U.S. patent application number 10/763692 was filed with the patent office on 2004-12-30 for polynucleotides differentially expressed in adenocarcinomas, polypeptides encoded thereby, and methods of use thereof.
Invention is credited to Kennedy, Giulia C..
Application Number | 20040265928 10/763692 |
Document ID | / |
Family ID | 32329755 |
Filed Date | 2004-12-30 |
United States Patent
Application |
20040265928 |
Kind Code |
A1 |
Kennedy, Giulia C. |
December 30, 2004 |
Polynucleotides differentially expressed in adenocarcinomas,
polypeptides encoded thereby, and methods of use thereof
Abstract
The present invention features human HX2004-6 polypeptide and
nucleotide sequences encoding HX2004-6 polypeptides. In a
particular aspect, the polynucleotide is the nucleotide sequence of
SEQ ID NO: 1. In related aspects the invention features expression
vectors and host cells comprising polynucleotides that encode a
human HX2004-6 polypeptide. The present invention also relates to
antibodies that bind specifically to a human HX2004-6 polypeptide.
Further provided are diagnostic and screening methods using
HX2004-6 polynucleotides and antibodies specific for HX2004-6
polypeptides.
Inventors: |
Kennedy, Giulia C.; (San
Francisco, CA) |
Correspondence
Address: |
Chiron Corporation
Intellectual Property - R440
P.O. Box 8097
Emeryville
CA
94662-8097
US
|
Family ID: |
32329755 |
Appl. No.: |
10/763692 |
Filed: |
January 22, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10763692 |
Jan 22, 2004 |
|
|
|
09626301 |
Jul 25, 2000 |
|
|
|
6743602 |
|
|
|
|
60145612 |
Jul 26, 1999 |
|
|
|
60148936 |
Aug 13, 1999 |
|
|
|
Current U.S.
Class: |
435/7.23 ;
435/226; 435/320.1; 435/325; 435/6.16; 435/69.1; 536/23.2 |
Current CPC
Class: |
A01K 2217/05 20130101;
C07K 14/47 20130101; A01K 2217/075 20130101 |
Class at
Publication: |
435/007.23 ;
435/069.1; 435/226; 435/320.1; 435/325; 536/023.2; 435/006 |
International
Class: |
C12Q 001/68; G01N
033/574; C07H 021/04; C12N 009/64 |
Claims
What is claimed is:
1. An isolated human HX2004-6 polypeptide.
2. The human HX2004-6 polypeptide of claim 1, comprising an amino
acid sequence of SEQ ID NO:2.
3. The human HX2004-6 polypeptide of claim 1, which has an amino
acid sequence of amino acids 1-342 of SEQ ID NO:2.
4. An isolated polynucleotide, or complement thereof, comprising a
polynucleotide sequence encoding a human HX2004-6 polypeptide of
claim 1.
5. The isolated polynucleotide sequence of claim 4 comprising a
polynucleotide sequence of SEQ ID NO:1.
6. The isolated polynucleotide sequence of claim 4 having a
polynucleotide sequence of nucleotides 1-1724of SEQ ID NO:1.
7. An isolated polynucleotide sequence which hybridizes under
stringent conditions to a polynucleotide having the sequence
depicted in SEQ ID NO:1.
8. An isolated polynucleotide sequence which hybridizes under
stringent conditions to a polynucleotide having the sequence of
nucleotides 1-1724 of SEQ ID NO: 1.
9. An isolated polynucleotide of claim 4, wherein said
polynucleotide is overexpressed in an adenocarcinoma of a tissue
selected from the group consisting of exocrine pancreas, breast,
and colon.
10. A recombinant expression vector comprising the polynucleotide
sequence of claim 4.
11. An isolated host cell comprising the polynucleotide sequence of
claim 4.
12. A method for producing the human HX2004-6 polypeptide of claim
1, the method comprising the steps of: a) culturing a recombinant
host cell containing a human HX2004-6 polypeptide-encoding
polynucleotide sequence under conditions suitable for the
expression of the polypeptide; and b) recovering the polypeptide
from the host cell culture.
13. An isolated antibody that specifically binds a human HX2004-6
polypeptide of claim 1.
14. A method for identifying a polynucleotide homologous to the
polynucleotide of claim 4, the method comprising the steps of:
contacting a polynucleotide probe with a test polynucleotide, the
probe comprising at least 15 contiguous nucleotides of a
polynucleotide sequence encoding a human HX2004-6 polypeptide; and
detecting hybridization of the probe with the test polynucleotide;
wherein detection of hybridization of the probe to the test
polynucleotide indicates that the polynucleotide shares sequence
homology with the human HX2004-6 polypeptide-encoding
polynucleotide.
15. A method of detecting the presence of an HX2004-6 mRNA in a
biological sample, comprising: a) contacting the sample with an
HX2004-6 polynucleotide; and b) detecting hybridization.
16. The method of claim 15, wherein the sample is ductal epithelial
cells from a tissue selected from the group consisting of pancreas,
colon, and breast.
17. The method of claim 15, further comprising, before step (a) the
step of making a cDNA copy of the HX2004-6 mRNA.
18. A method for detecting the presence of an HX2004-6 polypeptide
in a biological sample, comprising: a) contacting the sample with
an antibody specific for an HX2004-6 polypeptide; and b) detecting
specific binding of the antibody.
19. A method for identifying an agent that modulates HX2004-6
expression in a cell, the method comprising: combining a candidate
agent with a cell comprising a nucleic acid encoding a human
HX2004-6 polypeptide; and determining the effect of said agent on
HX2004-6 expression.
20. The method of claim 19, wherein said determining is carried out
by measuring an amount of an HX2004-6 mRNA in the cell.
21. The method of claim 19, wherein said determining is carried out
by measuring an amount of an HX2004-6 polypeptide in the cell.
Description
FIELD OF THE INVENTION
[0001] The invention relates generally to novel polynucleotides,
particularly those that are differentially expressed in cancer, in
particular, pancreas, colon, and breast cancer.
BACKGROUND OF THE INVENTION
[0002] Pancreatic Cancer
[0003] Cancer of the pancreas is the fifth leading cause of cancer
death in the United States. According to the American Cancer
Society, approximately 28,000 people will die of pancreatic cancer
in the United States in 1998. The pancreas is a tongue-shaped
glandular organ composed of both endocrine and exocrine gland
portions, as well as ducts that connect the pancreas to the bile
duct and small intestine. The endocrine portion of the pancreas
secretes hormones, such as insulin and glucagon, which are involved
in blood sugar regulation, into the bloodstream. The exocrine
portion of the pancreas produces pancreatic enzymes involved in the
digestion of fats and proteins; these enzymes are delivered to the
bile duct and into the small intestine.
[0004] Tumors of the endocrine pancreas have unique biological
characteristics, and therapy is relatively effective. Neoplasms of
the exocrine pancreas develop insidiously, and therapy is
relatively ineffective. When considered by histological type,
ductal cell adenocarcinomas are the most frequent type of exocrine
pancreas tumors, accounting for approximately 82% of all tumors of
the exocrine pancreas.
[0005] Although early and accurate diagnosis can thus be extremely
important in treatment success, conventional screening tests for
detecting pancreatic cancer in asymptomatic persons are inadequate.
Imaging procedures such as magnetic resonance imaging and computed
tomography are too costly to use as routine screening tests, while
more accurate tests such as endoscopic retrograde
cholangiopancreatography (ERCP) and endoscopic ultrasound are
inappropriate for screening asymptomatic patients due to their
invasiveness. Abdominal ultrasonography is a noninvasive screening
test, but there is little information on the efficacy of abdominal
ultrasound as a screening test for pancreatic cancer in
asymptomatic persons. In symptomatic patients with suspected
disease it has a reported sensitivity of 40-98% and a specificity
as high as 90-94%. Conventional ultrasonography is limited by
visualization difficulties in the presence of bowel gas or obesity
and by its range of resolution (2-3 cm). Even tumors less than 2 cm
in diameter are frequently associated with metastatic disease, thus
limiting the ability of ultrasound to detect early disease.
[0006] Most persons with pancreatic malignancy have elevated levels
of certain serologic markers such as CA19-9, peanut agglutinin,
pancreatic oncofetal antigen, DU-PAN-2, carcinoembryonic antigen,
alpha-fetoprotein, CA-50, SPan-1, and tissue polypeptide antigen
(Rhodes et al. (1990) Bailleres Clin. Gastroenterol. 4:833;
Steinberg (1990) Am. J Gastroenterol. 85:350; Satake et al. (1990)
Int. J. Pancreatol. 7:25; Satake (1991) Int. J. Pancreatol. 9:93).
None of these markers is, however, tumor specific or organ specific
(Satake (1991), supra). Elevations of various serologic markers
also occur in significant proportions of persons with benign
gastrointestinal diseases or malignancies other than pancreatic
cancer (Carter (1990) Gut 31:494; Rhodes et al. (1990), supra;
Satake et al. (1990), supra; Satake (1991), supra). Most of these
markers have been studied exclusively in high-risk populations,
such as symptomatic patients with suspected pancreatic cancer.
CA19-9 has probably achieved the widest acceptance as a
serodiagnostic test for pancreatic carcinoma in symptomatic
patients, with an overall sensitivity of approximately 80% (68-93%)
and specificity of 90% (73-100%); sensitivity was highest in
patients with more advanced disease (Steinberg (1990), supra;
Satake et al. (1990), supra). Among healthy subjects, CA19-9 has
good specificity (94-99%) (DelVillano et al. (1983) Clin. Chem.
29:549; Ritts et al. (1984) Int. J. Cancer 33:339; Fabris et al.
(1988) Am. J. Gastroentrol 83:549) but nevertheless generates a
large proportion of false-positive results due to the very low
prevalence of pancreatic cancer in the general population (Frebourg
et al. (1988) Cancer 62:2287; Homma et al. (1991) Int. J.
Pancreatol. 9:119). The predictive value of a positive test could
be improved if a population at substantially higher risk could be
identified.
[0007] Breast Cancer
[0008] Breast cancer is the most common malignant neoplasm in women
worldwide. This is also true in the United States, where the annual
incidence was 104.6 new cases per 100,000 in 1989. The lifetime
risk of breast cancer in the United States is estimated ato be
about one case for every eight women. Most breast cancers are
invasive adenocarcinomas arising from the ductal lobular epithelial
unit (Fisher (1975) Cancer 36:1), and the vast majority of patients
have infiltrating ductal carcinomas. Overall, breast cancer makes
up 32 percent of all cancer in U.S. women. The annual mortality
rate from breast cancer has remained at about 27 deaths per 100,000
for many years despite improvements in medical management (Cancer
Treatment, 4.sup.th Ed. C. Haskell, ed. (1995) W.B. Saunders Co).
Current treatments include surgical resection, ionizing radiation
therapy, systemic chemotherapy, endocrine therapy, or a combination
of the foregoing.
[0009] Early diagnosis is of paramount importance in reducing
mortality. Currently, screening and diagnostic methods include
mammography and self-examination. Certain serum markers may be
indicative of metastasis. Serial measurements of serum calcium and
alkaline phosphatase are of established value for monitoring
patients with known metastatic disease. Carcinoembryonic antigen
(CEA) has been used to assess the response of patients to
chemotherapy. The role of other potential tumor markers, such as
CA549 and CA15-3, is currently under investigation.
[0010] Colorectal Cancer
[0011] Colorectal cancer is a major health problem in most affluent
countries. In the United States, it is the fourth most frequent
site for a primary malignant neoplasm, with approximately 149,000
new cases and 56,000 deaths expected in 1994. The vast majority of
primary colorectal malignant neoplasms are epithelial
adenocarcinbmas. Current treatments include surgical resection, and
single-agent and combination chemotherapy.
[0012] Current screening and diagnostic methods include, for
asymptomatic people, tests for occult blood in the stool and
screening flexible sigmoidoscopy. For symptomatic patients,
diagnostic tests include barium enema, colonoscopy, and
ultrasound.
[0013] Inadequacies of conventional diagnostic methods for the
above-mentioned cancers highlight the need for diagnostic and
therapeutic methods and compositions, as well as for a better
understanding of the disease to provide the basis for more
rationale and more quickly responsive therapy. The present
invention addresses this need by providing nucleotide sequence that
are differentially expressed in these diseases.
[0014] Related Literature
[0015] A human mRNA, designated "KIAA0858", was identified in human
brain tissue, and is described in Nagase et al. (1998) DNA Res.
5:355-364. The nucleotide sequence of KIAA0858 is provided under
GenBank Accession No. AB020665. A human mRNA was identified in
pancreas tissue, its predicted translation product encodes a
zinc-finger domain-containing protein, and its sequence is provided
under GenBank Accession No. U90654.
SUMMARY OF THE INVENTION
[0016] The present invention is based on the discovery of
polynucleotides that represent a gene that is differentially
expressed in restricted types of cancer cells, specifically, colon,
breast, and pancreatic cancer cells, particularly cancerous colon,
breast, and pancreatic ductal epithelial cells. The present
invention features a human HX2004-6 polypeptide and nucleotide
sequences encoding HX2004-6 polypeptides. In a particular aspect,
the polynucleotide is the nucleotide sequence of SEQ ID NO:1 and
SEQ ID NO:3. In addition, the invention features polynucleotide
sequences that hybridize under stringent conditions to SEQ ID NO:1
or SEQ ID NO:3. In related aspects the invention features
expression vectors and host cells comprising polynucleotides that
encode a human HX2004-6 polypeptide. The present invention also
provides antibodies that bind specifically to a human HX2004-6
polypeptide.
[0017] The invention further provides methods using the
polynucleotides and antibodies of the invention. The methods
include methods for producing human HX2004-6 polypeptides; methods
for detecting the presence of an HX2004-6 polypeptide or an
HX2004-6 polynucleotide in a biological sample; methods for
detecting cells expressing HX2004-6; methods for identification of
individuals at risk for pancreatic, colon, or breast cancer by
detecting alteration in HX2004-6 coding and regulatory sequences
and HX2004-6 expression levels.
[0018] Another object of the invention is to provide an isolated
human HX2004-6 polypeptide-encoding polynucleotide for use in
generation of non-human transgenic animal models for HX2004-6 gene
function, particularly "knock-in" HX2004-6 non-human transgenic
animals characterized by excess or ectopic expression of the
HX2004-6 gene.
[0019] The invention further provides screening methods to identify
agents that modulate expression of human HX2004-, for example,
transcription and/or translation of a human HX2004-6
polynucleotide. Of particular interest are those compounds that
reduce human HX2004-expression, which compounds can be further
evaluated for use in treating adenocarcinomas of breast, colon and
pancreatic ductal epithelial cell origin.
[0020] These and other objects, advantages and features of the
present invention will become apparent to those persons skilled in
the art upon reading the details of the invention more fully set
forth below.
[0021] The invention will now be described in further detail.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1 depicts a sequencing gel autoradiograph of samples
from a differential display assay. The arrow indicates the message
differentially expressed in primary cultures of ductal epithelial
cells from normal pancreas, and pancreas from individuals diagnosed
with dysplasia of pancreatic cells, pancreatitis, and pancreatic
cancer.
[0023] FIGS. 2A-B depict the nucleotide sequence of HX2004-6 cDNA
clone 1 (SEQ ID NO:1). For convenience, FIGS. 2A-B are referred to
herein as "FIG. 2". The initiation codon and stop codons, ATG and
TGA, respectively, are shown, in bold and underlined.
[0024] FIGS. 3A-B depict the nucleotide sequence of HX2004-6 cDNA
clone 2 (SEQ ID NO:3. For convenience, FIGS. 3A-B are referred to
herein as "FIG. 3". The sequence which is the 2004-6 probe (SEQ ID
NO:5) is shown as a bold sequence. Within the 2004-6 sequence is
the 30-nucleotide insertion (underlined and in lower case letters)
relative to SEQ ID NO:1. The initiation codon and stop codons, ATG
and TGA, respectively, are shown, in bold and underlined.
[0025] FIG. 4 depicts an autoradiograph of a human multiple tissue
Northern blot probed with PCR-2004. RNA was from the following
tissues: Lane 1, heart; Lane 2, brain; Lane 3, placenta; Lane 4,
lung; Lane 5., liver; Lane 6, skeletal muscle; Lane 7, kidney; Lane
8, pancreas.
[0026] FIG. 5 depicts an autoradiograph of a human multiple cancer
cell line Northern blot probed with PCR-2004. Cell lines were as
follows: Lane 1, HL-60 (promyelocytic leukemia); Lane 2, HeLa cell
S3; Lane 3, K-562 (chronic myelogenous leukemia); Lane 4, MOLT-4
(acute lymphoblastic leukemia); Lane 5, Raji (Burkitt's lymphoma);
Lane 6, SW480 (colorectal adenocarcinoma); Lane 7, A549 (lung
carcinoma); Lane 8, G361 (melanoma).
[0027] FIG. 6 depicts an autoradiograph of a tumor mRNA Northern
blot probed with the 2004-6 probe (upper panels) and, as a control,
.beta.-actin (lower panels). mRNA samples were from breast tumor
(Left-hand panels; Lanes marked "T") and normal breast (Left-hand
panels; Lane "N") tissues, and colon tumor (Right-hand panels;
Lanes marked "T") and normal colon tissue (Right-hand panels; Lane
"N"), as described in Example 4.
[0028] FIG. 7 depicts and autoradiograph of a colon cancer cell
line RNA blot probed with the 2004-6 probe.
[0029] FIG. 8 is a graph showing the percentages of tumor and
normal tissue samples expressing PCD1 by in situ hybridization
analysis.
[0030] FIGS. 9A-9H (collectively referred to herein as FIG. 9) are
a series of graphs showing HX2004-6 expression levels in tissues
from eight colon cancer patients. N: normal colon tissue; PT:
primary tumor colon tissue; MET: metastatic liver tissue. The
expression data (on the Y axis) are adjusted by .beta.-actin
expression level and are thus relative values. All PCR reactions
were performed. in duplicate.
DETAILED DESCRIPTION OF THE INVENTION
[0031] Before the present nucleotide and polypeptide sequences are
described, it is to be understood that this invention is not
limited to the particular methodology, protocols, cell lines,
vectors and reagents described as such may, of course, vary. It is
also to be understood that the terminology used herein is for the
purpose of describing particular embodiments only, and is not
intended to limit the scope of the present invention which will be
limited only by the appended claims.
[0032] It must be noted that as used herein and in the appended
claims, the singular forms "a", "and", and "the" include plural
referents unless the context clearly dictates otherwise. Thus, for
example, reference to "a host cell" includes a plurality of such
host cells and reference to "the antibody" includes reference to
one or more antibodies and equivalents thereof known to those
skilled in the art, and so forth.
[0033] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood to one of
ordinary skill in the art to which this invention belongs. Although
any methods, devices and materials similar or equivalent to those
described herein can be used in the practice or testing of the
invention, the preferred methods, devices and materials are now
described.
[0034] All publications mentioned herein are incorporated herein by
reference for the purpose of describing and disclosing, for
example, the cell lines, vectors, and methodologies which are
described in the publications which might be used in connection
with the presently described invention. The publications discussed
herein are provided solely for their disclosure prior to the filing
date of the present application. Nothing herein is to be construed
as an admission that the inventors are not entitled to antedate
such disclosure by virtue of prior invention.
[0035] Definitions
[0036] "Polynucleotide" as used herein refers to an
oligonucleotide, nucleotide, and fragments or portions thereof, as
well as to peptide nucleic acids (PNA), fragments, portions or
antisense molecules thereof, and to DNA or RNA of genomic or
synthetic origin which can be single- or double-stranded, and
represent the sense or antisense strand. Where "polynucleotide" is
used to refer to a specific polynucleotide sequence (e.g. a
HX2004-6 polypeptide-encoding polynucleotide), "polynucleotide" is
meant to encompass polynucleotides that encode a polypeptide that
is functionally equivalent to the recited polypeptide, e.g.,
polynucleotides that are degenerate variants, or polynucleotides
that encode biologically active variants or fragments of the
recited polypeptide. Similarly, "polypeptide" as used herein refers
to an oligopeptide, peptide, or protein. Where "polypeptide" is
recited herein to refer to an amino acid sequence of a
naturally-occurring protein molecule, "polypeptide" and like terms
are not meant to limit the amino acid sequence to the complete,
native amino acid sequence associated with the recited protein
molecule.
[0037] By "antisense polynucleotide" is mean a polynucleotide
having a nucleotide sequence complementary to a given
polynucleotide sequence (e.g, a polynucleotide sequence encoding an
HX2004-6 polypeptide) including polynucleotide sequences associated
with the transcription or translation of the given polynucleotide
sequence (e.g., a promoter of a polynucleotide encoding an HX2004-6
polypeptide), where the antisense polynucleotide is capable of
hybridizing to an HX2004-6 polypeptide-encoding polynucleotide
sequence. Of particular interest are antisense polynucleotides
capable of inhibiting transcription and/or translation of an
HX2004-6-encoding polynucleotide either in vitro or in vivo.
[0038] "Peptide nucleic acid" as used herein refers to a molecule
which comprises an oligomer to which an amino acid residue, such as
lysine, and an amino group have been added. These small molecules,
also designated anti-gene agents, stop transcript elongation by
binding to their complementary (template) strand of nucleic acid
(Nielsen et al. (1993) Anticancer Drug Des. 8:53-63).
[0039] As used herein, "HX2004-6 polypeptide" refers to an amino
acid sequence of a recombinant or nonrecombinant polypeptide having
an amino acid sequence of i) a native HX2004-6 polypeptide, ii) a
fragment of an HX2004-6 polypeptide, iii) polypeptide analogs of an
HX2004-6 polypeptide, iv) variants of an HX2004-6 polypeptide, and
v) an immunologically active fragment of an HX2004-6 polypeptide.
HX2004-6 polypeptides of the invention can be obtained from any
species, e.g., mammalian or non-mammalian (e.g., reptiles,
amphibians, avian (e.g., chicken)), particularly mammalian,
including human, rodent (e.g., murine or rat), bovine, ovine,
porcine, murine, or equine, preferably rat or human, from any
source whether natural, synthetic, semi-synthetic or recombinant.
"Human HX2004-6 polypeptide" refers to the amino acid sequences of
isolated human HX2004-6 polypeptide obtained from a human, and is
meant to include all naturally-occurring allelic variants, and is
not meant to limit the amino acid sequence to the complete, native
amino acid sequence associated with the recited protein
molecule.
[0040] The term "immunologically active" defines the capability of
the natural, recombinant or synthetic human HX2004-6 polypeptide,
or any oligopeptide thereof, to induce a specific immune response
in appropriate animals or cells and to bind with specific
antibodies.
[0041] As used herein, a "HX2004-6 associated disorder" is one that
is associated with a neoplasm of pancreatic, colon, or breast cell,
particularly an adenocarcinoma of one of these tissues,
particularly a neoplasm of a ductal epithelial cell from one of
these tissues. A "HX2004-6 associated disorder" is also one that is
caused by, directly or indirectly, a neoplasm of one of the
aforementioned cells. A "HX2004-6 associated disorder" is also a
physiological condition or disease associated with altered HX2004-6
function (e.g., due to aberrant HX2004-6 expression, particularly
overexpression of HX2004-6).
[0042] "Overexpression" intends that an HX2004-6 mRNA is found at
levels at least about 1.5-fold, usually at least about 2-fold,
normally at least about 5-fold, generally at least about 10-fold,
and up to at least about 50-fold or higher when compared with a
non-cancerous cell of the same cell type. In particular, the
comparison is made between a ductal epithelial cell to be tested
and a non-cancerous ductal epithelial cell, for example, a
non-cancerous normal cell, or a dysplastic non-cancerous cell. The
comparison can be made between two tissues, for example, if one is
using in situ hybridization or another assay method which allows
some degree of discrimination among cell types in the tissue, as
described in Example 5; however, it may be preferable to make the
comparison between cells removed from their tissue source, as
described in Example 1. Whether an HX2004-6 polynucleotide is
over-expressed in a given cell can be readily determined by those
skilled in the art using known methods, including, but not limited
to, detection of HX2004-6 transcripts by hybridization with a
polynucleotide that hybridizes to a HX2004-6 polynucleotide, a
polymerase chain reaction using specific oligonucleotide primers,
in situ hybridization, by detection of encoded HX2004-6 polypeptide
using an immunoassay, and the like.
[0043] As used herein, "neoplastic cells" and "neoplasia" (used
interchangeably herein with "tumor", "cancer", "cancerous cells",
and "carcinoma") refers to cells which exhibit relatively
autonomous growth, so that they exhibit an aberrant growth
phenotype characterized by a significant loss of control of cell
proliferation. Neoplastic cells can be benign or malignant,
metastatic or non-metastatic. The term "adenocarcinoma" is one well
understood in the art, and denotes a tumor originating in glandular
epithelium.
[0044] A "host cell", as used herein, denotes microorganisms or
eukaryotic cells or cell lines cultured as unicellular entities
which can be, or have been, used as recipients for recombinant
vectors or other transfer polynucleotides, and include the progeny
of the original cell which has been transfected. It is understood
that the progeny of a single cell may not necessarily be completely
identical in morphology or in genomic or total DNA complement as
the original parent, due to natural, accidental, or deliberate
mutation. A host cell which comprises a recombinant vector of the
invention is a "recombinant host cell".
[0045] As used herein, "antigenic amino acid sequence" means an
amino acid sequence that, either alone or in association with a
carrier molecule, can elicit an antibody response in a mammal.
[0046] A "variant" of a human HX2004-6 polypeptide is defined as an
amino acid sequence that is altered by one or more amino acids. The
variant can have "conservative" changes, wherein a substituted
amino acid has similar structural or chemical properties, e.g.,
replacement of leucine with isoleucine. More rarely, a variant can
have "nonconservative" changes, e.g., replacement of a glycine with
a tryptophan. Similar minor variations can also include amino acid
deletions or insertions, or both. Guidance in determining which and
how many amino acid residues may be substituted, inserted or
deleted without abolishing biological or immunological activity can
be found using computer programs well known in the art, for
example, DNAStar software.
[0047] A "deletion" is defined as a change in either amino acid or
nucleotide sequence in which one or more amino acid or nucleotide
residues, respectively, are absent as compared to an amino acid
sequence or nucleotide sequence of a naturally occurring HX2004-6
polypeptide.
[0048] An "insertion" or "addition" is that change in an amino acid
or nucleotide sequence which has resulted in the addition of one or
more amino acid or nucleotide residues, respectively, as compared
to an amino acid sequence or nucleotide sequence of a naturally
occurring HX2004-6 polypeptide.
[0049] A "substitution" results from the replacement of one or more
amino acids or nucleotides by different amino acids or nucleotides,
respectively as compared to an amino acid sequence or nucleotide
sequence of a naturally occurring HX2004-6 polypeptide.
[0050] The term "derivative" as used herein refers to the chemical
modification of a nucleic acid encoding a human HX2004-6
polypeptide or the encoded human HX2004-6 polypeptide. Illustrative
of such modifications would be replacement of hydrogen by an alkyl,
acyl, or amino group. A nucleic acid derivative would encode a
polypeptide which retains essential biological characteristics of a
natural HX2004-6 polypeptide.
[0051] As used herein the term "isolated" is meant to describe a
compound of interest (e.g., either a polynucleotide, a polypeptide,
an antibody, or a cell) that is in an environment different from
that in which the compound naturally occurs. "Isolated" is meant to
include compounds that are within samples that are substantially
enriched for the compound of interest and/or in which the compound
of interest is partially or substantially purified.
[0052] As used herein, the term "substantially purified" refers to
a compound (e.g., either a polynucleotide or a polypeptide) that is
removed from its natural environment and is at least 60% free,
preferably 75% free, and most preferably 90% free from other
components with which it is naturally associated.
[0053] "Stringency" typically occurs in a range from about
Tm-:5.degree. C. (5.degree. C. below the Tm of the probe) to about
20.degree. C. to 25.degree. C. below Tm. As will be understood by
those of skill in the art, stringency hybridization can be used to
identify or detect identical polynucleotide sequences or to
identify or detect similar or related polynucleotide sequences.
[0054] The term "hybridization" as used herein shall include "any
process by which a strand of nucleic acid joins with a
complementary strand through base pairing" (Coombs 1994 Dictionary
of Biotechnology, Stockton Press, New York N.Y.). Amplification as
carried out in polymerase chain reaction technologies is described
in Dieffenbach et al. 1995, PCR Primer, a Laboratory Manual, Cold
Spring Harbor Press, Plainview N.Y.
[0055] By "transformation" is meant a permanent or transient
genetic change, preferably a permanent genetic change, induced in a
cell following incorporation of new DNA (i.e., DNA exogenous to the
cell). Genetic change can be accomplished either by incorporation
of the new DNA into the genome of the host cell, or by transient or
stable maintenance of the new DNA as an episomal element. Where the
cell is a mammalian cell, a permanent genetic change is generally
achieved by introduction of the DNA into the genome of the
cell.
[0056] By "construct" is meant a recombinant nucleic acid,
generally recombinant DNA, that has been generated for the purpose
of the expression of a specific nucleotide sequence(s), or is to be
used in the construction of other recombinant nucleotide
sequences.
[0057] A "transcriptional control region" (sometimes referred to as
a "transcriptional regulatory region") encompasses all the elements
necessary for transcription, and may include elements necessary for
transcription. Thus, a transcriptional control region includes at
least the promoter sequence, and may also include other regulatory
sequences such as enhancers, and transcription factor binding
sites.
[0058] A "transcriptional control region heterologous to a coding
region" is one that is not normally associated with the coding
region in nature.
[0059] "Operably linked" refers to a juxtaposition wherein the
components so described are in a relationship permitting them to
function in their intended manner. For instance, a promoter is
operably linked to a coding sequence if the promoter effects its
transcription or expression.
[0060] "Regulatory sequences" refer to those sequences normally
associated with (for example within 50 kb) of the coding region of
a locus which affect the expression of the gene (including
transcription of the gene, and translation, splicing, stability, or
the like of the messenger RNA). Regulatory sequences include, inter
alia, promoters, enhancers, splice sites and polyadenylation
sites.
[0061] By "operatively inserted" is meant that a nucleotide
sequence of interest is positioned adjacent a nucleotide sequence
that directs transcription or transcription and translation of the
introduced nucleotide sequence of interest (i.e., facilitates the
production of, e.g., a polypeptide or a polynucleotide encoded by
an HX2004-6 sequence).
[0062] The term "biological sample" encompasses a variety of sample
types obtained from an organism and can be used in a diagnostic or
monitoring assay. The term encompasses blood and other liquid
samples of biological origin, solid tissue samples, such as a
biopsy specimen or tissue cultures or cells derived therefrom and
the progeny thereof. For particular methods described herein, such
as diagnostic or screening methods, a biological sample of
particular interest comprises ductal epithelial cells from
pancreas, breast, and colon tissues. The term encompasses samples
that have been manipulated in any way after their procurement, such
as by treatment with reagents, solubilization, or enrichment for
certain components. The term encompasses a clinical sample, and
also includes cells in cell culture, cell supernatants, cell
lysates, serum, plasma, biological fluids, and tissue samples.
[0063] By "individual" or "subject" or "patient" is meant any
mammalian subject for whom diagnosis or therapy is desired,
particularly humans. Other subjects may include cattle, dogs, cats,
guinea pigs, rabbits, rats, mice, horses, and so on. Of particular
interest are subjects having an HX2004-6-associated disorder that
is amenable to treatment (e.g., to mitigate symptoms associated
with the disorder) by modulating expression of
either-HX2004-6-encoding nucleic acid in a cell of the subject.
[0064] The term "transgene" is used herein to describe genetic
material which has been or is about-to be artificially inserted
into the genome of a mammalian, particularly a mammalian cell of a
living animal.
[0065] By "transgenic organism" is meant a non-human orgarnism
(e.g., single-cell organisms (e.g., yeast), mammal, non-mammal
(e.g., nematode or Drosophila)) having a non-endogenous (i.e.,
heterologous) nucleic acid sequence present as an extrachromosomal
element in a portion of its cells or stably integrated into its
germ line DNA.
[0066] By "transgenic animal" is meant a non-human animal, usually
a mammal, having a non-endogenous (i.e., heterologous) nucleic acid
sequence present as an extrachromosomal element in a portion of its
cells or stably integrated into its germ line DNA (i.e., in the
genomic sequence of most or all of its cells). Heterologous nucleic
acid is introduced into the germ line of such transgenic animals by
genetic manipulation of, for example, embryos or embryonic stem
cells of the host animal.
[0067] A "knock-out" of a target gene means an alteration in the
sequence of the gene that results in a decrease of function of the
target gene, preferably such that target gene expression is
undetectable or insignificant. A knock-out of an HX2004-6 gene
means that function of the HX2004-6 gene has been substantially
decreased so that HX2004-6 expression is not detectable or only
present at insignificant levels. "Knock-out" transgenics of the
invention can be transgenic animals having a heterozygous knock-out
of the HX2004-6 gene or a homozygous knock-out of the HX2004-6
gene. "Knock-outs" also include conditional knock-outs, where
alteration of the target gene can occur upon, for example, exposure
of the animal to a substance that promotes target gene alteration,
introduction of an enzyme that promotes recombination at the target
gene site (e.g., Cre in the Cre-lox system), or other method for
directing the target gene alteration postnatally.
[0068] A "knock-in" of a target gene means an alteration in a host
cell genome that results in altered expression (e.g., increased
(including ectopic) or decreased expression) of the target gene,
e.g., by introduction of an additional copy of the target gene, or
by operatively inserting a regulatory sequence that provides for
enhanced expression of an endogenous copy of the target gene.
"Knock-in" transgenics of the invention can be transgenic animals
having a heterozygous knock-in of the HX2004-6 gene or a homozygous
knock-in of the HX2004-6 gene. "Knock-ins" also encompass
conditional knock-ins.
[0069] As used herein, the term "treatment" encompasses any
treatment of any disease or condition in a mammal, particularly a
human, and includes: a) preventing a disease, condition, or symptom
of a disease or condition from occurring in a subject which may be
predisposed to the disease but has not yet been diagnosed as having
it; b) inhibiting a disease, condition, or symptom of a disease or
condition, e.g., causing regression of the disease and/or its
symptoms.
[0070] Overview of the Invention
[0071] The present invention is based upon the identification and
isolation of a polynucleotide sequence encoding a human HX2004-6
polypeptide. Accordingly, the present invention encompasses such
human HX2004-6 polypeptide-encoding polynucleotides, as well as
human HX2004-6 polypeptides encoded by such polynucleotides.
Overexpression of HX2004-6 is linked to adenocarcinomas of
pancreas, colon, and breast, particularly neoplasms of ductal
epithelial cells of pancreas, colon, and breast.
[0072] The present invention provides methods of detecting an
HX2004-6 polynucleotide or polypeptide in a biological sample for
diagnostic purposes. The invention also encompasses the use of the
polynucleotides disclosed herein to facilitate identification and
isolation of polynucleotide and polypeptide sequences having
homology to a human HX2004-6 polynucleotide and polypeptide of the
invention. The human HX2004-6 polypeptides and polynucleotides of
the invention are also useful in the identification of human
HX2004-6 polypeptide-binding compounds, particularly compounds
which specifically bind human HX2004-6 polypeptide. Compounds which
specifically bind HX2004-6 are useful in diagnostic assays to
detect the presence of and/or measure a level of HX2004-6
polypeptide. In addition, the human HX2004-6 polypeptides,
polynucleotides, and antibodies of the invention are useful in the
diagnosis, prevention and treatment of disease associated with
human HX2004-6 overexpression.
[0073] The human HX2004-6 polypeptide-encoding polynucleotides of
the invention can also be used as a molecular probe with which to
determine the structure, location, and expression of the human
HX2004-6 polypeptide and related polypeptides in mammals (including
humans), and to investigate potential associations between disease
states or clinical disorders and defects or alterations in human
HX2004-6 polypeptide structure, expression, or function.
[0074] The human HX2004-6 polynucleotides and antibodies specific
for HX2004-6 -polypeptides are also useful in screening assays to
identify substances which modulate HX2004-6 expression in a
cell.
[0075] HX2004-6 Nucleic Acid
[0076] The present invention provides isolated HX2004-6 nucleic
acids. These nucleic acids are useful in methods to produce
HX2004-6 polypeptides, as well as in diagnostic methods, including
methods to detect an HX2004-6 mRNA in a biological sample, methods
to identify polynucleotides having sequence similarity to HX2004-6
polynucleotides of the invention, methods to detect an alteration
in HX2004-6 polynucleotide sequence in a cell, and methods to
identify substances which modulate HX2004-6 mRNA and/or polypeptide
levels in a cell.
[0077] In some embodiments, an HX2004-6 polynucleotide of the
invention has the sequence shown in SEQ ID NO: 1 (FIG. 2). In other
embodiments, an HX2004-6 polynucleotide has the sequence shown in
nucleotides 1-1724 of SEQ ID NO:1. In other embodiments, an
HX2004-6 polynucleotide has the sequence shown in nucleotides
698-1724 of SEQ ID NO:1. In other embodiments, an HX2004-6
polynucleotide has the sequence shown in SEQ ID NO:3 (FIG. 3). In
other embodiments, an HX2004-6 polynucleotide has the sequence
shown in nucleotides 1-1754 of SEQ ID NO:3. In still other
embodiments, an HX2004-6 polynucleotide has the sequence shown in
nucleotides 728-1754 of SEQ ID NO:3. Also encompassed are the
complement of any of the aforementioned sequences. Also encompassed
by "HX2004-6 polynucleotide" are fragments of the aforementioned
sequences. In one embodiment, a fragment of an HX2004-6
polynucleotide has the sequence of nucleotides 559 to 1107 of the
sequence shown in SEQ ID NO:3, and shown in bold in FIG. 3. This
sequence, which is given as SEQ ID NO:5 is also the sequence of the
polynucleotide probe referred to herein as "the 2004-6 probe".
Further encompassed are polynucleotides that hybridize under
stringent hybridization conditions with any one of the
aforementioned sequences, as described in detail herein. The
invention also encompasses polypeptides encoded by any of the
polynucleotide sequences described herein.
[0078] The term "HX2004-6 gene" is encompassed in the term
"HX2004-6 polynucleotide" and is used generically to designate
HX2004-6 genes and their alternate forms. "HX2004-6 gene" is also
intended to mean the open reading frame encoding specific HX2004-6
polypeptides, introns, and adjacent 5' and 3' non-coding nucleotide
sequences involved in the regulation of expression, up to about 1
kb beyond the coding region, but possibly further in either
direction. The DNA sequences encoding HX2004-6 may be cDNA or
genomic DNA or a fragment thereof. The gene may be introduced into
an appropriate vector for extrachromosomal maintenance or for
integration into the host.
[0079] The term "cDNA" as used herein is intended to include all
nucleic acids that share the arrangement of sequence elements found
in native mature mRNA species, where sequence elements are exons
(e.g., sequences encoding open reading frames of the encoded
polypeptide) and 3' and 5' non-coding regions. Normally mRNA
species have contiguous exons, with the intervening introns removed
by nuclear RNA splicing, to create a continuous open reading frame
encoding the HX2004-6 polypeptide.
[0080] While other genomic HX2004-6 sequences of other sources may
have non-contiguous open reading frames (e.g., where introns
interrupt the protein coding regions), the human genomic HX2004-6
sequence has no introns interrupting the coding sequence. A genomic
sequence of interest comprises the nucleic acid present between the
initiation codon and the stop codon, as defined in the listed
sequences, including all of the introns that are normally present
in a native chromosome. It may further include the 3' and 5'
untranslated regions found in the mature mRNA. It may further
include specific transcriptional and translational regulatory
sequences, such as promoters, enhancers, etc., including about 1
kb, but possibly more, of flanking genomic DNA at either the 5' or
3' end of the transcribed region. The genomic DNA may be isolated
as a fragment of 100 kbp or smaller; and substantially free of
flanking. chromosomal sequence.
[0081] The sequence of this 5' region, and further 5' upstream
sequences and 3' downstream sequences, may be utilized for promoter
elements, including enhancer binding sites, that provide for
expression in tissues where HX2004-6 is expressed. The sequences of
the HX2004-6 promoter elements of the invention can be based on the
nucleotide sequences of any species (e.g., mammalian or
non-mammalian (e.g., reptiles, amphibians, avian (e.g., chicken)),
particularly mammalian, including human, rodenti (e.g., murine or
rat), bovine, ovine, porcine, murine, or equine, preferably rat or
human) and can be isolated or produced from any source whether
natural, synthetic, semi-synthetic or recombinant.
[0082] As shown in Example 5, overexpression of HX2004-6 is
restricted to neoplasms of pancreas, breast, and colon,
particularly neoplasms of ductal epithelial cells of these tissues.
The tissue-restricted overexpression of HX2004-6 is useful for
determining the pattern of expression, and for providing promoters
that mimic the native pattern of expression. Naturally occurring
polymorphisms in the promoter region are useful for determining
natural variations in expression, particularly those that may be
associated with disease. Alternatively, mutations may be introduced
into the promoter region to determine the effect of altering
expression in experimentally defined systems. Methods for the
identification of specific DNA motifs involved in the binding of
transcriptional factors are known in the art, e.g. sequence
similarity to known binding motifs, gel retardation studies, etc.
For examples, see Blackwell et al. 1995 Mol Med 1:194-205; Mortlock
et al. 1996 Genome Res. 6: 327-33; and Joulin and Richard-Foy
(1995) Eur J Biochem 232: 620-626.
[0083] As shown in Example 5, HX2004-6 is overexpressed in certain
cancer cells, namely pancreas, colon, and breast cancers,
particularly adenocarcinomas, particularly cancerous ductal
epithelial cells of these tissues. Accordingly, in some
embodiments, HX2004-6 polynucleotides are over-expressed in
exocrine pancreatic, colorectal, and/or breast cancer cells,
particularly adenocarcinomas, particularly cancerous ductal
epithelial cells of these cancers. "Overexpression" intends that an
HX2004-6 mRNA is found at levels at least about 1.5-fold, normally
at least about 2-fold, usually at least about 5-fold, generally at
least about 10-fold, up to at least about 50-fold or higher when
compared with a non-cancerous cell of the same cell type. Those
skilled in the art can readily determine whether an HX2004-6
nucleic acid is overexpressed, using any known method, including
Northern blot analysis, in situ hybridization, and the like, using
an HX2004-6 nucleic acid of the invention or fragment thereof.
[0084] HX2004-6 regulatory sequences may be used to identify cis
acting sequences required for transcriptional or translational
regulation of HX2004-6 expression, especially in different tissues
or stages of development, and to identify cis acting sequences and
trans acting factors that regulate or mediate HX2004-6 expression.
Such transcriptional or translational control regions may be
operably linked to an HX2004-6 gene or other genes in order to
promote expression of wild type or altered HX2004-6 or other
proteins of interest in cultured cells, or in embryonic, fetal or
adult tissues, and for gene therapy. HX2004-6 transcriptional or
translational control regions can also be used to identify
extracellular signal molecules that regulate HX2004-6 promoter
activity, and thus regulate HX2004-6 expression.
[0085] The nucleic acid compositions used in the subject invention
may encode all or a part of the HX2004-6 polypeptides as
appropriate. SEQ ID NO:2 gives the amino acid translation of the
nucleotide sequence given as SEQ ID NO:1. SEQ ID NO:4 gives the
amino acid translation of the nucleotide sequence given as SEQ ID
NO:3. In some embodiments, an HX2004-6 polynucleotide encodes a
polypeptide having the amino acid sequence shown in SEQ ID NO:2. In
other embodiments, an HX2004-6 polynucleotide encodes a polypeptide
having the amino acid sequence shown as amino acids 1-342 of SEQ ID
NO:2. In other embodiments, an HX2004-6 polynucleotide encodes a
polypeptide having the amino acid sequence shown in SEQ ID NO:4. In
other embodiments, an HX2004-6 polynucleotide encodes a polypeptide
having the amino acid sequence given as amino acids 1-352 of SEQ ID
NO:4. Also encompassed are HX2004-6 polynucleotides encoding
variants, fragments and fusion proteins of the aforementioned
polypeptides. Accordingly, the invention encompasses an HX2004-6
polynucleotide which encodes a polypeptide having an amino acid
sequence of at least 5, usually at least about 15, usually at least
about 30 or more contiguous amino acids of amino acids 1-342 of SEQ
ID NO:2 or amino acids 1-352 of SEQ ID NO:4; variants of an
HX200-46 polypeptide, particularly variants having conservative
amino acid substitutions of the aforementioned fragments; and
fusion proteins comprising any one of the aforementioned fragments
and a heterologous polypeptide (i.e., a non-HX2004-6
polypeptide).
[0086] HX2004-6 nucleic acids can be obtained by chemical or
biochemical synthesis, by recombinant DNA techniques, or by
isolating the nucleic acids from a biological source. Fragments may
be obtained of the DNA sequence by chemically synthesizing
oligonucleotides in accordance with conventional methods, by
restriction enzyme digestion, by amplification (e.g., by a
polymerase chain reaction), etc. For the most part, DNA fragments
will be of at least about ten contiguous nucleotides, usually at
least about 15 nucleotides (nt), more usually at least about 18 nt
to about 20 nt, more usually at least about 25 nt to about 50 nt.
Such small DNA fragments are useful as primers for PCR,
hybridization screening, etc. Larger DNA fragments, i.e. greater
than 100 nt are useful for production of the encoded polypeptide.
For use in amplification reactions, such as PCR, a pair of primers
will be used. The exact composition of the primer sequences is not
critical to the invention, but for most applications the primers
will hybridize to the subject sequence under stringent conditions,
as known in the art. It is preferable to choose a pair of primers
that will generate an amplification product of at least about 50
nt, preferably at least about 100 nt. Algorithms for the selection
of primer sequences are generally known, and are available in
commercial software packages. Amplification primers hybridize to
complementary strands of DNA, and will prime towards each
other.
[0087] The HX2004-6 gene is isolated and obtained in substantial
purity, generally as other than an intact mammalian chromosome.
Usually, the DNA will be obtained substantially free of other
nucleic acid sequences that do not include an HX2004-6 sequence or
fragment thereof, generally being at least about 50%, usually at
least about 90% pure and are typically "recombinant", i.e. flanked
by one or more nucleotides with which it is not normally associated
on a naturally occurring chromosome.
[0088] The DNA sequences are used in a variety of ways. They can be
used in methods to detect HX2004-6 mRNA in a biological sample, as
described in more detail below.
[0089] They may also be used as probes for identifying homologs of
HX2004-6. Mammalian homologs have substantial sequence similarity
to one another, i.e. at least 75%, usually at least 90%, more
usually at least 95% sequence, identity. Sequence similarity is
calculated based on a reference sequence, which may be a subset of
a larger sequence, such as a conserved motif, coding region,
flanking region, etc. A reference sequence will usually be at least
about 18 nt long, more usually at least about 30 nt long, and may
extend to the complete sequence that is being compared. Algorithms
for sequence analysis are known in the art, such as BLAST,
described in Altschul et al. (1990) J Mol. Biol. 215:403-10. For
the purposes of this invention, sequence identity is determined by
the Smith-Waterman homology search algorithm as implemented in
MPSRCH program (Oxford Molecular). For the purposes of this
invention, a preferred method of calculating percent identity is
the Smith-Waterman algorithm, using the following. Global DNA
sequence identity must be greater than 65% as determined by the
Smith-Waterman homology search algorithm as implemented in MPSRCH
program (Oxford Molecular) using an affine gap search with the
following search parameters: gap open penalty, 12; and gap
extension penalty, 1.
[0090] Nucleic acids having sequence similarity are detected by
hybridization under low stringency conditions, for example, at
50.degree. C. and 6.times.SSC (0.9 M saline/0.09 M sodium citrate)
and remain bound when subjected to washing at 55.degree. C. in
1.times.SSC (0.15 M sodium chloride/0.015 M sodium citrate).
Sequences sharing a high degree of nucleotide sequence identity may
be determined by hybridization under high stringency conditions,
for example, at 50.degree. C. or higher and 0.1.times.SSC (15 mM
saline/0.15 mM sodium citrate). By using probes, particularly
labeled probes of DNA sequences, one can isolate homologous or
related genes. The source of homologous genes may be any species,
e.g. primate species, particularly human; rodents, such as rats and
mice, canines, felines, bovines, ovines, equines, yeast,
Drosophila, Caenhorabditis, etc.
[0091] The HX2004-6-encoding DNA may also be used to identify
expression of the gene in a biological specimen. The manner in
which one probes cells for the presence of particular nucleotide
sequences, as genomic DNA or RNA, is well established in the
literature and does not require elaboration here. mRNA may be
isolated from a cell sample, or may be detected without being first
isolated. mRNA may be amplified by RT-PCR, using reverse
transcriptase to form a complementary DNA strand, followed by
polymerase chain reaction amplification using primers specific for
the subject DNA sequences. Alternatively, mRNA sample is separated
by gel electrophoresis, transferred to a suitable support, e.g.
nitrocellulose, nylon, etc., and then probed with a fragment of the
subject DNA as a probe. Other techniques, such as oligonucleotide
ligation assays, in situ hybridizations, and hybridization to DNA
probes arrayed on a solid chip may also find use. Detection of mRNA
hybridizing to an HX2004-6 sequence is indicative of HX2004-6 gene
expression in the sample.
[0092] The HX2004-6 nucleic acid sequence may be modified for a
number of purposes, particularly where they will be used
intracellularly, for example, by being joined to a nucleic acid
cleaving agent, e.g. a chelated metal ion, such as iron or chromium
for cleavage of the gene; or the like.
[0093] The sequence of the HX2004-6 locus, including flanking
promoter regions and coding regions, may be mutated in various ways
known in the art to generate targeted changes in promoter strength,
sequence of the encoded protein, etc. The DNA sequence or product
of such a mutation will be substantially similar to the sequences
provided herein, i.e. will differ by at least one nucleotide or
amino acid, respectively, and may differ by at least two but
generally not more than about ten nucleotides or amino acids. The
sequence changes may be substitutions, insertions or deletions.
Deletions may further include larger changes, such as deletions of
a domain or exon. Other modifications of interest include epitope
tagging, e.g. with the FLAG system, HA, etc. For studies of
subcellular localization, fusion proteins with green fluorescent
proteins (GFP) may be used. Such mutated genes may be used to study
structure-function relationships of HX2004-6 polypeptides with
other polypeptides, or to alter properties of the proteins that
affect their function or regulation. Such modified HX2004-6
sequences can be used, for example, to generate transgenic
animals.
[0094] Techniques for in vitro mutagenesis of cloned genes are
known. Examples of protocols for scanning mutations may be found in
Gustin et al., 1993 Biotechniques 14:22 ; Barany, 1985 Gene
37:111-23; Colicelli et al., 1985 Mol Gen Genet 199:537-9; and
Prentki et al., 1984 Gene 29:303-13. Methods for site-specific
mutagenesis can be found in Sambrook et al., 1989 Molecular
Cloning: A Laboratory Manual, CSH Press, pp. 15.3-15.108; Weiner et
al., 1993 Gene 126:35-41; Sayers et al., 1992 Biotechniques
13:592-6; Jones and Winistorfer, 1992 Biotechniques 12:528-30;
Barton et al., 1990 Nucleic Acids Res. 18:7349-55; Marotti and
Tomich, 1989 Gene Anal. Tech. 6:67-70; and Zhu 1989 Anal. Biochem.
177:120-4.
[0095] Recombinant Vectors
[0096] The present invention further provides recombinant vectors
comprising an HX2004-6 polynucleotide of the invention. Recombinant
vectors are useful for propagation of the subject HX2004-6
polynucleotides (cloning vectors). They are also useful for
effecting expression of an HX2004-6 polynucleotide in a cell. The
choice of appropriate vector is well within the skill of the art. A
wide variety of vectors, both cloning vectors and expression
vectors, are known to those skilled in the art, have been described
in, inter alia, Current Protocols in Molecular Biology, (F. M.
Ausubel, et al., Eds. 1987, and updates), and can be used in the
present invention. Many such vectors are available
commercially.
[0097] The subject polynucleotides are generally propagated by
placing an HX2004-6 polynucleotide in a vector. Viral and non-viral
vectors can be used, including plasmids. The choice of plasmid will
depend on the type of cell in which propagation is desired and the
purpose of propagation. Certain vectors are useful for amplifying
and making large amounts of the desired DNA sequence.
[0098] Other vectors are suitable for expression in cells in
culture ("expression vectors"). These vectors will generally
include regulatory sequences ("control sequences" or "control
regions") which are necessary to effect the expression of an
HX2004-6 polynucleotide to which they are operably linked. Still
other vectors are suitable for transfer and expression in cells in
a whole organism or person.
[0099] Host Cells
[0100] The present invention further provides isolated host cells
comprising HX2004-6 polynucleotides of the invention. Suitable host
cells include prokaryotes such as E. coli, B. subtilis, S.
cerevisiae; and eukaryotic cells, including insect cells in
combination with baculovirus vectors, yeast cells, such as
Saccharomyces cerevisiae, or cells of a higher organism such as
vertebrates, particularly mammals, e.g. COS 7 cells, may be used as
the expression host cells. Host cells can be used for the purposes
of propagating an HX2004-6 polynucleotide, for production of an
HX2004-6 polypeptide, or in a screening method as described
below.
[0101] HX2004-6 Transgenic Animals
[0102] The HX2004-6-encoding nucleic acids can be used to generate
genetically modified non-human animals or site specific gene
modifications in cell lines. The term "transgenic" is intended to
encompass genetically modified animals having a deletion or other
knock-out of HX2004-6 gene activity, having an exogenous HX2004-6
gene that is stably transmitted in the host cells, "knock-in"
having altered HX2004-6 gene expression, or having an exogenous
HX2004-6 promoter operably linked to a reporter gene. Of particular
interest are homozygous and heterozygous knock-outs of
HX2004-6.
[0103] Transgenic animals may be made through homologous
recombination, where the HX2004-6 locus is altered. Alternatively,
a nucleic acid construct is randomly integrated into the genome.
Vectors for stable integration include plasmids, retroviruses and
other animal viruses, YACs (yeast artificial chromosomes), and the
like. Of interest are transgenic mammals, preferably a mammal from
a genus selected from the group consisting of Mus (e.g., mice),
Rattus (e.g., rats), Oryctologus (e.g., rabbits) and Mesocricetus
(e.g., hamsters). More preferably the animal is a mouse which is
defective or contains some other alteration in HX2004-6 gene
expression or function.
[0104] A "knock-out" animal is genetically manipulated to
substantially reduce, or eliminate endogenous HX2004-6 function,
preferably such that target gene expression is undetectable or
insignificant. Different approaches may be used to achieve the
"knock-out". A chromosomal deletion of all or part of the native
HX2004-6 homolog may be induced. Deletions of the non-coding
regions, particularly the promoter region, 3' regulatory sequences,
enhancers, or deletions of gene that activate expression of the
HX2004-6 genes. A functional knock-out may also be achieved by the
introduction of an anti-sense construct that blocks expression of
the native HX2004-6 gene (for example, see Li and Cohen (1996) Cell
85:319-329).
[0105] Conditional knock-outs of HX2004-6 gene function can also be
generated. Conditional knock-outs are transgenic animals that
exhibit a defect in HX2004-6 gene function upon exposure of the
animal to a substance that promotes target gene alteration,
introduction of an enzyme that promotes recombination at the target
gene site (e.g., Cre in the Cre-IoxP system), or other method for
directing the target gene alteration.
[0106] For example, a transgenic animal having a conditional
knock-out of HX2004-6 gene function can be produced using the
Cre-IoxP recombination system (see, e.g., Kilby et al. 1993 Trends
Genet 9:413-421). Cre is an enzyme that excises the DNA between two
recognition sequences, termed IoxP. This system can be used in a
variety of ways to create conditional knock-outs of HX2004-6. For
example, two independent transgenic mice can be produced: one
transgenic for an HX2004-6. sequence flanked by IoxP sites and a
second transgenic for Cre. The Cre transgene can be under the
control of an inducible or developmentally regulated promoter (Gu
et al. 1993 Cell 73:1155-1164; Gu et al. 1994 Science 265:103-106),
or under control of a tissue-specific or cell type-specific
promoter (e.g., a pancreas-specific promoter or brain
tissue-specific promoter). The HX2004-6 transgenic is then crossed
with the Cre transgenic to produce progeny deficient for the
HX2004-6 gene only in those cells that expressed Cre during
development.
[0107] Transgenic animals may be made having an exogenous HX2004-6
gene. For example, the transgenic animal may comprise a "knock-in"
of an HX2004-6 gene, such that the host cell genome contains an
alteration that results in altered expression (e.g., increased
(including ectopic) or decreased expression) of an HX2004-6 gene,
e.g., by introduction of an additional copy of the target gene, or
by operatively inserting a regulatory sequence that provides for
enhanced expression of an endogenous copy of the target gene.
"Knock-in" transgenics can be transgenic animals having a
heterozygous knock-in of the HX2004-6 gene or a homozygous knock-in
of the HX2004-6. "Knock-ins" also encompass conditional
knock-ins.
[0108] The exogenous gene introduced into the host cell genome to
produce a transgenic animal is usually either from a different
species than the animal host, or is otherwise altered in its coding
or non-coding sequence. The introduced gene may be a wild-type
gene, naturally occurring polymorphism, or a genetically
manipulated sequence, for example those previously described with
deletions, substitutions or insertions in the coding or non-coding
regions. The introduced sequence may encode an HX2004-6
polypeptide, or may utilize the HX2004-6 promoter operably linked
to a reporter gene. Where the introduced gene is a coding sequence,
it is usually operably linked to a promoter, which may be
constitutive or inducible, and other regulatory sequences required
for expression in the host animal.
[0109] Specific constructs of interest include, but are not limited
to, anti-sense HX2004-6, or a ribozyme based on an HX2004-6
sequence, which will block HX2004-6 expression, as well as
expression of dominant negative HX2004-6 mutations, and
over-expression of an HX2004-6 gene. A detectable marker, such as
lac Z may be introduced into the HX2004-6 locus, where upregulation
of expression of the HX2004-6 gene will result in an easily
detected change in phenotype. Constructs utilizing a promoter
region of the HX2004-6 genes in combination with a reporter gene or
with the coding region of HX2004-6 are also of interest. Constructs
having a sequence encoding a truncated or altered (e.g, mutated)
HX2004-6 are also of interest.
[0110] The modified cells or animals are useful in the study of
function and regulation of HX2004-6. Such modified cells or animals
are also useful in, for example, the study of the function and
regulation of genes whose expression is affected by HX2004. Thus,
the transgenic animals of the invention are useful in identifying
downstream targets of HX2004-6, as such targets may have a role in
the phenotypes associated with overexpression of HX2004-6.
[0111] Animals may also be used in functional studies, drug
screening, etc., e.g. to determine the effect of a candidate drug
on HX2004-6 expression. A series of small deletions and/or
substitutions may be made in the HX2004-6 genes to determine the
role of different polypeptide-encoding regions in DNA binding,
transcriptional regulation, etc. By providing expression of
HX2004-6 protein in cells in which it is otherwise not normally
produced (e.g., ectopic expression), one can induce changes in cell
behavior.
[0112] DNA constructs for homologous recombination will comprise at
least a portion of the HX2004-6gene with the desired genetic
modification, and will include regions of homology to the target
locus. DNA constructs for random integration need not include
regions of homology to mediate recombination. Conveniently, markers
for positive and negative selection are included. Methods for
generating cells having targeted gene modifications through
homologous recombination are known in the art. For various
techniques for transfecting mammalian cells, see Keown et al. 1990
Methods in Enzymology 185:527-537.
[0113] For embryonic stem (ES) cells, an ES cell line may be
employed, or embryonic cells may be obtained freshly from a host,
e.g. mouse, rat, guinea pig, etc. Such cells are grown on an
appropriate fibroblast-feeder layer or grown in the presence of
appropriate growth factors, such as leukemia inhibiting factor
(LIF). When ES cells have been transformed, they may be used to
produce transgenic animals. After transformation, the cells are
plated onto a feeder layer in an appropriate medium. Cells
containing the construct may be detected by employing a selective
medium. After sufficient time for colonies to grow, they are picked
and analyzed for the occurrence of homologous recombination or
integration of the construct. Those colonies that are positive may
then be used for embryo manipulation and blastocyst injection.
Blastocysts are obtained from 4 to 6 week old superovulated
females. The ES cells are trypsinized, and the modified cells are
injected into the blastocoel of the blastocyst. After injection,
the blastocysts are returned to each uterine horn of pseudopregnant
females. Females are then allowed to go to term and the resulting
litters screened for mutant cells having the construct. By
providing for a different phenotype of the blastocyst and the ES
cells, chimeric progeny can be readily detected.
[0114] The chimeric animals are screened for the presence of the
modified gene. Chimeric animals having the modification (normally
chimeric males are mated with wild-type animals to produce
heterozygotes, and the heterozygotes mated to produce homozygotes.
If the gene alterations cause lethality at some point in
development, tissues or organs can be maintained as allogeneic or
congenic grafts or transplants, or in in vitro culture.
[0115] Investigation of genetic function may utilize non-mammalian
models, particularly using those organisms that are biologically
and genetically well characterized, such as C. elegans, D.
melanogaster and S. cerevisiae. For example, transposon (Tc1)
insertions in the nematode homolog of an HX2004-6 gene or a
promoter region of an HX2004-6 gene may be made. The HX2004-6 gene
sequences may be used to knock-out or to complement defined genetic
lesions in order to determine the physiological and biochemical
pathways involved in development of a neoplasm. It is well known
that human genes can complement mutations in lower eukaryotic
models.
[0116] HX2004-6 Polypeptides
[0117] The invention provides isolated HX2004-6 polypeptides and
methods for making the polypeptides. HX2004-6 polypeptides include
polypeptides having the sequences shown in SEQ ID NO:2 and SEQ ID
NO:4, amino acids 1-342 of SEQ ID NO:2, amino acids 1-352 of SEQ ID
NO:4; variants thereof, particularly variants comprising
conservative amino acid substitutions; fragments thereof,
particularly fragments having at least about 5, usually at least
about 15, usually at least about 30 or more contiguous amino acids
of the aforementioned sequences; and fusion proteins thereof.
HX2004-6 polypeptides can be chemically synthesized, produced by
recombinant methods, isolated from a biological source, or a
combination of the foregoing.
[0118] HX2004-6-encoding nucleic acid may be employed to synthesize
full-length HX2004-6 polypeptides or fragments thereof, for
example, fragments at least about 8 amino acids in length, more
usually at least about 15 amino acids in length, to about 25 amino
acids, and up to the complete open reading frame of the HX2004-6
cDNA; and including fusions of the subject polypeptides to other
proteins or parts thereof. For expression, an expression cassette
may be employed, providing for a transcriptional and translational
initiation region, which may be inducible or constitutive, where
the coding region is operably linked under the transcriptional
control of the transcriptional initiation region, and a
transcriptional and translational termination region. Various
transcriptional initiation regions may be employed that are
functional in the expression host.
[0119] The polypeptides may be expressed in prokaryotes or
eukaryotes in accordance with conventional ways, depending upon the
purpose for expression. For large scale production of the protein,
a unicellular organism, such as E. coli, B. subtilis, S.
cerevisiae, or cells of a higher organism such as vertebrates,
particularly mammals, e.g. COS 7 cells, may be used as the
expression host cells. In many situations, it may be desirable to
express the HX2004-6 genes in mammalian cells, particularly
isolated mammalian cells, especially where the encoded polypeptides
will benefit from native folding and post-translational
modifications. Small peptides can also be synthesized in the
laboratory.
[0120] With the availability of the polypeptides in large amounts,
by employing an expression host, the polypeptides may be isolated
and purified in accordance with conventional ways. A lysate may be
prepared of the expression host and the lysate purified using HPLC,
exclusion chromatography, gel electrophoresis, affinity
chromatography, or other purification technique. The purified
polypeptide will generally be at least about 80% pure, preferably
at least about 90% pure, and may be up to and including 100% pure.
Pure is intended to mean free of other proteins, as well as
cellular debris.
[0121] Antibodies Specific for HX2004-6 Polypeptides
[0122] The invention further provides isolated antibodies specific
for HX2004-6 polypeptides of the invention. The HX2004-6
polypeptides can be used for the production of antibodies, where
short fragments provide for antibodies specific for the particular
polypeptide, and larger fragments or the entire protein allow for
the production of antibodies over the surface of the polypeptide.
Antibodies may be raised to the wild-type or variant forms of
HX2004-6. Antibodies may be raised to isolated peptides
corresponding to these domains, or to the native protein, e.g. by
immunization with cells expressing HX2004-6, immunization with
liposomes having HX2004-6 polypeptides inserted in the membrane,
etc.
[0123] Antibodies are prepared in accordance with conventional
ways, where the expressed polypeptide or protein is used as an
immunogen, by itself or conjugated to known immunogenic carriers,
e.g. KLH, pre-S HBsAg, other viral or eukaryotic proteins, or the
like. Various adjuvants may be employed, with a series of
injections, as appropriate. For monoclonal antibodies, after one or
more booster injections, the spleen is isolated, the lymphocytes
immortalized by cell fusion, and then screened for high affinity
antibody binding. The immortalized cells, i.e. hybridomas,
producing the desired antibodies may then be expanded. For further
description, see Monoclonal Antibodies: A Laboratory Manual, Harlow
and Lane eds., Cold Spring Harbor Laboratories, Cold Spring Harbor,
N.Y., 1988. If desired, the mRNA encoding the heavy and light
chains may be isolated and mutagenized by cloning in E. coli, and
the heavy and light chains mixed to further enhance the affinity of
the antibody. Alternatives to in vivo immunization as a method of
raising antibodies include binding to phage "display" libraries,
usually in conjunction with in vitro affinity maturation.
[0124] Isolation of HX2004-6 Allelic Variants and Homologs in Other
Species
[0125] Other mammalian HX2004-6 genes can be identified and
isolated and their function characterized using the HX2004-6 genes
used in the present invention. Other HX2004-6 genes of interest
include, but are not limited to, mammalian (e.g., human, rodent
(e.g, murine, or rat), bovine, feline, canine, and the like) and
non-mammalian (e.g., chicken, reptile, and the like). Methods for
identifying, isolating, sequencing, and characterizing an unknown
gene based upon its homology to a known gene sequence are well
known in the art (see, e.g., Sambrook et al., Molecular Cloning: A
Laboratory Manual, CSH Press 1989.
[0126] Detection Methods Using HX2004-6 Polynucleotides and
Antibodies of the Invention
[0127] The present invention provides detection methods using
HX2004-6 polynucleotides, and antibodies specific for HX2004-6
polypeptides of the invention. Detection methods using HX2004-6
polynucleotides include methods of detecting a level of HX2004-6
messenger RNA (mRNA) in a biological sample. These methods can be
used to monitor HX2004-6 mRNA levels in response to a treatment,
such as chemotherapy or radiation therapy, for treating pancreatic,
breast, or colon cancer; to assess the efficacy of a drug in
lowering HX2004-6 polynucleotide levels in a cell; to detect the
presence of cells in an individual or in a culture which
overexpress HX2004-6 mRNA, wherein the presence of a cell or cells
which overexpress HX2004-6 mRNA is indicative of the presence of
cancerous cells; in screening methods to detect agents which
modulate levels of HX2004-6 mRNA; and to monitor progression of a
cell from a normal to a neoplastic state. Detection methods to
detect the presence of a HX2004-6 polynucleotide can also be used
to detect a polymorphism in the HX2004-6 polynucleotide, which
polymorphism may be indicative or predictive of a predisposition to
develop pancreatic, breast, or colon cancer.
[0128] Similarly, the invention provides methods of detecting
HX2004-6 polypeptides in a biological sample. These methods can be
used to assess the efficacy of a drug in lowering HX2004-6
polypeptide levels in a cell; to detect the presence of cells in an
individual or in a culture which overexpress HX2004-6 protein,
wherein the presence of a cell or cells which overexpress HX2004-6
protein may be indicative of the presence of cancerous cells; in
screening methods to detect agents which modulate levels of
HX2004-6 polypeptides; and to monitor progression of a cell from a
normal to a neoplastic state. Detection methods to detect the
presence of a HX2004-6 polypeptide can also be used to detect the
presence an abnormal HX2004-6 polypeptide, such as a truncated
polypeptide, or other mutant HX2004-6 protein.
[0129] Methods of Detecting HX2004-6 mRNA in a Biological
Sample
[0130] The present invention provides methods of detecting an
HX2004-6 messenger RNA (mRNA) in a biological sample. Such methods
are useful diagnostic methods to assess the potential of a cell to
become neoplastic (where overexpression of HX2004-6 is an
indication that a cell is, or is pre-disposed to become,
neoplastic), to assess the efficacy of a chemotherapeutic regimen,
as part of a screening method to identify agents that reduce the
expression of HX2004-6 mRNA, and/or to detect the presence of a
cell(s) which overexpress HX2004-6 mRNA. The methods generally
involve contacting a biological sample with an HX2004-6
polynucleotide capable of hybridizing to an HX2004-6 mRNA, or the
complement thereof as appropriate, and detecting hybridization.
mRNA can be detected directly, or can first be reverse transcribed
into cDNA for analysis. In addition, multiple copies of the mRNA
can be made by amplification reactions, if desired.
[0131] mRNA may be isolated from a biological sample,.or may be
detected without being first isolated. Alternatively, the mRNA
sample is separated by gel electrophoresis, transferred to a
suitable support, e.g. nitrocellulose, nylon, etc., and then probed
with all or a fragment of HX2004-6 cDNA as a probe, and detecting
hybridization by Northern blotting, liquid hybridization
techniques, and the like. Where mRNA is being directly hybridized
to an HX2004-6 polynucleotide, the HX2004-6 polynucleotide
comprises a sequence complementary to the HX2004-6 mRNA being
detected.
[0132] Alternatively, mRNA may be amplified by RT-PCR, using
reverse transcriptase to form a complementary DNA strand, followed
by a polymerase chain reaction amplification using primers specific
for the subject DNA sequences.
[0133] For example, pancreatic cells may be used as a source of
mRNA, which may be assayed directly or reverse transcribed into
cDNA for analysis. The nucleic acid may be amplified by
conventional techniques, such as the polymerase chain reaction
(PCR), to provide sufficient amounts for analysis. The use of the
polymerase chain reaction is described in Saiki, et al. 1985
Science 239:487; a review of current techniques may be found in
Sambrook, et al. Molecular Cloning: A Laboratory Manual, CSH Press
1989, pp.14.2-14.33.
[0134] In some instances, it may be desirable to analyze many
samples at the same time for HX2004-6 mRNA expression levels. A
variety of arrays have been described, and can be used in these
methods. Quantitative monitoring of gene expression patterns with a
complementary DNA microarray is described in Schena et al. (1995)
Science 270:467. DeRisi et al. (1997) Science 270:680-686 explore
gene expression on a genomic scale. Analysis of gene expression
patterns in human cancer using a cDNA microarray is described in
DeRisi et al. (1996) Nat. Genet. 14:457. Expression analysis using
nucleic acid arrays is reviewed by Ramsay (1998) Nat. Biotech.
16:40-44. Methods for creating microarrays of biological samples,
such as arrays of DNA samples to be used in DNA hybridization
assays, are described in PCT publication no. WO 95/35505, published
Dec. 28, 1995; U.S. Pat. No. 5,445,934; Drmanac et al., Science
260:1649; and Yershov et al. (1996) Genetics 93:4913. Use of
differential display to identify differential gene expression is
described in, for example, U.S. Pat. No. 5,776,683; and U.S. Pat.
No. 5,807,680.
[0135] Methods for preparation of substrate matrices (e.g.,
arrays), design of oligonucleotides for use with such matrices,
labeling of probes, hybridization conditions, scanning of
hybridized matrices, and analysis of patterns generated, including
comparison analysis, are described in, for example, U.S. Pat. No.
5,800,992.
[0136] Other techniques, such as oligonucleotide ligation assays,
and in situ hybridizations, can also be used. In situ hybridization
is described in a variety of textbooks, including, for example,
Current Protocols in Molecular Biology, Ausubel et al., eds. For
example, a fragment of HX2004-6 cDNA, particularly and
oligonucleotide of about 18-30 nucleotides in length, can be
labeled, for example, with biotin, and used to probe a tissue
section. The tissue section can then be developed using an
avidin-coupled enzyme and a substrate for the enzyme which yields a
colored product. Counterstaining with, for example, hematoxylin and
eosin, according to standard protocols, can be carried out.
[0137] In other embodiments, mRNA is detected by amplifying
reverse-transcribed cDNA copies of the mRNA, using oligonucleotide
primers that are detectably labeled. In these embodiments, a
detectable label is included in an amplification reaction. Suitable
labels include fluorochromes, e.g. fluorescein isothiocyanate
(FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin,
6-carboxyfluorescein (6-FAM),
2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein (JOE),
6-carboxy-X-rhodamine (ROX),
6-carboxy-2',4',7',4,7-hexachlorofluorescein (HEX),
5-carboxyfluorescein (5-FAM) or N,N,N',N'-tetramethyl-6-carboxyrho-
damine (TAMRA), radioactive labels, e.g. .sup.32P, .sup.35S,
.sup.3H; etc. The label may be a two stage system, where the
amplified DNA is conjugated to biotin, haptens, etc. having a high
affinity binding partner, e.g. avidin, specific antibodies, etc.,
where the binding partner is conjugated to a detectable label. The
label may be conjugated to one or both of the primers.
Alternatively, the pool of nucleotides used in the amplification is
labeled, so as to incorporate the label into the amplification
product. Detection of the reverse-transcribed and amplified
HX2004-6 mRNA is achieved by standard methods to detect, as
appropriate, fluorescence, radioactivity, the product(s) of an
enzymatic reaction, etc.
[0138] Overexpression of HX2004-6 mRNA is assessed relative to an
appropriate control, e.g., a counterpart cell that is known to be
normal, and/or a cell line of the same cell type which is known to
have normal expression of HX2004-6 mRNA.
[0139] Methods of Detecting HX2004-6 Polypeptides in a Biological
Sample
[0140] The present invention further provides methods of detecting
HX2004-6 polypeptides in a biological sample. Antibodies specific
for HX2004-6 polypeptides can be used in these detection methods.
The methods generally comprise contacting a biological sample with
an antibody specific for an HX2004-6 polypeptide, and detecting
specific binding.
[0141] A sample is taken from a patient suspected of having an
HX2004-6-associated disorder. Samples, as used herein, include
tissue biopsies, biological fluids, organ or tissue culture derived
fluids, and fluids extracted from physiological tissues, as well as
derivatives and fractions of such fluids. If the polypeptide to be
detected is associated with a cell, the number of cells in a sample
will generally be at least about 10.sup.3, usually at least
10.sup.4 more usually at least about 10.sup.5. The cells may be
dissociated, in the case of solid tissues, or tissue sections may
be analyzed. Alternatively a lysate of the cells may be
prepared.
[0142] Diagnosis may be performed by a number of methods. The
different methods all determine the absence or presence of HX2004-6
polypeptide in the biological sample being tested. For example,
detection may utilize staining of cells or histological sections,
performed in accordance with conventional methods. Antibodies
specific for HX2004-6 polypeptides are added to the cell sample,
and incubated for a period of time sufficient to allow binding to
the epitope(s), usually at least about 10 minutes. The antibody may
be labeled with radioisotopes, enzymes, fluorescers,
chemiluminescers, or other labels for direct detection.
Alternatively, a second stage antibody or reagent is used to
amplify the signal. Such reagents are well known in the art. For
example, the primary antibody may be conjugated to biotin, with
horseradish peroxidase-conjugated avidin added as a second stage
reagent. Final detection uses a substrate that undergoes a color
change in the presence of the peroxidase. The absence or presence
of antibody binding may be determined by various methods, including
flow cytometry of dissociated cells, microscopy, radiography,
scintillation counting, etc.
[0143] An alternative method for diagnosis depends on the in vitro
detection of binding between antibodies and HX2004-6 polypeptides
in a cell lysate or other biological fluid. Measuring the
concentration of HX2004-6 binding in a sample or fraction thereof
may be accomplished by a variety of specific assays. A conventional
sandwich type assay may be used. For example, a sandwich assay may
first attach HX2004-6-specific antibodies to an insoluble surface
or support. The particular manner of binding is not crucial so long
as it is compatible with the reagents and overall methods of the
invention. They may be bound to the plates covalently or
non-covalently.
[0144] The insoluble supports may be any compositions to which
polypeptides can be bound, which is readily separated from soluble
material, and which is otherwise compatible with the overall
method. The surface of such supports may be solid or porous and of
any convenient shape. Examples of suitable insoluble supports to
which the receptor is bound include beads, e.g. magnetic beads,
membranes and microtiter plates. These are typically made of glass,
plastic (e.g. polystyrene), polysaccharides, nylon or
nitrocellulose. Microtiter plates are especially convenient because
a large number of assays can be carried out simultaneously, using
small amounts of reagents and samples.
[0145] Cell lysates (or other biological fluid) are then added to
separately assayable supports (for example, separate wells of a
microtiter plate) containing antibodies. Preferably, a series of
standards, containing known concentrations of normal and/or
abnormal HX2004-6 is assayed in parallel with the samples or
aliquots thereof to serve as controls. Preferably, each sample and
standard will be added to multiple wells so that mean values can be
obtained for each. The incubation time should be sufficient for
binding, generally, from about 0.1 to 3 hours is sufficient. After
incubation, the insoluble support is generally washed of non-bound
components. Generally, a dilute non-ionic detergent medium at an
appropriate pH, generally 7-8, is used as a wash medium. From one
to six washes may be employed, with sufficient volume to thoroughly
wash non-specifically bound proteins present in the sample.
[0146] After washing, a solution containing a second antibody is
applied. The antibody will bind HX2004-6 with sufficient
specificity such that it can be distinguished from other components
present. The second antibodies may be labeled to facilitate direct,
or indirect quantification of binding. Examples of labels that
permit direct measurement of second receptor binding include
radiolabels, such as .sup.3H or 125I, fluorescers, dyes, beads,
chemiluminescers, colloidal particles, and the like. Examples of
labels which permit indirect measurement of binding include enzymes
where the substrate may provide for a colored or fluorescent
product. In a preferred embodiment, the antibodies are labeled with
a covalently bound enzyme capable of providing a detectable product
signal after addition of suitable substrate. Examples of suitable
enzymes for use in conjugates include horseradish peroxidase,
alkaline phosphatase, malate dehydrogenase and the like. Where not
commercially available, such antibody-enzyme conjugates are readily
produced by techniques known to those skilled in the art. The
incubation time should be sufficient for the labeled ligand to bind
available molecules. Generally, from about 0.1 to 3 hr is
sufficient, usually 1 hr sufficing.
[0147] After the second binding step, the insoluble support is
again washed free of non-specifically bound material. The signal
produced by the bound conjugate is detected by conventional means.
Where an enzyme conjugate is used, an appropriate enzyme substrate
is provided so a detectable product is formed.
[0148] Other immunoassays are known in the art and may find use as
diagnostics. Ouchterlony plates provide a simple determination of
antibody binding. Western blots may be performed on protein gels or
protein spots on filters, using a detection system specific for
HX2004-6 as desired, conveniently using a labeling method as
described for the sandwich assay. Antibody arrays may be formed
wherein antibody specific for HX2004-6 polypeptide is attached to a
solid support and, after allowing binding of a test sample,
HX2004-6 polypeptide is detected using a detectably labeled
antibody specific for HX2004-6 polypeptide.
[0149] Screening Assays
[0150] The transgenic animals, recombinant host cells,
polynucleotides, and antibodies of the invention can be used to
identify candidate agents that affect HX2004-6 expression (e.g., by
affecting HX2004-6 promoter function) or that interact with
HX2004-6 polypeptides. Agents of interest can include those that
enhance, inhibit, regulate, or otherwise affect HX2004-6
expression. Of particular interest are agents that reduce
expression of HX2004-6. Agents that reduce HX2004-6 expression can
be used to, for example, treat or study disorders associated with
overexpression of HX2004-6 (e.g., pancreatic, breast, and/or colon
cancer. "Candidate agents" is meant to include synthetic molecules
(e.g., small molecule drugs, peptides, or other synthetically
produced molecules or compounds, as well as recombinantly produced
gene products) as well as naturally occurring compounds (e.g.,
polypeptides, hormones, plant extracts, and the like). In the
screening assays of the invention, results obtained with test
substances are compared to results obtained with appropriate
controls. An appropriate control is provided by conducting the
assay in the absence of the test substance.
[0151] Drug Screening Assays
[0152] Of particular interest in the present invention is the
identification of agents that have activity in affecting HX2004-6
expression and/or function. Such agents are candidates for
development of treatments for, for example, cancer or other
condition that may be associated with overexpression of HX2004-6.
Drug screening identifies agents that provide for down-regulation
of HX2004-6 expression or function in affected cells. Of particular
interest are screening assays for agents that have a low toxicity
for human cells.
[0153] The term "agent" as used herein describes any molecule, e.g.
protein or pharmaceutical, with the capability of reducing
expression of HX2004-6 and/or of reducing HX2004-6 polypeptide
function. Generally a plurality of assay mixtures are run in
parallel with different agent concentrations to obtain a
differential response to the various concentrations. Typically, one
of these concentrations serves as a negative control, i.e. at zero
concentration or below the level of detection.
[0154] Candidate agents encompass numerous chemical classes, though
typically they are organic molecules, preferably small organic
compounds having a molecular weight of more than 50 and less than
about 2,500 daltons. Candidate agents comprise functional groups
necessary for structural interaction with proteins, particularly
hydrogen bonding, and typically include at least an amine,
carbonyl, hydroxyl or carboxyl group, preferably at least two of
the functional chemical groups. The candidate agents often comprise
cyclical carbon or heterocyclic structures and/or aromatic or
polyaromatic structures substituted with one or more of the above
functional groups. Candidate agents are also found
among-biomolecules including, but not limited to: peptides,
saccharides, fatty acids, steroids, purines, pyrimidines,
derivatives, structural analogs or combinations thereof.
[0155] Candidate agents are obtained from a wide variety of sources
including libraries of synthetic or natural compounds. For example,
numerous means are available for random and directed synthesis of a
wide variety of organic compounds and biomolecules, including
expression of randomized oligonucleotides and oligopeptides.
Alternatively, libraries of natural compounds in the form of
bacterial, fungal, plant and animal extracts are available or
readily produced. Additionally, natural or synthetically produced
libraries and compounds are readily modified through conventional
chemical, physical and biochemical means, and may be used to
produce combinatorial libraries. Known pharmacological agents may
be subjected to directed or random chemical modifications, such as
acylation, alkylation, esterification, amidification, etc. to
produce structural analogs.
[0156] Screening of Candidate Agents In Vivo
[0157] Agents can be screened for their ability to affect HX2004-6
expression or function or to mitigate an undesirable phenotype
(e.g., a symptom) associated with an alteration in HX2004-6
expression or function. In some embodiments, screening of candidate
agents is performed in vivo in a transgenic animal described
herein. Transgenic animals suitable for use in screening assays
include any transgenic animal having an alteration in HX2004-6
expression, and can include transgenic animals having, for example,
an exogenous and stably transmitted human HX2004-6 gene sequence, a
reporter gene composed of an isolated human HX2004-6 promoter
sequence operably linked to a reporter gene (e.g,.
.beta.-galactosidase, CAT, luciferase, or other gene that can be
easily assayed for expression), or a homozygous or heterozygous
knockout of an HX2004-6 gene. The transgenic animals can be either
homozygous or heterozygous for the genetic alteration and, where a
sequence is introduced into the animal's genome for expression, may
contain multiple copies of the introduced sequence. Where the in
vivo screening assay is to identify agents that affect the activity
of the HX2004-6 promoter, the HX2004-6 promoter can be operably
linked to a reporter gene (e.g., luciferase) and integrated into
the non-human host animal's genome.
[0158] The candidate agent is administered to a non-human,
transgenic animal having altered HX2004-6 expression, and the
effects of the candidate agent determined. The candidate agent can
be administered in any manner desired and/or appropriate for
delivery of the agent in order to effect a desired result. For
example, the candidate agent can be administered by injection
(e.g., by injection intravenously, intramuscularly, subcutaneously,
or directly into the tissue in which the desired affect is to be
achieved), orally, or by any other desirable means. Normally, the
in vivo screen will involve a number of animals receiving varying
amounts and concentrations of the candidate agent (from no agent to
an amount of agent that approaches an upper limit of the amount
that can be delivered successfully to the animal), and may include
delivery of the agent in different formulation. The agents can be
administered singly or can be combined in combinations of two or
more, especially where administration of a combination of agents
may result in a synergistic effect.
[0159] The effect of agent administration upon the transgenic
animal can be monitored by assessing HX2004-6 function as
appropriate (e.g., by examining expression of a reporter or fusion
gene), or by assessing a phenotype associated with the HX2004-6
expression. For example, where the transgenic animal used in the
screen exhibits overexpression of HX2004-6, the effect of the
candidate agent can be assessed by determining levels of HX2004-6
mRNA produced in normal non-transgenic littermates and/or in
wildtype mice Levels of HX2004-6 mRNA can be measured using
techniques that are well known in the art. Where the in vivo
screening assay is to identify agents that affect the activity of
the HX2004-6 promoter and the non-human transgenic animal (or
cultured mammalian cell line) comprises an HX2004-6 promoter
operably linked to a reporter gene, the effects of candidate agents
upon HX2004-6 promoter activity can be screened by, for example,
monitoring the expression from the HX2004-6 promoter (through
detection of the reporter gene) and correlation of altered HX2004-6
promoter activity an aberrant cellular phenotype, such as aberrant
mitotic activity, or other indications of neoplastic
transformation. Alternatively or in addition, HX2004-6 promoter
activity can be assessed by detection (qualitative or quantitative)
of HX2004-6 mRNA or protein levels. Where the candidate agent
affects HX2004-6 expression, and/or affects an HX2004-6-associated
phenotype, in a desired manner, the candidate agent is identified
as an agent which may be suitable for use in therapy of an
HX2004-6-associated disorder in vivo.
[0160] Screening of Candidate Agents Using Cell-Based Assays
[0161] In addition to screening of agents in HX2004-6 transgenic
animals, a wide variety of cell-based assays may be used for this
purpose, using, for example, a mammalian cell transformed with a
construct comprising HX2004-6 cDNA such that the cDNA is
overexpressed, or, alternatively, a construct comprising an
HX2004-6 promoter operably linked to a reporter gene.
[0162] Accordingly, the present invention provides a method for
identifying an agent, particularly a biologically active agent,
that modulates a level of human HX2004-6 expression in a cell, the
method comprising: combining a candidate agent to be tested with a
cell comprising a nucleic acid which encodes a human HX2004-6
polypeptide; and determining the effect of said agent on HX2004-6
expression. "Modulation" of HX2004-6 expression levels includes
increasing the level and decreasing the level of HX2004-6 mRNA
and/or HX2004-6 polypeptide encoded by the HX2004-6 polynucleotide
when compared to a control lacking the agent being tested. An
increase or decrease of about 1.25-fold, usually at least about
1.5-fold, usually at least about 2-fold, usually at least about
5-fold, usually at least about 10-fold or more, in the level (i.e.,
an amount) of HX2004-6 mRNA and/or polypeptide following contacting
the cell with a candidate agent being tested, compared to a control
to which no agent is added, is an indication that the agent
modulates HX2004-6 expression.
[0163] An agent being tested for its effect on HX2004-6 expression
is assessed for any cytotoxic activity it may exhibit toward the
cell used in the assay, using well-known assays, such as trypan
blue dye exclusion, an MTT
([3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium
bromide]) assay, and the like. Agents that do not exhibit cytotoxic
activity are considered candidate agents.
[0164] The cells used in the assay are usually mammalian cells,
including, but not limited to, rodent cells and human cells. The
cells may be primary cultures of ductal epithelial cells, or may be
immortalized cell lines.
[0165] HX2004-6 mRNA and/or polypeptide whose levels are being
measured can be encoded by an endogenous HX2004-6 polynucleotide,
or the HX2004-6 polynucleotide can be one that is comprised within
a recombinant vector and introduced into the cell, i.e., the
HX2004-6 mRNA and/or polypeptide can be encoded by an exogenous
HX2004-6 polynucleotide. For example, a recombinant vector may
comprise an isolated human HX2004-6 transcriptional regulatory
sequence, such as a promoter sequence, operably linked to a
reporter gene (e.g,. .beta.-galactosidase, CAT, luciferase, or
other gene that can be easily assayed for expression). In these
embodiments, the method for identifying an agent that modulates a
level of human HX2004-6 expression in a cell, comprises: combining
a candidate agent to be tested with a cell comprising a nucleic
acid which comprises a human HX2004-6 gene transcriptional
regulatory element operably linked to a reporter gene; and
determining the effect of said agent on reporter gene expression. A
recombinant vector may comprise comprise an isolated human HX2004-6
transcriptional regulatory sequence, such as a promoter sequence,
operably linked to sequences coding for an HX2004-6 polypeptide; or
the transcriptional control sequences can be operably linked to
coding sequences for an HX2004-6 fusion protein comprising HX2004-6
polypeptide fused to a polypeptide which facilitates detection. In
these embodiments, the method comprises combining a candidate agent
to be tested with a cell comprising a nucleic acid which comprises
a human HX2004-6 gene transcriptional regulatory element operably
linked to an HX2004-6 polypeptide-coding sequence; and determining
the effect of said agent on HX2004 expression, which determination
can be carried out by measuring an amount of HX2004-6 mRNA,
HX2004-6 polypeptide, or HX2004-6 fusion polypeptide produced by
the cell.
[0166] Cell-based assays generally comprise the steps of contacting
the cell with an agent to be tested, forming a test sample, and,
after a suitable time, assessing the effect of the agent on
HX2004-6 expression. A control sample comprises the same cell
without the candidate agent added. HX2004-6 expression levels are
measured in both the test sample and the control sample. A
comparison is made between HX2004-6 expression level in the test
sample and the control sample. HX2004-6 expression can be assessed
using conventional assays. For example, when a mammalian cell line
is transformed with a construct that results in expression of
HX2004-6, HX2004-6 mRNA levels can be detected and measured, as
described above, or HX2004-6 polypeptide levels can be detected and
measured, as described above. A suitable period of time for
contacting the agent with the cell can be determined empirically,
and is generally a time sufficient to allow entry of the agent into
the cell and to allow the agent to have a measurable effect on
HX2004-6 mRNA and/or polypeptide levels. Generally, a suitable time
is between 10 minutes and 24 hours, more typically about 1-8 hours.
Methods of measuring HX2004-6 mRNA levels are known in the art,
several of which have been described above, and any of these
methods can be used in the methods of the present invention to
identify an agent which modulates HX2004-6 mRNA level in a cell,
including, but not limited to, a PCR, such as a PCR employing
detectably labeled oligonucleotide primers, and any of a variety of
hybridization assays. Similarly, HX2004-6 polypeptide levels can be
measured using any standard method, several of which have been
described herein, including, but not limited to, an immunoassay
such as ELISA, for example an ELISA employing a detectably labeled
antibody specific for an HX2004-6 polypeptide.
[0167] The method described above is useful for identifying agents
which may be useful in treating certain cancers. An agent which
reduces HX2004-6 expression and is not cytotoxic is considered a
possible agent for treatment of adenocarcinomas of pancreatic,
breast, and colon ductal epithelial cell origin, e.g., to
facilitate tumor regression, reduction in tumor mass, etc. Such
agents are then further evaluated for safety and efficacy.
[0168] Screening of Candidate Agents Using Cell-Free Assays
[0169] Cell-free assays, i.e., assays which measure HX2004-6
polypeptide levels or function directly, include, but are not
limited to, labeled in vitro protein-protein binding assays,
protein-DNA binding assays, electrophoretic mobility shift assays,
immunoassays for protein binding, and the like. Using these
methods, one can identify substances that bind specifically to
HX2004-6 polypeptides. Such substances are useful as diagnostic
agents to detect the presence of and/or to measure a level of
HX2004-6 polypeptide in a biological.
[0170] The screening assay can be a binding assay, wherein one or
more of the molecules may be joined to a label, and the label
directly or indirectly provide a detectable signal. Various labels
include radioisotopes, fluorescers, chemiluminescers, enzymes,
specific binding molecules, particles, e.g. magnetic particles, and
the like. Specific binding molecules include pairs, such as biotin
and streptavidin, digoxin and antidigoxin etc. For the specific
binding members, the complementary member would normally be labeled
with a molecule that provides for detection, in accordance with
known procedures.
[0171] A variety of other reagents may be included in the screening
assays described herein. Where the assay is a binding assay, these
include reagents like salts, neutral proteins, e.g. albumin,
detergents, etc that are used to facilitate optimal protein-protein
binding, protein-DNA binding, and/or reduce non-specific or
background interactions. Reagents that improve the efficiency of
the assay, such as protease inhibitors, nuclease inhibitors,
anti-microbial agents, etc. may be used. The components are added
in any order that provides for the requisite binding. Incubations
are performed at any suitable temperature, typically between 4 and
40.degree. C. Incubation periods are selected for optimum activity,
but may also be optimized to facilitate rapid high-throughput
screening. Typically between 0.1 and 1 hours will be
sufficient.
[0172] Many mammalian genes have homologs in yeast and lower
animals. The study of such homologs' physiological role and
interactions with other proteins in vivo or in vitro can facilitate
understanding of biological function. In addition to model systems
based on genetic complementation, yeast has been shown to be a
powerful tool for studying protein-protein interactions through the
two hybrid system described in Chien et al. 1991 Proc. Natl. Acad.
Sci. USA 88:9578-9582. Two-hybrid system analysis is of particular
interest for exploring transcriptional activation by HX2004-6
proteins and to identify cDNAs encoding polypeptides that interact
with HX2004-6.
[0173] Identified Candidate Agents
[0174] The compounds having the desired activity (i.e., modulation
of HX2004-6 expression) may be administered in a physiologically
acceptable carrier to a host for treatment of a condition
attributable to overexpression of HX2004-6 (e.g. a neoplasm of a
pancreatic, breast, or colon cell, particular an adenocarcinoma of
one of these tissues). The therapeutic agents may be administered
in a variety of ways, orally, topically, parenterally e.g.
subcutaneously, intraperitoneally, by viral infection,
intravascularly, etc. Depending upon the manner of introduction,
the compounds may be formulated in a variety of ways. The
concentration of therapeutically active compound in the formulation
may vary from about 0.1-100 wt. %.
[0175] The pharmaceutical compositions can be prepared in various
forms, such as granules, tablets, pills, suppositories, capsules,
suspensions, salves, lotions and the like. Pharmaceutical grade
organic or inorganic carriers and/or diluents suitable for oral and
topical use can be used to make up compositions containing the
therapeutically-active compounds. Diluents known to the art include
aqueous media, vegetable and animal oils and fats. Stabilizing
Agents, wetting and emulsifying Agents, salts for varying the
osmotic pressure or buffers for securing an adequate pH value, and
skin penetration enhancers can be used as auxiliary agents.
EXAMPLES
[0176] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to carry out the invention and is not intended
to limit the scope of what the inventors regard as their invention.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g., amounts, temperatures, etc.), but some experimental
error and deviation should be accounted for. Unless indicated
otherwise, parts are parts by weight, molecular weight is average
molecular weight, temperature is in degrees Celcius, and pressure
is at or near atmospheric.
Example 1
Identification of a Message Differentially Expressed in Pancreatic
Cancer Cells
[0177] A family was identified that had several members who had
been diagnosed with pancreatic cancer. The family members also have
a form of diabetes. The pathological features of disease in the
family included progression from normal to metaplasia to dysplasia
to cancer. Tissues were obtained from a member of the family
diagnosed with pancreatic cancer and from a member of the family
diagnosed with dysplasia of pancreatic cells, and primary cultures
of ductal cells prepared according to methods well known in the
art. Tissue was also obtained from an unrelated person who was
diagnosed with pancreatitis, and from an unrelated person who had a
normal pancreas, and primary cultures of ductal cells prepared
according to methods well known in the art.
[0178] The Genomyx HIEROGLYPH.TM. mRNA profile kit for differential
display analysis was used according to the manufacturer's
instructions to identify genes that are differentially expressed in
the various samples relative to one another. Briefly, RNA was
extracted from primary cultures of ductal epithelial cells obtained
from patients with normal pancreas, nonspecific pancreatitis,
pancreatic dysplasia and pancreatic carcinoma. Two .mu.g of total
RNA prepared by the guanidinium method was reverse-transcribed with
anchored oligo-dT primer in a 10 .mu.l reaction volume. Two .mu.l
of each reaction was subjected to PCR using 200 primer pairs to
profile gene expression. [.alpha.-32P]dCTP (Amersham Pharmacia
Biotech Inc., Piscataway, N.J.) was included in the PCR reaction.
The PCR products were then separated on 6% sequencing gels using a
GenomyxLR sequencer. The dried gels were subjected to
autoradiography on Kodak BioMax films (33.times.61 cm).
[0179] The cDNA fragment pattern in each sample was manually
compared to the cDNA fragment pattern in every other sample on the
gel. The results, depicted in FIG. 1, show that cDNA 2004-6
(HX2004-6) is expressed in ductal epithelial cells of pancreatic
tissue from individuals with pancreatic dysplasia and individuals
with pancreatic cancer. In contrast, the transcript was not
detectable in normal and pancreatitis samples. Thus, an alternative
name assigned to the gene is PCD1 (pancreatic cancer-derived).
Example 2
Isolation and Sequencing of a Human HX2004-6 Polypeptide-Encoding
Polynucleotide
[0180] A band representing a differentially expressed gene product
(i.e., a band associated with relatively more or less cDNA in one
sample relative to another) was cut from the gel, amplified,
cloned, and sequenced. The polynucleotide sequence of cDNA
fragments isolated from one such differentially displayed cDNA
fragment was identified as being differentially regulated in
pancreatic disease and potentially other cancers. A cDNA library
prepared from the human colon cell line HT29 was screened to
isolate a full-length cDNA. This 4,612-nucleotide sequence ("clone
1") is given as SEQ ID NO:1 in the sequence listing, and depicted
in FIG. 2. The predicted translation product of this polynucleotide
is a 1054-amino acid polypeptide (provided as SEQ ID NO:2). Another
clone ("clone 2") was sequenced, and was found to differ from the
sequence shown in SEQ ID NO: 1 by an insertion of 30 nucleotides
(bold, underlined, lower-case lettering in FIG. 3). Its sequence is
provided as SEQ ID NO:3 in the sequence listing. Translation of
this polynucleotide predicts a translation product of 1064 amino
acids (provided as SEQ ID NO:4). The deduced amino acid sequence
contains a PDZ domain in the middle (amino acid residues 427-504)
and a highly conserved LIM domain at the C-terminus (amino acid
residues 995-1053) (FIG. 3).
[0181] PDZ domains (also called DHR or GLGF domains) are found in
diverse membrane-proteins including members of the MAGUK family of
guanylate kinase homologues, several protein phosphatases and
kinases, neuronal nitric oxide synthase, and several
dystrophin-associated proteins, collectively known as syntrophins.
Many PDZ domain-containing proteins appear to be localized to
highly specialized submembranous sites. LIM domains are
cysteine-rich domains that bind zinc ions, and which act as the
interface for interface for protein-protein interaction. The LIM
domain of HX2004-6 matched well with the LIM consensus motif
CX.sub.2CX.sub.16-23HX.sub.2CX.sub.2CX.sub.2C.sub.16-21CX.sub.2-3(C/H/D).
Example 3
Comparison of SEQ ID NO: 1 with Sequences in Database
[0182] The sequence given as SEQ ID NO:1 was used as a query
sequence to search for similar sequences in GenBank, using the
BLASTN (2.0.8) program with default parameters. Altschul et al.
(1997) Nucl. Acids. Res. 25:3389-3402. A 2224-nucleotide sequence
having 100% nucleotide identity with nucleotides 1725-3863 of SEQ
ID NO: 1 was identified. This sequence (GenBank Accession No.
AB020665) is a human cDNA clone, from brain tissue, which encodes a
polypeptide termed KIAA0858. Nagase et al. (1998) DNA Res.
5:355-364. Comparison of the predicted translation product of SEQ
ID NO: 1 with the translation product of the sequence found in
GenBank revealed 100% amino acid sequence identity between amino
acids 343-1054 of HX 2004-6 clone 1 polypeptide sequence and the
KIAA0858 protein sequence.
[0183] Another sequence was found which shares 100% nucleotide
sequence identity with nucleotides 2837-3863 of SEQ ID NO: 1. This
sequence (GenBank Accession No. U90654) is a partial cDNA sequence,
from mRNA isolated from human pancreas, encoding a putative human
zinc-finger domain. Comparison of the amino acid sequence revealed
100% amino acid sequence identity between amino acids 714-1054 of
the predicted translation product of SEQ ID NO: 1 and amino acids
of the predicted translation product of U90654.
Example 4
Analysis of Tissue and Cell Type Distribution of 2004
Expression
[0184] To determine the tissue and cell type distribution of HX2004
expression, the HX2004 cDNA clone was used as a template for PCR to
generate a radiolabeled probe corresponding to a portion of the
cDNA clone. This radiolabeled fragment ("the PCR-2004 probe" or
"the 2004-6 probe") was used to probe various RNA blots. This probe
corresponds to nucleotides 559 to 1107 of SEQ ID NO:3, is denoted
by bold lettering in FIG. 3, and is given here as SEQ ID NO:5.
[0185] When the 2004-6 probe was used as a hybridization probe with
multiple tissue RNA blots (Clontech), a 4.6-kb band was observed in
heart, placenta, lung, liver, kidney, and pancreas, as shown in
FIG. 4. A band corresponding to an approximately 6-kb mRNA species
was seen in heart, brain, lung, liver, and skeletal muscle. Thus,
mRNA hybridizing with the 2004-6 probe is found in a variety of
normal tissues. In addition, tissue-specific splicing event(s) may
lead to messages of different lengths.
[0186] A multiple tissue RNA blot containing RNA from various
cancer cell lines was hybridized with the 2004-6 probe (upper
panels) and, to control for amount of RNA loaded per lane, a
.beta.-actin probe (lower panels). The results, depicted in FIG. 5,
show that the 4.6-kb band was observed in HeLa, MOLT-4
(lymphoblastic leukemia), SW480 (colorectal adenocarcinoma), and
faintly in A549 (lung carcinoma) cells.
[0187] To assess whether expression of HX2004 mRNA is associated
with a particular cancerous state, a human tumor mRNA Northern blot
(Invitrogen) was probed with the PCR-2004 probe. The data,
presented in FIG. 6, show that the HX2004-6 message is detected in
breast and colon tumors. Lanes marked "T" in the left-hand panels
are breast tumor tissue samples. The first and third lanes marked
"T" are invasive ductal carcinomas, while second lane marked "T" is
a poorly differentiated invasive ductal carcinoma. Lane N in the
left-hand panels is normal breast tissue. Lanes marked "T" in the
right-hand panels are colon adenocarcinomas, and Lane N in the
right-hand panels is normal colon tissue. HX2004-6 transcripts were
also detected in normal tissues. This likely reflects the fact that
the tissues used to prepare the human tumor material comprise many
different cell types, including ductal epithelial cells.
[0188] A variety of colon cancer cell lines were analyzed by
Northern blot using the 2004-6 probe. The results, shown in FIG. 7,
show that eight cell lines strongly express mRNA hybridizing with
the 2004-6 probe; three cell lines show moderate levels of mRNA
hybridizing with the 2004-6 probe; and three cell lines show low or
undetectable expression of mRNA hybridizing with the 2004-6
probe.
Example 5
In Situ Hybridization Analysis of HX2004-6 Expression in Breast,
Pancreas, and Colon Cancer Tissue Sections
[0189] In view of the fact that the tissue samples analyzed in the
Northern analysis described in Example 4 comprise many different
cell types, and thus would not assess differential expression in
any one cell type, in situ hybridization analyses were conducted.
Since these analyses use tissue sections, HX2004-6 expression
levels in individual cell types can be evaluated.
[0190] Normal and cancerous tissue sections were obtained from
colon, breast, liver, lung, pancreas, stomach, and prostate tissues
using standard methods. The sections were fixed with 4%
paraformaldehyde fixative, then overlaid with a mixture of
oligonucleotide probes corresponding to HX2004-6, as follows:
1 Oligo #2 5'- GTAACTTTTTCGACGATCTTTCCAC -3' (SEQ ID NO: 6) Oligo
#4 5'- TATTTTCTGCATCTCCTCGTAACGC -3' (SEQ ID NO: 7) Oligo #6 5'-
TGACATCACTCATGGACTTACTCCC -3' (SEQ ID NO: 8) Oligo #8 5'-
GTTCCATCTGCTTCTGTATAAACCG -3' (SEQ ID NO: 9) Oligo #13 5'-
TCTGTTATCCTCATGTTTGTCTGGC -3' (SEQ ID NO: 10) Oligo #14 5'-
TCTGGCTTTTTCTTTCTCAAAGTGC -3' (SEQ ID NO: 11) Oligo #16 5'-
AAGTGCTGGTACATAGATGGCTGTC -3' (SEQ ID NO: 12) Oligo #18 5'-
TCTACTTTTGTTGGGGTTGAAAACG -3' (SEQ ID NO: 13) Oligo #19 5'-
TGTGTCACTTTCAAAAACTTCACGC -3' (SEQ ID NO: 14) Oligo #21 5'-
AGAGCAGCTTGTCTATGAACTCCAG -3' (SEQ ID NO: 15)
[0191] The oligonucleotides were labeled with fluorescein
isothiocyanate (FITC) according to standard procedures. Normal and
cancerous tissue was stained with hematoxylin-eosin. Hybridization
was detected using the Super Sensitive ISH Detection System kit
from Biogenex Laboratories, Inc., San Ramon, Calif. All procedures
were carried out as instructed in the protocol provided by the
manufacturer.
[0192] Table 1 summarizes the mRNA expression of HX2004-6 in 7
different tissues which we examined and FIG. 8 shows percentages of
tissues which are positive for HX2004-6.
2TABLE 1 Summary of HX2004-6 expression in tumor and normal tissues
detected by in situ hybridization. Tumor Normal Tissue + - Total +
- Total Colon 65 73 138 4 44 48 Breast 76 103 179 3 26 29 Liver 51
0 51 1 7 8 Lung 20 0 20 0 8 8 Pancreas 7 0 7 0 4 4 Stomach 2 1 3 0
8 8 Prostate 4 0 4 2 12 14 =: strong expression; -: weak or no
detectable expression
[0193] For all seven tumor tissues, HX2004-6 expression is highly
expressed in a significant portion of the samples tested; in
contrast, few or none showed positive HX2004-6 expression in normal
samples for each tissue. Therefore, HX2004-6 expression is elevated
in a significant portion of tumor tissue samples from colon,
breast, liver, lung, pancreas, stomach and prostate cancer
patients.
Example 6
Expression Analysis by Real-Time Quantitative RT-PCR
[0194] Real-time quantitative PCR was performed using a Lightcycler
instrument to investigate expression levels of HX2004-6 message in
tumor tissues from eight colon cancer patients.
[0195] One .mu.g human placenta total RNA (Clontech, Palo Alto,
Calif.) was reverse-transcribed with oligo-dT.sub.18 primer at
42.degree. C. for 1 hour then heated at 94.degree. C. for 5 minutes
in a total reaction volume of 20 .mu.l (1st-Strand.TM. cDNA
Systhesis Kit, Clontech). The reaction mix was used as the 1.times.
template standard for PCR in the Lightcycler. Serial dilutions from
the 1.times. template standard were then prepared:
10.sup.-1.times., 10.sup.-2.times., 10.sup.-3.times.,
10.sup.-4.times., 10.sup.-5.times. template standards.
[0196] Patient colon tissue was obtained at surgery and stored
frozen in liquid nitrogen. The patient tissue samples were
homogenized in TRIZOL reagent. Chloroform was then added to isolate
RNA, followed by RNA precipitation with isopropanol. The RNA
precipitates were washed with 75% ethanol, dried in air, then
dissolved in RNase-free distilled water. The total RNA samples were
treated with DNase I (RNase-free) (2 U/.mu.l, Ambion, Austin, Tex.)
and cleaned up using RNeasy Mini Kit (Qiagen, Santa Clarita,
Calif.) then reverse-transcribed with oligo-dT.sub.18 primer
(1st-Strand.TM. cDNA Systhesis Kit, Clontech). PCR was performed in
the Lightcycler using the following gene-specific primers:
3 .beta.-actin: forward 5'-CGGGAAATCGTGCGTGACATTAAG-3' primer (SEQ
ID NO: 16) reverse 5'-TGATCTCCTTCTGCATCCTGTC- GG-3' primer (SEQ ID
NO: 17) PCD1: forward 5'-TTCGTAGCATCAGTTGAAGCAGG-3' primer (SEQ ID
NO: 18) reverse 5'-GGTGAACCAGCCTTTCCATAGC-3' primer (SEQ ID NO:
19)
[0197] The 20-.mu.l PCR reaction mix in each Lightcycler capillary
contained 2 .mu.l of 10.times.PCR buffer II, 3 mM MgCl.sub.2
(Perkin-Elmer, Foster City, Calif.), 140 .mu.M dNTP, 1:50000 of
SYBR Green I, 0.25 mg/ml BSA, 1 unit of Taq polymerase (Boehringer
Mannheim, Indianapolis, Ind.), 0.175 .mu.M each primer, 2 .mu.l of
RT reaction mix. The PCR amplification began with 20-second
denaturation at 95.degree. C., followed by 45 cycles of
denaturation at 95.degree. C. for 5 seconds, annealing at
60.degree. C. for 1 second and extension at 72.degree. C. for 30
seconds. At the end of final cycle, PCR products were annealed at
60.degree. C. for 5 seconds, then slowly heated to 95.degree. C. at
0.2.degree. C./second, to measure melting curves of specific PCR
products. All experiments were performed in duplicate. Data
analysis was performed using Lightcycler Software (Roche Diagnosis)
with quantification and melting curve options.
[0198] The quantification assay was based on determination of the
cycle crossing point, which represents the cycle when the PCR
product begins to double with each cycle, i.e., when the log-linear
phase begins. A template dilution test was performed and
demonstrated that the gene-specific primers for .beta.-actin and
HX2004-6 are capable of accurate, sensitive and specific detection
of expression levels for .beta.-actin and HX2004-6, respectively
(Data not shown).
[0199] For each colon cancer patient, RNA was extracted from a trio
of surgical specimens: normal colon tissue, primary colon tumor
tissue and metastatic liver tissue from patients with colon cancer.
The sample trio from each patient was always tested simultaneously
in the same run of the Lightcycler. Each run of the Lightcycler
included a standard curve established on .beta.-actin expression in
the template standards. .beta.-actin expression in patient tissue
samples was used as the internal adjustment control.
[0200] The results are quantified and shown in FIGS. 9A-9H.
HX2004-6 is overexpressed (>2 fold) in primary tumor colon
tissue and/or metastatic liver tissue relative to normal colon
tissue in 5/8 patients. Specifically, HX2004-6 was overexpressed in
metastatic liver tissue relative to normal tissue in 5/8 patients;
HX2004-6 was overexpressed in primary tumor tissue relative to
normal tissue in 3/8 patients; and HX2004-6 was overexpressed in
either primary tumor and/or metastatic liver tissue relative to
normal tissue (i.e., in cancerous tissue relative to normal tissue)
in 6/8 patients. These results are consistent with the previous
results from in situ hybridization and Northern hybridization
described above. It is noteworthy that in one patient, HX2004-6
expression levels in primary tumor colon and metastatic liver
tissue are dramatically decreased, not increased, relative to
normal colon tissue.
Example 7
Chromosomal Localization of HX2004-6
[0201] To determine the chromosomal localization of HX2004-6, the
2004-6 probe was labeled and used as a probe on human metaphase
chromosomes using fluorescence in situ hybridization according to
standard procedures. The results indicated that HX2004-6 localizes
to 13q21.33.
Example 8
Fabricating a DNA Array Using Polynucleotides Differentially
Expressed in Ductal Epithelial Cells
[0202] A DNA array is made by spotting DNA fragments onto glass
microscope slides that are pretreated with poly-L-lysine. Spotting
onto the array is accomplished by a robotic arrayer. The DNA is
cross-linked to the glass by ultraviolet irradiation, and the free
poly-L-lysine groups are blocked by treatment with 0.05% succinic
anhydride, 50% 1-methyl-2-pyrrolidinone and 50% borate buffer.
[0203] The spots on the array are oligonucleotides synthesized on
an ABI automated synthesizer. Each spot is one of the
polynucleotides of SEQ ID NO: 1 or SEQ ID NO:3, a fragment thereof,
a complement thereof, or a complement of a fragment thereof, which
correspond to a gene that is differentially expressed in
pancreatic, breast, or colon epithelial cells according to varying
disease states (e.g., overexpressed in cancerous, pancreatic
cancer, breast cancer, colorectal cancer cells). The
polynucleotides may be present on the array in any of a variety of
combinations or subsets. Some internal standards and negative
control spots including non-differentially expressed sequences
and/or bacterial controls are included.
[0204] mRNA from patient samples is isolated, the mRNA used to
produce cDNA, amplified and subsequently labeled with fluorescent
nucleotides as follows: isolated mRNA is added to a standard PCR
reaction containing primers (100 pmoles each), 250 .mu.M
nucleotides, and 5 Units of Taq polymerase (Perkin Elmer). In
addition, fluorescent nucleotides (Cy3-dUTP (green fluorescence) or
Cy5-dUTP (red fluorescence), sold by Amersham) are added to a final
concentration of 60 .mu.M. The reaction is carried out in a Perkin
Elmer thermocycler (PE9600) for 30 cycles using the following cycle
profile: 92.degree. C. for 30 seconds, 58.degree. C. for 30
seconds, and 72.degree. C. for 2 minutes. Unincorporated
fluorescent nucleotides are removed by size exclusion
chromatography (Microcon-30 concentration devices, sold by
Amicon).
[0205] Buffer replacement, removal of small nucleotides and primers
and sample concentration is accomplished by ultrafiltration over an
Amicon microconcentrator-30 (mw cutoff=30,000 Da) with three
changes of 0.45 ml TE. The sample is reduced to 5 .mu.l and
supplemented with 1.4 .mu.l 20.times.SSC and 5 pg yeast tRNA.
Particles are removed from this mixture by filtration through a
pre-wetted 0.45 .mu. microspin filter (Ultrafree-MC, Millipore,
Bedford, Mass.). SDS is added to a 0.28% final concentration. The
fluorescently-labeled cDNA mixture is then heated to 98.degree. C.,
for 2 min., quickly cooled and applied to the DNA array on a
microscope slide. Hybridization proceeds under a coverslip, and the
slide assembly is kept in a humidified chamber at 65.degree. C. for
15 hours.
[0206] The slide is washed briefly in 1.times.SSC and 0.03% SDS,
followed by a wash in 0.06% SSC. The slide is kept in a humidified
chamber until fluorescence scanning was done. Fluorescence scanning
and data acquisition are then accomplished using any of a variety
of suitable methods well known in the art. For example,
fluorescence scanning is set for 20 microns/pixel and two readings
are taken per pixel. Data for channel 1 is set to collect
fluorescence from Cy3 with excitation at 520 nm and emission at
550-600 nm. Channel 2 collects signals excited at 647 nm and
emitted at 660-705 nm, appropriate for Cy5. No neutral density
filters are applied to the signal from either channel, and the
photomultiplier tube gain is set to 5. Fine adjustments are then
made to the photomultiplier gain so that signals collected from the
two spots are equivalent.
[0207] The data acquired from the scan of the array is then
converted to any suitable form for analysis. For example, the data
may be analyzed using a computer system, and the data may be
displayed in a pictoral format on a computer screen, where the
display shows the array as a collection of spots, each spot
corresponding to a location of a different polynucleotide on the
array. The spots vary in brightness according to the amount of
fluorescent probe associated with the spot, which in turn is
correlated with an amount of hybridized DNA in the sample. The
relative brightness of the spots on the array can be compared with
one another to determine their relative intensities, either
qualitatively or quantitatively.
[0208] The display of spots on the array, along with their relative
brightness, provides a test sample pattern. The test sample pattern
can be then compared with reference array patterns associated with
positive and negative control samples on the same array, e.g., an
array having polynucleotides in substantially the same locations as
the array used with the test sample. The reference array patterns
used in the comparison can be array patterns generated using
samples from normal pancreas cells, cancerous pancreatic cells,
pancreatitis-associated pancreas cells, normal breast and breast
cancer cells, normal colon and colorectal cancer cells, and the
like. A substantial or significant match between the test array
pattern and a reference array pattern is indicative of a disease
state of the patient from whom the test sample was obtained.
[0209] The invention now being fully described, it will be apparent
to one of ordinary skill in the art that many changes and
modifications can be made thereto without departing from the spirit
or scope of the appended claims.
Sequence CWU 1
1
19 1 4612 DNA Homo Sapiens CDS (698)...(3862) 1 atagcacgac
tgtgtatgct ctggaggact gaaaggctgt acaagcccta tgtatttttt 60
ttcaaatata catatgcatg ggtcttgctg ctgcctcttt tgctgactgt aattggactt
120 tgaagcttcg aagttatatc ataaaaattt gtaacctttg tctgagagag
agctcagcta 180 agcaatcact ttccacttct tttcacagga taatataaac
gttttcttga aagcttgtga 240 acagattgga ttgaaagaag cccagctttt
ccatcctgga gatctacagg atttatcaaa 300 tcgagtcact gtcaagcaag
aagagactga caggagagtg aaaaatgttt tgataacatt 360 gtactggctg
ggaagaaaag cacaaagcaa cccgtactat aatggtcccc atcttaattt 420
gaaagcgttt gagaatcttt taggacaagc actgacgaag gcactcgaag actccagctt
480 cctgaaaaga agtggcaggg acagtggcta cggtgacatc tggtgtcctg
aacgtggaga 540 atttcttgct cctccaaggc accataagag agaagattcc
tttgaaagct tggactcttt 600 gggctcgagg tcattgacaa gctgctcctc
tgatatcacg ttgagagggg ggcgtgaagg 660 ttttgaaagt gacacagatt
cggaatttac attcaag atg cag gat tat aat aaa 715 Met Gln Asp Tyr Asn
Lys 1 5 gat gat atg tcg tat cga agg att tcg gct gtt gag cca aag act
gcg 763 Asp Asp Met Ser Tyr Arg Arg Ile Ser Ala Val Glu Pro Lys Thr
Ala 10 15 20 tta ccc ttc aat cgt ttt tta ccc aac aaa agt aga cag
cca tcc tat 811 Leu Pro Phe Asn Arg Phe Leu Pro Asn Lys Ser Arg Gln
Pro Ser Tyr 25 30 35 gta cca gca cct ctg aga aag aaa aag cca gac
aaa cat gag gat aac 859 Val Pro Ala Pro Leu Arg Lys Lys Lys Pro Asp
Lys His Glu Asp Asn 40 45 50 aga aga agt tgg gca agc ccg gtt tat
aca gaa gca gat gga aca ttt 907 Arg Arg Ser Trp Ala Ser Pro Val Tyr
Thr Glu Ala Asp Gly Thr Phe 55 60 65 70 tca agg agt aag tcc atg agt
gat gtc agc gca gaa gat gtt caa aac 955 Ser Arg Ser Lys Ser Met Ser
Asp Val Ser Ala Glu Asp Val Gln Asn 75 80 85 ttg cgt cag ctg cgt
tac gag gag atg cag aaa ata aaa tca caa tta 1003 Leu Arg Gln Leu
Arg Tyr Glu Glu Met Gln Lys Ile Lys Ser Gln Leu 90 95 100 aaa gaa
caa gat cag aaa tgg cag gat gac ctt gca aaa tgg aaa gat 1051 Lys
Glu Gln Asp Gln Lys Trp Gln Asp Asp Leu Ala Lys Trp Lys Asp 105 110
115 cgt cga aaa agt tac act tca gat ctg cag aag aaa aaa gaa gag aga
1099 Arg Arg Lys Ser Tyr Thr Ser Asp Leu Gln Lys Lys Lys Glu Glu
Arg 120 125 130 gaa gaa att gaa aag cag gca ctt gag aag tct aag aga
agc tct aag 1147 Glu Glu Ile Glu Lys Gln Ala Leu Glu Lys Ser Lys
Arg Ser Ser Lys 135 140 145 150 acg ttt aag gaa atg ctg cag gac agg
gaa tcc caa aat caa aag tct 1195 Thr Phe Lys Glu Met Leu Gln Asp
Arg Glu Ser Gln Asn Gln Lys Ser 155 160 165 aca gtt ccg tca aga agg
aga atg tat tct ttt gat gat gtg ctg gag 1243 Thr Val Pro Ser Arg
Arg Arg Met Tyr Ser Phe Asp Asp Val Leu Glu 170 175 180 gaa gga aag
cga ccc cct aca atg act gtg tca gaa gca agt tac cag 1291 Glu Gly
Lys Arg Pro Pro Thr Met Thr Val Ser Glu Ala Ser Tyr Gln 185 190 195
agt gag aga gta gaa gag aag gga gca act tat cct tca gaa att ccc
1339 Ser Glu Arg Val Glu Glu Lys Gly Ala Thr Tyr Pro Ser Glu Ile
Pro 200 205 210 aaa gaa gat tct acc act ttt gca aaa aga gag gac cgt
gta aca act 1387 Lys Glu Asp Ser Thr Thr Phe Ala Lys Arg Glu Asp
Arg Val Thr Thr 215 220 225 230 gaa att cag ctt cct tct caa agt cct
gtg gaa gaa caa agc cca gcc 1435 Glu Ile Gln Leu Pro Ser Gln Ser
Pro Val Glu Glu Gln Ser Pro Ala 235 240 245 tct ttg tct tct ctg cgt
tca cgg agc aca caa atg gaa tca act cgt 1483 Ser Leu Ser Ser Leu
Arg Ser Arg Ser Thr Gln Met Glu Ser Thr Arg 250 255 260 gtt tca gct
tct ctc ccc aga agt tac cgg aaa act gat aca gtc agg 1531 Val Ser
Ala Ser Leu Pro Arg Ser Tyr Arg Lys Thr Asp Thr Val Arg 265 270 275
tta aca tct gtg gtc aca cca aga ccc ttt ggc tct cag aca agg gga
1579 Leu Thr Ser Val Val Thr Pro Arg Pro Phe Gly Ser Gln Thr Arg
Gly 280 285 290 atc tca tca ctc ccc aga tct tac acg atg gat gat gct
tgg aag tat 1627 Ile Ser Ser Leu Pro Arg Ser Tyr Thr Met Asp Asp
Ala Trp Lys Tyr 295 300 305 310 aat gga gat gtt gaa gac att aag aga
act cca aac aat gtg gtc agc 1675 Asn Gly Asp Val Glu Asp Ile Lys
Arg Thr Pro Asn Asn Val Val Ser 315 320 325 acc cct gca cca agc ccg
gac gca agc caa ctg gct tca agc tta tct 1723 Thr Pro Ala Pro Ser
Pro Asp Ala Ser Gln Leu Ala Ser Ser Leu Ser 330 335 340 agc cag aaa
gag gta gca gca aca gaa gaa gat gtg aca agg ctg ccc 1771 Ser Gln
Lys Glu Val Ala Ala Thr Glu Glu Asp Val Thr Arg Leu Pro 345 350 355
tct cct aca tcc ccc ttc tca tct ctt tcc caa gac cag gct gcc act
1819 Ser Pro Thr Ser Pro Phe Ser Ser Leu Ser Gln Asp Gln Ala Ala
Thr 360 365 370 tct aaa gcc aca ttg tct tcc aca tct ggt ctt gat tta
atg tct gaa 1867 Ser Lys Ala Thr Leu Ser Ser Thr Ser Gly Leu Asp
Leu Met Ser Glu 375 380 385 390 tct gga gaa ggg gaa atc tcc cca caa
aga gaa gtc tca aga tcc cag 1915 Ser Gly Glu Gly Glu Ile Ser Pro
Gln Arg Glu Val Ser Arg Ser Gln 395 400 405 gat cag ttc agt gat atg
aga atc agc ata aac cag acg cct ggg aag 1963 Asp Gln Phe Ser Asp
Met Arg Ile Ser Ile Asn Gln Thr Pro Gly Lys 410 415 420 agt ctt gac
ttt ggg ttt aca ata aaa tgg gat att cct ggg atc ttc 2011 Ser Leu
Asp Phe Gly Phe Thr Ile Lys Trp Asp Ile Pro Gly Ile Phe 425 430 435
gta gca tca gtt gaa gca ggt agc cca gca gaa ttt tct cag cta caa
2059 Val Ala Ser Val Glu Ala Gly Ser Pro Ala Glu Phe Ser Gln Leu
Gln 440 445 450 gta gat gat gaa att att gct att aac aac acc aag ttt
tca tat aac 2107 Val Asp Asp Glu Ile Ile Ala Ile Asn Asn Thr Lys
Phe Ser Tyr Asn 455 460 465 470 gat tca aaa gag tgg gag gaa gcc atg
gct aag gct caa gaa act gga 2155 Asp Ser Lys Glu Trp Glu Glu Ala
Met Ala Lys Ala Gln Glu Thr Gly 475 480 485 cac cta gtg atg gat gtg
agg cgc tat gga aag gct ggt tca cct gaa 2203 His Leu Val Met Asp
Val Arg Arg Tyr Gly Lys Ala Gly Ser Pro Glu 490 495 500 aca aag tgg
att gat gca act tct gga att tac aac tca gaa aaa tct 2251 Thr Lys
Trp Ile Asp Ala Thr Ser Gly Ile Tyr Asn Ser Glu Lys Ser 505 510 515
tca aat cta tct gta aca act gat ttc tcc gaa agc ctt cag agt tct
2299 Ser Asn Leu Ser Val Thr Thr Asp Phe Ser Glu Ser Leu Gln Ser
Ser 520 525 530 aat att gaa tcc aaa gaa atc aat gga att cat gat gaa
agc aat gct 2347 Asn Ile Glu Ser Lys Glu Ile Asn Gly Ile His Asp
Glu Ser Asn Ala 535 540 545 550 ttt gaa tca aaa gca tct gaa tcc att
tct ttg aaa aac tta aaa agg 2395 Phe Glu Ser Lys Ala Ser Glu Ser
Ile Ser Leu Lys Asn Leu Lys Arg 555 560 565 cga tca caa ttt ttt gaa
caa gga agc tct gat tcg gtg gtt cct gat 2443 Arg Ser Gln Phe Phe
Glu Gln Gly Ser Ser Asp Ser Val Val Pro Asp 570 575 580 ctt cca gtt
cca acc atc agt gcc ccg agt cgc tgg gtg tgg gat caa 2491 Leu Pro
Val Pro Thr Ile Ser Ala Pro Ser Arg Trp Val Trp Asp Gln 585 590 595
gag gag gag cgg aag cgg cag gag agg tgg cag aag gag cag gac cgc
2539 Glu Glu Glu Arg Lys Arg Gln Glu Arg Trp Gln Lys Glu Gln Asp
Arg 600 605 610 cta ctg cag gaa aaa tat caa cgt gag cag gag aaa ctg
agg gaa gag 2587 Leu Leu Gln Glu Lys Tyr Gln Arg Glu Gln Glu Lys
Leu Arg Glu Glu 615 620 625 630 tgg caa agg gcc aaa cag gag gca gag
aga gag aat tcc aag tac ttg 2635 Trp Gln Arg Ala Lys Gln Glu Ala
Glu Arg Glu Asn Ser Lys Tyr Leu 635 640 645 gat gag gaa ctg atg gtc
cta agc tca aac agc atg tct ctg acc aca 2683 Asp Glu Glu Leu Met
Val Leu Ser Ser Asn Ser Met Ser Leu Thr Thr 650 655 660 cgg gag ccc
tct ctt gcc acc tgg gaa gct acc tgg agt gaa ggg tcc 2731 Arg Glu
Pro Ser Leu Ala Thr Trp Glu Ala Thr Trp Ser Glu Gly Ser 665 670 675
aag tct tca gac aga gaa gga acc cga gca gga gaa gag gag agg aga
2779 Lys Ser Ser Asp Arg Glu Gly Thr Arg Ala Gly Glu Glu Glu Arg
Arg 680 685 690 cag cca caa gag gaa gtt gtt cat gag gac caa gga aag
aag ccg cag 2827 Gln Pro Gln Glu Glu Val Val His Glu Asp Gln Gly
Lys Lys Pro Gln 695 700 705 710 gat cag ctt gtt att gag aga gag agg
aaa tgg gag caa cag ctt cag 2875 Asp Gln Leu Val Ile Glu Arg Glu
Arg Lys Trp Glu Gln Gln Leu Gln 715 720 725 gaa gag caa gag caa aag
cgg ctt cag gct gag gct gag gag cag aag 2923 Glu Glu Gln Glu Gln
Lys Arg Leu Gln Ala Glu Ala Glu Glu Gln Lys 730 735 740 cgt cct gcg
gag gag cag aag cgc cag gca gag ata gag cgg gaa aca 2971 Arg Pro
Ala Glu Glu Gln Lys Arg Gln Ala Glu Ile Glu Arg Glu Thr 745 750 755
tca gtc aga ata tac cag tac agg agg cct gtt gat tcc tat gat ata
3019 Ser Val Arg Ile Tyr Gln Tyr Arg Arg Pro Val Asp Ser Tyr Asp
Ile 760 765 770 cca aag aca gaa gaa gca tct tca ggt ttt ctt cct ggt
gac agg aat 3067 Pro Lys Thr Glu Glu Ala Ser Ser Gly Phe Leu Pro
Gly Asp Arg Asn 775 780 785 790 aaa tcc aga tct act act gaa ctg gat
gat tac tcc aca aat aaa aat 3115 Lys Ser Arg Ser Thr Thr Glu Leu
Asp Asp Tyr Ser Thr Asn Lys Asn 795 800 805 gga aac aat aaa tat tta
gac caa att ggg aac acg acc tct tca cag 3163 Gly Asn Asn Lys Tyr
Leu Asp Gln Ile Gly Asn Thr Thr Ser Ser Gln 810 815 820 agg aga tcc
aag aaa gaa caa gta cca tca gga gca gaa ttg gag agg 3211 Arg Arg
Ser Lys Lys Glu Gln Val Pro Ser Gly Ala Glu Leu Glu Arg 825 830 835
caa caa atc ctt cag gaa atg agg aag aga aca ccc ctt cac aat gac
3259 Gln Gln Ile Leu Gln Glu Met Arg Lys Arg Thr Pro Leu His Asn
Asp 840 845 850 aac agc tgg atc cga cag cgc agt gcc agt gtc aac aaa
gag cct gtt 3307 Asn Ser Trp Ile Arg Gln Arg Ser Ala Ser Val Asn
Lys Glu Pro Val 855 860 865 870 agt ctt cct ggg atc atg aga aga ggc
gaa tct tta gat aac ctg gac 3355 Ser Leu Pro Gly Ile Met Arg Arg
Gly Glu Ser Leu Asp Asn Leu Asp 875 880 885 tcc ccc cga tcc aat tct
tgg aga cag cct cct tgg ctc aat cag ccc 3403 Ser Pro Arg Ser Asn
Ser Trp Arg Gln Pro Pro Trp Leu Asn Gln Pro 890 895 900 aca gga ttc
tat gct tct tcc tct gtg caa gac ttt agt cgc cca cca 3451 Thr Gly
Phe Tyr Ala Ser Ser Ser Val Gln Asp Phe Ser Arg Pro Pro 905 910 915
cct cag ctg gtg tcc aca tca aac cgt gcc tac atg cgg aac ccc tcc
3499 Pro Gln Leu Val Ser Thr Ser Asn Arg Ala Tyr Met Arg Asn Pro
Ser 920 925 930 tcc agc gtg ccc cca cct tca gct ggc tcc gtg aag acc
tcc acc aca 3547 Ser Ser Val Pro Pro Pro Ser Ala Gly Ser Val Lys
Thr Ser Thr Thr 935 940 945 950 ggt gtg gcc acc aca cag tcc ccc acc
ccg aga agc cat tcc cct tca 3595 Gly Val Ala Thr Thr Gln Ser Pro
Thr Pro Arg Ser His Ser Pro Ser 955 960 965 gct tca cag tca ggc tct
cag ctg cgt aac agg tca gtc agt ggg aag 3643 Ala Ser Gln Ser Gly
Ser Gln Leu Arg Asn Arg Ser Val Ser Gly Lys 970 975 980 cgc ata tgc
tcc tac tgc aat aac att ctg ggc aaa gga gcc gcc atg 3691 Arg Ile
Cys Ser Tyr Cys Asn Asn Ile Leu Gly Lys Gly Ala Ala Met 985 990 995
atc atc gag tcc ctg ggt ctt tgt tat cat ttg cat tgt ttt aag tgt
3739 Ile Ile Glu Ser Leu Gly Leu Cys Tyr His Leu His Cys Phe Lys
Cys 1000 1005 1010 gtt gcc tgt gag tgt gac ctc gga ggc tct tcc tca
gga gct gaa gtc 3787 Val Ala Cys Glu Cys Asp Leu Gly Gly Ser Ser
Ser Gly Ala Glu Val 1015 1020 1025 1030 agg atc aga aac cac caa ctg
tac tgc aac gac tgc tat ctc aga ttc 3835 Arg Ile Arg Asn His Gln
Leu Tyr Cys Asn Asp Cys Tyr Leu Arg Phe 1035 1040 1045 aaa tct gga
cgg cca acc gcc atg tga tgtaagcctc catacgaaag 3882 Lys Ser Gly Arg
Pro Thr Ala Met * 1050 cactgttgca gatagaagaa gaggtggttg ctgctcatgt
agatctataa atatgtgttg 3942 tatgtctttt ttgctttttt tttaaaaaaa
agaataactt tttttgcctc tttagattac 4002 atagaagcat tgtagtcttg
gtagaaccag tatttttgtt gtttatttat aaggtaattg 4062 tgtgtgggga
aaagtgcagt atttacctgt tgaattcagc atcttgagag cacaagggaa 4122
aaaataagaa cctacgaata tttttgaggc agataatgat ctagtttgac tttctagtta
4182 gtggtgtttt gaagagggta ttttattgtt ttttaaaaaa aggttcttaa
acattatttg 4242 aaatagttaa tataaataca taattgcatt tgctctgttt
attgtaatgt attctaaatt 4302 aatgcagaac catatggaaa atttcattaa
aatctatccc caaatgtgct ttctgtatcc 4362 ttccttctac ctattattct
gatttttaaa aatgcagtta atgtaccatt tatttgcttg 4422 atgaagggag
ctctattttc tttaccagaa atgttgctaa gtaattccca atagaaagct 4482
gcttattttc attaatgaaa aataaccatg gtttgtatac tagaagtctt cttcagaaac
4542 tggtgagcct ttctgttcaa ttgcatttgt aaataaactt gctgatgcat
ttaaaaaaaa 4602 aaaaaaaaaa 4612 2 1054 PRT Homo Sapiens 2 Met Gln
Asp Tyr Asn Lys Asp Asp Met Ser Tyr Arg Arg Ile Ser Ala 1 5 10 15
Val Glu Pro Lys Thr Ala Leu Pro Phe Asn Arg Phe Leu Pro Asn Lys 20
25 30 Ser Arg Gln Pro Ser Tyr Val Pro Ala Pro Leu Arg Lys Lys Lys
Pro 35 40 45 Asp Lys His Glu Asp Asn Arg Arg Ser Trp Ala Ser Pro
Val Tyr Thr 50 55 60 Glu Ala Asp Gly Thr Phe Ser Arg Ser Lys Ser
Met Ser Asp Val Ser 65 70 75 80 Ala Glu Asp Val Gln Asn Leu Arg Gln
Leu Arg Tyr Glu Glu Met Gln 85 90 95 Lys Ile Lys Ser Gln Leu Lys
Glu Gln Asp Gln Lys Trp Gln Asp Asp 100 105 110 Leu Ala Lys Trp Lys
Asp Arg Arg Lys Ser Tyr Thr Ser Asp Leu Gln 115 120 125 Lys Lys Lys
Glu Glu Arg Glu Glu Ile Glu Lys Gln Ala Leu Glu Lys 130 135 140 Ser
Lys Arg Ser Ser Lys Thr Phe Lys Glu Met Leu Gln Asp Arg Glu 145 150
155 160 Ser Gln Asn Gln Lys Ser Thr Val Pro Ser Arg Arg Arg Met Tyr
Ser 165 170 175 Phe Asp Asp Val Leu Glu Glu Gly Lys Arg Pro Pro Thr
Met Thr Val 180 185 190 Ser Glu Ala Ser Tyr Gln Ser Glu Arg Val Glu
Glu Lys Gly Ala Thr 195 200 205 Tyr Pro Ser Glu Ile Pro Lys Glu Asp
Ser Thr Thr Phe Ala Lys Arg 210 215 220 Glu Asp Arg Val Thr Thr Glu
Ile Gln Leu Pro Ser Gln Ser Pro Val 225 230 235 240 Glu Glu Gln Ser
Pro Ala Ser Leu Ser Ser Leu Arg Ser Arg Ser Thr 245 250 255 Gln Met
Glu Ser Thr Arg Val Ser Ala Ser Leu Pro Arg Ser Tyr Arg 260 265 270
Lys Thr Asp Thr Val Arg Leu Thr Ser Val Val Thr Pro Arg Pro Phe 275
280 285 Gly Ser Gln Thr Arg Gly Ile Ser Ser Leu Pro Arg Ser Tyr Thr
Met 290 295 300 Asp Asp Ala Trp Lys Tyr Asn Gly Asp Val Glu Asp Ile
Lys Arg Thr 305 310 315 320 Pro Asn Asn Val Val Ser Thr Pro Ala Pro
Ser Pro Asp Ala Ser Gln 325 330 335 Leu Ala Ser Ser Leu Ser Ser Gln
Lys Glu Val Ala Ala Thr Glu Glu 340 345 350 Asp Val Thr Arg Leu Pro
Ser Pro Thr Ser Pro Phe Ser Ser Leu Ser 355 360 365 Gln Asp Gln Ala
Ala Thr Ser Lys Ala Thr Leu Ser Ser Thr Ser Gly 370 375 380 Leu Asp
Leu Met Ser Glu Ser Gly Glu Gly Glu Ile Ser Pro Gln Arg 385 390 395
400 Glu Val Ser Arg Ser Gln Asp Gln Phe Ser Asp Met Arg Ile Ser Ile
405 410 415 Asn Gln Thr Pro Gly Lys Ser Leu Asp Phe Gly Phe Thr Ile
Lys Trp 420 425 430 Asp Ile Pro Gly Ile Phe Val Ala Ser Val Glu Ala
Gly Ser Pro Ala 435 440 445 Glu Phe Ser Gln Leu Gln Val Asp Asp Glu
Ile Ile Ala Ile Asn Asn 450 455 460 Thr Lys Phe Ser Tyr Asn Asp Ser
Lys Glu Trp Glu Glu Ala Met Ala 465 470 475 480 Lys Ala Gln Glu Thr
Gly His Leu Val Met
Asp Val Arg Arg Tyr Gly 485 490 495 Lys Ala Gly Ser Pro Glu Thr Lys
Trp Ile Asp Ala Thr Ser Gly Ile 500 505 510 Tyr Asn Ser Glu Lys Ser
Ser Asn Leu Ser Val Thr Thr Asp Phe Ser 515 520 525 Glu Ser Leu Gln
Ser Ser Asn Ile Glu Ser Lys Glu Ile Asn Gly Ile 530 535 540 His Asp
Glu Ser Asn Ala Phe Glu Ser Lys Ala Ser Glu Ser Ile Ser 545 550 555
560 Leu Lys Asn Leu Lys Arg Arg Ser Gln Phe Phe Glu Gln Gly Ser Ser
565 570 575 Asp Ser Val Val Pro Asp Leu Pro Val Pro Thr Ile Ser Ala
Pro Ser 580 585 590 Arg Trp Val Trp Asp Gln Glu Glu Glu Arg Lys Arg
Gln Glu Arg Trp 595 600 605 Gln Lys Glu Gln Asp Arg Leu Leu Gln Glu
Lys Tyr Gln Arg Glu Gln 610 615 620 Glu Lys Leu Arg Glu Glu Trp Gln
Arg Ala Lys Gln Glu Ala Glu Arg 625 630 635 640 Glu Asn Ser Lys Tyr
Leu Asp Glu Glu Leu Met Val Leu Ser Ser Asn 645 650 655 Ser Met Ser
Leu Thr Thr Arg Glu Pro Ser Leu Ala Thr Trp Glu Ala 660 665 670 Thr
Trp Ser Glu Gly Ser Lys Ser Ser Asp Arg Glu Gly Thr Arg Ala 675 680
685 Gly Glu Glu Glu Arg Arg Gln Pro Gln Glu Glu Val Val His Glu Asp
690 695 700 Gln Gly Lys Lys Pro Gln Asp Gln Leu Val Ile Glu Arg Glu
Arg Lys 705 710 715 720 Trp Glu Gln Gln Leu Gln Glu Glu Gln Glu Gln
Lys Arg Leu Gln Ala 725 730 735 Glu Ala Glu Glu Gln Lys Arg Pro Ala
Glu Glu Gln Lys Arg Gln Ala 740 745 750 Glu Ile Glu Arg Glu Thr Ser
Val Arg Ile Tyr Gln Tyr Arg Arg Pro 755 760 765 Val Asp Ser Tyr Asp
Ile Pro Lys Thr Glu Glu Ala Ser Ser Gly Phe 770 775 780 Leu Pro Gly
Asp Arg Asn Lys Ser Arg Ser Thr Thr Glu Leu Asp Asp 785 790 795 800
Tyr Ser Thr Asn Lys Asn Gly Asn Asn Lys Tyr Leu Asp Gln Ile Gly 805
810 815 Asn Thr Thr Ser Ser Gln Arg Arg Ser Lys Lys Glu Gln Val Pro
Ser 820 825 830 Gly Ala Glu Leu Glu Arg Gln Gln Ile Leu Gln Glu Met
Arg Lys Arg 835 840 845 Thr Pro Leu His Asn Asp Asn Ser Trp Ile Arg
Gln Arg Ser Ala Ser 850 855 860 Val Asn Lys Glu Pro Val Ser Leu Pro
Gly Ile Met Arg Arg Gly Glu 865 870 875 880 Ser Leu Asp Asn Leu Asp
Ser Pro Arg Ser Asn Ser Trp Arg Gln Pro 885 890 895 Pro Trp Leu Asn
Gln Pro Thr Gly Phe Tyr Ala Ser Ser Ser Val Gln 900 905 910 Asp Phe
Ser Arg Pro Pro Pro Gln Leu Val Ser Thr Ser Asn Arg Ala 915 920 925
Tyr Met Arg Asn Pro Ser Ser Ser Val Pro Pro Pro Ser Ala Gly Ser 930
935 940 Val Lys Thr Ser Thr Thr Gly Val Ala Thr Thr Gln Ser Pro Thr
Pro 945 950 955 960 Arg Ser His Ser Pro Ser Ala Ser Gln Ser Gly Ser
Gln Leu Arg Asn 965 970 975 Arg Ser Val Ser Gly Lys Arg Ile Cys Ser
Tyr Cys Asn Asn Ile Leu 980 985 990 Gly Lys Gly Ala Ala Met Ile Ile
Glu Ser Leu Gly Leu Cys Tyr His 995 1000 1005 Leu His Cys Phe Lys
Cys Val Ala Cys Glu Cys Asp Leu Gly Gly Ser 1010 1015 1020 Ser Ser
Gly Ala Glu Val Arg Ile Arg Asn His Gln Leu Tyr Cys Asn 1025 1030
1035 1040 Asp Cys Tyr Leu Arg Phe Lys Ser Gly Arg Pro Thr Ala Met
1045 1050 3 4642 DNA Homo Sapiens CDS (698)...(3892) 3 atagcacgac
tgtgtatgct ctggaggact gaaaggctgt acaagcccta tgtatttttt 60
ttcaaatata catatgcatg ggtcttgctg ctgcctcttt tgctgactgt aattggactt
120 tgaagcttcg aagttatatc ataaaaattt gtaacctttg tctgagagag
agctcagcta 180 agcaatcact ttccacttct tttcacagga taatataaac
gttttcttga aagcttgtga 240 acagattgga ttgaaagaag cccagctttt
ccatcctgga gatctacagg atttatcaaa 300 tcgagtcact gtcaagcaag
aagagactga caggagagtg aaaaatgttt tgataacatt 360 gtactggctg
ggaagaaaag cacaaagcaa cccgtactat aatggtcccc atcttaattt 420
gaaagcgttt gagaatcttt taggacaagc actgacgaag gcactcgaag actccagctt
480 cctgaaaaga agtggcaggg acagtggcta cggtgacatc tggtgtcctg
aacgtggaga 540 atttcttgct cctccaaggc accataagag agaagattcc
tttgaaagct tggactcttt 600 gggctcgagg tcattgacaa gctgctcctc
tgatatcacg ttgagagggg ggcgtgaagg 660 ttttgaaagt gacacagatt
cggaatttac attcaag atg cag gat tat aat aaa 715 Met Gln Asp Tyr Asn
Lys 1 5 gat gat atg tcg tat cga agg att tcg gct gtt gag cca aag act
gcg 763 Asp Asp Met Ser Tyr Arg Arg Ile Ser Ala Val Glu Pro Lys Thr
Ala 10 15 20 tta ccc ttc aat cgt ttt tta ccc aac aaa agt aga cag
cca tcc tat 811 Leu Pro Phe Asn Arg Phe Leu Pro Asn Lys Ser Arg Gln
Pro Ser Tyr 25 30 35 gta cca gca cct ctg aga aag aaa aag cca gac
aaa cat gag gat aac 859 Val Pro Ala Pro Leu Arg Lys Lys Lys Pro Asp
Lys His Glu Asp Asn 40 45 50 aga aga agt tgg gca agc ccg gtt tat
aca gaa gca gat gga aca ttt 907 Arg Arg Ser Trp Ala Ser Pro Val Tyr
Thr Glu Ala Asp Gly Thr Phe 55 60 65 70 tca aga ctc ttt caa aag att
tat ggt gag aat ggg agt aag tcc atg 955 Ser Arg Leu Phe Gln Lys Ile
Tyr Gly Glu Asn Gly Ser Lys Ser Met 75 80 85 agt gat gtc agc gca
gaa gat gtt caa aac ttg cgt cag ctg cgt tac 1003 Ser Asp Val Ser
Ala Glu Asp Val Gln Asn Leu Arg Gln Leu Arg Tyr 90 95 100 gag gag
atg cag aaa ata aaa tca caa tta aaa gaa caa gat cag aaa 1051 Glu
Glu Met Gln Lys Ile Lys Ser Gln Leu Lys Glu Gln Asp Gln Lys 105 110
115 tgg cag gat gac ctt gca aaa tgg aaa gat cgt cga aaa agt tac act
1099 Trp Gln Asp Asp Leu Ala Lys Trp Lys Asp Arg Arg Lys Ser Tyr
Thr 120 125 130 tca gat ctg cag aag aaa aaa gaa gag aga gaa gaa att
gaa aag cag 1147 Ser Asp Leu Gln Lys Lys Lys Glu Glu Arg Glu Glu
Ile Glu Lys Gln 135 140 145 150 gca ctt gag aag tct aag aga agc tct
aag acg ttt aag gaa atg ctg 1195 Ala Leu Glu Lys Ser Lys Arg Ser
Ser Lys Thr Phe Lys Glu Met Leu 155 160 165 cag gac agg gaa tcc caa
aat caa aag tct aca gtt ccg tca aga agg 1243 Gln Asp Arg Glu Ser
Gln Asn Gln Lys Ser Thr Val Pro Ser Arg Arg 170 175 180 aga atg tat
tct ttt gat gat gtg ctg gag gaa gga aag cga ccc cct 1291 Arg Met
Tyr Ser Phe Asp Asp Val Leu Glu Glu Gly Lys Arg Pro Pro 185 190 195
aca atg act gtg tca gaa gca agt tac cag agt gag aga gta gaa gag
1339 Thr Met Thr Val Ser Glu Ala Ser Tyr Gln Ser Glu Arg Val Glu
Glu 200 205 210 aag gga gca act tat cct tca gaa att ccc aaa gaa gat
tct acc act 1387 Lys Gly Ala Thr Tyr Pro Ser Glu Ile Pro Lys Glu
Asp Ser Thr Thr 215 220 225 230 ttt gca aaa aga gag gac cgt gta aca
act gaa att cag ctt cct tct 1435 Phe Ala Lys Arg Glu Asp Arg Val
Thr Thr Glu Ile Gln Leu Pro Ser 235 240 245 caa agt cct gtg gaa gaa
caa agc cca gcc tct ttg tct tct ctg cgt 1483 Gln Ser Pro Val Glu
Glu Gln Ser Pro Ala Ser Leu Ser Ser Leu Arg 250 255 260 tca cgg agc
aca caa atg gaa tca act cgt gtt tca gct tct ctc ccc 1531 Ser Arg
Ser Thr Gln Met Glu Ser Thr Arg Val Ser Ala Ser Leu Pro 265 270 275
aga agt tac cgg aaa act gat aca gtc agg tta aca tct gtg gtc aca
1579 Arg Ser Tyr Arg Lys Thr Asp Thr Val Arg Leu Thr Ser Val Val
Thr 280 285 290 cca aga ccc ttt ggc tct cag aca agg gga atc tca tca
ctc ccc aga 1627 Pro Arg Pro Phe Gly Ser Gln Thr Arg Gly Ile Ser
Ser Leu Pro Arg 295 300 305 310 tct tac acg atg gat gat gct tgg aag
tat aat gga gat gtt gaa gac 1675 Ser Tyr Thr Met Asp Asp Ala Trp
Lys Tyr Asn Gly Asp Val Glu Asp 315 320 325 att aag aga act cca aac
aat gtg gtc agc acc cct gca cca agc ccg 1723 Ile Lys Arg Thr Pro
Asn Asn Val Val Ser Thr Pro Ala Pro Ser Pro 330 335 340 gac gca agc
caa ctg gct tca agc tta tct agc cag aaa gag gta gca 1771 Asp Ala
Ser Gln Leu Ala Ser Ser Leu Ser Ser Gln Lys Glu Val Ala 345 350 355
gca aca gaa gaa gat gtg aca agg ctg ccc tct cct aca tcc ccc ttc
1819 Ala Thr Glu Glu Asp Val Thr Arg Leu Pro Ser Pro Thr Ser Pro
Phe 360 365 370 tca tct ctt tcc caa gac cag gct gcc act tct aaa gcc
aca ttg tct 1867 Ser Ser Leu Ser Gln Asp Gln Ala Ala Thr Ser Lys
Ala Thr Leu Ser 375 380 385 390 tcc aca tct ggt ctt gat tta atg tct
gaa tct gga gaa ggg gaa atc 1915 Ser Thr Ser Gly Leu Asp Leu Met
Ser Glu Ser Gly Glu Gly Glu Ile 395 400 405 tcc cca caa aga gaa gtc
tca aga tcc cag gat cag ttc agt gat atg 1963 Ser Pro Gln Arg Glu
Val Ser Arg Ser Gln Asp Gln Phe Ser Asp Met 410 415 420 aga atc agc
ata aac cag acg cct ggg aag agt ctt gac ttt ggg ttt 2011 Arg Ile
Ser Ile Asn Gln Thr Pro Gly Lys Ser Leu Asp Phe Gly Phe 425 430 435
aca ata aaa tgg gat att cct ggg atc ttc gta gca tca gtt gaa gca
2059 Thr Ile Lys Trp Asp Ile Pro Gly Ile Phe Val Ala Ser Val Glu
Ala 440 445 450 ggt agc cca gca gaa ttt tct cag cta caa gta gat gat
gaa att att 2107 Gly Ser Pro Ala Glu Phe Ser Gln Leu Gln Val Asp
Asp Glu Ile Ile 455 460 465 470 gct att aac aac acc aag ttt tca tat
aac gat tca aaa gag tgg gag 2155 Ala Ile Asn Asn Thr Lys Phe Ser
Tyr Asn Asp Ser Lys Glu Trp Glu 475 480 485 gaa gcc atg gct aag gct
caa gaa act gga cac cta gtg atg gat gtg 2203 Glu Ala Met Ala Lys
Ala Gln Glu Thr Gly His Leu Val Met Asp Val 490 495 500 agg cgc tat
gga aag gct ggt tca cct gaa aca aag tgg att gat gca 2251 Arg Arg
Tyr Gly Lys Ala Gly Ser Pro Glu Thr Lys Trp Ile Asp Ala 505 510 515
act tct gga att tac aac tca gaa aaa tct tca aat cta tct gta aca
2299 Thr Ser Gly Ile Tyr Asn Ser Glu Lys Ser Ser Asn Leu Ser Val
Thr 520 525 530 act gat ttc tcc gaa agc ctt cag agt tct aat att gaa
tcc aaa gaa 2347 Thr Asp Phe Ser Glu Ser Leu Gln Ser Ser Asn Ile
Glu Ser Lys Glu 535 540 545 550 atc aat gga att cat gat gaa agc aat
gct ttt gaa tca aaa gca tct 2395 Ile Asn Gly Ile His Asp Glu Ser
Asn Ala Phe Glu Ser Lys Ala Ser 555 560 565 gaa tcc att tct ttg aaa
aac tta aaa agg cga tca caa ttt ttt gaa 2443 Glu Ser Ile Ser Leu
Lys Asn Leu Lys Arg Arg Ser Gln Phe Phe Glu 570 575 580 caa gga agc
tct gat tcg gtg gtt cct gat ctt cca gtt cca acc atc 2491 Gln Gly
Ser Ser Asp Ser Val Val Pro Asp Leu Pro Val Pro Thr Ile 585 590 595
agt gcc ccg agt cgc tgg gtg tgg gat caa gag gag gag cgg aag cgg
2539 Ser Ala Pro Ser Arg Trp Val Trp Asp Gln Glu Glu Glu Arg Lys
Arg 600 605 610 cag gag agg tgg cag aag gag cag gac cgc cta ctg cag
gaa aaa tat 2587 Gln Glu Arg Trp Gln Lys Glu Gln Asp Arg Leu Leu
Gln Glu Lys Tyr 615 620 625 630 caa cgt gag cag gag aaa ctg agg gaa
gag tgg caa agg gcc aaa cag 2635 Gln Arg Glu Gln Glu Lys Leu Arg
Glu Glu Trp Gln Arg Ala Lys Gln 635 640 645 gag gca gag aga gag aat
tcc aag tac ttg gat gag gaa ctg atg gtc 2683 Glu Ala Glu Arg Glu
Asn Ser Lys Tyr Leu Asp Glu Glu Leu Met Val 650 655 660 cta agc tca
aac agc atg tct ctg acc aca cgg gag ccc tct ctt gcc 2731 Leu Ser
Ser Asn Ser Met Ser Leu Thr Thr Arg Glu Pro Ser Leu Ala 665 670 675
acc tgg gaa gct acc tgg agt gaa ggg tcc aag tct tca gac aga gaa
2779 Thr Trp Glu Ala Thr Trp Ser Glu Gly Ser Lys Ser Ser Asp Arg
Glu 680 685 690 gga acc cga gca gga gaa gag gag agg aga cag cca caa
gag gaa gtt 2827 Gly Thr Arg Ala Gly Glu Glu Glu Arg Arg Gln Pro
Gln Glu Glu Val 695 700 705 710 gtt cat gag gac caa gga aag aag ccg
cag gat cag ctt gtt att gag 2875 Val His Glu Asp Gln Gly Lys Lys
Pro Gln Asp Gln Leu Val Ile Glu 715 720 725 aga gag agg aaa tgg gag
caa cag ctt cag gaa gag caa gag caa aag 2923 Arg Glu Arg Lys Trp
Glu Gln Gln Leu Gln Glu Glu Gln Glu Gln Lys 730 735 740 cgg ctt cag
gct gag gct gag gag cag aag cgt cct gcg gag gag cag 2971 Arg Leu
Gln Ala Glu Ala Glu Glu Gln Lys Arg Pro Ala Glu Glu Gln 745 750 755
aag cgc cag gca gag ata gag cgg gaa aca tca gtc aga ata tac cag
3019 Lys Arg Gln Ala Glu Ile Glu Arg Glu Thr Ser Val Arg Ile Tyr
Gln 760 765 770 tac agg agg cct gtt gat tcc tat gat ata cca aag aca
gaa gaa gca 3067 Tyr Arg Arg Pro Val Asp Ser Tyr Asp Ile Pro Lys
Thr Glu Glu Ala 775 780 785 790 tct tca ggt ttt ctt cct ggt gac agg
aat aaa tcc aga tct act act 3115 Ser Ser Gly Phe Leu Pro Gly Asp
Arg Asn Lys Ser Arg Ser Thr Thr 795 800 805 gaa ctg gat gat tac tcc
aca aat aaa aat gga aac aat aaa tat tta 3163 Glu Leu Asp Asp Tyr
Ser Thr Asn Lys Asn Gly Asn Asn Lys Tyr Leu 810 815 820 gac caa att
ggg aac acg acc tct tca cag agg aga tcc aag aaa gaa 3211 Asp Gln
Ile Gly Asn Thr Thr Ser Ser Gln Arg Arg Ser Lys Lys Glu 825 830 835
caa gta cca tca gga gca gaa ttg gag agg caa caa atc ctt cag gaa
3259 Gln Val Pro Ser Gly Ala Glu Leu Glu Arg Gln Gln Ile Leu Gln
Glu 840 845 850 atg agg aag aga aca ccc ctt cac aat gac aac agc tgg
atc cga cag 3307 Met Arg Lys Arg Thr Pro Leu His Asn Asp Asn Ser
Trp Ile Arg Gln 855 860 865 870 cgc agt gcc agt gtc aac aaa gag cct
gtt agt ctt cct ggg atc atg 3355 Arg Ser Ala Ser Val Asn Lys Glu
Pro Val Ser Leu Pro Gly Ile Met 875 880 885 aga aga ggc gaa tct tta
gat aac ctg gac tcc ccc cga tcc aat tct 3403 Arg Arg Gly Glu Ser
Leu Asp Asn Leu Asp Ser Pro Arg Ser Asn Ser 890 895 900 tgg aga cag
cct cct tgg ctc aat cag ccc aca gga ttc tat gct tct 3451 Trp Arg
Gln Pro Pro Trp Leu Asn Gln Pro Thr Gly Phe Tyr Ala Ser 905 910 915
tcc tct gtg caa gac ttt agt cgc cca cca cct cag ctg gtg tcc aca
3499 Ser Ser Val Gln Asp Phe Ser Arg Pro Pro Pro Gln Leu Val Ser
Thr 920 925 930 tca aac cgt gcc tac atg cgg aac ccc tcc tcc agc gtg
ccc cca cct 3547 Ser Asn Arg Ala Tyr Met Arg Asn Pro Ser Ser Ser
Val Pro Pro Pro 935 940 945 950 tca gct ggc tcc gtg aag acc tcc acc
aca ggt gtg gcc acc aca cag 3595 Ser Ala Gly Ser Val Lys Thr Ser
Thr Thr Gly Val Ala Thr Thr Gln 955 960 965 tcc ccc acc ccg aga agc
cat tcc cct tca gct tca cag tca ggc tct 3643 Ser Pro Thr Pro Arg
Ser His Ser Pro Ser Ala Ser Gln Ser Gly Ser 970 975 980 cag ctg cgt
aac agg tca gtc agt ggg aag cgc ata tgc tcc tac tgc 3691 Gln Leu
Arg Asn Arg Ser Val Ser Gly Lys Arg Ile Cys Ser Tyr Cys 985 990 995
aat aac att ctg ggc aaa gga gcc gcc atg atc atc gag tcc ctg ggt
3739 Asn Asn Ile Leu Gly Lys Gly Ala Ala Met Ile Ile Glu Ser Leu
Gly 1000 1005 1010 ctt tgt tat cat ttg cat tgt ttt aag tgt gtt gcc
tgt gag tgt gac 3787 Leu Cys Tyr His Leu His Cys Phe Lys Cys Val
Ala Cys Glu Cys Asp 1015 1020 1025 1030 ctc gga ggc tct tcc tca gga
gct gaa gtc agg atc aga aac cac caa 3835 Leu Gly Gly Ser Ser Ser
Gly Ala Glu Val Arg Ile Arg Asn His Gln 1035 1040 1045 ctg tac tgc
aac gac tgc tat ctc aga ttc aaa tct gga cgg cca acc 3883 Leu Tyr
Cys Asn Asp Cys Tyr Leu Arg Phe Lys Ser Gly Arg Pro Thr 1050 1055
1060 gcc atg tga tgtaagcctc catacgaaag cactgttgca gatagaagaa 3932
Ala Met * gaggtggttg ctgctcatgt agatctataa atatgtgttg tatgtctttt
ttgctttttt 3992 tttaaaaaaa agaataactt tttttgcctc tttagattac
atagaagcat tgtagtcttg 4052 gtagaaccag tatttttgtt gtttatttat
aaggtaattg tgtgtgggga
aaagtgcagt 4112 atttacctgt tgaattcagc atcttgagag cacaagggaa
aaaataagaa cctacgaata 4172 tttttgaggc agataatgat ctagtttgac
tttctagtta gtggtgtttt gaagagggta 4232 ttttattgtt ttttaaaaaa
aggttcttaa acattatttg aaatagttaa tataaataca 4292 taattgcatt
tgctctgttt attgtaatgt attctaaatt aatgcagaac catatggaaa 4352
atttcattaa aatctatccc caaatgtgct ttctgtatcc ttccttctac ctattattct
4412 gatttttaaa aatgcagtta atgtaccatt tatttgcttg atgaagggag
ctctattttc 4472 tttaccagaa atgttgctaa gtaattccca atagaaagct
gcttattttc attaatgaaa 4532 aataaccatg gtttgtatac tagaagtctt
cttcagaaac tggtgagcct ttctgttcaa 4592 ttgcatttgt aaataaactt
gctgatgcat ttaaaaaaaa aaaaaaaaaa 4642 4 1064 PRT Homo Sapiens 4 Met
Gln Asp Tyr Asn Lys Asp Asp Met Ser Tyr Arg Arg Ile Ser Ala 1 5 10
15 Val Glu Pro Lys Thr Ala Leu Pro Phe Asn Arg Phe Leu Pro Asn Lys
20 25 30 Ser Arg Gln Pro Ser Tyr Val Pro Ala Pro Leu Arg Lys Lys
Lys Pro 35 40 45 Asp Lys His Glu Asp Asn Arg Arg Ser Trp Ala Ser
Pro Val Tyr Thr 50 55 60 Glu Ala Asp Gly Thr Phe Ser Arg Leu Phe
Gln Lys Ile Tyr Gly Glu 65 70 75 80 Asn Gly Ser Lys Ser Met Ser Asp
Val Ser Ala Glu Asp Val Gln Asn 85 90 95 Leu Arg Gln Leu Arg Tyr
Glu Glu Met Gln Lys Ile Lys Ser Gln Leu 100 105 110 Lys Glu Gln Asp
Gln Lys Trp Gln Asp Asp Leu Ala Lys Trp Lys Asp 115 120 125 Arg Arg
Lys Ser Tyr Thr Ser Asp Leu Gln Lys Lys Lys Glu Glu Arg 130 135 140
Glu Glu Ile Glu Lys Gln Ala Leu Glu Lys Ser Lys Arg Ser Ser Lys 145
150 155 160 Thr Phe Lys Glu Met Leu Gln Asp Arg Glu Ser Gln Asn Gln
Lys Ser 165 170 175 Thr Val Pro Ser Arg Arg Arg Met Tyr Ser Phe Asp
Asp Val Leu Glu 180 185 190 Glu Gly Lys Arg Pro Pro Thr Met Thr Val
Ser Glu Ala Ser Tyr Gln 195 200 205 Ser Glu Arg Val Glu Glu Lys Gly
Ala Thr Tyr Pro Ser Glu Ile Pro 210 215 220 Lys Glu Asp Ser Thr Thr
Phe Ala Lys Arg Glu Asp Arg Val Thr Thr 225 230 235 240 Glu Ile Gln
Leu Pro Ser Gln Ser Pro Val Glu Glu Gln Ser Pro Ala 245 250 255 Ser
Leu Ser Ser Leu Arg Ser Arg Ser Thr Gln Met Glu Ser Thr Arg 260 265
270 Val Ser Ala Ser Leu Pro Arg Ser Tyr Arg Lys Thr Asp Thr Val Arg
275 280 285 Leu Thr Ser Val Val Thr Pro Arg Pro Phe Gly Ser Gln Thr
Arg Gly 290 295 300 Ile Ser Ser Leu Pro Arg Ser Tyr Thr Met Asp Asp
Ala Trp Lys Tyr 305 310 315 320 Asn Gly Asp Val Glu Asp Ile Lys Arg
Thr Pro Asn Asn Val Val Ser 325 330 335 Thr Pro Ala Pro Ser Pro Asp
Ala Ser Gln Leu Ala Ser Ser Leu Ser 340 345 350 Ser Gln Lys Glu Val
Ala Ala Thr Glu Glu Asp Val Thr Arg Leu Pro 355 360 365 Ser Pro Thr
Ser Pro Phe Ser Ser Leu Ser Gln Asp Gln Ala Ala Thr 370 375 380 Ser
Lys Ala Thr Leu Ser Ser Thr Ser Gly Leu Asp Leu Met Ser Glu 385 390
395 400 Ser Gly Glu Gly Glu Ile Ser Pro Gln Arg Glu Val Ser Arg Ser
Gln 405 410 415 Asp Gln Phe Ser Asp Met Arg Ile Ser Ile Asn Gln Thr
Pro Gly Lys 420 425 430 Ser Leu Asp Phe Gly Phe Thr Ile Lys Trp Asp
Ile Pro Gly Ile Phe 435 440 445 Val Ala Ser Val Glu Ala Gly Ser Pro
Ala Glu Phe Ser Gln Leu Gln 450 455 460 Val Asp Asp Glu Ile Ile Ala
Ile Asn Asn Thr Lys Phe Ser Tyr Asn 465 470 475 480 Asp Ser Lys Glu
Trp Glu Glu Ala Met Ala Lys Ala Gln Glu Thr Gly 485 490 495 His Leu
Val Met Asp Val Arg Arg Tyr Gly Lys Ala Gly Ser Pro Glu 500 505 510
Thr Lys Trp Ile Asp Ala Thr Ser Gly Ile Tyr Asn Ser Glu Lys Ser 515
520 525 Ser Asn Leu Ser Val Thr Thr Asp Phe Ser Glu Ser Leu Gln Ser
Ser 530 535 540 Asn Ile Glu Ser Lys Glu Ile Asn Gly Ile His Asp Glu
Ser Asn Ala 545 550 555 560 Phe Glu Ser Lys Ala Ser Glu Ser Ile Ser
Leu Lys Asn Leu Lys Arg 565 570 575 Arg Ser Gln Phe Phe Glu Gln Gly
Ser Ser Asp Ser Val Val Pro Asp 580 585 590 Leu Pro Val Pro Thr Ile
Ser Ala Pro Ser Arg Trp Val Trp Asp Gln 595 600 605 Glu Glu Glu Arg
Lys Arg Gln Glu Arg Trp Gln Lys Glu Gln Asp Arg 610 615 620 Leu Leu
Gln Glu Lys Tyr Gln Arg Glu Gln Glu Lys Leu Arg Glu Glu 625 630 635
640 Trp Gln Arg Ala Lys Gln Glu Ala Glu Arg Glu Asn Ser Lys Tyr Leu
645 650 655 Asp Glu Glu Leu Met Val Leu Ser Ser Asn Ser Met Ser Leu
Thr Thr 660 665 670 Arg Glu Pro Ser Leu Ala Thr Trp Glu Ala Thr Trp
Ser Glu Gly Ser 675 680 685 Lys Ser Ser Asp Arg Glu Gly Thr Arg Ala
Gly Glu Glu Glu Arg Arg 690 695 700 Gln Pro Gln Glu Glu Val Val His
Glu Asp Gln Gly Lys Lys Pro Gln 705 710 715 720 Asp Gln Leu Val Ile
Glu Arg Glu Arg Lys Trp Glu Gln Gln Leu Gln 725 730 735 Glu Glu Gln
Glu Gln Lys Arg Leu Gln Ala Glu Ala Glu Glu Gln Lys 740 745 750 Arg
Pro Ala Glu Glu Gln Lys Arg Gln Ala Glu Ile Glu Arg Glu Thr 755 760
765 Ser Val Arg Ile Tyr Gln Tyr Arg Arg Pro Val Asp Ser Tyr Asp Ile
770 775 780 Pro Lys Thr Glu Glu Ala Ser Ser Gly Phe Leu Pro Gly Asp
Arg Asn 785 790 795 800 Lys Ser Arg Ser Thr Thr Glu Leu Asp Asp Tyr
Ser Thr Asn Lys Asn 805 810 815 Gly Asn Asn Lys Tyr Leu Asp Gln Ile
Gly Asn Thr Thr Ser Ser Gln 820 825 830 Arg Arg Ser Lys Lys Glu Gln
Val Pro Ser Gly Ala Glu Leu Glu Arg 835 840 845 Gln Gln Ile Leu Gln
Glu Met Arg Lys Arg Thr Pro Leu His Asn Asp 850 855 860 Asn Ser Trp
Ile Arg Gln Arg Ser Ala Ser Val Asn Lys Glu Pro Val 865 870 875 880
Ser Leu Pro Gly Ile Met Arg Arg Gly Glu Ser Leu Asp Asn Leu Asp 885
890 895 Ser Pro Arg Ser Asn Ser Trp Arg Gln Pro Pro Trp Leu Asn Gln
Pro 900 905 910 Thr Gly Phe Tyr Ala Ser Ser Ser Val Gln Asp Phe Ser
Arg Pro Pro 915 920 925 Pro Gln Leu Val Ser Thr Ser Asn Arg Ala Tyr
Met Arg Asn Pro Ser 930 935 940 Ser Ser Val Pro Pro Pro Ser Ala Gly
Ser Val Lys Thr Ser Thr Thr 945 950 955 960 Gly Val Ala Thr Thr Gln
Ser Pro Thr Pro Arg Ser His Ser Pro Ser 965 970 975 Ala Ser Gln Ser
Gly Ser Gln Leu Arg Asn Arg Ser Val Ser Gly Lys 980 985 990 Arg Ile
Cys Ser Tyr Cys Asn Asn Ile Leu Gly Lys Gly Ala Ala Met 995 1000
1005 Ile Ile Glu Ser Leu Gly Leu Cys Tyr His Leu His Cys Phe Lys
Cys 1010 1015 1020 Val Ala Cys Glu Cys Asp Leu Gly Gly Ser Ser Ser
Gly Ala Glu Val 1025 1030 1035 1040 Arg Ile Arg Asn His Gln Leu Tyr
Cys Asn Asp Cys Tyr Leu Arg Phe 1045 1050 1055 Lys Ser Gly Arg Pro
Thr Ala Met 1060 5 549 DNA Homo Sapiens 5 gcaccataag agagaagatt
cctttgaaag cttggactct ttgggctcga ggtcattgac 60 aagctgctcc
tctgatatca cgttgagagg ggggcgtgaa ggttttgaaa gtgacacaga 120
ttcggaattt acattcaaga tgcaggatta taataaagat gatatgtcgt atcgaaggat
180 ttcggctgtt gagccaaaga ctgcgttacc cttcaatcgt tttttaccca
acaaaagtag 240 acagccatcc tatgtaccag cacctctgag aaagaaaaag
ccagacaaac atgaggataa 300 cagaagaagt tgggcaagcc cggtttatac
agaagcagat ggaacatttt caagactctt 360 tcaaaagatt tatggtgaga
atgggagtaa gtccatgagt gatgtcagcg cagaagatgt 420 tcaaaacttg
cgtcagctgc gttacgagga gatgcagaaa ataaaatcac aattaaaaga 480
acaagatcag aaatggcagg atgaccttgc aaagtggaaa gatcgtcgaa aaagttacac
540 ttcagatct 549 6 25 DNA Artificial Sequence Primer 6 gtaacttttt
cgacgatctt tccac 25 7 25 DNA Artificial Sequence Primer 7
tattttctgc atctcctcgt aacgc 25 8 25 DNA Artificial Sequence Primer
8 tgacatcact catggactta ctccc 25 9 25 DNA Artificial Sequence
Primer 9 gttccatctg cttctgtata aaccg 25 10 25 DNA Artificial
Sequence Primer 10 tctgttatcc tcatgtttgt ctggc 25 11 25 DNA
Artificial Sequence Primer 11 tctggctttt tctttctcaa agtgc 25 12 25
DNA Artificial Sequence Primer 12 aagtgctggt acatagatgg ctgtc 25 13
25 DNA Artificial Sequence Primer 13 tctacttttg ttggggttga aaacg 25
14 25 DNA Artificial Sequence Primer 14 tgtgtcactt tcaaaaactt cacgc
25 15 25 DNA Artificial Sequence Primer 15 agagcagctt gtctatgaac
tccag 25 16 24 DNA Artificial Sequence Primer 16 cgggaaatcg
tgcgtgacat taag 24 17 24 DNA Artificial Sequence Primer 17
tgatctcctt ctgcatcctg tcgg 24 18 23 DNA Artificial Sequence Primer
18 ttcgtagcat cagttgaagc agg 23 19 22 DNA Artificial Sequence
Primer 19 ggtgaaccag cctttccata gc 22
* * * * *