U.S. patent application number 10/825898 was filed with the patent office on 2005-01-06 for osteoprotegerin binding proteins and receptors.
This patent application is currently assigned to Amgen Inc.. Invention is credited to Boyle, William J..
Application Number | 20050003400 10/825898 |
Document ID | / |
Family ID | 27126366 |
Filed Date | 2005-01-06 |
United States Patent
Application |
20050003400 |
Kind Code |
A1 |
Boyle, William J. |
January 6, 2005 |
Osteoprotegerin binding proteins and receptors
Abstract
A novel polypeptide, osteoprotegerin binding protein, involved
in osteolcast maturation has been identified based upon its
affinity for osteoprotegerin. Nucleic acid sequences encoding the
polypeptide, or a fragment, analog or derivative thereof, vectors
and host cells for production, methods of preparing osteoprotegerin
binding protein, and binding assays are also described.
Compositions and methods for the treatment of bone diseases such as
osteoporosis, bone loss due to arthritis or metastasis,
hypercalcemia, and Paget's disease are also provided. Receptors for
osteoprotegerin binding proteins are also described. The receptors,
and agonists and antagonists thereof, may be used to treat bone
diseases.
Inventors: |
Boyle, William J.;
(Moorpark, CA) |
Correspondence
Address: |
Robert B. Winter
AMGEN, INC.
U. S. Patent Operations/RBW, Dept. 4300
One Amgen Center Drive, M/S 27-4-A
Thousand Oaks
CA
91320-1799
US
|
Assignee: |
Amgen Inc.
|
Family ID: |
27126366 |
Appl. No.: |
10/825898 |
Filed: |
April 15, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10825898 |
Apr 15, 2004 |
|
|
|
09721212 |
Nov 21, 2000 |
|
|
|
09721212 |
Nov 21, 2000 |
|
|
|
09052521 |
Mar 30, 1998 |
|
|
|
6316408 |
|
|
|
|
09052521 |
Mar 30, 1998 |
|
|
|
08880855 |
Jun 23, 1997 |
|
|
|
08880855 |
Jun 23, 1997 |
|
|
|
08842842 |
Apr 16, 1997 |
|
|
|
5843678 |
|
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/252.33; 435/320.1; 435/6.1; 435/69.1; 514/16.8; 514/16.9;
514/19.8; 514/8.8; 530/388.1; 536/23.5 |
Current CPC
Class: |
A61P 3/14 20180101; A61P
35/04 20180101; C07K 14/70578 20130101; A61P 1/02 20180101; A61P
19/00 20180101; A61P 19/02 20180101; C07K 14/70575 20130101; C07K
2319/30 20130101; A61P 19/08 20180101; A61K 39/00 20130101; A61K
38/00 20130101; A61P 29/00 20180101; A61P 19/10 20180101 |
Class at
Publication: |
435/006 ;
514/012; 435/069.1; 435/320.1; 435/252.33; 530/388.1;
536/023.5 |
International
Class: |
C12Q 001/68; C07H
021/04; C07K 016/18 |
Claims
1-42. (canceled)
43. A method for identifying a compound which decreases the
activity of osteoprotegerin binding protein (OPGbp) comprising:
adding to a cell culture a test compound under conditions where the
cell culture forms osteoclasts in the presence of OPGbp; and
measuring osteoclast formation, wherein a decrease in osteoclast
formation in the presence of the test compound indicates that the
compound decreases the activity of OPGbp.
44. A method for identifying a compound which increases the
activity of osteoprotegerin binding protein (OPGbp) comprising:
adding to a cell culture a test compound under conditions where the
cell culture forms osteoclasts in the presence of OPGbp; and
measuring osteoclast formation, wherein an increase in osteoclast
formation in the presence of the test compound indicates that the
compound increases the activity of OPGbp.
45. The method of claims 43 or 44 wherein the test compound binds
to OPGbp.
46. The method of claims 43 or 44 wherein the test compound binds
to ODAR.
47. The method of claims 43 or 44 wherein the test compound is an
antibody or fragment thereof.
48. The method of claim 47 wherein the test compound is an antibody
or fragment thereof which binds OPGbp.
49. The method of claim 47 wherein the test compound is an antibody
or fragment thereof which binds ODAR.
50. The method of claims 43 or 44 wherein the test compound is
derived from human OPGbp.
51. The method of claims 43 or 44 wherein the test compound is
derived from human ODAR.
52. The method of claims 43 or 44 wherein the test compound
comprises part or all of the extracellular domain of human
ODAR.
53. The method of claims 43 or 44 wherein the test compound
comprises part or all of the extracellular domain of human
OPGbp.
54. The method of claims 43 or 44 wherein OPGbp comprises the amino
acid sequence from residues 1 to 317 inclusive as shown in SEQ ID
NO:3 or a fragment thereof.
55. The method of claim 53 wherein the extracellular domain of
human OPGbp comprises residues 69-317 inclusive as shown in SEQ ID
NO:3 or a fragment thereof.
56. The method of claim 43 wherein the test compound increases bone
density.
57. The method of claim 43 wherein the test compound decreases bone
resorption.
Description
[0001] This application is a continuation of application Ser. No.
09/721,212, filed Nov. 21, 2000, which is a continuation of
application Ser. No. 09/052,521 filed Mar. 30, 1998, now U.S. Pat.
No. 6,316,408, which is a continuation-in-part of application Ser.
No. 08/880,855 filed Jun. 23, 1997, abandoned, which is a
continuation-in-part of application Ser. No. 08/842,842, filed Apr.
16, 1997, now U.S. Pat. No. 5,843,678, all of which are hereby
incorporated by reference
FIELD OF THE INVENTION
[0002] The present invention relates to polypeptides which are
involved in osteoclast differentiation. More particularly, the
invention relates to osteoprotegerin binding proteins, nucleic
acids encoding the proteins, expression vectors and host cells for
production of the proteins, and binding assays. Compositions and
methods for the treatment of bone diseases, such as osteoporosis,
bone loss from arthritis, Paget's disease, and hypercalcemia, are
also described.
[0003] The invention also relates to receptors for osteoprotegerin
binding proteins and methods and compositions for the treatment of
bone diseases using the receptors.
BACKGROUND OF THE INVENTION
[0004] Living bone tissue exhibits a dynamic equilibrium between
deposition and resorption of bone. These processes are mediated
primarily by two cell types: osteoblasts, which secrete molecules
that comprise the organic matrix of bone; and osteoclasts, which
promote dissolution of the bone matrix and solubilization of bone
salts. In young individuals with growing bone, the rate of bone
deposition exceeds the rate of bone resorption, while in older
individuals the rate of resorption can exceed deposition. In the
latter situation, the increased breakdown of bone leads to reduced
bone mass and strength, increased risk of fractures, and slow or
incomplete repair of broken bones.
[0005] Osteoclasts are large phagocytic multinucleated cells which
are formed from hematopoietic precursor cells in the bone marrow.
Although the growth and formation of mature functional osteoclasts
is not well understood, it is thought that osteoclasts mature along
the monocyte/macrophage cell lineage in response to exposure to
various growth-promoting factors. Early development of bone marrow
precursor cells to preosteoclasts are believed to mediated by
soluble factors such as tumor necrosis factor-.alpha.
(TNF-.alpha.), tumor necrosis factory-.beta. (TNF-.beta.),
interleukin-1 (IL-1), interleukin-4 (IL-4), interleukin-6 (IL-6),
and leukemia inhibitory factor (LIF). In culture, preosteoclasts
are formed in the presence of added macrophage colony stimulating
factor (M-CSF). These factors act primarily in early steps of
osteoclast development. The involvement of polypeptide factors in
terminal stages of osteoclast formation has not been extensively
reported. It has been reported, however, that parathyroid hormone
stimulates the formation and activity of osteoclasts and that
calcitonin has the opposite effect, although to a lesser
extent.
[0006] Recently, a new polypeptide factor, termed osteoprotegerin
(OPG), has been described which negatively regulated formation of
osteoclasts in vitro and in vivo (see co-owned and co-pending U.S.
Serial No. 08/577,788 filed Dec. 22, 1995, Ser. No. 08/706,945
filed Sep. 3, 1996, and Ser. No. 08/771,777, filed Dec. 20, 1996,
hereby incorporated by reference; and PCT Application No.
WO96/26271). OPG dramatically increased the bone density in
transgenic mice expressing the OPG polypeptide and reduced the
extent of bone loss when administered to ovariectomized rats. An
analysis of OPG activity in in vitro osteoclast formation revealed
that OPG does not interfere with the growth and differentiation of
monocyte/macrophage precursors, but more likely blocks the
differentiation of osteoclasts from monocyte/macrophage precursors.
Thus OPG appears to have specificity in regulating the extent of
osteoclast formation.
[0007] OPG comprises two polypeptide domains having different
structural and functional properties. The amino-terminal domain
spanning about residues 22-194 of the full-length polypeptide (the
N-terminal methionine is designated residue 1) shows homology to
other members of the tumor necrosis factor receptor (TNFR) family,
especially TNFR-2, through conservation of cysteine rich domains
characteristic of TNFR family members. The carboxy terminal domain
spanning residues 194-401 has no significant homology to any known
sequences. Unlike a number of other TNFR family members, OPG
appears to be exclusively a secreted protein and does not appear to
be synthesized as a membrane associated form.
[0008] Based upon its activity as a negative regulator of
osteoclast formation, it is postulated that OPG may bind to a
polypeptide factor involved in osteoclast differentiation and
thereby block one or more terminal steps leading to formation of a
mature osteoclast.
[0009] It is therefore an object of the invention to identify
polypeptides which interact with OPG. Said polypeptides may play a
role in osteoclast maturation and may be useful in the treatment of
bone diseases.
SUMMARY OF THE INVENTION
[0010] A novel member of the tumor necrosis factor family has been
identified from a murine cDNA library expressed in COS cells
screened using a recombinant OPG-Fc fusion protein as an affinity
probe. The new polypeptide is a transmembrane OPG binding protein
which is predicted to be 316 amino acids in length, and has an
amino terminal cytoplasmic domain, a transmembrane domain, and a
carboxy terminal extracellular domain. OPG binding proteins of the
invention may be membrane-associated or may be in soluble form.
[0011] The invention provides for nucleic acids encoding an OPG
binding protein, vectors and host cells expressing the polypeptide,
and method for producing recombinant OPG binding protein.
Antibodies or fragments thereof which specifically bind OPG binding
protein are also provided.
[0012] OPG binding proteins may be used in assays to quantitate OPG
levels in biological samples, identify cells and tissues that
display OPG binding protein, and identify new OPG and OPG binding
protein family members. Methods of identifying compounds which
interact with OPG binding protein are also provided. Such compounds
include nucleic acids, peptides, proteins, carbohydrates, lipids or
small molecular weight organic molecules and may act either as
agonists or antagonists of OPG binding protein activity.
[0013] OPG binding proteins are involved in osteoclast
differentiation and the level of osteoclast activity in turn
modulates bone resorption. OPG binding protein agonists and
antagonists modulate osteoclast formation and bone resorption and
may be used to treat bone diseases characterized by changes in bone
resorption, such as osteoporosis, hypercalcemia, bone loss due to
arthritis metastasis, immobilization or periodontal disease,
Paget's disease, osteopetrosis, prosthetic loosening and the like.
Pharmaceutical compositions comprising OPG binding proteins and OPG
binding protein agonists and antagonists are also encompassed by
the invention.
[0014] Receptors for OPG binding proteins have also been identified
from a marine cDNA library constructed from bone marrow cells which
bind to a fluorescent-label OPG binding protein. The receptors may
be used to identify agonists and antagonists of OPG binding protein
interactions with its receptor which may be used to treat bone
disease.
DESCRIPTION OF THE FIGURES
[0015] FIG. 1. (SEQ ID NOS: 1 and 2) Structure and sequence of the
32 D-F3 insert encoding OPG binding protein. Predicted
transmembrane domain and sites for asparagine-linked carbohydrate
chains are underlined.
[0016] FIG. 2. OPG binding protein expression in COS-7 cells
transfected with pcDNA/32D-F3. Cells were lipofected with
pcDNA/32D-F3 DNA, the assayed for binding to either goat anti-human
IgG1 alkaline phosphatase conjugate (secondary alone), human
OPG[22-201]-Fc plus secondary (OPG-Fc), or a chimeric ATAR
extracellular domain-Fc fusion protein (sATAR-Fc). ATAR is a new
member of the TNFR superfamily, and the sATAR-Fc fusion protein
serves as a control for both human IgG1 Fc domain binding, and
generic TNFR releated protein, binding to 32D cell surface
molecules.
[0017] FIG. 3. Expression of OPG binding protein in human tissues.
Northern blot analysis of human tissue mRNA (Clontech) using a
radiolabeled 32D-F3 derived hybridization probe. Relative molecular
mass is indicated at the left in kilobase pairs (kb). Arrowhead on
right side indicates the migration of an approximately 2.5 kb
transcript detected in lymph node mRNA. A very faint band of the
same mass is also detected in fetal liver.
[0018] FIG. 4. (SEQ ID NOS: 3 and 4) Structure and sequence of the
pcDNA/hu OPGbp 1.1 insert encoding the human OPG binding protein.
The predicted transmembrane domain and site for asparagine-linked
carbohydrate chains are underlined.
[0019] FIG. 5. Stimulation of osteoclast development in vitro from
bone marrow macrophage and ST2 cell cocultures treated with
recombinant murine OPG binding protein [158-316]. Cultures were
treated with varying concentrations of murine OPG binding protein
ranging from 1.6 to 500 ng/ml. After 8-10 days, cultures were
lysed, and TRAP activity was measured by solution assay. In
addition, some cultures were simultaneously treated with 1, 10,
100, 500, and 1000 ng/ml of recombinant murine OPG [22-401]-Fc
protein. Murine OPG binding protein induces a dose-dependent
stimulation in osteoclast formation, whereas OPG [22-401]-Fc
inhibits osteoclast formation.
[0020] FIG. 6. Stimulation of osteoclast development from bone
marrow precursors in vitro in the presence of M-CSF and murine OPG
binding protein [158-316]. Mouse bone marrow was harvested, and
cultured in the presence 250, 500, 1000, and 2000 U/ml of M-CSF.
Varying concentrations of OPG binding protein [158-316], ranging
from 1.6 to 500 ng/ml, were added to these same cultures.
Osteoclast development was measured by TRAP solution assay.
[0021] FIG. 7. Osteoclasts derived from bone marrow cells in the
presence of both M-CSF and OPG binding protein [158-316] resorb
bone in vitro. Bone marrow cells treated with either M-CSF, OPG
binding protein, or with both factors combined, were plated onto
bone slices in culture wells, and were allowed to develop into
mature osteoclasts. The resulting cultures were then stained with
Toluidine Blue (left column), or histochemically to detect TRAP
enzyme activity (right column). In cultures receiving both factors,
mature osteoclasts were formed that were capable of eroding bone as
judged by the presence of blue stained pits on the bone surface.
This correlated with the presence of multiple large,
multinucleated, TRAP positive cells.
[0022] FIG. 8. Graph showing the whole blood ionized calcium (iCa)
levels from mice injected with OPG binding protein, 51 hours after
the first injection, and in mice also receiving concurrent OPG
administration. OPG binding protein significantly and dose
dependently increased iCa levels. OPG (1 mg/kg/day) completely
blocked the increase in iCa at a dose of OPG binding protein of 5
ug/day, and partially blocked the increase at a dose of OPG binding
protein of 25 ug/day. (*), different to vehicle treated control
(p<0.05). (#), OPG treated iCa level significantly different to
level in mice receiving that dose of OPG binding protein alone
(p<0.05).
[0023] FIG. 9. Radiographs of the left femur and tibia in mice
treated with 0, 5, 25 or 100 g/day of OPG binding protein for 3.5
days. There is a dose dependent decrease in bone density evident
most clearly in the proximal tibial metaphysis of these mice, and
that is profound at a dose of 100 g/day.
[0024] FIG. 10. (SEQ ID NOS: 42 and 43) Murine ODAR cDNA sequence
and protein sequence. Nucleic acid sequence of the .about.2.1 kb
cDNA clone is shown, and translation of the 625 residue long open
reading frame indicated above. The hydrophobic signal peptide is
underlined, and the hydrophobic transmembrane sequence (residues
214-234) is in bold. Cysteine residues that comprise the
cysteine-rich repeat motifs in the extracellular domain are in
bold.
[0025] FIG. 11. Immunofluorescent staining of ODAR-Fc binding to
OPG binding protein transfected cells. COS-7 cells transfected with
OPG binding protein expression plasmid were incubated with human
IgG Fc (top panel), ODAR-Fc (middle panel) or OPG-Fc (bottom
panel). A FITC-labeled goat anti-human IgG Fc antibody was used as
a secondary antibody. Positive binding cells were examined by
confocal microscopy.
[0026] FIG. 12. Effects of ODAR-Fc on the generation of osteoclasts
from mouse bone marrow in vitro. Murine bone marrow cultures were
established as in Example 8 and exposed to OPG binding protein (5
ng/ml) and CSF-1 (30 ng/ml). Various concentrations of ODAR-Fc
ranging from 1500 ng/ml to 65 ng/ml were added. Osteoclast
formation was assessed by TRAP cytochemistry and the TRAP solution
assay after 5 days in culture.
[0027] FIG. 13. Bone mineral density in mice after treatment for
four days with ODAR-Fc at varying doses. Mice received ODAR-Fc by
daily subcutaneous injection in a phosphate buffered saline
vehicle. Mineral density was determined from bones fixed in 70%
ETOH at the proximal tibial metaphysis mice by peripheral
quantitative computed tomography (pQCT) (XCT-960M, Norland Medical
Systems, Ft Atkinson, Wis.). Two 0.5 mm cross-sections of bone, 1.5
mm and 2.0 mm from the proximal end of the tibia were analyzed
(XMICE 5.2, Stratec, Germany) to determine total bone mineral
density in the metaphysis. A soft tissue separation threshold of
1500 was used to define the boundary of the metaphyseal bone.
ODAR-Fc produced a significant increase in bone mineral density in
the proximal tibial metaphysis in a dose dependent manner. Group
n=4.
DETAILED DESCRIPTION OF THE INVENTION
[0028] The invention provides for a polypeptide referred to as an
OPG binding protein, which specifically binds OPG and is involved
in osteoclast differentiation. A cDNA clone encoding the murine
form of the polypeptide was identified from a library prepared from
a mouse myelomonocytic cell line 32-D and transfected into COS
cells. Transfectants were screened for their ability to bind to an
OPG[22-201]-Fc fusion polypeptide (Example 1). The nucleic acid
sequence revealed that OPG binding protein is a novel member of the
TNF family and is most closely related to AGP-1, a polypeptide
previously described in co-owned and co-pending U.S. Ser. No.
08/660,562, filed Jun. 7, 1996. (A polypeptide identical to AGP-1
and designated TRAIL is described in Wiley et al. Immunity 3,
673-682 (1995)). OPG binding protein is predicted to be a type II
transmembrane protein having a cytoplamsic domain at the amino
terminus, a transmembrane domain, and a carboxy terminal
extracellular domain (FIG. 1). The amino terminal cytoplasmic
domain spans about residues 1-48, the transmembrane domain spans
about residues 49-69 and the extracellular domain spans about
residues 70-316 as shown in FIG. 1 (SEQ ID NO: 2). The
membrane-associated protein specifically binds OPG (FIG. 2). Thus
OPG binding protein and OPG share many characteristics of a
receptor-ligand pair although it is possible that other
naturally-occurring receptors for OPG binding protein exist.
[0029] A DNA clone encoding human OPG binding protein was isolated
from a lymph node cDNA library. The human sequence (FIG. 4) is
homologous to the murine sequence. Purified soluble murine OPG
binding protein stimulated osteoclast formation in vitro and
induced hypercalcemia and bone resorption in vivo.
[0030] OPG binding protein refers to a polypeptide having an amino
acid sequence of mammalian OPG binding protein, or a fragment,
analog, or derivative thereof, and having at least the activity of
binding OPG. In preferred embodiments, OPG binding protein is of
murine or human origin. In another embodiment, OPG binding protein
is a soluble protein having, in one form, an isolated extracellular
domain separate from cytoplasmic and transmembrane domains. OPG
binding protein is involved in osteoclast differentiation and in
the rate and extent of bone resorption, and was found to stimulate
osteoclast formation and stimulate bone resorption.
[0031] Nucleic Acids
[0032] The invention provides for isolated nucleic acids encoding
OPG binding proteins. As used herein, the term nucleic acid
comprises cDNA, genomic DNA, wholly or partially synthetic DNA, and
RNA. The nucleic acids of the invention are selected from the group
consisting of:
[0033] a) the nucleic acids as shown in FIG. 1 (SEQ ID NO: 1) and
FIG. 4 (SEQ ID NO: 3);
[0034] b) nucleic acids which hybridize to the polypeptide coding
regions of the nucleic acids shown in FIG. 1 (SEQ ID NO: 1) and
FIG. 4 (SEQ ID NO: 3); and remain hybridized to the nucleic acids
under high stringency conditions; and
[0035] c) nucleic acids which are degenerate to the nucleic acids
of (a) or (b).
[0036] Nucleic acid hybridizations typically involve a multi-step
process comprising a first hybridization step to form nucleic acid
duplexes from single strands followed by a second hybridization
step carried out under more stringent conditions to selectively
retain nucleic acid duplexes having the desired homology. The
conditions of the first hybridization step are generally not
crucial, provided they are not of higher stringency than the second
hybridization step. Generally, the second hybridization is carried
out under conditions of high stringency, wherein "high stringency"
conditions refers to conditions of temperature and salt which are
about 12-20.degree. C. below the melting temperature (T.sub.m) of a
perfect hybrid of part or all of the complementary strands
corresponding to FIG. 1 (SEQ. ID. NO: 2) and FIG. 4 (SEQ ID NO: 4).
In one embodiment, "high stringency" conditions refer to conditions
of about 65.degree. C. and not more than about 1M Na.sup.+. It is
understood that salt concentration, temperature and/or length of
incubation may be varied in either the first or second
hybridization steps such that one obtains the hybridizing nucleic
acid molecules according to the invention. Conditions for
hybridization of nucleic acids and calculations of T.sub.m for
nucleic acid hybrids are described in Sambrook et al. Molecular
Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press,
New York (1989).
[0037] The nucleic acids of the invention may hybridize to part or
all of the polypeptide coding regions of OPG binding protein as
shown in FIG. 1 (SEQ ID NO: 2) and FIG. 4 (SEQ ID NO: 4); and
therefore may be truncations or extensions of the nucleic acid
sequences shown therein. Truncated or extended nucleic acids are
encompassed by the invention provided that they retain at least the
property of binding OPG. In one embodiment, the nucleic acid will
encode a polypeptide of at least about 10 amino acids. In another
embodiment, the nucleic acid will encode a polypeptide of at least
about 20 amino acids. In yet another embodiment, the nucleic acid
will encode a polypeptide of at least about 50 amino acids. The
hybridizing nucleic acids may also include noncoding sequences
located 5' and/or 3' to the OPG binding protein coding regions.
Noncoding sequences include regulatory regions involved in
expression of OPG binding protein, such as promoters, enhancer
regions, translational initiation sites, transcription termination
sites and the like.
[0038] In preferred embodiments, the nucleic acids of the invention
encode mouse or human OPG binding protein. Nucleic acids may encode
a membrane bound form of OPG binding protein or soluble forms which
lack a functional transmembrane region. The predicted transmembrane
region for murine OPG binding protein includes amino acid residues
49-69 inclusive as shown in FIG. 1 (SEQ. ID. NO: 2). The predicted
transmembrane region for human OPG binding protein includes
residues 49-69 as shown in FIG. 4 (SEQ ID NO: 4). Substitutions
which replace hydrophobic amino acid residues in this region with
neutral or hydrophilic amino acid residues would be expected to
disrupt membrane association and result in soluble OPG binding
protein. In addition, deletions of part or all the transmembrane
region would also be expected to produce soluble forms of OPG
binding protein. Nucleic acids encoding amino acid residues 70-316
as shown in FIG. 1 (SEQ ID NO: 1), or fragments and analogs
thereof, encompass soluble OPG binding proteins.
[0039] Nucleic acids encoding truncated forms of soluble human OPG
binding proteins are also included. Soluble forms include residues
69-317 as shown in FIG. 4 (SEQ ID NO: 3) and truncations thereof.
In one embodiment, N-terminal truncations generate polypeptides
from residues, 70-317, 71-317, 72-317, and so forth. In another
embodiment, nucleic acids encode soluble OPGbp comprising residues
69-317 and N-terminal truncations thereof up to OPGbp [158-317], or
alternatively, up to OPGbp [166-317].
[0040] Plasmid phuOPGbp 1.1 in E. coli strain DH10 encoding human
OPG binding protein was deposited with the American Type Culture
Collection, Rockville, Md. on Jun. 13, 1997 (ATCC Accession No.
98457).
[0041] Nucleic acid sequences of the invention may be used for the
detection of sequences encoding OPG binding protein in biological
samples. In particular, the sequences may be used to screen cDNA
and genomic libraries for related OPG binding protein sequences,
especially those from other species. The nucleic acids are also
useful for modulating levels of OPG binding protein by anti-sense
technology or in vivo gene expression. Development of transgenic
animals expressing OPG binding protein is useful for production of
the polypeptide and for the study of in vivo biological
activity.
[0042] Vectors and Host Cells
[0043] The nucleic acids of the invention will be linked with DNA
sequences so as to express biologically active OPG binding protein.
Sequences required for expression are known to those skilled in the
art and include promoters and enhancer sequences for initiation of
RNA synthesis, transcription termination sites, ribosome binding
sites for the initiation of protein synthesis, and leader sequences
for secretion. Sequences directing expression and secretion of OPG
binding protein may be homologous, i.e., the sequences are
identical or similar to those sequences in the genome involved in
OPG binding protein expression and secretion, or they may be
heterologous. A variety of plasmid vectors are available for
expressing OPG binding protein in host cells (see, for example,
Methods in Enzymology v. 185, Goeddel, D. V. ed., Academic Press
(1990)). For expression in mammalian host cells, a preferred
embodiment is plasmid pDSR.alpha. described in PCT Application No.
90/14363. For expression in bacterial host cells, preferred
embodiments include plasmids harboring the 1 ux promoter (see
co-owned and co-pending U.S. Ser. No. 08/577,778, filed Dec. 22,
1995). In addition, vectors are available for the tissue-specific
expression of OPG binding protein in transgenic animals. Retroviral
and adenovirus-based gene transfer vectors may also be used for the
expression of OPG binding protein in human cells for in vivo
therapy (see PCT Application No. 86/00922).
[0044] Procaryotic and eucaryotic host cells expressing OPG binding
protein are also provided by the invention. Host cells include
bacterial, yeast, plant, insect or mammalian cells. OPG binding
protein may also be produced in transgenic animals such as mice or
goats. Plasmids and vectors containing the nucleic acids of the
invention are introduced into appropriate host cells using
transfection or transformation techniques known to one skilled in
the art. Host cells may contain DNA sequences encoding OPG binding
protein as shown in FIG. 1 or a portion thereof, such as the
extracellular domain or the cytoplasmic domain. Nucleic acids
encoding OPG binding proteins may be modified by substitution of
codons which allow for optimal expression in a given host. At least
some of the codons may be so-called preference codons which do not
alter the amino acid sequence and are frequently found in genes
that are highly expressed. However, it is understood that codon
alterations to optimize expression are not restricted to the
introduction of preference codons. Examples of preferred mammalian
host cells for OPG binding protein expression include, but are not
limited to COS, CHOd-, 293 and 3T3 cells. A preferred bacterial
host cell is Escherichia coli.
[0045] Polypeptides
[0046] The invention also provides OPG binding protein as the
product of procaryotic or eucaryotic expression of an exogenous DNA
sequence, i.e., OPG binding protein is recombinant OPG binding
protein. Exogenous DNA sequences include cDNA, genomic DNA and
synthetic DNA sequences. OPG binding protein may be the product of
bacterial, yeast, plant, insect or mammalian cells expression, or
from cell-free translation systems. OPG binding protein produced in
bacterial cells will have an N-terminal methionine residue. The
invention also provides for a process of producing OPG binding
protein comprising growing procaryotic or eucaryotic host cells
transformed or transfected with nucleic acids encoding OPG binding
protein and isolating polypeptide expression products of the
nucleic acids.
[0047] Polypeptides which are mammalian OPG binding proteins or are
fragments, analogs or derivatives thereof are encompassed by the
invention. In a preferred embodiment, the OPG binding protein is
human OPG binding protein. A fragment of OPG binding protein refers
to a polypeptide having a deletion of one or more amino acids such
that the resulting polypeptide has at least the property of binding
OPG. Said fragments will have deletions originating from the amino
terminal end, the carboxy terminal end, and internal regions of the
polypeptide. Fragments of OPG binding protein are at least about
ten amino acids, at least about 20 amino acids, or at least about
50 amino acids in length. In preferred embodiments, OPG binding
protein will have a deletion of one or more amino acids from the
transmembrane region (amino acid residues 49-69 as shown in FIG.
1), or, alternatively, one or more amino acids from the
amino-terminus up to and/or including the transmembrane region
(amino acid residues 1-49 as shown in FIG. 1). In another
embodiment, OPG binding protein is a soluble protein comprising,
for example, amino acid residues 69-316, or 70-316, or N-terminal
or C-terminal truncated forms thereof, which retain OPG binding
activity. OPG binding protein is also a human soluble protein as
shown in FIG. 4 comprising residues 69-317 as shown in FIG. 4 and
N-terminal truncated forms thereof, e.g., 70-517, 71-517, 71-317,
72-317 and so forth. In a preferred embodiment, the soluble human
OPG binding protein comprising residues 69-317 and N-terminal
truncation thereof up to OPGbp [158-317], or alternatively up to
OPG [166-317].
[0048] An analog of an OPG binding protein refers to a polypeptide
having a substitution or addition of one or more amino acids such
that the resulting polypeptide has at least the property of binding
OPG. Said analogs will have substitutions or additions at any place
along the polypeptide. Preferred analogs include those of soluble
OPG binding proteins. Fragments or analogs may be naturally
occurring, such as a polypeptide product of an allelic variant or a
mRNA splice variant, or they may be constructed using techniques
available to one skilled in the art for manipulating and
synthesizing nucleic acids. The polypeptides may or may not have an
amino terminal methionine residue
[0049] Also included in the invention are derivatives of OPG
binding protein which are polypeptides that have undergone
post-translational modifications (e.g., addition of N-linked or
O-linked carbohydrate chains, processing of N-terminal or
C-terminal ends), attachment of chemical moieties to the amino acid
backbone, chemical modifications of N-linked or O-linked
carbohydrate chains, and addition of an N-terminal methionine
residue as a result of procaryotic host cell expression. In
particular, chemically modified derivatives of OPG binding protein
which provide additional advantages such as increased stability,
longer circulating time, or decreased immunogenicity are
contemplated. Of particular use is modification with water soluble
polymers, such as polyethylene glycol and derivatives thereof (see
for example U.S. Pat. No. 4,179,337). The chemical moieties for
derivitization may be selected from water soluble polymers such as
polyethylene glycol, ethylene glycol/propylene glycol copolymers,
carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
The polypeptides may be modified at random positions within the
molecule, or at predetermined positions within the molecule and may
include one, two, three or more attached chemical moieties.
Polypeptides may also be modified at pre-determined positions in
the polypeptide, such as at the amino terminus, or at a selected
lysine or arginine residue within the polypeptide. Other chemical
modifications provided include a detectable label, such as an
enzymatic, fluorescent, isotopic or affinity label to allow for
detection and isolation of the protein.
[0050] OPG binding protein chimeras comprising part or all of an
OPG binding protein amino acid sequence fused to a heterologous
amino acid sequence are also included. The heterologous sequence
may be any sequence which allows the resulting fusion protein to
retain the at least the activity of binding OPG. In a preferred
embodiment, the carboxy terminal extracellular domain of OPG
binding protein is fused to a heterologous sequence. Such sequences
include heterologous cytoplasmic domains that allow for alternative
intracellular signaling events, sequences which promote
oligomerization such as the Fc region of IgG, enzyme sequences
which provide a label for the polypeptide, and sequences which
provide affinity probes, such as an antigen-antibody
recognition.
[0051] The polypeptides of the invention are isolated and purified
from tissues and cell lines which express OPG binding protein,
either extracted from lysates or from conditioned growth medium,
and from transformed host cells expressing OPG binding protein. OPG
binding protein may be obtained from murine myelomonocytic cell
line 32-D (ATCC accession no. CRL-11346). Human OPG binding
protein, or nucleic acids encoding same, may be isolated from human
lymph node or fetal liver tissue. Isolated OPG binding protein is
free from association with human proteins and other cell
constituents.
[0052] A method for the purification of OPG binding protein from
natural sources (e.g. tissues and cell lines which normally express
OPG binding protein) and from transfected host cells is also
encompassed by the invention. The purification process may employ
one or more standard protein purification steps in an appropriate
order to obtain purified protein. The chromatography steps can
include ion exchange, gel filtration, hydrophobic interaction,
reverse phase, chromatofocusing, affinity chromatography employing
an anti-OPG binding protein antibody or biotin-streptavidin
affinity complex and the like.
[0053] Antibodies
[0054] Antibodies specifically binding the polypeptides of the
invention are also encompassed by the invention. The antibodies may
be produced by immunization with full-length OPG binding protein,
soluble forms of OPG binding protein, or a fragment thereof. The
antibodies of the invention may be polyclonal or monoclonal, or may
be recombinant antibodies, such as chimeric antibodies wherein the
murine constant regions on light and heavy chains are replaced by
human sequences, or CDR-grafted antibodies wherein only the
complementary determining regions are of murine origin. Antibodies
of the invention may also be human antibodies prepared, for
example, by immunization of transgenic animals capable of producing
human antibodies (see, for example, PCT Application No.
WO93/12227). The antibodies are useful for detecting OPG binding
protein in biological samples, thereby allowing the identification
of cells or tissues which produce the protein In addition,
antibodies which bind to OPG binding protein and block interaction
with other binding compounds may have therapeutic use in modulating
osteoclast differentiation and bone resorption.
[0055] Antibodies to the OPG binding protein may be useful in
treatment of bone diseases such as, osteoporosis and Paget's
disease. Antibodies can be tested for binding to the OPG binding
protein in the absence or presence of OPG and examined for their
ability to inhibit ligand (OPG binding protein) mediated
osteoclastogenesis and/or bone resorption. It is also anticipated
that the peptides themselves may act as an antagonist of the
ligand:receptor interaction and inhibit ligand-mediated
osteoclastogenesis, and peptides of the OPG binding protein will be
explored for this purpose as well.
[0056] Compositions
[0057] The invention also provides for pharmaceutical compositions
comprising a therapeutically effective amount of the OPG binding
protein of the invention together with a pharmaceutically
acceptable diluent, carrier, solubilizer, emulsifier, preservative
and/or adjuvant. The invention also provides for pharmaceutical
compositions comprising a therapeutically effective amount of an
OPG binding protein agonist or antagonist. The term
"therapeutically effective amount" means an amount which provides a
therapeutic effect for a specified condition and route of
administration. The composition may be in a liquid or lyophilized
form and comprises a diluent (Tris, acetate or phosphate buffers)
having various pH values and ionic strengths, solubilizer such as
Tween or Polysorbate, carriers such as human serum albumin or
gelatin, preservatives such as thimerosal or benzyl alcohol, and
antioxidants such as ascorbic acid or sodium metabisulfite.
Selection of a particular composition will depend upon a number of
factors, including the condition being treated, the route of
administration and the pharmacokinetic parameters desired. A more
extensive survey of component suitable for pharmaceutical
compositions is found in Remington's Pharmaceutical Sciences, 18th
ed. A. R. Gennaro, ed. Mack, Easton, Pa. (1980).
[0058] In a preferred embodiment, compositions comprising soluble
OPG binding proteins are also provided. Also encompassed are
compositions comprising soluble OPG binding protein modified with
water soluble polymers to increase solubility, stability, plasma
half-life and bioavailability. Compositions may also comprise
incorporation of soluble OPG binding protein into liposomes,
microemulsions, micelles or vesicles for controlled delivery over
an extended period of time. Soluble OPG binding protein may be
formulated into microparticles suitable for pulmonary
administration.
[0059] Compositions of the invention may be administered by
injection, either subcutaneous, intravenous or intramuscular, or by
oral, nasal, pulmonary or rectal administration. The route of
administration eventually chosen will depend upon a number of
factors and may be ascertained by one skilled in the art.
[0060] The invention also provides for pharmaceutical compositions
comprising a therapeutically effective amount of the nucleic acids
of the invention together with a pharmaceutically acceptable
adjuvant. Nucleic acid compositions will be suitable for the
delivery of part or all of the coding region of OPG binding protein
and/or flanking regions to cells and tissues as part of an
anti-sense therapy regimen.
[0061] Methods of Use
[0062] OPG binding proteins may be used in a variety of assays for
detecting OPG and characterizing interactions with OPG. In general,
the assay comprises incubating OPG binding protein with a
biological sample containing OPG under conditions which permit
binding to OPG to OPG binding protein, and measuring the extent of
binding. OPG may be purified or present in mixtures, such as in
body fluids or culture medium. Assays may be developed which are
qualitative or quantitative, with the latter being useful for
determining the binding parameters (affinity constants and
kinetics) of OPG to OPG binding protein and for quantitating levels
of biologically active OPG in mixtures. Assays may also be used to
evaluate the binding of OPG to fragments, analogs and derivatives
of OPG binding protein and to identify new OPG and OPG binding
protein family members.
[0063] Binding of OPG to OPG binding protein may be carried out in
several formats, including cell-based binding assays, membrane
binding assays, solution-phase assays and immunoassays. In general,
trace levels of labeled OPG are incubated with OPG binding protein
samples for a specified period of time followed by measurement of
bound OPG by filtration, electrochemiluminescent (ECL, ORIGEN
system by IGEN), cell-based or immunoassays. Homogeneous assay
technologies for radioactivity (SPA; Amersham) and time resolved
fluorescence (HTRF, Packard) can also be implemented. Binding is
detected by labeling OPG or an anti-OPG antibody with radioactive
isotopes (125I, 35S, 3H), fluorescent dyes (fluorescein),
lanthamide (Eu3+) chelates or cryptates, orbipyridyl-ruthenium
(Ru2+) complexes. It is understood that the choice of a labeled
probe will depend upon the detection system used. Alternatively,
OPG may be modified with an unlabeled epitope tag (e.g., biotin,
peptides, His.sub.61 myc) and bound to proteins such as
streptavidin, anti-peptide or anti-protein antibodies which have a
detectable label as described above.
[0064] In an alternative method, OPG binding protein may be assayed
directly using polyclonal or monoclonal antibodies to OPG binding
proteins in an immunoassay. Additional forms of OPG binding
proteins containing epitope tags as described above may be used in
solution and immunoassays.
[0065] Methods for identifying compounds which interact with OPG
binding protein are also encompassed by the invention. The method
comprises incubating OPG binding protein with a compound under
conditions which permit binding of the compound to OPG binding
protein, and measuring the extent of binding. The compound may be
substantially purified or present in a crude mixture. Binding
compounds may be nucleic acids, proteins, peptides, carbohydrates,
lipids or small molecular weight organic compounds. The compounds
may be further characterized by their ability to increase or
decrease OPG binding protein activity in order to determine whether
they act as an agonist or an antagonist.
[0066] OPG binding proteins are also useful for identification of
intracellular proteins which interact with the cytoplasmic domain
by a yeast two-hybrid screening process. As an example, hybrid
constructs comprising DNA encoding the N-terminal 50 amino acids of
an OPG binding protein fused to a yeast GAL4-DNA binding domain may
be used as a two-hybrid bait plasmid. Positive clones emerging from
the screening may be characterized further to identify interacting
proteins. This information may help elucidate a intracellular
signaling mechanism associated with OPG binding protein and provide
intracellular targets for new drugs that modulate bone
resorption.
[0067] OPG binding protein may be used to treat conditions
characterized by excessive bone density. The most common condition
is osteopetrosis in which a genetic defect results in elevated bone
mass and is usually fatal in the first few years of life.
Osteopetrosis is preferably treated by administration of soluble
OPG binding protein.
[0068] The invention also encompasses modulators (agonists and
antagonists) of OPG binding protein and the methods for obtaining
them. An OPG binding protein modulator may either increase or
decrease at least one activity associated with OPG binding protein,
such as ability to bind OPG or some other interacting molecule or
to regulate osteoclast maturation. Typically, an agonist or
antagonist may be a co-factor, such as a protein, peptide,
carbohydrate, lipid or small molecular weight molecule, which
interacts with OPG binding protein to regulate its activity.
Potential polypeptide antagonists include antibodies which react
with either soluble or membrane-associated forms of OPG binding
protein, and soluble forms of OPG binding protein which comprise
part or all of the extracellular domain of OPG binding protein.
Molecules which regulate OPG binding protein expression typically
include nucleic acids which are complementary to nucleic acids
encoding OPG binding protein and which act as anti-sense regulators
of expression.
[0069] OPG binding protein is involved in controlling formation of
mature osteoclasts, the primary cell type implicated in bone
resorption. An increase in the rate of bone resorption (over that
of bone formation) can lead to various bone disorders collectively
referred to as osteopenias, and include osteoporosis,
osteomyelitis, hypercalcemia, osteopenia brought on by surgery or
steroid administration, Paget's disease, osteonecrosis, bone loss
due to rheumatoid arthritis, periodontal bone loss, immobilization,
prosthetic loosing and osteolytic metastasis. Conversely, a
decrease in the rate of bone resorption can lead to osteopetrosis,
a condition marked by excessive bone density. Agonists and
antagonists of OPG binding protein modulate osteoclast formation
and may be administered to patients suffering from bone disorders.
Agonists and antagonists of OPG binding protein used for the
treatment of osteopenias may be administered alone or in
combination with a therapeutically effective amount of a bone
growth promoting agent including bone morphogenic factors
designated BMP-1 to BMP-12, transforming growth factory and
TGF-.beta. family members, fibroblast growth factors FGF-1 to
FGF-10, interleukin-1 inhibitors, TNF.alpha. inhibitors,
parathyroid hormone, E series prostaglandins, bisphosphonates and
bone-enhancing minerals such as fluoride and calcium. Antagonists
of OPG binding proteins may be particularly useful in the treatment
of osteopenia.
[0070] Receptors for Osteoproteqerin Binding Proteins
[0071] The invention also provides for receptors which interact
with OPG binding proteins. More particularly, the invention
provides for an osteoclast differentiation and activation receptor
(ODAR). ODAR is a transmembrane polypeptide which shows highest
degree of homology to CD40, a TNF receptor family member. The
nucleic acid sequence of murine ODAR and encoded polypeptide is
shown in FIG. 10. The human homolog of murine ODAR may be readily
isolated by hybridization screening of a human cDNA or genomic
library with the nucleic acid sequence of FIG. 10. Procedures for
cloning human ODAR are similar to those described in Example 5 for
cloning human OPG binding proteins. The human homolog of the
polypeptide shown in FIG. 10 has appeared in Anderson et al.
(Nature 390, 175-179 (1997)) and is referred to therein as RANK.
RANK is characterized as a type I transmembrane protein having
homology to TNF receptor family members and is involved in
dendritic cell function.
[0072] Evidence for the interaction of ODAR and OPG binding protein
is shown in Example 13. A soluble form of ODAR (ODAR-Fc fusion
protein) prevents osteoclast maturation in vitro (FIG. 12) and
increases bone density in normal mice after subcutaneous injection
(FIG. 13). The results are consistent with OPG binding protein
interacting with and activating ODAR to promote osteoclast
maturation.
[0073] Osteoclast development and the rate and extent of bone
resorption are regulated by the interaction of OPG binding protein
and ODAR. Compounds which decrease or block the interaction of OPG
binding protein and ODAR are potential antagonists of OPG binding
protein activity and may disrupt osteoclast development leading to
decreased bone resorption. Alternatively, compounds which increase
the interaction of OPG binding protein and ODAR are potential
agonists which promote osteoclast development and enhance bone
resorption.
[0074] A variety of assays may be used to measure the interaction
of OPG binding protein and ODAR in vitro using purified proteins.
These assays may be used to screen compounds for their ability to
increase or decrease the rate or extent of binding to ODAR by OPG
binding protein. In one type of assay, ODAR protein can be
immobilized by attachment to the bottom of the wells of a
microtiter plate. Radiolabeled OPG binding protein (for example,
iodinated OPG binding protein) and the test compound(s) can then be
added either one at a time (in either order) or simultaneously to
the wells. After incubation, the wells can be washed and counted
using a scintillation counter for radioactivity to determine the
extent of binding to ODAR by OPG binding protein in the presence of
the test compound. Typically, the compound will be tested over a
range of concentrations, and a series of control wells lacking one
or more elements of the test assays can be used for accuracy in
evaluation of the results. An alternative to this method involves
reversing the "positions" of the proteins, i.e., immobilizing OPG
binding protein to the mictrotiter plate wells, incubating with the
test compound and radiolabeled ODAR, and determining the extent of
ODAR binding (see, for example, chapter 18 of Current Protocols in
Molecular Biology, Ausubel et al., eds., John Wiley & Sons, New
York, N.Y. [1995]).
[0075] As an alternative to radiolabelling, OPG binding protein or
ODAR may be conjugated to biotin and the presence of biotinylated
protein can then be detected using streptavidin linked to an
enzyme, such as horse radish peroxidase [HRP] or alkaline
phosphatase [AP], that can be detected colorometrically, or by
fluorescent tagging of streptavidin. An antibody directed to OPG
binding protein or ODAR that is conjugated to biotin may also be
used and can be detected after incubation with enzyme-linked
streptavidin linked to AP or HRP OPG binding protein and ODAR may
also be immobilized by attachment to agarose beads, acrylic beads
or other types of such inert substrates. The substrate-protein
complex can be placed in a solution containing the complementary
protein and the test compound; after incubation, the beads can be
precipitated by centrifugation, and the amount of binding between
OPG binding protein and ODAR can be assessed using the methods
described above. Alternatively, the substrate-protein complex can
be immobilized in a column and the test molecule and complementary
protein passed over the column. Formation of a complex between OPG
binding protein and ODAR can then be assessed using any of the
techniques set forth above, i.e., radiolabeling, antibody binding,
or the like.
[0076] Another type of in vitro assay that is useful for
identifying a compound which increases or decreases formation of an
ODAR/OPG binding protein complex is a surface plasmon resonance
detector system such as the Biacore assay system (Pharmacia,
Piscataway, N.J.). The Biacre system may be carried out using the
manufacturer's protocol. This assay essentially involves covalent
binding of either OPG binding protein or ODAR to a dextran-coated
sensor chip which is located in a detector. The test compound and
the other complementary protein can then be injected into the
chamber containing the sensor chip either simultaneously or
sequentially and the amount of complementary protein that binds can
be assessed based on the change in molecular mass which is
physically associated with the dextran-coated side of the of the
sensor chip; the change in molecular mass can be measured by the
detector system.
[0077] In some cases, it may be desirable to evaluate two or more
test compounds together for use in increasing or decreasing
formation of ODAR/OPG binding protein complex. In these cases, the
assays set forth above can be readily modified by adding such
additional test compound(s) either simultaneously with, or
subsequently to, the first test compound. The remainder of steps in
the assay are as set forth above.
[0078] In vitro assays such as those described above may be used
advantageously to screen rapidly large numbers of compounds for
effects on complex formation by ODAR and OPG binding protein. The
assays may be automated to screen compounds generated in phage
display, synthetic peptide and chemical synthesis libraries.
[0079] Compounds which increase or decrease complex formation of
OPG binding protein and ODAR may also be screened in cell culture
using ODAR-bearing cells and cell lines. Cells and cell lines may
be obtained from any mammal, but preferably will be from human or
other primate, canine, or rodent sources. ODAR containing cells
such as osteoclasts may be enriched from other cell types by
affinity chromatography using publicly available procedures.
Attachment of OPG binding protein to ODAR-bearing cells is
evaluated in the presence or absence of test compounds and the
extent of binding may be determined by, for example, flow cytometry
using a biotinylated antibody to OPG binding protein.
Alternatively, a mouse or human osteoclast culture may be
established as described in Example 8 and test compounds may be
evaluated for their ability to block osteoclast maturation
stimulated by addition of CSF-1 and OPG binding protein. Cell
culture assays may be used advantageously to further evaluate
compounds that score positive in protein binding assays described
above.
[0080] Compounds which increase or decrease the interaction of OPG
binding protein with ODAR may also be evaluated for in vivo
activity by administration of the compounds to mice followed by
measurements of bone density using bone scanning densitometry or
radiography. Procedures for measuring bone density are described in
PCT publication WO97/23614 and in Example 13.
[0081] The invention provides for compounds which decrease or block
the interaction of OPG binding protein and ODAR and are antagonists
of osteoclast formation. Such compounds generally fall into two
groups. One group includes those compounds which are derived from
OPG binding protein or which interact with OPG binding protein.
These have been described above. A second group includes those
compounds which are derived from ODAR or which interact with ODAR.
Examples of compounds which are antagonists of ODAR include nucleic
acids, proteins, peptides, carbohydrates, lipids or small molecular
weight organic compounds.
[0082] Antagonists of ODAR may be compounds which bind at or near
one or more binding sites for OPG bp in the ODAR extracellular
domain and decrease or completely block complex formation. Those
regions on ODAR that are involved in complex formation with OPG
binding protein may be identified by analogy with the structure of
the homologous TNF.beta./TNF-R55 complex which has been described
in Banner et al. (Cell 73, 431-445 (1993)). For example, the
structure of the TNF.beta./TNF-R55 complex may be used to identify
regions of OPG binding protein and ODAR that are involved in
complex formation. Compounds may then be designed which
preferentially bind to the regions involved in complex formation
and act as antagonists. In one approach set forth in Example 11,
peptide antigens were designed for use in raising antibodies to OPG
binding protein that act as antagonists. These antibodies are
expected to bind to OPG binding protein and block complex formation
with ODAR. In a similar approach, peptide antigens based upon ODAR
structure may be used to raise anti-ODAR antibodies that act as
antagonists.
[0083] Anatoginists of ODAR may also bind to ODAR at locations
distinct from the binding site(s) for OPG bp and induce
conformational changes in ODAR polypeptide that result in decreased
or nonproductive complex formation with OPG binding proteins.
[0084] In one embodiment, an antagonist is a soluble form of ODAR
lacking a functional transmembrane domain. Soluble forms of ODAR
may have a deletion of one or more amino acids in the transmembrane
domain (amino acids 214-234 as shown in FIG. 10). Soluble ODAR
polypeptides may have part or all of the extracellular domain and
are capable of binding OPG binding protein. Optionally, soluble
ODAR may be part of a chimeric protein, wherein part or all of the
extracellular domain of ODAR is fused to a heterologous amino acid
sequence. In one embodiment, the heterologous amino acid sequence
is an Fc region from human IgG.
[0085] Modulators (agonists and antagonists) of ODAR may be used to
prevent or treat osteopenia, including osteoporosis, osteomyelitis,
hypercalcemia of malignancy, osteopenia brought on by surgery or
steroid administration, Paget's disease, osteonecrosis, bone loss
due to rheumatoid arthritis, periodontal bone loss, immobilization,
prosthetic loosing and osteolytic metastasis. Agonists and
antagonists of ODAR used for the treatment of osteopenias may be
administered alone or in combination with a therapeutically
effective amount of a bone growth promoting agent including bone
morphogenic factors designated BMP-1 to BMP-12, transforming growth
factory and TGF-.beta. family members, fibroblast growth factors
FGF-1 to FGF-10, interleukin-1 inhibitors, TNF.alpha. inhibitors,
parathyroid hormone, E series prostaglandins, bisphosphonates,
estrogens, SERMs and bone-enhancing minerals such as fluoride and
calcium. Antagonists of ODAR are particularly useful in the
treatment of osteopenia.
[0086] The following examples are offered to more fully illustrate
the invention, but are not construed as limiting the scope
thereof.
EXAMPLE 1
Identification of a Cell Line Source for an OPG Binding Protein
[0087] Osteoprotegerin (OPG) negatively regulates
osteoclastogenesis in vitro and in vivo. Since OPG is a
TNFR-related protein, it is likely to interact with a TNF-related
family member while mediating its effects. With one exception, all
known members of the TNF superfamily are type II transmembrane
proteins expressed on the cell surface. To identify a source of an
OPG binding protein, recombinant OPG-Fc fusion proteins were used
as immunoprobes to screen for OPG binding proteins located on the
surface of various cell lines and primary hematopoietic cells.
[0088] Cell lines that grew as adherent cultures in vitro were
treated using the following methods: Cells were plated into 24 well
tissue culture plates (Falcon), then allowed to grow to
approximately 80% confluency. The growth media was then removed,
and the adherent cultures were washed with phosphate buffered
saline (PBS) (Gibco) containing 1% fetal calf serum (FCS).
Recombinant mouse OPG [22-194]-Fc and human OPG [22-201]-Fc fusion
proteins (see U.S. Ser. No. 08/706,945 filed Sep. 3, 1996) were
individually diluted to 5 ug/ml in PBS containing 1% FCS, then
added to the cultures and allowed to incubate for 45 min at
0.degree. C. The OPG-Fc fusion protein solution was discarded, and
the cells were washed in PBS-FCS solution as described above. The
cultures were then exposed to phycoeyrthrin-conguated goat F(ab')
anti-human IgG secondary antibody (Southern Biotechnology
Associates Cat. # 2043-09) diluted into PBS-FCS. After a 30-45 min
incubation at 0.degree. C., the solution was discarded, and the
cultures were washed as described above. The cells were then
analyzed by immunofluorescent microscopy to detect cell lines which
express a cell surface OPG binding protein.
[0089] Suspension cell cultures were analyzed in a similar manner
with the following modifications: The diluent and wash buffer
consisted of calcium- and magnesium-free phosphate buffered saline
containing 1% FCS. Cells were harvested from exponentially
replicating cultures in growth media, pelleted by centrifugation,
then resuspended at 1.times.10.sup.7 cells/ml in a 96 well
microtiter tissue culture plate (Falcon). Cells were sequentially
exposed to recombinant OPG-Fc fusion proteins, then secondary
antibody as described above, and the cells were washed by
centrifugation between each step. The cells were then analyzed by
fluorescence activated cell sorting (FACS) using a Becton Dickinson
FACscan.
[0090] Using this approach, the murine myelomonocytic cell line 32D
(ATCC accession no. CRL-11346) was found to express a surface
molecule which could be detected with both the mouse OPG[22-194]-Fc
and the human OPG[22-201]-Fc fusion proteins. Secondary antibody
alone did not bind to the surface of 32D cells nor did purified
human IgG1 Fc, indicating that binding of the OPG-Fc fusion
proteins was due to the OPG moiety. This binding could be competed
in a dose dependent manner by the addition of recombinant murine or
human OPG[22-401] protein. Thus the OPG region required for its
biological activity is capable of specifically binding to a
32D-derived surface molecule.
EXAMPLE 2
Expression Cloning of a Murine OPG Binding Protein
[0091] A cDNA library was prepared from 32D mRNA, and ligated into
the mammalian expression vector pcDNA3.1(+) (Invitrogen, San Diego,
Calif.). Exponentially growing 32D cells maintained in the presence
of recombinant interleukin-3 were harvested, and total cell RNA was
purified by acid guanidinium thiocyanate-phenol-chloroform
extraction (Chomczynski and Sacchi. Anal. Biochem. 162, 156-159,
(1987)). The poly (A+) mRNA fraction was obtained from the total
RNA preparation by adsorption to, and elution from, Dynabeads Oligo
(dT).sub.25 (Dynal Corp) using the manufacturer's recommended
procedures. A directional, oligo-dT primed cDNA library was
prepared using the Superscript Plasmid System (Gibco BRL,
Gaithersburg, Md.) using the manufacturer's recommended procedures.
The resulting cDNA was digested to completion with Sal I and Not I
restriction endonuclease, then fractionated by size exclusion gel
chromatography. The highest molecular weight fractions were
selected, and then ligated into the polyliker region of the plasmid
vector PcDNA3.1(+) (Invitrogen, San Diego, Calif.). This vector
contains the CMV promoter upstream of multiple cloning site, and
directs high level expression in eukaryotic cells. The library was
then electroporated into competent E. coli (ElectroMAX DH10B,
Gibco, N.Y.), and titered on LB agar containing 100 ug/ml
ampicillin. The library was then arrayed into segregated pools
containing approximately 1000 clones/pool, and 1.0 ml cultures of
each pool were grown for 16-20 hr at 37.degree. C. Plasmid DNA from
each culture was prepared using the Qiagen Qiawell 96 Ultra Plasmid
Kit (catalog #16191) following manufacturer's recommended
procedures.
[0092] Arrayed pools of 32D cDNA expression library were
individually lipofected into COS-7 cultures, then assayed for the
acquisition of a cell surface OPG binding protein. To do this,
COS-7 cells were plated at a density of 1.times.10.sup.6 per ml in
six-well tissue culture plates (Costar), then cultured overnight in
DMEM (Gibco) containing 10% FCS. Approximately 2 .mu.g of plasmid
DNA from each pool was diluted into 0.5 ml of serum-free DMEM, then
sterilized by centrifugation through a 0.2 .mu.m Spin-X column
(Costar). Simultaneously, 10 .mu.l of Lipofectamine (Life
Technologies Cat # 18324-012) was added to a separate tube
containing 0.5 ml of serum-free DMEM. The DNA and Lipofectamine
solutions were mixed, and allowed to incubate at RT for 30 min. The
COS-7 cell cultures were then washed with serum-free DMEM, and the
DNA-lipofectamine complexes were exposed to the cultures for 2-5 hr
at 37.degree. C. After this period, the media was removed, and
replaced with DMEM containing 10% FCS. The cells were then cultured
for 48 hr at 37.degree. C.
[0093] To detect cultures that express an OPG binding protein, the
growth media was removed, and the cells were washed with PBS-FCS
solution. A 1.0 ml volume of PBS-FCS containing 5 .mu.g/ml of human
OPG[22-201]-Fc fusion protein was added to each well and incubated
at RT for 1 hr. The cells were washed three times with PBS-FCS
solution, and then fixed in PBS containing 2% paraformaldehyde and
0.2% glutaraldehyde in PBS at RT for 5 min. The cultures were
washed once with PBS-FCS, then incubated for 1 hr at 65.degree. C.
while immersed in PBS-FCS solution. The cultures were allowed to
cool, and the PBS-FCS solution was aspirated. The cultures were
then incubated with an alkaline-phosphatase conjugated goat
anti-human IgG (Fc specific) antibody (SIGMA Product # A-9544) at
Rt for 30 min, then washed three-times with 20 mM Tris-Cl (pH 7.6),
and 137 mM NaCl. Immune complexes that formed during these steps
were detected by assaying for alkaline phosphatase activity using
the Fast Red TR/AS-MX Substrate Kit (Pierce, Cat. # 34034)
following the manufacturer's recommended procedures.
[0094] Using this approach, a total of approximately 300,000
independent 32D cDNA clones were screened, represented by 300
transfected pools of 1000 clones each. A single well was identified
that contained cells which acquired the ability to be specifically
decorated by the OPG-Fc fusion protein. This pool was subdivided by
sequential rounds of sib selection, yielding a single plasmid clone
32D-F3 (FIG. 1). 32D-F3 plasmid DNA was then transfected into COS-7
cells, which were immunostained with either FITC-conjugated goat
anti-human IgG secondary antibody alone, human OPG[22-201]-Fc
fusion protein plus secondary, or with ATAR-Fc fusion protein (ATAR
also known as HVEM; Montgomery et al. Cell 87, 427-436 (1996))
(FIG. 2). The secondary antibody alone did not bind to COS-7/32D-F3
cells, nor did the ATAR-Fc fusion protein. Only the OPG Fc fusion
protein bound to the COS-7/32D-F3 cells, indicating that 32D-F3
encoded an OPG binding protein displayed on the surface of
expressing cells.
EXAMPLE 3
OPG Binding Protein Sequence
[0095] The 32D-F3 clone isolated above contained an approximately
2.3 kb cDNA insert (FIG. 1), which was sequenced in both directions
on an Applied Biosystems 373A automated DNA sequencer using
primer-driven Taq dye-terminator reactions (Applied Biosystems)
following the manufacturer's recommended procedures. The resulting
nucleotide sequence obtained was compared to the DNA sequence
database using the FASTA program (GCG, University of Wisconsin),
and analyzed for the presence of long open reading frames (LORF's)
using the "Six-way open reading frame" application (Frames) (GCG,
University of Wisconsin). A LORF of 316 amino acid (aa) residues
beginning at methionine was detected in the appropriate
orientation, and was preceded by a 5' untranslated region of about
150 bp. The 5' untranslated region contained an in-frame stop codon
upstream of the predicted start codon. This indicates that the
structure of the 32D-F3 plasmid is consistent with its ability to
utilize the CMV promoter region to direct expression of a 316 aa
gene product in mammalian cells.
[0096] The predicted OPG binding protein sequence was then compared
to the existing database of known protein sequences using a
modified version of the FASTA program (Pearson, Meth. Enzymol. 183,
63-98 (1990)). The amino acid sequence was also analyzed for the
presence of specific motifs conserved in all known members of the
tumor necrosis factor (TNF) superfamily using the sequence profile
method of (Gribskov et al. Proc. Natl. Acad. Sci. USA 83, 4355-4359
(1987)), as modified by Luethy et al. Protein Sci. 3, 139-146
(1994)). There appeared to be significant homology throughout the
OPG binding protein to several members of the TNF superfamily. The
mouse OPG binding protein appear to be most closely related to the
mouse and human homologs of both TRAIL and CD40 ligand. Further
analysis of the OPG binding protein sequence indicated a strong
match to the TNF superfamily, with a highly significant Z score of
19.46.
[0097] The OPG binding protein amino acid sequence contains a
probable hydrophobic transmembrane domain that begins at a M49 and
extends to L69. Based on this configuration relative to the
methionine start codon, the OPG binding protein is predicted to be
a type II transmembrane protein, with a short N-terminal
intracellular domain, and a longer C-terminal extracellular domain
(FIG. 4). This would be similar to all known TNF family members,
with the exception of lymphotoxin alpha (Nagata and Golstein,
Science 267, 1449-1456 (1995)).
EXAMPLE 4
Expression of Human OPG Binding Protein mRNA
[0098] Multiple human tissue northern blots (Clontech, Palo Alto,
Calif.) were probed with a .sup.32P-dCTP labeled 32D-F3 restriction
fragment to detect the size of the human transcript and to
determine patterns of expression. Northern blots were prehybridized
in 5.times.SSPE, 50% formamide, 5.times. Denhardt's solution, 0.5%
SDS, and 100 .mu.g/ml denatured salmon sperm DNA for 2-4 hr at
42.degree. C. The blots were then hybridized in 5.times.SSPE, 50%
formamide, 2.times. Denhardt's solution, 0.1% SDS, 100 .mu.g/ml
denatured salmon sperm DNA, and 5 ng/ml labeled probe for 18-24 hr
at 42.degree. C. The blots were then washed in 2.times.SSC for 10
min at RT, 1.times.SSC for 10 min at 50.degree. C., then in
0.5.times.SSC for 10-15 min.
[0099] Using a probe derived from the mouse cDNA and hybridization
under stringent conditions, a predominant mRNA species with a
relative molecular mass of about 2.5 kb was detected in lymph nodes
(FIG. 3). A faint signal was also detected at the same relative
molecular mass in fetal liver mRNA. No OPG binding protein
transcripts were detected in the other tissues examined. The data
suggest that expression of OPG binding protein mRNA was extremely
restricted in human tissues. The data also indicate that the cDNA
clone isolated is very close to the size of the native transcript,
suggesting 32D-F3 is a full length clone.
EXAMPLE 5
Molecular Cloning of the Human OPG Binding Protein
[0100] The human homolog of the OPG binding protein is expressed as
an approximately 2.5 kb mRNA in human peripheral lymph nodes and is
detected by hybridization with a mouse cDNA probe under stringent
hybridization conditions. DNA encoding human OPG binding protein is
obtained by screening a human lymph node cDNA library by either
recombinant bacteriphage plaque, or transformed bacterial colony,
hybridization methods (Sambrook et al. Molecular Cloning: A
Laboratory Manual Cold Spring Harbor Press, New York (1989)). To
this the phage or plasmid cDNA library are screened using
radioactively-labeled probes derived from the murine OPG binding
protein clone 32D-F3. The probes are used to screen nitrocellulose
filter lifted from a plated library. These filters are
prehybridized and then hybridized using conditions specified in
Example 4, ultimately giving rise to purified clones of the human
OPG binding protein cDNA. Inserts obtained from any human OPG
binding protein clones would be sequenced and analyzed as described
in Example 3.
[0101] A human lymph node poly A+ RNA (Clontech, Inc., Palo Alto,
Calif.) was analyzed for the presence of OPG-bp transcripts as
previously in U.S. Ser. No. 08/577,788, filed Dec. 22, 1995. A
northern blot of this RNA sample probed under stringent conditions
with a .sup.32P-labeled mouse OPG-bp probe indicated the presence
of human OPG-bp transcripts. An oligo dT-primed cDNA library was
then synthesized from the lymph node mRNA using the SuperScript kit
(GIBCO life Technologies, Gaithersberg, Md.) as described in
example 2. The resulting cDNA was size selected, and the high
molecular fraction ligated to plasmid vector pcDNA 3.1 (+)
(Invitrogen, San Diego, Calif.). Electrocompetent E. coli DH10
(GIBCO life Technologies, Gaithersberg, Md.) were transformed, and
1.times.10.sup.6 ampicillin resistant transformants were screened
by colony hybridization using a .sup.32P-labeled mouse OPG binding
protein probe.
[0102] A plasmid clone of putative human OPG binding protein cDNA
was isolated, phuOPGbp-1.1, and contained a 2.3 kp insert. The
resulting nucleotide sequence of the phuOPGbp-1.1 insert was
approximately 80-85% homologous to the mouse OPG binding protein
cDNA sequence. Translation of the insert DNA sequence indicated the
presence of a long open reading frame predicted to encode a 317 aa
polypeptide (FIG. 4). Comparison of the mouse and human OPG-bp
polypeptides shows that they are .about.87% identical, indicating
that this protein is highly conserved during evolution.
[0103] The human OPG binding protein DNA and protein sequences were
not present in Genbank, and there were no homologus EST sequences.
As with the murine homolog, the human OPG binding protein shows
strong sequence similarity to all members of the TNF.alpha.
superfamily of cytokines.
EXAMPLE 6
Cloning and Bacterial Expression of OPG Binding Protein
[0104] PCR amplification employing the primer pairs and templates
described below are used to generate various forms of murine OPG
binding proteins. One primer of each pair introduces a TAA stop
codon and a unique XhoI or SacII site following the carboxy
terminus of the gene. The other primer of each pair introduces a
unique NdeI site, a N-terminal methionine, and optimized codons for
the amino terminal portion of the gene. PCR and thermocycling is
performed using standard recombinant DNA methodology. The PCR
products are purified, restriction digested, and inserted into the
unique NdeI and XhoI or SacII sites of vector pAMG21 (ATCC
accession no. 98113) and transformed into the prototrophic E. coli
393 or 2596. Other commonly used E. coli expression vectors and
host cells are also suitable for expression. After transformation,
the clones are selected, plasmid DNA is isolated and the sequence
of the OPG binding protein insert is confirmed.
[0105] pAMG21-Murine OPG Binding Protein [75-316]
[0106] This construct was engineered to be 242 amino acids in
length and have the following N-terminal and C-terminal residues,
NH.sub.2-Met(75)-Asp-Pro-Asn-Arg-------- Gln-Asp-Ile-Asp(316)-COOH.
The template to be used for PCR was pcDNA/32D-F3 and
oligonucleotides #1581-72 and #1581-76 were the primer pair to be
used for PCR and cloning this gene construct.
1 1581-72: 5'-GTTCTCCTCATATGGATCCAAACCGTATTTCTG (SEQ ID NO: 5)
AAGACAGCACTCACTGCTT- 3' 1581-76:
5'-TACGCACTCCGCGGTTAGTCTATGTCCTGAACT (SEQ ID NO: 6) TTGA-3'
[0107] pAMG21-Murine OPG Binding Protein [95-316]
[0108] This construct was engineered to be 223 amino acids in
length and have the following N-terminal and C-terminal residues,
NH.sub.2-Met-His(95)-Glu-Asn-Ala-Gly---
----Gln-Asp-Ile-Asp(316)-COOH. The template used for PCR was
pcDNA/32D-F3 and oligonucleotides #1591-90 and #1591-95 were the
primer pair used for PCR and cloning this gene construct.
2 1591-90: 5'-ATTTGATTCTAGAAGGAGGAATAACATATGCAT (SEQ ID NO: 7)
GAAAACGCAGGTCTGCAG-3' 1591-95: 5'-TATCCGCGGATCCTCGAGTTAGTCTATGTCCTG
(SEQ ID NO: 8) AACTTTGAA-3'
[0109] pAMG21-Murine OPG Binding Protein [107-316]
[0110] This construct was engineered to be 211 amino acids in
length and have the following N-terminal and C-terminal residues,
NH.sub.2-Met-Ser(107)-Glu-Asp-Thr-Leu--
-----Gln-Asp-Ile-Asp(316)-COOH. The template used for PCR was
pcDNA/32D-F3 and oligonucleotides #1591-93 and #1591-95 were the
primer pair used for PCR and cloning this gene construct.
3 1591-93: 5'-ATTTGATTCTAGAAGGAGGAATAACATATGT (SEQ ID NO: 9)
CTGAAGACACTCTGCCGGACTCC-3' 1591-95:
5'-TATCCGCGGATCCTCGAGTTAGTCTATGTCC (SEQ ID NO: 10)
TGAACTTTGAA-3'
[0111] pAMG21-Murine OPG Binding Protein [118-316]
[0112] This construct was engineered to be 199 amino acids in
length and have the following N-terminal and C-terminal residues,
NH.sub.2-Met(118)-Lys-Gln-Ala-Phe-Gln--
-----Gln-Asp-Ile-Asp(316)-COOH. The template used for PCR was
pcDNA/32D-F3 and oligonucleotides #1591-94 and #1591-95 were the
primer pair used for PCR and cloning this gene construct.
4 1591-94: 5'-ATTTGATTCTAGAAGGAGGAATAACATATGA (SEQ ID NO: 11)
AACAAGCTTTTCAGGGG-3' 1591-95: 5'-TATCCGCGGATCCTCGAGTTAGTCTATGTCC
(SEQ ID NO: 12) TGAACTTTGAA-3'
[0113] pAMG21-Murine OPG Binding Protein [128-316]
[0114] This construct was engineered to be 190 amino acids in
length and have the following N-terminal and C-terminal residues,
NH.sub.2-Met-Lys(128)-Glu-Leu-Gln-His--
-----Gln-Asp-Ile-Asp(316)-COOH. The template used for PCR was
pcDNA/32D-F3 and oligonucleotides #1591-91 and #1591-95 were the
primer pair used for PCR and cloning this gene construct.
5 1591-91: 5'-ATTTGATTCTAGAAGGAGGAATAACATATGA (SEQ ID NO: 13)
AAGAACTGCAGCACATTGTG-3' 1591-95: 5'-TATCCGCGGATCCTCGAGTTAGTCTATGTCC
(SEQ ID NO: 14) TGAACTTTGAA-3'
[0115] pAMG21-Murine OPG binding protein [137-316]
[0116] This construct was engineered to be 181 amino acids in
length and have the following N-terminal and C-terminal residues,
NH.sub.2-Met-Gln(137)-Arg-Phe-Ser-Gly--
-----Gln-Asp-Ile-Asp(316)-COOH. The template used for PCR was
pcDNA/32D-F3 and oligonucleotides #1591-92 and #1591-95 were the
primer pair used for PCR and cloning this gene construct.
6 1591-92: 5'-ATTTGATTCTAGAAGGAGGAATAACATATGC (SEQ ID NO: 15)
AGCGTTTCTCTGGTGCTCCA-3' 1591-95: 5'-TATCCGCGGATCCTCGAGTTAGTCTATGTCC
(SEQ ID NO: 16) TGAACTTTGAA-3'
[0117] pAMG21-Murine OPG binding protein [146-316]
[0118] This construct is engineered to be 171 amino acids in length
and have the following N-terminal and C-terminal residues,
NH.sub.2-Met(146)-Glu-Gly-Ser-Trp------
--Gln-Asp-Ile-Asp(316)-COOH. The template to be used for PCR is
pAMG21-murine OPG binding protein [75-316] described above and
oligonucleotides #1600-98 and #1581-76 will be the primer pair to
be used for PCR and cloning this gene construct.
7 1600-98: 5'-GTTCTCCTCATATGGAAGGTTCTTGGTTGGA (SEQ ID NO: 17)
TGTGGCCCA-3' 1581-76: 5'-TACGCACTCCGCGGTTAGTCTATGTCCTGAA (SEQ ID
NO: 18) CTTTGA-3'
[0119] pAMG21-Murine OPG Binding Protein [156-316]
[0120] This construct is engineered to be 162 amino acids in length
and have the following N-terminal and C-terminal residues,
NH.sub.2-Met-Arg(156)-Gly-Lys-Pro------
--Gln-Asp-Ile-Asp(316)-COOH. The template to be used for PCR is
pAMG21-murine OPG binding protein [158-316] below and
oligonucleotides #1619-86 and #1581-76 will be the primer pair to
be used for PCR and cloning this gene construct.
8 1619-86: 5'-GTTCTCCTCATATGCGTGGTAAACCTGAAGC (SEQ ID NO: 19)
TCAACCATTTGCA-3' 1581-76: 5'-TACGCACTCCGCGGTTAGTCTATGTCCTGAA (SEQ
ID NO: 20) CTTTGA-3'
[0121] pAMG21-Murine OPG Binding Protein [158-316]
[0122] This construct was engineered to be 160 amino acids in
length and have the following N-terminal and C-terminal residues,
NH.sub.2-Met-Lys(158)-Pro-Glu-Ala------
--Gln-Asp-Ile-Asp(316)-COOH. The template to be used for PCR was
pcDNA/32D-F3 and oligonucleotides #1581-73 and #1581-76 were the
primer pair to be used for PCR and cloning this gene construct.
9 1581-73: 5'-GTTCTCCTCATATGAAACCTGAAGCTCAACC (SEQ ID NO: 21)
ATTTGCACACCTCACCATCAAT-3' 1581-76:
5'-TACGCACTCCGCGGTTAGTCTATGTCCTGAA (SEQ ID NO: 22) CTTTGA-3'
[0123] pAMG21-Murine OPG Binding Protein [166-316]
[0124] This construct is engineered to be 152 amino acids in length
and have the following N-terminal and C-terminal residues,
NH.sub.2-Met-His(166)-Leu-Thr-Ile------
--Gln-Asp-Ile-Asp(316)-COOH. The template to be used for PCR is
pcDNA/32D-F3 and oligonucleotides #1581-75 and #1581-76 will be the
primer pair to be used for PCR and cloning this gene construct.
10 1581-75: 5'-GTTCTCCTCATATGCATTTAACTATTAACGC (SEQ ID NO: 23)
TGCATCTATCCCATCGGGTTCCCATAAAGTC ACT-3' 1581-76:
5'-TACGCACTCCGCGGTTAGTCTATGTCCTGAA (SEQ ID NO: 24) CTTTGA-3'
[0125] pAMG21-Murine OPG Binding Protein [168-316]
[0126] This construct is engineered to be 150 amino acids in length
and have the following N-terminal and C-terminal residues,
NH.sub.2-Met-Thr(168)-Ile-Asn-Ala------
--Gln-Asp-Ile-Asp(316)-COOH. The template to be used for PCR is
pcDNA/32D-F3 and oligonucleotides #1581-74 and #1581-76 will be the
primer pair to be used for PCR and cloning.
11 1581-74: 5'-GTTCTCCTCATATGACTATTAACGCTGCATC (SEQ ID NO: 25)
TATCCCATCGGGTTCCCATAAAGTCACT-3' 1581-76:
5'-TACGCACTCCGCGGTTAGTCTATGTCCTGAA (SEQ ID NO: 26) CTTTGA-3'
[0127] It is understood that the above constructs are examples and
one skilled in the art may readily obtain other forms of OPG
binding protein using the general methodology presented her.
[0128] Recombinant bacterial constructs pAMG21-murine OPG binding
protein [75-316], [95-316], [107-316], [118-316], [128-316],
[137-316], and [158-316] have been cloned, DNA sequence confirmed,
and levels of recombinant gene product expression following
induction has been examined. All constructs produced levels of
recombinant gene product which was readily visible following SDS
polyacrylamide gel electrophoresis and coomassie staining of crude
lysates. Growth of transformed E. coli 393 or 2596, induction of
OPG binding protein expression and isolation of inclusion bodies
containing OPG binding protein is done according to procedures
described in PCT WO97/23614. Purification of OPG binding proteins
from inclusion bodies requires solubilization and renaturing of OPG
binding protein using procedures available to one skilled in the
art. Recombinant murine OPG binding protein [158-316] was found to
be produced mostly insolubly, but about 40% was found in the
soluble fraction. Recombinant protein was purified from the soluble
fraction as described below and its bioactivity examined.
EXAMPLE 7
Purification of Recombinant Murine OPG Binding Protein
[158-316]
[0129] Frozen bacterial cells harboring expressed murine OPG
binding protein (158-316) were thawed and resuspended in 20 mM
tris-HCl pH 7.0, 10 mM EDTA. The cell suspension (20% w/v) was then
homogenized by three passes through a microfluidizer. The lysed
cell suspension was centrifuged in a JA14 rotor at 10,000 rpm for
45 minutes. SDS-PAGE analysis showed a band of approximately 18 kd
molecular weight present in both inclusion bodies and the
supernatant. The soluble fraction was then applied to a Pharmacia
SP Sepharose 4FF column equilibrated with 10 mM MES pH 6.0. The OPG
binding protein was eluted with a 20 column volume gradient of
0-0.4M NaCl in MES pH 6.0. Fractions containing OPG binding protein
were then applied to an ABX Bakerbond column equilibrated with 20
mM MES pH 6.0. OPG binding protein was eluted with a 15CV gradient
of 0-0.5M NaCl in MES pH 6.0. The final product was over 95%
homogeneous by SDS-PAGE. N-terminal sequencing gave the following
sequence: Met-Lys-Pro-Glu-Ala-Gln-Pro-Phe-Ala-His which was
identified to that predicted for a polypeptide starting at residue
158 (with an initiator methionine). The relative molecular weight
of the protein during SDS-PAGE does not change upon reduction.
EXAMPLE 8
In Vitro Bioactivity of Recombinant Soluble OPG Binding Protein
[0130] Recombinant OPG protein has previously been shown to block
vitamin D3-dependent osteoclast formation from bone marrow and
spleen precursors in an osteoclast forming assay as described in
U.S. Ser. No. 08/577,788. Since OPG binding protein binds to OPG,
and is a novel member of the TNF family of ligands, it is a
potential target of OPG bioactivity. Recombinant soluble OPG
binding protein (158-316), representing the minimal core
TNF.alpha.-like domain, was tested for its ability to modulate
osteoclast differentiation from osteoclast precursors. Bone marrow
cells were isolated from adult mouse femurs, and treated with
M-CSF. The non-adherent fraction was co-cultured with ST2 cells in
the presence and absence of both vitamin D3 and dexamethasone. As
previously shown, osteoclasts develop only from co-cultures
containing stromal cells (ST2), vitamin D3 and dexamethasone.
Recombinant soluble OPG binding protein was added at varying
concentrations ranging from 0.16 to 500 ng/ml and osteoclast
maturation was determined by TRAP solution assay and by visual
observation. OPG binding protein strongly stimulated osteoclast
differentiation and maturation in a dose dependent manner, with
half-maximal effects in the 1-2 ng/ml range, suggesting that it
acts as an potent inducer of osteoclastogenesis in vitro (FIG. 5).
The effect of OPG binding protein is blocked by recombinant OPG
(FIG. 6).
[0131] To test whether OPG binding protein could replace the stroma
and added steroids, cultures were established using M-CSF at
varying concentrations to promote the growth of osteoclast
precursors and various amounts of OPG binding protein were also
added. As shown in FIG. 6, OPG binding protein dose dependently
stimulated TRAP activity, and the magnitude of the stimulation was
dependent on the level of added M-CSF suggesting that these two
factors together are pivotal for osteoclast development. To confirm
the biological relevance of this last observation, cultures were
established on bovine cortical bone slices and the effects of M-CSF
and OPG binding protein either alone or together were tested. As
shown in FIG. 7, OPG binding protein in the presence of M-CSF
stimulated the formation of large TRAP positive osteoclasts that
eroded the bone surface resulting in pits. Thus, OPG binding
protein acts as an osteoclastogenesis stimulating (differentiation)
factor. This suggests that OPG blocks osteoclast development by
sequestering OPG binding protein.
EXAMPLE 9
In Vivo Activity of Recombinant Soluble OPG Binding Protein
[0132] Based on in vitro studies, recombinant murine OPG binding
protein [158-316] produced in E. coli is a potent inducer of
osteoclast development from myeloid precursors. To determine its
effects in vivo, male BDF1 mice aged 4-5 weeks (Charles River
Laboratories) received subcutaneous injections of OPG binding
protein [158-316] twice a day for three days and on the morning of
the fourth day (days 0, 1, 2, and 3). Five groups of mice (n=4)
received carrier alone, or 1, 5, 25 or 100 .mu.g/ of OPG binding
protein [158-316] per day. An additional 5 groups of mice (n=4)
received the above doses of carrier or of OPG binding protein
[158-316] and in addition received human Fc-OPG [22-194] at 1
mg/Kg/day (approximately 20 .mu.g/day) by single daily subcutaneous
injection. Whole blood ionized calcium was determined prior to
treatment on day 0 and 3-4 hours after the first daily injection of
OPG binding protein [158-316] on days 1, 2, and 3. Four hours after
the last injection on day 3 the mice were sacrificed and
radiographs were taken.
[0133] Recombinant of OPG binding protein [158-316] produced a
significant increase in blood ionized calcium after two days of
treatment at dose of 5 .mu.g/day and higher (FIG. 8). The severity
of the hypercalcemia indicates a potent induction of osteoclast
activity resulting from increased bone resorption. Concurrent OPG
administration limited hypercalcemia at doses of OPG binding
protein [158-316] of 5 and 25 .mu.g/day, but not at 100 .mu.g/day.
These same animal were analyzed by radiography to determine if
there were any effects on bone mineral density visible by X-ray
(FIG. 9). Recombinant of OPG binding protein [158-316] injected for
3 days decreased bone density in the proximal tibia of mice in a
dose-dependent manner. The reduction in bone density was
particularly evident in mice receiving 100 .mu.g/d confirming that
the profound hypercalcemia in these animals was produced from
increased bone resorption and the resulting release of calcium from
the skeleton. These data clearly indicate that of OPG binding
protein [158-316] acts in vivo to promote bone resorption, leading
to systemic hypercalcemia, and recombinant OPG abbrogates these
effects.
EXAMPLE 10
Cloning and Expression of Soluble OPG Binding Protein in Mammalian
Cells
[0134] The full length clone of murine and human OPG binding
protein can be expressed in mammalian cells as previously described
in Example 2. Alternatively, the cDNA clones can be modified to
encode secreted forms of the protein when expressed in mammalian
cells. To do this, the natural 5'end of the cDNA encoding the
initiation codon, and extending approximately through the first 69
amino acid of the protein, including the transmembrane spanning
region, could be replaced with a signal peptide leader sequence.
For example, DNA sequences encoding the initiation codon and signal
peptide of a known gene can be spliced to the OPG binding protein
cDNA sequence beginning anywhere after the region encoding amino
acid residue 68. The resulting recombinant clones are predicted to
produce secreted forms of OPB binding protein in mammalian cells,
and should undergo post translational modifications which normally
occur in the C-terminal extracellular domain of OPG binding
protein, such as glycoslyation. Using this strategy, a secreted
form of OPG binding protein was constructed which has at its 5' end
the murine OPG signal peptide, and at its 3' end the human IgG1 Fc
domain. The plasmid vector pCEP4/muOPG[22-401]-Fc as described in
U.S. Ser. No. 08/577,788, filed Dec. 22, 1995, was digested with
NotI to cleave between the 3' end of OPG and the Fc gene. The
linearized DNA was then partially digested with XmnI to cleave only
between residues 23 and 24 of OPG leaving a blunt end. The
restriction digests were then dephosphorylated with CIP and the
vector portion of this digest (including residues 1-23 of OPG and
Fc) was gel purified.
[0135] The murine OPG binding protein cDNA region encoding amino
acid residues 69-316 were PCR amplified using Pfu Polymerase
(Stratagene, San Diego, Calif.) from the plasmid template using
primers the following oligonucleotides:
12 1602-61: CCT CTA GGC CTG TAC TTT CGA GCG (SEQ ID NO: 27) CAG ATG
1602-59: CCT CTG CGG CCG CGT CTA TGT CCT (SEQ ID NO: 28) GAA CTT
TG
[0136] The 1602-61 oligonucleotide amplifies the 5' end of the gene
and contains an artificial an StuI site. The 1602-59 primer
amplifies the 3' end of the gene and contains an artificial NotI
site. The resulting PCR product obtained was digested with NotI and
StuI, then gel purified. The purified PCR product was ligated with
vector, then used to transform electrocompetent E. coli DH10B
cells. The resulting clone was sequenced to confirm the integrity
of the amplified sequence and restriction site junctions. This
plasmid was then used to transfect human 293 fibroblasts, and the
OPG binding protein-Fc fusion protein was collected form culture
media as previously described in U.S. Ser. No. 08/577,788, filed
Dec. 22, 1995.
[0137] Using a similar strategy, an expression vector was designed
that is capable of expressing a N-terminal truncation of fused to
the human IgG1 Fc domain. This construct consists of the murine OPG
signal peptide (aa residue 1-21), fused in frame to murine OPG
binding protein residues 158-316, followed by an inframe fusion to
human IgG1 Fc domain. To do this, the plasmid vector pCEP4/murine
OPG [22-401] (U.S. Ser. No. 08/577,788, filed Dec. 22, 1995), was
digested with HindIII and NotI to remove the entire OPG reading
frame. Murine OPG binding protein, residues 158-316 were PCR
amplified using from the plasmid template pCDNA/32D-F3 using the
following primers:
13 1616-44: CCT CTC TCG AGT GGA CAA CCC AGA (SEQ ID NO: 29) AGC CTG
AGG CCC AGC CAT TTG C 1602-59: CCT CTG CGG CCG CGT CTA TGT CCT (SEQ
ID NO: 30) GAA CTT TG
[0138] 1616-44 amplifies OPG binding protein starting at residue
158 as well as containing residues 16-21 of the muOPG signal
peptide with an artificial XhoI site. 1602-59 amplifies the 3' end
of the gene and adds an in-frame NotI site. The PCR product was
digested with NotI and XhoI and then gel purified.
[0139] The following complimentary primers were annealed to each
other to form an adapter encoding the murine OPG signal peptide and
Kozak sequence surrounding the translation initiation site:
14 1616-41: AGC TTC CAC CAT GAA CAA GTG GCT (SEQ ID NO: 31) GTG CTG
CGC ACT CCT GGT GCT CCT GGA CAT CA 1616-42: TCG ATG ATG TCC AGG AGC
ACC AGG (SEQ ID NO: 32) AGT GCG CAG CAC AGC CAC TTG TTC ATG GTG
GA
[0140] These primers were annealed, generating 5' overhangs
compatible with HindIII on the 5' end and XhoI on the 3' end. The
digested vector obtained above, the annealed oligos, and the
digested PCR fragment were ligated together and electroporated into
DH10B cells. The resulting clone was sequenced to confirm authentic
reconstruction of the junction between the signal peptide, OPG
binding protein fragment encoding residues 158-316, and the IgG1 Fc
domain. The recombinant plasmid was purified, transfected into
human 293 fibroblasts, and expressed as a conditioned media product
as described above.
[0141] Full length murine and human cDNAs were cloned into the
pCEP4 expression vector (Invitrogen, San Diego, Calif.) then
transfected into cultures of human 293 fibroblasts as described in
Example 1. The cell cultures were selected with hygromycin as
described above and serum-free conditioned media was prepared. The
conditioned media was exposed to a column of immobilized
recombinant OPG, and shed forms of murine and human recombinant OPG
bp were affinity purified. N-terminal sequence analysis of the
purified soluble OPG binding proteins indicates that the murine
protein is preferentially cleaved before phenylalanine 139, and the
human protein is preferentially cleaved before the homologous
residue, isoleucine 140. In addition the human protein is also
preferentially cleaved before glycine 145. This suggests that
naturally occurring soluble forms of human OPG binding protein have
amino terminal residues at either isoleucine at position 140 or
glycine at position 145.
EXAMPLE 11
Peptides of the OPG Binding Protein and Preparation of Polyclonal
and Monoclonal Antibodies to the Protein
[0142] Antibodies to specific regions of the OPG binding protein
may be obtained by immunization with peptides from OPG binding
protein. These peptides may be used alone, or conjugated forms of
the peptide may be used for immunization.
[0143] The crystal structure of mature TNF.alpha. has been
described [E. Y. Jones, D. I. Stuart, and N. P. C. Walker (1990) J.
Cell Sci. Suppl. 13, 11-18] and the monomer forms an antiparallel
.beta.-pleated sheet sandwich with a jellyroll topology. Ten
antiparallel .beta.-strands are observed in this crystal structure
and form a beta sandwich with one beta sheet consisting of strands
B'BIDG and the other of strands C'CHEF [E. Y. Jones et al., ibid.]
Two loops of mature TNF.alpha. have been implicated from
mutagenesis studies to make contacts with receptor, these being the
loops formed between beta strand B & B' and the loop between
beta strands E & F [C. R. Goh, C--S. Loh, and A. G. Porter
(1991) Protein Engineering 4, 785-791]. The crystal structure of
the complex formed between TNF.beta. and the extracellular domain
of the 55 kd TNF receptor (TNF-R55) has been solved and the
receptor-ligand contacts have been described [D. W. Banner, A.
D'Arcy, W. Janes, R. Gentz, H-J. Schoenfeld, C. Broger, H.
Loetscher, and W. Lesslauer (1993) Cell 73, 431-445]. In agreement
with mutagenesis studies described above [C. R. Goh et al., ibid.]
the corresponding loops BB' and EF of the ligand TNF.beta. were
found to make the majority of contacts with the receptor in the
resolved crystal structure of the TNFb:TNF-R55 complex. The amino
acid sequence of murine OPG binding protein was compared to the
amino acid sequences of TNF.alpha. and TNF.beta.. The regions of
murine OPG binding protein corresponding to the BB' and EF loops
were predicted based on this comparison and peptides have been
designed and are described below
[0144] A. Antigen(s): Recombinant murine OPG binding protein
[158-316] has been used as an antigen (ag) for immunization of
animals as described below, and serum will be examined using
approaches described below. Peptides to the putative BB' and EF
loops of murine OPG binding protein have been synthesized and will
be used for immunization; these peptides are:
15 BB' loop peptide: NH2--NAASIPSGSHKVTLSSWYHDRGWAKI (SEQ ID NO:
33) S--COOH BB' loop-Cys peptide: NH2--NAASIPSGSHKVTLSSWYHDRGWAKIS
(SEQ ID NO: 34) C--COOH EF loop peptide: NH2--VYVVKTSIKIPSSHNLM--C-
OOH (SEQ ID NO: 35) EF loop-Cys peptide:
NH2--VYVVKTSIKIPSSHNLMC--COOH (SEQ ID NO: 36)
[0145] Peptides with a carboxy-terminal cysteine residue have been
used for conjugation using approaches described in section B below,
and have been used for immunization.
[0146] B. Keyhole Limpet Hemocyanin or Bovine Serum Albumin
Coniugation: Selected peptides or protein fragments may be
conjugated to keyhole limpet hemocyanin (KLH) in order to increase
their immunogenicity in animals. Also, bovine serum albumin (BSA)
conjugated peptides or protein fragments may be utilized in the EIA
protocol. Imject Maleimide Activated KLH or BSA (Pierce Chemical
Company, Rockford, Ill.) is reconstituted in dH.sub.2O to a final
concentration of 10 mg/ml. Peptide or protein fragments are
dissolved in phosphate buffer then mixed with an equivalent mass
(g/g) of KLH or BSA. The conjugation is allowed to react for 2
hours at room temperature (rt) with gentle stirring. The solution
is then passed over a desalting column or dialyzed against PBS
overnight. The peptide conjugate is stored at -20.degree. C. until
used in immunizations or in EIAs.
[0147] C. Immunization: Balb/c mice, (Charles Rivers Laboratories,
Wilmington, Mass.) Lou rats, or New Zealand White rabbits will be
subcutaneously injected (SQI) with ag (50 .mu.g, 150 .mu.g, and 100
.mu.g respectively) emulsified in Complete Freund's Adjuvant (CFA,
50% vol/vol; Difco Laboratories, Detroit, Mich.). Rabbits are then
boosted two or three times at 2 week intervals with antigen
prepared in similar fashion in Incomplete Freund's Adjuvant (ICFA;
Difco Laboratories, Detroit, Mich.). Mice and rats are boosted
approximately every 4 weeks. Seven days following the second boost,
test bleeds are performed and serum antibody titers determined.
When a titer has developed in rabbits, weekly production bleeds of
50 mls are taken for 6 consecutive weeks. Mice and rats are
selected for hybridoma production based on serum titer levels;
animals with half-maximal titers greater than 5000 are used.
Adjustments to this protocol may be applied by one skilled in the
art; for example, various types of immunomodulators are now
available and may be incorporated into this protocol.
[0148] D. Enzyme-linked Immunosorbent Assay (EIA): EIAs will be
performed to determine serum antibody (ab) titres of individual
animals, and later for the screening of potential hybridomas. Flat
bottom, high-binding, 96-well microtitration EIA/RIA plates (Costar
Corporation, Cambridge, Mass.) will be coated with purified
recombinant protein or protein fragment (antigen, ag) at 5 .mu.g
per ml in carbonate-bicarbonate buffer, pH 9.2 (0.015 M
Na.sub.2CO.sub.31 0.035 M NaHCO.sub.3). Protein fragments may be
conjugated to bovine serum albumin (BSA) if necessary. Fifty .mu.l
of ag will be added to each well. Plates will then be covered with
acetate film (ICN Biomedicals, Inc., Costa Mesa, Calif.) and
incubated at room temperature (rt) on a rocking platform for 2
hours or over-night at 4.degree. C. Plates will be blocked for 30
minutes at rt with 250 .mu.l per well 5% BSA solution prepared by
mixing 1 part BSA diluent/blocking solution concentrate (Kirkegaard
and Perry Laboratories, Inc., Gaithersburg, Md.) with 1 part
deionized water (dH.sub.2O). Blocking solution having been
discarded, 50 .mu.l of serum 2-fold dilutions (1:100 through
1:12,800) or hybridoma tissue culture supernatants will be added to
each well. Serum diluent is 1% BSA (10% BSA diluent/blocking
solution concentrate diluted 1:10 in Dulbecco's Phosphate Buffered
Saline, D-PBS; Gibco BRL, Grand Island, N.Y.)) while hybridoma
supernatants are tested undiluted. In the case of hybridoma
screening, one well is maintained as a conjugate control, and a
second well as a positive ab control. Plates are again incubated at
rt, rocking for 1 hour, then washed 4 times using a 1.times.
preparation of wash solution 20.times. concentrate (Kirkegaard and
Perry Laboratories, Inc., Gaithersburg, Md.) in dH.sub.2O.
Horseradish peroxidase conjugated secondary ab
[0149] (Boeringer Mannheim Biochemicals, Indianapolis, Ind.)
[0150] diluted in 1% BSA is then incubated in each well for 30
minutes. Plates are washed as before, blotted dry, and ABTS
peroxidase single component substrate (Kirkegaard and Perry
Laboratories, Inc., Gaithersburg, Md.) is added. Absorbance is read
at 405 nm for each well using a Microplate EL310 reader (Bio-tek
Instruments, Inc., Winooski, Vt.). Half-maximal titre of serum
antibody is calculated by plotting the log.sub.10 of the serum
dilution versus the optical density at 405, then extrapolating at
the 50% point of the maximal optical density obtained by that
serum. Hybridomas are selected as positive if optical density
scores greater than 5-fold above background. Adjustments to this
protocol may be applied; in example, conjugated secondary antibody
may be chosen for specificity or non-cross-reactivity.
[0151] E. Cell fusion: The animal selected for hybridoma production
is intravenously injected with 50 to 100 .mu.g of ag in PBS. Four
days later, the animal is sacrificed by carbon dioxide and its
spleen collected under sterile conditions into 35 ml Dulbeccos'
Modified Eagle's Medium containing 200 U/ml Penicillin G, 200
.mu.g/ml Streptomycin Sulfate, and 4 mM glutamine (2.times.P/S/G
DMEM). The spleen is trimmed of excess fatty tissue, then rinsed
through 4 dishes of clean 2.times.P/S/G DMEM. It is next
transferred to a sterile stomacher bag (Tekmar, Cincinnati, Ohio)
containing 10 ml of 2.times.P/S/G DMEM and disrupted to single cell
suspension with the Stomacher Lab Blender 80 (Seward Laboratory UAC
House; London, England). As cells are released from the spleen
capsule into the media, they are removed from the bag and
transferred to a sterile 50 ml conical centrifuge tube (Becton
Dickinson and Company, Lincoln Park, N.J.). Fresh media is added to
the bag and the process is continued until the entire cell content
of the spleen is released. These splenocytes are washed 3 times by
centrifugation at 225.times.g for 10 minutes.
[0152] Concurrently, log phase cultures of myeloma cells,
Sp2/0-Ag14 or Y3-Ag1.2.3 for mouse or rat splenocyte fusions,
respectively, (American Type Culture Collection; Rockville, Md.)
grown in complete medium (DMEM, 10% inactivated fetal bovine serum,
2 mM glutamine, 0.1 mM non-essential amino acids, 1 mM sodium
pyruvate, and 10 mM hepes buffer; Gibco Laboratories, Grand Island,
N.Y.) are washed in similar fashion. The splenocytes are combined
with the myeloma cells and pelleted once again. The media is
aspirated from the cell pellet and 2 ml of polyethylene glycol 1500
(PEG 1500; Boehringer Mannheim Biochemicals, Indianapolis, Ind.) is
gently mixed into the cells over the course of 1 minute.
Thereafter, an equal volume of 2.times.P/S/G DMEM is slowly added.
The cells are allowed to fuse at 37.degree. C. for 2 minutes, then
an additional 6 ml of 2.times.P/S/G DMEM is added. The cells are
again set at 37.degree. C. for 3 minutes. Finally, 35 ml of
2.times.P/S/G DMEM is added to the cell suspension, and the cells
pelleted by centrifugation. Media is aspirated from the pellet and
the cells gently resuspended in complete medium. The cells are
distributed over 96-well flat-bottom tissue culture plates (Becton
Dickinson Labware; Lincoln Park, N.J.) by single drops from a 5 ml
pipette. Plates are incubated overnight in humidified conditions at
37.degree. C. 5% CO.sub.2. The next day, an equal volume of
selection medium is added to each well. Selection consists of 0.1
mM hypoxanthine, 4.times.10-4 mM aminopterin, and
1.6.times.10.sup.-2 mM thymidine in complete medium. The fusion
plates are incubated for 7 days followed by 2 changes of medium
during the next 3 days; HAT selection medium is used after each
fluid change. Tissue culture supernatants are taken 3 to 4 days
after the last fluid change from each hybrid-containing well and
tested by EIA for specific antibody reactivity. This protocol has
been modified by that in Hudson and Hay, "Practical Immunology,
Second Edition", Blackwell Scientific Publications.
EXAMPLE 12
Cloning of an OPG Binding Protein Receptor Expressed on
Hematopoietic Precursor Cells
[0153] Biologically active recombinant murine OPG binding protein
[158-316] was conjugated to fluorescein-isothyocyanate (FITC) to
generate a fluorescent probe. Fluorescent labeling was performed by
incubation of recombinant murine OPG binding protein [158-316] with
6-fluorescein-5-(and 6) carboxyamido hexanoic acid succinimidyl
ester (Molecular Probes, Eugene, Oreg.) at a 1:6 molar ratio for 12
hrs. at 4.degree. C. FITC-labeled OPG binding protein [158-316] was
further purified by gel filtration chromatography. Mouse bone
marrow cells were isolated and incubated in culture in the presence
of CSF-1 and OPG binding protein [158-316] as described in Example
10. Mouse bone marrow cells were cultured overnight in CSF-1 (30
ng/ml) and OPG binding protein [158-316] (20 ng/ml). Non-adherent
cells were removed first and stored on ice and the remaining
adherent cells were removed by incubating with cell dissociation
buffer (Sigma Chemicals, St. Louis, Mo.), pooled with the
non-adherent population, and then stained with FITC-OPG binding
protein as described above. After washing and resuspending in PBS
with 0.5% BSA, the cells were exposed to FITC-OPG binding protein,
washed, then sorted by FACS. The population of cells that were
positive for staining with the FITC-OPG binding protein was
collected and mRNA was isolated as described in Example 2. This
mRNA preparation was used to make a cDNA library following
procedures described in Example 2.
[0154] The cDNA library produced from this source was used for
random EST sequence analysis as previously described in PCT
Publication No. WO97/23614 and in Simonet et al. (Cell 89, 309-319
(1997)). Using this method, an .about.2.1 kb cDNA was detected that
encoded a novel TNFR-related protein. The long open reading frame
of the murine ODAR cDNA encodes a protein of 625 amino acid
residues and contains the hallmark features of TNFR-related
proteins: a hydrophobic signal peptide at its N-termini, four
tandem cysteine-rich repeat sequences, a hydrophobic transmembrane
domain, and a cytoplasmic signaling domain. The homology of this
protein with other members of the TNF receptor family and its
expression in bone marrow cells that bind FITC-labeled OPG binding
protein suggest that it is a potential receptor for the TNF-related
OPG binding protein. This protein is designated ODAR, or osteoclast
differentiation and activation receptor. The nucleic acid sequence
and predicted amino acid sequence of murine ODAR is shown in FIG.
10.
[0155] Recent analysis of sequences in publicly available databases
indicate that this protein is the murine homolog of a human
TNFR-related protein known as RANK (Anderson et al., Nature 390,
175-179 (1997)).
EXAMPLE 13
Production of Recombinant ODAR Protein in Mammalian Cells
[0156] A soluble ODAR extracellular domain fused to the Fc region
of human IgG.sub.i was produced using procedures for the
construction and expression of Fc fusion proteins as previously
described in WO97/23614 and in Simonet et al., supra. To generate
soluble ODAR protein in mammalian cells, cDNA encoding
extracellular domain of murine ODAR (amino acids 27-211) was PCR
amplified with the following set of oligonucleotide primers:
16 5' TCT CCA AGC TTG TGA CTC TCC AGG (SEQ ID NO: 37) TCA CTC C-3'
5' TCT CCG CGG CCG CGT AAG CCT GGG (SEQ ID NO: 38) CCT CAT TGG
GTG-3'
[0157] PCR reactions were carried in a volume of 50 .mu.l with 1
unit of vent DNA polymerase (New England Biolabs) in 20 mM Tris-HCl
pH 8.8, 10 mM KCl, 10 mM (NH.sub.4).sub.2SO.sub.4, 0.1%
Triton-X100, 10 .mu.M of each dNTP, 1 .mu.M of each primer and 10
ng of ODAR cDNA template. Reactions were performed in 94.degree. C.
for 30 s, 55.degree. C. for 30 s, and 72.degree. C. for 1 min, for
a total of 16 cycles. The PCR fragment was isolated by
electrophoresis. The PCR fragment creates a Hind III restriction
site at 5' end and a Not I restriction site at 3' end. The Hind
III-Not I digested PCR fragment was then subcloned in-frame into a
modified pCEP4-Fc vector in front of the human IgG-yl heavy chain
sequence as described previously in WO97/23614 and in Simonet et
al. supra). A linker was introduced which encodes two irrelevant
amino acids spanning the junction between the ODAR extracellular
domain and the IgG Fc region.
[0158] The construct was then digested with Nhe I and Hind III and
the following annealed oligonucleotide pair encoding OPG signal
peptide (amino acid 1-21) was inserted in-frame:
17 5' CTA GCA CCA TGA ACA AGT GGC TGT (SEQ ID NO: 39) GCT GCG CAC
TCC TGG TGC TCC TGG ACA TCA TTG AAT GGA CAA CCC AGA-3' 5' AGC TTC
TGG GTT GTC CAT TCA ATG (SEQ ID NO: 40) ATG TCC AGG AGC ACC AGG AGT
GCG CAG CAC AGC CAC TTG TTC ATG GTG-3'
[0159] A linker which encodes two irrelevant amino acids was
introduced between OPG signal peptide and ODAR sequences. The final
engineered construct (ODAR-Fc/pCEP4) encodes a fusion protein
containing from amino terminus to carboxy terminus: OPG signal
peptide (amino acids 1-21)-linker (LysLeu)-ODAR (amino acids
27-211)-linker (AlaAla)-human IgG Fc.
[0160] The construct was transfected into 293-EBNA-1 cells by
calcium phosphate method as described (Ausubel et al., Curr. Prot.
Mol. Biol. 1, 9.1.1-9.1.3, (1994). The transfected cells were then
selected in 200 .mu.g/ml hygromycin (GibcoBRL) and the resulting
drug-resistant mass cultures were pooled and grown to confluence.
The cells were washed in PBS once and then cultured in serum-free
media for 72 hr. The conditioned media was collected. The ODAR-Fc
fusion protein in the media was detected by western blot analysis
with anti-human IgG Fc antibody.
[0161] The Fc fusion protein was purified by protein-A column
chromatography (Pierce) using the manufacturer's recommended
procedures. Fifty pmoles of the purified protein was then subjected
to N-terminal sequence analysis by automated Edman degradation as
essentially described by Matsudaira et al (J. Biol. Chem. 262,
10-35 (1987)). The following amino acid sequence was read after 10
cycles:
18 NH.sub.2- K L V T L Q V T P-CO.sub.2H.
[0162] The binding activity of ODAR-Fc with OPG binding protein was
examined by immunofluorescent staining of transfected COS-7 cell
cultures as described in Example 2. COS-7 cells were lipofected
with 1 .mu.g of an expression vector containing DNA encoding murine
OPG binding protein. After 48 hr incubation, cells were then
incubated in PBS-FBS solution containing 10 mg/.mu.l of human IgG
Fc, ODAR-Fc, or OPG-Fc protein at 4.degree. C. for 1 hr. Cells were
then washed with PBS twice and then incubated in PBS-FBS solution
containing 20 .mu.g/ml FITC-labeled goat anti-human IgG (Southern
Biotech Associates) for another hr. After washing with PBS, cells
were examined by confocal microscopy (ACAS, Ultima, Insight
Biomedical Imaging, Inc., Okemos, Mich.). Both ODAR-Fc and OPG-Fc
bind to OPGL transfected COS-7 cells (FIG. 11).
EXAMPLE 14
In Vitro Biological Activity of Recombinant Soluble ODAR
[0163] The ability of ODAR to inhibit stimulation of osteoclast
formation by OPG binding protein was assessed in a mouse bone
marrow culture in the presence of CSF-1 (30 ng/ml) and OPG binding
protein (5 ng/ml). Procedures for the use of mouse bone marrow
cultures to study osteoclast maturation are described in WO97/23614
and in Example 8. ODAR-Fc fusion protein produced as described in
Example 12 was added to concentrations of 65 to 1500 ng/ml.
Osteoclast formation was assessed by tartrate resistant alkaline
phosphotase (TRAP) cytochemistry and the TRAP solution assay after
five days in culture.
[0164] A dose dependent inhibition of osteoclast formation by
ODAR-Fc fusion was observed both by cytochemistry and by TRAP
activity (FIG. 12). ODAR-Fc fusion protein inhibited osteoclast
formation with an ED.sub.50 of about 10-50 ng/ml.
EXAMPLE 15
In Vivo Biological Activity of Recombinant Soluble ODAR
[0165] Young rapidly growing male BDF1 mice aged 3-4 weeks received
varying doses of ODAR-Fc fusion protein by single daily
subcutaneous injection in carrier (PBS/0.1% BSA) for four days. The
mice were x-rayed on day 5. Doses of ODAR-Fc fusion protein used
were 0.5, 1.5 and 5 mg/kg/day. For each treatment, all the mice in
that group and in the control group that received PBS/0.1% BSA were
x-rayed on a single film. The proximal tibial metaphyseal region
was compared between pairs of control and treated tibias and scored
as a "+" if the treated tibia was denser by visual assessment than
the control giving the 8 scores shown below. An arbitrary score of
5/8 was required for a "positive" result. (Dose is in mg/Kg/day).
(n=4).
[0166] After sacrifice the right tibia was removed from each animal
and the bone density in the proximal tibial metaphysis was measured
by peripheral quantitative computerized tomography (PQCT) (Stratec,
Germany). Two 0.5 mm cross-sections of bone, 1.5 mm and 2.0 mm from
the proximal end of the tibia were analyzed (XMICE 5.2, Stratec,
Germany) to determine total bone mineral density in the metaphysis.
A soft tissue separation threshold of 1500 was used to define the
boundary of the metaphyseal bone.
[0167] ODAR-Fc administration in young growing mice inhibited bone
resorption at the proximal tibial growth plate producing a region
of increased bone density that was evident visually on radiographs.
Radiographic changes were apparent at a dose of 1.5 mg/kg/day and
above in two experiments (Table 1). Measurement of the bone density
by PQCT in samples from the second experiment in a similar region
of the tibia confirmed the dose dependent increased in bone density
in these mice (FIG. 13).
19TABLE 1 Inhibition of bone resorption by ODAR-Fc fusion protein
Factor Dose 1 2 3 4 5 6 7 8 Result Experiment #1 ODAR-Fc 5.0 + + +
+ + + + + Positive 8/8 ODAR-Fc 1.5 - + + - + + + + Positive 6/8
ODAR-Fc 0.5 - - - - - - - - Negative 0/8 ODAR-Fc 0.15 - - - - - - -
- Negative 0/8 Experiment #2 ODAR-Fc 5.0 + + + + + + + + Positive
8/8 ODAR-Fc 1.5 + + + + + + + + Positive 8/8 ODAR-Fc 0.5 - - - + -
- - - Negative 1/8
[0168] While the present invention has been described in terms of
the preferred embodiments, it is understood that variations and
modifications will occur to those skilled in the art. Therefore, it
is intended that the appended claims cover all such equivalent
variations which come within the scope of the invention as claimed.
Sequence CWU 1
1
54 1 2295 DNA Mus musculus CDS (158)..(1105) 1 gagctcggat
ccactactcg acccacgcgt ccggccagga cctctgtgaa ccggtcgggg 60
cgggggccgc ctggccggga gtctgctcgg cggtgggtgg ccgaggaagg gagagaacga
120 tcgcggagca gggcgcccga actccgggcg ccgcgcc atg cgc cgg gcc agc
cga 175 Met Arg Arg Ala Ser Arg 1 5 gac tac ggc aag tac ctg cgc agc
tcg gag gag atg ggc agc ggc ccc 223 Asp Tyr Gly Lys Tyr Leu Arg Ser
Ser Glu Glu Met Gly Ser Gly Pro 10 15 20 ggc gtc cca cac gag ggt
ccg ctg cac ccc gcg cct tct gca ccg gct 271 Gly Val Pro His Glu Gly
Pro Leu His Pro Ala Pro Ser Ala Pro Ala 25 30 35 ccg gcg ccg cca
ccc gcc gcc tcc cgc tcc atg ttc ctg gcc ctc ctg 319 Pro Ala Pro Pro
Pro Ala Ala Ser Arg Ser Met Phe Leu Ala Leu Leu 40 45 50 ggg ctg
gga ctg ggc cag gtg gtc tgc agc atc gct ctg ttc ctg tac 367 Gly Leu
Gly Leu Gly Gln Val Val Cys Ser Ile Ala Leu Phe Leu Tyr 55 60 65 70
ttt cga gcg cag atg gat cct aac aga ata tca gaa gac agc act cac 415
Phe Arg Ala Gln Met Asp Pro Asn Arg Ile Ser Glu Asp Ser Thr His 75
80 85 tgc ttt tat aga atc ctg aga ctc cat gaa aac gca ggt ttg cag
gac 463 Cys Phe Tyr Arg Ile Leu Arg Leu His Glu Asn Ala Gly Leu Gln
Asp 90 95 100 tcg act ctg gag agt gaa gac aca cta cct gac tcc tgc
agg agg atg 511 Ser Thr Leu Glu Ser Glu Asp Thr Leu Pro Asp Ser Cys
Arg Arg Met 105 110 115 aaa caa gcc ttt cag ggg gcc gtg cag aag gaa
ctg caa cac att gtg 559 Lys Gln Ala Phe Gln Gly Ala Val Gln Lys Glu
Leu Gln His Ile Val 120 125 130 ggg cca cag cgc ttc tca gga gct cca
gct atg atg gaa ggc tca tgg 607 Gly Pro Gln Arg Phe Ser Gly Ala Pro
Ala Met Met Glu Gly Ser Trp 135 140 145 150 ttg gat gtg gcc cag cga
ggc aag cct gag gcc cag cca ttt gca cac 655 Leu Asp Val Ala Gln Arg
Gly Lys Pro Glu Ala Gln Pro Phe Ala His 155 160 165 ctc acc atc aat
gct gcc agc atc cca tcg ggt tcc cat aaa gtc act 703 Leu Thr Ile Asn
Ala Ala Ser Ile Pro Ser Gly Ser His Lys Val Thr 170 175 180 ctg tcc
tct tgg tac cac gat cga ggc tgg gcc aag atc tct aac atg 751 Leu Ser
Ser Trp Tyr His Asp Arg Gly Trp Ala Lys Ile Ser Asn Met 185 190 195
acg tta agc aac gga aaa cta agg gtt aac caa gat ggc ttc tat tac 799
Thr Leu Ser Asn Gly Lys Leu Arg Val Asn Gln Asp Gly Phe Tyr Tyr 200
205 210 ctg tac gcc aac att tgc ttt cgg cat cat gaa aca tcg gga agc
gta 847 Leu Tyr Ala Asn Ile Cys Phe Arg His His Glu Thr Ser Gly Ser
Val 215 220 225 230 cct aca gac tat ctt cag ctg atg gtg tat gtc gtt
aaa acc agc atc 895 Pro Thr Asp Tyr Leu Gln Leu Met Val Tyr Val Val
Lys Thr Ser Ile 235 240 245 aaa atc cca agt tct cat aac ctg atg aaa
gga ggg agc acg aaa aac 943 Lys Ile Pro Ser Ser His Asn Leu Met Lys
Gly Gly Ser Thr Lys Asn 250 255 260 tgg tcg ggc aat tct gaa ttc cac
ttt tat tcc ata aat gtt ggg gga 991 Trp Ser Gly Asn Ser Glu Phe His
Phe Tyr Ser Ile Asn Val Gly Gly 265 270 275 ttt ttc aag ctc cga gct
ggt gaa gaa att agc att cag gtg tcc aac 1039 Phe Phe Lys Leu Arg
Ala Gly Glu Glu Ile Ser Ile Gln Val Ser Asn 280 285 290 cct tcc ctg
ctg gat ccg gat caa gat gcg acg tac ttt ggg gct ttc 1087 Pro Ser
Leu Leu Asp Pro Asp Gln Asp Ala Thr Tyr Phe Gly Ala Phe 295 300 305
310 aaa gtt cag gac ata gac tgagactcat ttcgtggaac attagcatgg 1135
Lys Val Gln Asp Ile Asp 315 atgtcctaga tgtttggaaa cttcttaaaa
aatggatgat gtctatacat gtgtaagact 1195 actaagagac atggcccacg
gtgtatgaaa ctcacagccc tctctcttga gcctgtacag 1255 gttgtgtata
tgtaaagtcc ataggtgatg ttagattcat ggtgattaca caacggtttt 1315
acaattttgt aatgatttcc tagaattgaa ccagattggg agaggtattc cgatgcttat
1375 gaaaaactta cacgtgagct atggaagggg gtcacagtct ctgggtctaa
cccctggaca 1435 tgtgccactg agaaccttga aattaagagg atgccatgtc
attgcaaaga aatgatagtg 1495 tgaagggtta agttcttttg aattgttaca
ttgcgctggg acctgcaaat aagttctttt 1555 tttctaatga ggagagaaaa
atatatgtat ttttatataa tgtctaaagt tatatttcag 1615 gtgtaatgtt
ttctgtgcaa agttttgtaa attatatttg tgctatagta tttgattcaa 1675
aatatttaaa aatgtctcac tgttgacata tttaatgttt taaatgtaca gatgtattta
1735 actggtgcac tttgtaattc ccctgaaggt actcgtagct aagggggcag
aatactgttt 1795 ctggtgacca catgtagttt atttctttat tctttttaac
ttaatagagt cttcagactt 1855 gtcaaaacta tgcaagcaaa ataaataaat
aaaaataaaa tgaatacctt gaataataag 1915 taggatgttg gtcaccaggt
gcctttcaaa tttagaagct aattgacttt aggagctgac 1975 atagccaaaa
aggatacata ataggctact gaaatctgtc aggagtattt atgcaattat 2035
tgaacaggtg tcttttttta caagagctac aaattgtaaa ttttgtttct tttttttccc
2095 atagaaaatg tactatagtt tatcagccaa aaaacaatcc actttttaat
ttagtgaaag 2155 ttattttatt atactgtaca ataaaagcat tgtctctgaa
tgttaatttt ttggtacaaa 2215 aaataaattt gtacgaaaac ctgaaaaaaa
aaaaaaaaaa aaaaaaaagg gcggccgctc 2275 tagagggccc tattctatag 2295 2
316 PRT Mus musculus 2 Met Arg Arg Ala Ser Arg Asp Tyr Gly Lys Tyr
Leu Arg Ser Ser Glu 1 5 10 15 Glu Met Gly Ser Gly Pro Gly Val Pro
His Glu Gly Pro Leu His Pro 20 25 30 Ala Pro Ser Ala Pro Ala Pro
Ala Pro Pro Pro Ala Ala Ser Arg Ser 35 40 45 Met Phe Leu Ala Leu
Leu Gly Leu Gly Leu Gly Gln Val Val Cys Ser 50 55 60 Ile Ala Leu
Phe Leu Tyr Phe Arg Ala Gln Met Asp Pro Asn Arg Ile 65 70 75 80 Ser
Glu Asp Ser Thr His Cys Phe Tyr Arg Ile Leu Arg Leu His Glu 85 90
95 Asn Ala Gly Leu Gln Asp Ser Thr Leu Glu Ser Glu Asp Thr Leu Pro
100 105 110 Asp Ser Cys Arg Arg Met Lys Gln Ala Phe Gln Gly Ala Val
Gln Lys 115 120 125 Glu Leu Gln His Ile Val Gly Pro Gln Arg Phe Ser
Gly Ala Pro Ala 130 135 140 Met Met Glu Gly Ser Trp Leu Asp Val Ala
Gln Arg Gly Lys Pro Glu 145 150 155 160 Ala Gln Pro Phe Ala His Leu
Thr Ile Asn Ala Ala Ser Ile Pro Ser 165 170 175 Gly Ser His Lys Val
Thr Leu Ser Ser Trp Tyr His Asp Arg Gly Trp 180 185 190 Ala Lys Ile
Ser Asn Met Thr Leu Ser Asn Gly Lys Leu Arg Val Asn 195 200 205 Gln
Asp Gly Phe Tyr Tyr Leu Tyr Ala Asn Ile Cys Phe Arg His His 210 215
220 Glu Thr Ser Gly Ser Val Pro Thr Asp Tyr Leu Gln Leu Met Val Tyr
225 230 235 240 Val Val Lys Thr Ser Ile Lys Ile Pro Ser Ser His Asn
Leu Met Lys 245 250 255 Gly Gly Ser Thr Lys Asn Trp Ser Gly Asn Ser
Glu Phe His Phe Tyr 260 265 270 Ser Ile Asn Val Gly Gly Phe Phe Lys
Leu Arg Ala Gly Glu Glu Ile 275 280 285 Ser Ile Gln Val Ser Asn Pro
Ser Leu Leu Asp Pro Asp Gln Asp Ala 290 295 300 Thr Tyr Phe Gly Ala
Phe Lys Val Gln Asp Ile Asp 305 310 315 3 2271 DNA Homo sapiens CDS
(185)..(1135) 3 aagcttggta ccgagctcgg atccactact cgacccacgc
gtccgcgcgc cccaggagcc 60 aaagccgggc tccaagtcgg cgccccacgt
cgaggctccg ccgcagcctc cggagttggc 120 cgcagacaag aaggggaggg
agcgggagag ggaggagagc tccgaagcga gagggccgag 180 cgcc atg cgc cgc
gcc agc aga gac tac acc aag tac ctg cgt ggc tcg 229 Met Arg Arg Ala
Ser Arg Asp Tyr Thr Lys Tyr Leu Arg Gly Ser 1 5 10 15 gag gag atg
ggc ggc ggc ccc gga gcc ccg cac gag ggc ccc ctg cac 277 Glu Glu Met
Gly Gly Gly Pro Gly Ala Pro His Glu Gly Pro Leu His 20 25 30 gcc
ccg ccg ccg cct gcg ccg cac cag ccc ccc gcc gcc tcc cgc tcc 325 Ala
Pro Pro Pro Pro Ala Pro His Gln Pro Pro Ala Ala Ser Arg Ser 35 40
45 atg ttc gtg gcc ctc ctg ggg ctg ggg ctg ggc cag gtt gtc tgc agc
373 Met Phe Val Ala Leu Leu Gly Leu Gly Leu Gly Gln Val Val Cys Ser
50 55 60 gtc gcc ctg ttc ttc tat ttc aga gcg cag atg gat cct aat
aga ata 421 Val Ala Leu Phe Phe Tyr Phe Arg Ala Gln Met Asp Pro Asn
Arg Ile 65 70 75 tca gaa gat ggc act cac tgc att tat aga att ttg
aga ctc cat gaa 469 Ser Glu Asp Gly Thr His Cys Ile Tyr Arg Ile Leu
Arg Leu His Glu 80 85 90 95 aat gca gat ttt caa gac aca act ctg gag
agt caa gat aca aaa tta 517 Asn Ala Asp Phe Gln Asp Thr Thr Leu Glu
Ser Gln Asp Thr Lys Leu 100 105 110 ata cct gat tca tgt agg aga att
aaa cag gcc ttt caa gga gct gtg 565 Ile Pro Asp Ser Cys Arg Arg Ile
Lys Gln Ala Phe Gln Gly Ala Val 115 120 125 caa aag gaa tta caa cat
atc gtt gga tca cag cac atc aga gca gag 613 Gln Lys Glu Leu Gln His
Ile Val Gly Ser Gln His Ile Arg Ala Glu 130 135 140 aaa gcg atg gtg
gat ggc tca tgg tta gat ctg gcc aag agg agc aag 661 Lys Ala Met Val
Asp Gly Ser Trp Leu Asp Leu Ala Lys Arg Ser Lys 145 150 155 ctt gaa
gct cag cct ttt gct cat ctc act att aat gcc acc gac atc 709 Leu Glu
Ala Gln Pro Phe Ala His Leu Thr Ile Asn Ala Thr Asp Ile 160 165 170
175 cca tct ggt tcc cat aaa gtg agt ctg tcc tct tgg tac cat gat cgg
757 Pro Ser Gly Ser His Lys Val Ser Leu Ser Ser Trp Tyr His Asp Arg
180 185 190 ggt tgg gcc aag atc tcc aac atg act ttt agc aat gga aaa
cta ata 805 Gly Trp Ala Lys Ile Ser Asn Met Thr Phe Ser Asn Gly Lys
Leu Ile 195 200 205 gtt aat cag gat ggc ttt tat tac ctg tat gcc aac
att tgc ttt cga 853 Val Asn Gln Asp Gly Phe Tyr Tyr Leu Tyr Ala Asn
Ile Cys Phe Arg 210 215 220 cat cat gaa act tca gga gac cta gct aca
gag tat ctt caa cta atg 901 His His Glu Thr Ser Gly Asp Leu Ala Thr
Glu Tyr Leu Gln Leu Met 225 230 235 gtg tac gtc act aaa acc agc atc
aaa atc cca agt tct cat acc ctg 949 Val Tyr Val Thr Lys Thr Ser Ile
Lys Ile Pro Ser Ser His Thr Leu 240 245 250 255 atg aaa gga gga agc
acc aag tat tgg tca ggg aat tct gaa ttc cat 997 Met Lys Gly Gly Ser
Thr Lys Tyr Trp Ser Gly Asn Ser Glu Phe His 260 265 270 ttt tat tcc
ata aac gtt ggt gga ttt ttt aag tta cgg tct gga gag 1045 Phe Tyr
Ser Ile Asn Val Gly Gly Phe Phe Lys Leu Arg Ser Gly Glu 275 280 285
gaa atc agc atc gag gtc tcc aac ccc tcc tta ctg gat ccg gat cag
1093 Glu Ile Ser Ile Glu Val Ser Asn Pro Ser Leu Leu Asp Pro Asp
Gln 290 295 300 gat gca aca tac ttt ggg gct ttt aaa gtt cga gat ata
gat 1135 Asp Ala Thr Tyr Phe Gly Ala Phe Lys Val Arg Asp Ile Asp
305 310 315 tgagccccag tttttggagt gttatgtatt tcctggatgt ttggaaacat
tttttaaaac 1195 aagccaagaa agatgtatat aggtgtgtga gactactaag
aggcatggcc ccaacggtac 1255 acgactcagt atccatgctc ttgaccttgt
agagaacacg cgtatttaca gccagtggga 1315 gatgttagac tcatggtgtg
ttacacaatg gtttttaaat tttgtaatga attcctagaa 1375 ttaaaccaga
ttggagcaat tacgggttga ccttatgaga aactgcatgt gggctatggg 1435
aggggttggt ccctggtcat gtgccccttc gcagctgaag tggagagggt gtcatctagc
1495 gcaattgaag gatcatctga aggggcaaat tcttttgaat tgttacatca
tgctggaacc 1555 tgcaaaaaat actttttcta atgaggagag aaaatatatg
tatttttata taatatctaa 1615 agttatattt cagatgtaat gttttctttg
caaagtattg taaattatat ttgtgctata 1675 gtatttgatt caaaatattt
aaaaatgtct tgctgttgac atatttaatg ttttaaatgt 1735 acagacatat
ttaactggtg cactttgtaa attccctggg gaaaacttgc agctaaggag 1795
gggaaaaaaa tgttgtttcc taatatcaaa tgcagtatat ttcttcgttc tttttaagtt
1855 aatagatttt ttcagacttg tcaagcctgt gcaaaaaaat taaaatggat
gccttgaata 1915 ataagcagga tgttggccac caggtgcctt tcaaatttag
aaactaattg actttagaaa 1975 gctgacattg ccaaaaagga tacataatgg
gccactgaaa tctgtcaaga gtagttatat 2035 aattgttgaa caggtgtttt
tccacaagtg ccgcaaattg tacctttttt tttttttcaa 2095 aatagaaaag
ttattagtgg tttatcagca aaaaagtcca attttaattt agtaaatgtt 2155
atcttatact gtacaataaa aacattgcct ttgaatgtta attttttggt acaaaaataa
2215 atttatatga aaaaaaaaaa aaaagggcgg ccgctctaga gggccctatt ctatag
2271 4 317 PRT Homo sapiens 4 Met Arg Arg Ala Ser Arg Asp Tyr Thr
Lys Tyr Leu Arg Gly Ser Glu 1 5 10 15 Glu Met Gly Gly Gly Pro Gly
Ala Pro His Glu Gly Pro Leu His Ala 20 25 30 Pro Pro Pro Pro Ala
Pro His Gln Pro Pro Ala Ala Ser Arg Ser Met 35 40 45 Phe Val Ala
Leu Leu Gly Leu Gly Leu Gly Gln Val Val Cys Ser Val 50 55 60 Ala
Leu Phe Phe Tyr Phe Arg Ala Gln Met Asp Pro Asn Arg Ile Ser 65 70
75 80 Glu Asp Gly Thr His Cys Ile Tyr Arg Ile Leu Arg Leu His Glu
Asn 85 90 95 Ala Asp Phe Gln Asp Thr Thr Leu Glu Ser Gln Asp Thr
Lys Leu Ile 100 105 110 Pro Asp Ser Cys Arg Arg Ile Lys Gln Ala Phe
Gln Gly Ala Val Gln 115 120 125 Lys Glu Leu Gln His Ile Val Gly Ser
Gln His Ile Arg Ala Glu Lys 130 135 140 Ala Met Val Asp Gly Ser Trp
Leu Asp Leu Ala Lys Arg Ser Lys Leu 145 150 155 160 Glu Ala Gln Pro
Phe Ala His Leu Thr Ile Asn Ala Thr Asp Ile Pro 165 170 175 Ser Gly
Ser His Lys Val Ser Leu Ser Ser Trp Tyr His Asp Arg Gly 180 185 190
Trp Ala Lys Ile Ser Asn Met Thr Phe Ser Asn Gly Lys Leu Ile Val 195
200 205 Asn Gln Asp Gly Phe Tyr Tyr Leu Tyr Ala Asn Ile Cys Phe Arg
His 210 215 220 His Glu Thr Ser Gly Asp Leu Ala Thr Glu Tyr Leu Gln
Leu Met Val 225 230 235 240 Tyr Val Thr Lys Thr Ser Ile Lys Ile Pro
Ser Ser His Thr Leu Met 245 250 255 Lys Gly Gly Ser Thr Lys Tyr Trp
Ser Gly Asn Ser Glu Phe His Phe 260 265 270 Tyr Ser Ile Asn Val Gly
Gly Phe Phe Lys Leu Arg Ser Gly Glu Glu 275 280 285 Ile Ser Ile Glu
Val Ser Asn Pro Ser Leu Leu Asp Pro Asp Gln Asp 290 295 300 Ala Thr
Tyr Phe Gly Ala Phe Lys Val Arg Asp Ile Asp 305 310 315 5 52 DNA
Artificial Sequence Synthetic Oligonucleotide 5 gttctcctca
tatggatcca aaccgtattt ctgaagacag cactcactgc tt 52 6 37 DNA
Artificial Sequence Synthetic Oligonucleotide 6 tacgcactcc
gcggttagtc tatgtcctga actttga 37 7 51 DNA Artificial Sequence
Synthetic Oligonucleotide 7 atttgattct agaaggagga ataacatatg
catgaaaacg caggtctgca g 51 8 42 DNA Artificial Sequence Synthetic
Oligonucleotide 8 tatccgcgga tcctcgagtt agtctatgtc ctgaactttg aa 42
9 54 DNA Artificial Sequence Synthetic Oligonucleotide 9 atttgattct
agaaggagga ataacatatg tctgaagaca ctctgccgga ctcc 54 10 42 DNA
Artificial Sequence Synthetic Oligonucleotide 10 tatccgcgga
tcctcgagtt agtctatgtc ctgaactttg aa 42 11 48 DNA Artificial
Sequence Synthetic Oligonucleotide 11 atttgattct agaaggagga
ataacatatg aaacaagctt ttcagggg 48 12 42 DNA Artificial Sequence
Synthetic Oligonucleotide 12 tatccgcgga tcctcgagtt agtctatgtc
ctgaactttg aa 42 13 51 DNA Artificial Sequence Synthetic
Oligonucleotide 13 atttgattct agaaggagga ataacatatg aaagaactgc
agcacattgt g 51 14 42 DNA Artificial Sequence Synthetic
Oligonucleotide 14 tatccgcgga tcctcgagtt agtctatgtc ctgaactttg aa
42 15 51 DNA Artificial Sequence Synthetic Oligonucleotide 15
atttgattct agaaggagga ataacatatg cagcgtttct ctggtgctcc a 51 16 42
DNA Artificial Sequence Synthetic Oligonucleotide 16 tatccgcgga
tcctcgagtt agtctatgtc ctgaactttg aa 42 17 40 DNA Artificial
Sequence Synthetic Oligonucleotide 17 gttctcctca tatggaaggt
tcttggttgg atgtggccca 40 18 37 DNA Artificial Sequence Synthetic
Oligonucleotide 18 tacgcactcc gcggttagtc tatgtcctga actttga 37 19
44 DNA Artificial Sequence Synthetic Oligonucleotide 19 gttctcctca
tatgcgtggt aaacctgaag ctcaaccatt tgca 44 20 37 DNA Artificial
Sequence Synthetic Oligonucleotide 20 tacgcactcc gcggttagtc
tatgtcctga actttga 37 21 53 DNA Artificial Sequence Synthetic
Oligonucleotide 21 gttctcctca tatgaaacct gaagctcaac catttgcaca
cctcaccatc aat 53 22 37 DNA Artificial Sequence Synthetic
Oligonucleotide 22 tacgcactcc gcggttagtc tatgtcctga actttga 37 23
65 DNA Artificial Sequence Synthetic Oligonucleotide 23 gttctcctca
tatgcattta actattaacg ctgcatctat cccatcgggt tcccataaag 60 tcact 65
24 37 DNA Artificial Sequence Synthetic Oligonucleotide 24
tacgcactcc gcggttagtc tatgtcctga actttga 37 25 59 DNA Artificial
Sequence Synthetic Oligonucleotide 25 gttctcctca tatgactatt
aacgctgcat ctatcccatc gggttcccat aaagtcact 59 26 37 DNA Artificial
Sequence Synthetic Oligonucleotide 26 tacgcactcc gcggttagtc
tatgtcctga actttga 37 27 30 DNA Artificial Sequence Synthetic
Oligonucleotide 27 cctctaggcc tgtactttcg agcgcagatg 30 28 32 DNA
Artificial Sequence Synthetic Oligonucleotide 28 cctctgcggc
cgcgtctatg tcctgaactt tg 32 29 46 DNA Artificial Sequence Synthetic
Oligonucleotide 29 cctctctcga gtggacaacc cagaagcctg aggcccagcc
atttgc 46 30 32 DNA Artificial Sequence Synthetic Oligonucleotide
30 cctctgcggc cgcgtctatg tcctgaactt tg 32 31 56 DNA Artificial
Sequence Synthetic Oligonucleotide 31 agcttccacc atgaacaagt
ggctgtgctg cgcactcctg gtgctcctgg acatca 56 32 56 DNA Artificial
Sequence Synthetic Oligonucleotide 32 tcgatgatgt ccaggagcac
caggagtgcg cagcacagcc acttgttcat ggtgga 56 33 27 PRT Artificial
Sequence Synthetic Oligonucleotide 33 Asn Ala Ala Ser Ile Pro Ser
Gly Ser His Lys Val Thr Leu Ser Ser 1 5 10 15 Trp Tyr His Asp Arg
Gly Trp Ala Lys Ile Ser 20 25 34 28 PRT Artificial Sequence
Synthetic Oligonucleotide 34 Asn Ala Ala Ser Ile Pro Ser Gly Ser
His Lys Val Thr Leu Ser Ser 1 5 10 15 Trp Tyr His Asp Arg Gly Trp
Ala Lys Ile Ser Cys 20 25 35 17 PRT Artificial Sequence Synthetic
Oligonucleotide 35 Val Tyr Val Val Lys Thr Ser Ile Lys Ile Pro Ser
Ser His Asn Leu 1 5 10 15 Met 36 18 PRT Artificial Sequence
Synthetic Oligonucleotide 36 Val Tyr Val Val Lys Thr Ser Ile Lys
Ile Pro Ser Ser His Asn Leu 1 5 10 15 Met Cys 37 31 DNA Artificial
Sequence Synthetic Oligonucleotide 37 tctccaagct tgtgactctc
caggtcactc c 31 38 36 DNA Artificial Sequence Synthetic
Oligonucleotide 38 tctccgcggc cgcgtaagcc tgggcctcat tgggtg 36 39 72
DNA Artificial Sequence Synthetic Oligonucleotide 39 ctagcaccat
gaacaagtgg ctgtgctgcg cactcctggt gctcctggac atcattgaat 60
ggacaaccca ga 72 40 72 DNA Artificial Sequence Synthetic
Oligonucleotide 40 agcttctggg ttgtccattc aatgatgtcc aggagcacca
ggagtgcgca gcacagccac 60 ttgttcatgg tg 72 41 9 PRT Artificial
Sequence Synthetic Oligonucleotide 41 Met Asp Pro Asn Arg Gln Asp
Ile Asp 1 5 42 2071 DNA Artificial Sequence Synthetic
Oligonucleotide 42 actcgaccca cgcgtccgcc cgcccgcacc gcgcc atg gac
ccg cgc gcc cgg 53 Met Asp Pro Arg Ala Arg 1 5 cgg cgc cgc cag ctg
ccc gcg ccg ctg ctg gcg ctc tgc gtg ctg ctc 101 Arg Arg Arg Gln Leu
Pro Ala Pro Leu Leu Ala Leu Cys Val Leu Leu 10 15 20 gtt cca ctg
cag gtg act ctc cag gtc act cct cca tgc acc cag gag 149 Val Pro Leu
Gln Val Thr Leu Gln Val Thr Pro Pro Cys Thr Gln Glu 25 30 35 agg
cat tat gag cat ctc gga cgg tgt tgc agc aga tgc gaa cca gga 197 Arg
His Tyr Glu His Leu Gly Arg Cys Cys Ser Arg Cys Glu Pro Gly 40 45
50 aag tac ctg tcc tct aag tgc act cct acc tcc gac agt gtg tgt ctg
245 Lys Tyr Leu Ser Ser Lys Cys Thr Pro Thr Ser Asp Ser Val Cys Leu
55 60 65 70 ccc tgt ggc ccc gat gag tac ttg gac acc tgg aat gaa gaa
gat aaa 293 Pro Cys Gly Pro Asp Glu Tyr Leu Asp Thr Trp Asn Glu Glu
Asp Lys 75 80 85 tgc ttg ctg cat aaa gtc tgt gat gca ggc aag gcc
ctg gtg gcg gtg 341 Cys Leu Leu His Lys Val Cys Asp Ala Gly Lys Ala
Leu Val Ala Val 90 95 100 gat cct ggc aac cac acg gcc ccg cgt cgc
tgt gct tgc acg gct ggc 389 Asp Pro Gly Asn His Thr Ala Pro Arg Arg
Cys Ala Cys Thr Ala Gly 105 110 115 tac cac tgg aac tca gac tgc gag
tgc tgc cgc agg aac acg gag tgt 437 Tyr His Trp Asn Ser Asp Cys Glu
Cys Cys Arg Arg Asn Thr Glu Cys 120 125 130 gca cct ggc ttc gga gct
cag cat ccc ttg cag ctc aac aag gat acg 485 Ala Pro Gly Phe Gly Ala
Gln His Pro Leu Gln Leu Asn Lys Asp Thr 135 140 145 150 gtg tgc aca
ccc tgc ctc ctg ggc ttc ttc tca gat gtc ttt tcg tcc 533 Val Cys Thr
Pro Cys Leu Leu Gly Phe Phe Ser Asp Val Phe Ser Ser 155 160 165 aca
gac aaa tgc aaa cct tgg acc aac tgc acc ctc ctt gga aag cta 581 Thr
Asp Lys Cys Lys Pro Trp Thr Asn Cys Thr Leu Leu Gly Lys Leu 170 175
180 gaa gca cac cag ggg aca acg gaa tca gat gtg gtc tgc agc tct tcc
629 Glu Ala His Gln Gly Thr Thr Glu Ser Asp Val Val Cys Ser Ser Ser
185 190 195 atg aca ctg agg aga cca ccc aag gag gcc cag gct tac ctg
ccc agt 677 Met Thr Leu Arg Arg Pro Pro Lys Glu Ala Gln Ala Tyr Leu
Pro Ser 200 205 210 ctc atc gtt ctg ctc ctc ttc atc tct gtg gta gta
gtg gct gcc atc 725 Leu Ile Val Leu Leu Leu Phe Ile Ser Val Val Val
Val Ala Ala Ile 215 220 225 230 atc ttc ggc gtt tac tac agg aag gga
ggg aaa gcg ctg aca gct aat 773 Ile Phe Gly Val Tyr Tyr Arg Lys Gly
Gly Lys Ala Leu Thr Ala Asn 235 240 245 ttg tgg aat tgg gtc aat gat
gct tgc agt agt cta agt gga aat aag 821 Leu Trp Asn Trp Val Asn Asp
Ala Cys Ser Ser Leu Ser Gly Asn Lys 250 255 260 gag tcc tca ggg gac
cgt tgt gct ggt tcc cac tcg gca acc tcc agt 869 Glu Ser Ser Gly Asp
Arg Cys Ala Gly Ser His Ser Ala Thr Ser Ser 265 270 275 cag caa gaa
gtg tgt gaa ggt atc tta cta atg act cgg gag gag aag 917 Gln Gln Glu
Val Cys Glu Gly Ile Leu Leu Met Thr Arg Glu Glu Lys 280 285 290 atg
gtt cca gaa gac ggt gct gga gtc tgt ggg cct gtg tgt gcg gca 965 Met
Val Pro Glu Asp Gly Ala Gly Val Cys Gly Pro Val Cys Ala Ala 295 300
305 310 ggt ggg ccc tgg gca gaa gtc aga gat tct agg acg ttc aca ctg
gtc 1013 Gly Gly Pro Trp Ala Glu Val Arg Asp Ser Arg Thr Phe Thr
Leu Val 315 320 325 agc gag gtt gag acg caa gga gac ctc tcg agg aag
att ccc aca gag 1061 Ser Glu Val Glu Thr Gln Gly Asp Leu Ser Arg
Lys Ile Pro Thr Glu 330 335 340 gat gag tac acg gac cgg ccc tcg cag
cct tcg act ggt tca ctg ctc 1109 Asp Glu Tyr Thr Asp Arg Pro Ser
Gln Pro Ser Thr Gly Ser Leu Leu 345 350 355 cta atc cag cag gga agc
aaa tct ata ccc cca ttc cag gag ccc ctg 1157 Leu Ile Gln Gln Gly
Ser Lys Ser Ile Pro Pro Phe Gln Glu Pro Leu 360 365 370 gaa gtg ggg
gag aac gac agt tta agc cag tgt ttc acc ggg act gaa 1205 Glu Val
Gly Glu Asn Asp Ser Leu Ser Gln Cys Phe Thr Gly Thr Glu 375 380 385
390 agc acg gtg gat tct gag ggc tgt gac ttc act gag cct ccg agc aga
1253 Ser Thr Val Asp Ser Glu Gly Cys Asp Phe Thr Glu Pro Pro Ser
Arg 395 400 405 act gac tct atg ccc gtg tcc cct gaa aag cac ctg aca
aaa gaa ata 1301 Thr Asp Ser Met Pro Val Ser Pro Glu Lys His Leu
Thr Lys Glu Ile 410 415 420 gaa ggt gac agt tgc ctc ccc tgg gtg gtc
agc tcc aac tca aca gat 1349 Glu Gly Asp Ser Cys Leu Pro Trp Val
Val Ser Ser Asn Ser Thr Asp 425 430 435 ggc tac aca ggc agt ggg aac
act cct ggg gag gac cat gaa ccc ttt 1397 Gly Tyr Thr Gly Ser Gly
Asn Thr Pro Gly Glu Asp His Glu Pro Phe 440 445 450 cca ggg tcc ctg
aaa tgt gga cca ttg ccc cag tgt gcc tac agc atg 1445 Pro Gly Ser
Leu Lys Cys Gly Pro Leu Pro Gln Cys Ala Tyr Ser Met 455 460 465 470
ggc ttt ccc agt gaa gca gca gcc agc atg gca gag gcg gga gta cgg
1493 Gly Phe Pro Ser Glu Ala Ala Ala Ser Met Ala Glu Ala Gly Val
Arg 475 480 485 ccc cag gac agg gct gat gag agg gga gcc tca ggg tcc
ggg agc tcc 1541 Pro Gln Asp Arg Ala Asp Glu Arg Gly Ala Ser Gly
Ser Gly Ser Ser 490 495 500 ccc agt gac cag cca cct gcc tct ggg aac
gtg act gga aac agt aac 1589 Pro Ser Asp Gln Pro Pro Ala Ser Gly
Asn Val Thr Gly Asn Ser Asn 505 510 515 tcc acg ttc atc tct agc ggg
cag gtg atg aac ttc aag ggt gac atc 1637 Ser Thr Phe Ile Ser Ser
Gly Gln Val Met Asn Phe Lys Gly Asp Ile 520 525 530 atc gtg gtg tat
gtc agc cag acc tcg cag gag ggc ccg ggt tcc gca 1685 Ile Val Val
Tyr Val Ser Gln Thr Ser Gln Glu Gly Pro Gly Ser Ala 535 540 545 550
gag ccc gag tcg gag ccc gtg ggc cgc cct gtg cag gag gag acg ctg
1733 Glu Pro Glu Ser Glu Pro Val Gly Arg Pro Val Gln Glu Glu Thr
Leu 555 560 565 gca cac aga gac tcc ttt gcg ggc acc gcg ccg cgc ttc
ccc gac gtc 1781 Ala His Arg Asp Ser Phe Ala Gly Thr Ala Pro Arg
Phe Pro Asp Val 570 575 580 tgt gcc acc ggg gct ggg ctg cag gag cag
ggg gca ccc cgg cag aag 1829 Cys Ala Thr Gly Ala Gly Leu Gln Glu
Gln Gly Ala Pro Arg Gln Lys 585 590 595 gac ggg aca tcg cgg ccg gtg
cag gag cag ggt ggg gcg cag act tca 1877 Asp Gly Thr Ser Arg Pro
Val Gln Glu Gln Gly Gly Ala Gln Thr Ser 600 605 610 ctc cat acc cag
ggg tcc gga caa tgt gca gaa tgacctcacc ttctctgtct 1930 Leu His Thr
Gln Gly Ser Gly Gln Cys Ala Glu 615 620 625 gccctgggtg cagggcacca
gtgcctttcc aaaaacatgg tgtagctagc cactgtgcac 1990 ctcctcactg
gtgcaggctg ctggcatggt gatggagccc acctctcact tcctccagtg 2050
cccctctcct ctgcctccta c 2071 43 625 PRT Artificial Sequence
Synthetic Oligonucleotide 43 Met Asp Pro Arg Ala Arg Arg Arg Arg
Gln Leu Pro Ala Pro Leu Leu 1 5 10 15 Ala Leu Cys Val Leu Leu Val
Pro Leu Gln Val Thr Leu Gln Val Thr 20 25 30 Pro Pro Cys Thr Gln
Glu Arg His Tyr Glu His Leu Gly Arg Cys Cys 35 40 45 Ser Arg Cys
Glu Pro Gly Lys Tyr Leu Ser Ser Lys Cys Thr Pro Thr 50 55 60 Ser
Asp Ser Val Cys Leu Pro Cys Gly Pro Asp Glu Tyr Leu Asp Thr 65 70
75 80 Trp Asn Glu Glu Asp Lys Cys Leu Leu His Lys Val Cys Asp Ala
Gly 85 90 95 Lys Ala Leu Val Ala Val Asp Pro Gly Asn His Thr Ala
Pro Arg Arg 100 105 110 Cys Ala Cys Thr Ala Gly Tyr His Trp Asn Ser
Asp Cys Glu Cys Cys 115 120 125 Arg Arg Asn Thr Glu Cys Ala Pro Gly
Phe Gly Ala Gln His Pro Leu 130 135 140 Gln Leu Asn Lys Asp Thr Val
Cys Thr Pro Cys Leu Leu Gly Phe Phe 145 150 155 160 Ser Asp Val Phe
Ser Ser Thr Asp Lys Cys Lys Pro Trp Thr Asn Cys 165 170 175 Thr Leu
Leu Gly Lys Leu Glu Ala His Gln Gly Thr Thr Glu Ser Asp 180 185 190
Val Val Cys Ser Ser Ser Met Thr Leu Arg Arg Pro Pro Lys Glu Ala 195
200 205 Gln Ala Tyr Leu Pro Ser Leu Ile Val Leu Leu Leu Phe Ile Ser
Val 210 215 220 Val Val Val Ala Ala Ile Ile Phe Gly Val Tyr Tyr Arg
Lys Gly Gly 225 230 235 240 Lys Ala Leu Thr Ala Asn Leu Trp Asn Trp
Val Asn Asp Ala Cys Ser 245 250 255 Ser Leu Ser Gly Asn Lys Glu Ser
Ser Gly Asp Arg Cys Ala Gly Ser 260 265 270 His Ser Ala Thr Ser Ser
Gln Gln Glu Val Cys Glu Gly Ile Leu Leu 275 280 285 Met Thr Arg Glu
Glu Lys Met Val Pro Glu Asp Gly Ala Gly Val Cys 290 295 300 Gly Pro
Val Cys Ala Ala Gly Gly Pro Trp Ala Glu Val Arg Asp Ser 305 310 315
320 Arg Thr Phe Thr Leu Val Ser Glu Val Glu Thr Gln Gly Asp Leu Ser
325 330 335 Arg Lys Ile Pro Thr Glu Asp Glu Tyr Thr Asp Arg Pro Ser
Gln Pro 340 345 350 Ser Thr Gly Ser Leu Leu Leu Ile Gln Gln Gly Ser
Lys Ser Ile Pro 355 360 365 Pro Phe Gln Glu Pro Leu Glu Val Gly Glu
Asn Asp Ser Leu Ser Gln 370 375 380 Cys Phe Thr Gly Thr Glu Ser Thr
Val Asp Ser Glu Gly Cys Asp Phe 385 390 395 400 Thr Glu Pro Pro Ser
Arg Thr Asp Ser Met Pro Val Ser Pro Glu Lys 405 410 415 His Leu Thr
Lys Glu Ile Glu Gly Asp Ser Cys Leu Pro Trp Val Val 420 425 430 Ser
Ser Asn Ser Thr Asp Gly Tyr Thr Gly Ser Gly Asn Thr Pro Gly 435 440
445 Glu Asp His Glu Pro Phe Pro Gly Ser Leu Lys Cys Gly Pro Leu Pro
450 455 460 Gln Cys Ala Tyr Ser Met Gly Phe Pro Ser Glu Ala Ala Ala
Ser Met 465 470 475 480 Ala Glu Ala Gly Val Arg Pro Gln Asp Arg Ala
Asp Glu Arg Gly Ala 485 490 495 Ser Gly Ser Gly Ser Ser Pro Ser Asp
Gln Pro Pro Ala Ser Gly Asn 500 505 510 Val Thr Gly Asn Ser Asn Ser
Thr Phe Ile Ser Ser Gly Gln Val Met 515 520 525 Asn Phe Lys Gly Asp
Ile Ile Val Val Tyr Val Ser Gln Thr Ser Gln 530 535 540 Glu Gly Pro
Gly Ser Ala Glu Pro Glu Ser Glu Pro Val Gly Arg Pro 545 550 555 560
Val Gln Glu Glu Thr Leu Ala His Arg Asp Ser Phe Ala Gly Thr Ala 565
570 575 Pro Arg Phe Pro Asp Val Cys Ala Thr Gly Ala Gly Leu Gln Glu
Gln 580 585 590 Gly Ala Pro Arg Gln Lys Asp Gly Thr Ser Arg Pro Val
Gln Glu Gln 595 600 605 Gly Gly Ala Gln Thr Ser Leu His Thr Gln Gly
Ser Gly Gln Cys Ala 610 615 620 Glu 625 44 10 PRT Artificial
Sequence Synthetic Oligonucleotide 44 Met His Glu Asn Ala Gly Gln
Asp Ile Asp 1 5 10 45 10 PRT Artificial Sequence Synthetic
Oligonucleotide 45 Met Ser Glu Asp Thr Leu Gln Asp Ile Asp 1 5 10
46 10 PRT Artificial Sequence Synthetic Oligonucleotide 46 Met Lys
Gln Ala Phe Gln Gln Asp Ile Asp 1 5 10 47 10 PRT Artificial
Sequence Synthetic Oligonucleotide 47 Met Lys Glu Leu Gln His Gln
Asp Ile Asp 1 5 10 48 10 PRT Artificial Sequence Synthetic
Oligonucleotide 48 Met Gln Arg Phe Ser Gly Gln Asp Ile Asp 1 5 10
49 9 PRT Artificial Sequence Synthetic Oligonucleotide 49 Met Glu
Gly Ser Trp Gln Asp Ile Asp 1 5 50 9 PRT Artificial Sequence
Synthetic Oligonucleotide 50 Met Arg Gly Lys Pro Gln Asp Ile Asp 1
5 51 9 PRT Artificial Sequence Synthetic Oligonucleotide 51 Met Lys
Pro Glu Ala Gln Asp Ile Asp 1 5 52 9 PRT Artificial Sequence
Synthetic Oligonucleotide 52 Met His Leu Thr Ile Gln Asp Ile Asp 1
5 53 9 PRT Artificial Sequence Synthetic Oligonucleotide 53 Met Thr
Ile Asn Ala Gln Asp Ile Asp 1 5 54 9 PRT Artificial Sequence
Synthetic Oligonucleotide 54 Lys Leu Val Thr Leu Gln Val Thr Pro 1
5
* * * * *