U.S. patent application number 09/784332 was filed with the patent office on 2005-01-06 for diagnosis and treatment of aur1 and/or aur2 related disorders.
Invention is credited to Bischof, James, Plowman, Gregory.
Application Number | 20050002938 09/784332 |
Document ID | / |
Family ID | 21753554 |
Filed Date | 2005-01-06 |
United States Patent
Application |
20050002938 |
Kind Code |
A1 |
Plowman, Gregory ; et
al. |
January 6, 2005 |
DIAGNOSIS AND TREATMENT OF AUR1 AND/OR AUR2 RELATED DISORDERS
Abstract
The present invention relates to AUR1 and/or AUR2 polypeptides,
nucleic acids encoding such polypeptides, cells, tissues and
animals containing such nucleic acids, antibodies to such
polypeptides, assays utilizing such polypeptides, and methods
relating to all of the foregoing. Methods for treatment, diagnosis,
and screening are provided for AUR1 and/or AUR2 related diseases or
conditions characterized by an abnormal interaction between a AUR1
and/or AUR2 polypeptide and a AUR1 and/or AUR2 binding partner.
Inventors: |
Plowman, Gregory; (San
Carlos, CA) ; Bischof, James; (Nerviano, IT) |
Correspondence
Address: |
Beth A. Burrous
FOLEY & LARDNER
Washington Harbour
3000 K Street, N.W., Suite 500
Washington
DC
20007-5109
US
|
Family ID: |
21753554 |
Appl. No.: |
09/784332 |
Filed: |
February 16, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09784332 |
Feb 16, 2001 |
|
|
|
09283011 |
Mar 31, 1999 |
|
|
|
6207401 |
|
|
|
|
09283011 |
Mar 31, 1999 |
|
|
|
09012135 |
Jan 22, 1998 |
|
|
|
6716575 |
|
|
|
|
09012135 |
Jan 22, 1998 |
|
|
|
09005268 |
Jan 9, 1998 |
|
|
|
09005268 |
Jan 9, 1998 |
|
|
|
08755728 |
Nov 25, 1996 |
|
|
|
5962312 |
|
|
|
|
60008809 |
Dec 18, 1995 |
|
|
|
60023943 |
Aug 14, 1996 |
|
|
|
Current U.S.
Class: |
424/155.1 ;
435/344; 514/44R; 530/388.8 |
Current CPC
Class: |
A01K 2217/05 20130101;
G01N 2333/9121 20130101; C12Q 1/485 20130101; G01N 2500/04
20130101; A61K 38/00 20130101; A61P 35/00 20180101; G01N 2500/02
20130101; G01N 2500/10 20130101; C12N 9/1205 20130101 |
Class at
Publication: |
424/155.1 ;
530/388.8; 514/044; 435/344 |
International
Class: |
C12Q 001/48; A61K
048/00; A61K 039/395; C12N 005/06 |
Claims
1-16. (Canceled)
17. An antibody or antibody fragment having specific binding
affinity to AUR1 and/or AUR2 polypeptide or AUR1 and/or AUR2 domain
polypeptide.
18. A hybridoma which produces an antibody having specific binding
affinity to an AUR1 and/or AUR2 polypeptide.
19-20. (Canceled)
21. A method of treating colon cancer or pancreatic cancer by
administering to a patient in need of treatment for (a) colon
cancer a substance that modulates the kinase activity or expression
of a full length human AUR-1 or AUR-2 polypeptide or (b) pancreatic
cancer a substance that modulates the kinase activity or expression
of a full length human AUR-1 polypeptide.
22. The method of claim 21, wherein said patient has pancreatic
cancer.
23. The method of claim 21, wherein said patient has colon
cancer.
24. The method of claim 21, wherein said substance is an antisense
oligonucleotide selected from the group consisting of: SEQ ID
NO:30, SEQ ID NO:31, and SEQ ID NO:32.
25. The method of claim 21, wherein said substance is a protein
kinase inhibitor.
26-27. (Canceled)
28. An antisense oligonucleotide comprised of a nucleotide base
sequence selected from the group consisting of SEQ ID NO:30, SEQ ID
NO:31, and SEQ ID NO:32.
29. The method according to claim 21, wherein said substance that
modulates the kinase activity or expression of a full length human
AUR-1 or AUR-2 polypeptide is at least one substance which shows
positive results in at least one in vitro assay corresponding to
treatment of said colon cancer or pancreatic cancer.
30. (Canceled)
31. The method according to claim 21, wherein said substance that
modulates the kinase activity or expression of a full length human
AUR-1 or AUR-2 polypeptide comprises an antisense oligonucleotide.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 09/012,135 (Lyon & Lyon Docket No. 231/282), filed
Jan. 22, 1998, by Plowman et al., and entitled "AUR1 and/or AUR2
Related Disorders" which is a continuation-in-part of U.S. patent
application Ser. No. 09/005,268 (Lyon & Lyon Docket No.
229/022), filed Jan. 9, 1998, by Plowman et al., and entitled "AUR1
and/or AUR2 Related Disorders" which is a continuation-in-part of
U.S. patent application Ser. No. 08/755,728 (Lyon & Lyon Docket
No. 223/113), filed Nov. 25, 1996, by Plowman, et al., and entitled
"Diagnosis and Treatment of AUR1 and/or AUR2 Related Disorders",
and relates to U.S. patent application Ser. No. 60/008,809 filed
Dec. 18, 1995, and U.S. patent application Ser. No. 60/023,943,
filed Aug. 14, 1996, all of which are incorporated herein by
reference in their entirety, including any drawings.
FIELD OF THE INVENTION
[0002] The present invention relates to the novel proteins termed
AURORA ONE and AURORA TWO ("AUR1 and AUR2"), nucleotide sequences
encoding AUR1 and/or AUR2, as well as various products and methods
useful for the diagnosis and treatment of various AUR1 and/or AUR2
related diseases and conditions. AUR1 AND/OR AUR2 RELATED
DISORDERS
BACKGROUND OF THE INVENTION
[0003] The following description of the background of the invention
is provided to aid in understanding the invention but is not
admitted to be prior art to the invention.
[0004] Cellular signal transduction is a fundamental mechanism
whereby external stimuli that regulate diverse cellular processes
are relayed to the interior of cells. One of the key biochemical
mechanisms of signal transduction involves the reversible
phosphorylation of proteins, which enables regulation of the
activity of mature proteins by altering their structure and
function.
[0005] The best characterized protein kinases in eukaryotes
phosphorylate proteins on the alcohol moiety of serine, threonine
and tyrosine residues. These kinases largely fall into two groups,
those specific for phosphorylating serines and threonines, and
those specific for phosphorylating tyrosines. Some kinases,
referred to as "dual specificity" kinases, are able to
phosphorylate on tyrosine as well as serine/threonine residues.
[0006] Protein kinases can also be characterized by their location
within the cell. Some kinases are transmembrane receptor-type
proteins capable of directly altering their catalytic activity in
response to the external environment such as the binding of a
ligand.
[0007] Others are non-receptor-type proteins lacking any
transmembrane domain. They can be found in a variety of cellular
compartments from the inner surface of the cell membrane to the
nucleus.
[0008] Many kinases are involved in regulatory cascades wherein
their substrates may include other kinases whose activities are
regulated by their phosphorylation state.
[0009] Ultimately the activity of some downstream effector is
modulated by phosphorylation resulting from activation of such a
pathway.
[0010] The serine/threonine kinase family includes members found at
all steps of various signaling cascades, including those involved
in controlling cell growth, migration, differentiation and
secretion of hormones, phosphorylation of transcription factors
resulting in altered gene expression, muscle contraction, glucose
metabolism, control of cellular protein synthesis, and regulation
of the cell cycle.
[0011] Chromosomal abnormalities are a hallmark of human cancer,
reflecting the deleterious consequences of the gain or loss of
genetic information (Mitelman et al., Nature Genet. 15:417-474,
1997; Hartwell et al., Science 266:1821-1828, 1994). Some of these
defects may have a causal role in cellular transformation due to
loss of a negative growth regulator, loss of a gene responsible for
maintenance of genome integrity, or through the amplification or
activation of an oncogene (Kinzler et al., Nature 386:761-763,
1997; Hunter Cell 88:333-346, 1997). Alternatively, these
abnormalities may be a consequence of tumor progression where
mitotic checkpoints have been disrupted, resulting in abnormal
nuclei, miss-segregated chromosomes, and aneuploidy (Elledge
Science 274:1664-1672, 1996; Sherr Science 274:1672-1677,
1996).
SUMMARY OF THE INVENTION
[0012] The present invention relates in part to AUR1 and/or AUR2
polypeptides, nucleic acids encoding such polypeptides, cells,
tissues and animals containing such nucleic acids, antibodies to
such polypeptides, assays utilizing such polypeptides, and methods
relating to all of the foregoing. The utility of the present
invention includes the ability to screen for inhibitors of cell
growth and to develop small molecule therapeutics for treating
cancers.
[0013] Thus, in a first aspect, the invention features an isolated,
enriched, or purified nucleic acid encoding an AUR1 and/or AUR2
polypeptide.
[0014] By "isolated" in reference to nucleic acid is meant a
polymer of 6 (preferably 21, more preferably 39, most preferably
75) or more nucleotides conjugated to each other, including DNA and
RNA that is isolated from a natural source or that is synthesized.
In certain embodiments of the invention, longer nucleic acids are
preferred, for example those of 300, 600, 900 or more nucleotides
and/or those having at least 50%, 60%, 75%, 90%, 95% or 99%
identity to the full length sequence shown in SEQ ID NO:1 or SEQ ID
NO:2. The isolated nucleic acid of the present invention is unique
in the sense that it is not found in a pure or separated state in
nature. Use of the term "isolated" indicates that a naturally
occurring sequence has been removed from its normal cellular (i.e.,
chromosomal) environment. Thus, the sequence may be in a cell-free
solution or placed in a different cellular environment. The term
does not imply that the sequence is the only nucleotide chain
present, but that it is essentially free (about 90-95% pure at
least) of non-nucleotide material naturally associated with it, and
thus is distinguished from isolated chromosomes.
[0015] By the use of the term "enriched" in reference to nucleic
acid is meant that the specific DNA or RNA sequence constitutes a
significantly higher fraction (2-5 fold) of the total DNA or RNA
present in the cells or solution of interest than in normal or
diseased cells or in the cells from which the sequence was taken.
This could be caused by a person by preferential reduction in the
amount of other DNA or RNA present, or by a preferential increase
in the amount of the specific DNA or RNA sequence, or by a
combination of the two. However, it should be noted that enriched
does not imply that there are no other DNA or RNA sequences
present, just that the relative amount of the sequence of interest
has been significantly increased. The term significant here is used
to indicate that the level of increase is useful to the person
making such an increase, and generally means an increase relative
to other nucleic acids of about at least 2 fold, more preferably at
least 5 to 10 fold or even more. The term also does not imply that
there is no DNA or RNA from other sources. The other source DNA
may, for example, comprise DNA from a yeast or bacterial genome, or
a cloning vector such as pUC19. This term distinguishes from
naturally occurring events, such as viral infection, or tumor type
growths, in which the level of one mRNA may be naturally increased
relative to other species of mRNA. That is, the term is meant to
cover only those situations in which a person has intervened to
elevate the proportion of the desired nucleic acid.
[0016] It is also advantageous for some purposes that a nucleotide
sequence be in purified form. The term "purified" in reference to
nucleic acid does not require absolute purity (such as a
homogeneous preparation). Instead, it represents an indication that
the sequence is relatively more pure than in the natural
environment (compared to the natural level this level should be at
least 2-5 fold greater, e.g., in terms of mg/mL). Individual clones
isolated from a cDNA library may be purified to electrophoretic
homogeneity. The claimed DNA molecules obtained from these clones
could be obtained directly from total DNA or from total RNA. The
cDNA clones are not naturally occurring, but rather are preferably
obtained via manipulation of a partially purified naturally
occurring substance (messenger RNA). The construction of a cDNA
library from mRNA involves the creation of a synthetic substance
(cDNA) and pure individual cDNA clones can be isolated from the
synthetic library by clonal selection of the cells carrying the
cDNA library. Thus, the process which includes the construction of
a cDNA library from mRNA and isolation of distinct cDNA clones
yields an approximately 10.sup.6-fold purification of the native
message. Thus, purification of at least one order of magnitude,
preferably two or three orders, and more preferably four or five
orders of magnitude is expressly contemplated.
[0017] By "an AUR1 and/or AUR2 polypeptide" is meant 25 (preferably
30, more preferably 35, most preferably 40) or more contiguous
amino acids set forth in the full length amino acid sequence of SEQ
ID NO:3 or SEQ ID NO:4, or a functional derivative thereof as
described herein. In certain aspects, polypeptides of 100, 200, 300
or more amino acids are preferred. The AUR1 and/or AUR2 polypeptide
can be encoded by a full-length nucleic acid sequence or any
portion of the full-length nucleic acid sequence, so long as a
functional activity of the polypeptide is retained.
[0018] Also included are inactive and activated mutants of AUR1
and/or AUR2, including, but not limited to those defined in Example
11 herein. By "inactive" is meant an AUR1 and/or AUR2 polypeptide
which lacks kinase activity. In some embodiments, the essential
lysine (residue 162) is mutated. Preferably the polypeptide is
otherwise unchanged. By "activated" is meant an AUR1 and/or AUR2
polypeptide which has kinase activity in vitro, preferably in
situations where the unmutated polypeptide does not. Preferably,
the AUR1 and/or AUR2 polypeptide is mutated to mimic constitutive
phosphorylation. In some embodiments, the threonine at residue 288
in the activation loop is modified to an aspartic acid.
[0019] The amino acid sequence will be substantially similar to the
sequence shown in SEQ ID NO:3 or SEQ ID NO:4, or fragments thereof.
A sequence that is substantially similar will preferably have at
least 90% identity (more preferably at least 95% and most
preferably 99-100%) to the sequence of SEQ ID NO:3 or SEQ ID
NO:4.
[0020] By "identity" is meant a property of sequences that measures
their similarity or relationship. Identity is measured by dividing
the number of identical residues by the total number of residues
and multiplying the product by 100. Thus, two copies of exactly the
same sequence have 100% identity, but sequences that are less
highly conserved, and have deletions, additions, or replacements,
may have a lower degree of identity. Those skilled in the art will
recognize that several computer programs are available for
determining sequence identity.
[0021] In a preferred embodiment, the invention features a nucleic
acid molecule comprising a nucleotide sequence that: (a) encodes a
polypeptide having the full length amino acid sequence set forth in
SEQ ID NO:3 or SEQ ID NO:4; (b) is the complement of the nucleotide
sequence of (a); (c) hybridizes under highly stringent conditions
to the nucleic acid molecule of (a) and encodes a naturally
occurring AUR1 and/or AUR2 polypeptide; (d) encodes AUR1 and/or
AUR2 polypeptide having the full length amino acid sequence set
forth in SEQ ID NO:3 or SEQ ID NO:4 except that it lacks one or
more of the following segments of amino acid residues: 1-73,
74-271, or 272-344 of SEQ ID NO:3, or 1-129, 130-274, or 275-403 of
SEQ ID NO:4; (e) is the complement of the nucleotide sequence of
(d); (f) encodes a polypeptide having the amino acid sequence set
forth in SEQ ID NO:3 or SEQ ID NO:4 from amino acid residues 1-73,
74-271, or 272-344 of SEQ ID NO:3, or 1-129, 130-274, 275-403 of
SEQ ID NO:4; (g) is the complement of the nucleotide sequence of
(f); (h) encodes a polypeptide having the full length amino acid
sequence set forth in SEQ ID NO:3 or SEQ ID NO:4 except that it
lacks one or more of the domains selected from the group consisting
of a C-terminal domain, a catalytic domain, and an N-terminal
domain; or (i) is the complement of the nucleotide sequence of
(h).
[0022] The term "complement" refers to two nucleotides that can
form multiple favorable interactions with one another. For example,
adenine is complementary to thymine as they can form two hydrogen
bonds. Similarly, guanine and cytosine are complementary since they
can form three hydrogen bonds. A nucleotide sequence is the
complement of another nucleotide sequence if all of the nucleotides
of the first sequence are complementary to all of the nucleotides
of the second sequence.
[0023] The term "domain" refers to a region of a polypeptide which
contains a particular function. For instance, N-terminal or
C-terminal domains of signal transduction proteins can serve
functions including, but not limited to, binding molecules that
localize the signal transduction molecule to different regions of
the cell or binding other signaling molecules directly responsible
for propagating a particular cellular signal. Some domains can be
expressed separately from the rest of the protein and function by
themselves, while others must remain part of the intact protein to
retain function. The latter are termed functional regions of
proteins and also relate to domains.
[0024] The term "N-terminal domain" refers to a portion of the full
length amino acid sequence spanning from the amino terminus to the
start of the catalytic domain. The N-terminal domain spans amino
acid residues 1-73 of the sequence set forth in SEQ ID NO:3 or
amino acids 1-130 of the sequence set forth in SEQ ID NO:4.
[0025] The term "catalytic domain" refers to a portion of the full
length amino acid sequence that does not contain the N-terminal
domain or the C-terminal domain and has catalytic activity. The
catalytic domain spans amino acid residues 73-271 of the sequence
set forth in SEQ ID NO:3 or residues 130-274 of the sequence set
forth in SEQ ID NO:4.
[0026] The term "C-terminal domain" refers to a portion of the full
length amino acid sequence that begins at the end of the catalytic
domain and ends at the carboxyl terminal amino acid, which is the
last amino acid encoded before the stop codon in the nucleic acid
sequence. The C-terminal domain spans amino acid residues 272-344
of the sequence set forth in SEQ ID NO:3 or amino acids 275-403 of
the sequence set forth in SEQ ID NO:4.
[0027] In preferred embodiments, the isolated nucleic acid
comprises, consists essentially of, or consists of a nucleic acid
sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, encodes the full
length amino acid sequence of SEQ ID NO:3 or SEQ ID NO:4, a
functional derivative thereof, or at least 25, 30, 35, 40, 50, 100,
200, or 300 contiguous amino acids thereof. The AUR1 and/or AUR2
polypeptide comprises, consists essentially of, or consists of at
least 25, 30, 35, or 40 contiguous amino acids of an AUR1 and/or
AUR2 polypeptide. The nucleic acid may be isolated from a natural
source by cDNA cloning or by subtractive hybridization. The natural
source may be mammalian, preferably human, blood, semen, or tissue
and the nucleic acid may be synthesized by the triester method or
by using an automated DNA synthesizer.
[0028] In yet other preferred embodiments, the nucleic acid is a
conserved or unique region, for example those useful for: the
design of hybridization probes to facilitate identification and
cloning of additional polypeptides, the design of PCR probes to
facilitate cloning of additional polypeptides, obtaining antibodies
to polypeptide regions, and designing antisense oligonucleotides.
Examples of amino acid sequences of the present invention include
the following amino acid sequences (the isolated, purified or
enriched nucleic acids encoding them are also within the scope of
the present invention): ENSYPWPYGRQ (SEQ ID NO:5), CISGP (SEQ ID
NO:6), QFPQ (SEQ ID N0:7), VNSGQ (SEQ ID NO:8), RKEPVTPSA-LV (SEQ
ID NO:9), LMSRSNVQPTAAP (SEQ ID NO:10), VQNQKQKQLQATSVPH (SEQ ID
NO:11), PVSRPLNNTQK (SEQ ID NO:12), VMENSSGTPD (SEQ ID NO:13),
ILTRHFTID (SEQ ID NO:14), and SKQPLPSAPENNPEEQLASKQK (SEQ ID
NO:15).
[0029] By "conserved nucleic acid regions", are meant regions
present on two or more nucleic acids encoding an AUR1 and/or AUR2
polypeptide, to which a particular nucleic acid sequence can
hybridize under lower stringency conditions. Examples of lower
stringency conditions suitable for screening for nucleic acid
encoding AUR1 and/or AUR2 polypeptides are provided in Abe et al.
J. Biol. Chem. 19:13361-13368, 1992 (hereby incorporated by
reference herein in its entirety, including any drawings).
Preferably, conserved regions differ by no more than 5 out of 20
nucleotides.
[0030] By "unique nucleic acid region" is meant a sequence present
in a full length nucleic acid coding for an AUR1 and/or AUR2
polypeptide that is not present in a sequence coding for any other
naturally occurring polypeptide. Such regions preferably comprise
30 to 45 contiguous nucleotides present in the full length nucleic
acid encoding an AUR1 and/or AUR2 polypeptide. In particular, a
unique nucleic acid region is preferably of mammalian origin.
[0031] In a preferred embodiment, the isolated, enriched or
purified nucleic acid molecule encoding AUR1 and/or AUR2
polypeptide, comprises a vector or promoter effective to initiate
transcription in a host cell.
[0032] The invention also features a nucleic acid probe for the
detection of nucleic acid encoding an AUR1 and/or AUR2 polypeptide
in a sample. The nucleic acid probe contains a nucleotide base
sequence that will hybridize to a sequence set forth in SEQ ID NO:1
or SEQ ID NO:2 or a functional derivative thereof.
[0033] In preferred embodiments the nucleic acid probe hybridizes
to nucleic acid encoding at least 12, 75, 90, 105, 120, 150, 200,
250, 300 or 350 contiguous amino acids of the full-length sequence
set forth in SEQ ID NO:3 or SEQ ID NO:4 or a functional derivative
thereof. Various low or high stringency hybridization conditions
may be used depending upon the specificity and selectivity desired.
Under stringent hybridization conditions only highly complementary
nucleic acid sequences hybridize. Preferably, such conditions
prevent hybridization of nucleic acids having 1 or 2 mismatches out
of 20 contiguous nucleotides.
[0034] By stringent hybridization assay conditions is meant
hybridization assay conditions at least as stringent as the
following: hybridization in 50% formamide, 5.times.SSC, 50 mM
NaH.sub.2PO.sub.4, pH 6.8, 0.5% SDS, 0.1 mg/mL sonicated salmon
sperm DNA, and 5.times.Denhart solution at 42.degree. C. overnight;
washing with 2.times.SSC, 0.1% SDS at 45.degree. C.; and washing
with 0.2.times.SSC, 0.1% SDS at 45.degree. C.
[0035] Methods for using the probes include detecting the presence
or amount of AUR1 and/or AUR2 RNA in a sample by contacting the
sample with a nucleic acid probe under conditions such that
hybridization occurs and detecting the presence or amount of the
probe bound to AUR1 and/or AUR2 RNA. The nucleic acid duplex formed
between the probe and a nucleic acid sequence coding for an AUR1
and/or AUR2 polypeptide may be used in the identification of the
sequence of the nucleic acid detected (Nelson et al., in
Nonisotopic DNA Probe Techniques, Academic Press, San Diego,
Kricka, ed., p. 275, 1992, hereby incorporated by reference herein
in its entirety, including any drawings). Kits for performing such
methods may be constructed to include a container means having
disposed therein a nucleic acid probe.
[0036] The invention also features recombinant nucleic acid,
preferably in a cell or an organism. The recombinant nucleic acid
may contain a sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 or a
functional derivative thereof and a vector or a promoter effective
to initiate transcription in a host cell. The recombinant nucleic
acid can alternatively contain a transcriptional initiation region
functional in a cell, a sequence complementary to an RNA sequence
encoding an AUR1 and/or AUR2 polypeptide and a transcriptional
termination region functional in a cell.
[0037] In another aspect, the invention describes a recombinant
cell or tissue containing nucleic acid coding for an AUR1 and/or
AUR2 polypeptide. In such cells, the nucleic acid may be under the
control of its genomic regulatory elements, or may be under the
control of exogenous regulatory elements including an exogenous
promoter. By "exogenous" it is meant a promoter that is not
normally coupled in vivo transcriptionally to the coding sequence
for the AUR1 and/or AUR2 polypeptide.
[0038] The polypeptide is preferably a fragment of the protein
encoded by the full length amino acid sequence set forth in SEQ ID
NO:3 or SEQ ID NO:4. By "fragment," is meant an amino acid sequence
present in a full-length AUR1 and/or AUR2 polypeptide that is not
present in any other naturally occurring polypeptide. Preferably,
such a sequence comprises 6 contiguous amino acids present in the
full sequence. More preferably, such a sequence comprises 12
contiguous amino acids present in the full sequence. Even more
preferably, such a sequence comprises 18 contiguous amino acids
present in the full sequence.
[0039] In another aspect the invention features an isolated,
enriched, or purified AUR1 and/or AUR2 polypeptide.
[0040] By "isolated" in reference to a polypeptide is meant a
polymer of 2 (preferably 7, more preferably 13, most preferably 25)
or more amino acids conjugated to each other, including
polypeptides that are isolated from a natural source or that are
synthesized. In certain aspects longer polypeptides are preferred,
such as those with 402, 407, 413, or 425 contiguous amino acids set
forth in SEQ ID NO:3 or SEQ ID NO:4. The isolated polypeptides of
the present invention are unique in the sense that they are not
found in a pure or separated state in nature. Use of the term
"isolated" indicates that a naturally occurring sequence has been
removed from its normal cellular environment. Thus, the sequence
may be in a cell-free solution or placed in a different cellular
environment. The term does not imply that the sequence is the only
amino acid chain present, but that it is essentially free (about
90-95% pure at least) of non-amino acid material naturally
associated with it.
[0041] By the use of the term "enriched" in reference to a
polypeptide is meant that the specific amino acid sequence
constitutes a significantly higher fraction (2-5 fold) of the total
amino acids present in the cells or solution of interest than in
normal or diseased cells or in the cells from which the sequence
was taken. This could be caused by a person by preferential
reduction in the amount of other amino acids present, or by a
preferential increase in the amount of the specific amino acid
sequence of interest, or by a combination of the two. However, it
should be noted that enriched does not imply that there are no
other amino acid sequences present, just that the relative amount
of the sequence of interest has been significantly increased. The
term significant here is used to indicate that the level of
increase is useful to the person making such an increase, and
generally means an increase relative to other amino acids of about
at least 2 fold, more preferably at least 5 to 10 fold or even
more. The term also does not imply that there is no amino acid from
other sources. The other source amino acid may, for example,
comprise amino acid encoded by a yeast or bacterial genome, or a
cloning vector such as pUC19. The term is meant to cover only those
situations in which man has intervened to elevate the proportion of
the desired amino acid.
[0042] It is also advantageous for some purposes that an amino acid
sequence be in purified form. The term "purified" in reference to a
polypeptide does not require absolute purity (such as a homogeneous
preparation); instead, it represents an indication that the
sequence is relatively purer than in the natural environment.
Compared to the natural level this level should be at least 2-5
fold greater (e.g., in terms of mg/mL). Purification of at least
one order of magnitude, preferably two or three orders, and more
preferably four or five orders of magnitude is expressly
contemplated. The substance is preferably free of contamination at
a functionally significant level, for example 90%, 95%, or 99%
pure.
[0043] In preferred embodiments, the AUR1 and/or AUR2 polypeptide
contains at least 25, 30, 35, 40, 50, 100, 150, 200, 250, 300, or
350 contiguous amino acids of the full-length sequence set forth in
SEQ ID NO:3 or SEQ ID NO:4, or a functional derivative thereof.
[0044] Also included are inactive and activated mutants of AUR1
and/or AUR2, including, but not limited to those defined in Example
11 herein. By "inactive" is meant an AUR1 and/or AUR2 polypeptide
which lacks kinase activity. In some embodiments, the essential
lysine (residue 162) is mutated. Preferably the polypeptide is
otherwise unchanged. By "activated" is meant an AUR1 and/or AUR2
polypeptide which has kinase activity in vitro, preferably in
situations where the unmutated polypeptide does not. Preferably,
the AUR1 and/or AUR2 polypeptide is mutated to mimic constitutive
phosphorylation. In some embodiments, the threonine at residue 288
in the activation loop is modified to an aspartic acid.
[0045] The polypeptide may be isolated from a natural source by
methods well-known in the art. The natural source may be mammalian,
preferably human, blood, semen, or tissue, and the polypeptide may
be synthesized using an automated polypeptide synthesizer.
[0046] In a preferred embodiment, the invention features a
polypeptide comprising an amino acid sequence having (a) the full
length amino acid sequence set forth in SEQ ID NO:3 or SEQ ID NO:4;
(b) the full length amino acid sequence set forth in SEQ ID NO:3 or
SEQ ID NO:4 except that it lacks one or more of the following
segments of amino acid residues: 1-73, 74-271, or 272-344 of SEQ ID
NO:3, or 1-129, 130-274, or 275-403 of SEQ ID NO:4; (c) the amino
acid sequence set forth in SEQ ID NO:3 or SEQ ID NO:4 from amino
acid residues 1-73, 74-271, or 272-344 of SEQ ID NO:3, or 1-129,
130-274, or 275-403 of SEQ ID NO:4; or (d) the full length amino
acid sequence set forth in SEQ ID NO:3 or SEQ ID NO:4 except that
it lacks one or more of the domains selected from the group
consisting of a C-terminal domain, a catalytic domain, and an
N-terminal domain.
[0047] In some embodiments the invention includes a recombinant
AUR1 and/or AUR2 polypeptide. By "recombinant AUR1 and/or AUR2
polypeptide" is meant a polypeptide produced by recombinant DNA
techniques such that it is distinct from a naturally occurring
polypeptide either in its location (e.g., present in a different
cell or tissue than found in nature), purity or structure.
Generally, such a recombinant polypeptide will be present in a cell
in an amount different from that normally observed in nature.
[0048] In yet another aspect, the invention features an antibody
(e.g., a monoclonal or polyclonal antibody) having specific binding
affinity to an AUR1 and/or AUR2 polypeptide or an AUR1 and/or AUR2
polypeptide domain or fragment. By "specific binding affinity" is
meant that the antibody binds to the target (AUR1 and/or AUR2)
polypeptide with greater affinity than it binds to other
polypeptides under specified conditions. Antibodies or antibody
fragments are polypeptides which contain regions that can bind
other polypeptides. The term "specific binding affinity" describes
an antibody that binds to an AUR1 and/or AUR2 polypeptide with
greater affinity than it binds to other polypeptides under
specified conditions.
[0049] The term "polyclonal" refers to antibodies that are
heterogenous populations of antibody molecules derived from the
sera of animals immunized with an antigen or an antigenic
functional derivative thereof. For the production of polyclonal
antibodies, various host animals may be immunized by injection with
the antigen. Various adjuvants may be used to increase the
immunological response, depending on the host species.
[0050] "Monoclonal antibodies" are substantially homogenous
populations of antibodies to a particular antigen. They may be
obtained by any technique which provides for the production of
antibody molecules by continuous cell lines in culture. Monoclonal
antibodies may be obtained by methods known to those skilled in the
art (Kohler et al., Nature 256:495-497, 1975, and U.S. Pat. No.
4,376,110).
[0051] The term "antibody fragment" refers to a portion of an
antibody, often the hyper variable region and portions of the
surrounding heavy and light chains, that displays specific binding
affinity for a particular molecule. A hyper variable region is a
portion of an antibody that physically binds to the polypeptide
target.
[0052] Antibodies or antibody fragments having specific binding
affinity to an AUR1 and/or AUR2 polypeptide may be used in methods
for detecting the presence and/or amount of AUR1 and/or AUR2
polypeptide in a sample by probing the sample with the antibody
under conditions suitable for AUR1 and/or AUR2-antibody
immunocomplex formation and detecting the presence and/or amount of
the antibody conjugated to the AUR1 and/or AUR2 polypeptide.
Diagnostic kits for performing such methods may be constructed to
include antibodies or antibody fragments specific for AUR1 and/or
AUR2 as well as a conjugate of a binding partner of the antibodies
or the antibodies themselves.
[0053] An antibody or antibody fragment with specific binding
affinity to an AUR1 and/or AUR2 polypeptide can be isolated,
enriched, or purified from a prokaryotic or eukaryotic organism.
Routine methods known to those skilled in the art enable production
of antibodies or antibody fragments, in both prokaryotic and
eukaryotic organisms. Purification, enrichment, and isolation of
antibodies, which are polypeptide molecules, are described
above.
[0054] Antibodies having specific binding affinity to an AUR1
and/or AUR2 polypeptide may be used in methods for detecting the
presence and/or amount of AUR1 and/or AUR2 polypeptide in a sample
by contacting the sample with the antibody under conditions such
that an immunocomplex forms and detecting the presence and/or
amount of the antibody conjugated to the AUR1 and/or AUR2
polypeptide. Diagnostic kits for performing such methods may be
constructed to include a first container containing the antibody
and a second container having a conjugate of a binding partner of
the antibody and a label, such as, for example, a radioisotope. The
diagnostic kit may also include notification of an FDA approved use
and instructions therefor.
[0055] In another aspect, the invention features a hybridoma which
produces an antibody having specific binding affinity to an AUR1
and/or AUR2 polypeptide or an AUR1 and/or AUR2 polypeptide domain.
By "hybridoma" is meant an immortalized cell line which is capable
of secreting an antibody, for example an antibody to AUR1 and/or
AUR2; In preferred embodiments the antibody to AUR1 and/or AUR2
comprises a sequence of amino acids that is able to specifically
bind an AUR1 and/or AUR2 polypeptide.
[0056] In another aspect, the invention features an AUR1 and/or
AUR2 polypeptide binding agent able to bind to an AUR1 and/or AUR2
polypeptide. The binding agent is preferably a purified antibody
which recognizes an epitope present on an AUR1 and/or AUR2
polypeptide. Other binding agents include molecules which bind to
the AUR1 and/or AUR2 polypeptide and analogous molecules which bind
to an AUR1 and/or AUR2 polypeptide. Such binding agents may be
identified by using assays that measure AUR1 and/or AUR2 binding
partner activity, such as those that measure PDGFR activity.
[0057] The invention features a method for screening for human
cells containing an AUR1 and/or AUR2 polypeptide or an equivalent
sequence. The method involves identifying the novel polypeptide in
human cells using techniques that are routine and standard in the
art, such as those described herein for identifying AUR1 and/or
AUR2 (e.g., cloning, Southern or Northern blot analysis, in situ
hybridization, PCR amplification, etc.).
[0058] In another aspect, the invention provides a method for
identifying a substance capable of modulating AUR1 and/or AUR2
activity comprising the steps of (a) contacting AUR1 and/or AUR2
polypeptide with a test substance; (b) measuring the activity of
said polypeptide; and (c) determining whether said substance
modulates the activity of said polypeptide.
[0059] The term "modulates" refers to the ability of a compound to
alter the function of AUR1 and/or AUR2. A modulator preferably
activates or inhibits the activity of AUR1 and/or AUR2 depending on
the concentration of the compound exposed to AUR1 and/or AUR2.
[0060] The term "activates" refers to increasing the cellular
activity of AUR1 and/or AUR2. The term "inhibit" refers to
decreasing the cellular activity of AUR1 and/or AUR2. AUR1 and/or
AUR2 activity is preferably the interaction with a natural binding
partner.
[0061] The term "modulates" also refers to altering the function of
AUR1 and/or AUR2 by increasing or decreasing the probability that a
complex forms between AUR1 and/or AUR2 and a natural binding
partner. A modulator preferably increases the probability that such
a complex forms between AUR1 and/or AUR2 and the natural binding
partner, more preferably increases or decreases the probability
that a complex forms between AUR1 and/or AUR2 and the natural
binding partner depending on the concentration of the compound
exposed to AUR1 and/or AUR2, and most preferably decreases the
probability that a complex forms between AUR1 and/or AUR2 and the
natural binding partner.
[0062] The term "complex" refers to an assembly of at least two
molecules bound to one another. Signal transduction complexes often
contain at least two protein molecules bound to one another. For
instance, a protein tyrosine receptor protein kinase, GRB2, SOS,
RAF, and RAS assemble to form a signal transduction complex in
response to a mitogenic ligand.
[0063] The term "natural binding partner" refers to polypeptides or
nucleic acids that bind to AUR1 and/or AUR2 in cells. A change in
the interaction between AUR1 and/or AUR2 and a natural binding
partner can manifest itself as an increased or decreased
probability that the interaction forms, or an increased or
decreased concentration of AUR1 and/or AUR2/natural binding partner
complex.
[0064] The term "contacting" as used herein refers to mixing a
solution comprising the test compound with a liquid medium bathing
the cells of the methods. The solution comprising the compound may
also comprise another component, such as dimethyl sulfoxide (DMSO),
which facilitates the uptake of the test compound or compounds into
the cells of the methods. The solution comprising the test compound
may be added to the medium bathing the cells by utilizing a
delivery apparatus, such as a pipet-based device or syringe-based
device.
[0065] In another aspect, the invention provides for the treatment
of diseases by administering to a patient in need of such treatment
a substance that modulates the activity of AUR1 and/or AUR2. Such
substances preferably show positive results in one or more in vitro
assays for an activity corresponding to treatment of the disease or
disorder in question (such as the assays described in example 13
below). Examples of substances that can be screened for favorable
activity are provided in section XI below. The diseases that could
be treated by a modulator of AUR1 and/or AUR2 activity preferably
include colon, breast, renal, ovarian, bladder, head and neck
cancers, and gliomas, medulloblastomas, chondrosarcomas, and
pancreatic tumors, and preferably include breast, colon, and renal
cancers, and more preferably, colon cancer. The substances that
modulate the activity of AUR1 and/or AUR2 preferably include, but
are not limited to, antisense oligonucleotides, as described
herein, and inhibitors of protein kinases, as determined by methods
and screens described herein in the Examples.
[0066] Another aspect of the invention features a method for
detection of aur1 and/or aur2 in a sample as a diagnostic tool for
diseases comprising the steps of (a) contacting said sample with a
nucleic acid probe which hybridizes under hybridization assay
conditions to a nucleic acid target region of aur1 and/or aur2,
said probe comprising the nucleic acid sequence encoding an AUR1
and/or AUR2 polypeptide, a fragment thereof, or the complement of
said sequence or fragment; and (b) detecting the presence or amount
of the probe:target region hybrid as an indication of said
disease.
[0067] The aur1 and/or aur2 "target region" is the nucleotide base
sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, a functional
derivative thereof, or a fragment thereof to which the nucleic acid
probe will specifically hybridize. Specific hybridization indicates
that in the presence of other nucleic acids the probe only
hybridizes detectably with the aur1 and/or aur2 target region.
Putative target regions can be identified by methods well known in
the art consisting of alignment and comparison of the most closely
related sequences in the database.
[0068] In preferred embodiments the nucleic acid probe hybridizes
to an aur1 and/or aur2 target region encoding at least 12, 75, 90,
105, 120, 150, 200, 250, 300 or 350 contiguous amino acids of the
full-length sequence set forth in SEQ ID NO:3 or SEQ ID NO:4 or a
functional derivative thereof. Hybridization conditions should be
such that hybridization occurs only with aur1 and/or aur2 in the
presence of other nucleic acid molecules. Under stringent
hybridization conditions only highly complementary nucleic acid
sequences hybridize. Preferably, such conditions prevent
hybridization of nucleic acids having 1 or 2 mismatches out of 20
contiguous nucleotides. Such conditions are defined supra.
[0069] The diseases for which detection of aur1 and/or aur2 in a
sample could be diagnostic include diseases in which aur1 and/or
aur2 nucleic acid (DNA and/or RNA) is amplified in comparison to
normal cells. By "amplification" is meant increased numbers of aur1
and/or aur2 DNA or RNA in a cell compared with normal cells. In
normal cells, aur1 and aur2 are found as single copy genes. In
selected diseases, the chromosomal location of aur1 and/or aur2 is
amplified, resulting in multiple copies of the gene, or
amplification. Gene amplification can lead to amplification of aur1
and/or aur2 RNA, or aur1 and/or aur2 RNA can be amplified in the
absence of aur1 and/or aur2 DNA amplification.
[0070] "Amplification" as it refers to RNA can be the detectable
presence of aur1 and/or aur2 RNA in cells, since in some normal
cells there is no basal expression of aur1 and/or aur2 RNA. In
other normal cells, a basal level of expression of aur1 and/or aur2
exists, therefore in these cases amplification is the detection of
at least 1-2-fold, and preferably more, aur1 and/or aur2 RNA,
compared to the basal level.
[0071] The diseases that could be diagnosed by detection of aur1
and/or aur2 in a sample preferably include colon, breast, renal,
ovarian, bladder, head and neck cancers, and gliomas,
medulloblastomas, chondrosarcomas, and pancreatic tumors, and
preferably include breast, colon, and renal cancers, and more
preferably, colon cancer.
[0072] The test samples suitable for nucleic acid probing methods
of the present invention include, for example, cells or nucleic
acid extracts of cells, or biological fluids. The samples used in
the above-described methods will vary based on the assay format,
the detection method and the nature of the tissues, cells or
extracts to be assayed. Methods for preparing nucleic acid extracts
of cells are well known in the art and can be readily adapted in
order to obtain a sample which is compatible with the method
utilized.
[0073] Another aspect of the invention features antisense
oligonucleotides to the nucleic acid sequences encoding AUR1 and/or
AUR2 polypeptides contained in SEQ ID NO:1 and/or SEQ ID NO:2, and
fragments thereof. In a preferred invention the antisense
oligonucleotides are synthesized as phosphorothionates. In a
preferred embodiment the antisense oligonucleotides comprise the
following sequences 5'-3': nucleotides 1743-1763 of aur2:
CAGGGCAGAGTGGTCACTTTC (SEQ ID NO:30), nucleotides 42-62 of aur2:
CGTCCGCCACTCCGACCAGCC (SEQ ID NO:31), nicleotides 1654-1674 of
aur2: TGCAGTCGAACCTTGCCTCCA (SEQ ID NO:32).
[0074] The antisense oligonucleotides of the invention are
preferably used to inhibit AUR1 and/or AUR2 protein expression in
vivo in normal and tumor cells. Antisense oligonucleotides can be
used either singly or in combination. In a preferred embodiment,
either SEQ ID NO:30 and SEQ ID NO:32 or SEQ ID NO:31 and SEQ ID
NO:32 are used jointly. In a preferred embodiment, expression of
AUR2 is significantly reduced, and more preferably reduced to below
the limit of detection. In other preferred embodiments, treatment
with SEQ ID NO:31 and SEQ ID NO:32 inhibits growth and/or induces
apoptosis in cells. Antisense oligonucleotides can also be used to
inhibit AUR1 and/or AUR2 protein expression in human tumor cell
xenografts in nude mice. Antisense oligonucleotides may
preferentially be used as a treatment in various human tumors over
expressing AUR2.
[0075] Additional antisense oligonucleotides and effective
combinations can be identified by methods well known in the art.
Briefly, cells or tissues over expressing aur1 and/or aur2 can be
contacted with antisense oligonucleotides, either singly or in
combination, and the expression of aur1 and/or aur2-RNA, and/or
AUR1 and/or AUR2 polypeptide can be determined by methods described
herein. Preferably, treatment with aur1 and/or aur2 causes a
decrease in the expression of aur1 and/or aur2 RNA and/or AUR1
and/or AUR2 polypeptide, more preferably expression is decreased
significantly (1 to 2-fold), most preferably expression is
decreased to an undetectable level.
[0076] The summary of the invention described above is non-limiting
and other features and advantages of the invention will be apparent
from the following description of the preferred embodiments, and
from the claims.
DESCRIPTION OF FIGURES
[0077] FIG. 1 shows the sequences for human aur1 and aur2 deduced
from full length cDNA clones isolated from normal duodenum,
pancreatic carcinoma, and primary colorectal carcinoma libraries.
Xenopus p46B (PIR:S53343), Drosophila aurora (PIR:A56220) and S.
cerevesiae IPL1 (SWISS-PROT:P38991) are included in the alignment.
The alignment was generated by also including the two murine
(DDBJ:D21099 and GB:U80932), an additional xenopis (PIR:S53342),
and two C. elegans (GB:U53336 and GB:U97196) sequences as input
into msa, a parallel coded multiple sequence alignment program that
was run on MasPar MP2216 supercomputer. Boxed residues are common
to three or more of the sequences, shaded residues represent
regions of amino acid similarity between two or more sequences,
overlines correspond to the conserved Aurora Box1 and Aurora Box2
sequences, the arrow denotes the start of the C-terminal
serine/threonine kinase domain, the circled residue indicates the
location of a single nucleotide polymorphism described in the text,
solid circles correspond to the location of various yeast and
Drosophila mutants, and stars denote the site of the kinase
inactivating and activating point mutants described in the
text.
DETAILED DESCRIPTION OF THE INVENTION
[0078] The present invention relates in part to AUR1 and/or AUR2
polypeptides, nucleic acids encoding such polypeptides, cells
containing such nucleic acids, antibodies to such polypeptides,
assays utilizing such polypeptides, and methods relating to all of
the foregoing. The present invention is based upon the isolation
and characterization of new proteins which we have designated AUR1
and/or AUR2. The polypeptides and nucleic acids may be produced
using well known and standard synthesis techniques when given the
sequences presented herein.
[0079] I. Nucleic Acid Encoding AUR1 and/or AUR2 Polypeptides.
[0080] Included within the scope of this invention are the
functional equivalents of the herein-described isolated nucleic
acid molecules. The degeneracy of the genetic code permits
substitution of certain codons by other codons which specify the
same amino acid and hence would give rise to the same protein. The
nucleic acid sequence can vary substantially since, with the
exception of methionine and tryptophan, the known amino acids can
be coded for by more than one codon. Thus, portions or all of the
AUR1 and/or AUR2 gene could be synthesized to give a nucleic acid
sequence significantly different from that shown in SEQ ID NO:1 or
SEQ ID NO:2. The encoded amino acid sequence thereof would,
however, be preserved.
[0081] In addition, the nucleic acid sequence may comprise a
nucleotide sequence which results from the addition, deletion or
substitution of at least one nucleotide to the 5'-end and/or the
3'-end of the nucleic acid formula shown in SEQ ID NO:1 or SEQ ID
NO:2 or a derivative thereof. Any nucleotide or polynucleotide may
be used in this regard, provided that its addition, deletion or
substitution does not alter the amino acid sequence of SEQ ID NO:3
or SEQ ID NO:4 which is encoded by the nucleotide sequence. For
example, the present invention is intended to include any nucleic
acid sequence resulting from the addition of ATG as an initiation
codon at the 5'-end of the inventive nucleic acid sequence or its
derivative, or from the addition of TTA, TAG or TGA as a
termination codon at the 3'-end of the inventive nucleotide
sequence or its derivative. Moreover, the nucleic acid molecule of
the present invention may, as necessary, have restriction
endonuclease recognition sites added to its 5'-end and/or
3'-end.
[0082] Such functional alterations of a given nucleic acid sequence
afford an opportunity to promote secretion and/or processing of
heterologous proteins encoded by foreign nucleic acid sequences
fused thereto. All variations of the nucleotide sequence of the
AUR1 and/or AUR2 genes and fragments thereof permitted by the
genetic code are, therefore, included in this invention.
[0083] Further, it is possible to delete codons or to substitute
one or more codons with codons other than degenerate codons to
produce a structurally modified polypeptide, but one which has
substantially the same utility or activity as the polypeptide
produced by the unmodified nucleic acid molecule. As recognized in
the art, the two polypeptides are functionally equivalent, as are
the two nucleic acid molecules which give rise to their production,
even though the differences between the nucleic acid molecules are
not related to the degeneracy of the genetic code.
[0084] II. A Nucleic Acid Probe for the Detection of AUR1 and/or
AUR2.
[0085] Southern analysis with probes derived from the unique
N-terminal regions of aur1 and aur2 indicate that they exist as
single copy genes in human cells. However, under low stringency
conditions, 1.3 kb and 3.2 kb SacI fragments which weakly hybridize
to the aur1 probe were detected.
[0086] A nucleic acid probe of the present invention may be used to
probe an appropriate chromosomal or cDNA library by usual
hybridization methods to obtain another nucleic acid molecule of
the present invention. A chromosomal DNA or cDNA library may be
prepared from appropriate cells according to recognized methods in
the art (cf. "Molecular Cloning: A Laboratory Manual", second
edition, Cold Spring Harbor Laboratory, Sambrook, Fritsch, &
Maniatis, eds., 1989).
[0087] In the alternative, chemical synthesis is carried out in
order to obtain nucleic acid probes having nucleotide sequences
which correspond to N-terminal and C-terminal portions of the amino
acid sequence of the polypeptide of interest. The synthesized
nucleic acid probes may be used as primers in a polymerase chain
reaction (PCR) carried out in accordance with recognized PCR
techniques, essentially according to PCR Protocols, "A Guide to
Methods and Applications", Academic Press, Michael et al., eds.,
1990, utilizing the appropriate chromosomal or cDNA library to
obtain the fragment of the present invention.
[0088] One skilled in the art can readily design such probes based
on the sequence disclosed herein using methods of computer
alignment and sequence analysis known in the art ("Molecular
Cloning: A Laboratory Manual", 1989, supra). The hybridization
probes of the present invention can be labeled by standard labeling
techniques such as with a radiolabel, enzyme label, fluorescent
label, biotin-avidin label, chemiluminescence, and the like. After
hybridization, the probes may be visualized using known
methods.
[0089] The nucleic acid probes of the present invention include
RNA, as well as DNA probes, such probes being generated using
techniques known in the art. The nucleic acid probe may be
immobilized on a solid support. Examples of such solid supports
include, but are not limited to, plastics such as polycarbonate,
complex carbohydrates such as agarose and sepharose, and acrylic
resins, such as polyacrylamide and latex beads. Techniques for
coupling nucleic acid probes to such solid supports are well known
in the art.
[0090] The test samples suitable for nucleic acid probing methods
of the present invention include, for example, cells or nucleic
acid extracts of cells, or biological fluids. The samples used in
the above-described methods will vary based on the assay format,
the detection method and the nature of the tissues, cells or
extracts to be assayed. Methods for preparing nucleic acid extracts
of cells are well known in the art and can be readily adapted in
order to obtain a sample which is compatible with the method
utilized.
[0091] III. A Probe Based Method and Kit for Detecting AUR1 and/or
AUR2.
[0092] Aur1 RNA is broadly expressed in rapidly dividing cells
derived from both normal and tumor tissues. Aur2 RNA is expressed
in a more restricted pattern, being low or absent in most normal
tissues, and abundant in only a subset of tumor-derived cell lines,
particularly those of colon, renal, melanoma, and breast origin in
which the 2.4 kb aur2 transcript is expressed in 96% (24 of 25).
The 1.4 kb aur1 transcript was coexpressed at similar levels as
aur2 in the same 24 tumor cell lines.
[0093] Aur2 RNA expression is also increased in approximately 54%
(22/41) of 41 primary human colorectal tumors compared with matched
normal colorectal controls. Aur2 RNA showed 4-28 fold
overexpression in tumor versus normal tissue.
[0094] Human aur1 is located on chromosome 17p13.1 and human aur2
on chromosome 20q13.2. Aur2 maps adjacent to the vitamin D
hydroxylase (CYP24) gene and the cosmid probe RMC20C001 that lie at
0.825-0.83 Flpter (fractional length from pter) on chromosome 20
(Tanner et al., Cancer res. 54:4257-4260, 1994; Tanner et al.,
Cancer Res. 56:3441-3445, 1996). Both of these markers have been
characterized for their presence in the 20q13 amplicon common to
many human malignancies, particularly those from breast, bladder,
and colon (Tanner 1994, supra; Tanner 1996, supra; Kallioniemi et
al., Proc. Natl. Acad. Sci. USA 91:2156-2160, 1994; Yaseen et al.,
Cancer Genet. Cytogenet. 44:83-97, 1990; Muleris et al., Cancer
Genet. Cytogenet. 29:289-301, 1987; Schlegel et al., Cancer Res.
55:6002-6005, 1995; James et al., Oncogene 14:1059-1065, 1997;
Solinas-Toldo et al., Cancer Res. 56:3803-3807, 1996; Bockmuhl et
al., Laryngorhinootologie 75:408-414, 1996; Larramendy et al., Am.
J. Pathol. 150:685-691, 1997; Reznikoff et al., Semin. Oncol.
23:571-584, 1996; Coujal et al., Br. J. Cancer 74:1984-1989, 1996;
Iwabuchi et al., Cancer Res. 55:6172-6180, 1995; Bigner et al.,
Cancer Genet. Cytogenet. 30:91-101, 1988). The aur2-specific bands
showed amplification in the tumor samples.
[0095] AUR2 DNA was amplified in 41 of 79 (52%) of the primary
colorectal tumors for which suitable DNA was available for
genotyping. Nine of twelve samples demonstrated a 2-8 fold
amplification of AUR2 DNA in the tumors compared to normal tissue.
Eleven of the samples showed a direct correlation between DNA
amplification and RNA overexpression.
[0096] The most common regions of high copy amplification in human
breast cancer have been localized to 17q22 and 20q13.2 (Tanner
1994, supra; Tanner 1996, supra; Kallioniemi 1994, supra). Low
level amplification of 20q has been described in 6-18% of primary
breast cancer and 40% of breast cancer cell lines. The incidence
increases to 60% in BRCA2 positive breast cancers (Tanner 1994,
supra; Tanner 1996, supra; Kallioniemi 1994, supra; Tirkkonen et
al., Cancer Res. 57:1222-1227, 1997). High levels of 20q
amplification correlate with poor prognosis for patients with node
negative breast cancer (Isola et al., Am. J. Pathol. 147:905-911,
1995). Low level amplification of 20q has also been noted in colon
cancer, ovarian cancer, bladder cancer, gliomas, medulloblastomas,
chondrosarcomas, pancreatic tumors, and head and neck cancers
(Yaseen 1990, supra; Muleris 1987, supra; Schlegel 1995, supra;
James 1997, supra; Solinas-Toldo 1996, supra; Bockmuhl 1996, supra;
Larramendy 1997, supra; Reznikoff 1996, supra; Courjal 1996, supra;
Iwabuchi 1995, supra; Bigner 1988, supra). Several studies have
also found chromosomal gains of 20q in approximately 60% of primary
colorectal carcinomas (Yaseen 1990, supra; Muleris 1987, supra;
Schlegel 1995, supra). Cell culture models have suggested that
low-level amplification of 20q is associated with immortalization
and subsequent high-level amplification correlates with chromosomal
instability (Savalieva et al., Oncogene 14:551-560, 1997).
[0097] AUR2 DNA was amplified in 41 of 79 (52%) of primary
colorectal tumors. The CYP24 gene was coamplified with aur2 in 37
of 41 (90%) matched pairs, and was only once found amplified in the
absence of aur2 amplification. Aur2 DNA amplification and RNA
overexpression is highly correlated (r=0.695). DNA amplification
may be a mechanism for aur2 activation and aur2 may be the oncogene
at 20q13 whose high level amplification correlates with poor
clinical outcome in a variety of solid tumors (Isola 1995,
supra).
[0098] One method of detecting the presence of aur1 and/or aur2 in
a sample comprises (a) contacting said sample with the
above-described nucleic acid probe under conditions such that
hybridization occurs, and (b) detecting the presence of said probe
bound to said nucleic acid molecule. One skilled in the art would
select the nucleic acid probe according to techniques known in the
art as described above. Samples to be tested include but should not
be limited to RNA samples of human tissue.
[0099] A kit for detecting the presence of aur1 and/or aur2 in a
sample comprises at least one container means having disposed
therein the above-described nucleic acid probe. The kit may further
comprise other containers comprising one or more of the following:
wash reagents and reagents capable of detecting the presence of
bound nucleic acid probe. Examples of detection reagents include,
but are not limited to radiolabelled probes, enzymatic labeled
probes (horseradish peroxidase, alkaline phosphatase), and affinity
labeled probes (biotin, avidin, or steptavidin).
[0100] In detail, a compartmentalized kit includes any kit in which
reagents are contained in separate containers. Such containers
include small glass containers, plastic containers or strips of
plastic or paper. Such containers allow the efficient transfer of
reagents from one compartment to another compartment such that the
samples and reagents are not cross-contaminated and the agents or
solutions of each container can be added in a quantitative fashion
from one compartment to another. Such containers will include a
container which will accept the test sample, a container which
contains the probe or primers used in the assay, containers which
contain wash reagents (such as phosphate buffered saline,
Tris-buffers, and the like), and containers which contain the
reagents used to detect the hybridized probe, bound antibody,
amplified product, or the like. One skilled in the art will readily
recognize that the nucleic acid probes described in the present
invention can readily be incorporated into one of the established
kit formats which are well known in the art.
[0101] IV. DNA Constructs Comprising an Aur1 and/or Aur2 Nucleic
Acid Molecule and Cells Containing these Constructs.
[0102] The present invention also relates to a recombinant DNA
molecule comprising, 5'to 3', a promoter effective to initiate
transcription in a host cell and the above-described nucleic acid
molecules. In addition, the present invention relates to a
recombinant DNA molecule comprising a vector and an above-described
nucleic acid molecule. The present invention also relates to a
nucleic acid molecule comprising a transcriptional region
functional in a cell, a sequence complementary to an RNA sequence
encoding an amino acid sequence corresponding to the
above-described polypeptide, and a transcriptional termination
region functional in said cell. The above-described molecules may
be isolated and/or purified DNA molecules.
[0103] The present invention also relates to a cell or organism
that contains an above-described nucleic acid molecule and thereby
is capable of expressing a peptide. The polypeptide may be purified
from cells which have been altered to express the polypeptide. A
cell is said to be "altered to express a desired polypeptide" when
the cell, through genetic manipulation, is made to produce a
protein which it normally does not produce or which the cell
normally produces at lower levels. One skilled in the art can
readily adapt procedures for introducing and expressing either
genomic, cDNA, or synthetic sequences into either eukaryotic or
prokaryotic cells.
[0104] A nucleic acid molecule, such as DNA, is said to be "capable
of expressing" a polypeptide if it contains nucleotide sequences
which contain transcriptional and translational regulatory
information and such sequences are "operably linked" to nucleotide
sequences which encode the polypeptide. An operable linkage is a
linkage in which the regulatory DNA sequences and the DNA sequence
sought to be expressed are connected in such a way as to permit
gene sequence expression. The precise nature of the regulatory
regions needed for gene sequence expression may vary from organism
to organism, but shall in general include a promoter region which,
in prokaryotes, contains both the promoter (which directs the
initiation of RNA transcription) as well as the DNA sequences
which, when transcribed into RNA, will signal synthesis initiation.
Such regions will normally include those 5'-non-coding sequences
involved with initiation of transcription and translation, such as
the TATA box, capping sequence, CAAT sequence, and the like.
[0105] If desired, the non-coding region 3' to the sequence
encoding an AUR1 and/or AUR2 polypeptide may be obtained by the
above-described methods. This region may be retained for its
transcriptional termination regulatory sequences, such as
termination and polyadenylation. Thus, by retaining the 3'-region
naturally contiguous to the DNA sequence encoding an AUR1 and/or
AUR2 polypeptide, the transcriptional termination signals may be
provided. Where the transcriptional termination signals are not
satisfactorily functional in the expression host cell, then a 3'
region functional in the host cell may be substituted.
[0106] Two DNA sequences (such as a promoter region sequence and an
aur1 and/or aur2 sequence) are said to be operably linked if the
nature of the linkage between the two DNA sequences does not (1)
result in the introduction of a frame-shift mutation, (2) interfere
with the ability of the promoter region sequence to direct the
transcription of an aur1 and/or aur2 gene sequence, or (3)
interfere with the ability of the aur1 and/or aur2 gene sequence to
be transcribed by the promoter region sequence. Thus, a promoter
region would be operably linked to a DNA sequence if the promoter
were capable of effecting transcription of that DNA sequence. Thus,
to express an aur1 and/or aur2 gene, transcriptional and
translational signals recognized by an appropriate host are
necessary.
[0107] The present invention encompasses the expression of the aur1
and/or aur2 gene (or a functional derivative thereof) in either
prokaryotic or eukaryotic cells. Prokaryotic hosts are, generally,
very efficient and convenient for the production of recombinant
proteins and are, therefore, one type of preferred expression
system for the aur1 and/or aur2 gene. Prokaryotes most frequently
are represented by various strains of E. coli. However, other
microbial strains may also be used, including other bacterial
strains.
[0108] In prokaryotic systems, plasmid vectors that contain
replication sites and control sequences derived from a species
compatible with the host may be used. Examples of suitable plasmid
vectors may include pBR322, pUC118, pUC119 and the like; suitable
phage or bacteriophage vectors may include .gamma.gt10, .gamma.gt11
and the like; and suitable virus vectors may include pMAM-neo, pKRC
and the like. Preferably, the selected vector of the present
invention has the capacity to replicate in the selected host
cell.
[0109] Recognized prokaryotic hosts include bacteria such as E.
coil, Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia,
and the like. However, under such conditions, the peptide will not
be glycosylated. The prokaryotic host must be compatible with the
replicon and control sequences in the expression plasmid.
[0110] To express aur1 and/or aur2 (or a functional derivative
thereof) in a prokaryotic cell, it is necessary to operably link
the aur1 and/or aur2 sequence to a functional prokaryotic promoter.
Such promoters may be either constitutive or, more preferably,
regulatable (i.e., inducible or derepressible). Examples of
constitutive promoters include the int promoter of bacteriophage
.lambda., the bla promoter of the .beta.-lactamase gene sequence of
pBR322, and the CAT promoter of the chloramphenicol acetyl
transferase gene sequence of pPR325, and the like. Examples of
inducible prokaryotic promoters include the major right and left
promoters of bacteriophage .lambda.(P.sub.L and P.sub.R), the trp,
recA, .lambda.acZ, .lambda.acI, and gal promoters of E. coli, the
.alpha.-amylase (Ulmanen et al., J. Bacteriol. 162:176-182, 1985)
and the .cedilla.-28-specific promoters of B. subtilis (Gilman et
al., Gene Sequence 32:11-20, 1984), the promoters of the
bacteriophages of Bacillus (Gryczan, In: The Molecular Biology of
the Bacilli, Academic Press, Inc., NY, 1982), and Streptomyces
promoters (Ward et al., Mol. Gen. Genet. 203:468-478, 1986).
Prokaryotic promoters are reviewed by Glick (Ind. Microbiot.
1:277-282, 1987), Cenatiempo (Biochimie 68:505-516, 1986), and
Gottesman (Ann. Rev. Genet. 18:415-442, 1984).
[0111] Proper expression in a prokaryotic cell also requires the
presence of a ribosome binding site upstream of the gene
sequence-encoding sequence. Such ribosome binding sites are
disclosed, for example, by Gold et al. (Ann. Rev. Microbiol.
35:365-404, 1981). The selection of control sequences, expression
vectors, transformation methods, and the like, are dependent on the
type of host cell used to express the gene. As used herein, "cell",
"cell line", and "cell culture" may be used interchangeably and all
such designations include progeny. Thus, the words "transformants"
or "transformed cells" include the primary subject cell and
cultures derived therefrom, without regard to the number of
transfers. It is also understood that all progeny may not be
precisely identical in DNA content, due to deliberate or
inadvertent mutations. However, as defined, mutant progeny have the
same functionality as that of the originally transformed cell.
[0112] Host cells which may be used in the expression systems of
the present invention are not strictly limited, provided that they
are suitable for use in the expression of the AUR1 and/or AUR2
peptide of interest. Suitable hosts may often include eukaryotic
cells. Preferred eukaryotic hosts include, for example, yeast,
fungi, insect cells, mammalian cells either in vivo, or in tissue
culture. Mammalian cells which may be useful as hosts include HeLa
cells, cells of fibroblast origin such as VERO or CHO-K1, or cells
of lymphoid origin and their derivatives. Preferred mammalian host
cells include SP2/0 and J558L, as well as neuroblastoma cell lines
such as IMR 332, which may provide better capacities for correct
post-translational processing.
[0113] In addition, plant cells are also available as hosts, and
control sequences compatible with plant cells are available, such
as the cauliflower mosaic virus 35S and 19S, and nopaline synthase
promoter and polyadenylation signal sequences. Another preferred
host is an insect cell, for example the Drosophila larvae. Using
insect cells as hosts, the Drosophila alcohol dehydrogenase
promoter can be used (Rubin, Science 240:1453-1459, 1988).
Alternatively, baculovirus vectors can be engineered to express
large amounts of AUR1 and/or AUR2 in insects cells (Jasny, Science
238:1653, 1987; Miller et al., In: Genetic Engineering, Vol. 8,
Plenum, Setlow et al., eds., pp. 277-297, 1986).
[0114] Any of a series of yeast expression systems can be utilized
which incorporate promoter and termination elements from the
actively expressed sequences coding for glycolytic enzymes that are
produced in large quantities when yeast are grown in mediums rich
in glucose. Known glycolytic gene sequences can also provide very
efficient transcriptional control signals. Yeast provides
substantial advantages in that it can also carry out
post-translational modifications. A number of recombinant DNA
strategies exist utilizing strong promoter sequences and high copy
number plasmids which can be utilized for production of the desired
proteins in yeast. Yeast recognizes leader sequences on cloned
mammalian genes and secretes peptides bearing leader sequences
(i.e., pre-peptides). Several possible vector systems are available
for the expression of aur1 and/or aur2 in a mammalian host.
[0115] A wide variety of transcriptional and translational
regulatory sequences may be employed, depending upon the nature of
the host. The transcriptional and translational regulatory signals
may be derived from viral sources, such as adenovirus, bovine
papilloma virus, cytomegalovirus, simian virus, or the like, where
the regulatory signals are associated with a particular gene
sequence which has a high level of expression. Alternatively,
promoters from mammalian expression products, such as actin,
collagen, myosin, and the like, may be employed. Transcriptional
initiation regulatory signals may be selected which allow for
repression or activation, so that expression of the gene sequences
can be modulated. Of interest are regulatory signals which are
temperature-sensitive so that by varying the temperature,
expression can be repressed or initiated, or are subject to
chemical (such as metabolite) regulation.
[0116] Expression of aur1 and/or aur2 in eukaryotic hosts requires
the use of eukaryotic regulatory regions. Such regions will, in
general, include a promoter region sufficient to direct the
initiation of RNA synthesis. Preferred eukaryotic promoters
include, for example, the promoter of the mouse metallothionein I
gene sequence (Hamer et al., J. Mol. Appl. Gen. 1:273-288, 1982);
the TK promoter of Herpes virus (McKnight, Cell 31:355-365, 1982);
the SV40 early promoter (Benoist et al., Nature (London)
290:304-31, 1981); and the yeast ga14 gene sequence promoter
(Johnston et al., Proc. Natl. Acad. Sci. (USA) 79:6971-6975, 1982;
Silver et al., Proc. Natl. Acad. Sci. (USA) 81:5951-5955,
1984).
[0117] Translation of eukaryotic mRNA is initiated at the codon
which encodes the first methionine. For this reason, it is
preferable to ensure that the linkage between a eukaryotic promoter
and a DNA sequence which encodes AUR1 and/or AUR2 (or a functional
derivative thereof) does not contain any intervening codons which
are capable of encoding a methionine (i.e., AUG). The presence of
such codons results either in the formation of a fusion protein (if
the AUG codon is in the same reading frame as the aur1 and/or aur2
coding sequence) or a frame-shift mutation (if the AUG codon is not
in the same reading frame as the aur1 and/or aur2 coding
sequence).
[0118] An aur1 and/or aur2 nucleic acid molecule and an operably
linked promoter may be introduced into a recipient prokaryotic or
eukaryotic cell either as a nonreplicating DNA or RNA molecule,
which may either be a linear molecule or, more preferably, a closed
covalent circular molecule. Since such molecules are incapable of
autonomous replication, the expression of the gene may occur
through the transient expression of the introduced sequence.
Alternatively, permanent expression may occur through the
integration of the introduced DNA sequence into the host
chromosome.
[0119] A vector may be employed which is capable of integrating the
desired gene sequences into the host cell chromosome. Cells which
have stably integrated the introduced DNA into their chromosomes
can be selected by also introducing one or more markers which allow
for selection of host cells which contain the expression vector.
The marker may provide for prototrophy to an auxotrophic host,
biocide resistance, e.g., antibiotics, or heavy metals, such as
copper, or the like. The selectable marker gene sequence can either
be directly linked to the DNA gene sequences to be expressed, or
introduced into the same cell by co-transfection. Additional
elements may also be needed for optimal synthesis mRNA. These
elements may include splice signals, as well as transcription
promoters, enhancers, and termination signals. cDNA expression
vectors incorporating such elements include those described by
Okayama (Mol. Cell. Biol. 3:280-?, 1983).
[0120] The introduced nucleic acid molecule can be incorporated
into a plasmid or viral vector capable of autonomous replication in
the recipient host. Any of a wide variety of vectors may be
employed for this purpose. Factors of importance in selecting a
particular plasmid or viral vector include: the ease with which
recipient cells that contain the vector may be recognized and
selected from those recipient cells which do not contain the
vector; the number of copies of the vector which are desired in a
particular host; and whether it is desirable to be able to
"shuttle" the vector between host cells of different species.
[0121] Preferred prokaryotic vectors include plasmids such as those
capable of replication in E. coil (such as, for example, pBR322,
ColE1, pSC101, pACYC 184, .pi.VX; "Molecular Cloning: A Laboratory
Manual", 1989, supra). Bacillus plasmids include pC194, pC221,
pT127, and the like (Gryczan, In: The Molecular Biology of the
Bacilli, Academic Press, NY, pp. 307-329, 1982). Suitable
Streptomyces plasmids include p1J101 (Kendall et al., J. Bacteriol.
169:4177-4183, 1987), and streptomyces bacteriophages such as
.phi.C31 (Chater et al., In: Sixth International Symposium on
Actinomycetales Biology, Akademiai Kaido, Budapest, Hungary, pp.
45-54, 1986). Pseudomonas plasmids are reviewed by John et al.
(Rev. Infect. Dis. 8:693-704, 1986), and Izaki (Jpn. J. Bacteriol.
33:729-742, 1978).
[0122] Preferred eukaryotic plasmids include, for example, BPV,
vaccinia, SV40, 2-micron circle, and the like, or their
derivatives. Such plasmids are well known in the art (Botstein et
al., Miami Wntr. Symp. 19:265-274, 1982; Broach, In: "The Molecular
Biology of the Yeast Saccharomyces: Life Cycle and Inheritance",
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., p.
445-470, 1981; Broach, Cell 28:203-204, 1982; Bollon et al., J.
Ctin. Hematol. Oncol. 10:39-48, 1980; Maniatis, In: Cell Biology: A
Comprehensive Treatise, Vol. 3, Gene Sequence Expression, Academic
Press, NY, pp. 563-608, 1980).
[0123] Once the vector or nucleic acid molecule containing the
construct(s) has been prepared for expression, the DNA construct(s)
may be introduced into an appropriate host cell by any of a variety
of suitable means, i.e., transformation, transfection, conjugation,
protoplast fusion, electroporation, particle gun technology,
calcium phosphate-precipitation, direct microinjection, and the
like. After the introduction of the vector, recipient cells are
grown in a selective medium, which selects for the growth of
vector-containing cells. Expression of the cloned gene(s) results
in the production of AUR1 and/or AUR2 or fragments thereof. This
can take place in the transformed cells as such, or following the
induction of these cells to differentiate (for example, by
administration of bromodeoxyuracil to neuroblastoma cells or the
like). A variety of incubation conditions can be used to form the
peptide of the present invention. The most preferred conditions are
those which mimic physiological conditions.
[0124] V. Purified AUR1 and/or AUR2 Polypeptides
[0125] AUR1 and AUR2 are related serine/threonine kinases with
short N-terminal extensions. The Drosophila and yeast homologs
appear to be involved in mitotic regulation. The human proteins
appear to be involved in cancer and/or other signal transduction
disorders.
[0126] Primary sequence analysis of the human aur1 and aur2 genes
reveals that they contain a highly conserved C-terminal protein
kinase domain with all the characteristic motifs of a
serine/threonine kinase. In addition, the 73 to 129 amino acid
N-terminal domains of human aur1 and aur2 contain two distantly
conserved motifs present in the non-catalytic region of all aurora
genes which may play a regulatory role or function as a substrate
binding motif.
[0127] The first motif includes a 10 amino stretch, KENX.sub.4PVK,
termed Aurora Box1. The second motif is centered around a 15 amino
acid stretch, QX.sub.9QRVL, termed Aurora Box 2. Several potential
serine and threonine phosphorylation sites are also conserved among
these proteins including a protein kinase A phosphorylation motif,
RRXT, in the activation loop of the kinase, which suggests a
regulatory pathway similar to the cell cycle regulated
CDC2/CDK-related proteins.
[0128] A temperature sensitive mutant of the yeast IPL1 gene
consists of a Thr to Ala substitution within the activation loop2,
suggesting that phosphorylation at this site may be biologically
relevant. Additional mutants in the yeast (Chan et al., Genetics
135:677-691, 1993) and Drosophila (Glover et al. Cell 81:95-105,
1995) homologues of aurora have been mapped exclusively to the
kinase domain, except for a single Drosophila mutant that involves
a mutation at Asp47 within the N-terminal Aurora Box2. These
mutations result in abnormal nuclei, chromosome missegregation, and
monopolar spindles.
[0129] Aur2 expression is primarily restricted to fetal liver,
adult testis, and thymus, suggestive of a normal role for these
proteins in meiotic division. Human Aur1 is also expressed at
highest levels in normal testis and thymus, with a moderate level
of expression in lung and small intestine. Very weak expression of
Aur2 is also detected in bone marrow, lymph node, and spleen, and
no expression is detected in all other adult tissues examined.
[0130] Additional studies demonstrate tight temporal regulation of
these transcripts during mitosis (and Kimura et al., J. Biol. Chem.
272:13766-13771, 1997). Both AUR1 and AUR2 appear to regulate
nuclear division, with disruption of their signaling resulting in
polyploid cells. This phenotype is likely due to chromosomal
missegregation, as seen with the yeast homologue IPL1.
[0131] AUR2 appears to play a role in cellular transformation.
Ectopic expression of activated AUR2, which can phosphorylate
myelin basic protin in vitro, confers a growth advantage to NIH3T3
cells in low serum as compared to wild-type AUR2, kinase inactive
ALTR2, and vector. In addition, only NIH3T3 cells expressing
activated AUR2 grow large colonies in soft agar thus resulting in
anchorage-dependent growth.
[0132] However, in a rat1 fibroblast system, both the wild-type and
activated AUR2 (T288D) proteins were able to phosphorylate the
artificial substrate, .alpha.-casein, over the levels observed in
the vector control cell line. In addition, cells expressing the
wild-type as well as the activated mutant AUR2 formed colonies in
soft agar, in contrast to the lack of growth by cells expressing
the kinase inactive AUR2.
[0133] A variety of methodologies known in the art can be utilized
to obtain the peptide of the present invention. The peptide may be
purified from tissues or cells which naturally produce the peptide.
Alternatively, the above-described isolated nucleic acid fragments
could be used to express the AUR1 and/or AUR2 protein in any
organism. The samples of the present invention include cells,
protein extracts or membrane extracts of cells, or biological
fluids. The samples will vary based on the assay format, the
detection method, and the nature of the tissues, cells or extracts
used as the sample.
[0134] Any eukaryotic organism can be used as a source for the
peptide of the invention, as long as the source organism naturally
contains such a peptide. As used herein, "source organism" refers
to the original organism from which the amino acid sequence of the
subunit is derived, regardless of the organism the subunit is
expressed in and ultimately isolated from.
[0135] One skilled in the art can readily follow known methods for
isolating proteins in order to obtain the peptide free of natural
contaminants. These include, but are not limited to: size-exclusion
chromatography, HPLC, ion-exchange chromatography, and
immuno-affinity chromatography.
[0136] VI. An Antibody having Binding Affinity to an AUR1 and/or
AUR2 Polypeptide and a Hybridoma Containing the Antibody.
[0137] The present invention relates to an antibody having binding
affinity to an AUR1 and/or AUR2 polypeptide. The polypeptide may
have the amino acid sequence set forth in SEQ ID NO:3 or SEQ ID
NO:4, or a functional derivative thereof, or at least 9 contiguous
amino acids thereof (preferably, at least 20, 30, 35, or 40
contiguous amino acids thereof).
[0138] The present invention also relates to an antibody having
specific binding affinity to an AUR1 and/or AUR2 polypeptide. Such
an antibody may be isolated by comparing its binding affinity to an
AUR1 and/or AUR2 polypeptide with its binding affinity to other
polypeptides. Those which bind selectively to AUR1 and/or AUR2
would be chosen for use in methods requiring a distinction between
AUR1 and/or AUR2 and other polypeptides. Such methods could
include, but should not be limited to, the analysis of altered AUR1
and/or AUR2 expression in tissue containing other polypeptides.
[0139] The AUR1 and/or AUR2 proteins of the present invention can
be used in a variety of procedures and methods, such as for the
generation of antibodies, for use in identifying pharmaceutical
compositions, and for studying DNA/protein interaction.
[0140] The AUR1 and/or AUR2 peptide of the present invention can be
used to produce antibodies or hybridomas. One skilled in the art
will recognize that if an antibody is desired, such a peptide would
be generated as described herein and used as an immunogen. The
antibodies of the present invention include monoclonal and
polyclonal antibodies, as well fragments of these antibodies, and
humanized forms. Humanized forms of the antibodies of the present
invention may be generated using one of the procedures known in the
art such as chimerization or CDR grafting. The present invention
also relates to a hybridoma which produces the above-described
monoclonal antibody, or binding fragment thereof. A hybridoma is an
immortalized cell line which is capable of secreting a specific
monoclonal antibody.
[0141] In general, techniques for preparing monoclonal antibodies
and hybridomas are well known in the art (Campbell, "Monoclonal
Antibody Technology: Laboratory Techniques in Biochemistry and
Molecular Biology," Elsevier Science Publishers, Amsterdam, The
Netherlands, 1984; St. Groth et al., J. Immunol. Methods 35:1-21,
1980). Any animal (mouse, rabbit, and the like) which is known to
produce antibodies can be immunized with the selected polypeptide.
Methods for immunization are well known in the art. Such methods
include subcutaneous or intraperitoneal injection of the
polypeptide. One skilled in the art will recognize that the amount
of polypeptide used for immunization will vary based on the animal
which is immunized, the antigenicity of the polypeptide and the
site of injection.
[0142] The polypeptide may be modified or administered in an
adjuvant in order to increase the peptide antigenicity. Methods of
increasing the antigenicity of a polypeptide are well known in the
art. Such procedures include coupling the antigen with a
heterologous protein (such as globulin or .beta.-galactosidase) or
through the inclusion of an adjuvant during immunization.
[0143] For monoclonal antibodies, spleen cells from the immunized
animals are removed, fused with myeloma cells, such as SP2/0-Ag14
myeloma cells, and allowed to become monoclonal antibody producing
hybridoma cells. Any one of a number of methods well known in the
art can be used to identify the hybridoma cell which produces an
antibody with the desired characteristics. These include screening
the hybridomas with an ELISA assay, western blot analysis, or
radioimmunoassay (Lutz et al., Exp. Cell Res. 175:109-124, 1988).
Hybridomas secreting the desired antibodies are cloned and the
class and subclass are determined using procedures known in the art
(Campbell, "Monoclonal Antibody Technology: Laboratory Techniques
in Biochemistry and Molecular Biology", supra, 1984).
[0144] For polyclonal antibodies, antibody containing antisera is
isolated from the immunized animal and is screened for the presence
of antibodies with the desired specificity using one of the
above-described procedures. The above-described antibodies may be
detectably labeled. Antibodies can be detectably labeled through
the use of radioisotopes, affinity labels (such as biotin, avidin,
and the like), enzymatic labels (such as horse radish peroxidase,
alkaline phosphatase, and the like) fluorescent labels (such as
FITC or rhodamine, and the like), paramagnetic atoms, and the like.
Procedures for accomplishing such labeling are wellknown in the
art, for example, see (Steinberger et al., J. Histochem. Cytochem.
18:315, 1970; Bayer et al., Meth. Enzym. 62:308-, 1979; Engval et
al., Immunol. 109:129-, 1972; Goding, J. Immunol. Meth. 13:215-,
1976). The labeled antibodies of the present invention can be used
for in vitro, in vivo, and in situ assays to identify cells or
tissues which express a specific peptide.
[0145] The above-described antibodies may also be immobilized on a
solid support. Examples of such solid supports include plastics
such as polycarbonate, complex carbohydrates such as agarose and
sepharose, acrylic resins and such as polyacrylamide and latex
beads. Techniques for coupling antibodies to such solid supports
are well known in the art (Weir et al., "Handbook of Experimental
Immunology" 4th Ed., Blackwell Scientific Publications, Oxford,
England, Chapter 10, 1986; Jacoby et al., Meth. Enzym. 34, Academic
Press, N.Y., 1974). The immobilized antibodies of the present
invention can be used for in vitro, in vivo, and in situ assays as
well as in immunochromotography.
[0146] Furthermore, one skilled in the art can readily adapt
currently available procedures, as well as the techniques, methods
and kits disclosed above with regard to antibodies, to generate
peptides capable of binding to a specific peptide sequence in order
to generate rationally designed antipeptide peptides (Hurby et al.,
"Application of Synthetic Peptides: Antisense Peptides", In
Synthetic Peptides, A User's Guide, W. H. Freeman, NY, pp. 289-307,
1992; Kaspczak et al., Biochemistry 28:9230-9238, 1989).
[0147] Anti-peptide peptides can be generated by replacing the
basic amino acid residues found in the AUR1 and/or AUR2 peptide
sequence with acidic residues, while maintaining hydrophobic and
uncharged polar groups. For example, lysine, arginine, and/or
histidine residues are replaced with aspartic acid or glutamic acid
and glutamic acid residues are replaced by lysine, arginine or
histidine.
[0148] VII. An Antibody Based Method and Kit for Detecting AUR1
and/or AUR2.
[0149] Antibodies to AUR2 protein detect a protein of approximately
46 kDa (the size of the AUR2 protein) in 2 primary human colon
cancers, but not in adjacent samples of normal tissue. Endogenous
AUR2 is also detected in cultured tumor cell lines.
[0150] The present invention encompasses a method of detecting an
AUR1 and/or AUR2 polypeptide in a sample, comprising: (a)
contacting the sample with an above-described antibody, under
conditions such that immunocomplexes form, and (b) detecting the
presence of said antibody bound to the polypeptide. In detail, the
methods comprise incubating a test sample with one or more of the
antibodies of the present invention and assaying whether the
antibody binds to the test sample. Altered levels of AUR1 and/or
AUR2 in a sample as compared to normal levels may indicate
disease.
[0151] Conditions for incubating an antibody with a test sample
vary. Incubation conditions depend on the format employed in the
assay, the detection methods employed, and the type and nature of
the antibody used in the assay. One skilled in the art will
recognize that any one of the commonly available immunological
assay formats (such as radioimmunoassays, enzyme-linked
immunosorbent assays, diffusion based Ouchterlony, or rocket
immunofluorescent assays) can readily be adapted to employ the
antibodies of the present invention. Examples of such assays can be
found in Chard ("An Introduction to Radioimmunoassay and Related
Techniques" Elsevier Science Publishers, Amsterdam, The
Netherlands, 1986), Bullock et al. ("Techniques in
Immunocytochemistry," Academic Press, Orlando, Fla. Vol. 1, 1982;
Vol. 2, 1983; Vol. 3, 1985), Tijssen ("Practice and Theory of
Enzyme Immunoassays: Laboratory Techniques in Biochemistry and
Molecular Biology," Elsevier Science Publishers, Amsterdam, The
Netherlands, 1985).
[0152] The immunological assay test samples of the present
invention include cells, protein or membrane extracts of cells, or
biological fluids such as blood, serum, plasma, or urine. The test
samples used in the above-described method will vary based on the
assay format, nature of the detection method and the tissues, cells
or extracts used as the sample to be assayed. Methods for preparing
protein extracts or membrane extracts of cells are well known in
the art and can be readily be adapted in order to obtain a sample
which is testable with the system utilized.
[0153] A kit contains all the necessary reagents to carry out the
previously described methods of detection. The kit may comprise:
(i) a first container means containing an above-described antibody,
and (ii) second container means containing a conjugate comprising a
binding partner of the antibody and a label. In another preferred
embodiment, the kit further comprises one or more other containers
comprising one or more of the following: wash reagents and reagents
capable of detecting the presence of bound antibodies.
[0154] Examples of detection reagents include, but are not limited
to, labeled secondary antibodies, or in the alternative, if the
primary antibody is labeled, the chromophoric, enzymatic, or
antibody binding reagents which are capable of reacting with the
labeled antibody. The compartmentalized kit may be as described
above for nucleic acid probe kits. One skilled in the art will
readily recognize that the antibodies described in the present
invention can readily be incorporated into one of the established
kit formats which are well known in the art.
[0155] VIII. Isolation of Compounds which Interact with AUR1 and/or
AUR2.
[0156] The present invention also relates to a method of detecting
a compound capable of binding to an AUR1 and/or AUR2 polypeptide
comprising incubating the compound with AUR1 and/or AUR2 and
detecting the presence of the compound bound to AUR1 and/or AUR2.
The compound may be present within a complex mixture, for example,
serum, body fluid, or cell extracts.
[0157] The present invention also relates to a method of detecting
an agonist or antagonist of AUR1 and/or AUR2 activity or AUR1
and/or AUR2 binding partner activity comprising incubating cells
that produce AUR1 and/or AUR2 in the presence of a compound and
detecting changes in the level of AUR1 and/or AUR2 activity or AUR1
and/or AUR2 binding partner activity. The compounds thus identified
would produce a change in activity indicative of the presence of
the compound. The compound may be present within a complex mixture,
for example, serum, body fluid, or cell extracts. Once the compound
is identified it can be isolated using techniques well known in the
art.
[0158] The present invention also encompasses a method of agonizing
(stimulating) or antagonizing AUR1 and/or AUR2 associated activity
in a mammal comprising administering to said mammal an agonist or
antagonist to AUR1 and/or AUR2 in an amount sufficient to effect
said agonism or antagonism. A method of treating diseases in a
mammal with an agonist or antagonist of AUR1 and/or AUR2 related
activity comprising administering the agonist or antagonist to a
mammal in an amount sufficient to agonize or antagonize AUR1 and/or
AUR2 associated functions is also encompassed in the present
application.
[0159] IX. Transgenic Animals.
[0160] A variety of methods are available for the production of
transgenic animals associated with this invention. DNA can be
injected into the pronucleus of a fertilized egg before fusion of
the male and female pronuclei, or injected into the nucleus of an
embryonic cell (e.g., the nucleus of a two-cell embryo) following
the initiation of cell division (Brinster et al., Proc. Nat. Acad.
Sci. USA 82: 4438-4442, 1985). Embryos can be infected with
viruses, especially retroviruses, modified to carry inorganic-ion
receptor nucleotide sequences of the invention.
[0161] Pluripotent stem cells derived from the inner cell mass of
the embryo and stabilized in culture can be manipulated in culture
to incorporate nucleotide sequences of the invention. A transgenic
animal can be produced from such cells through implantation into a
blastocyst that is implanted into a foster mother and allowed to
come to term. Animals suitable for transgenic experiments can be
obtained from standard commercial sources such as Charles River
(Wilmington, Mass.), Taconic (Germantown, N.Y.), Harlan Sprague
Dawley (Indianapolis, Ind.), etc.
[0162] The procedures for manipulation of the rodent embryo and for
microinjection of DNA into the pronucleus of the zygote are well
known to those of ordinary skill in the art (Hogan et al., supra).
Microinjection procedures for fish, amphibian eggs and birds are
detailed in Houdebine and Chourrout (Experientia 47: 897-905,
1991). Other procedures for introduction of DNA into tissues of
animals are described in U.S. Pat. No., 4,945,050 (Sandford et al.,
Jul. 30, 1990).
[0163] By way of example only, to prepare a transgenic mouse,
female mice are induced to superovulate. Females are placed with
males, and the mated females are sacrificed by CO.sub.2
asphyxiation or cervical dislocation and embryos are recovered from
excised oviducts. Surrounding cumulus cells are removed. Pronuclear
embryos are then washed and stored until the time of injection.
Randomly cycling adult female mice are paired with vasectomized
males. Recipient females are mated at the same time as donor
females. Embryos then are transferred surgically. The procedure for
generating transgenic rats is similar to that of mice (Hammer et
al., Cell 63:1099-1112, 1990).
[0164] Methods for the culturing of embryonic stem (ES) cells and
the subsequent production of transgenic animals by the introduction
of DNA into ES cells using methods such as electroporation, calcium
phosphate/DNA precipitation and direct injection also are well
known to those of ordinary skill in the art (Teratocarcinomas and
Embryonic Stem Cells, A Practical Approach, E. J. Robertson, ed.,
IRL Press, 1987).
[0165] In cases involving random gene integration, a clone
containing the sequence(s) of the invention is co-transfected with
a gene encoding resistance. Alternatively, the gene encoding
neomycin resistance is physically linked to the sequence(s) of the
invention. Transfection and isolation of desired clones are carried
out by any one of several methods well known to those of ordinary
skill in the art (E. J. Robertson, supra).
[0166] DNA molecules introduced into ES cells can also be
integrated into the chromosome through the process of homologous
recombination (Capecchi, Science 244: 1288-1292, 1989). Methods for
positive selection of the recombination event (i.e., neo
resistance) and dual positive-negative selection (i.e., neo
resistance and gancyclovir resistance) and the subsequent
identification of the desired clones by PCR have been described by
Capecchi, supra and Joyner et al. (Nature 338: 153-156, 1989), the
teachings of which are incorporated herein in their entirety
including any drawings. The final phase of the procedure is to
inject targeted ES cells into blastocysts and to transfer the
blastocysts into pseudopregnant females. The resulting chimeric
animals are bred and the offspring are analyzed by Southern
blotting to identify individuals that carry the transgene.
Procedures for the production of non-rodent mammals and other
animals have been discussed by others (Houdebine and Chourrout,
supra; Pursel et al., Science 244:1281-1288, 1989; and Simms et
al., Bio/Technology 6:179-183, 1988).
[0167] Thus, the invention provides transgenic, nonhuman mammals
containing a transgene encoding an AUR1 and/or AUR2 polypeptide or
a gene effecting the expression of an AUR1 and/or AUR2 polypeptide.
Such transgenic nonhuman mammals are particularly useful as an in
vivo test system for studying the effects of introducing an AUR1
and/or AUR2 polypeptide, or regulating the expression of an AUR1
and/or AUR2 polypeptide (i.e., through the introduction of
additional genes, antisense nucleic acids, or ribozymes).
[0168] A "transgenic animal" is an animal having cells that contain
DNA which has been artificially inserted into a cell, which DNA
becomes part of the genome of the animal which develops from that
cell. Preferred transgenic animals are primates, mice, rats, cows,
pigs, horses, goats, sheep, dogs and cats. The transgenic DNA may
encode for a human AUR1 and/or AUR2 polypeptide. Native expression
in an animal may be reduced by providing an amount of anti-sense
RNA or DNA effective to reduce expression of the receptor.
[0169] X. Gene Therapy.
[0170] AUR2 protein expression in the human tumor cell line H1299
is significantly down regulated in the presence of any one of three
antisense phosphothionate oligonucleotides (SEQ ID NO:30, SEQ ID
NO:31 and SEQ ID NO:32) which target specific regions of human aur2
mRNA transcripts. When used in combination, oligonucleotides SEQ ID
NO:30 and SEQ ID NO:32, and SEQ ID NO:31 and SEQ ID NO:32 reduce
the expression of AUR2 protein below the limit of detection.
Treatment of H1299 cells with the combination of SEQ ID NO:31 and
SEQ ID NO:32 inhibited the growth of this tumor cell line, and
induced apoptosis as measured by FACs.
[0171] AUR1 and/or AUR2 or its genetic sequences will also be
useful in gene therapy (reviewed in Miller, Nature 357:455-460,
1992). Miller states that advances have resulted in practical
approaches to human gene therapy that have demonstrated positive
initial results. The basic science of gene therapy is described in
Mulligan (Science 260:926-931, 1993).
[0172] In one preferred embodiment, an expression vector containing
the AUR1 and/or AUR2 coding sequence is inserted into cells, the
cells are grown in vitro and then infused in large numbers into
patients. In another preferred embodiment, a DNA segment containing
a promoter of choice (for example a strong promoter) is transferred
into cells containing an endogenous aur1 and/or aur2 in such a
manner that the promoter segment enhances expression of the
endogenous aur1 and/or aur2 gene (for example, the promoter segment
is transferred to the cell such that it becomes directly linked to
the endogenous aur1 and/or aur2 gene).
[0173] The gene therapy may involve the use of an adenovirus
containing aur1 and/or aur2 cDNA targeted to a tumor, systemic AUR1
and/or AUR2 increase by implantation of engineered cells, injection
with aur1 and/or aur2 virus, or injection of naked aur1 and/or aur2
DNA into appropriate tissues.
[0174] Target cell populations may be modified by introducing
altered forms of one or more components of the protein complexes in
order to modulate the activity of such complexes. For example, by
reducing or inhibiting a complex component activity within target
cells, an abnormal signal transduction event(s) leading to a
condition may be decreased, inhibited, or reversed. Deletion or
missense mutants of a component, that retain the ability to
interact with other components of the protein complexes but cannot
function in signal transduction may be used to inhibit an abnormal,
deleterious signal transduction event.
[0175] Expression vectors derived from viruses such as
retroviruses, vaccinia virus, adenovirus, adeno-associated virus,
herpes viruses, several RNA viruses, or bovine papilloma virus, may
be used for delivery of nucleotide sequences (e.g., cDNA) encoding
recombinant AUR1 and/or AUR2 protein into the targeted cell
population (e.g., tumor cells). Methods which are well known to
those skilled in the art can be used to construct recombinant viral
vectors containing coding sequences (Maniatis et al., Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y.,
1989; Ausubel et al., Current Protocols in Molecular Biology,
Greene Publishing Associates and Wiley Interscience, N.Y., 1989).
Alternatively, recombinant nucleic acid molecules encoding protein
sequences can be used as naked DNA or in a reconstituted system
e.g., liposomes or other lipid systems for delivery to target cells
(e.g., Felgner et al., Nature 337:387-8, 1989). Several other
methods for the direct transfer of plasmid DNA into cells exist for
use in human gene therapy and involve targeting the DNA to
receptors on cells by complexing the plasmid DNA to proteins
(Miller, supra).
[0176] In its simplest form, gene transfer can be performed by
simply injecting minute amounts of DNA into the nucleus of a cell,
through a process of microinjection (Capecchi, Cell 22:479-88,
1980). Once recombinant genes are introduced into a cell, they can
be recognized by the cells normal mechanisms for transcription and
translation, and a gene product will be expressed. Other methods
have also been attempted for introducing DNA into larger numbers of
cells. These methods include: transfection, wherein DNA is
precipitated with CaPO.sub.4 and taken into cells by pinocytosis
(Chen et al., Mol. Cell Biol. 7:2745-52, 1987); electroporation,
wherein cells are exposed to large voltage pulses to introduce
holes into the membrane (Chu et al., Nucleic Acids Res. 15:1311-26,
1987); lipofection/liposome fusion, wherein DNA is packaged into
lipophilic vesicles which fuse with a target cell (Felgner et al.,
Proc. Natl. Acad. Sci. USA. 84:7413-7417, 1987); and particle
bombardment using-DNA bound to small projectiles (Yang et al.,
Proc. Natl. Acad. Sci. 87:9568-9572, 1990). Another method for
introducing DNA into cells is to couple the DNA to chemically
modified proteins.
[0177] It has also been shown that adenovirus proteins are capable
of destabilizing endosomes and enhancing the uptake of DNA into
cells. The admixture of adenovirus to solutions containing DNA
complexes, or the binding of DNA to polylysine covalently attached
to adenovirus using protein crosslinking agents substantially
improves the uptake and expression of the recombinant gene (Curiel
et al., Am. J. Respir. Cell. Mol. Biol., 6:247-52, 1992).
[0178] As used herein "gene transfer" means the process of
introducing a foreign nucleic acid molecule into a cell. Gene
transfer is commonly performed to enable the expression of a
particular product encoded by the gene. The product may include a
protein, polypeptide, anti-sense DNA or RNA, or enzymatically
active RNA. Gene transfer can be performed in cultured cells or by
direct administration into animals. Generally gene transfer
involves the process of nucleic acid contact with a target cell by
non-specific or receptor mediated interactions, uptake of nucleic
acid into the cell through the membrane or by endocytosis, and
release of nucleic acid into the cytoplasm from the plasma membrane
or endosome. Expression may require, in addition, movement of the
nucleic acid into the nucleus of the cell and binding to
appropriate nuclear factors for transcription.
[0179] As used herein "gene therapy" is a form of gene transfer and
is included within the definition of gene transfer as used herein
and specifically refers to gene transfer to express a therapeutic
product from a cell in vivo or in vitro. Gene transfer can be
performed ex vivo on cells which are then transplanted into a
patient, or can be performed by direct administration of the
nucleic acid or nucleic acid-protein complex into the patient.
[0180] In another preferred embodiment, a vector having nucleic
acid sequences encoding an AUR1 and/or AUR2 polypeptide is provided
in which the nucleic acid sequence is expressed only in specific
tissue. Methods of achieving tissue-specific gene expression as set
forth in International Publication No. WO 93/09236, filed Nov. 3,
1992 and published May 13, 1993.
[0181] In all of the preceding vectors set forth above, a further
aspect of the invention is that the nucleic acid sequence contained
in the vector may include additions, deletions or modifications to
some or all of the sequence of the nucleic acid, as defined
above.
[0182] In another preferred embodiment, a method of gene
replacement is set forth. "Gene replacement" as used herein means
supplying a nucleic acid sequence which is capable of being
expressed in vivo in an animal and thereby providing or augmenting
the function of an endogenous gene which is missing or defective in
the animal.
[0183] XI. Compounds that Modulate the Function of AUR1 and/or Aur2
Proteins
[0184] In an effort to discover novel treatments for diseases,
biomedical researchers and chemists have designed, synthesized, and
tested molecules that inhibit the function of protein kinases. Some
small organic molecules form a class of compounds that modulate the
function of protein kinases. Examples of molecules that have been
reported to inhibit the function of protein kinases include, but
are not limited to, bis monocyclic, bicyclic or hetero cyclic aryl
compounds (PCT WO 92/20642, published Nov. 26, 1992 by Maguire et
al.), vinylene-azaindole derivatives (PCT WO 94/14808, published
Jul. 7, 1994 by Ballinari et al.),
1-cyclopropyl-4-pyridyl-quinolones (U.S. Pat. No. 5,330,992),
styryl compounds (U.S. Pat. No. 5,217,999), styryl-substituted
pyridyl compounds (U.S. Pat. No. 5,302,606), certain quinazoline
derivatives (EP Application No. 0 566 266 A1), seleoindoles and
selenides (PCT WO 94/03427, published Feb. 17, 1994 by Denny et
al.), tricyclic polyhydroxylic compounds (PCT WO 92/21660,
published Dec. 10, 1992 by Dow), and benzylphosphonic acid
compounds (PCT WO 91/15495, published Oct. 17, 1991 by Dow et al).
The compounds that can traverse cell membranes and are resistant to
acid hydrolysis are potentially advantageous therapeutics as they
can become highly bioavailable after being administered orally to
patients. However, many of these protein kinase inhibitors only
weakly inhibit the function of protein kinases. In addition, many
inhibit a variety of protein kinases and will therefore cause
multiple side-effects as therapeutics for diseases.
[0185] Some indolinone compounds, however, form classes of acid
resistant and membrane permeable organic molecules. WO 96/22976,
published Aug. 1, 1996 by Ballinari et al. describes hydrosoluble
indolinone compounds that harbor tetralin, naphthalene, quinoline,
and indole substituents fused to the oxindole ring. These bicyclic
substituents are in turn substituted with polar moieties including
hydroxylated alkyl, phosphate, and ether moieties. U.S. patent
application Ser. Nos. 08/02,232, filed Aug. 23, 1996, entitled
"Indolinone Combinatorial Libraries and Related Products and
Methods for the Treatment of Disease" by Tang et al. (Lyon &
Lyon Docket No. 221/187) and 08/485,323, filed Jun. 7, 1995,
entitled "Benzylidene-Z-Indoline Compounds for the Treatment of
Disease" by Tang et al. (Lyon & Lyon Docket No. 223/298) and
International Patent Publication WO 96/22976, published Aug. 1,
1996 by Ballinari et al., all of which are incorporated herein by
reference in their entirety, including any drawings, describe
indolinone chemical libraries of indolinone compounds harboring
other bicyclic moieties as well as monocyclic moieties fused to the
oxindole ring. Applications 08/02,232, filed Aug. 23, 1996,
entitled "Indolinone Combinatorial Libraries and Related Products
and Methods for the Treatment of Disease" by Tang et al. (Lyon
& Lyon Docket No. 221/187), 08/485,323, filed Jun. 7, 1995,
entitled "Benzylidene-Z-Indoline Compounds for the Treatment of
Disease" by Tang et al. (Lyon & Lyon Docket No. 223/298), and
WO 96/22976, published Aug. 1, 1996 by Ballinari et al. teach
methods of indolinone synthesis, methods of testing the biological
activity of indolinone compounds in cells, and inhibition patterns
of indolinone derivatives.
[0186] Other examples of substances capable of modulating AUR1
and/or AUR2 activity include, but are-not limited to, tyrphostins,
quinazolines, quinoxolines, and quinolines.
[0187] The quinazolines, tyrphostins, quinolines, and quinoxolines
referred to above include well known compounds such as those
described in the literature. For example, representative
publications describing quinazoline include Barker et al., EPO
Publication No. 0 520 722 A1; Jones et al., U.S. Pat. No.
4,447,608; Kabbe et al., U.S. Pat. No. 4,757,072; Kaul and
Vougioukas, U.S. Pat. No. 5, 316,553; Kreighbaum and Comer, U.S.
Pat. No. 4,343,940; Pegg and Wardleworth, EPO Publication No. 0 562
734 A1; Barker et al., Proc. of Am. Assoc. for Cancer Research
32:327 (1991); Bertino, J. R., Cancer Research 3:293-304 (1979);
Bertino, J. R., Cancer Research 9(2 part 1):293-304 (1979); Curtin
et al., Br. J. Cancer 53:361-368 (1986); Fernandes et al., Cancer
Research 43:1117-1123 (1983); Ferris et al. J. Org. Chem.
44(2):173-178; Fry et al., Science 265:1093-1095 (1994); Jackman et
al., Cancer Research 51:5579-5586 (1981); Jones et al. J. Med.
Chem. 29(6):1114-1118; Lee and Skibo, Biochemistry 26(23):7355-7362
(1987); Lemus et al., J. Org. Chem. 54:3511-3518 (1989); Ley and
Seng, Synthesis 1975:415-522 (1975); Maxwell et al., Magnetic
Resonance in Medicine 17:189-196 (1991); Mini et al., Cancer
Research 45:325-330 (1985); Phillips and Castle, J. Heterocyclic
Chem. 17(19):1489-1596 (1980); Reece et al., Cancer Research
47(11):2996-2999 (1977); Sculier et al., Cancer Immunol. and
Immunother. 23:A65 (1986); Sikora et al., Cancer Letters 23:289-295
(1984); Sikora et al., Analytical Biochem. 172:344-355 (1988); all
of which are incorporated herein by reference in their entirety,
including any drawings.
[0188] Quinoxaline is described in Kaul and Vougioukas, U.S. Pat.
No. 5,316,553, incorporated herein by reference in its entirety,
including any drawings.
[0189] Quinolines are described in Dolle et al., J. Med. Chem.
37:2627-2629 (1994); MaGuire, J. Med. Chem. 37:2129-2131 (1994);
Burke et al., J. Med. Chem. 36:425-432 (1993); and Burke et al.
BioOrganic Med. Chem. Letters 2:1771-1774 (1992), all of which are
incorporated by reference in their entirety, including any
drawings.
[0190] Tyrphostins are described in Allen et al., Clin. Exp.
Immunol. 91:141-156 (1993); Anafi et al., Blood 82:12:3524-3529
(1993); Baker et al., J. Cell Sci. 102:543-555 (1992); Bilder et
al., Amer. Physiol. Soc. pp. 6363-6143:C721-C730 (1991); Brunton et
al., Proceedings of Amer. Assoc. Cancer Rsch. 33:558 (1992);
Bryckaert et al., Experimental Cell Research 199:255-261 (1992);
Dong et al., J. Leukocyte Biology 53:53-60 (1993); Dong et al., J.
Immunol. 151(5):2717-2724 (1993); Gazit et al., J. Med. Chem.
32:2344-2352 (1989); Gazit et al., "J. Med. Chem. 36:3556-3564
(1993); Kaur et al., Anti-Cancer Drugs 5:213-222 (1994); Kaur et
al., King et al., Biochem. J. 275:413-418 (1991); Kuo et al.,
Cancer Letters 74:197-202 (1993); Levitzki, A., The FASEB J.
6:3275-3282 (1992); Lyall et al., J. Biol. Chem. 264:14503-14509
(1989); Peterson et al., The Prostate 22:335-345 (1993); Pillemer
et al., Int. J. Cancer 50:80-85 (1992); Posner et al., Molecular
Pharmacology 45:673-683 (1993); Rendu et al., Biol. Pharmacology
44(5):881-888 (1992); Sauro and Thomas, Life Sciences 53:371-376
(1993); Sauro and Thomas, J. Pharm. and Experimental Therapeutics
267(3):119-1125 (1993); Wolbring et al., J. Biol. Chem.
269(36):22470-22472 (1994); and Yoneda et al., Cancer Research
51:4430-4435 (1991); all of which are incorporated herein by
reference in their entirety, including any drawings.
[0191] Other compounds that could be used as modulators include
oxindolinones such as those described in U.S. patent application
Ser. No. 08/702,232 filed Aug. 23, 1996, incorporated herein by
reference in its entirety, including any drawings.
EXAMPLES
[0192] The examples below are non-limiting and are merely
representative of various aspects and features of the present
invention. The examples below demonstrate the isolation, and
characterization of the novel proteins AUR1 and AUR2.
Example 1
[0193] Cloning of Aur1 and Aur2 and Structural Motifs
[0194] Materials and Methods:
[0195] Molecular Cloning
[0196] Total RNAs were isolated using the Guanidine Salts/Phenol
extraction protocol of Chomczynski and Sacchi (Anal. Biochem.
162:156-159, 1987) from normal human prostate, duodenum, ovary,
liver, pituitary, brain, thymus, and salivary gland, from human
HEPM cells (palatal mesenchyme), from primary human Wilm's tumor
and ovarian carcinoma, and from human tumor cell lines originating
from colon/rectum (HT29, SW480, SW1463, SW1417, SW837, SW948,
SW620, SW403, SW1116, T84, HTC15, LS123, and Caco-2), kidney
(CaKi-1, CaKi-2), liver (SK-HEP-1), pancreas (HS766T, ASPC,
Capan-1), and breast (MCF7).
[0197] These RNAs were used as templates to generate
single-stranded cDNAs using the Superscript Preamplification System
for First Strand Synthesis kit purchased from GibcoBRL (Life
Technologies, U.S.A.; Gerard et al. 1989, FOCUS 11, 66) under
conditions recommended by manufacturer. A typical reaction used 10
.mu.g total RNA or 2 .mu.g poly(A).sup.+ RNA with 1.5 .mu.g
oligo(dT).sub.12-18 in a reaction volume of 60 .mu.L. The product
was treated with RNaseH and diluted to 100 .mu.L with H.sub.20. For
subsequent PCR amplification, 1-4 .mu.L of these sscDNAs were used
in each reaction.
[0198] Oligonucleotides were synthesized on an Applied Biosystems
394 DNA synthesizer using established phosphoramidite chemistry and
were used unpurified after precipitation with ethanol. The
degenerate oligonucleotide primers are:
1 A = 5'-GARTTYGGNGARGTNTTYYTNGC-3' (SEQ ID NO:16) (sense) and DVW
= 5'-AGNACNCCRAANGCCCACACRTC-3' (SEQ ID NO:17) (antisense).
[0199] These primers were derived from the peptide sequences
EFGEVFLA (SEQ ID NO:18) (sense strand from kinase subdomain I) and
DVW(A/S)FGVL (SEQ ID NO:29; antisense strand from kinase subdomain
IX), respectively. Degenerate nucleotide residue designations are:
N=A, C, G, or T; R=A or G; and Y=C or T. Using CCK4 as a template,
these primers produce a product of 567 bp.
[0200] A PCR reaction was performed using Primers A and DVW applied
to the single-stranded sources listed above. The primers were added
at a final concentration of 5 .mu.M each to a mixture containing 10
mM TrisHCl (pH8.3), 50 mM KCl, 1.5 mM MgCl.sub.2, 200 .mu.M each
deoxynucleoside triphosphate, 0.001% gelatin, and 1.5 U AmpliTaq
DNA Polymerase (Perkin-Elmer/Cetus), and 1-4 .mu.L cDNA. Following
3 min denaturation at 95.degree. C., the cycling conditions were
94.degree. C. for 30 s, 37.degree. C. for 1 min, a 2 min ramp to
72.degree. C., and 72.degree. C. for 1 min for the first 3 cycles,
followed by 94.degree. C. for 30 s, 50.degree. C. for 1 min, and
72.degree. C. for 1 min 45 s for 35 cycles. PCR fragments migrating
at between 500-600 bp were isolated from 2% agaorse gels using
GeneClean (Bio101), and T-A cloned into the pCRII vector
(Invitrogen Corp. U.S.A.) according to the manufacturer's
protocol.
[0201] Colonies were selected for mini plasmid DNA-preparations
using Qiagen columns and the plasmid DNAs were sequenced using a
cycle sequencing dye-terminator kit with AmpliTaq DNA Polymerase,
FS (ABI, Foster City, Calif.). Sequencing reaction products were
run on an ABI Prism 377 DNA Sequencer, and analyzed using the BLAST
alignment algorithm (Altschul et al., J. Mol. Biol. 215:403-410,
?). A novel clone (#43-43) was isolated by PCR with primers A and
DVW on single-stranded cDNA from human embryonic palatal mesenchyme
(HEPM or CRL1486) as a template. This clone was subsequently
designated as a fragment of human aur1.
[0202] A lambda ZapII (Stratagene Cloning Systems, La Jolla,
Calif.) cDNA library was constructed using mRNA from a pool of
pancreatic carcinoma cell lines as a template for first strand cDNA
synthesis. Phage were screened on nitrocellulose filters with the
random primed .sup.32P-labeled insert from p43-43 encoding human
aur1 at 2.times.10.sup.6 cpm/mL in hybridization buffer containing
6.times.SSC, 1.times.Denhardt's reagent, 0.1% SDS, with 0.1 mg/mL
denatured, fragmented salmon sperm DNA. After overnight
hybridization at 65.degree. C., filters were washed in
0.1.times.SSC, 0.1% SDS at 65.degree. C. Full length cDNA clones
were sequenced on both strands using manual sequencing with T7
polymerase and oligonucleotide primers (Tabor et al., Proc. Natl.
Acad. Sci. U.S.A. 84: 4767-4771, 1987).
[0203] Southern Blot Analysis
[0204] Genomic DNA was isolated from a variety of transformed human
lines (CaCO.sub.2, HTC15, LS147T, SKCO4, SW480, W403, SW620, SW948,
SW1417, SW1116, MCF7, BT474) using standard procedures (Maniatis et
al. supra). Cells were trypsinized, washed with PBS and resuspended
at .about.10.sup.8 cells/mL in Digestion buffer (100 mM NaCl, 10 mM
Tris pH8, 25 mM EDTA, pH8, 0.5% SDS, 0.1 mg/mL proteinase K). Cells
were lysed by incubation at 50.degree. C. for 12 hours, followed by
extraction with phenol/chloroform and precipitated with an equal
volume of 7.5 M ammonium acetate and 100% EtOH. DNAs
were-resuspended in TE buffer. Approximately 20 .mu.g genomic DNA
was digested with HindIII or XhoII at 37.degree. C. for at least 4
hours before fractionation on 1% agarose gels. The DNA fragments
were transferred to nitrocellulose membranes by the capillary
transfer method (Southern, J. Mol. Biol. 98:503-, 1975) and
hybridized with human aur1 and aur2-specific probes as described
for Northern Blot analysis below. DNAs were restricted with HindIII
since both aur1 and aur2 cDNAs contain a single site for this
restriction enzyme.
[0205] Results:
[0206] In order to identify homologues of CCK4, a receptor that
represents a distinct family of tyrosine kinases, degenerate
primers to conserved sequences within kinase subdomains I and IX of
ROS and the TRK-family of receptor tyrosine kinases were designed,
since multiple alignments suggested CCK4 was most closely related
these receptors. Subdomain I is at the N-terminus of the kinase
domain and contains the consensus motif GXGXXGXV (SEQ ID NO:26)
which is involved in anchoring ATP to the catalytic unit of all
classes of kinases. Subdomain IX contains a nearly invariant Asp
which acts to stabilize the catalytic loop by bonding to residues
in subdomain VIB. Based on comparison of all known protein kinases,
degenerate oligonucleotide primers to subdomains I and IX that
would pick up only CCK4 and its chicken homologue KLG by PCR were
designed.
[0207] Degenerate primers A and DVW were designed based on
conserved residues within the kinase domain of CCK4, to use for
identification of novel kinases using polymerase chain reaction
(PCR). When applied to HEPM cell sscDNA as a template, multiple
copies of CCK4 were isolated as well as a novel DNA fragment
(43-43) of 567 bp with homology to other kinases. The novel
sequence was most similar to Drosophila aurora kinase (GeneBank
Accession #X83465) and the clone was designated human aur1.
[0208] The aur1 probe was used to screen a cDNA library constructed
from human pancreatic cancer cell line mRNA to isolate overlapping
clones spanning the complete open reading frame of aur1. Of
multiple clones isolated, seven corresponded to human aur1. Two
additional faintly hybridizing clones were also isolated during
this screen and sequence analysis revealed they corresponded to a
related, yet distinct kinase, which we designated human aur2.
[0209] Aur1 showed a single 4.3 kb band of equal intensity from all
sources suggesting it is a single copy, non-rearranged gene in the
multiple tumor types assayed. However, under low stringency
conditions, it was possible to detect 1.3 kb and 3.2 kb SacI
fragments which weakly hybridize to the aur1 probe. Aur2 showed
bands at 7.0 kb and 4.3 kb and a faint higher molecular weight band
at .about.10 kb from all sources. These data suggest aur2 is also a
single copy gene. The multiple bands seen on blots probed with aur2
are likely due to the fact that a full length cDNA probe was
used.
[0210] The complete sequences of human aur1 and aur2 were
determined from full length clones of each, isolated from the human
pancreatic carcinoma library, from normal human duodenum, and from
the partial human aur1 isolated from HEPM cells.
[0211] The 1,244 bp human aur1 nucleotide sequence is shown in SEQ
ID NO:1 and contains a single open reading frame encoding a
polypeptide of 344 amino acids. The AUR1 coding region is flanked
by a 54 nucleotide 5'-untranslated region and a 132 nucleotide
3'-untranslated region ending with a poly(A) tail.
[0212] The 2,198 bp human aur2 nucleotide sequence is shown in SEQ
ID NO:2 and contains a single open reading frame encoding a
polypeptide of 403 amino acids. The AUR2 coding region is flanked
by a 200 nucleotide 5'-untranslated region and a 768 nucleotide
3'-untranslated region.
[0213] The aur1 and aur2 cDNAs were sequenced from both a human
pancreatic tumor and normal human duodenum, with no sequence
differences observed except some probably polymorphic sites. These
ambiguities include:
2 cDNA nucleotide Comment aur1 1174 one clone has poly A inserted
873 T in all duodenal clones, C in pancreatic tumor 469 T in one
clone, C in all others 848 G in one clone, A in all others -
changes amino acid E to G 1097 G in one clone, T in 2 others 956 G
in one clone, A in 4 others 29 Splice to 103 in 5 clones, no splice
(as sown in 5 clones aur2 349 T in 1 cline, C in multiple others
(change amino acid P to L) 369 A in 3 clones, G in multiple others
(change AA V to I)
[0214] The C-terminal portions AUR1 and AUR2 conserve all 12
subdomains characteristic of eukaryotic protein kinases. The AUR1
and AUR2 kinase domains are preceded by a N-terminal domain of 74
and 130 amino acids, respectively. Comparison of the aur1 and aur2
nucleotide and deduced amino acid sequences (SEQ ID NO:3 or SEQ ID
NO:4) with the available DNA and protein sequence databases
indicated that they are unique with the exception of several EST
sequences sharing high sequence identity. They do however have
striking homology in both the N-terminal and catalytic domains with
the drosophila aurora and Saccharomyces cerevisiae IPL1 genes.
Furthermore, two unpublished database entries are likely to be
close homologues from Xenopus laevis (p46APK-GB accession #Z17206
and p46BPK-GB accession #Z17207).
[0215] The N-terminal domains of aurora from human, frog,
Drosophila, and yeast share limited sequence identity. Comparison
of the catalytic domains of these proteins reveals AUR1 shares 70%
amino acid identity with AUR2, 61% with the Drosophila aurora, and
45% with the yeast IPL1 gene. AUR2 kinase shares 60% amino acid
identity with the Drosophila protein and 45% identity to yeast
IPL1. Both AUR1 and AUR2 share less than 45% homology with all
other known mammalian kinases (the closest being cAMP-dependent
protein kinase A) suggesting they are homologues of these
drosophila and yeast kinases.
[0216] AUR1 and AUR2 both contain a cAMP-dependent protein kinase
phosphorylation site (THR232 of AUR1 and THR288 of AUR2) that is
conserved in the drosophila and yeast homologues and is a known
regulatory site in the cyclin-dependent kinase p34cdc2. AUR2
contains an additional PKA-site at SER342. Both proteins also have
multiple Casein kinase II (five and six for AUR1 and AUR2) and
protein kinase C (four and ten for AUR1 and AUR2) phosphorylation
sites. AUR2 also has a single tyrosine phosphorylation consensus
site at TYR334 that is also conserved with the Drosophila aurora,
but is not present in AUR1 or yeast IPL1.
[0217] Natural mutants of the drosophila aurora AUR_dm and yeast
IPL1 gene result in asymmetric nuclear division leading to
chromosome missegregation, and atypical, monopolar spindles. This
phenotype appears to result from a failure of centrosome
separation. The associated microtubule architecture appear
unaffected. Natural mutants in both drosophila and yeast target
amino acid residues that are strictly conserved between human AUR1
and AUR2, further supporting they may be functional homologues. The
corresponding residues in AUR1 that are found in natural mutants of
AUR_dm or IPL1 are GLU125, THR232, PRO312, HIS324. All of these
mutations are within the catalytic domain, and notably, one
represents the conserved PKA-phosphorylation site. An additional
mutation in AUR_dm at ASP47 is at a non-conserved residue in the
N-terminal domain.
[0218] These findings suggest the catalytic activity may indeed
play a central role in the biology of centrosome replication or
segregation in lower organisms, and suggest that human AUR1 and
AUR2 may play a complementary role in mammalian cells.
Example 2
[0219] AUR1 and AUR2 Expression in Human Tissues
[0220] Materials and Methods:
[0221] Northern Blot Analysis
[0222] Northern blots containing 2 .mu.g poly A+RNA per lane from
16 different adult human tissues (spleen, thymus, prostate, testis,
ovary, small intestine, colonic mucosa, heart, brain, placenta,
lung, liver, skeletal muscle, kidney, pancreas, and peripheral
blood leukocytes), four different human fetal tissues (brain, lung,
liver, and kidney), and 8 human cancer cell lines (HL60, HeLa,
K-562, MOLT-4, Raji, SW480, and G361) on a charge-modified nylon
membrane were obtained from Clontech (Palo Alto, Calif.).
Additional Northern blots were prepared by running 10 .mu.g total
RNA isolated from human tumor cell lines on a denaturing
formaldehyde 1.2% agarose gel and transferring to nylon
membranes.
[0223] Filters were hybridized with random primed
[.sup.32P]dCTP-labeled probes synthesized from either the 527 bp
insert from human aur1 clone 43-43 or the 1162 bp EcoRI fragment
from pSG20, and either the 1 kb EcoRI fragment of human aur2 clone
11-1A or the 1257 bp BamHI-Not I fragment from pS621. Hybridization
was performed at 60.degree. C. overnight in 6.times.SSC, 0.1% SDS,
1.times.Denhardt's solution, 100 mg/mL denatured herring sperm DNA
with 1-2.times.10.sup.6 cpm/mL of .sup.32P-labeled DNA probes. The
filters were washed in 0.1.times.SSC/0.1% SDS, 65.degree. C., and
exposed overnight on Kodak XAR-2 film.
[0224] Semi-Quantitative PCR Detection of aur1
[0225] RNA was isolated from a variety of human cell lines, fresh
frozen tissues, and primary tumors. Single stranded cDNA was
synthesized from 10 mg of each RNA as described above using the
Superscript Preamplification System (GibcoBRL). These single strand
templates were then used in a 35 cycle PCR reaction with two
aur1-specific oligonucleotides (3476:
5'-TTTGGCTCGGGAGAAGAAAAGCCAT-3' (SEQ ID NO:19), and 3506:
5'-CAATCATCTCTGGGGGCAGGTAGT-3') (SEQ ID NO:20). Reaction products
were electrophoresed on 2% agarose gels, stained with ethidium
bromide and photographed on a UV light box. The relative intensity
of the .about.475 bp aur1-specific bands were estimated for each
sample.
[0226] Results:
[0227] A single aur1 mRNA transcript of approximately 1.4 kb was
identified, and was found to be most abundant in the thymus and
small intestine with weak signals from testis, ovary, colon,
placenta, and spleen. Prostate and peripheral blood lymphocytes
were negative. Human fetal liver and kidney were also positive,
with a weaker signal in fetal lung and no expression in fetal brain
(Table)
[0228] A similar analysis of human aur2 expression showed a more
restricted expression profile. A single 2.4 kb aur2 transcript was
detected strongly in the adult testis and thymus, and weakly in
heart, placenta, skeletal muscles and in fetal liver and kidney
whereas the other normal tissue sources were negative (see
Table).
[0229] The aur1 mRNA expression profile in several primary tumors
and multiple cell lines of diverse neoplastic origin were
determined by Northern analysis and by the semi-quantitative PCR
assay using primers from sequences in the aur1 kinase domain. The
results are included in the Table. Aur1 transcripts were detected
in every tumor line assayed with the highest expression in several
human colon cancer cell lines (SW480, Colo320, SW620, SW1417,
Caco2, SW12417) and in lung carcinoma (Calu3), breast carcinoma
(T47D, MCF7), Melanoma (A375), Kidney carcinoma (CaKi-1, CaKi-2),
liver carcinoma (SK-HEP-1), and neural tumors (SF767, T98G). Lesser
expression of aur1 was seen in other colon carcinomas (HTC15, T84,
SW948, SW1116, HT29), neural tumors (Daoy), Ovarian carcinoma
(Ovcar3, Primary tumor), pancreatic carcinoma (HS766T), and a
primary kidney tumor.
[0230] The aur2 expression profile in tumor cell lines was
strikingly more restricted than that of aur1. Strong expression of
aur2 was detected only in colon carcinoma cell lines (Caco2, SW480,
SW1417, SW620) whereas weak signals were seen in other colon
(HTC15, Colo320), Breast (T47D, MCF7) and lung (Calu3) tumor cell
lines. Several other tumor lines had no detectable aur2
transcripts.
3 AUR1 and AUR2 NORTHERN ANALYSIS IN HUMAN NORMAL TISSUE AND CANCER
CELLSS Cell type Origin AUR 1 AUR 2 Thymus Normal tissue 5 4 Fetal
liver Normal tissue 4 2 Fetal kidney Normal tissue 4 1 Lung Normal
tissue 3 0 Duodenum Normal tissue 2 1 Colon Normal tissue 2 0 Fetal
lung Normal tissue 2 0 Ovary Normal tissue 2 0 Testis Normal tissue
2 2 Brain Normal tissue 0 0 Cerebellum Normal tissue 0 0 Salivary
gland Normal tissue 0 0 Heart Normal tissue 0 0 Liver Normal tissue
0 0 Pancreas Normal tissue 0 0 Kidney Normal tissue 0 0 Spleen
Normal tissue 0 0 Stomach Normal tissue 0 0 Uterus Normal tissue 0
0 Prostate Normal tissue 0 0 Skeletal muscle Normal tissue 0 0
Fetal brain Normal tissue 0 0 PBLs Normal tissue 0 0 Salivary gland
Normal tissue 0 0 Placenta Normal tissue 0 0 SF-268 CNS tumor 4 ND
CCRF-CEM Leukemia 4 ND K-562 Leukemia 4 ND HCC-2998 Colon tumor 4
ND SW620 Colon tumor 4 2 KM-12 Leukemia 4 ND MCF7/ADR-RES Breast
tumor 4 2 MDA-N Breast tumor 4 ND BT-549 Breast tumor 4 ND SW480
Colon tumor 4 4 SW48 Colon tumor 4 ND Calu-3 Lung tumor 4 ND Calu3
Lung tumor 4 2 T47D Breast tumor 4 2 A375 Melanoma 4 0 SF767 CNS
tumor 4 0 SW1417 Colon tumor 4 4 CaKi2 Kidney tumor 4 0 CaKi1
Kidney tumor 4 0 Caco2 Colon tumor 4 4 SW1417 Colon tumor 4 0 T98G
CNS tumor 4 0 SF-539 CNS tumor 3 ND SK-MEL-2 Melanoma 3 ND SK-MEL-5
Melanoma 3 ND R-48 Gastric tumor 3 ND RF-1 Gastric tumor 3 ND SW948
Colon tumor 3 ND AGS Gastric tumor 3 ND HFL1 Normal lung 3 ND
OVCAR-8 Ovarian tumor 2 ND HT-29 Colon tumor 2 ND MDA-MB-231 Breast
tumor 2 ND MDA-MB-435 Breast tumor 2 ND SK-MEL-5 Melanoma 2 ND
Kato-3 Gastric tumor 2 ND Colo 205 Colon tumor 2 ND Colo 320DM
Colon tumor 2 2 WiDr Colon tumor 2 ND HT-29 Colon tumor 2 ND
SNU-C2B Colon tumor 2 ND HTC15 Colon tumor 2 2 T84 Colon tumor 2 0
SW948 Colon tumor 2 0 Daoy CNS tumor 2 0 OVCAR3 Ovary tumor 2 0
HS766T Pancreas tumor 2 0 SW1116 Colon tumor 2 0 Wilms tumor Kidney
tumor 2 0 UO-31 Renal tumor 0 ND
Example 3
[0231] Recombinant Expression of Aur1 and Aur2
[0232] Materials and Methods:
[0233] Expression Vector Construction
[0234] Expression constructs were generated by PCR-assisted
mutagenesis in which the entire coding domains of aur1 and aur2
were tagged on their carboxy-terminal ends with the hemophilus
influenza hemaglutinin (HA) epitope YPYDVPDYAS (SEQ ID NO:21)(Pati,
Gene 114:285-288, 1992). These constructs were introduced into two
mammalian expression vectors: pLXSN (Miller et al., Biotechniques
7:980-988, 1989) for the generation of virus producing lines; and
pRK5 for transient expression analysis. Inserts were designed to be
flanked by unique BamHI and NotI sites and were cloned directly
into pLXSN or pRK5 at the 5'-BamHI and 3'-NotI sites.
[0235] The BamHI-NotI full length aur1 and aur2 constructs were
also ligated into pRS316 (Liu et al, Genetics 132:665-673, 1992).
This vector contains a galactose-inducible promoter in a
centromeric shuttle vector for expression in Saccharomyces
cerevisiae. These are to assess if the human genes can complement
the related temperature sensitive yeast IPL1 mutant, which is
closely related to aur1. In addition, fusion constructs containing
the N-terminal domain of yeast IPL1 fused to the C-terminal kinase
domains of aur1 and aur2 were generated. These were produced by
insertion of an artificial ClaI site at the 5' end of the kinase
domains of the kinases, at the conserved Asp-Asp-Phe-Glu
sequence.
[0236] Dominant negative aur1 and aur2 constructs were also made in
both pLXSN and pRK5 by mutation of the invariant Lys (amino acid
positions 106 and 162 in AUR1 and AUR2, respectively) to an Met by
PCR mutagenesis. The constructs are termed AUR1KM and AUR2KM.
Constitutively active forms of AUR1 and AUR2 were generated by
mutation of the DNA heading the encoding the phosphorylation site
(232 and 288) to an Asp resulting in AUR1TD and AUR2TD.
[0237] Expression constructs in both pLXSN and pRK5 were also made
containing just the N-terminal, non-catalytic domain of AUR1 and
AUR2. These were generated by PCR from the parental constructs and
contain the N-terminal 77 amino acids of AUR1 and 132 amino acids
of AUR2.
[0238] The entire aur1 and aur2 open reading frames (no HA-tag)
excluding the initiating methionines were generated by PCR and
ligated into pGEX vector for bacterial production of GST-fusion
proteins for immunization of rabbits for antibody production.
[0239] Generation of Virus Producing AUR Cell Lines
[0240] To generate high-titer virus stocks, pLXSN recombinant
constructs containing either aur1 or aur2 genes were transfected
into an amphotropic helper cell line PA317 using
CaCl.sub.2-mediated transfection. After selection on G418, the
cells were plated on normal media without G418 (500 .mu.mL).
Supernatants from resistant cells were used to infect the ecotropic
helper cell line GP+E86, and cells again selected on G418.
Resistant cells were again taken off G418, and the supernatants
harvested every 8-12 hours and pooled as virus stock (Redemann et
al., Mol. Cell. Biol. 12, 491-498, 1992). Viral stock titers were
typically .about.10.sup.6/mL.
[0241] Retroviral Infection of NIH-3T3 Cells with Aur1 and/or
Aur2
[0242] NIH-3T3, and BALB/3T3 cells were grown in 100 mm plates with
DMEM (Gibco) containing 10% fetal calf serum (FCS). The cells were
superinfected with the aur1 and aur2 retrovirus by adding
approximately 3 mL viral supernatant to 15 mL culture media for
approximately 24 hours. Cells expressing the retroviral constructs
were then selected by growth in DMEM/10% FCS supplemented with 500
.mu.g/mL G418.
[0243] Transient Expression of Aur1 and/or Aur2 in Mammalian
Cells
[0244] The pRK5 expression plasmids (10 .mu.g DNA/100 mm plate)
containing the HA-tagged aur1 and aur2 genes were introduced into
COS and 293 cells with lipofectamine (Gibco BRL). After 72 hours,
the cells were harvested in 0.5 mL solubilization buffer (20 mM
HEPES pH7.35, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM
MgCl.sub.2, 1 mM EGTA, 2 mM phenylnethylsulfonyl fluoride, 1
.mu.g/mL aprotinin).
[0245] Sample aliquots were resolved by SDS polyacrylamide gel
electrophoresis (PAGE) on 15% acrylamide/0.5% bis-acrylamide gels
and electrophoretically transferred to nitrocellulose. Non-specific
binding was blocked by preincubating blots in Blotto (phosphate
buffered saline containing 5% w/v non-fat dried milk and 0.2% v/v
nonidet P-40 (Sigma)), and recombinant protein was detected using a
murine Mab to the HA decapeptide tag. Alternatively, recombinant
protein can be detected using various AUR1- or AUR2-specific
antisera.
[0246] Results:
[0247] Recombinant AUR1 and AUR2 expressed in COS cells migrated
with apparent Mr of 39,000 and 46,000, consistent with their
predicted molecular weights of 39264 and 46730 based on their
primary amino acid sequence. This analysis confirms that the
recombinant protein can be stably produced in mammalian cells.
[0248] Dominant negative and constitutively active forms of AUR1
and AUR2 will be useful for delineating biologic consequences of
either oblation or overexpression of these putative
serine/threonine kinases. Initial studies with altered DNA
constructs demonstrates that in just 2 hours following infection of
NIH3T3 or BALB/3T3 cells with aur1 or aur2 retroviral stocks, cells
become multinucleated. This phenotype persisted such that 2 days
after infection some cells were found to have as many as 20 nuclei.
The multinucleated cells typically had increased cytoplasm and
diffuse cell boundaries. Immunostaining with both actin and DAPI,
confirmed these nuclei were all contained within a single cell, and
that the actin cytoskeleton was apparently normal.
Example 4
[0249] Generation of AUR-Specific Immunoreagents
[0250] Material and Methods:
[0251] AUR-specific immunoreagents were raised in rabbits against
KLH-conjugated synthetic peptides corresponding to either the
N-terminal region of AUR2 (.sup.104SAPENNPEEQLASK.sup.117) (SEQ ID
NO:22) and (.sup.90RPLNNTQKSKQPL.sup.102) (SEQ ID NO:23) or the
N-terminus or N-terminal domain of human AUR1
(.sup.1MAQKENSYPWPYG.sup.13) (SEQ ID NO:24) and
(.sup.53PGQKVMENSSGTP.sup.65) (SEQ ID NO:25). Additional
immunoreagents were generated by immunizing rabbits with the
bacterially expressed fill length AUR1 and AUR2 GST-fusion
proteins.
[0252] Results:
[0253] Specific immunoreagents were generated in rabbits against
peptide sequence from the N-terminal domains of AUR1 and AUR2 to
localize expression of endogenous and recombinant AUR within cells.
These reagents can also be used to identify substrates for the
AURs.
Example 5
[0254] Myelin Basic Protein is an Artificial Substrate for AUR1 and
AUR2 Kinase
[0255] Method:
[0256] Human colorectal adenocarcinoma SW480 cells were cultured in
RPMI 1640 plus 10% fetal bovine serum, L-glutamine, penicillin and
streptomycin. Confluent cultures of SW480 cells were washed three
times with ice cold phosphate buffered saline (PBS) and then were
scraped into 1 mL of ice cold PBS. The cells were centrifuged at
1,000 rpm at 4.degree. C., the PBS aspirated away, and the
resulting cell pellet stored at -80.degree. C. The pellets from
three 15 cm plates were thawed on ice and resuspended in a total of
1 mL of kinase lysis buffer 50 mM HEPES pH 7.4, 100 mM KCl, 25 mM
NaF, 1 mM NaVO.sub.3, 0.5% NP40, 1 mM DTT, 2 .mu.g/mL aprotinin,
and 1 .mu.g/mL leupeptin) and were rotated gently for 20 minutes at
4.degree. C. The samples were then centrifuged at 10,000.times.g
for 10 minutes at 4.degree. C. and the resulting supernatant was
transferred to a clean 1.5 mL centrifuge tube and stored or kept on
ice. The protein concentration was determined by Bradford analysis.
One milligram of total protein was pre-cleared with 10 .mu.L of
protein A-Sepharose (Boehringer) for 15 minutes at 4.degree. C.
followed by the addition of 2 .mu.L of either rabbit pre-immune
serum, affinity purified AUR1 peptide antisera, affinity purified
AUR1 peptide antisera plus 6 .mu.g of competing AUR1 peptide,
affinity purified AUR2 peptide antisera, or, affinity purified AUR2
peptide antisera plus 6 .mu.g of competing AUR2 peptide and
incubated for 30 minutes at 4.degree. C.
[0257] Subsequently, 10 .mu.L of protein A-sepharose was added and
the incubation was continued for an additional 45 minutes at
4.degree. C. The tubes were briefly centrifuged to pellet the
antibody-protein A-sepharose complex and the resulting supernatant
was aspirated off. The antibody-protein A-sepharose pellet was
washed twice with 0.5 mL of kinase lysis buffer followed by a wash
with 0.5 mL of kinase buffer (20 mM HEPES pH 7.4, 125 mM KCl, 10 mM
MgCl.sub.2, 1 mM NaF, 1 mM NaVO.sub.3, and 1 mM DTT). The
antibody-protein A-sepharose pellet was resuspended in 20 .mu.L of
kinase buffer containing 5 .mu.Ci of [.sym.-.sup.32P] ATP and 0.5
mg/mL myelin basic protein (Sigma), incubated for 20 minutes at
37.degree. C. after which 10 .mu.L of protein sample buffer 200 mM
Tris-Cl pH 6.8, 40% glycerol, 730 mM B-mercaptoethanol, 0.4% SDS,
and 0.05% Bromophenol Blue) was added. The tubes were mixed well
and incubated for 5 minutes at 100.degree. C. The samples were
resolved on an 18% SDS polyacrylamide gel and visualized by
autoradiography.
[0258] Results:
[0259] AUR1 and AUR2 immunocomplexes were able to phosphorylate
myelin basic protein. When competing peptide was used in the
immunoprecipitations neither AUR1 nor AUR2 antsera immunocomplexes
were able to phosphorylate myelin basic protein more than the
pre-immune sera control. This suggests that the kinase activity
observed is due to AUR1 and AUR2 and not to other proteins present
in the immunocomplex.
[0260] This observation will allow for the purification of active
AUR1 and AUR2 kinase by using myelin basic protein as a substrate
to follow kinase activity. It also will allow the development of an
in vitro kinase assay using recombinant AUR1 and AUR2 proteins.
Furthermore an AUR1 and AUR2 in vitro kinase assay will allow one
to screen small molecule collections for inhibitors of the AUR1 and
AUR2 kinases by measuring the inhibition of phosphorylation of
myelin basic protein.
Example 6
[0261] Structural Comparison of Aur Homologues
[0262] Materials and Methods:
[0263] cDNA cloning
[0264] Degenerate oligonucleotide primers were designed for PCR
cloning based on kinase domains I and IX of CCK4 (GenBank:U33635;
Cowley et al., Cell 77:841-852, 1994), a receptor tyrosine kinase
expressed in a wide range of normal and transformed epithelial
cells. The sense primer was 5'-GARTTYGGNGARGTNTTYYTNGC-3' (SEQ ID
NO:16), encoding the amino acids EFGEVFLA (SEQ ID NO:18) and the
antisense primer was 5'-AGNACNCCRAANGCCCACACRTC-3' (SEQ ID NO:17),
encoding the complementary strand of amino acids DVWAFGVL (SEQ ID
NO:33). These primers were applied to sscDNA generated from RNA
isolated from several colon cancer cell lines as well as other
tumor sources. PCR products of 500-600 bp were subcloned and
sequenced, revealing a fragment related to Drosophila aurora. This
fragment was used to probe a lambda library constructed from a pool
of several human pancreatic cancer cell line RNAs, leading to
isolation of full length clones for human aur1. Two weakly
hybridizing clones were also isolated and sequence analysis
revealed that they represented a related but distinct cDNA termed
aur2. Full length clones were also isolated for both genes from
normal human duodenum cDNA. All clones were sequenced on both
strands with internal oligonucleotide primers using both T7
polymerase manual sequencing and using dye-terminator cycle
sequencing with AmpliTaq DNA polymerase on an ABI Prism 377. The
complete aur2 coding sequence was also confirmed from 10 primary
colorectal tumor samples. Primers 5'-CGCCTTTGCATCCGCTCCTG -3' (SEQ
ID NO:34) and 5'-GATTTGCCTCCTGTGAAGAC -3' (SEQ ID NO:35) were used
in an RT-PCR reaction with sscDNA generated from the tumor RNAs.
The PCR products were purified by GeneClean and sequenced directly
by dye-terminator cycle sequencing with several oligonucleotide
primers. While no sequence differences were observed between clones
isolated from normal or tumor sources, a single nucleotide
polymorphism was identified in 2 of the tumor samples which would
encode an F to I change at residue 31. Abbreviations for degenerate
nucleotide residues are: R=A or G; Y=C or T; N=A, C, G or T.
[0265] Results:
[0266] A PCR-based screen was initiated to identify novel colon
cancer associated kinases. One of these clones encoded a protein
with homology to the aurora protein kinase from Drosophila
melanogaster and the IPL1 kinase from Saccharomyces cerevisiae
(Francisco et al., Mol. Cell. Biol. 14:4731-4740, 1994; Glover et
al., Cell 81:95-105, 1995). While using this fragment to screen for
a full length cDNA clone, a weakly hybridizing clone was found to
encode a related kinase. These genes are referred to as aur1 and
aur2, to reflect their homology to each other and to the Drosophila
aurora kinase.
[0267] Aur1 cDNA contained a 1032 bp open reading frame that
encodes a 344 amino acid polypeptide with a predicted molecular
mass of 39.3 kDa. The aur2 cDNA contained a 1209 bp open reading
frame that encodes a 403 amino acid polypeptide with a predicted
molecular mass of 45.8 kDa. Two additional human aur pseudogenes
were also identified as expressed transcripts that are each
contained on single exons and maintain striking DNA homology to
either aur1 or aur2, yet exhibit multiple frame shifts.
[0268] A partial sequence of BTAK (Sen et al., Oncogene
14:2195-2200, 1997), a breast tumor associated kinase, has been
reported that appears to be fragment of human aur2. A second
manuscript reports the sequence of human aik (Kimura et al., J.
Biol. Chem. 272:13766-13771, 1997), a cell cycle-regulated protein
localized to spindle pole bodies, which shares 92% amino acid
sequence identity with human AUR2 but is likely identical except
for the incorporation of 6 frameshifts resulting from sequencing
errors. A third paper provides the sequence of AYK1 (Yanai et al.
Oncogene 14:2943-2950, 1997), a meiotic regulated gene, that
appears to be the murine orthologue of AUR2. The present invention
describes the first complete sequence for both human aur1 and
aur2.
[0269] The deduced amino acid sequences of human aur1 and aur2 are
presented in FIG. 1 aligned with the yeast and Drosophila
homologues IPL1 and aurora. Human AUR2 protein shares 57%, 43%, and
41% identity over its entire length with human AUR1, Drosophila
aurora, and IPL1, respectively. The four sequences contain a
C-terminal domain with all the characteristic motifs of a
serine/threonine kinase. The kinase domain of human AUR2 shares
74%, 62%, and 49% amino acid identity with human AUR1, Drosophila
aurora, and IPL1 and 83.5% identity with two amphibian homologues
present in Xenopus [p46Eg22 (PIR:S53342) and p46Eg265
(PIR:S53343)]. The Drosophila aurora is most related to human AUR1
whereas the yeast IPL1 is most related to AUR2. This structural
assessment is supported by complementation studies in yeast where
only the human AUR2 kinase can complement an IPL1 mutant. Whereas a
single aurora-like kinase is present in yeast, at least two members
are present in C. elegans (GB:U53336, gene K07C11.2 and GB:U97196,
gene B0207.4). The deduced catalytic domains of these C. elegans
proteins share 55% and 64% amino acid sequence identity to the
human AUR2 kinase domain. We predict an additional aurora homologue
will ultimately be identified in Drosophila as characterization of
its genome nears completion.
[0270] The 129 and 73 amino acid N-terminal domains of human AUR2
and AUR1 share limited homology with each other and with the
analogous 160 and 100 amino acid domains of Drosophila aurora and
yeast IPL1. The N-terminal regions of human and mouse AUR2 share
54% identity to each other and 28-30% identity to the two Xenopus
proteins, and together help define two distantly conserved motifs
present in the non-catalytic region of all auroras (FIG. 1). The
first motif includes 10 amino stretch, KENX.sub.4PVK, termed AUR
Box1 and the second motif is centered around a 15 amino acid
stretch, QX.sub.9AQRVL, termed AUR Box 2 (see overlines in FIG. 1).
The Drosophila aurora has a 36 amino acid insert in AUR Box2.
Several potential serine and threonine phosphorylation sites are
also conserved among these proteins including a protein kinase A
phosphorylation motif RRXT in the activation loop of the kinase. A
temperature sensitive mutant of the yeast IPL1 gene consists of a
Thr to Ala substitution within the activation loop (Gopalan et al.,
J. Cell Biol. 138:643-656, 1997), suggesting that phosphorylation
at this site may be biologically relevant. Additional mutants in
the yeast (Chan 1993, supra) and Drosophila (Glover 1995, supra)
homologues of aurora have been mapped exclusively to the kinase
domain, except for a single Drosophila mutant (Glover 1995, supra)
that involves a mutation at Asp47 within the N-terminal AUR Box2.
Since these mutations result in abnormal nuclei, chromosome
missegregation, and monopolar spindles, these findings suggest that
the catalytic activity of the auroras may play an important role in
centrosome biology.
Example 7
[0271] Expression of Aur1 and Aur2 RNA in Normal Tissues and Tumor
Cell Lines
[0272] Materials and Methods:
[0273] Northern Blots
[0274] Cell pellets from cultured tumor cell lines were provided by
Nick Scuidero (Developmental Therapeutics Program, NCI), and are
part of the NCI tumor panel (see website listing at
http://epnws1.ncifcrf.gov:2345/di- s3d/cancer_screen/cellist.html).
Normal human tissue samples were obtained from the Cooperative
Human Tissue Network (Cleveland, Ohio). Human colorectal tissue
samples for Northern and Southern analysis were obtained from Los
Angeles area hospitals including UCLA-Harbor, Wadsworth and Cedars
Sinai from 1988 to 1997. Tumor histology was confirmed prior to
preparing RNA, DNA and protein lysates from each sample. Total cell
or tissue RNA was isolated using the guanidine salts/phenol
extraction protocol of Chomczynski and Sacchi (Wolf et al.,
Oncogene 14:543-549, 1997). Northern blotting was performed using
standard techniques (Mossie et al. Oncogene 11:2179-2184, 1995)
with a random-labeled 586 bp BamHI-SspI fragment of the human aur2
cDNA. A multiple tissue Northern blot and a human immune system
blot (Clontech) containing 2 g polyA.sup.+ mRNA per lane were also
probed for aur2 expression. A human b-actincDNA probe (Clontech)
was used to confirm equivalent loading of intact RNA. RNA (10 g)
from the SK-HEP-1 (HTB52) liver adenocarcinoma cell line served as
an internal standard for detection of aur2 expression on each blot.
Blots were quantitated using a phosphorimager and ImageQuant
software (Molecular Dynamics, Mountain View, Calif.).
[0275] Results:
[0276] Northern blot analysis of mRNA isolated from normal adult
human tissues demonstrates that aur2 expression is primarily
restricted to testis, thymus and fetal liver, with very weak
expression in bone marrow, lymph node, and spleen and no detectable
expression in all other adult tissues examined. Additional studies
demonstrate tight temporal regulation of these transcripts during
mitosis (and Kimura 1997, supra). Human aur1 was also expressed at
highest levels in normal testis and thymus, with a moderate level
of expression in lung and small intestine.
[0277] Since these genes were originally identified from human
tumors, we performed Northern blot analysis with aur2 on a panel of
human tumor cell lines of colon, renal, melanoma, and breast
origin. The 2.4 kb aur2 transcript was expressed in 96% (24 of 25)
of these transformed cell lines, with the only exception being the
UO-31 renal carcinoma cell line. The 1.4 kb aur1 transcript was
co-expressed at surprisingly similar levels as aur2 in the same 24
tumor cell lines.
Example 8
[0278] Amplification and Overexpression of Aur2 in Primary Human
Colorectal Cancers
[0279] Materials and Methods:
[0280] Chromosomal Localization
[0281] The Stanford G3 radiation hybrid panel was obtained from
Research Genetics (Huntsville, Ala.). Primers used for radiation
hybrid mapping were: 5'-ATGCCTCCGGAAAGAGCCTGT-3' (SEQ ID NO:36) and
5'-GTGTCCCACTGCTATTCTCCAT -3'(SEQ ID NO:37) for aur1 and
5'-CAGGGCTGCCATATAACCTGA -3'(SEQ ID NO:38) and
5'-CTAGCACAGGCTGACGGGGC -3'(SEQ ID NO:39) for aur2. The aur1
primers are directed to the N-terminal region of the gene and
generate a 247 bp fragment following 25 cycle PCR with a 54.degree.
C. annealing temperature. The aur2 primers amplify a 255 bp
fragment from the 3' UTR following a 25 cycle PCR with a 54.degree.
C. annealing temperature. The raw score for aur1 against the SHGCR
G3 panel is:
000000000000100000000000000000000000000100000001001001-
0000000000010000 0000001010101, and for aur2:
1000000000100010100000010001-
001000000000001000000110000100100101000001 0010010010010.
[0282] Southern Blotting
[0283] Genomic DNA was isolated from the human colorectal tissue
samples by standard methods (Proteinase K digestion,
phenol:chloroform extraction, and ethanol precipitation). Southern
blots were prepared by digesting 5 .mu.g of DNA with PstI,
separating the fragments on 1% agarose gels, blotting onto nylon
membranes (Nytran-Plus, Schleicher & Schuell), and probing
sequentially with a random primer labeled 1044 bp aur2 cDNA
fragment (pSG19) and a 1700 bp cloned fragment of the CYP24 gene
(pKS-h24, from J. Omdahl, U. of New Mexico). A probe for human
.beta.-globin was used to confirm equivalent sample loading. Final
washes were at 0.1.times.SSC, 0.1% SDS, 60.degree. C.
Autoradiographs were quantitated relative to .beta.-globin using
ImageQuant software (Molecular Dynamics, Mountain View,
Calif.).
[0284] Results:
[0285] Aur2 expression was next characterized by Northern blot
analysis in a panel of 41 primary human colorectal tumors and
matched normal colorectal tissue from the same patients.
Approximately 54% (22/41) of the samples showed increased
expression of the 2.4 kb aur2 transcript in the tumor as compared
to the normal colon control. Aur2 RNA showed 4-28 fold
overexpression in tumor versus normal tissue.
[0286] The aur1 and aur2 genes were mapped using the Stanford Human
Genome Center G3 radiation hybrid panel. Human aur1 is located on
chromosome 17p13.1 (LOD score of 9.555 to linked marker SHGC-35513)
and human aur2 on chromosome 20q13.2 (LOD score of 17.26 to linked
marker SHGC-3245). Mapping was also confirmed by hybridization to a
human-rodent somatic cell hybrid panel (Coriell Cell Repository,
Camden, N.J.). Aur2 maps adjacent to the vitamin D hydroxylase
(CYP24) gene and the cosmid probe RMC20C001 that lie at 0.825-0.83
Flpter (fractional length from pter) on chromosome 20 (Tanner 1994,
supra; Tanner 1996, supra). Both of these markers have been
characterized for their presence in the 20q13 amplicon common to
many human malignancies, particularly those from breast, bladder,
and colon cancers.
[0287] Southern blot hybridization was performed using an aur2 cDNA
probe along with a control probe for the CYP24 gene that serves as
a marker of the amplicon (Tanner 1994, supra; Tanner 1996, supra).
The aur2 probe hybridized to PstI fragments of 5.8, 3.7, 3.3, 2.8,
2.5, and 1.3 kb. The 5.8, 3.3, 2.8, and 2.5 kb bands are specific
to aur2. Only the aur2-specific bands showed amplification in the
tumor samples.
[0288] Aur2 DNA was amplified in 41 of 79 (52%) of the primary
colorectal tumors for which suitable DNA was available for
genotyping. Nine of twelve samples demonstrated a 2-8 fold
amplification of aur2 DNA in the tumors compared to normal tissue.
One of the samples demonstrates RNA overexpression in the absence
of DNA amplification, whereas the other eleven show a direct
correlation between DNA amplification and RNA overexpression. The
CYP24 gene was found to be co-amplified with aur2 in 37 of 41 (90%)
matched pairs, and was only once found to be amplified in the
absence of aur2 amplification.
[0289] There is a high correlation (.rho.=0.695) between aur2 DNA
amplification and RNA overexpression with only one discordant
result. In the single case of aur2 DNA amplification in the absence
of RNA overexpression, aur2 RNA was actually elevated in both the
normal and tumor specimens, compared to other tumor-normal pairs.
Conceivably, high expression of aur2 RNA in this normal colon
sample may represent an early predisposing lesion. Conversely, five
paired samples showed increased RNA expression in the absence of
DNA amplification, possibly due to transcriptional activation. If
these five pairs are excluded from the analysis, the correlation
between aur2 DNA amplification and RNA overexpression increases to
.rho.=0.939. These data suggest that DNA amplification is a
mechanism for AUR2 activation and also implicates aur2 as an
oncogene at 20q13 whose high level amplification correlates with
poor clinical outcome in breast cancer (Isola 1995, supra).
[0290] To determine if the aur2 sequence from the 20q13 amplicon
was the same as that from normal sources, we performed direct
sequencing of RT-PCR products encompassing the complete aur2 coding
region from 10 primary colorectal tumor samples. Eight samples,
including both normal and amplified levels of the 20q13 amplicon,
confirmed the aur2 sequence. A single nucleotide polymorphism was
identified in 2 samples resulting in a phenylalanine to isoleucine
change at residue 31 in the N-terminal Aurora Box1 (circled in FIG.
1). This analysis demonstrates that the 20q13 amplicon typically
contains increased copies of the intact, unmutated aur2 coding
region.
Example 9
[0291] Detection of AUR2 Protein in Primary Human Colon Cancer
Samples
[0292] Materials and Methods:
[0293] Western Blotting
[0294] Matched human tissue samples from primary colorectal
carcinomas and adjacent normal tissue were obtained from the
Cooperative Human Tissue Network (Cleveland, Ohio) and Pathology
Associates International (Frederick, Md.). Thirty micron cryostat
sections of OCT embedded tissue was lysed directly in 25 82 L of
ice-cold RIPA buffer (50 mM Tris-Cl, pH 8.0, 150 mM NaCl, 1.0%
Np-40, 0.5% deoxycholate, 0.1% SDS, 1 mM DTT, and protease
inhibitors) by gentle mixing on ice for 20 minutes. The lysate was
then spun for 10 minutes at 10,000.times.g in a microfuge at
4.degree. C. The resulting supernatant was transferred to a clean
tube and the total protein concentration was determined by Bradford
analysis. Equal amounts of total protein from the matched samples
was resolved on a 12% polyacrylamide gel, transferred to a nylon
membrane (BioRad), and probed with a 1:2,000 dilution of affinity
purified antibodies to AUR2. The immunoblot was developed with ECL
reagent (Amersham). Lysates from tumor cell lines were prepared and
analysed as described above.
[0295] Results:
[0296] To analyze AUR2 protein expression, we generated polyclonal
antibodies in rabbits against the entire open reading frame
expressed in E. coli as a GST-fusion protein. The anti-AUR2
antibodies were used to probe blots of protein lysates made from
cryostat sections of primary human colon carcinomas or from
adjacent normal tissue. The AUR2 antibodies detect a protein of
approximately 46 kDa in two primary human colon carcinomas, but not
in samples derived from the adjacent normal tissue. These
antibodies also detect overexpression of AUR2 protein in various
cultured tumor cell lines derived from colorectal carcinomas.
Example 10
[0297] Aur2 Transforms Rat1 Fibroblasts
[0298] Materials and Methods:
[0299] Expression Constructs
[0300] HA-tagged.sup.42 versions of wild-type, kinase dead (K162M),
and activated (T288D) aur2 were subcloned into the expression
vector pLXSN. These contructs were transfected into the amphotropic
packaging cell line PA317 and the supernatants were harvested and
used to infect the producer cell line GP+E-86 (Markowitz et al,
Virology 167:400-406, 1988). Neomycin resistant clones were
selected and assayed for AUR2 protein expression. Supernatants from
the positive producer cell lines were used to infect Rat1 and
NIH3T3 cells. Stable clones were selected for in the presence of
neomycin and assayed for AUR2 protein expression by
immunobloting.
[0301] In vitro Kinase Assays
[0302] Rat1 and NIH3T3 cells expressing the appropriate aur2
construct were solubilized in kinase lysis buffer (50 mM Hepes, pH
7.4, 100 mM KCl, 25 mM NaF, 0.5% NP40, 1 mM NaVO.sub.3, 1 mM DTT,
and protease inhibitors) for 15 minutes on ice, spun in a microfuge
at 10,000.times.g for 10 minutes at 4.degree. C. The resulting
supernatant was transferred to a clean tube and the total protein
concentration was determined by Bradford analysis. Equal amounts of
protein (usually 2 mg) were immunoprecipitated with the anti-HA
monoclonal antibody 12CA (Boehinger). The immune complexes were
washed three times with kinase lysis buffer followed and were
either resuspended in 1.times. Laemmli SDS sample buffer or washed
three times with kinase buffer (without .gamma.-.sup.32P-ATP and
.alpha.-casein) and resuspended in 30 .mu.L of 1.times. kinase
buffer (20 mM Hepes, pH 7.4, 150 mM KCl, 5 mM MnCl.sub.2, 5 nM NaF,
1 nM DTT, 50 .mu.M ATP, 20 .mu.Ci .gamma.-.sup.32P-ATP, and 0.5
mg/ml .alpha.-casein). In vitro kinase reactions were carried out
for 20 minutes at 37.degree. C. and stopped by the addition of 30
.mu.L of 2.times. Laemmli SDS sample buffer. Samples were incubated
for 5 minutes at 95.degree. C. and resolved on 14%
SDS-polyacrylamide gels.
[0303] Soft Agar Assays
[0304] A 3% solution of agar (at 56.degree. C.) was diluted to a
final concentration of 0.6% with growth medium (at 56.degree. C.),
pipetted into tissue culture dishes, and allowed to solidify at
room temperature for 20-30 minutes. At this time, 2.times.10.sup.5
cells in a volume of 50 .mu.L were mixed with 0.3% agar (diluted
with growth media at 40.degree. C.), pipetted gently onto the
bottom agar layer, and allowed to solidify for 20-25 minutes at
room temperature. Once solidified, the plates were incubated at
37.degree. C. in a 5% CO.sub.2 atmosphere. Fresh top agar was added
once a week. After 4 weeks the plates were stained with neutral
red.
[0305] Results:
[0306] If aur2 is a relevant target on the 20q13 amplicon, one
might expect that overexpression of aur2 would be transforming. To
examine this question, we established stable Rat1 cell lines that
express human aur2. Rat1 cells were infected with retroviruses that
express a hemagglutinin (HA)-tagged (Pati 1992, supra) wild-type
aur2 or a kinase inactive mutant where the essential lysine at
residue 162 (FIG. 1) was changed to a methionine (K162M). In
addition, an activating mutation was made in which the threonine at
residue 288 (FIG. 1) in the activation loop was changed to an
aspartic acid (T288D). This mutation was designed to mimic
constitutive phosphorylation at this site and indeed activates the
kinase in vitro. The stable Rat1 lines expressed similar amounts of
AUR2 protein. In vitro kinase assays were performed using the AUR2
protein produced by the stable cell lines. The kinase inactive AUR2
mutant (K162M) was unable to phosphorylate-casein over the levels
observed in the vector control cell line in vitro, whereas the
wild-type and activated AUR2 (T288D) proteins had increased
activity on this artificial substrate.
[0307] To characterize the transforming potential of aur2, we
performed soft agar assays with the Rat1 clones. The vector
control, K162M, wild-type, and T288D AUR2 expressing Rat1 cells
were plated in soft agar and scored for growth after 4 weeks. Cells
expressing the wild-type and the T288D AUR2 formed colonies in soft
agar, in contrast to the lack of growth by cells expressing the
kinase inactive AUR2. Ten of thirteen wild-type clones and six of
twelve T288D clones grew in soft agar, compared to one of eleven
vector and K162M clones. The number of colonies formed in soft agar
from two independent clones of each of the transfections was
quantitated. The average number of colonies per 200,000 cells
plated were: K162M, 32 colonies; wild-type, 470 colonies; and
T288D, 250 colonies. Although the T288D Rat1 stables formed fewer
colonies than the wild-type AUR2 Rat1 stables, the T288D colonies
in general grew to larger size.
[0308] The T288D AUR2 mutant was also able transform NIH3T3 cells,
as measured by growth in soft agar and growth as tumors in nude
mice. In constrast, the wild-type AUR2 was unable to transform
NIH3T3 cells. The transforming ability of these constructs
correlated with catalytic activity, since the wild-type AUR2 was
catalytically inactive in NIH3T3 cells whereas the T288D had strong
kinase activity. These data suggest that the genetic background of
the cells is important in determining the transforming potential of
AUR2.
Example 11
[0309] Activated AUR Transforms NIH3T3 Cells
[0310] Stable mouse NIH3T3 cell lines that express human AUR2 were
established. NIH3T3 cells were infected with retroviruses that
express a hemagglutinin (HA)-tagged (Chan 1993, supra) wild-type
AUR2 or a kinase inactive mutant where the essential lysine at
residue 162 (FIG. 1) was changed to a methionine (K162M). In
addition, an activating mutation was made in which the threonine at
residue 288 (FIG. 1) in the activation loop was changed to an
aspartic acid (T288D). This mutation was designed to mimic
constitutive phosphorylation at this site and indeed activates the
kinase in vitro. The stable lines expressed similar amounts of AUR2
protein. In vitro kinase assays were performed using the AUR2
protein produced by the stable cell lines.
[0311] The wild-type and kinase inactive AUR2 mutant (K162M) were
unable to phosphorylate myelin basic protein in vitro, however the
activated AUR2 mutant (T288D) had marked activity on this
artificial substrate. It is not clear why the wild-type AUR2
appears to be catalytically inactive in the in vitro kinase assay.
Perhaps a putative activator of AUR2 is limiting in the NIH3T3
cells or a negative regulator, such as an AUR2 phosphatase, has
increased activity in these cells. Indeed, an interfering mutant of
the S. cerevisiae phosphatase PP1 can exacerbate the IPL1 mutant
phenotype, suggesting that IPL1 may be negatively regulated by this
phosphatase (Francisco et al, Mol. Cell. Biol. 14:4731-4740). It is
also possible that while activated AUR2 can utilize myelin basic
protein as an artificial substrate in vitro, the wild-type kinase
has a more restricted substrate preference.
[0312] To determine if ectopic expression of activated AUR2 alters
the growth of NIH3T3 cells, growth curves in media containing low
(2%) serum were generated. For the first 24 hours under these
conditions, the expression of activated AUR2 provided a growth
advantage to NIH3T3 as compared to cell lines expressing wild-type
AUR2, kinase inactive AUR2, or the vector control. However, after
48 hours in 2% serum, all the cell lines ceased to divide,
indicating that activated AUR2 alone is unable to promote
indefinite cell proliferation.
[0313] To characterize the transforming potential of activated
AUR2, soft agar assays were performed with the 3T3 clones. The
vector control, wild-type, kinase inactive, and activated AUR2
expressing NIH3T3 cells were plated in soft agar and scored for
growth after 3-4 weeks. Cells expressing the activated AUR2 grew
large colonies in soft agar, in sharp contrast to the lack of
growth by cells expressing the wild-type and the kinase inactive
AUR2. Ectopic expression of activated AUR2 appears to confer a
growth advantage to NIH3T3 cells in low serum and results in
anchorage-dependent growth.
Example 12
[0314] Aur2 Antisense Oligos Inhibit AUR2 Expression In vivo
[0315] Material and Methods:
[0316] Human H1299 cells were seeded at .about.40-50% confluency in
a 6 well plate (Falcon). The following day lipofectin (Gibco) and
oligo(s) were mixed with OptiMEM (Gibco) such that the final
concentration of lipofectin is 100 .mu.g/mL and the final
concentration of each oligo is 1 .mu.M in a volume of 200 .mu.L.
The lipofectin/oligo/OptiMEM mixture was incubated at room
temperature (20-25.degree. C.) for 15 minutes, 800 .mu.L of OptiMEM
was added to the lipofectin/oligo/OptiMEM mixture, and mixed
gently. The growth medium was removed from the H1299 cells, which
were at .about.80% confluency. Cells were washed once with OptiMEM.
The OptiMEM was aspirated, the lipofectin/oligo/OptiMEM mixture was
added, cultures incubated at 37.degree. C. for 4 hours. The
lipofectin/oligo/OptiMEM mixture was removed and replaced with
normal growth medium containing the antisense oligo(s) at a
concentration of 200 nM. The plates were returned to the 37.degree.
C. incubator for 16-20 hours after which the growth medium was
removed from the cells and they were washed once with OptiMEM. The
OptiMEM was again aspirated and the lipofectin/oligo/OptiMEM
mixture was added (prepared as described above) and the plates
again were incubated at 37.degree. C. for 4 hours. The
lipofectin/oligo/OptiMEM mixture was removed again and replaced
with normal growth medium containing the antisense oligo(s) at a
concentration of 200 nM. The platea were returned to the 37.degree.
C. incubator for 16-20 hours. The cells were harvested (.about.40
hours after initial treatment) and analyzed for aur2 mRNA by
northern blot or AUR2 protein expression by immunoblot.
[0317] Results:
[0318] Three antisense oligonucleotides (SEQ ID NOs:16, 17, and 18)
which target specific regions of human aur2 mRNA transcript were
found to significantly down regulate AUR2 protein expression in the
human tumor cell line H1299. When used in combination oligos SEQ ID
NO:30 and SEQ ID NO:32 and SEQ ID NO:31 and SEQ ID NO:32 reduce the
expression of AUR2 protein below the limit of detection. Treatment
of H1299 cells with the combination of SEQ ID NO:31 and SEQ ID
NO:32 inhibited the growth of this tumor cell line as measured by
cell growth and appeared to induce apoptosis as measured by
FACs.
[0319] Sequences (5'-3'): The oligo number as well as the location
of the sequence within the aur2 cDNA are presented below. Note:
these oligonucleotides were synthesized as phosphothionates.
4 SEQ ID NO:30 (nucleotides 1743-1763): CAGGGCAGAGTGGTCACTTTC SEQ
ID NO:31 (nucleotides 42-62): CGTCCGCCACTCCGACCAGCC SEQ ID NO:32
(nucleotides 1654-1674): TGCAGTCGAACCTTGCCTCCA
[0320] These antisense oligonucleotides would be useful for
inhibition of AUR2 expression in normal and tumor cells in order to
profile the potential effects of small molecule AUR2 inhibitors.
They can also be used to inhibit AUR2 expression in human tumor
cell xenografts in nude mice to determine the antitumor effects of
AUR2 inhibitors. Another use is as a "drug" to inhibit AUR2
expression in various human tumors that are "driven" by
overexpression of the aur2 gene.
Example 13
[0321] Screening Systems for the Identification of Inhibitors of
AUR2 Activity
[0322] Assays may be performed in vitro or in vivo and are
described in detail herein or can be obtained by modifying existing
assays, such as the growth assay described in patent application
Ser. No. 08/487,088 (Lyon & Lyon Docket No. 212/276), filed
Jun. 7, 1995, by Tang et al., and entitled "Novel Pharmaceutical
Compounds", or the assays described in patent application Serial
No. 60/005,167 (Lyon & Lyon Docket No. 212/256), filed Oct. 13,
1995 by Seedorf et al., and entitled "Diagnosis and Treatment of
TKA-1 related disorders", all of which are hereby incorporated
herein by reference in their entirety including any drawings.
Another assay which could be modified to use the genes of the
present invention is described in International Application No. WO
94/23039, published Oct. 13, 1994, hereby incorporated herein by
reference in its entirety including any drawings. Other
possibilities include detecting kinase activity in an
autophosphorylation assay or testing for kinase activity on
standard substrates such as histones, myelin basic protein, gamma
tubulin, or centrosomal proteins. Binding partners may be
identified by putting the N-terminal portion of the protein into a
two-hybrid screen or detecting phosphotyrosine of a dual
specificity kinase (Fields and Song, U.S. Pat. No. 5,283,173,
issued Feb. 1, 1994, incorporated by reference herein, including
any drawings).
[0323] One means by which inhibitors of AUR2 activity may be
defined is a screening system using a temperature-sensitive yeast
mutant as described by Chan and Botstein (Genetics 135:677-691,
1993); see also Francisco et al. (Mol. Cell. Bio. 14:4731-4740,
1994) both of which are hereby incorporated herein by reference in
their entirety including any drawings.
[0324] Briefly, yeast strain CCY72-3D-1 (ip 11-2), which expresses
a temperature sensitive form of the yeast homologue of AUR2 (ip11),
while viable at 26.degree. C. is incapable of growth at 37.degree.
C. Transfection of this strain with an expression plasmid
containing a hybrid aurora gene consisting of the N-terminal
portion of ip11, containing the putative substrate interaction
domain(s)), and the C-terminal portion of AUR2, containing the
catalytic domain, overcomes this sensitivity to growth temperature.
The AUR expressing yeast strain is then grown at 37.degree. C. in
the presence of a test substance. No growth will be evident in the
presence of substances that inhibit AUR catalytic function.
Potential inhibitors include antisense oligonucleotides, small
molecular weight chemicals, and/or natural products isolated from
diverse organisms such as fungi, marine organisms, plants, etc.
CONCLUSION
[0325] One skilled in the art would readily appreciate that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those inherent
therein. The molecular complexes and the methods, procedures,
treatments, molecules, specific compounds described herein are
presently representative of preferred embodiments are exemplary and
are not intended as limitations on the scope of the invention.
Changes therein and other uses will occur to those skilled in the
art which are encompassed within the spirit of the invention are
defined by the scope of the claims.
[0326] It will be readily apparent to one skilled in the art that
varying substitutions and modifications may be made to the
invention disclosed herein without departing from the scope and
spirit of the invention.
[0327] All patents and publications mentioned in the specification
are indicative of the levels of those skilled in the art to which
the invention pertains. All patents and publications are herein
incorporated by reference to the same extent as if each individual
publication was specifically and individually indicated to be
incorporated by reference.
[0328] The invention illustratively described herein suitably may
be practiced in the absence of any element or elements, limitation
or limitations which is not specifically disclosed herein. Thus,
for example, in each instance herein any of the terms "comprising",
"consisting essentially of" and "consisting of" may be replaced
with either of the other two terms. The terms and expressions which
have been employed are used as terms of description and not of
limitation, and there is no intention that in the use of such terms
and expressions of excluding any equivalents of the features shown
and described or portions thereof, but it is recognized that
various modifications are possible within the scope of the
invention claimed.
[0329] In addition, where features or aspects of the invention are
described in terms of Markush groups, those skilled in the art will
recognize that the invention is also thereby described in terms of
any individual member or subgroup of members of the Markush group.
For example, if X is described as selected from the group
consisting of bromine, chlorine, and iodine, claims for X being
bromine and claims for X being bromine and chlorine are fully
described.
[0330] In view of the degeneracy of the genetic code, other
combinations of nucleic acids also encode the claimed peptides and
proteins of the invention. For example, all four nucleic acid
sequences GCT, GCC, GCA, and GCG encode the amino acids alanine.
Therefore, if for an amino acid there exists an average of three
codons, a polypeptide of 100 amino acids in length will, on
average, be encoded by 3.sup.100, or 5.times.10.sup.47, nucleic
acid sequences. It is understood by those skilled in the art that,
with, Thus, a nucleic acid sequence can be modified to form a
second nucleic acid sequence, encoding the same polypeptide as
encoded by the first second nucleic acid sequences, using routine
procedures and without undue experimentation. Thus, all possible
nucleic acids that encode the claimed peptides and proteins are
also fully described herein, as if all were written out in full
taking into account the codon usage, especially that preferred in
humans.
[0331] Furthermore, changes in the amino acid sequences of
polypeptides, or in the corresponding nucleic acid sequence
encoding such polypeptide, may be designed or selected to take
place in an area of the sequence where the significant activity of
the polypeptide remains unchanged. For example, an amino acid
change may take place within a .beta.-turn, away from the active
site of the polypeptide. Also changes such as deletions (e.g.
removal of a segment of the polypeptide, or in the corresponding
nucleic acid sequence encoding such polypeptide, which does not
affect the active site) and additions (e.g. addition of more
peptides to the polypeptide sequence without affecting the function
of the active site, such as the formation of GST-fusion proteins,
or additions in the corresponding nucleic acid sequence encoding
such polypeptide without affecting the function of the active site)
are also within the scope of the present invention. Such changes to
the polypeptides can be performed by those with ordinary skill in
the art using routine procedures and without undue experimentation.
Thus, all possible nucleic and/or amino acid sequences that can
readily be determined not to affect a significant activity of the
peptide or protein of the invention are also fully described
herein.
[0332] Other embodiments are within the following claims.
Sequence CWU 1
1
* * * * *
References