U.S. patent application number 10/825739 was filed with the patent office on 2004-12-30 for methods of treating inflammatory skin diseases.
Invention is credited to Rudge, John S., Xia, Yuping, Yancopoulos, George D..
Application Number | 20040266686 10/825739 |
Document ID | / |
Family ID | 25099593 |
Filed Date | 2004-12-30 |
United States Patent
Application |
20040266686 |
Kind Code |
A1 |
Xia, Yuping ; et
al. |
December 30, 2004 |
Methods of treating inflammatory skin diseases
Abstract
Methods of treating diseases in which plasma leakage and/or
vascular permeability occurs, for example, inflammatory skin
diseases, particularly psoriasis, with a vascular endothelial
growth factor (VEGF) antagonist. Further included are methods for
enhacing wound healing with a VEGF antagonist.
Inventors: |
Xia, Yuping; (Cortlandt
Manor, NY) ; Rudge, John S.; (Mahopac, NY) ;
Yancopoulos, George D.; (Yorktown Heights, NY) |
Correspondence
Address: |
REGENERON PHARMACEUTICALS, INC
777 OLD SAW MILL RIVER ROAD
TARRYTOWN
NY
10591
US
|
Family ID: |
25099593 |
Appl. No.: |
10/825739 |
Filed: |
April 16, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10825739 |
Apr 16, 2004 |
|
|
|
09773877 |
Jan 31, 2001 |
|
|
|
09773877 |
Jan 31, 2001 |
|
|
|
PCT/US00/14142 |
May 23, 2000 |
|
|
|
60138133 |
Jun 8, 1999 |
|
|
|
Current U.S.
Class: |
514/8.1 ;
514/18.7; 514/9.4 |
Current CPC
Class: |
A61P 17/06 20180101;
A61K 38/00 20130101; A61P 35/00 20180101; A61P 13/12 20180101; A61P
17/02 20180101; C07K 2319/00 20130101; A61P 43/00 20180101; A61P
29/00 20180101; A61P 27/02 20180101; C07K 14/71 20130101 |
Class at
Publication: |
514/012 |
International
Class: |
A61K 038/17 |
Claims
We claim:
1. A method of treating inflammatory skin disease in a mammal,
comprising administering a VEGF antagonist to the mammal, such that
the inflammatory skin disease is treated.
2. The method of claim 1, wherein the VEGF antagonist is a fusion
polypeptide capable of binding VEGF.
3. The method of claim 2, wherein the fusion polypeptide comprises
a VEGF receptor component and a multimerizing component.
4. The method of claim 3, wherein the VEGF receptor component
consists essentially of the amino acid sequence of Ig domain 2 of
the extracellular domain of a first VEGF receptor and the amino
acid sequence of Ig domain 3 of the extracellular domain of a
second VEGF receptor.
5. The method of claim 4, wherein the first VEGF receptor is
Flt1.
6. The method of claim 4, wherein the second VEGF receptor is Flk1
or Flt4.
7. The method of claim 6, wherein the second VEGF receptor is Flk1
or Flt4.
8. The method of claim 3, wherein the VEGF antagonist is a fusion
polypeptide selected from the group consisting of acetylated
Flt-1(1-3)-Fc, Flt-1(1-3.sub.R->N)-Fc, Flt-1(1-3.sub.AB)-Fc,
Flt-1(2-3.sub.AB)-Fc, Flt-1 (2-3)-Fc, Flt-1
D2-VEGFR3D3-Fc.DELTA.C1(a), Flt-i D2-Flk-1 D3-Fc.DELTA.C1(a), and
VEGFR1R2-Fc.DELTA.C1(a).
9. The method of claim 4, wherein Ig domain 2 of the extracellular
domain of the first VEGF receptor is upstream or downstreatm of Ig
domain 3 of the extracellular domain of the second VEGF
receptor.
10. The method of claim 3, wherein the multimerizing component
comprises an immunoglobulin domain.
11. The method of claim 10, wherein the immunoglobulin domain is
selected from the group consisting of the Fc domain of IgG, the
heavy chain of IgG, and the light chain of IgG.
12. The method of claim 10, wherein the immunoglobulin domain is
the Fc of IgG1, or a derivative thereof.
13. The method of claim 1, wherein the mammal is a human suffering
from an inflammatory skin disease.
14. The method of claim 1, wherein the inflammatory skin disease is
psoriasis.
15. The method of claim 14, wherein treatment results in treatment
of a symptom associated with psoriasis resulting in reduced
severity of a psoriatic lesion, reduced hyperproliferation of
keratinocytes, reduced epidermal hyperplasia, reduced reteridges,
reversal of epidermal hyperplasia, prevention of infiltration of
lymphocytes from dermis into epidermis and/or treatment of
parakeratosis and microabcess.
16. The method of claim 1, wherein administration is topical
administration, subcutaneous administration, or perhaps
intramuscular, intranasal, intrathecal, intraarterial, intravenous,
transvaginal, transdermal, or transanal administration.
17. A method of enhancing wound healing in a human comprising
administering a VEGF antagonist to the human.
18. The method of claim 17, wherein administration is topical
administration.
19. The method of claim 17, wherein administration is subcutaneous
administration.
20. The method of claim 17, wherein administration is
intramuscular, intranasal, intrathecal, intraarterial, intravenous,
transvaginal, transdermal, or transanal administration.
Description
STATEMENT OF RELATED APPLICATIONS
[0001] The application is a divisional of application Ser. No.
09/773,877, filed 31 Jan. 2001, now allowed, which is the National
Stage of International Application No. PCT/US00/14142, filed 23 May
2000, which claims the benefit under 35 U.S.C. .sctn. 119(e) of
U.S. Provisional Application No. 60/138,133, filed 8 Jun. 1999.
BACKGROUND
[0002] 1. Field of the Invention
[0003] This invention relates to methods of treating inflammatory
skin diseases with an antagonist of vascular endothelial cell
growth factor (VEGF). More specifically the invention relates to
methods of using a VEGF antagonist in the treatment of
psoriasis.
[0004] 2. Statement of Related Art
[0005] Persistent angiogenesis may cause or exacerbate certain
diseases such as psoriasis, rheumatoid arthritis, hemangiomas,
angiofibromas, diabetic retinopathy and neovascular glaucoma. An
inhibitor of VEGF activity would be useful as a treatment for such
diseases and other VEGF-induced pathological angiogenesis and
vascular permeability conditions, such as tumor vascularization.
The present invention relates to a VEGF inhibitor that is based on
the VEGF receptor Flt1.
[0006] Plasma leakage, a key component of inflammation, occurs in a
distinct subset of microvessels. In particular, in most organs
plasma leakage occurs specifically in the venules. Unlike
arterioles and capillaries, venules become leaky in response to
numerous inflammatory mediators including histamine, bradykinin,
and serotonin. One characteristic of inflammation is the plasma
leakage that results from intercellular gaps that form in the
endothelium of venules. Most experimental models of inflammation
indicate that these intercellular gaps occur between the
endothelial cells of postcapillary and collecting venules (Baluk et
al. (1998) Am. J. Pathol. 152:1463-76). It has been shown that
certain lectins may be used to reveal features of focal sites of
plasma leakage, endothelial gaps, and finger-like processes at
endothelial cell borders in inflamed venules (Thurston et al.
(1996) Am. J. Physiol, 271:H2547-62). In particular, plant lectins
have been used to visualize morphological changes at endothelial
cell borders in inflamed venules of, for example, the rat trachea.
Lectins, such as conconavalin A and ricin, that bind focally to
inflamed venules reveal regions of the subendothelial vessel wall
exposed by gaps that correspond to sites of plasma leakage
(Thurston et al. (1996) supra).
[0007] U.S. Pat. No. 6,011,003 (Metris Therapeutics Limited)
discloses an altered, soluble form of Flt polypeptide being capable
of binding to VEGF and thereby exerting an inhibitory effect
thereon, the polypeptide comprising five or fewer complete
immunoglobulin domains. U.S. Pat. No. 5,712,380 (Merck & Co.)
discloses vascular endothelial cell growth factor (VEGF) inhibitors
that are naturally occurring or recombinantly engineered soluble
forms with or without a C-terminal transmembrane region of the
receptor for VEGF. WO 97/44453 (Genentech, Inc.) discloses novel
chimeric VEGF receptor proteins comprising amino acid sequences
derived from the vascular endothelial growth factor (VEGF)
receptors Flt1 and KDR, including the murine homologue to the human
KDR receptor FLK1, wherein said chimeric VEGF receptor proteins
bind to VEGF and antagonize the endothelial cell proliferative and
angiogenic activity thereof. WO 97/13787 (To a Gosei Co., LTD.)
discloses a low molecular weight VEGF inhibitor usable in the
treatment of diseases accompanied by neovascularization such as
solid tumors.
BRIEF SUMMARY OF THE INVENTION
[0008] In a first aspect, the invention features a method of
treating inflammatory skin disease in a mammal, comprising
administering a VEGF antagonist to the mammal. In a preferred
embodiment, the VEGF antagonist is a fusion polypeptide capable of
binding a VEGF polypeptide comprising (a) a VEGF receptor component
operatively linked to (b) a multimerizing component, wherein the
VEGF receptor component is the only VEGF receptor component of the
fusion polypeptide and consists essentially of a the amino acid
sequence of Ig domain 2 of the extracellular domain of a first VEGF
receptor and a the amino acid sequence of Ig domain 3 of the
extracellular domain of a second VEGF receptor. In a specific
embodiment, the first VEGF receptor is Flt1, the second VEGF
receptor is Flk1 or Flt4. In specific embodiments, the VEGF
antagonist is a fusion polypeptide selected from the group
consisting of Flt-1(1-3)-Fc, Flt-1(1-3.sub.R->N)-Fc (described
in FIG. 16A-C of parent application U.S. Ser. No. 09/773,877),
Flt-1(1-3.sub..DELTA.B)-Fc (described in FIG. 13A-D of parent
application U.S. Ser. No. 09/773,877, herein specifically
incorporated by reference in its entirety),
Flt-1(2-3.sub..DELTA.B)-Fc (described in FIG. 14A-C of parent
application U.S. Ser. No. 09/773,877), Flt-1(2-3)-Fc (described in
FIG. 15A-C of parent application U.S. Ser. No. 09/773,877),
Flt-1D2-VEGFR3D3-Fc.DELTA.C1(a), Flt-1D2-Flk-1D3-Fc.DELT- A.C1(a),
and VEGFR1R2-Fc.DELTA.C1(a). In further preferred embodiments, Ig
domain 2 of the extracellular domain of the first VEGF receptor is
upstream of Ig domain 3 of the extracellular domain of the second
VEGF receptor. In still another preferred embodiment, the Ig domain
2 of the extracellular domain of the first VEGF receptor is
downstream of Ig domain 3 of the extracellular domain of the second
VEGF receptor. In a preferred embodiment of the invention, the
multimerizing component comprises an immunoglobulin domain. In
another embodiment, the immunoglobulin domain is selected from the
group consisting of the Fc domain of IgG, the heavy chain of IgG,
and the light chain of IgG. In a most specific embodiment, the VEGF
antagonist is a VEGF trap comprised of VEGFR1R2-FcDC1(a). In a
preferred embodiment, the mammal is a human.
[0009] In a second aspect, the invention features a method of
reducing the severity of a psoriatic lesion in a mammal comprising
administering a VEGF antagonist to the mammal.
[0010] In a third aspect, the invention features a method of
minimizing the extent of hyperproliferation of keratinocytes
associated with psoriasis in a mammal comprising administering a
VEGF antagonist to the mammal.
[0011] In a fourth aspect, the invention features a method of
minimizing the extent of epidermal hyperplasia associated with
psoriasis in a mammal comprising administering a VEGF antagonist to
the mammal.
[0012] In a fifth aspect, the invention features a method of
reversing epidermal hyperplasia associated with psoriasis in a
mammal, comprising administering a VEGF antagonist to the
mammal.
[0013] In a sixth aspect, the invention features methods of
treating parakeratosis and treating microabcess associated with
psoriasis in a human, comprising administering a VEGF antagonist to
the human.
[0014] In a seventh aspect, the invention features a method of
decreasing reteridges associated with psoriasis in a human
comprising administering a VEGF antagonist to the human.
[0015] In an eighth aspect, the invention features a method of
preventing the infiltration of lymphocytes from the dermis into the
epidermis of a human comprising administering VEGFR1R2-FCDC1(a) to
the human.
[0016] In preferred embodiments of the invention the administration
is topical administration, subcutaneous administration, or perhaps
intramuscular, intranasal, intrathecal, intraarterial, intravenous,
transvaginal, transdermal, or transanal administration.
[0017] In a ninth aspect, the invention features a method of
enhancing wound healing in a human comprising administering a VEGF
antagonist to the human. Another preferred embodiment is a method
of enhancing wound healing in a human comprising administering
VEGFR1R2-FcDC1(a) to the human. In preferred embodiments of the
invention the administration is topical administration,
subcutaneous administration, or perhaps intramuscular, intranasal,
intrathecal, intraarterial, intravenous, transvaginal, transdermal,
or transanal administration.
BRIEF DESCRIPTION OF THE FIGURES
[0018] FIG. 1. The ability of Flt1D2.Flk1D3.Fc.DELTA.C1(a) to
inhibit HT-1080 fibrosarcoma tumor growth in vivo. Every other day
or 2 times per week treatment of SCID mice with
Flt1D2.Flk1D3.Fc.DELTA.C1(a) at 25 mg/Kg significantly decreases
the growth of subcutaneous HT-1080 fibrosarcoma tumors.
[0019] FIG. 2. The ability of Flt1D2.Flk1D3.Fc.DELTA.C1(a) to
inhibit C6 glioma tumor growth in vivo. Every other day or 2 times
a week treatment of SCID mice with Flt1D2.Flk1D3.Fc.DELTA.C1(a)
significantly decreases the growth of subcutaneous C6 glioma tumors
at doses as low as 2.5 mg/Kg.
[0020] FIG. 3 VEGF-Induced Uterine Hyperpermeability. Subcutaneous
injection of Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) at 25 mg/kg at 1 hr after PMSG
injection results in about a 50% inhibition of the increase in
uterine wet weight.
[0021] FIG. 4A-B. Assessment of Corpus Luteum Angiogenesis Using
Progesterone as a Readout. Subcutaneous injection of Flt1(1-3)-Fc
(A40) or Flt1D2.Flk1D3.Fc.DELTA.C1(a) at 25 mg/kg or 5 mg/kg at 1
hr. after PMSG injection resulted in a complete inhibition of the
progesterone induction on day 4.
[0022] FIG. 5. Gross phenotype of K14VEGF transgenic mice. Six
months after birth, the mice develop significant skin lesions on
the ears and scalp. The skin becomes red, edematous, and profoundly
scaling (parakeratosis and hyperkeratosis) to the point of
generalized desquamation.
[0023] FIG. 6A-C. Histology of ear skin from K14VEGF transgenic
mice (hematoxylin and eosin stained sections). FIG. 6A: Control,
nontransgenic wildtype mouse. FIG. 6B: K14VEGF transgenic mouse at
three months of age. FIG. 6C: K14VEGF transgenic mouse at six
months of age. Note thickening of epidermis with increased
hyperkeratosis and parakeratosis (40.times.).
[0024] FIG. 7. Rete ridge formation in relatively mature
psoriatic-like lesions in K14VEGF transgenic mice (Masson's
Trichrome staining). K14VEGF transgenic mouse at 6 months of age
has developed dramatic rete ridge structures, some of which are
fused at the base (4.times.).
[0025] FIG. 8A-B. Formation of microabscesses in relatively mature
psoriatic-like lesions in K14VEGF transgenic mice. (Hematoxylin and
eosin staining of skin sections from K14VEGF transgenic mice at 6
months of age.) FIG. 8A: Monro microabscess. FIG. 8B: Kogoj
microabscess.
[0026] FIG. 9A-P: Effect of VEGFR1R2-FcDC1(a) in an animal model of
psoriasis. A K14VEGF transgenic mouse with severe skin lesions was
injected with VEGFR1R2-FcDC1(a) (25 mg/kg) on day 0 (FIG. 9A-D),
day 3 (FIG. 9E-H), day 7 (FIG. 91-L), and day 10 (FIG. 9M-P), and
photographed after each injection.
DETAILED DESCRIPTION OF THE INVENTION
[0027] Before the present methods are described, it is to be
understood that this invention is not limited to particular
methods, and experimental conditions described, as such methods and
conditions may vary. It is also to be understood that the
terminology used herein is for the purpose of describing particular
embodiments only, and is not intended to be limiting, since the
scope of the present invention will be limited only the appended
claims.
[0028] Psoriasis is a chronic skin disease characterized by red
patches that are covered with white scales and is often accompanied
by varying degrees of discomfort. The disease is not contagious;
however, its cause and mechanism have not yet been determined.
Because of the formation of unsightly skin lesions and eruptions,
psoriasis often has a negative psychological impact on its
sufferers. Among people in Western countries, approximately 2-3% of
the total population suffers from the disease. Various
classifications have been proposed for psoriasis, but it is
generally classified into psoriasis vulgaris, pustular psoriasis,
psoriatic arthritis, guttate psoriasis, and the like. Of these,
psoriasis vulgaris is the major type and accounts for 80 to 90% of
all instances of the disease.
[0029] Psoriasis is considered to be a multicausal hereditary
disease which is often triggered by the action of various
non-genetic factors such as injury, infection, drugs, food,
climate, and stress. Furthermore, psoriasis is known to be
associated with certain histocompatibility antigens (HLA). In fact,
studies have linked certain types of psoriasis with specific HLAs.
For example, Tiilikainen et al. (1980) Br. J. Dermatol. 102:179-84,
have reported that the prevalence of histocompatibility antigen
HLA-Cw6 is 72.7% in twenty-two patients with the guttate form of
psoriasis and 45.9% in thirty-seven patients with the vulgaris form
of psoriasis. Thus, psoriasis clearly is a disease with a genetic
basis in its cause.
[0030] There are two characteristic symptoms of psoriasis including
1) an inflammatory response common to that caused by other
superficial skin diseases and 2) a tendency toward abnormal growth
of the cuticle of the skin. The inflammatory response is
characterized by vascular permeability, T-lymphocyte
hypermigration, and release of the T-helper type I (THI) cytokine
into the epidermis (Nickoloff et al. (1999) Arch Dermatol
September;135(9):1104-10). The abnormal cuticle growth is
characterized by epidermal acanthosis and rete ridge formation in
more mature psoriasis. In more advanced psoriatic lesions,
confluent parakeratosis with aberrantly differentiated
keratinocytes containing nuclei in stratum corneum and
microabcesses with neutrophils arranged in tiers within the
confluent parakeratotic cornified layer (Altman et al. (1999)
Seminars Cutaneous Med. Surg. 18:25-35) often develop. These are
the key features for the clinical diagnosis of psoriasis.
[0031] The therapeutic methods currently available to treat
psoriasis include the control of the hyperproliferation of
epidermal cells; control of the inflammatory response; promotion of
immunomodulation; and avoidance of infection by bacteria and fungi.
The following is a summary of the therapeutic methods that are
generally utilized: (1) External and internal use of adrenocortical
hormone--The external or topical use of a steroid has the immediate
effect of reducing the symptoms of psoriasis, particularly the
reduction of eruptions. However, administration of adrenocortical
hormone over long periods of time increases resistance and
tolerance buildup, so that the dose must be increased, or stronger
drugs must be used, in order to obtain an acceptable therapeutic
effect. In addition, when the psoriatic lesion occurs over a
relatively large area, it cannot be completely cured by this method
alone and, therefore, must be combined with other therapies; (2)
Photochemotherapy--This method consists of administering psoralen
in the form of an external or internal preparation and applying
longwave ultraviolet rays to the affected region. Unfortunately,
not all types of psoriasis can be treated by this method; (3)
Phototherapy (UV Irradiation)--While this mode of treatment is
often effective, over time it has the undesirable side effect of
causing accelerated aging of the skin. In addition, there is the
risk of inducing carcinogenesis; (4) External use of coal tar--Coal
tar suppresses the growth of cells so that the psoriatic lesion
diminishes over a short period of time and a relatively long
remission period may be achieved. However, occasionally, other skin
disorders can result such as stimulant dermatitis and folliculitis
(tar acne); (5) Administration of methotrexate-Methotrexate is an
antagonist against folic acid, which is active in inhibiting the
growth of cells. The use of methotrexate is effective for treating
pustular psoriasis. Unfortunately, the use of methotrexate for a
long period of time causes adverse effects such as disturbances in
liver function, suppression of myeloproliferation, and loss of
reproductive function; (6) Administration of retinoid --Retinoid is
considered to have an immunomodulation effect in that it may
control the abnormal cornification of epidermal cells and increased
leukocyte migration. The internal administration of retinoid-based
therapeutics is particularly effective for treating pustular
psoriasis and psoriatic erythroderma. However, retinoid can exhibit
adverse effects such as a decrease in the thickness of the skin and
the visible mucous membranes. Furthermore, abnormal levels of serum
lipoprotein are occasionally observed. Importantly, because
retinoid is teratogenic and likely to accumulate and remain inside
the body for a long period of time, the administration of retinoid
to people of childbearing age is avoided, thus limiting the patient
population to those who are beyond childbearing age or who are
suffering from intractable psoriasis; and (7) Cyclosporin A--an
immunosuppressant that is often used by physicians for treating
psoriasis. The major disadvantage of cyclosporin A as a treatment
for psoriasis is that it is a general immunosuppressant, thus
making patients more vulnerable to infection or other bacterial or
viral diseases.
[0032] Recent studies have shown that the growth factor VEGF is
upregulated in psoriatic lesions (Detmar et al. (1994) J Exp Med
1;180(3):1141-6). However, to date there are no data that describe
what role the overexpression of VEGF may have in either the
development of or the progression of psoriasis. It is known that
VEGF causes vascular permeability, increased microvascular density
and enhanced leukocyte rolling and adhesion (Detmar et al. (1998)
J. Invest. Dermatol. 111(1): 1-6). Increased expression of VEGF has
also been identified in chronic inflammatory dermatoses, including
bullous pemphigoid, dermatitis herpetiformis, and erythema
multiforme, all of which are characterized by hyperpermeable dermal
microvessels and pronounced papillary dermal edema (Brown et al.
(1995) J. Invest. Dermatol. 104(5):744-9).
[0033] While there are therapies available to treat psoriasis, most
of these available therapies are less than ideal due to the
severity of their side effects, the eventual development of
resistance, and/or limitations on suitable patient populations,
thus rendering clear the need for new safe and effective treatments
for psoriasis. To satisfy this need, Applicants have discovered a
new and novel method of treating psoriasis, such method utilizing a
novel protein molecule that is able to reverse psoriatic-like
lesions in a relatively short period of time with no apparent side
effects during the course of treatment.
[0034] Other features of the invention will become apparent in the
course of the following descriptions of exemplary embodiments which
are given for illustration of the invention and are not intended to
be limiting thereof.
EXAMPLES
[0035] The following example is put forth so as to provide those of
ordinary skill in the art with a complete disclosure and
description of how to make and use the methods and compositions of
the invention, and are not intended to limit the scope of what the
inventors regard as their invention. Efforts have been made to
ensure accuracy with respect to numbers used (e.g., amounts,
temperature, etc.) but some experimental errors and deviations
should be accounted for. Unless indicated otherwise, parts are
parts by weight, molecular weight is average molecular weight,
temperature is in degrees Centigrade, and pressure is at or near
atmospheric.
Example 1
Modified Flt1 Receptor Vector Construction
[0036] The rationale for constructing modified versions of the Flt1
receptor (also known as VEGFR1) was based on the observation that
the protein sequence of Flt1 was highly basic, and was therefore
likely to stick to extracellular matrix (ECM). The highly basic
nature of Flt1 probably explains why unmodified Flt1(1-3)-Fc
(described in U.S. Ser. No. 09/773,877, the specification of which
is herein specifically incorporated by reference) has poor
pharmacokinetics that make it difficult to use as a therapeutic
agent. The chemically modified form of 40 fold molar excess
acetylated Flt1(1-3)-Fc, hereinafter termed A40, exhibited a
greatly improved pharmacokinetic (PK) profile over the
non-acetylated Flt1(1-3)-Fc. Therefore, attempts were made to
engineer DNA molecules that could be used to recombinantly express
modified forms of a Flt1 receptor molecule that would possess the
improved PK profile exhibited by A40 and still maintain the ability
to bind tightly to VEGF.
[0037] It is known in the literature that the first Ig domain of
Flt1 (which has a net charge of +5 at neutral pH) is not essential
for tight binding to VEGF, so this domain was deleted. The third Ig
domain (having a net charge of +11) is not essential for binding,
but confers higher affinity for VEGF than the second Ig domain, so
instead of deleting it entirely, it was replaced with the
equivalent domains of the Flt1 receptor relatives Flk1 (also known
as VEGFR2) and Flt4 (also known as VEGFR3). These chimeric
molecules (denoted R1R2 (Flt1.D2.Flk1D3.Fc.DELTA.- C1(a) and
VEGFR1R2-Fc.DELTA.C1(a) and R1R3 (Flt1D2.VEGFR3D3-Fc.DELTA.C1(a)
and VEGFR1R3-Fc.DELTA.C1(a) respectively, wherein R1 and Flt1D2=Ig
domain 2 of Flt1 (VEGFR1); R2 and Flk1D3=Ig domain 3 of Flk1
(VEGFR2); and R3 and VEGFR3D3=Ig domain 3 of Flt4 (VEGFR3)) were
much less sticky to ECM, as judged by an in vitro ECM binding assay
as described infra, had greatly improved PK as described infra. In
addition, these molecules were able to bind VEGF tightly and block
phosphorylation of the native Flk1 receptor expressed in
endothelial cells (described in U.S. Ser. No. 09/773,877, the
specification of which is herein specifically incorporated by
reference).
[0038] (a) Construction of the expression plasmid
pFlt1D2.Flk1D3.Fc.DELTA.- C1(a). Expression plasmids
pMT21.Flt1(1-3).Fc(6519 bp) and pMT21.Flk-1(1-3).Fc (5230 bp) are
plasmids that encode ampicillin resistance and Fc-tagged versions
of Ig domains 1-3 of human Flt1 and human Flk1, respectively. These
plasmids were used to construct a DNA fragment consisting of a
fusion of Ig domain 2 of Flt1 with Ig domain 3 of Flk1, using PCR
amplification of the respective Ig domains followed by further
rounds of PCR to achieve fusion of the two domains into a single
fragment. For Ig domain 2 of Flt1, the 5' and 3' amplification
primers were as follows: 5': bsp/flt1D2 (5'-GACTAGCAG
TCCGGAGGTAGACCTTTCGTAGAGATG- -3') (SEQ ID NO:1); 3':
Flt1D2-Flk1D3.as (5'-CGGACTCAGAACCACATCTATGATTGTAT- TGGT-3') (SEQ
ID NO:2). The 5' amplification primer encodes a BspE1 restriction
enzyme site upstream of Ig domain 2 of Flt1, defined by the amino
acid sequence GRPFVEM (SEQ ID NO:3) (corresponding to amino acids
27-33 of FIG. 21A-21C of U.S. Ser. No. 09/773,877). The 3' primer
encodes the reverse complement of the 3' end of Flt1 Ig domain 2
fused directly to the 5' beginning of Flk1 Ig domain 3, with the
fusion point defined as TIID of Flt1 (corresponding to amino acids
123-126 of FIG. 21A-21C of U.S. Ser. No. 09/773,877) and continuing
into VVLS (SEQ ID NO:4)(corresponding to amino acids 127-130 of
FIG. 21A-21C of U.S. Ser. No. 09/773,877) of Flk1.
[0039] For Ig domain 3 of Flk1, the 5' and 3' amplification primers
were as follows: 5': Flt1D2-Flk1D3.s
(5'-ACAATCATAGATGTGGTTCTGAGTCCGTCTCATGG-3- ') (SEQ ID NO:5) 3':
Flk1D3/apa/srf.as (5'-GATAATGCCCGGGCCCTTTTCATGGACCCTG- ACAAATG-3')
(SEQ ID NO:6). The 5' amplification primer encodes the end of Flt1
Ig domain 2 fused directly to the beginning of Flk1 Ig domain 3, as
described above. The 3' amplification primer encodes the end of
Flk1 Ig domain 3, defined by the amino acids VRVHEK (SEQ ID
NO:7)(corresponding to amino acids 223-228 of FIG. 21A-21C of U.S.
Ser. No. 09/773,877), followed by a bridging sequence that includes
a recognition sequence for the restriction enzyme Srf1, and encodes
the amino acids GPG. The bridging sequence corresponds to amino
acids 229-231 of FIG. 21A-21C of U.S. Ser. No. 09/773,877. After a
round of PCR amplification to produce the individual domains, the
products were combined in a tube and subjected to a further round
of PCR with the primers bsp/flt1D2 and Flk1D3/apa/srf.as (described
in U.S. Ser. No. 09/773,877) to produce the fusion product. This
PCR product was subsequently digested with the restriction enzymes
BspEI and SmaI and the resulting 614 bp fragment was subcloned into
the BspEI to Srf1 restriction sites of the vector
pMT21/.DELTA.B2.Fc, to create the plasmid pMT21/Flt1D2.Flk1D3.Fc.
The nucleotide sequence of the Flt1D2-Flk1D3 gene fusion insert was
verified by standard sequence analysis. This plasmid was then
digested with the restriction enzymes EcORI and SrfI and the
resulting 702 bp fragment was transferred into the EcORI to Srf1
restriction sites of the plasmid pFlt1(1-3)B2-Fc.DELTA.C1(a) to
produce the plasmid pFlt1D2.Flk1D3.Fc.DELTA.C1(a). The complete DNA
and deduced amino acid sequences of the
Flt1D2.Flk1D3.Fc.DELTA.C1(a) chimeric molecule is set forth in FIG.
21A-21C of U.S. Ser. No. 09/773,877.
[0040] (b) Construction of the expression plasmid
pFlt1D2VEGFR3D3Fc.DELTA.- C1(a). The expression plasmid
pMT21.Flt1(1-3).Fc (6519 bp) encodes ampicillin resistance and an
Fc-tagged version of Ig domains 1-3 of human Flt1 receptor. This
plasmid was used to produce a DNA fragment containing Ig domain 2
of Flt1 by PCR. RNA from the cell line HEL921.7 was used to produce
Ig domain 3 of Flk1, using standard RT-PCR methodology. A further
round of PCR amplification was used to achieve fusion of the two Ig
domains into a single fused fragment. For Ig domain 2 of Flt1, the
5' and 3' amplification primers were as follows: 5': bsp/flt1D2
(5'-GACTAGCAGTCCGGAGGTAGA CCTTT CGTAGAGATG-3')(SEQ ID NO:8); 3':
Flt1D2.VEGFR3D3.as(TTCCTGGGCAACAG CTGGATATCTATGATTGTATTGGT) (SEQ ID
NO:9). The 5' amplification primer encodes a BspE1 restriction site
upstream of Ig domain 2 of Flt1, defined by the amino acid sequence
GRPFVEM (SEQ ID NO: 10) (corresponding to amino acids 27-33 of FIG.
22A-22C of U.S. Ser. No. 09/773,877). The 3' amplification primer
encodes the reverse complement of the end of Flt1 Ig domain 2 fused
directly to the beginning of VEGFR3 Ig domain 3, with the fusion
point defined as TIID (SEQ ID NO: 11) of Flt1 (corresponding to
amino acids 123-126 of FIG. 22A-22C of U.S. Ser. No. 09/773,877)
and continuing into IQLL (SEQ ID NO: 12) of VEGFR3 (corresponding
to amino acids 127-130 of FIG. 22A-22C of U.S. Ser. No.
09/773,877). For Ig domain 3 of VEGFR3, the 5' and 3' primers used
for RT-PCR were as follows: 5': R3D3.s
(ATCCAGCTGTTGCCCAGGAAGTCGCTGGAGCTGCTGGTA)
[0041] 3' (SEQ ID NO:13): R3D3.as
(ATTTTCATGCACAATGACCTCGGTGCTCTCCCGAAATCG- ) (SEQ ID NO:14). Both
the 5' and 3' amplification primers match the sequence of VEGFR3.
The 296 bp amplification product of this RT-PCR reaction was
isolated by standard techniques and subjected to a second round of
PCR to add suitable sequences to allow for fusion of the Flt1D2
with the Flk1D3 domains and fusion of the Flk1D3 and Fc domains via
a GPG bridge (see below). The amplification primers were as
follows: 5':Flt1D2.VEGFR3D3.s (TCATAGATATCCAGCTGTTG
CCCAGGAAGTCGCTGGAG) (SEQ ID NO:15); 3': VEGFR3D3/srf.as (GATAATGCCC
GGGCCATTTTCATGCACAATGACCTCGGT) (SEQ ID NO:16). The 5' amplification
primer encodes the 3' end of Flt1 Ig domain 2 fused directly to the
beginning (5' end) of VEGFR3 Ig domain 3, as described above. The
3' amplification primer encodes the 3' end of VEGFR3 Ig domain 3,
defined by the amino acids VIVHEN (SEQ ID NO: 17) (corresponding to
amino acids 221-226 of FIG. 22A-22C of U.S. Ser. No. 09/773,877),
followed by a bridging sequence that includes a recognition
sequence for Srf1, and encodes the amino acids GPG. The bridging
sequence corresponds to amino acids 227-229 of FIG. 22A-22C of U.S.
Ser. No. 09/773,877.
[0042] After one round (for Flt1 Ig domain 2) or two rounds (for
Flt4 Ig domain 3) of PCR to produce the individual Ig domains, the
PCR products were combined in a tube and subjected to a further
round of PCR amplification with the amplification primers
bsp/flt1D2 and VEGFR3D3/srf.as described supra, to produce the
fusion product. This PCR product was subsequently digested with the
restriction enzymes BspEI and SmaI and the resulting 625 bp
fragment was subcloned into the BspEI to SrfI restriction sites of
the vector pMT21/Flt1.DELTA.B2.Fc (described supra), to create the
plasmid pMT21/Flt1D2.VEGFR3D3.Fc. The sequence of the
Flt1D2-VEGFR3D3 gene fusion insert was verified by standard
sequence analysis. This plasmid was then digested with the
restriction enzymes EcORI and SrfI and the resulting 693 bp
fragment was subcloned into the EcORI to SrfI restriction sites of
the plasmid pFlt1(1-3).DELTA.B2-Fc.DEL- TA.C1(a) to produce the
plasmid designated pFlt1D2.VEGFR3D3.Fc.DELTA.C1(a)- . The complete
DNA deduced amino acid sequence of the
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) chimeric molecule is set forth in
FIG. 22A-22C of U.S. Ser. No. 09/773,877.
Example 2
Extracellular Matrix Binding (ECM) Binding Assay
[0043] ECM-coated plates (Becton Dickinson catalog # 35-4607) were
rehydrated with warm DME supplemented with glutamine (2 mM), 100 U
penicillin, 100 U streptomycin, and 10% BCS for at least 1 hr.
before adding samples. The plates were then incubated for 1 hr. at
room temperature with varying concentrations of
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a)
starting at 10 nM with subsequent 2-fold dilutions in PBS plus 10%
BCS. The plates were then washed 3 times with PBS plus 0.1%
Triton-X and incubated with alkaline phosphatase-conjugated
anti-human Fc antibody (Promega, 1:4000 in PBS plus 10% BCS) for 1
hr. at room temperature. The plates were then washed 4 times with
PBS 0.1% Triton-X and alkaline phosphatase buffer/pNPP solution
(Sigma) was added for color development. Plates were read at
I=405-570 nm. The results of this experiment demonstrate that the
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a)
proteins are considerably less sticky to the ECM as compared to the
Flt1(1-3)-Fc protein.
Example 3
Transient Expression of pFlt1D2.Flk1D3.Fc.DELTA.C1(a) in CHO-K1
(E1A) Cells
[0044] J A large scale (2 L) culture of E. coli DH10B cells
carrying the pFlt1D2.Flk1D3.Fc.DELTA.C1(a) plasmid described supra
in Example 1(a) was grown overnight in Terrific Broth (TB) plus 100
.mu.g/ml ampicillin. The next day, the plasmid DNA was extracted
using a QIAgen Endofree Megaprep kit following the manufacturer's
protocol. The concentration of the purified plasmid DNA was
determined by standard techniques using a UV spectrophotometer and
fluorometer. The plasmid DNA was verified by standard restriction
enzyme digestion of aliquots using the restriction enzymes EcORI
plus NotI and AseI. All restriction enzyme digest fragments
corresponded to the predicted sizes when analyzed on a 1% agarose
gel.
[0045] Forty 15 cm petri plates were seeded with CHO-K1/E1A cells
at a density of 4.times.10.sup.6 cells/plate. Plating media was
Gibco Ham's F-12 supplemented with 10% Hyclone Fetal Bovine Serum
(FBS), 100 U penicillin/100 U streptomycin and glutamine (2 mM).
The following day each plate of cells was transfected with 6 .mu.g
of the pFlt1D2.Flk1D3.Fc.DELTA.C1(a) plasmid DNA using Gibco
Optimem and Gibco Lipofectamine in 12 ml volume, following the
manufacturer's protocol. Four hours after adding the transfection
mix to the cells, 12 ml/plate of Optimem supplemented with 10% FBS
was added. Plates were incubated at 37.degree. C. in a 5% CO.sub.2
incubator overnight. The following day the media was removed from
each plate and 25 ml expression media (Gibco CHO-S-SFM II
supplemented with glutamine (2 mM) and 1 mM sodium butyrate) was
added. The plates were incubated at 37.degree. C. for 3 days. After
3 days of incubation, the media was aspirated from each plate and
centrifuged at 400 rpm in a swinging bucket rotor to pellet cells.
The supernatant was decanted into sterile 1 L bottles and
purification of the expressed protein was performed as described of
U.S. Ser. No. 09/773,877.
Example 4
Construction pVEGFR1R2-Fc.DELTA.C1(a) Expression Vector
[0046] The pVEGFR1R2.Fc.DELTA.C1(a) expression plasmid was
constructed by insertion of DNA encoding amino acids SDT
(corresponding to amino acids 27-29 of FIG. 24A-24C of U.S. Ser.
No. 09/773,877) between Flt1d2-Flk1d3-Fc.DELTA.C1(a) amino acids 26
and 27 of FIG. 21A-21C of U.S. Ser. No. 09/773,877 (GG) and removal
of DNA encoding amino acids GPG corresponding to amino acids
229-231. The SDT amino acid sequence is native to the Flt1 receptor
and was added back in to decrease the likelihood of heterogeneous
N-terminal processing. The GPG (bridging sequence) was removed so
that the Flt1 and Flk1 Ig domains were fused directly to one
another. The complete DNA and deduced amino acid sequences of the
pVEGFR1R2.Fc.DELTA.C1(a) chimeric molecule is set forth in FIG.
24A-24C of U.S. Ser. No. 09/773,877.
Example 5
Cell Culture Process Used to Produce Modified Flt1 Receptors
[0047] (a) Cell Culture Process Used to Produce
Flt1D2.Flk1D3.Fc.DELTA.C1(- a). The process for production of
Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein using the expression plasmid
pFlt1D2.Flk1D3.Fc.DELTA.C1(a) described in Example 1 of U.S. Ser.
No. 09/773,877 involves suspension culture of recombinant Chinese
hamster ovary (CHO K1/E1A) cells which constitutively express the
protein product. The cells are grown in bioreactors and the protein
product is isolated and purified by affinity and size exclusion
chromatography. The process is provided in greater detail
below.
[0048] Cell Expansion. Two confluent T-225 cm.sup.2 flasks
containing the Flt1D2.Flk1D3.Fc.DELTA.C1(a) expressing cell line
were expanded by passaging cells into eight T-225 cm.sup.2 flasks
in medium (GMEM+10% serum, GIBCO) and incubated at 37.degree. C.
and 5% CO.sub.2. When the flasks approached confluence
(approximately 3 to 4 days) the cells were detached using trypsin.
Fresh medium was added to protect the cells from further exposure
to the trypsin. The cells were centrifuged and resuspended in fresh
medium then transferred to eight 850 cm.sup.2 roller bottles and
incubated at 37.degree. C. and 5% CO.sub.2 until confluent.
[0049] Suspension Culture in Bioreactors. Cells grown in roller
bottles were trypsinized to detach them from the surface and washed
with suspension culture medium. The cells are aseptically
transferred to a 5 L bioreactor (New Brunswick Celligen Plus) where
the cells are grown in 3.5 L of suspension culture. The suspension
culture medium was a glutamine-free low glucose modification of
IS-CHO (Irvine Scientific) to which 5% fetal bovine serum
(Hyclone), GS supplement (Life Technologies) and 25 .mu.M
methionine sulfoximine (Sigma) was added. The pH was controlled at
7.2 by addition of carbon dioxide to the inlet gas or by addition
of a liquid solution of sodium carbonate to the bioreactor.
Dissolved oxygen level was maintained at 30% of saturation by
addition of oxygen or nitrogen to the inlet gas and temperature
controlled at 37.degree. C. When a density of 4.times.10.sup.6
cells/mL was reached the cells were transferred to a 40 L
bioreactor containing the same medium and setpoints for controlling
the bioreactor. The temperature setpoint was reduced to 34.degree.
C. to slow cell growth and increase the relative rate of protein
expression.
[0050] (b) Cell Culture Process Used to Produce
Flt1D2.VEGFR3D3.Fc.DELTA.C- 1(a). The same methodologies as
described supra for Flt1D2.Flk1D3.Fc.DELTA.C1(a) were used to
produce Flt1D2.VEGFR3D3.Fc.DELT- A.C1(a).
Example 6
Harvest and Purification of Modified Flt1 Receptors
[0051] (a) Harvest and Purification of
Flt1D2.Flk1D3.Fc.DELTA.C1(a). The product protein was aseptically
harvested from the bioreactor while retaining cells using Millipore
Prostak tangential-flow filtration modules and a low-shear
mechanical pump (Fristam). Fresh medium was added to the bioreactor
to replace that removed during the harvest filtration.
Approximately 40 L of harvest filtrate was then loaded onto a 400
mL column containing Protein A Sepharose resin (Amersham
Pharmacia). After loading the resin was washed with buffer
containing 10 mM sodium phosphate, 500 mM sodium chloride, pH 7.2
to remove any unbound contaminating proteins.
Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein was eluted with a pH 3.0
citrate buffer. The eluted protein was neutralized by addition of
Tris base and frozen at -20.degree. C.
[0052] Several frozen lots of Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein
from the Protein A step above were thawed, pooled and concentrated
using a Millipore 30 kD nominal molecular weight cutoff (NMWCO)
tangential flow filtration membrane. The protein was transferred to
a stirred cell concentrator (Millipore) and further concentrated to
30 mg/mL using a 30 kD NMWCO membrane. The concentrated protein was
loaded onto a size exclusion column packed with Superdex 200 resin
(Amersham Pharmacia) that was equilibrated with phosphate buffered
saline plus 5% glycerol. The same buffer was used to run the
column. The fractions corresponding to Flt1D2.Flk1D3.Fc.DELTA.C1(a)
dimer were pooled, sterile filtered through a 0.22 micron filter,
aliquoted and frozen.
[0053] (b) Harvest and Purification of
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). The same methodologies as described
supra for Flt1D2.Flk1D3.Fc.DELTA.C1(a) were used to harvest and
purify Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
Example 7
Phosphorylation Assay for Transiently Expressed VEGFR2
[0054] Primary human umbilical vein endothelial cells (HUVECs),
passage 4-6, were starved for 2 hrs in serum-free DME high glucose
media. Samples containing 40 ng/ml (1 nM) human VEGF165, which is a
ligand for the VEGF receptors Flt1, Flk1 and Flt4(VEGFR3) were
prepared and were preincubated for 1 hr. at room temperature with
varying amounts of the modified Flt1 receptors Flt1 (1-3)-Fc, Flt1
(1-3)-Fc (A40), Flt1D2Flk1D3.Fc.DELTA.C1(a) and
Flt1D2VEGFR3D3.Fc.DELTA.C1(a) in serum-free DME-high glucose media
containing 0.1% BSA. Cells were challenged for 5 minutes with the
samples prepared above +VEGF165, followed by whole cell lysis using
complete lysis buffer. Cell lysates were immunoprecipitated with an
antibody directed against the C-terminus of VEGFR2 receptor. The
immunoprecipitated lysates were loaded onto 4-12% SDS-PAGE Novex
gel and then transferred to PVDF membrane using standard transfer
methodologies. Detection of phosphorylated VEGFR2 was done by
immunoblotting with the anti-phospho Tyrosine mAb called 4G10 (UBI)
and developed using ECL-reagent (Amersham). The results of this
experiment reveal that detection by Western blot of tyrosine
phosphorylated VEGFR2(Flk1) by VEGF165 ligand stimulation shows
that cell-surface receptors are phosphorylated to varying levels
depending on which modified Flt1 receptor is used during the
preincubations with VEGF. At a 1.5 molar excess of either
Flt1(1-3)-Fc, Flt1(1-3)-Fc (A40) or transient
Flt1D2Flk1D3.Fc.DELTA.C1(a) there is complete blockage of receptor
stimulation by these three modified Flt1 receptors as compared to
control media challenge. In contrast, transient
Flt1D2VEGFR3D3.Fc.DELTA.C1(a) does not show significant blockage at
this molar excess, as compared with VEGF positive control
challenge. Similarly, the modified Flt receptors are in a 3-fold
molar excess to VEGF165 ligand. Where the modified Flt1 receptors
are in a 6-fold molar excess to VEGF165 ligand, transient
Flt1D2VEGFR3D3.Fc.DELTA.C1(a) can now be shown to be partially
blocking VEGF165-induced stimulation of cell-surface receptors.
Detection by Western blot of tyrosine phosphorylated VEGFR2(Flk1)
by VEGF165 ligand stimulation shows that cell-surface receptors are
not phosphorylated by challenge samples which have VEGF165
preincubated with 1 and 2 fold molar excess or 3 and 4 fold molar
excess of either transient Flt1D2Flk1D3.Fc.DELTA.C1(a), stable
Flt1D2Flk1D3.Fc.DELTA.C1(a), or transient VEGFR1R2-Fc.DELTA.C1(a).
At all modified Flt1 receptor concentrations tested there is
complete binding of VEGF 165 ligand during the preincubation,
resulting in no detectable stimulation of cell-surface receptors by
unbound VEGF 165 as compared to control media challenge.
Example 8
Cell Proliferation Bioassay
[0055] The test cell population is MG87 cells that have been stably
transfected with a expression plasmid that contains a DNA insert
encoding the VEGFR2(Flk1) extracellular domain fused to the TrkB
intracellular kinase domain, thus producing a chimeric molecule.
The reason the TrkB intracellular kinase domain was used rather
than the native VEGFR2(Flk1) intracellular kinase domain is that
the intracellular kinase domain of VEGFR2(Flk1) does not cause a
strong proliferative response when stimulated by VEGF165 in these
cells. It is known that MG87 cells containing full length TrkB
receptor give a robust proliferative response when stimulated with
BDNF, so the TrkB intracellular kinase domain was engineered to
replace the intracellular kinase domain of VEGFR2(Flk1) to take
advantage of this proliferative response capability.
[0056] 5.times.10.sup.3 cells/well were plated in a 96 well plate
and allowed to settle for 2 hrs at 37.degree. C. The following
modified Flt receptors Flt1(1-3)-Fc, Flt1D2.Flk1D3.Fc.DELTA.C1(a)
and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a), plus an irrelevant receptor
termed Tie2-Fc as a negative control, were titrated from 40 nM to
20 .mu.M and incubated on the cells for 1 hr at 37.degree. C. Human
recombinant VEGF165 in defined media was then added to all the
wells at a concentration of 1.56 nM. The plates were incubated for
72 hrs at 37.degree. C. and then MTS (Owen's reagent, Promega)
added and the plates were incubated for an additional for 4 hrs.
Finally, the plates were read on a spectrophotometer at 450/570 nm.
The results show that control receptor Tie2-Fc does not block
VEGF165-induced cell proliferation at any concentration whereas
Flt1D2.Flk1D3.Fc.DELTA.C1(a) blocks 1.56 nM VEGF165 with a half
maximal dose of 0.8 nM. Flt1(1-3)-Fc and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) are less effective in blocking VEGF
165 in this assay with a half maximal dose of 2 nM. VEGF165 alone
gives a reading of 1.2 absorbance units and the background is 0.38
absorbance units.
Example 9
Binding Stoichiometry of Modified Flt Receptors to VEGF165
[0057] (a) BIAcore Analysis. The stoichiometry of
Flt1D2Flk1D3.Fc.DELTA.C1- (a) and VEGFR1R2-Fc.DELTA.C1 (a)
interaction with human VEGF165 was determined by measuring either
the level of VEGF saturation binding to the
Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a) surfaces or
measuring concentration of VEGF165 needed to completely prevent
binding of Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a)
to VEGF BIAcore chip surface.
[0058] Modified Flt receptors Flt1D2Flk1D3.Fc.DELTA.C1(a) and
VEGFR1R2-Fc.DELTA.C1(a), were captured with an anti-Fc specific
antibody that was first immobilized on a Biacore chip (BIACORE)
using amine-coupling chemistry. A blank antibody surface was used
as a negative control. VEGF 165 was injected at a concentration of
1 nM, 10 nM, and 50 nM over the Flt1D2Flk1D3.Fc.DELTA.C1(a) and
VEGFR1R2-Fc.DELTA.C1(a) surfaces at 10 .mu.l/min for one hour. A
real-time binding signal was recorded and saturation binding was
achieved at the end of each injection. Binding stoichiometry was
calculated as a molar ratio of bound VEGF165 to the immobilized
Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a), using the
conversion factor of 1000 RU equivalent to 1 ng/ml. The results
indicated binding stoichiometry of one VEGF165 dimeric molecule per
one Flt1D2Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a)
molecule.
[0059] In solution, Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a) at a concentration of 1 nM (estimated to be
1000 times higher than the KD of the Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a)/VEGF165 interaction) were mixed with varied
concentrations of VEGF165. After one hour incubation,
concentrations of the free Flt1D2Flk1D3.Fc.DELTA.C1(a) in solution
were measured as a binding signal to an amine-coupled VEGF165
surface. A calibration curve was used to convert the
Flt1D2Flk1D3.Fc.DELTA.C1(a) BIAcore binding signal to its molar
concentration. The data showed that the addition of 1 nM VEGF165
into the Flt1D2Flk1D3.Fc.DELTA.C1(a) solution completely blocked
Flt1D2Flk1D3.Fc.DELTA.C1(a) binding to the VEGF165 surface. This
result suggested the binding stoichiometry of one VEGF165 molecule
per one Flt1D2Flk1D3.Fc.DELTA.C1(a) molecule. When the
concentration of Flt1D2Flk1D3.Fc.DELTA.C1(a) was plotted as a
function of added concentration of VEGF165, the slope of the linear
portion was -1.06 for Flt1D2Flk1D3.Fc.DELTA.C1(a) and -1,07 for
VEGFR1R2-Fc.DELTA.C1(a). The magnitude of the slope, very close to
negative one, was indicative that one molecule of VEGF165 bound to
one molecule of either Flt1D2Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a).
[0060] (b) Size Exclusion Chromatography.
Flt1D2Flk1D3.Fc.DELTA.C1(a) was mixed with a 3-fold excess of
VEGF165 and the receptor-ligand complex was purified using a
Pharmacia Superose 6 size exclusion chromatography column. The
receptor-ligand complex was then incubated in a buffer containing
6M guanidine hydrochloride in order to dissociate it into its
component proteins. Flt1D2Flk1D3.Fc.DELTA.C1(a) was separated from
VEGF165 using Superose 6 size exclusion chromatography column run
in 6M guanidium chloride. In order to determine complex
stoichiometry, several injections of Flt1D2Flk1D3.Fc.DELTA.C1(a)
and VEGF165 were made and peak height or peak integrated intensity
was plotted as a function of the concentration of injected protein.
The calibration was done under condition identical to one used in
separating components of Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF complex.
Quantification of the Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF complex
composition was based on the calibration curves. The results of
this experiment shows the ratio of VEGF165 to
Flt1D2Flk1D3.Fc.DELTA.C1(a) in a complex to be 1:1.
Example 10
Determination of the Binding Stoichiometry of
Flt1D2Flk1D3.Fc.DELTA.C1(a)/- VEGF165 Complex by Size Exclusion
Chromatography
[0061] Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 Complex Preparation.
VEGF165 (concentration=3.61 mg/ml) was mixed with CHO cell
transiently expressed Flt1D2.Flk1D3.Fc.DELTA.C1(a)
(concentration=0.9 mg/ml) in molar ratio of 3:1
(VEGF165:Flt1D2.Flk1D3.Fc.DELTA.C1(a)) and incubated overnight at
4.degree. C.
[0062] (a) Size Exclusion Chromatography (SEC) under native
conditions. To separate the complex from excess of unbound VEGF
165, 50 .mu.l of the complex was loaded on a Pharmacia Superose 12
PC 3.2/30 which was equilibrated in PBS buffer. The sample was
eluted with the same buffer at flow rate 40 .mu.l/min. at room
temperature. Peak #1 represents the complex and peak #2 represents
unbound VEGF 165. Fractions eluted between 1.1 and 1.2 ml were
combined and guanidinium hydrochloride (GuHCl) was added to a final
concentration 4.5M to dissociate the complex.
[0063] (b) Size Exclusion Chromatography (SEC) under dissociative
conditions. To separate the components of the receptor-ligand
complex and to determine their molar ratio, 50 .mu.l of dissociated
complex as described supra was loaded onto a Superose 12 PC 3.2/30
equilibrated in 6M GuHCl and eluted with the same solution at a
flow rate 40 .mu.l/min. at room temperature. The results are shown
in FIG. 32 of U.S. Ser. No. 09/773,877, with peak #1
Flt1D2Flk1D3.Fc.DELTA.C1(a) and peak #2 VEGF165.
[0064] (c) Calculation of Flt1D2Flk1D3.Fc.DELTA.C1(a):VEGF165
Complex Stoichiometry. The stoichiometry of the receptor-ligand
complex was determined from the peak area or the peak height of the
components. Concentrations of VEGF165 and
Flt1D2Flk1D3.Fc.DELTA.C1(a) corresponding to the peak height or
peak area, respectively, were obtained from the standard curves for
VEGF165 and Flt1D2Flk1D3.Fc.DELTA.C1(a). To obtain a standard
curve, four different concentrations (0.04 mg/ml-0.3 mg/ml) of
either component were injected onto a Pharmacia Superose 12 PC
3.2/30 column equilibrated in 6M guanidinium chloride and eluted
with the same solution at flow rate 40 .mu.l/min. at room
temperature. The standard curve was obtained by plotting peak area
or peak height vs protein concentration. The molar ratio of
VEGF165:Flt1D2Flk1D3.Fc.DELTA.C1(a) determined from the peak area
of the components was 1.16. The molar ratio of
VEGF165:Flt1D2Flk1D3.Fc.DELTA.C1(a) determined from the peak height
of the components was 1.10.
Example 11
Determination of the Stoichiometry of the
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF- 165 Complex by Size Exclusion
Chromatography with On-Line Light Scattering
[0065] Complex preparation. VEGF165 was mixed with CHO transiently
expressed Flt1D2.Flk1D3.Fc.DELTA.C1(a) protein in molar ratio of
3:1 (VEGF165:Flt1D2Flk1D3.Fc.DELTA.C1(a)) and incubated overnight
at 4.degree. C.
[0066] (a) Size Exclusion Chromatography (SEC) with On-Line Light
Scattering. Size exclusion chromatography column with a MiniDawn
on-line light scattering detector (Wyatt Technology, Santa Barbara,
Calif.) and refractive index (R1) detectors (Shimadzu, Kyoto,
Japan) was used to determine the molecular weight (MW) of the
receptor-ligand complex. Samples were injected onto a Superose 12
HR 10/30 column (Pharmacia) equilibrated in PBS buffer and eluted
with the same buffer at flow rate 0.5 ml/min. at room temperature.
The elution profile showed two peaks. Peak #1 represents the
receptor-ligand complex and peak #2 represents the unbound VEGF165.
MW was calculated from LS and R1 signals. The same procedure was
used to determine MW of the individual components of the
receptor-ligand complex. The results of these determinations are as
follows: MW of the Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 complex at
the peak position is 157 300, the MW of VEGF165 at the peak
position is 44 390 and the MW of R1R2 at the peak is 113 300.
[0067] These data indicated that the stoichiometry of the
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF complex is 1:1 as its corresponds
to the sum of molecular weights for Flt1D2Flk1D3.Fc.DELTA.C1(a) and
VEGF165. Importantly, this method conclusively proved that the
Flt1D2Flk1D3.Fc.DELTA.C1(a)/VEGF165 complex was indeed composed of
only one molecule of VEGF165 ligand and only one molecule of the
Flt1D2Flk1D3.Fc.DELTA.C1(a).
Example 12
Peptide Mapping of Flt1D2.Flk1D3.Fc.DELTA.C1(a)
[0068] The disulfide structures and glycosylation sites in
Flt1D2.Flk1D3.Fc.DELTA.C1(a) were determined by a peptide mapping
method. In this method, the protein was first cleaved with trypsin.
Tryptic fragments were analyzed and identified by HPLC coupled with
mass spectrometry, in addition to an N-terminal sequencing
technique. Reduction of the tryptic digest was employed to help
identify disulfide-bond-containing fragments. Treatment of the
tryptic digest with PNGase F (Glyko, Novato, Calif.) was employed
to help identify fragments with N-linked glycosylation sites. There
were a total of ten cysteines in Flt1D2.Flk1D3.Fc.DELTA.C1(a); six
of them belong to the Fc region. Cys27 has been confirmed to be
disulfide bonded to Cys76. Cys121 is confirmed to be disulfide
bonded to Cys 182. The first two cysteines in the Fc region (Cys211
and Cys214) form an intermolecular disulfide bond with the same two
cysteines in another Fc chain. However, because these two cysteines
can not be separated enzymatically from each other, it can not be
determined whether disulfide bonding is occurring between same
cysteines (Cys211 to Cys211, for example) or between Cys211 and
Cys214. Cys216 is confirmed to be disulfide bonded to Cys306. Cys
352 is confirmed to be disulfide bonded to Cys410.
[0069] There are five possible N-linked glycosylation sites in
Flt1D2.Flk1D3.Fc.DELTA.C1(a). All five of them are found to be
glycosylated to varying degrees. Complete glycosylation was
observed at Asn33 (amino acid sequence NIT), Asn193 (amino acid
sequence NST), and Asn282 (amino acid sequence NST). In addition,
partial glycosylation is observed on Asn65 and Asn120.
Example 13
Pharmacokinetic Analysis of Modified Flt Receptors
[0070] (a) Pharmacokinetic analysis of Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1(a). Balb/c
mice (25-30 g) were injected subcutaneously with 4 mg/kg of
Flt1(1-3)-Fc (A40), CHO transiently expressed
Flt1D2.Flk1D3.Fc.DELTA.C1(a), CHO stably expressed
Flt1D2.Flk1D3.Fc.DELTA.C1(a), and CHO transiently expressed
VEGFR1R2-Fc.DELTA.C1(a). The mice were tail bled at 1, 2, 4, 6, 24
hrs, 2 days, 3 days and 6 days after injection. The sera were
assayed in an ELISA designed to detect Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) or VEGFR1R2-Fc.DELTA.C1(a). The ELISA
involves coating an ELISA plate with VEGF165, binding the detect
Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) or
VEGFR1R2-Fc.DELTA.C1(a) and reporting with an anti-Fc antibody
linked to horse radish peroxidase. The T.sub.max for Flt1(1-3)-Fc
(A40) was at 6 hrs while the T.sub.max for the transient and stable
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and the transient
VEGFR1R2-Fc.DELTA.C1(a) was 24 hrs. The C.sub.max for Flt1(1-3)-Fc
(A40) was 81 g/ml. For both transients
(Flt1D2.Flk1D3.Fc.DELTA.C1(a) and VEGFR1R2-Fc.DELTA.C1 (a)) the
C.sub.max was 18 .mu.g/ml and the C.sub.max for the stable
VEGFR1R2-Fc.DELTA.C1(a) was 30 .mu.g/ml.
[0071] (b) Pharmacokinetic analysis of Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
Balb/c mice (25-30 g) were injected subcutaneously with 4 mg/kg of
Flt1(1-3)-Fc (A40), CHO transiently expressed
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and CHO transiently expressed
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). The mice were tail bled at 1, 2, 5,
6, 7, 8, 12, 15 and 20 days after injection. The sera were assayed
in an ELISA designed to detect Flt1(1-3)-Fc,
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a).
The ELISA involves coating an ELISA plate with 165, binding the
Flt1(1-3)-Fc, Flt1D2.Flk1D3.Fc.DELTA.C1(a) or
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a) and reporting with an anti-Fc
antibody linked to horse radish peroxidase. Flt1(1-3)-Fc (A40)
could no longer be detected in the serum after day 5 whereas,
Flt1D2.Flk1D3.Fc.DELTA.C1(a) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a)
were detectable for 15 days or more.
Example 14
Evaluation of the Ability of Flt1D2.Flk1D3.Fc.DELTA.C1(a) to
Inhibit Tumor Growth In Vivo
[0072] To evaluate the ability of Flt1D2.Flk1D3.Fc.DELTA.C1(a) to
inhibit tumor growth in vivo a model in which tumor cell
suspensions are implanted subcutaneously on the right flank of male
severe combined immunodeficiency (SCID) mice was employed. Two cell
lines, the human HT-1080 fibrosarcoma cell line (ATCC accession no.
CCL-121) and the rat C6 glioma cell line (ATCC accession no.
CCL-107), each of which exhibit distinctly different morphologies
and growth characteristics, were used in the assay. The first dose
of Flt1D2.Flk1D3.Fc.DELTA.C1(a) (at 25 mg/Kg or as indicated in
FIGS. 1-2) was given on the day of tumor implantation. Animals
subsequently received subcutaneous injections of Flt1(1-3)-Fc
(A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) or vehicle either every other
day (EOD) or two times per week (2.times./wk) for a period of 2
weeks. After 2 weeks, animals were perfused with fixative, tumors
were removed and samples were blinded. Tumor volume was determined
by measuring the length and width of visible subcutaneous tumors.
Both of Flt1(1-3)-Fc (A40) and Flt1D2.Flk1D3.Fc.DELTA.C1(a)
significantly reduced the growth of tumors formed by HT-1080 and C6
cells.
Example 15
The Effect of VEGF165 and Modified Flt Receptors in Female
Reproductive System
[0073] The stereotypic pattern of vascular remodeling which occur
in the uterus and ovary over the course of the reproductive cycle
has been well characterized, making these tissues particularly well
suited to the study of mechanisms which regulate angiogenesis,
vascular remodeling and vascular regression. Indeed, in situ
hybridization studies in the reproductive tissues provided the
first clear evidence that VEGF acts as a mediator of physiological
angiogenesis in mature rodents, as well as humans and non-human
primates. As cyclic angiogenesis and vascular remodeling are
prominent features of the normal ovary and uterus, it is not
surprising that abnormal blood vessel growth and/or vascular
dysfunction have been found to characterize many pathological
conditions which affect these organs. Furthermore, these pathogenic
vascular abnormalities are thought to be caused or perpetuated by
the dysregulated expression of one or more angiogenic or
anti-angiogenic factors, most prominently VEGF.
[0074] Abnormal angiogenesis is characteristic of polycystic ovary
disease, endometriosis and endometrial carcinoma, and in each case
VEGF is over expressed in the affected tissue. Overexpression of
VEGF is also thought to play a pathogenic role in the establishment
of systemic vascular hyperpermeability in ovarian hyperstimulation
syndrome. In addition, VEGF has been implicated as the permeability
factor responsible for the production of ascites associated with
ovarian carcinoma and other tumors. Agents which effectively
neutralize the biological actions of VEGF can reasonably be
anticipated to be of therapeutic benefit in the above and related
conditions.
[0075] Angiogenesis and vascular remodeling are also hallmarks of
blastocyst implantation and placental development. VEGF is strongly
expressed both in the maternal decidua and in embryonic
trophoblasts, where it is thought to first stimulate expansion and
hyperpermeability of the uterine vasculature during the
peri-implantation period and subsequently mediate formation of both
the maternal and embryonic components of the placental vasculature.
VEGF is also required for luteal angiogenesis and associated
progesterone secretion necessary to prepare the uterus for
implantation. Thus, agents which inhibit the biological actions of
VEGF may prove to be useful as contraceptive agents (by preventing
implantation), or as an abortifacients in the early stages of
gestation. The latter application might find particular use as a
non-surgical intervention for the termination of ectopic
pregnancies.
[0076] While the expression of VEGF receptors is largely confined
to the vascular endothelium in normal reproductive tissues, Flt1 is
also expressed by trophoblasts in the placenta in both humans and
animals where it has been proposed to play a role in trophoblast
invasion. Interestingly, both Flt1 and KDR (Flk1) are expressed by
choriocarcinoma cell line BeWo, and VEGF has been shown to promote
DNA synthesis and tyrosine phosphorylation of MAP kinase in these
cells. Furthermore, primary and metastatic ovarian carcinomas not
only to express high levels of VEGF, but--in addition to the
vascular endothelium--the tumor cells themselves express KDR and/or
Flt1. These findings suggest that VEGF may not only be critically
involved in the generation and maintenance of tumor vasculature,
but that at least in some tumors of reproductive origin VEGF may
subserve an autocrine role, directly supporting the survival and
proliferation of the tumor cells. Thus agents which block the
actions of VEGF may have particularly beneficial applications to
the treatment of tumors of reproductive origin.
[0077] Assessment of VEGF-Induced Uterine Hyperpermeability.
Pregnant mare's serum gonadotrophin (PMSG) was injected
subcutaneously (5 IU) to induce ovulation in prepubertal female
rats. This results in a surge of estradiol after 2 days which in
turn causes an induction of VEGF in the uterus. It is reported that
this induction results in hyperpermeability of the uterus and an
increase in uterine wet weight 6 hrs. later and, therefore, could
potentially be blocked by the modified Flt receptors Flt1(1-3)-Fc
(A40), Flt1D2.Flk1D3.Fc.DELTA.C1(a) and
Flt1D2.VEGFR3D3.Fc.DELTA.C1(a). In this in vivo model, the normal
weight of the rat uterus is about 50 mg and this can be induced to
300-350 mg by PMSG. Desiccation of the tissue reveals that this is
all water weight. Subcutaneous injection of Flt1(1-3)-Fc (A40),
Flt1D2.Flk1D3.Fc.DELTA.C1(a- ) and Flt1D2.VEGFR3D3.Fc.DELTA.C1(a)
at 25 mg/kg at 1 hr. after PMSG injection results in about a 50%
inhibition of the increase in uterine wet weight. Increasing the
dose of modified Flt receptor does not further reduce the increase
in wet weight suggesting that there is a VEGF-independent component
to this model. The results of this experiment are shown in FIG.
3.
[0078] Assessment of corpus luteum angiogenesis using progesterone
as a readout. Pregnant mare's serum gonadotrophin (PMSG) is
injected subcutaneously (5 IU) to induce ovulation in prepubertal
female rats. This results in a fully functioning corpus luteum
containing a dense network of blood vessels after 4 days that
allows for the secretion of progesterone into the blood stream in
order to prepare the uterus for implantation. The induction of
angiogenesis in the corpus luteum requires VEGF; therefore,
blocking VEGF would result in a lack of new blood vessels and thus
a lack of progesterone secreted into the blood stream. In this in
vivo model, resting levels of progesterone are about 5 ng/ml and
this can be induced to a level of 25-40 ng/ml after PMSG.
Subcutaneous injection of Flt1(1-3)-Fc (A40) or
Flt1D2.Flk1D3.Fc.DELTA.C1- (a) at 25 mg/kg or 5 mg/kg at 1 hr.
after PMSG injection results in a complete inhibition of the
progesterone induction on day 4. The results of this experiment are
shown in FIGS. 4A-B.
Example 16
Pharmacokinetic Analysis of Flt1(1-3)-Fc (A40) and Pegylated
Flt1(1-3)-Fc
[0079] Flt1(1-3)-Fc was PEGylated with either 10 kD PEG or 20 kD
PEG and tested in balb/c mice for their pharmacokinetic profile.
Both PEGylated forms of Flt1(1-3)-Fc were found to have much better
PK profiles than Flt1(1-3)-Fc (A40), with the T.sub.max occurring
at 24 hrs. for the PEGylated molecules as opposed to 6 hrs. for
Flt1(1-3)-Fc (A40).
Example 17
VEGF165 ELISA to Test Affinity of Modified Flt1 Receptor
Variants
[0080] 10 .mu.M of VEGF 165 was incubated overnight at room
temperature with modified Flt1 receptor variants ranging from 160
.mu.M to 0.1 .mu.M. The modified Flt1 receptor variants used in
this experiment were Flt1(1-3)-Fc, Flt1(1-3)-Fc (A40), transiently
expressed Flt1D2Flk1D3.Fc.DELTA.C1(a), transiently expressed
Flt1D2VEFGFR3D3-Fc.DELTA.C1(a), Flt1-(1-3NAS)-Fc,
Flt1(1-3.sub.R->C)-F- c and Tie2-Fc. Flt1(1-3 NAS)-Fc is a
modified version of Flt1(1-3)-Fc in which the highly basic amino
acid sequence KNKRASVRRR is replaced by NASVNGSR, resulting in the
incorporation of two new glycosylation sites and a net reduction of
five positive charges, both with the purpose of reducing the
unfavorable effects of this sequence on PK.
Flt1(1-3.sub.R->C)-Fc is a modification in which a single
arginine (R) residue within the same basic amino acid sequence is
changed to a cysteine (C) KNKCASVRRR (SEQ ID NO:18) to allow for
pegylation at that residue, which could then shield the basic
region from exerting its unfavorable effects on PK. After
incubation the solution was transferred to a plate containing a
capture antibody for VEGF165 (R&D). The amount of free VEGF165
was then determined using an antibody to report free VEGF165. This
showed that the modified Flt1 receptor variant with the highest
affinity for VEGF165 (determined as the lowest amount of free
VEGF165) was Flt1D2Flk1D3.Fc.DELTA.C1(a), followed by Flt1(1-3)-Fc
and Flt1(1-3)-Fc (A40) and then by Flt1(1-3.sub.R->C)-Fc,
Flt1(1-3.sub.NAS)-Fc and Flt1D2VEFGFR3D3-Fc.DELTA.C1(a). Tie2Fc has
no affinity for VEGF165.
Example 18
The Effects of VEGFR1R2-FcDC1(a) in a Novel Animal Model of
Psoriasis
[0081] K14VEGF Transgenic mice. A Keratin-14 (K14)-based expression
vector and a mouse cDNA encoding VEGF164 was used to generate
K14VEGF transgenic mice by an approach identical to that used for
generating K14-Ang1 mice (Suri et al. (1998) Science
16;282(5388):468-71). The K14 promoter directs expression of VEGF
to the basal layer of the epidermis, including cells lining the
hair. The K14VEGF transgenic homozygous mice were used throughout
the studies described herein.
[0082] Tissue processing and immunostaining. For
immunohistochemistry, 10 .mu.m cryo-sections of ear skin obtained
from both wild-type and K14VEGF transgenic mice were stained with
anti-mouse platelet-endothelial cell adhesion molecule-1 (PECAM-1,
CD31, PharMingen, San Diego, Calif.), anti-mouse CD4 (BD
PharMingen, San Diego, Calif.), CD8 (BD PharMingen, San Diego,
Calif.), anti-mouse F4/80 (Serotec, Oxford, England), or anti-mouse
VEGF (R&D systems, Minneapolis, Minn.). For immunostaining with
PECAM-1 and VEGF, tissue sections were pre-fixed in 4%
paraformaldehyde before staining according to standard procedure
known in the art. For immunostaining with CD4, CD8, or F4/80
antibody, acetone-fixed tissue sections were used that were
prepared by standard techniques familiar in the art.
[0083] Histology. Hematoxolin and eosin (H&E) staining were
performed according to standard protocols familiar to the skilled
artisan.
[0084] VEGFR1R2-FcDC1(a) injection. The K14VEGF homozygous
transgenic mice were treated with VEGFR1R2-FcDC1(a) by subcutaneous
injection into the neck skin. The mice were treated with either 25
mg/kg VEGFR1R2-FcDC1(a) or 12.5 mg/kg human Fc as a control, using
an injection schedule of every three days for 10 days resulting in
a total of four injections per animal. Photographs of the mice were
taken immediately before each injection. Mouse ear tissue was
harvested on day 12 for subsequent histological analyses.
[0085] Phenotype of K14VEGF transgenic mice. As previously
reported, the K14VEGF transgenic mice are fertile and overtly
healthy (Suri et al. (1998) supra; Detmar et al. (1998) supra).
However, the ear skin of the K14VEGF transgenic mice is visibly
redder than that of their wild-type FVB littermates. Focal lesions
which appeared similar to psoriatic lesions started to develop on
the ear skin and, to a lesser extent, on the dorsal and lateral
skin of young K14VEGF transgenic mice. The condition worsened with
age. Massive skin lesions were observed on the ears of these
transgenic mice by age 5 months or older. Lesions were accompanied
by bloody, flaky skin, and hair loss. FIG. 5 is a photograph of the
mice exhibiting such massive lesions at about 6 months of age.
[0086] Expression of VEGF in the skin of K14VEGF transgenic mice.
VEGF transgene expression was detected by immunostaining with an
antibody specific to mouse VEGF. Strong protein expression was
observed in basal keratinocytes and in microvessels in the
papillary dermis.
[0087] Histological analyses of psoriatic lesions in K14VEGF
transgenic mice. Histological analyses of K14VEGF transgenic mouse
ears exhibiting the psoriatic lesions revealed a characteristic
psoriatic skin phenotype. Standard hematoxolin and eosin (H&E)
staining revealed that the epidermis of young K14VEGF transgenic
mice exhibited moderate acanthosis (i.e. epidermal hyperplasia) and
focal parakeratosis (i.e. keratinocytes in the stratum corneum
retain nuclei) compared to control mouse (see FIGS. 6A and B). In
the dermal compartment, edema coupled with an approximately 5-fold
increase in tissue thickness was observed, as was inflammatory cell
infiltration. The condition progressed with age. K14VEGF
transgenics over 6 months of age developed obvious rete ridges that
are typical for psoriasiform hyperplasia and the skin became more
thickened (see FIG. 7). More confluent hyperkeratosis with
excessive deposition of keratin, and parakeratosis with
neutrophil-laden pustules were present in the stratum corneum (FIG.
6C). Munro microabscesses (FIG. 8A) localized within parakeratotic
areas of the comified layer (Altman et al. (1999) supra) and Kogoj
microabscesses (FIG. 8B) that localized immediately beneath the
parakeratotic cornified layer were identified in the lesions of
older K14VEGF transgenics. The presence of microabscesses are key
features in clinical psoriasis diagnosis.
[0088] K14VEGF transgenic mice are characterized by visible skin
redness and vascularization. Immunohistological staining for
PECAM-1, an integral membrane protein located on endothelial cells
(DeLisser et al. (1994) Immunol. Today October;15(10):490-5)
revealed an increased number of dermal microvessels within K14VEGF
transgenic skin. Dilated and tortuous capillaries in the papillary
dermis, that spiral to near the undersurface of the epidermis, were
also observed.
[0089] The pathological basis for psoriasis is not known. One issue
is whether the disorder reflects an abnormality in the epidermal
keratinocyte or bone-marrow-derived immunocytes. Recent studies
using severe combined immunodeficient (SCID) mice engrafted with
symptomless skin from a psoriasis patient provided direct in vivo
evidence that activated CD4+, but not CD8+T-lymphocytes, can
trigger the formation of a psoriatic phenotype (Wrone-Smith et al.
(1996) J. Clin. Invest. October 15;98(8):1878-87; Nickoloff et al.
(1999) Am. J. Pathol. July;155(1):145-58). To analyze the
immunologic basis that mediates the inflammatory response in the
K14VEGF transgenic mouse psoriasis model described herein,
immunostaining was performed for CD4+ and CD8+ immunocytes. The
results revealed massive infiltration of CD4+ T-lymphocytes that
are localized primarily in the dermis of both early psoriatic
lesions and in more mature psoriatic lesions isolated from older
K14VEGF transgenic mice. The overall level of CD8+T-lymphocytes
that infiltrated into the lesional skin was significantly less than
that of the CD4+ T-lymphocytes. In young K14VEGF transgenic
lesions, CD8+ T-lymphocytes were detected in both the dermis and
the epidermis. Interestingly, CD8+ lymphocytes become primarily
localized in the epidermis with maturation of psoriatic lesion.
When cryosections of skin from K14VEGF transgenic mice were stained
with an antibody recognizing the murine macrophage marker F4/80
antigen, a significant increase in the number of macrophages was
observed as compared to control. This increased macrophage
infiltration became even more dramatic with the development of
psoriatic lesions in older transgenic mice, which suggests that the
cytokines or growth factors secreted by activated CD8+lymphocytes
further stimulate macrophage proliferation leading to exacerbation
of psoriatic phenotype.
[0090] The effects of VEGFR1R2-FcDC1(a) in an animal model of
psoriasis. The novel animal model of psoriasis described herein
demonstrates that a psoriatic phenotype can be induced primarily by
over expression of VEGF in the mouse epidermis. To confirm the
causative role of VEGF in the formation of a psoriatic lesion,
VEGFR1R2-FcDC1(a) was injected subcutaneously into mouse neck skin.
VEGFR1R2-FcDC1(a) competes with endogenous mouse VEGF receptor for
binding of VEGF by forming a complex with the VEGF, thus preventing
it from binding to its receptor and transducing a signal. Five
K14VEGF transgenic mice with obvious psoriatic lesions were treated
on days 0 (FIGS. 9A-D), day 3 (FIGS. 9E-H), day 7 (FIGS. 91-L), and
day 10 (FIGS. 9M-P), with VEGFR1R2-FcDC1(a) at a dose of 25 mg/kg.
Three of the treated mice showed significant improvement of the
skin lesions by day 3, following the first injection of
VEGFR1R2-FcDC1(a). The remaining two of the animals showed mild
improvement in their lesions by day 3. Subsequent injections of
VEGFR1R2-FcDC1(a) demonstrated further improvements in the skin
lesions in all the mice up to day 7. However, by day 10, two of the
mice started to develop small focal lesions, presumably due to the
formation of VEGFR1R2-FcDC1(a) neutralizing antibodies (FIGS.
9A-P).
Example 19
The Effects of VEGFR1R2-FcDC1(a) in a Novel Animal Model of Wound
Healing
[0091] During the early phase of wound healing, new granulation
tissue begins to form approximately 4 days after the injury.
Numerous new capillaries along with fibroblasts and extracellular
matrix proteins move into the wound space (Hunt (1980) World J.
Surg. 4(3):271-7). Neo-vascularization provides oxygen and
nutrients necessary to sustain cell metabolism. In fact, adequate
new blood vessel formation seems to be crucial to the normal
process of wound healing. However, the growth factor(s) that
stimulate the angiogenesis associated with wound healing as well as
the underlying molecular mechanisms at play remain elusive.
[0092] VEGF, a potent angiogenesis factor, has strong
vasopermeability activity (Dvorak et. al. (1995) Am. J. Pathol.
146(5):1029-39) and is produced in large quantities by the
epidermis during wound healing (Brown et al. (1992) J. Exp.
Med.1;176(5):1375-9). Therefore, the role of VEGF in wound healing
using a novel murine excisional wound healing model was
studied.
[0093] Murine excisional wound healing model. A novel wound healing
model was created by introducing an excisional wound on the dorsal
skin of a mouse ear. Female FVB mice (Taconic, NY) weighing
approximately 25 to 30 g were used in this experiment. Animals were
housed under standard conditions, and provided food and water ad
libitum. Post-operatively, animals were housed in individual cages
under standard conditions, and checked daily for signs of healing.
Mice were anesthetized using ketamine (200 mg/kg) and xylazine (10
mg/kg) through intraperitoneal injection. Using electric clippers,
the hair on the ear skin of the mice was gently shaved. A standard
depilating agent was applied to remove the remaining hair, and PBS
and betadine was used to clean the exposed skin. One
full-thickness, circular wound was created on each ear. Excision
was made by 4 mm biopsy punch (Clark, NY) extending down to bare
cartilage, followed by dissection with a microknife (Roboz, MD).
Nicks were made on ear cartilage to mark the origin of wound. All
the wounds were covered with an occlusive polyurethane dressing
(Tegaderm, 3M, Minneapolis, Minn. until harvest. Upon harvest,
animals were euthanized by lethal intraperitoneal injection of
ketamine and xylazine. The wounds were bisected and analyzed
histologically. These wounds, splinted by underlying cartilage,
were minimally Re-epithelialization rate, percentage of full
re-epithelialization, and new granulation tissue formation in all
age and sex matched wounds were measured by computer assisted image
analysis program Osteomeasure (Osteometrics, Inc. Atlanta, Ga.).
Tissue preparation, Histology, and VEGFR1R2-FcDC1(a) injections
were done as described supra in Example 6.
[0094] Wound healing in K14VEGF transgenic mice. One wound was
introduced onto each ear of homozygous K14VEGF transgenic mice.
Wounds were harvested on days 3, 7 and 10 after surgery.
Cryosections were stained with H&E for morphological analysis.
Wound tissue was quantified for granulation tissue formation and
neo-epithelialization using a computer-assisted imaging program
Osteomeasure (Osteometrics, Inc. Atlanta, Ga.). In 3 month old
K14VEGF transgenic mice, granulation tissue formation was impaired
by 37.8% (p<0.05) on POD3 compared to age-matched wild type
littermate control mice.
[0095] The effects of VEGFR1R2-FcDC1(a) on wound healing in normal
mice. As stated supra, overexpression of VEGF in mouse skin retards
wound healing, presumably due to an excessive inflammatory response
and edema. However, in this experiment, blocking endogenous VEGF in
normal FVB mouse wounds by administering VEGFR1R2-FcDC1(a) at 25
mg/kg does not affect wound healing in a significant way. This may
be due to the relatively lower levels of VEGF in a "normal" wound
as compared to the high levels of expression in chronic wounds
which tend not to heal efficiently. These observations support the
use of VEGFR1R2-FcDC1(a) in improving and enhancing wound healing
in clinical settings in which VEGF is overexpressed by down
regulating inflammation and edema.
[0096] The present invention may be embodied in other specific
forms without departing from the spirit or essential attributes
thereof.
Sequence CWU 1
1
18 1 36 DNA Artificial Sequence Primer 1 gactagcagt ccggaggtag
acctttcgta gagatg 36 2 33 DNA Artificial Sequence Primer 2
cggactcaga accacatcta tgattgtatt ggt 33 3 7 PRT Homo Sapien 3 Gly
Arg Pro Phe Val Glu Met 1 5 4 4 PRT Homo Sapien 4 Val Val Leu Ser 1
5 35 DNA Artificial Sequence Primer 5 acaatcatag atgtggttct
gagtccgtct catgg 35 6 38 DNA Artificial Sequence Primer 6
gataatgccc gggccctttt catggaccct gacaaatg 38 7 6 PRT Homo Sapien 7
Val Arg Val His Glu Lys 1 5 8 36 DNA Artificial Sequence Primer 8
gactagcagt ccggaggtag acctttcgta gagatg 36 9 38 DNA Artificial
Sequence Primer 9 ttcctgggca acagctggat atctatgatt gtattggt 38 10 7
PRT Homo Sapien 10 Gly Arg Pro Phe Val Glu Met 1 5 11 4 PRT Homo
Sapien 11 Thr Ile Ile Asp 1 12 4 PRT Homo Sapien 12 Ile Gln Leu Leu
1 13 39 DNA Artificial Sequence Primer 13 atccagctgt tgcccaggaa
gtcgctggag ctgctggta 39 14 39 DNA Artificial Sequence Primer 14
attttcatgc acaatgacct cggtgctctc ccgaaatcg 39 15 38 DNA Artificial
Sequence Primer 15 tcatagatat ccagctgttg cccaggaagt cgctggag 38 16
39 DNA Artificial Sequence Primer 16 gataatgccc gggccatttt
catgcacaat gacctcggt 39 17 6 PRT Homo Sapien 17 Val Ile Val His Glu
Asn 1 5 18 10 PRT Homo Sapien 18 Lys Asn Lys Cys Ala Ser Val Arg
Arg Arg 1 5 10
* * * * *