridizes to template RNA). This design enables the
PTO to hybridize to the single stranded 3' portion of the second
primer extension product (which is present in a complex with the
first primer extension product). The 5'-most portion of the PTO is
a promoter sequence for a DNA-dependent RNA polymerase, which, as
described above, is used in certain (namely, the other "enhanced"
methods) embodiments of the amplification methods of the
invention.
[0191] Linear mRNA Amplification Using a First Composite Primer, a
Second Composite Primer, and a Target RNA
[0192] The invention provides methods of producing single stranded
antisense and sense polynucleotide, generally DNA, copies of an RNA
sequence of interest using a first composite primer, a second
composite primer which is used to generate the second strand cDNA,
and a target RNA. In this aspect of the invention, a first
composite primer is used to generate first extension product
(generally cDNA), which is a substrate for the linear amplification
using a composite primer, as described above. In addition, a second
composite primer is used to generate a second strand cDNA which is
a substrate for linear amplification, resulting in production of
single stranded polynucleotide copies of the RNA sequence of
interest.
[0193] The method involves the following: (a) formation of a double
stranded cDNA comprising a RNA-DNA heteroduplex at each end of the
cDNA; and (b) linear amplification of first strand (sense): cDNA
and second strand (antisense) cDNA by primer extension from the
first composite primer and from the second composite primer (which
binds to the first strand cDNA), and strand displacement. Single
stranded first and second strand cDNA product is produced, which is
useful for, for example, producing cDNA libraries. As is evident,
in this aspect of the invention, the second primer extension
product is primed by a composite primer.
[0194] FIG. 8 illustrates one embodiment of the invention. Two
composite primers comprising different "tail" sequences are used to
generate a double stranded cDNA comprising a RNA-DNA heteroduplex
at each end of the cDNA. Cleavage of RNA by an agent that cleaves
RNA from an RNA/DNA heteroduplex permits binding of another first
composite primer, another second composite primer (that hybridizes
to the first primer extension product), extension and strand
displacement, whereby multiple copies of an antisense single
stranded product and multiple copies of a sense single stranded DNA
product are produced. Combination of sense and antisense single
stranded cDNA product is capable of producing double stranded cDNA.
The process of the amplification methods of the invention resulting
in generation of single stranded cDNA products comprising sequences
complementary to an RNA sequence(s) of interest and sequences
comprising an RNA sequence(s) of interest is as follows (an
embodiment of which is illustrated in FIG. 7):
[0195] A) Formation of a Double Stranded cDNA Substrate for Linear
Amplification
[0196] 1. Composite primer 1 binds to an RNA target in a sample by
hybridization of the primer portion A (which can be based at least
in part on the poly-A sequence of the mRNA), to form complex I.
[0197] 2. A reverse transcriptase extends the hybridized primer 1
along the target RNA strand to which it is hybridized, to form an
RNA/DNA duplex, labeled II. An agent (such as RNase H) degrades the
target RNA strand of the hybrid duplex to generate a single
stranded first strand cDNA (labeled "III"). The 5' end of III is
primer 1.
[0198] 3. Composite primer 2, binds to the first strand cDNA, III,
by hybridization of sequence F, to form complex IV.
[0199] 4. Composite primer 2 is extended along the cDNA strand III
by a DNA polymerase to form a double stranded product (labeled "V")
which consists of first and second strand cDNA. Primer extension
along the 5' RNA portion of IV by an RNA-dependent DNA polymerase
such as a reverse transcriptase results in formation of an RNA/DNA
hybrid portion at one end of complex V.
[0200] 5. An agent (such as RNase H) degrades the RNA portion of
the RNA/DNA hybrid at one end of complex V, to create a partial
double stranded complex (labeled "VI") with a 3' DNA single
stranded end, which has a sequence which is the complement of
portion B of the composite primer 1.
[0201] 6. Composite primer 1 binds to complex VI by hybridization
of the RNA portion to the single stranded DNA end, which is
complementary to it, to form complex VII.
[0202] 7. Primer extension of bound primer 1 in complex VII along
the sense cDNA strand results in displacement of the previous
primer extension product (VII), and replicates portion "G" of the
second composite primer, to form complex VIII.
[0203] 8. An agent (such as RNase H) cleaves the RNA portions of
the RNA/DNA heteroduplexes, forming complex VIII. Complex VIII has
two RNA/DNA heteroduplexes comprised of composite primer 1 and the
complement of composite primer 1 at one end, and the second
composite primer and the complement of the second composite primer
at the other end. Complex VIII is a substrate for subsequence
reactions denoted "A" and "B".
[0204] B) Isothermal Linear Amplification
[0205] 9. In reaction A, a first composite primer binds to complex
VIII. Primer extension and displacement produces first displacement
product A. RNase cleavage creates a site for binding of a first
composite primer, and subsequence primer extension, whereby single
stranded antisense DNA product accumulates.
[0206] 10. In reaction B, a second composite primer binds to
complex VIII (or to first displacement product A). Primer extension
and displacement produces single stranded sense DNA products.
[0207] The single stranded products can be annealed to form a
double stranded complex of first and second strand cDNA, or can be
prevented from annealing (or subsequently denatured) to produce a
mixture of single stranded first and second strand cDNA.
[0208] Components and Reaction Conditions Used in the Methods of
the Invention
[0209] Template Nucleic Acid
[0210] The RNA target to be amplified includes RNAs from any source
in purified or unpurified form, which can be RNA such as total RNA,
tRNA, mRNA, rRNA, mitochondrial RNA, chloroplast RNA, DNA-RNA
hybrids, or mixtures thereof, from any source and/or species,
including human, animals, plants, and microorganisms such as
bacteria, yeasts, viruses, viroids, molds, fungi, plants, and
fragments thereof RNAs can be obtained and purified using standard
techniques in the art. Amplification of a DNA target (including
genomic DNA target) would require initial transcription of the DNA
target into RNA form, which can be achieved using methods disclosed
in Kurn, U.S. Pat. No. 6,251,639 B1, and by other techniques (such
as expression systems) known in the art. Amplification of a DNA-RNA
hybrid would require denaturation of the hybrid to obtain a ssRNA,
or denaturation followed by transcription of the DNA strand to
obtain an RNA. The target RNA can be only a minor fraction of a
complex mixture such as a biological sample and can be obtained
from various biological material by procedures well known in the
art. The target RNA can be known or unknown and may contain more
than one desired specific nucleic acid sequence of interest, each
of which may be the same or different from each other. Therefore,
the amplification process is useful not only for producing large
amounts of one specific nucleic acid sequence, but also for
amplifying simultaneously more than one different specific nucleic
acid sequence located on the same or different nucleic acid
molecules.
[0211] The initial step of the amplification of a target RNA
sequence is rendering the target single stranded. If the target
nucleic acid is double stranded (e.g., RNA/DNA hybrid) the initial
step could be target denaturation. Denaturation may also be carried
out to remove secondary structure present in a RNA target molecule.
The denaturation step may be thermal denaturation or any other
method known in the art.
[0212] Composite Primer
[0213] The methods of the invention employ; acomposite primer that
is composed of RNA and DNA portions. As described herein, when used
for hybridizing and initiating the methods of RNA amplification as
described herein, the composite primer generally comprises a DNA
portion which hybridizes to the RNA target (which, as described
herein, can have any of a number of sequence permutations,
depending on the nature of the RNA (whether a species or a
population) designed to be amplified). When used to amplify a cDNA
strand produced by the methods of the invention described herein,
the composite primer is designed such that subsequent displacement
of the primer extension product by binding of a new (additional)
composite primer and the extension of the new primer by the
polymerase can be achieved. In addition, cleavage of the RNA
portion of the primer extension product leads to generation of
amplification product which is not a substrate for amplification by
the composite primer. It is understood that, in the following
section that generally describes aspects of the composite primers
used in the methods of the invention, characteristics described may
be applicable to the primers if used for hybridizing and initiating
the RNA amplification (production of first extension product)
and/or for linear displacement amplification.
[0214] Composite primers for use in the methods and compositions of
the invention comprise a sequence capable of hybridizing to a
target RNA. The sequence that is capable of hybridizing to the
target RNA can be based on the particular sequence of a specific
target RNA (for e.g., the mRNA of a particular gene), or be based
on a more general sequence type known to be present in a plurality
of RNA species, such as the poly-A tail sequence generally believed
in the art to be present in all eukaryotic mRNA. In addition, the
sequence that is capable of hybridizing to the target RNA may
comprise a sequence complementary to the poly-A tail of mRNA, and
may further comprise an additional random sequence (generally not
complementary to a poly-A sequence) at the 3' end of the 3' portion
(or a population of random sequences).
[0215] The sequence that is capable of hybridizing to the target
RNA may also comprise a random sequence. Random primers are well
known in the art, see, e.g., and include at least the following:
primers hybridizable to two or more sequences in a sample; and
primers comprising poly-dT sequences that are hybridizable to a
multiplicity of RNAs in a sample (such as all mRNA). For
convenience, a single random composite primer is discussed above.
However, it is understood that the term "random primer" can refer
to a primer that is a member of a population of primers which are
collectively designed to a desired and/or significant population of
target sequences.
[0216] It is also understood that the amplification of a plurality
of mRNA species in a single reaction mixture may, but not
necessarily, employ a multiplicity of primers (from two to many
more). Thus, the invention contemplates the use of a multiplicity
of different composite primers (random or non-random) when
amplifying a plurality of mRNA species in a single reaction
mixture.
[0217] In some embodiments, a first composite primer is used in the
methods of the invention, including those steps which involve
linear displacement amplification (SPIA) of the second cDNA strand.
In other embodiments, a first and second, different, composite
primer are used in the methods of the invention. The second
composite primer is used for the linear displacement amplification
(SPIA) step, and may comprise some or all of the sequence of the
first composite primer, and the first composite primer may comprise
some or all of the sequence of the second composite primer. In some
embodiments, the second composite primer comprises a different
sequence than the first composite primer.
[0218] In some embodiments, a composite primer is designed such
that the entire primer hybridizes to the target RNA. In other
embodiments, a composite primer comprises a sequence, preferably at
the 5' end, that is not hybridizable (under a given set of
conditions) to the target (for example, a non-hybridized 5' portion
that would constitute a tail-when the primer is bound to the
target). Individual DNA and RNA portions of the composite primer
may be completely or partially hybridizable to the target RNA. For
example, the 5' RNA portion of a composite primer may be partially
hybridizable and partially nonhybridizable, or the DNA portion of a
composite primer may be partially hybridizable and partially
nonhybridizable, or both. Put another way, DNA portions can
constitute part of a "tail" and RNA portions can be partially or
completely hybridizable to target RNA. For example, the 5' RNA
portion of a composite primer may be partially hybridizable and
partially nonhybridizable, or the DNA portion of a composite primer
may be partially hybridizable and partially nonhybridizable, or
both.
[0219] For use in linear displacement amplification, a composite
primer comprises at least one RNA portion that is capable of (a)
binding (hybridizing) to a sequence on the second strand cDNA
(interchangeably called "second primer extension product" or
"composite primer extension product") independent of hybridization
of the DNA portion(s) to a sequence on the same second strand cDNA;
and (b) being cleaved with an agent such as a ribonuclease when
hybridized to the second primer or fragment extension product. The
composite primers bind to the second strand cDNA to form a partial
heteroduplex in which only the RNA portion of the primer is cleaved
upon contact with an agent which cleaves RNA in an RNA/DNA hybrid,
such as an enzyme, such as a ribonuclease (such as RNase H), while
the second strand cDNA remains intact, thus enabling annealing of
another composite primer.
[0220] When used for the linear displacement amplification
described herein, the composite primers also comprise a 3' DNA
portion that is capable of hybridization to a sequence on the
second strand cDNA such that its hybridization to the second strand
cDNA is favored over that of the nucleic acid strand that is
displaced from the second strand cDNA by the DNA polymerase. Such
primers can be rationally designed based on well known factors that
influence nucleic acid binding affinity, such as sequence length
and/or identity, as well as hybridization conditions. In a
preferred embodiment, hybridization of the 3' DNA portion of the
composite primer to its complementary sequence in the second strand
cDNA favored over the hybridization of the homologous sequence in
the 5' end of the displaced strand to the second strand cDNA.
[0221] Generation of primers suitable for extension by
polymerization is well known in the art, such as described in PCT
Pub. No. WO99/42618 (and references cited therein). The composite
primer comprises a combination of RNA and DNA (see definition
above), with the 3'-end nucleotide being a nucleotide suitable for
nucleic acid extension. The 3'-end nucleotide can be any nucleotide
or analog that when present in a primer, is extendable by a DNA
polymerase. Generally, the 3'-end nucleotide has a 3'-OH. Suitable
primers include those that comprise at least one portion of RNA and
at least one portion of DNA. For example, composite primers can
comprise a 5'-RNA portion and a 3'-DNA portion (in which the RNA
portion is adjacent to the 3'-DNA portion); or 5'- and 3'-DNA
portions with an intervening RNA portion. Accordingly, in one
embodiment, the composite primer comprises a 5' RNA portion and a
3'-DNA portion, preferably wherein the RNA portion is adjacent to
the 3'-DNA portion. In another embodiment, the composite primer
comprises 5'- and 3'-DNA portions with at least one intervening RNA
portion (i.e., an RNA portion between the two DNA portions). In yet
another embodiment, the composite primer of the invention comprises
a 3'-DNA portion and at least one intervening RNA portion (i.e., an
RNA portion between DNA portions).
[0222] The length of an RNA portion in a composite primer
comprising a 3'-DNA portion and an RNA portion can be preferably
from about 1 to about 50, more preferably from about 3 to about 20,
even more preferably from about 4 to about 15, and most preferably
from about 5 to about 10 nucleotides. In some embodiments of a
composite primer comprising a 3'-DNA portion and an RNA portion, an
RNA portion can be at least about any of 1, 3, 4, 5 nucleotides,
with an upper limit of about any of 10, 15, 20, 25, 3, 50
nucleotides.
[0223] The length of the 5'-RNA portion in a composite primer
comprising a 5'-RNA portion and a 3'-DNA portion can be preferably
from about 3 to about 50 nucleotides, more preferably from about 5
to about 20 nucleotides, even more preferably from about 7 to about
18 nucleotides, preferably from about 8 to about 17 nucleotides,
and most preferably from about 10 to about 15 nucleotides. In other
embodiments of a composite primer comprising a 5'-RNA portion and a
3'-DNA portion, the 5'-RNA portion can be at least about any of 3,
5, 7, 8, 10 nucleotides, with an upper limit of about any of 15,
17, 18, 20, 50 nucleotides. In one embodiment, the composite primer
has an RNA portion of about 14 nucleotides.
[0224] In embodiments of a composite primer comprising a 5'-RNA
portion and a 3'-DNA portion further comprising non-5'-RNA
portion(s), a non-5'-RNA portion can be preferably from about 1 to
about 7 nucleotides, more preferably from about 2 to about 6
nucleotides, and most preferably from about 3 to about 5
nucleotides. In certain embodiments of a composite primer
comprising a 5'-RNA portion and a 3'-DNA portion further comprising
non-5'-RNA portion(s), a non-5'-RNA portion can be at least about
any of 1, 2, 3, 5, with an upper limit of about any of 5, 6, 7, 10
nucleotides.
[0225] In embodiments of a composite primer comprising a 5'-RNA
portion and a 3'-DNA portion, in which the 5'-RNA portion is
adjacent to the 3'-DNA portion, the length of the 5'-RNA portion
can be preferably from about 3 to about 50 nucleotides, more
preferably from about 5 to about 20 nucleotides, even more
preferably from about 7 to about 18 nucleotides, preferably from
about 8 to about 17 nucleotides, and most preferably from about 10
to about 15 nucleotides. In certain embodiments of a composite
primer comprising a 5'-RNA portion and a 3'-DNA portion, in which
the 5'-RNA portion is adjacent to the 3'-DNA portion, the 5'-RNA
portion can be at least about any of 3, 5, 7, 8, 10 nucleotides,
with an upper limit of about any of 15, 17, 18, 20, 50
nucleotides.
[0226] The length of an intervening RNA portion in a composite
primer comprising 5'- and 3'-DNA portions with at least one
intervening RNA portion can be preferably from about 1 to about 7
nucleotides, more preferably from about 2 to about 6 nucleotides,
and most preferably from about 3 to about 5 nucleotides. In some
embodiments of a composite primer comprising 5'- and 3'-DNA
portions with at least one intervening RNA portion, an intervening
RNA portion can be at least about any of 1, 2, 3, 5 nucleotides,
with an upper limit of about any of 5, 6, 7, 10 nucleotides. The
length of an intervening RNA portion in a composite primer
comprising a 3'-DNA portion and at least one intervening RNA
portion can be preferably from about 1 to about 7 nucleotides, more
preferably from about 2 to about 6 nucleotides, and most preferably
from about 3 to about 5 nucleotides. In some embodiments of a
composite primer comprising a 3'-DNA portion and at least one
intervening RNA portion, an intervening RNA portion can be at least
about any of 1, 2, 3, 5 nucleotides, with an upper limit of about
any of 5, 6, 7, 10 nucleotides. In a composite primer comprising a
3'-DNA portion and at least one intervening RNA portion, further
comprising a 5'-RNA portion, the 5'-RNA portion can be preferably
from about 3 to about 25 nucleotides, more preferably from about 5
to about 20 nucleotides, even more preferably from about 7 to about
18 nucleotides, preferably from about 8 to about 17 nucleotides,
and most preferably from about 10 to about 15 nucleotides. In some
embodiments of a composite primer comprising a 3'-DNA portion and
at least one intervening RNA portion, further comprising a 5'-RNA
portion, the 5'-RNA portion can be at least about any of 3, 5, 7,
8, 10 nucleotides, with an upper limit of about any of 15, 17, 18,
20 nucleotides.
[0227] The length of the 3'-DNA portion in a composite primer
comprising a 3'-DNA portion and an RNA portion can be preferably
from about 1 to about 20, more preferably from about 3 to about 18,
even more preferably from about 5 to about 15, and most preferably
from about 7 to about 12 nucleotides. In some embodiments of a
composite primer comprising a 3'-DNA portion and an RNA portion,
the 3'-DNA portion can be at least about any of 1, 3, 5, 7, 10
nucleotides, with an upper limit of about any of 10, 12, 15, 18,
20, 22 nucleotides.
[0228] The length of the 3'-DNA portion in a composite primer
comprising a 5'-RNA portion and a 3'-DNA portion can be preferably
from about 1 to about 20 nucleotides, more preferably from about 3
to about 18 nucleotides, even more preferably from about 5 to about
15 nucleotides, and most preferably from about 7 to about 12
nucleotides. In some embodiments of a composite primer comprising a
5'-RNA portion and a 3'-DNA portion, the 3' DNA portion can be at
least about any of 1, 3, 5, 7, 10 nucleotides, with an upper limit
of about any of 10, 12, 15, 18, 20, 22 nucleotides.
[0229] In embodiments of a composite primer comprising a 5'-RNA
portion and a 3'-DNA portion, further comprising non-3'-DNA
portion(s), a non-3'-DNA portion can be preferably from about 1 to
about 10 nucleotides, more preferably from about 2 to about 8
nucleotides, and most preferably from about 3 to about 6
nucleotides. In some embodiments of a composite primer comprising a
5'-RNA portion and a 3'-DNA portion, further comprising non-3'-DNA
portion(s), a non-3'-DNA portion can be at least about any of 1, 2,
3, 5 nucleotides, with an upper limit of about any of 6, 8, 10, 12
nucleotides.
[0230] In embodiments of a composite primer comprising a 5'-RNA
portion and a 3'-DNA portion in which the 5'-RNA portion is
adjacent to the 3'-DNA portion, the length of the 3'-DNA portion
can be preferably from about 1 to about 20 nucleotides, more
preferably from about-3 to about 18 nucleotides, even more
preferably from about 5 to about 15 nucleotides, and most
preferably from about 7 to about 12 nucleotides. In certain
embodiments of the primer comprising a 5'-RNA portion and a 3'-DNA
portion in which the 5'-RNA portion is adjacent to the 3'-DNA
portion, the 3'-DNA portion can be at least about-any of 1, 3, 5,
7, 10 nucleotides, with an upper limit of about any of 10, 12, 15,
18, 20, 22 nucleotides.
[0231] The length of a non-3'-DNA portion in a composite primer
comprising 5'- and 3'-DNA portions with at least one intervening
RNA portion can be preferably from about 1 to about 10 nucleotides,
more preferably from about 2 to about 8 nucleotides, and most
preferably from about 3 to about 6 nucleotides. In some embodiments
of a primer comprising 5'- and 3'-DNA portions with at least one
intervening RNA portion, a non-3'-DNA portion can be at least about
any of 1, 2, 3, 5 nucleotides, with an upper limit of about any of
6, 8, 10, 12 nucleotides.
[0232] The length of the 3'-DNA portion in a composite primer
comprising 5'- and 3'-DNA portions with at least one intervening
RNA portion can be preferably from about 1 to about 20 nucleotides,
more preferably from about 3 to about 18 nucleotides, even more
preferably from about 5 to about 15 nucleotides, and most
preferably from about 7 to about 12 nucleotides. In some
embodiments of a composite primer comprising 5'- and 3'-DNA
portions with at least one intervening RNA portion, the 3'-DNA
portion can be at least about any of 1, 3, 5, 7, 10 nucleotides,
with an upper limit of about any of 10, 12, 15, 18, 20, 22
nucleotides.
[0233] The length of a non-3'-DNA portion (i.e., any DNA portion
other than the 3'-DNA portion) in a composite primer comprising a
3'-DNA portion and at least one intervening RNA portion can be
preferably from about 1 to about 10 nucleotides, more preferably
from about 2 to about 8 nucleotides, and most preferably from about
3 to about 6 nucleotides. In some embodiments of a composite primer
comprising a 3'-DNA portion and at least one intervening RNA
portion, a non-3'-DNA portion can be at least about any of 1, 3, 5,
7, 10 nucleotides, with an upper limit of about any of 6, 8, 10, 12
nucleotides. The length of the 3'-DNA portion in a composite primer
comprising a 3'-DNA portion and at least one intervening RNA
portion can be preferably from about 1 to about 20 nucleotides,
more preferably from about 3 to about 18 nucleotides, even more
preferably from about 5 to about 15 nucleotides, and most
preferably from about 7 to about 12 nucleotides. In some
embodiments of a composite primer comprising a 3'-DNA portion and
at least one intervening RNA portion, the 3'-DNA portion can be at
least about any of 1, 3, 5, 7, 10 nucleotides, with an upper limit
of about any of 10, 12, 15, 18, 20, 22 nucleotides. It is
understood that the lengths for the various portions can be greater
or less, as appropriate under the reaction conditions of the
methods of this invention.
[0234] In some embodiments, the 5'-DNA portion of a composite
primer includes the 5'-most nucleotide of the primer. In some
embodiments, the 5'-RNA portion of a composite primer includes the
5`most nucleotide of the primer`. In other embodiments, the 3'-DNA
portion of a composite primer includes the 3' most nucleotide of
the primer. In other embodiments, the 3'-DNA portion is adjacent to
the 5'-RNA portion and includes the 3' most nucleotide of the
primer (and the 5'-RNA portion includes the 5' most nucleotide of
the primer).
[0235] The total length of the composite primer can be preferably
from about 10 to about 50 nucleotides, more preferably from about
15 to about 30 nucleotides, and most preferably from about 20 to
about 25 nucleotides. In some embodiments, the length can be at
least about any of 10, 15, 20, 25 nucleotides, with an upper limit
of about any of 25, 30, 50, 60 nucleotides. It is understood that
the length can be greater or less, as appropriate under the
reaction conditions of the methods of this invention.
[0236] To achieve hybridization to a target nucleic acid (which, as
is well known and understood in the art, depends on other factors
such as, for example, ionic strength and temperature), the portion
of the primer that is hybridizable to the target RNA is preferably
of at least about 60%, more preferably at least about 75%, even
more preferably at least about 90%, and most preferably at least
about 95% complementarity to the target nucleic acid.
[0237] As described herein, one or more composite primers may be
used in an amplification reaction.
[0238] Second Primer
[0239] The second primer in the methods of the invention (which
primes generation of the second primer extension product,
interchangeably referred to as second strand cDNA) comprises a
sequence (which may or may not be the whole of the primer) that is
hybridizable (under a given set of conditions) to a first strand
cDNA (interchangeably called first primer extension product) at a
site on the first strand cDNA such that the second strand cDNA
would include the RNA sequence of interest. In some embodiments,
the hybridizable sequence of the second primer is designed based on
a known sequence of the desired binding site on a first strand
cDNA. In other embodiments, the hybridizable sequence is based on
random sequences, for example, known in the art to be suitable for
random priming of first strand cDNAs generated from a plurality of
RNA species. In other embodiments, the second primer comprises a
strand switch oligonucleotide, described in U.S. Pat. Nos.
5,962,271 and 5,962,272, which is hybridizable to the Cap sequences
present on mRNA and causes the reverse transcriptase to switch from
the mRNA template to the switch oligonucleotide, permitting
generation of a second strand cDNA primed by the "switch
oligonucleotide". Alternatively, a homopolymeric tail is added to
the 3' terminus of the first primer extension product, and the
second primer comprises the complement of the homopolymeric
tail.
[0240] In some embodiments, the second primer comprises DNA. In
other embodiments, the second primer consists of DNA. In other
embodiments, as described herein, the second primer is a fragment
of the target RNA, with the fragment being generated by cleavage of
the RNA target.
[0241] In some embodiments, the second primer (which primes
generation of the second strand cDNA) is a composite primer (as
described above). In these embodiments, the method involves the
following: (a) formation of a double stranded cDNA comprising a
RNA-DNA heteroduplex at one end of the cDNA; and (b) linear
amplification of first strand (sense) cDNA, whereby multiple copies
of single stranded first strand cDNA is generated.
[0242] To achieve hybridization to a first strand cDNA (which, as
is well known and understood in the art, depends on other factors
such as, for example, ionic strength and temperature), the sequence
of the second primer that is hybridizable to the first strand cDNA
is preferably of at least about 60%, more preferably at least about
75%, even more preferably at least about 90%, and most preferably
at least about 95% complementarity to the first strand cDNA.
[0243] In certain embodiments (typically, but not necessarily, ones
that include transcription), the second primer may also comprise a
sequence, preferably a sequence at the 5' end (which generally
includes the 5' most nucleotide), that is not hybridizable to a
first strand cDNA under a given set of conditions. This sequence
enables the creation of a defined end sequence for the 5' end of
the second strand cDNA (and thus, subsequently the 3' end of the
single stranded DNA products). Having a defined end sequence at the
3' end of the single stranded DNA products is particularly
advantageous with respect to hybridization (in embodiments that
include a transcription step) of a propromoter polynucleotide to
displaced first primer extension products in subsequent steps. In
certain embodiments, a 5' non-hybridizable sequence comprises a
sequence the complement of which is hybridizable by a propromoter
polynucleotide. Single stranded DNA products comprising a 3'
defined end sequence are also useful for hybridization to a
complementary oligonucleotide attached to a binding partner or
substrate, for example, a generic microarray as described herein.
Accordingly, the invention provides methods of making these
products with a 3' defined end, as described herein.
[0244] In one embodiment, the second primer comprises DNA. In
another embodiment, the second primer comprises RNA. In yet another
embodiment, the second primer comprises DNA and RNA.
[0245] In some embodiments, the second primer is provided by self
priming (for example, by a hairpin loop) at the 3' end of the
composite primer extension product. In these embodiments, a
sequence at the 3' end of the composite primer extension product
hybridizes to another sequence in the composite primer extension
product itself, for example as described in U.S. Pat. No.
6,132,997. In these embodiments, said sequence at the 3' of the
composite primer extension product is generally cleaved (for
example, with S1 nuclease) following its hybridization to the
composite primer extension product and/or its extension along the
composite primer extension product. U.S. Pat. No. 6,132,997.
[0246] In some embodiments, the second primer is provided by one or
more target RNA fragments. Such a target RNA fragment can be
generated as a result of incomplete degradation of a target RNA in
a complex of target RNA and first primer extension product by an
agent (such as an enzyme) that cleaves RNA in an RNA/DNA hybrid,
such that one or more RNA fragments remain bound to the first
primer extension product.
[0247] Polynucleotide Comprising a Propromoter and a Region Which
Hybridizes to a Primer Extension Product
[0248] Some embodiments employ a propromoter polynucleotide
comprising a propromoter and a region which hybridizes to a primer
extension product. In some embodiments, the propromoter
polynucleotide is provided as a PTO, as described in greater detail
below.
[0249] Propromoter Template Oligonucleotide
[0250] In some embodiments, the methods employ a promoter sequence
for transcription which is provided by a propromoter template
oligonucleotide (PTO).
[0251] A PTO for use in the methods and compositions of the
invention is a single-stranded polynucleotide, generally DNA,
comprising a propromoter sequence that is designed for formation of
a double stranded promoter of an RNA polymerase, and a portion
capable of hybridizing to the 3' end of a primer extension product.
In an embodiment of the invention, the portion capable of
hybridizing to the 3' end of a primer extension product comprises a
sequence the complement of which is hybridizable to a defined end
sequence of the second primer extension product (and thus,
subsequently the 3' end of the single stranded DNA products). In
another embodiment, the portion capable of hybridizing to the 3'
end of a primer extension product comprises a random sequence. In
another embodiment, the portion capable of hybridizing to the 3'
end of a primer extension product comprises a sequence the
complement of which is capable of hybridizing to sequences found at
the 3' end of a multiplicity of first strand cDNAs.
[0252] In a preferred embodiment, the propromoter sequence is
located in the 5' portion of the oligonucleotide and the
hybridizing sequence is located in the 3' portion of the
oligonucleotide. In one embodiment, and most typically, the
promoter and hybridizing sequences are different sequences. In
another embodiment, the promoter and hybridizing sequences overlap
in sequence identity. In yet another embodiment, the promoter and
hybridizing sequences are the same sequence, and thus are in the
same location on the PTO. In the embodiments wherein hybridization
of the PTO to the primer extension product results in a duplex
comprising an overhang (the 5' end of the PTO that does not
hybridize to the displaced primer extension product, typically
comprising all or part of the propromoter sequence), DNA polymerase
fills in the overhang to create a double-stranded promoter capable
of effecting transcription by a suitable RNA polymerase.
[0253] Promoter sequences that allow transcription of a template
DNA are known in the art and have been discussed above. Preferably,
the promoter sequence is selected to provide optimal
transcriptional activity of the particular RNA polymerase used.
Criteria for such selection, i.e., a particular promoter sequence
particularly favored by a particular RNA polymerase, is also known
in the art. For example, the sequences of the promoters for
transcription by T7 DNA dependent RNA polymerase and SP6 are known
in the art. The promoter sequence can be from a prokaryotic or
eukaryotic source.
[0254] In some embodiments, the PTO comprises an intervening
sequence between a propromoter sequence and a portion capable of
hybridizing to the 3' end of the primer extension product. Suitable
length of the intervening sequence can be empirically determined,
and can be at least about 1, 2, 4, 6, 8, 10, 12, 15 nucleotides.
Suitable sequence identity of the intervening sequence can also be
empirically determined, and the sequence is designed to preferably,
but not necessarily, enhance degree of amplification as compared to
omission of the sequence. In one embodiment, the intervening
sequence is a sequence that is designed to provide for enhanced, or
more optimal, transcription by the RNA polymerase used. Generally,
the sequence is not related (i.e., it does not substantially
hybridize) to the target nucleic acid. More optimal transcription
occurs when transcriptional activity of the polymerase from a
promoter that is operatively linked to said sequence is greater
than from a promoter that is not so linked. The sequence
requirements for optimal transcription are generally known in the
art as previously described for various DNA dependent RNA
polymerases, such as in U.S. Pat. Nos. 5,766,849 and 5,654,142, and
can also be empirically determined.
[0255] In another embodiment, the PTO comprises a sequence that is
5' to the propromoter sequence, i.e., the PTO comprises additional
nucleotides (which may or may not be transcriptional regulatory
sequences) located 5' to the propromoter sequence. Generally, but
not necessarily, the sequence is not hybridizable (under a given
set of conditions) to the primer extension product.
[0256] In one embodiment, the PTO cannot function efficiently as a
primer for nucleic acid extension. Techniques for blocking the
primer function of the PTO include any that prevent addition of
nucleotides to the 3' end of the PTO by a DNA polymerase. Such
techniques are known in the art, including, for example,
substitution or modification of the 3' hydroxyl group, or
incorporation of a modified nucleotide, such as a
dideoxynucleotide, in the 3'-most position of the PTO that is not
capable of anchoring addition of nucleotides by a DNA polymerase.
It is possible to block the 3' end using a label, or a small
molecule which is a member of a specific binding pair, such as
biotin. It is also possible to render the 3' end non-extendable by
addition of nucleotides which cannot hybridize to a primer
extension product, either due to non-complementarity or due to
structural modifications which do not support hydrogen bonding. In
other embodiments, the PTO is not blocked.
[0257] The length of the portion of the PTO that hybridizes to a
primer extension product of interest is preferably from about 5 to
about 50 nucleotides, more preferably from about 10 to about 40
nucleotides, even more preferably from about 15 to about 35
nucleotides, and most preferably from about 20 to 30 nucleotides.
In some embodiments, the hybridizing portion is at least about any
of the following: 3, 5, 10, 15, 20; and less than about any of the
following: 30, 40, 50, 60. The complementarity of the hybridizing
portion is preferably at least about 25%, more preferably at least
about 50%, even more preferably at least about 75%, and most
preferably at least about 90%, to its intended binding sequence on
the primer extension product of interest.
[0258] DNA Polymerase, an Agent Capable of Cleaving an RNA-DNA
Hybrid, and RNA Polymerase
[0259] The amplification methods of the invention employ the
following enzymes: an RNA-dependent DNA polymerase, a DNA-dependent
DNA polymerase, an agent capable of cleaving an RNA strand of an
RNA-DNA hybrid (for example, a ribonuclease such as RNase H), and,
in some aspects a DNA-dependent RNA polymerase. One or more of
these activities may be found and used in a single enzyme. For
example, RNase H activity may be supplied by an RNA-dependent DNA
polymerase (such as reverse transcriptase)-or may be providedin a
separate enzyme. Reverse transcriptases useful for this method may
or may not have RNase H activity.
[0260] One aspect of the invention is the formation of double
stranded cDNA from a primer-RNA complex. This process generally
utilizes the enzymatic activities of an RNA-dependent DNA
polymerase, a DNA-dependent DNA polymerase and a agent capable of
cleaving an RNA/DNA hybrid (such as RNase H).
[0261] RNA-dependent DNA polymerases for use in the methods and
compositions of the invention are capable of effecting extension of
a primer according to the methods of the invention. Accordingly, a
preferred RNA-dependent DNA polymerase is one that is capable of
extending a nucleic acid primer along a nucleic acid template that
is comprised at least predominantly of ribonucleotides. Suitable
RNA-dependent DNA polymerases for use in the methods and
compositions of the invention include reverse transcriptase. Many
reverse transcriptases, such as those from avian myeoloblastosis
virus (AMV-RT), and Moloney murine leukemia virus (MMLV-RT)
comprise more than one activity (for example, polymerase activity
and ribonuclease activity) and can function in the formation of the
double stranded cDNA molecules. However, in some instances, it is
preferable to employ a reverse transcriptase which lacks the RNase
H activity. Reverse transcriptase devoid of RNase H activity are
known in the art, including those comprising a mutation of the wild
type reverse transcriptase where the mutation eliminates the RNase
H activity. In these cases, the addition of an RNase H from other
sources, such as that isolated from E. coli, can be employed for
the formation of the double stranded cDNA.
[0262] DNA-dependent DNA polymerases for use in the methods and
compositions of the invention are capable of effecting extension of
the composite primer according to the methods of the invention.
Accordingly, a preferred polymerase is one that is capable of
extending a nucleic acid primer along a nucleic acid template that
is comprised at least predominantly of deoxynucleotides. The
formation of the double stranded cDNA can be carried out by reverse
transcriptase which comprises both RNA-dependent DNA polymerase and
DNA-dependent DNA polymerase activities. Amplification of an RNA
sequence according to methods of the invention involves the use of
a DNA polymerase that is able to displace a nucleic acid strand
from the polynucleotide to which the displaced strand is bound,
and, generally, the more strand displacement capability the
polymerase exhibits (i.e., compared to other polymerases which do
not have as much strand displacement capability) is preferable.
Preferably, the DNA polymerase has high affinity for binding at the
3'-end of an oligonucleotide hybridized to a nucleic acid strand.
Preferably, the DNA polymerase does not possess substantial nicking
activity. Generally, the DNA polymerase preferably has little or no
5'->3' exonuclease activity so as to minimize degradation of
primer, or primer extension polynucleotides. Generally, this
exonuclease activity is dependent on factors such as pH, salt
concentration, whether the template is double stranded or single
stranded, and so forth, all of which are familiar to one skilled in
the art. Mutant DNA polymerases in which the 5'->3' exonuclease
activity has been deleted, are known in the art and are suitable
for the amplification methods described herein. Mutant DNA
polymerases which lack both 5' to 3' nuclease and 3' to 5' nuclease
activities have also been described, for example, exo.sup.-/-Klenow
DNA polymerase. It is preferred that the DNA polymerase displaces
primer extension products from the template nucleic acid in at
least about 25%, more preferably at least about 50%, even more
preferably at least about 75%, and most preferably at least about
90%, of the incidence of contact between the polymerase and the 5'
end of the primer extension product. In some embodiments, the use
of thermostable DNA polymerases with strand displacement activity
is preferred. Such polymerases are known in the art, such as
described in U.S. Pat. No. 5,744,312 (and references cited
therein). Preferably, the DNA polymerase has little to no
proofreading activity
[0263] Suitable DNA polymerases for use in the methods and
compositions of the invention include those disclosed in U.S. Pat.
Nos. 5,648,211 and 5,744,312, which include exo.sup.- Vent (New
England Biolabs), exo.sup.- Deep Vent (New England Biolabs), Bst
(BiORad), exo.sup.- Pfu (Stratagene), Bca (Panvera), sequencing
grade Taq (Promega), exo.sup.-/-Klenow DNA polymerase, and
thermostable DNA polymerases from thermoanaerobacter
thermohydrosulfuricus.
[0264] The ribonuclease for use in the methods and compositions of
the invention is capable of cleaving ribonucleotides in an RNA/DNA
hybrid. Preferably, the ribonuclease cleaves ribonucleotides in an
RNA/DNA hybrid regardless of the identity and type of nucleotides
adjacent to the ribonucleotide to be cleaved. It is preferred that
the ribonuclease cleaves independent of sequence identity. Examples
of suitable ribonucleases for the methods and compositions of the
invention are well known in the art, including ribonuclease H(RNase
H) including Hybridase.
[0265] The DNA-dependent RNA polymerases for use in the methods and
compositions of the invention are known in the art. Either
eukaryotic or prokaryotic polymerases may be used. Examples include
T7, T3 and SP6 RNA polymerases. Generally, the RNA polymerase
selected is capable of transcribing from the promoter sequence
provided by the propromoter polynucleotides as described herein.
Generally, the RNA polymerase is a DNA-dependent polymerase, which
is preferably capable of transcribing from a single stranded DNA
template so long as the promoter region is double stranded.
[0266] In general, the enzymes used in the methods and compositions
of the invention should not produce substantial degradation of the
nucleic acid components of said methods and compositions.
[0267] Reaction Conditions and Detection
[0268] Appropriate reaction media and conditions for carrying out
the methods of the invention are those that permit nucleic acid
amplification according to the methods of the invention. Such media
and conditions are known to persons of skill in the art, and are
described in various publications, such as U.S. Pat. Nos.
5,554,516; 5,716,785; 5,130,238; 5,194,370; 6,090,591; 5,409,818;
5,554,517; 5,169,766; 5,480,784; 5,399,491; 5,679,512; and PCT Pub.
No. WO99/42618. For example, a buffer may be Tris buffer, although
other buffers can also be used as long as the buffer components are
non-inhibitory to enzyme components of the methods of the
invention. The pH is preferably from about 5 to about 11, more
preferably from about 6 to about 10, even more preferably from
about 7 to about 9, and most preferably from about 7.5 to about
8.5. The reaction medium can also include bivalent metal ions such
as Mg.sup.2+ or Mn.sup.2+, at a final concentration of free ions
that is within the range of from about 0.01 to about 15 mM, and
most preferably from about to 10 mM. The reaction medium can also
include other salts, such as KCl or NaCl, that contribute to the
total ionic strength of the medium. For example, the range of a
salt such as KCl is preferably from about 0 to about 125 mM, more
preferably from about 0 to about 100 mM, and most preferably from
about 0 to about 75 mM. The reaction medium can further include
additives that could affect performance of the amplification
reactions, but that are not integral to the activity of the enzyme
components of the methods. Such additives include proteins such as
BSA, single strand binding proteins (for e.g., T4 gene 32 protein),
and non-ionic detergents such as NP40 or Triton. Reagents, such as
DTT, that are capable of maintaining enzyme activities can also be
included. Such reagents are known in the art. Where appropriate, an
RNase inhibitor (such as Rnasin) that does not inhibit the activity
of the RNase employed in the method can also be included. Any
aspect of the methods of the invention can occur at the same or
varying temperatures. Preferably, the amplification reactions
(particularly, primer extension other than the first and second
strand cDNA synthesis steps, and strand displacement) are performed
isothermally, which avoids the cumbersome thermocycling process.
The amplification reaction is carried out at a temperature that
permits hybridization of the oligonucleotides (primer and/or PTO)
of the invention to the template polynucleotide and primer
extension products, and that does not substantially inhibit the
activity of the enzymes employed. The temperature can be in the
range of preferably about 25.degree. C. to about 85.degree. C.,
more preferably about 30.degree. C. to about 80.degree. C., and
most preferably about 37.degree. C. to about 75.degree. C. In some
embodiments that include RNA transcription, the temperature for the
transcription steps is lower than the temperature(s) for the
preceding steps. In these embodiments, the temperature of the
transcription steps can be in the range of preferably about
25.degree. C. to about 85.degree. C., more preferably about
30.degree. C. to about 75.degree. C., and most preferably about
37.degree. C. to about 70.degree. C.
[0269] Nucleotide and/or nucleotide analogs, such as
deoxyribonucleoside triphosphates, that can be employed for
synthesis of the primer extension products in the methods of the
invention are provided in the amount of from preferably about 50 to
about 2500 .mu.M, more preferably about 100 to about 2000 .mu.M,
even more preferably about 200 to about 1700 .mu.M, and most
preferably about 250 to about 1500 .mu.M. In some embodiments, a
nucleotide or nucleotide analog whose presence in the primer
extension strand enhances displacement of the strand (for example,
by causing base pairing that is weaker than conventional AT, CG
base pairing) is included. Such nucleotide or nucleotide analogs
include deoxyinosine and other modified bases, all of which are
known in the art. Nucleotides and/or analogs, such as
ribonucleoside triphosphates, that can be employed for synthesis of
the RNA transcripts in the methods of the invention are provided in
the amount of from preferably about 0.25 to about 6 mM, more
preferably about 0.5 to about 5 mM, even more preferably about 0.75
to about 4 mM, and most preferably about 1 to about 3 mM.
[0270] The oligonucleotide components of the amplification
reactions of the invention are generally in excess of the number of
target nucleic acid sequence to be amplified. They can be provided
at about or at least about any of the following: 10, 10.sup.2,
10.sup.4, 10.sup.6, 10.sup.8, 10.sup.10, 10.sup.12 times the amount
of target nucleic acid. Composite primers and PTO can each be
provided at about or at least about any of the following
concentrations: 50 nM, 100 nM, 500 nM, 1000 nM, 2500 nM, 5000
nM.
[0271] In one embodiment, the foregoing components are added
simultaneously at the initiation of the amplification process. In
another embodiment, components are added in any order prior to or
after appropriate timepoints during the amplification process, as
required and/or permitted by the amplification reaction. Such
timepoints, some of which are noted below, can be readily
identified by a person of skill in the art. The enzymes used for
nucleic acid amplification according to the methods of the
invention can be added to the reaction mixture either prior to the
target nucleic acid denaturation step, following the denaturation
step, or following hybridization of the primer to the target RNA,
as determined by their thermal stability and/or other
considerations known to the person of skill in the art. The first
strand cDNA (composite primer extension product) and the second
strand cDNA (second primer extension product) synthesis reactions
can be performed consecutively, followed by the amplification steps
(binding by another composite primer, primer extension and strand
displacement). In these embodiments, the reaction conditions and
components may be varied between the different reactions.
[0272] The amplification process can be stopped at various
timepoints, and resumed at a later time. Said timepoints can be
readily identified by a person of skill in the art. One timepoint
is at the end of first strand cDNA synthesis. Another timepoint is
at the end of second strand cDNA synthesis. Methods for stopping
the reactions are known in the art, including, for example, cooling
the reaction mixture to a temperature that inhibits enzyme activity
or heating the reaction mixture to a temperature that destroys an
enzyme. Methods for resuming the reactions are also known in the
art, including, for example, raising the temperature of the
reaction mixture to a temperature that permits enzyme activity or
replenishing a destroyed (depleted) enzyme. In some embodiments,
one or more of the components of the reactions is replenished prior
to, at, or following the resumption of the reactions. For example,
it may be necessary to replenish the composite primer prior to
beginning the linear amplification reaction if the same composite
primer is being used. Alternatively, the reaction can be allowed to
proceed (i.e., from start to finish) without interruption.
[0273] The reaction can be allowed to proceed without purification
of intermediate complexes, for example, to remove primer. Products
can be purified at various timepoints, which can be readily
identified by a person of skill in the art. One timepoint is at the
end of first strand cDNA synthesis. Another timepoint is at the end
of second strand cDNA synthesis. We have observed that routine
purification of the complex of first and second cDNA results in
slightly higher amplification efficiency in subsequent linear
amplification steps.
[0274] The detection of the amplification product is indicative of
the presence of the target sequence. Quantitative analysis is also
feasible. Direct and indirect detection methods (including
quantitation) are well known in the art. For example, by comparing
the amount of product amplified from a test sample containing an
unknown amount of a polynucleotide containing a target sequence to
the product of amplification of a reference sample that has a known
quantity of a polynucleotide that contains the target sequence, the
amount of target sequence in the test sample can be determined. The
amplification methods of the invention can also be extended to
analysis of sequence alterations and sequencing of the target
nucleic acid. Further, detection could be effected by, for example,
examination of translation products from RNA amplification
products.
[0275] Compositions and Kits of the Invention
[0276] The invention also provides compositions and kits used in
the methods described herein. The compositions may be any
component(s), reaction mixture and/or intermediate described
herein, as well as any combination. For example, the invention
provides a composition comprising a composite primer and a second
primer, wherein the second primer is a random primer. In some
embodiments, the second primer comprises DNA. In other embodiments,
the second primer consists of DNA. In still another example, the
composition comprises a composite primer and a second primer that
comprises a non-target sequence that is included for the purpose of
generating displaced primer extension products to which a
propromoter polynucleotide can hybridize. This second primer may
also be a random primer.
[0277] In some embodiments, the composite primer comprises an RNA
portion adjacent to the DNA portion. In another embodiment, the
composite primer comprises 5'- and 3'-DNA portions with at least
one intervening RNA portion. In other embodiments, the composite
primer comprises a poly-dT portion. In another example, the
invention comprises a composite primer that is a random primer. In
some embodiments, the random composite primer or composite primer
comprising a poly-dT portion further comprise a portion not
hybridizable to a target (under conditions where a portion of the
primer hybridizes to target). In other examples, the invention
provides a composition comprising a composite primer that is
further derivatized by attachment of a moiety capable of effecting
attachment of a polynucleotide comprising the composite primer to a
solid substrate used in preparing nucleic acid microarrays. In some
embodiments, the composite primer is further derivatized by
attachment of a positively charged moiety such as an amine.
[0278] In some embodiments, the invention provides a composition
comprising a composite primer and a polynucleotide comprising a
propromoter sequence, such as a PTO (i.e., any of those embodiments
described herein). With respect to compositions containing a random
primer, these compositions may also contain a plurality of random
primers (i.e., a population of random primers having different
sequences).
[0279] In certain embodiments, the composition comprises (a) a
composite primer; (b) a second primer (which can be a random
primer); and (c) a reverse transcriptase. In yet other embodiments,
the composition comprises (a) a composite primer; (b) a second
primer (which can be a random primer); (c) a reverse transcriptase;
and (d) a DNA polymerase. In some embodiments, the composition
comprises (a) a composite primer, (b) a second primer (which can be
a random primer); and (c) a polynucleotide comprising a propromoter
sequence (which can be a PTO). Any of the above compositions may
further comprise target RNA (which comprises an RNA sequence of
interest) and/or any of the enzymes described herein (such as DNA
polymerase, for example, reverse transcriptase, RNase H, and/or RNA
polymerase). The compositions are generally in lyophilized or
aqueous form, preferably in a suitable buffer.
[0280] The invention also provides compositions comprising the
amplification products described herein. Accordingly, the invention
provides a population of DNA or RNA molecules which are copies or
the complement of a target sequence, which are produced by any of
the methods described herein (or compositions comprising the
products).
[0281] In another aspect, the invention provides a population of
sense polynucleotide (preferably, DNA) molecules and antisense
polynucleotide (preferably, DNA) molecules which are copies and
complements of a target sequence, which are produced by any of the
methods described herein. The invention also includes compositions
and various configurations (such as arrays) of these populations,
which may be homogeneous (same sequence) or heterogeneous
(different sequence). These populations may be any assembly of
sequences obtained from the methods described herein, including
based on mRNA, as well as certain species or classes of mRNA.
[0282] The compositions are generally in a suitable medium,
although they can be in lyophilized form. Suitable media include,
but are not limited to, aqueous media (such as pure water or
buffers).
[0283] The invention provides kits for carrying out the methods of
the invention. Accordingly, a variety of kits are provided in
suitable packaging. The kits may be used for any one or more of the
uses described herein, and, accordingly, may contain instructions
for any one or more of the following uses: amplifying an RNA
sequence; sequencing of an RNA sequence of interest; detection of
sequence mutation based on amplifying an RNA sequence (e.g.,
genotyping or nucleic acid mutation detection); determining
presence or absence of a sequence of interest; methods of
expression profiling; methods of subtractive hybridization; methods
of preparing a subtractive hybridization probe; methods of
differential amplification; methods ofpreparation of libraries
(including cDNA and differential expression libraries); methods of
preparation of an immobilized nucleic acid (which can be a nucleic
acid immobilized on a microarray), and methods of characterizing
amplified nucleic acid products generated by the methods of the
invention.
[0284] The kits of the invention comprise one or more containers
comprising any combination of the components described herein, and
the following are examples of such kits. A kit may comprise any of
the composite primers described herein. In some embodiments, a kit
comprises two or more composite primers and second primers, which
may or may not be separately packaged. A kit may comprise a
composite primer and a polynucleotide comprising a propromoter
sequence (which may be a PTO). A kit may further comprise a second
primer (which can be a random primer). The composite primer may be
labeled or unlabeled. Kits may also optionally further include any
of one or more of the enzymes described herein (for example,
RNA-dependent DNA polymerase such as reverse transcriptase, and
ribonuclease such as RNase H), as well as deoxynucleoside
triphosphates (labeled or unlabeled) and/or ribonucleoside
triphosphates (labeled or unlabeled). Kits may also include one or
more suitable buffers (as described herein). Kits useful for
nucleic acid sequencing may optionally include labeled or unlabeled
nucleotide analogs that upon incorporation into a primer extension
product or RNA transcript effect termination of nucleotide
polymerization. One or more reagents in the kit can be provided as
a dry powder, usually lyophilized, including excipients, which on
dissolution will provide for a reagent solution having the
appropriate concentrations for performing any of the methods
described herein. Each component can be packaged in separate
containers or some components can be combined in one container
where cross-reactivity and shelf life pernit.
[0285] The kits of the invention may optionally include a set of
instructions, generally written instructions, although electronic
storage media (e.g., magnetic diskette or optical disk) containing:
instructions are also acceptable, relating to the use of components
of the methods of the invention for the intended nucleic acid
amplification, and/or, as appropriate, for using the amplification
products for purposes such as nucleic acid sequencing and detection
of sequence mutation. The instructions included with the kit
generally include information as to reagents (whether included or
not in the kit) necessary for practicing the methods of the
invention, instructions on how to use the kit, and/or appropriate
reaction conditions. For example, kits of the invention can
comprise: a composite primer (which can comprise a poly-dT portion
and/or can be a random primer), a second primer (which can be a
random primer), and instructions for using the primers to amplify
RNA according to methods of the invention. In another example, kits
of the invention comprise a composite primer (which can comprise a
poly-dT portion and/or can be a random primer), and instructions
for using the primers to amplify RNA according methods of the
invention. In another example, kits of the invention comprise: a
composite primer, a second primer (which can be a random primer),
and instructions for generating double stranded complementary DNA
from an RNA target and/or amplifying RNA according to methods of
the invention. In yet another example, any of these kits further
comprises a propromoter polynucleotide, and instructions for
producing a duplex of primer extension product and the propromoter
polynucleotide such that a double stranded promoter region is
generated and/or amplifying RNA according to methods of the
invention. In another example, kits of the invention comprise a
composite primer (which can comprise a poly-dT portion, and/or can
be a random primer) capable of generating a first strand cDNA, a
second composite primer capable of hybridizing to a first strand
cDNA, and instructions for using the primers to generate double
stranded cDNA according to any of the methods of the invention. In
another example, the kits of the invention comprise a double
stranded cDNA complex (comprising first and second strand cDNA)
comprising a 3' single stranded DNA portion. In yet another
example, any of these kits further comprises one or more controls
(which can be, for example, RNA template, composite primers, and/or
double stranded cDNA complex (comprising first and second strand
cDNA) coinprising a 3' single stranded DNA portion).
[0286] The component(s) of the kit may be packaged in any
convenient, appropriate packaging. The components may be packaged
separately, or in one or multiple combinations. Where kits are
provided for practicing amplification methods of the invention that
involve transcription, the RNA polymerase (if included) is
preferably provided separately from the components used in the
steps prior to the transcription steps.
[0287] The relative amounts of the various components in the kits
can be varied widely to provide for concentrations of the reagents
that substantially optimize the reactions that need to occur to
practice the methods disclosed herein and/or to further optimize
the sensitivity of any assay.
[0288] The invention also provides systems for effecting the
methods described herein. These systems comprise various
combinations of the components discussed above. For example, in
some embodiments, the invention provides a system suitable for
producing target polynucleotide sequence (or amplifying target
polynucleotide sequence) comprising (a) a composite primer (any of
those described herein), (b) DNA polymerase; and (c) ribonuclease.
In some embodiments, the system further comprises a polynucleotide
comprising a propromoter sequence (which may be a PTO) and a
DNA-dependent RNA polymerase. In other embodiments, the system
further comprises an RNA-dependent DNA polymerase. Any of the
systems embodiments may also comprise a template (target) sequence,
as described herein. A system generally includes one or more
apparatuses for performing the amplification methods of the
invention. Such apparatuses include, for example, heating devices
(such as heating blocks or water baths) and apparatuses which
effect automation of one or more steps of the methods described
herein. The methods of the invention are particularly suitable for
use with miniaturized devices, as thermal cycling is not required
for any of the steps. A non-limiting example of suitable devices
includes the BioAnalyzer (Agilant and Caliper) and the eSensor.
[0289] The invention also provides reaction mixtures (or
compositions comprising reaction mixtures) which contain various
combinations of components described herein. Examples of reaction
mixtures have been described. In some embodiments, the invention
provides reaction mixtures comprising (a) a target RNA; (b) a
composite primer comprising a 3' DNA portion and an RNA portion;
(c) a second primer; and (d) DNA polymerase. As described herein,
any of the composite primers may be in the reaction mixture (or a
plurality of composite primers), including a composite primer that
comprises a 5' RNA portion which is adjacent to the 3' DNA portion.
The reaction mixture could also further comprise an enzyme which
cleaves RNA from an RNA/DNA hybrid, such as RNase H. A reaction
mixture of the invention can also further comprise a polynucleotide
comprising a propromoter sequence as described herein. Another
example of a reaction mixture is (a) a displaced primer extension
product (and, as such, contains at its 5' end a sequence
complementary to the 3' DNA portion of the composite primer, but
not a sequence complementary to the RNA portion of the composite
primer); (b) a polynucleotide comprising a propromoter sequence
(for example, a PTO); and (c) RNA polymerase. Other reaction
mixtures are described herein and are encompassed by the
invention.
[0290] The invention also includes compositions comprising any of
the complexes (which are intermediates in the methods described
herein) described herein. Examples of such complexes are
schematically depicted in FIGS. 1-8. As an example, one complex of
the invention is a complex comprising: (a) a target RNA strand; and
(b) a composite primer, said composite primer comprising a 3' DNA
portion and an RNA portion. The composite primer may have an RNA
portion which is 5' and adjacent to the 3' DNA portion. As another
example, a complex of the invention is a complex comprising: (a) a
composite primer extension product; and (b) a target RNA strand. In
still another example, a complex of the invention is a complex
comprising: (a) a first primer extension product, wherein the first
primer is a composite primer comprising an RNA portion and a 3' DNA
portion; and (b) a second primer. In again another example, a
complex of the invention is a complex comprising: (a) a first
primer extension product, wherein the first primer is a composite
primer comprising an RNA portion and a 3' DNA portion; and (b) a
second primer extension product. In yet another example, a complex
of the invention is a complex comprising: (a) a displaced primer
extension product, wherein the primer is a composite primer
comprising an RNA portion and a 3' DNA portion; and (b) a
propromoter polynucleotide (such as a PTO).
[0291] In yet another example, a complex of the invention is a
double stranded cDNA complex further comprising a RNA/DNA portion
at one end, prepared by any of the methods described herein. In
some embodiments, the double stranded cDNA complex further
comprises a second RNA/DNA portion at a second end. In yet another
example, the complex of the invention is a first and second primer
extension product comprising a 3' single stranded DNA portion
comprising a 3' single stranded DNA portion produced by any of the
methods described herein. In some embodiments, the composition
further comprises a second 3' single stranded region. In another
example, the complex of the invention is (a) a complex of first and
second primer extension product comprising a 3' single stranded DNA
portion, and (b) a composite primer hybridized to second primer
extension product. In another example, the complex of the invention
is a complex of a first strand cDNA and a second strand cDNA (that
is generated by extension along first strand cDNA of a primer). In
some embodiments, the primer comprises a fragment of template RNA
hybridized to the first strand cDNA. In some embodiment, the primer
is DNA.
[0292] Methods Using the Amplifcation Methods and Compositions of
the Invention
[0293] The methods and compositions of the invention can be used
for a variety of purposes. For purposes of illustration, methods of
sequencing, genotyping (nucleic acid mutation detection),
determining the presence or absence of a sequence of interest,
preparation of an immobilized nucleic acid (which can be a nucleic
acid immobilized on a microarray), and characterizing nucleic acids
using the amplified nucleic acid products generated by the methods
of the invention, are described. Methods of expression profiling,
methods of subtractive hybridization and the preparation of probes
for subtractive hybridization, and methods of preparing libraries
(which can be cDNA and/or differential hybridization libraries) are
also described.
[0294] Sequencing of RNA Targets Using the Methods of the
Invention
[0295] The amplification methods of the invention are useful, for
example, for sequencing of an RNA sequence of interest. The
sequencing process is carried out by amplifying a target RNA
containing the sequence of interest by any of the methods described
herein. Addition of nucleotides during primer extension is analyzed
using methods known in the art, for example, incorporation of a
terminator nucleotide or sequencing by synthesis (e.g.
pyrosequencing).
[0296] In embodiments wherein the end product is in the form of
displaced DNA primer extension products, in addition to the
nucleotides, such as natural deoxyribonucleotide triphosphates
(dNTPs), that are used in the amplification methods, appropriate
nucleotide triphosphate analogs, which may be labeled or unlabeled,
that upon incorporation into a primer extension product effect
termination of primer extension, may be added to the reaction
mixture. Preferably, the dNTP analogs are added after a sufficient
amount of reaction time has elapsed since the initiation of the
amplification reaction such that a desired amount of second primer
extension product or fragment extension product has been generated.
Said amount of the time can be determined empirically by one
skilled in the art.
[0297] In embodiments wherein the end product is in the form of RNA
products, sequencing can be based on premature (deliberate)
termination of RNA transcription. The inclusion of rNTP analogs,
which may be labeled or unlabeled, that upon incorporation into an
RNA transcript effects termination of rNTP polymerization in the
reaction mixture, will result in production of truncated RNA
products, which result from blocking of the RNA polymerase at sites
of incorporation of the analogs.
[0298] Suitable analogs (dNTP and rNTP) include those commonly used
in other sequencing methods and are well known in the art. Examples
of dNTP analogs include dideoxyribonucleotides. Examples of rNTP
analogs (such as RNA polymerase terminators) include 3'-dNTP.
Sasaki et al., Biochemistry (1998) 95:3455-3460. These analogs may
be labeled, for example, with fluorochromes or radioisotopes. The
labels may also be labels which are suitable for mass spectroscopy.
The label may also be a small molecule which is a member of a
specific binding pair, and can be detected following binding of the
other member of the specific binding pair, such as biotin and
streptavidin, respectively, with the last member of the binding
pair conjugated to an enzyme that catalyzes the generation of a
detectable signal that could be detected by methods such as
colorimetry, fluorometry or chemiluminescence. All of the above
examples are well known in the art. These are incorporated into the
primer extension product or RNA transcripts by the polymerase and
serve to stop further extension along a template sequence. The
resulting truncated polymerization products are labeled. The
accumulated truncated products vary in length, according to the
site of incorporation of each of the analogs, which represent the
various sequence locations of a complementary nucleotide on the
template sequence.
[0299] Analysis of the reaction products for elucidation of
sequence information can be carried out using any of various
methods known in the: art. Such methods include gel electrophoresis
and detection of the labeled bands using appropriate scanner,
sequencing gel electrophoresis and detection of the radiolabeled
band directly by phosphorescence such as Molecular Dynamics reader,
capillary electrophoresis adapted with a detector specific for the
labels used in the reaction, and the like. The label can also be a
ligand for a binding protein which is used for detection of the
label in combination with an enzyme conjugated to the binding
protein, such as biotin-labeled chain terminator and streptavidin
conjugated to an enzyme. The label is detected by the enzymatic
activity of the enzyme, which generates a detectable signal. As
with other sequencing methods known in the art, the sequencing
reactions for the various nucleotide types (A, C, G, T or U) are
carried out either in a single reaction vessel, or in separate
reaction vessels (each representing 1 of the various nucleotide
types). The choice of method to be used is dependent on practical
considerations readily apparent to one skilled in the art, such as
the nucleotide tri phosphate analogs and/or label used. Thus, for
example, when each of the analogs is differentially labeled, the
sequencing reaction can be carried out in a single vessel. The
considerations for choice of reagent and reaction conditions for
optimal performance of sequencing analysis according to the methods
of the invention are similar to those for other previously
described sequencing methods. The reagent and reaction conditions
should be as described above for the nucleic acid amplification
methods of the invention.
[0300] Mutation Detection, Including Mutation Detection Based on
Single Stranded Conformation Polymorphism Utilizing the
Amplification Methods of the Invention
[0301] The DNA or RNA amplification products generated according to
the methods of the invention are also suitable for analysis for the
detection of any alteration in the target nucleic acid sequence, as
compared to a reference nucleic acid sequence which is identical to
the target nucleic acid sequence other than the sequence
alteration. The sequence alterations may be sequence alterations
present in the genomic sequence or may be sequence alterations
which are not reflected in the genomic DNA sequences, for example,
alterations due to post transcriptional alterations, and/or mRNA
processing, including splice variants. Sequence alterations
(interchangeably called "mutations") include deletion,
substitution, insertion and/or transversion of one or more
nucleotide.
[0302] The DNA or RNA products of the amplification methods are
suitable for single stranded conformation polymorphism (SSCP or
rSSCP) based mutation detection. The amplification methods of the
invention can be directly linked to appropriate means for detecting
single stranded conformation polymorphism, such as an
electrophoretic separation method for the identification of
specific mobility pattern of the single stranded DNA or RNA
products for the elucidation of the presence of specific sequence
feature(s), and/or the presence of any difference in a test nucleic
acid as compared to a reference nucleic acid.
[0303] Methods based on gel electrophoresis or capillary
electrophoresis can be used for the detection and analysis of the
various single stranded conformational isomers. Alternatively, it
is also likely that cleavage of the single stranded DNA or RNA
product using nucleases which recognize sequence dependent
secondary structures may be useful for the determination of
sequence specific conformation polymorphism. Such nucleases are
known in the art, such as the Cleavase assay (Third Wave). The
electrophoretic methods are potentially more suitable for high
throughput mutation, or genotyping, detection methods.
[0304] The determination of sequence specific electrophoretic
pattern for a given nucleic acid sequence is useful for, for
example, the detection of specific alleles of a test sequence.
Furthermore, it is expected that an electrophoretic mobility
pattern for the various alleles could be well differentiated, thus
allowing the detection of two alleles in a nucleic acid sample from
a single individual, as required for heterozygous genotype, or
multiple alleles. Any alteration in the test nucleic acid sequence,
such as base substitution, insertions or deletion, could be
detected using this method. The method is expected to be useful for
detection of specific single base polymorphism, SNP, and the
discovery of new SNPs. Thus, the invention also provides methods
for detecting a polynucleotide comprising a single nucleotide
polymorphism, comprising: (a) amplifying a target polynucleotide
using any of the methods described herein; and (b) analyzing the
amplification products for single stranded conformation, wherein a
difference in conformation as compared to a reference single
stranded polynucleotide indicates a single nucleotide polymorphism
in the target polynucleotide, whereby a polynucleotide comprising a
single nucleotide polymorphism is detected.
[0305] Other art recognized methods of analysis for the detection
of any alteration in the target nucleic acid sequence, as compared
to a reference nucleic acid sequence, are suitable for use with the
single stranded nucleic acid products of the amplification methods
of the invention. Such methods are well-known in the art, and
include various methods for the detection of specific defined
sequences including methods based on allele specific primer
extension, allele specific probe ligation, differential probe
hybridization, and limited primer extension. See, for example, Kurn
et al, U.S. Pat. No. 6,251,639 B1; U.S. Pat. Nos. 5,888,819;
6,004,744; 5,882,867; 5, 854, 033; 5,710,028; 6,027,889; 6,004,745;
5,763,178; 5,011,769; 5,185,243; 4,876,187; 5,882,867; 5,731,146;
WO US88/02746; WO 99/55912; WO92/15712; WO 00/09745; WO 97/32040;
WO 00/56925; and 5,660,988. Thus, the invention also provides
methods for detection of a mutation in an RNA sequence of interest
comprising a single nucleotide polymorphism, comprising: (a)
amplifying a target RNA using any of the methods described herein;
and (b) analyzing the amplification products for presence of an
alteration (mutation) as compared to a reference single stranded
polynucleotide.
[0306] Methods of Determining the Presence or Absence of a Sequence
of Interest
[0307] The unique properties of the second composite primer for use
in the isothermal amplification methods of the invention provide
the basis for an isothermal method for the detection of defined
mutations (defined in the sense that location of the mutation is
defined), or polymorphic sites (such as SNPs), in a target nucleic
acid sequence. The method is useful for genotyping, detection of
mutation leading to drug resistance and the like.
[0308] The RNA portion(s) of the composite primer is designed to be
hybridizable to the sequence of the test target RNA in which the
presence of a sequence alteration is suspected. Stated
alternatively, the primer comprises an RNA portion(s) that
comprises a sequence that is hybridizable to the reference RNA
sequence (for example, a wild type sequence) against which the
sequence in the test target RNA is to be compared. In some
embodiments, the altered sequence (i.e., the sequence comprising a
sequence alteration) and the reference sequence are alleles. The
sequence alteration may be a single nucleotide substitution, a
deletion or insertion.
[0309] In another embodiment, the RNA portion(s) of the composite
primer is designed to be hybridizable to the altered sequence
suspected to be present in the test target RNA. Stated
alternatively, the primer comprises an RNA portion(s) that
comprises a sequence that is hybridizable to the test target RNA,
and thus is not hybridizable to the reference sequence (for
example, a wild type sequence) against which the sequence in the
test target RNA is to be compared. In some embodiments, the altered
sequence (i.e., the sequence comprising a sequence alteration) and
the reference sequence are alleles.
[0310] The RNA portion, generally 5' RNA portion, of the composite
primer comprises a sequence which is hybridizable to a known normal
wild type sequence, or a known mutant or a polymorphic genotype.
Generally, a suitable composite primer comprises an RNA portion
that allows the primer to preferentially hybridize to a target
nucleic acid if the target nucleic sequence comprises a sequence
hybridizable to the RNA portion of the primer compared to if there
is a mismatch (i.e., the primer has the mutated sequence and the
target does not, or vice versa); wherein the target nucleic acid
has a bound primer extension product and has had its 5'-RNA portion
cleaved. The presence of sequence alteration does not generally
prevent the initial step of the amplification methods, such that a
double stranded complex of first and second primer extension
products comprising RNA/DNA heteroduplex. A ribonuclease, such as
RNase H, then cleaves the RNA portion of theRNA/DNA heteroduplex.
While it is likely that the presence of a mismatched base pair will
affect the pattern of cleavage of the RNA/DNA hybrid, the cleavage
is nonetheless likely to take place. The next step of binding of
another composite primer to the complex by hybridization of the 5'
RNA portion will be inhibited, preferably prevented, by a mismatch.
This effect is dependent on factors such as the size of the
hybridizing oligonucleotide and the stringency of the reaction
condition. These factors are considered in the design of the
composite primer, according to techniques well known and routine in
the art. It is also possible that the mismatch will inhibit
cleavage of the RNA portion(s) of the composite primer, thus
preventing the amplification of the second primer extension
product. Another possibility is that the mismatch will result in
lower efficiency of cleavage of the RNA portion of the primer thus
resulting in lower efficiency of amplification or production of
less amplification product. The inability of the composite primer
to hybridize to the target at this step of the amplification
prevents further steps of primer extension strand displacement and
production of multiple copies of the amplification products. It is
understood that the detection of mutation by the methods of the
present invention can be based on absence or presence of single
stranded amplification products, or quantitative comparisons of
amount of accumulated primer extension product. For example, when
the composite primer comprises the reference sequence (for example,
wild type), the presence of a mutation in a target strand may lead
to no detectable amplification products; alternatively, it may lead
to detectable products, but less than those produced from a
template strand without the mutation.
[0311] When the composite primer comprises an RNA portion,
generally a 5' RNA portion, that is fully hybridizable to a mutant
genotype, amplification of a sequence which is of the normal
genotype will be prevented, while a mutant genotype target will be
amplified. Thus, in this case the detection and/or quantitative
determination of multiple copies of the amplification product will
be indicative of the presence of a target sequence of the mutant
genotype. For example, parallel reactions that include either the
nucleic acid sample of interest or reference sample of target
nucleic with a wild type sequence could be run. Accumulation of
more primer extension products in the former compared to the latter
reaction would be indicative of the presence of a mutant genotype
in the sample of interest. Alternatively, when the composite primer
comprises a 5' RNA sequence that is fully hybridizable to a normal
genotype sequence of the test target, amplification of a target
sequence of the mutant genotype is prevented, and the detection
and/or quantitative determination of amplification products is
indicative of a normal genotype.
[0312] Any of the amplification methods of the present invention
are suitable for detection of mutation as described above.
[0313] Accordingly, the invention provides a method of determining
presence or absence of a sequence of interest said method
comprising (i) amplifying a target.
[0314] RNA containing the sequence of interest, said amplification
comprising extending a composite primer hybridized to cleaved
complex of first and second primer extension product prepared by
any of the methods described herein, wherein the sequence of the
RNA portion of the composite primer is known, and (ii) comparing
the amplification products if any from step (i) with the amount of
amplification products from a reference template wherein (1)
production of detectably fewer amplification products from the
template as compared to the amount of amplification products from
the reference template which comprises a region hybridizable to the
RNA portion of the composite primer indicates that the second
primer extension product does not comprise a sequence hybridizable
to the RNA portion of the composite primer and is a sequence
variant with respect to the sequence hybridizable to the RNA
portion of the composite primer; or (2) production of detectably
more amplification products from the template as compared to the
amount of amplification products from the reference template which
does not comprise a region which is hybridizable to the RNA portion
of the composite primer indicates that the second primer extension
product comprises a sequence hybridizable to the RNA portion of the
composite primer and is not a sequence variant with respect to the
sequence hybridizable to the RNA portion of the composite
primer.
[0315] Method of Preparing Nucleic Acids Immoblized to a Substrate,
Including a Microarray of Nucleic Acids
[0316] The single stranded products of some of the amplification
methods of the invention are suitable for immobilizing to a
surface. The single stranded products are particularly suitable for
preparng microarrays comprising the single stranded amplification
products.
[0317] Single stranded amplification products can be attached to a
solid or semi-solid support or surface, which may be made, e.g.,
from glass, plastic (e.g., polystyrene, polypropylene, nylon),
polyacrylamide, nitrocellulose, or other materials.
[0318] Several techniques are well-known in the art for attaching
nucleic acids to a solid substrate such as a glass slide. One
method is to incorporate modified bases or analogs that contain a
moiety that is capable of attachment to a solid substrate, such as
an amine group, a derivative of an amine group or another group
with a positive charge, into the amplified nucleic acids. The
amplified product is then contacted with a solid substrate, such as
a glass slide, which is coated with an aldehyde or another reactive
group which will form a covalent link with the reactive group that
is on the amplified product and become covalently attached to the
glass slide. Microarrays comprising the amplified products can be
fabricated using a Biodot (BioDot, Inc. Irvine, Calif.) spotting
apparatus and aldehyde-coated glass slides (CEL Associates,
Houston, Tex.). Amplification products can be spotted onto the
aldehyde-coated slides, and processed according to published
procedures (Schena et al., Proc. Natl. Acad. Sci. U.S.A. (1995)
93:10614-10619). Arrays can also be printed by robotics onto glass,
nylon (Ramsay, G., Nature Biotechnol. (1998), 16:40-44),
polypropylene (Matson, et al., Anal Biochem. (1995), 224(1):110-6),
and silicone slides (Marshall, A. and Hodgson, J., Nature
Biotechnol. (1998), 16:27-31). Other approaches to array assembly
include fine micropipetting within electric fields (Marshall and
Hodgson, supra), and spotting the polynucleotides directly onto
positively coated plates. Methods such as those using amino propyl
silicon surface chemistry are also known in the art, as disclosed
at http://www.cmt.corning.com and
http://cmgm.stanford.edu/pbrown/.
[0319] One method for making microarrays is by making high-density
polynucleotide arrays. Techniques are known for rapid deposition of
polynucleotides (Blanchard et al., Biosensors & Bioelectronics,
11:687-690). Other methods for making microarrays, e.g., by masking
(Maskos and Southern, Nuc. Acids. Res. (1992), 20:1679-1684), may
also be used. In principle, and as noted above, any type of array,
for example, dot blots on a nylon hybridization membrane, could be
used. However, as will be recognized by those skilled in the art,
very small arrays will frequently be preferred because
hybridization volumes will be smaller.
[0320] The amplified polynucleotides may be spotted as a matrix on
substrates comprising paper, glass, plastic, polystyrene,
polypropylene, nylon, polyacrylamide, nitrocellulose, silicon,
optical fiber or any other suitable solid or semi-solid (e.g., thin
layer of polyacrylamide gel (Khrapko, et al., DNA Sequence (1991),
1:375-388) surface.
[0321] An array may be assembled as a two-dimensional matrix on a
planar substrate or may have a three-dimensional configuration
comprising pins; rods, fibers, tapes, threads, beads, particles,
microtiter wells, capillaries, cylinders and any other arrangement
suitable for hybridization and detection of target molecules. In
one embodiment the substrate to which the amplification products
are attached is magnetic beads or particles. In another embodiment,
the solid substrate comprises an optical fiber. In yet another
embodiment, the amplification products are dispersed in fluid phase
within a capillary which, in turn, is immobilized with respect to a
solid phase.
[0322] Characterization of Nucleic Acids
[0323] The amplification products obtained by the methods of the
invention are amenable to further characterization. The single
stranded nature of some products of the methods facilitates
characterization. The methods of the invention producing single
stranded products are particularly amenable to quantitative
analysis, as sufficient single stranded DNA and RNA products are
produced which generally accurately reflect the representation of
the various mRNA in the starting material.
[0324] The amplified polynucleotide products, either DNA or RNA
(i.e., products of any of the amplification methods described
herein), can be analyzed using, for example, probe hybridization
techniques known in the art, such as Southern and Northern
blotting, and hybridizing to probe arrays. They can also be
analyzed by electrophoresis-based methods, such as differential
display and size characterization, which are known in the art. In
addition, the single stranded DNA and RNA products may serve as
starting material for other starting material for other analytical
and/or quantification methods known in the art, such as real time
PCR, quantitative TaqMan, quantitative PCR using molecular beacons,
methods described in Kurn, U.S. Pat. No. 6,251,639, etc. Thus, the
invention includes those further analytical and/or quantification
methods as applied to any of the products of the methods
herein.
[0325] In one embodiment, the amplification methods of the
invention are utilized to generate multiple copies of single
stranded products, and analyzing single stranded products by
contact with a probe.
[0326] In one embodiment, the amplification methods of the
invention are utilized to generate multiple copies of single
stranded polynucleotide (generally, DNA) products that are labeled
by using composite primers that are labeled (in the portion(s) that
is not cleaved). In another embodiment, the amplification methods
of the invention are utilized to generate multiple copies of single
stranded polynucleotide (DNA or RNA) products that are labeled by
the incorporation of labeled nucleotides during DNA or RNA
polymerization. For example, amplification according to the methods
of the invention can be carried out with suitable labeled dNTPs or
rNTPs. These labeled nucleotides can be directly attached to a
label, or can comprise a moiety which could be attached to a label.
The label may be attached covalently or non-covalently to the
amplification products. Suitable labels are known in the art, and
include, for example, a ligand which is a member of a specific
binding pair which can be detected/quantified using a detectable
second member of the binding pair. Thus, amplification of total
mRNA according to the methods of the invention in the presence of,
for example, Cy3-dUTP or Cy5-dUTP results in the incorporation of
these nucleotides into the amplification products.
[0327] The labeled amplified products are particularly suitable for
analysis (for example, detection and/or quantification) by
contacting them with, for example, microarrays (of any suitable
surface, which includes glass, chips, plastic), beads, or
particles, that comprise suitable probes such as cDNA and/or
oligonucleotide probes. Thus, the invention provides methods to
characterize (for example, detect and/or quantify) an RNA sequence
of interest by generating labeled polynucleotide (generally, DNA or
RNA) products using amplification methods of the invention, and
analyzing the labeled products. Analysis of labeled products can be
performed by, for example, hybridization of the labeled
amplification products to, for example, probes immobilized at, for
example, specific locations on a solid or semi-solid substrate,
probes immobilized on defined particles, or probes immobilized on
blots (such as a membrane), for example arrays, which have been
described above. Other methods of analyzing labeled products are
known in the art, such as, for example, by contacting them with a
solution comprising probes, followed by extraction of complexes
comprising the labeled amplification products and probes from
solution. The identity of the probes provides characterization of
the sequence identity of the amplified products, and thus by
extrapolation the identity of the target RNA present in a sample.
Hybridization of the labeled products is detectable, and the amount
of specific labels that are detected is proportional to the amount
of the labeled amplification products of a specific RNA sequence of
interest. This measurement is useful for, for example, measuring
the relative amounts of the various RNA species in a sample, which
are related to the relative levels of gene expression, as described
herein. The amount of labeled products (as indicated by, for
example, detectable signal associated with the label) hybridized at
defined locations on an array can be indicative of the detection
and/or quantification of the corresponding target RNA species in
the sample.
[0328] In another aspect, the invention provides a method of
quantitating single stranded polynucleotide (generally, DNA or RNA)
comprising use of an oligonucleotide (probe) of defined sequence
(which may be immobilized, for example, on a microarray). In this
aspect of the invention, labeled single stranded polynucleotide
(generally, DNA or RNA) products comprising defined sequences at
the 5' and/or 3' ends (introduced using tailed first or second
primers, as described herein) are hybridizable to a defined
oligonucleotides, wherein the oligonucleotide comprises the
complement of the defined sequence introduced at the 5' and/or 3'
end).
[0329] In some embodiments, specific mRNA species are amplified
using a composite and/or second primer tailed with a defined
sequence that is hybridizable to a sequence immobilized on the
array (depending whether the defined sequence is introduced in the
composite or second primer). For example, in one embodiment, a
first composite primer comprises a 3' portion which is hybridizable
to a sequence of a specific RNA species, and a 5' portion that is
not hybridizable to a specific RNA template, but is hybridizable to
a defined oligonucleotide. In another embodiment, a second primer
comprises a 3' portion which is hybridizable to a sequence of a
first primer extension product, and a 5' portion that is not
hybridizable to a first primer extension product, but comprises a
sequence of a defined oligonucleotide. Multiple copies of single
stranded labeled DNA or RNA products are produced which are
hybridizable to oligonucleotide. It is understood that although a
single RNA species is discussed above, multiple species may be
amplified simultaneously, each with a composite primer or second
primer comprising a tail hybridizable to a different defined
oligonucleotide.
[0330] Determination of Gene Expression Profile
[0331] The amplification methods of the invention are particularly
suitable for use in determining the levels of expression of one or
more genes in a sample since the methods described herein are
capable of amplifying one or more, preferably a plurality of target
RNAs in the same sample. As described above, amplification products
can be detected and quantified by various methods, as described
herein and/or known in the art. Since RNA is a product of gene
expression, the levels of the various RNA species, such as mRNAs,
in a sample is indicative of the relative expression levels of the
various genes (gene expression profile). Thus, determination of the
amount of RNA sequences of interest present in a sample, as
determined by quantifying amplification products of the sequences,
provides for determination of the gene expression profile of the
sample source.
[0332] Accordingly, the invention provides methods of determining
gene expression profile in a sample, said method comprising:
amplifying single stranded product from at least one RNA sequence
of interest in the sample, using any of the methods described
herein; and determining amount of amplification products of each
RNA sequence of interest, wherein each said amount is indicative of
amount of each RNA sequence of interest in the sample, whereby the
expression profile in the sample is determined. Generally, labeled
products are generated. In one embodiment, the target RNA is mRNA.
In yet another embodi ment, the composite primer comprises a
poly-dT sequence (such that mRNA in a sample is amplified). It is
understood that amount of amplification product may be determined
using quantitative and/or qualitative methods. Determining amount
of amplification product includes determining whether amplification
product is present or absent. Thus, an expression profile can
includes information about presence or absence of one or more RNA
sequence of interest. "Absent" or "absence" of product, and "lack
of detection of product" as used herein includes insignificant, or
de minimus levels.
[0333] The methods of expression profiling are useful in a wide
variety of molecular diagnostic, and especially in the study of
gene expression in essentially any mammalian cell (including a
single cell) or cell population. A cell or cell population (e.g. a
tissue) may be from, for example, blood, brain, spleen, bone,
heart, vascular, lung, kidney, pituitary, endocrine gland,
embryonic cells, tumors, or the like. Expression profiling is also
useful for comparing a control (normal) sample to a test sample,
including test samples collected at different times, including
before, after, and/or during development, a treatment, and the
like.
[0334] Method of Preparing a Library
[0335] The single stranded DNA and RNA products of the methods of
the invention are useful in preparing libraries, including cDNA
libraries and subtractive hybridization libraries. Using the
methods of the invention, libraries may be prepared from limited
amount of starting material, for example, mRNA extracted from
limited amount of tissue or even single cells. Accordingly, in one
aspect, the methods of the invention provides preparing a library
from the single stranded DNA or RNA products of the invention. In
another aspect, the invention provides methods of preparing a
library from the double stranded cDNA produced by the methods of
the invention comprising two composite primers. Method for
preparing libraries from double stranded cDNA are well known in the
art. In still another aspect, the invention provides methods for
making a library, said method comprising: preparing a subtractive
hybridization probe using any of the methods described herein.
[0336] In some embodiments, the first composite primer is
hybridizable to the poly-A sequence found in essentially all mRNAs.
In other embodiments, the first composite primer is a random
primer.
[0337] Methods of Subtractive Hybridization
[0338] The amplification methods of the invention are particularly
suitable for use in subtractive hybridization methods, in which (at
least) a first and second target RNA population is compared, since
the methods described herein are capable of amplifying multiple
target RNAs in the same sample, and the methods of the invention
are suitable for producing large amounts of single stranded
antisense nucleic acid suitable for use as "driver" in subtractive
hybridization. For example, two nucleic acid populations, one sense
and one antisense, can be allowed to mix together with one
population present in molar excess ("driver"). Sequence present in
both populations will form hybrids, while sequences present in only
one population remain single-stranded. Thereafter, various well
known techniques are used to separate the unhybridized molecules
representing differentially expressed sequences. See, e.g., Hamson
et al., U.S. Pat. No. 5,589,339; Van Gelder, U.S. Pat. No.
6,291,170.
[0339] Accordingly, the invention provides methods for performing
subtractive hybridization, said methods comprising: (a) preparing
multiple DNA copies of the complement of at least one RNA sequences
of interest from a first RNA population using any of the
amplification methods described herein; and (b) hybridizing the
multiple copies to a second mRNA population, whereby a
subpopulation of the second mRNA population forms a complex with a
nucleotide DNA copy. The invention also provides methods for
performing subtractive hybridization, said methods comprising:
hybridizing multiple copies of the complement of at least one RNA
sequences of interest from a first RNA population using any of the
amplification methods described herein to a second mRNA population,
whereby a subpopulation of the second mRNA population forms a
complex with a copy. In some embodiments, "driver" single stranded
anti-sense DNA product of the methods of the invention is combined
with tester (sense) mRNA species. In some embodiments, "driver"
single stranded antisense nucleic acid (generally, DNA) product is
produced using the methods of the invention described herein, and a
first composite primer hybridizable to the poly-A sequence
(amplifying essentially all mRNA species). In other embodiment, the
first composite primer is a random primer.
[0340] In another aspect, the invention provides methods of
differential amplification in which single stranded driver
(antisense) DNA sequences that hybridize with tester mRNA sequence
are subjected to cleavage by an agent that cleaves RNA present in a
DNA/RNA hybrid, such as RNase H. Cleavage of the mRNA results in
the inability to generate single stranded DNA product from the test
mRNA strands. Conversely, non-cleaved tester (i.e., tester mRNA
that did not hybridize to driver DNA molecules) may serve as a
substratefor subsequent amplification. Amplified differentially
expressed products have many uses, including as a differential
expression probe, to produce differential expression libraries
Accordingly, the invention provides methods for differential
amplification of one or more RNA sequence of interest, said method
comprising: (a) preparing multiple polynucleotide (generally, DNA)
copies of the complement of at least one RNA sequences of interest
from a first RNA population using any of the amplification methods
described herein; (b) hybridizing the multiple copies to a second
mRNA population, whereby a subpopulation of the second mRNA
population forms a complex with a DNA copy; (c) cleaving RNA in the
complex of step (b) with an enzyme that cleaves RNA from an RNA/DNA
hybrid; and (d) amplifying an unhybridized subpopulation of the
second mRNA population, whereby multiple copies of single stranded
DNA complementary to the unhybridized subpopulation of the second
mRNA population are generated. In some embodiments, step (d) is
performed using any of the amplification methods described herein.
In some embodiments, the methods comprise hybridizing multiple
polynucleotide (generally, DNA) copies of the complement of at
least one RNA sequences of interest from a first RNA population
using any of the amplification methods described herein to a second
mRNA population, whereby a subpopulation of the second mRNA
population forms a complex with a DNA copy, (b) cleaving RNA in the
complex of step (a) with an enzyme that cleaves RNA from an RNA/DNA
hybrid; and (c) amplifying an unhybridized subpopulation of the
second mRNA population, whereby multiple copies of single stranded
DNA complementary to the unhybridized subpopulation of the second
mRNA population are generated.
[0341] The following Examples are provided to illustrate, but not
limit, the invention.
EXAMPLES
Example 1
Amplification of Total Poly-A mRNA
[0342] Poly-A mRNA from MOLT4 cell line (CLONTECH 6587-1) was used
as a target for amplification. The process of amplification was in
three steps: 1) synthesis of first cDNA strand; 2) synthesis of
second cDNA strand to produce a double stranded cDNA from the total
mRNA of the sample; and 3) amplification of the total mRNA. The
double stranded cDNA product comprises at one end an RNA/DNA
heteroduplex, which is a substrate for RNase H. The sequence of the
two strands of this heteroduplex portion is not related to the
target, and is incorporated through utilization of a composite
(first) primer.
[0343] Primer sequences:
1 MTA1: GACGGAUGCGGUCUTTTTTTT MTA2: GACGGAUGCGGUCUTTTTTTTN MTA3:
GACGGAUGCGGUCUTTTTTTTNN
[0344] wherein italicized nucleotides denote ribonucleotides and
`N` denotes a degenerate nucleotide (i.e., it can be A, T, C or
G).
[0345] Step 1: Synthesis of the first strand cDNA from poly A
mRNA
[0346] 0.1 .mu.g of total poly-A mRNA was mixed with the following
reagents in a total volume of 10 ul:
[0347] 0.2 .mu.l primer MTA3 (100 .mu.M)
[0348] 0.5 .mu.l dNTPs (25 mM)
[0349] 0.1 .mu.l Rnasin
[0350] 0.1 .mu.l DTT
[0351] 2 .mu.l 5.times.AMV reverse transcriptase reaction buffer
DEPC treated water to 10 .mu.l total volume
[0352] The reaction mixture was incubated for 2 min at 75.degree.
C., and then cooled to 37.degree. C. 1 .mu.l AMV reverse
transcriptase (USB 70041Y, 15U/.mu.l) was added to each reaction
and the reaction mixture was further incubated at this temperature
for 60 min.
[0353] Step 2: Second Strand cDNA Synthesis
[0354] The first strand cDNA reaction mixture was mixed with 10
.mu.l of the second strand cDNA synthesis mixture containing the
following:
[0355] 1 .mu.l 10.times.Klenow reaction buffer
[0356] 0.1 .mu.l dNTPs (25 mM)
[0357] 0.5 .mu.l Klenow (USB 2141Y 5 U/.mu.l) DNA polymerase
[0358] 8.4 .mu.l water
[0359] The reaction mixture was incubated for 30 min at 37.degree.
C., followed by heating to 75.degree. C. for 5 min to stop the
reactions by inactivating the enzymes.
[0360] Step 3: Amplification of Total cDNA
[0361] Two composite primers were tested--MTA1 and MTA2.
[0362] The reactions were carried out in a total volume of 20
.mu.l, comprising the following:
[0363] 1 .mu.l cDNA reaction
[0364] 0.2 .mu.l MTA1 or MTA2 primer (both are at 100 .mu.M)
[0365] 0.2 .mu.l 25 mM dNTPs
[0366] 0.1 .mu.l Rnasin
[0367] 0.1 .mu.l DTT
[0368] 17.2 .mu.l water
[0369] The mixture above was incubated at 94.degree. C. for 20
seconds and then cooled to 50.degree. C. A mixture of 2U BCA, 0.02
U Hybridase (RNase H) and 0.4 .mu.g T4 Gene 32 protein (single
stranded DNA binding protein) was added, and the reaction mixture
was incubated at 50.degree. C. for 60 min.
[0370] 5 .mu.l of each reaction mixture was analyzed by
electrophoresis on 5-20% PAGE (Novex). Successful amplification was
indicated by the reaction products of the amplified total mRNA
appearing as a smear, which was expected due to amplification of a
plurality of mRNA species. No product was observed in reactions
carried out without one of the following components: a input double
stranded cDNA; b. primer for first strand synthesis; and c. input
mRNA for the first strand cDNA synthesis.
Example 2
Characterization of Products of Step 2 and Step 3 Reactions of
Example 1
[0371] In the amplification reactions of Example 1, a "unique"
sequence (i.e., a sequence not hybridizable to the RNA template) is
expected to be created at the 3'-end of the second strand cDNA due
to the "unique" sequence of the 5' RNA portion of the composite
primer used. This sequence (of the 3'-end of the second strand
cDNA) is complementary to the 5'-RNA portion of the composite
primer and is not related to sequences in the target RNA. To
determine the presence of this sequence in the second strand cDNA
that is obtained, PCR amplification of the reaction products (as
found in reaction mix of step 2 of Example 1) was performed using a
primer which is complementary to the expected sequence at the
3'-end of the second strand cDNA, as a forward primer, and a
G3PDH-specific primer as a reverse PCR primer. This primer pair
would be expected to amplify a specific product from a double
stranded cDNA that has the "unique" sequence. It would not,
however, be expected to generate a specific product from PCR
amplification of the anti-sense DNA products (as found in the
reaction mix of step 3 of Example 1), because these products would
not be expected to contain the "unique" sequence (which is
introduced by the RNA portion of the composite primer which is
cleaved by RNase H). Since the reaction mix of step 3 of Example 1
contains predominantly amplified DNA products (that should not
contain the "unique" sequence), PCR amplification of this reaction
mix would be expected to be much less efficient (and thus generate
substantially less products) than PCR amplification of the reaction
mix of step 2 (which contains primarily double stranded cDNA
product).
[0372] PCR reactions were carried out as follows:
[0373] Each 50 .mu.l of PCR reaction contains:
[0374] 0.4 .mu.M of each primer (Biosource International)
[0375] 100 .mu.M of each dNTP (Epicenter)
[0376] 2 mM Magnesium chloride (Epicenter)
[0377] 1-2 units Polymerase (either MasterAmp taq or MasterAmp Tfl,
both from Epicenter)
[0378] 5 .mu.l, 10.times. buffer as supplied with the enzyme.
[0379] Either 0.5 .mu.l of a linear amplification reaction from the
third step in Example 1, or a 1:20 dilution of the cDNA generated
in step 2 in Example 1.
[0380] The PCR amplification cycles were 94.degree. C. for 30
seconds, 51.degree. C. for 30 seconds, and 72.degree. C. for 30
seconds. Generally, the samples were cycled 20 or 25 times. There
was a final 5-minute extension at 72.degree. C. before the samples
were held at 4.degree. C.
[0381] Similar experiments were carried out with primer specific to
the T-cell receptor specific mRNA (TCR) which is expressed by the
MOLT4 cell line.
[0382] Expected PCR product size (base pairs) using the G3PDH
primers.
2 FORWARD PRIMER FORWARD PRIMER REV PRIMER G3PDH3 dMTA1 G3PDH5-2 18
62 G3PDH5-3 110 156 G3PDH5-4 157 203 G3PDH5 253 299 G3PDH5-6 309
354 G3PDH5-7 361 405
[0383] Primer Sequences
3 G3PDH5: 5' TTT CCT GGT ATG ACA ACG AA G3PDH5-4: 5' CCA GCA AGA
GCA CAA GAG GA G3PDH3: 5' GAT GGT ACA TGA CAA GGT dMTA1: 5' GAC GGA
TGC GGT CTT TTT TTT
[0384] Expected PCR product size (base pairs) using T-Cell receptor
primers
4 TCR3 DMTA1 TCR5-2 160 Approx. 440 TCR5 238 Approx. 500
[0385] Primer sequences
5 TCR5: 5' CCC GCA ACC ACT TCC GCT GTC TCR5-2: 5' CAA ACC CGT CAC
CCA GAT CGT TCR3: 5' CAA CAC AAG GGC GCT GAC C
[0386] The results show that the unique sequence is incorporated
into the second strand cDNA, as indicated by the presence of a
product that was about 250 base pairs in length when the step 2
reaction mix was PCR amplified using primers DMTA1 and G3PDH5
(amplification of a sequence of G3PDH mRNA), and a product of about
400 base pairs in length when using primers DMTA1 and TCR5-2
(amplification of a sequence of TCR beta chain mRNA). PCR
amplification of the step 3 reaction mix with the same primer
pairs, on the other hand, showed a greatly reduced amount of
amplification products. Thus, the results demonstrated the
incorporation of the "unique" sequence (of the RNA portion of the
composite primer used in Example 1) into the double stranded cDNA
products generated, and the absence of the sequence in the final
amplified DNA products (due to cleavage of the RNA portion).
Example 3
Amplification of Total mRNA Starting With a Total RNA
Preparation
[0387] The ability to amplify total mRNA from a preparation of
total RNA greatly simplifies the process by eliminating the mRNA
purification step. Experimental demonstration of amplifying total
mRNA from a total RNA preparation using methods of the invention
was carried out using commercial total RNA preparation from breast
cancer tumor (CLONTECH; cat. no.: 64015-1). The process of
amplification of total mRNA was carried out in three steps as
described in the following.
[0388] Primer sequence:
6 MTB2: GAC GGA UGC GGU CUTTTTTTTTTTTTTTNN BA5: AAC TAC CTT CAA CTC
CAT CA BA3: GGA CTC GTC ATA CTC CTG C
[0389] wherein italicized nucleotides denote ribonucleotides and
`N` denotes a degenerate nucleotide (i.e., it can be A, T, C or
G).
[0390] Step 1: First Strand cDNA Synthesis
[0391] Each reaction mixture comprised the following:
[0392] 4 .mu.l of a SX buffer (250 mM Tris-HCl, pH 8.3; 375 mM KCl,
15 mM MgCl2)
[0393] MTB2 primer @1 .mu.M
[0394] 25 mM dNTPs
[0395] 0.2 .mu.l RNasin Ribonuclease Inhibitor (Promega N2511, 40
u/.mu.l)
[0396] 1 .mu.l 0.1 M DTT
[0397] 5 .mu.g, 1 .mu.g, 0.2 .mu.g or 40 ng of total RNA per
reaction
[0398] DEPC-- treated water to a total volume of 19 .mu.l
[0399] The reaction mixtures were incubated at 75.degree. C. for 2
minutes, and then cooled down to 42.degree. C. SuperScript II RNase
H--Reverse Transcriptase (200 U, BRL 18064-022) was added to each
reaction, and the reactions were incubated at 42.degree. C. for 50
minutes.
[0400] Step 2: Synthesis of Second Strand cDNA
[0401] 10 .mu.l of the first strand cDNA synthesis reaction mixture
was aliquoted to individual reaction tubes. 20 .mu.l of second
strand synthesis stock reaction mixture was added to each tube. The
second strand syntheis stock reaction rmixture contained the
following:
[0402] 2 .mu.l of 10.times.Klenow reaction buffer (10.times.
buffer: 500 mM Tris-HCl, pH 8.0; 100 mM MgCl.sub.2, 500 mM
NaCl)
[0403] 2 U Klenow DNA polymerase (BRL 18012-021)
[0404] 0.1 .mu.l of AMV reverse transcriptase (BRL 18020-016, 25
U/.mu.l)
[0405] 0.2 .mu.l of E coli Ribonuclease H (BRL 18021-014, 4
U/.mu.l)
[0406] 0.2 .mu.l (25 mM) dNTPs
[0407] 0 or 0.2 .mu.l of Ecoli DNA ligase (BRL 18052-019, 10
U/.mu.l)
[0408] The reaction mixtures were incubated at 37.degree. C. for 30
minutes. The reactions were stopped by heating to 75.degree. C. for
5 minutes to inactivate the enzymes.
[0409] Step 3: Amplification of Total cDNA
[0410] Amplification was carried out using 1 .mu.l of the second
strand cDNA reaction mixture above, using the MTA1 composite primer
in the presence of T4 gene 32 protein at 50.degree. C. for 60
min.
[0411] Each reaction mixture contained the following:
[0412] 2 .mu.l of 10.times. buffer (200 mM Tris-HCl, pH 8.5, 50 mM
MgCl2, 1% NP-40)
[0413] 0.2 .mu.l of dNTPs (25 mM)
[0414] 0.2 .mu.l of MTA1 (100 .mu.M)
[0415] 1 .mu.l of the second strand cDNA synthesis mixture
[0416] 0.1 .mu.l Rnasin
[0417] 0.1 .mu.l DTT (0.1M)
[0418] DEPC-treated water to a total volume of 18.8 .mu.l
[0419] The reaction mixtures were incubated at 94.degree. C. for 20
seconds, and then cooled down to 50.degree. C. 2U Bca (Takara Cat.#
2710A), 0.02U Hybridase Thermostable Rnase H (Epicentre H39100),
and 0.4 .mu.g T4 Gene 32 Protein (USB 70029Z) were added, and the
reactions were further incubated at this temperature for 60
min.
[0420] The step 3 reaction mix (expected to contain amplified DNA
products) was analyzed by gel electrophoresis (5-20% PAGE, Novex).
Successful amplification was indicated by the amplification
products of the total mRNA appearing as a smear, which was expected
due to amplification of a plurality of mRNA species in the
sample.
[0421] The incorporation of a "unique" (defined) sequence
(complementary to the 5'-end RNA portion of the corhposite primer
used) into the second strand cDNA was demonstrated by PCR
amplification using specific primer pairs. Aliquots of the step 2
and step 3 reaction mixes were subjected to PCR amplification using
primers G3PDH54/G3PDH3 or BA5/BA3 (beta actin), using conditions as
described in Example 2. PCR amplification of step 2 reaction mixes
resulted in substantial amounts of products of the correct size,
whereas amplification of step 3 reaction mixes resulted in
substantial smaller amounts of the same products. Thus, the results
demonstrated the incorporation of the "unique" sequence (of the RNA
portion of the composite primer used in this Example) into the
double stranded cDNA products, and the absence of the sequence in
the final amplified DNA products (due to cleavage of the RNA
portion).
Example 4
Preparation of Double Stranded cDNA Comprising an Appended Defined
Sequence in the Second Strand cDNA from Total RNA Preparation and
Purified mRNA
[0422] Total RNA (1 ug) prepared from the HCT116 cell line, or mRNA
(100 ng) prepared from MOLT4 cell line (Clontech) was used as a
target for production of the intermediate double stranded cDNA
product comprising an appended defined sequence in the second
strand cDNA. The appended sequence is incorporated through
utilization of a composite (first) primer.
[0423] The process of preparing the first and second strand cDNA
was carried out essentially as described in Example 1 and 3, and
generally included the following steps: (1) synthesis of first cDNA
strand; (2) synthesis of second cDNA strand to produce a double
stranded cDNA comprising at one end an RNA/DNA heteroduplex which
is a substrate for RNase H. Double stranded cDNA intermediate
products are expected to comprise cDNA copies of multiple RNA from
the target RNA sample, each cDNA with the same appended defined
sequence. The sequence of the appended defined sequence is expected
to be the complement of the sequence of the 5' RNA portion of the
composite (first) primer that hybridizes to target RNA. PCR
experiments were performed to confirm the presence of second strand
cDNA comprising (a) second strand cDNA copy of a sequence of the
GAPDH mRNA known to be represented in the mRNA of both RNA target
samples and (b) the defined sequence (i.e., the complement of the
5' RNA portion of the first composite primer) at the 3' end. The
PCR primer pairs used were as follows:
[0424] 1) A primer complementary to the unique sequence (DMTAI) and
a primer complementary to the sequence of the GAPDH mRNA (GAPDH54)
for generation of a 203 bp product that is dependent on appending
of the sequence at the 3' end of the second cDNA strand.
[0425] 2) Two primers complementary to the sequence of the GAPDH
mRNA, GAPDH3 and primer GAPDH54, used for generation of a 157 bp
product specific for GAPDH and is independent of appending the
unique sequence at the 3' end of the second cDNA strand.
[0426] PCR was performed as described in Examples 1 and 2 using two
separate preparation of cDNA from each starting template, as
described above. PCR reactions were analyzed using gel
electrophoresis. The results are shown in FIG. 9. Lanes correspond
to the reaction mixtures containing the following templates and
primer pairs:
7 1. marker 2. cDNA from HCT116 GAPDH3/GAPDH5-4 3. cDNA from HCT116
GAPDH3/GAPDH5-4 4. cDNA from MOLT4 GAPDH3/GAPDH5-4 5. cDNA from
MOLT4 GAPDH3/GAPDH5-4 6. no template GAPDH3/GAPDH5-4 7. cDNA from
HCT116 dMTA1/GAPDH5-4 8. cDNA from HCT116 dMTA1/GAPDH5-4 9. cDNA
from MOLT4 dMTA1/GAPDH5-4 10. cDNA from MOLT4 dMTA1/GAPDH5-4 11. no
template dMTA1/GAPDH5-4
[0427] Arrows mark the position of expected pcr product.
[0428] As expected, a longer product was produced in HCT 116 and
MOLT4 samples amplified using primer pair (1), and a sorter product
was generated in HCT116 and MOLT4 samples amplified using primer
pair (2). No product was produced in control samples lacking
template. This example demonstrates efficient appending of a
defined sequence at the 3' end of the second cDNA using the methods
described herein.
Example 5
Amplification of Total polyA mRNA and Quantification of Products
Using Real Time PCR
[0429] 200 ng of total RNA from Human Colon Tumor Total RNA,
(Clontech Catalog No. 64014-1), was used as a target for
amplification. The preparation of first and second strand cDNA and
subsequent amplification step was carried out essentially as
described in Example 3 with the following modifications:
[0430] (1) The reaction mixture for second strand cDNA synthesis
contained Klenow DNA polymerase (which lacks 3' and 5' exonuclease
activities), and lacked ligase.
[0431] (2) Amplification of the resultant cDNA was carried out
using Bst polymerase (4 units, NEB) instead of Bca polymerase
[0432] Quantification was determined for the cDNA intermediates
(second strand cDNA) and the antisense amplification products using
four different primer pairs corresponding to four different mRNAs,
and Real Time PCR according to the following protocol:
[0433] cDNA or amplification products were diluted 1:10 or 1:100 in
TE buffer.
[0434] Reaction mixtures for Real Time PCR were set to a total
volume of 20 ul, as follows:
[0435] For each reaction
[0436] 10 .mu.l of 2.times.ABI SYBR Green master mix (ABI Cat
#4309155)
[0437] 0.6 .mu.L of 10 .mu.M forward primer
[0438] 0.6 .mu.l of 10 .mu.M reverse primer
[0439] 1 .mu.l template (dilution of either cDNA or amplification
products specified above)
[0440] 7.8 .mu.l of H.sub.2O
[0441] The following primer pairs were used for quantification of
four specific expressed genes in either cDNA or amplification
products generated as described above:
8 G6PD G6PD5 5' AGGCAGCCTCTCTGCTATAAGAAA 3' G6PD3 5'
GCAGGGCATTGAGGTTGG 3' LGALS1 LGALS15 5' ATGGCAGCTGACGGTGACTT 3'
LGALS13 5' CATGGGCTGGCTGATTT 3' MT2A MT2A5 5' CGCCTGATGCTGGGACAG 3'
MT2A3 5' GTTGTACATAAAAAATCCAGGTTT- GTG 3' RPL27 RPL275 5'
GATCCTGCTCTTAAACGCAAGG 3' RPL273 5' TGCCTGTCTTGTATCTCTCTTCAAAC
3'
[0442] PCR reaction were performed in an iCycler (BiORad), using
the following thermocycling protocol:
[0443] 94.degree. C. for 10 min to activate the DNA polymerase
[0444] 40 cycles of: 94.degree. C. for 30 seconds followed by
60.degree. C. for 30 seconds.
[0445] Data analysis was carried out as recommended by the
manufacturer.
[0446] FIG. 10 show 4 traces of fluorescence reading as a function
of cycle number for PCR reaction quantifying cDNA product (by
amplifying the second strand cDNA) or the corresponding SPIA
amplification products (by amplifying accumulated second strand
cDNA). The panels depict the results of quantification experiments
performed using (from top to bottom):MTA2, RPL27, LGALS1, and G6PD
primer pairs, respectively. Each panel shows the results of 6
experiments using amplification product preparation (labeled
"SPIA") and 2 experiments using cDNA product preparation (labeled
"cDNA"). The X axis is PCR cycles and the Y axis is PCR baseline
subtracted RFU.
[0447] The level of amplification of each of the gene products
using the method of the invention is defined by the different
number of PCR cycles required for generation of fluorescence signal
(termed "CT") above a defined threshold, between reaction carried
out using cDNA product template and reactions carried out using the
corresponding amplification products as template. Table 1 shows a
calculation of a "delta CT" value for each gene product (reflecting
the comparison between CT values corresponding to reactions carried
out using cDNA product template and reactions carried out using the
corresponding amplification products as template), andwhich
revealed that regardless of their expression level in the input
total RNA, mRNAs corresponding to the four gene products in the
sample are equally amplified by the method of the invention.
9TABLE 1 Calculation of delta CT value for each gene product Gene
cDNA CT SPIA CT delta CT MT2A 37 26 11 RPL27 30 19 11 LGAL 31 21 10
G6PD 35 26 9
[0448] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be apparent to those skilled in the art
that certain changes and modifications may be practiced. Therefore,
the descriptions and examples should not be construed as limiting
the scope of the invention, which is delineated by the appended
claims.
* * * * *
References