U.S. patent application number 10/889948 was filed with the patent office on 2004-12-30 for fhm a novel member of the tnf ligand supergene family: antibody materials and methods.
Invention is credited to Boyle, William James, Hsu, Hailing, Wooden, Scott Kenneth.
Application Number | 20040265913 10/889948 |
Document ID | / |
Family ID | 22521006 |
Filed Date | 2004-12-30 |
United States Patent
Application |
20040265913 |
Kind Code |
A1 |
Hsu, Hailing ; et
al. |
December 30, 2004 |
Fhm a novel member of the TNF ligand supergene family: antibody
materials and methods
Abstract
The present invention provides a purified polynucleotide
encoding a novel polypeptide, designated Fhm, which belongs to the
TNF gene superfamily; to purified Fhm polypeptide molecules; to
antibodies that bind Fhm; to materials comprising such molecules;
and to methods of using such molecules.
Inventors: |
Hsu, Hailing; (Moorpark,
CA) ; Wooden, Scott Kenneth; (Thousand Oaks, CA)
; Boyle, William James; (Moorpark, CA) |
Correspondence
Address: |
MARSHALL, GERSTEIN & BORUN LLP
6300 SEARS TOWER
233 S. WACKER DRIVE
CHICAGO
IL
60606
US
|
Family ID: |
22521006 |
Appl. No.: |
10/889948 |
Filed: |
July 13, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10889948 |
Jul 13, 2004 |
|
|
|
10286696 |
Nov 1, 2002 |
|
|
|
10286696 |
Nov 1, 2002 |
|
|
|
09632287 |
Aug 3, 2000 |
|
|
|
6521422 |
|
|
|
|
60147294 |
Aug 4, 1999 |
|
|
|
Current U.S.
Class: |
435/7.1 ;
530/388.15; 530/391.1 |
Current CPC
Class: |
Y02A 50/30 20180101;
A61P 31/12 20180101; C07K 14/70575 20130101; A61P 37/02 20180101;
A61P 7/00 20180101; Y02A 50/412 20180101; C12N 2799/021 20130101;
A61K 38/00 20130101; A61P 29/00 20180101; A01K 2217/05 20130101;
A61P 31/00 20180101; A61K 39/00 20130101; A61P 43/00 20180101; A61P
35/00 20180101; Y02A 50/58 20180101; A61P 19/02 20180101 |
Class at
Publication: |
435/007.1 ;
530/388.15; 530/391.1 |
International
Class: |
G01N 033/53; C07K
016/46 |
Claims
What is claimed is:
1. An antibody that specifically binds a first polypeptide
comprising the amino acid sequence set forth in SEQ ID NO: 4, and
antagonizes the binding of the first polypeptide to a NTR3
polypeptide.
2. The antibody of claim 1, that is a monoclonal antibody or an
antigen binding fragment thereof.
3. The monoclonal antibody of claim 2 that is fully human,
humanized, or chimeric.
4. The monoclonal antibody of claim 2 that is a fully human
monoclonal antibody or an antigen binding fragment thereof.
5. The monoclonal antibody of claim 2 that is a humanized
monoclonal antibody or an antigen binding fragment thereof.
6. The monoclonal substance of claim 2 that is chimeric monoclonal
antibody or an antigen binding fragment thereof.
7. A monoclonal antibody comprising a complementarity-determining
region of the antibody of claim 2 or claim 3.
8. A monoclonal antibody comprising a variable region of the
monoclonal antibody of claim 2 or 3.
9. The antigen-binding fragment of claim 2 or claim 3 that is a Fab
or Fab' fragment.
10. The monoclonal antibody of claim 2, wherein the antibody
substance further comprises a detectable label.
11. A hybridoma that produces the monoclonal antibody of claim
2.
12. A mammalian host cell that produces the monoclonal antibody of
claim 2.
13. A Chinese hamster ovary (CHO) cell that produces the monoclonal
antibody of claim 2.
14. A composition comprising the monoclonal antibody of claim 2 or
an antigen-binding fragment thereof, and a diluent or a
carrier.
15. A composition comprising the monoclonal antibody of claim 3 or
an antigen-binding fragment thereof, and a diluent or a carrier.
Description
RELATED APPLICATIONS
[0001] This application claims priority, under U.S.C. .sctn. 119,
from U.S. provisional patent application Ser. No. 60/147,294 filed
Aug. 4, 1999.
FIELD OF THE INVENTION
[0002] The present invention is in the field of recombinant
genetics. In particular, the present invention relates to a novel
receptor ligand, designated Fhm, belonging to the TNF ligand
supergene family and nucleic acid molecules encoding the same. The
invention also relates to vectors, host cells, anti-Fhm antibodies,
and recombinant methods for producing Fhm polypeptides. The
invention also relates to the use of the recombinant Fhm
polypeptide to identify putative binding partners/receptors. In
addition, provided for are methods and reagents for the diagnosis
of diseases associated with abnormal Fhm or abnormal expression of
its putative receptor, and methods and pharmaceutical compositions
for the treatment of diseases associated with abnormal Fhm or
abnormal expression of Fhm and/or itsreceptor. The invention also
discloses pharmaceutical compositions for use in the treatment of
these diseases.
BACKGROUND OF THE INVENTION
[0003] Technical advances in the identification, cloning,
expression and manipulation of nucleic acid molecules have greatly
accelerated the discovery of novel therapeutics based upon
deciphering the human genome. Rapid nucleic acid sequencing
techniques can now generate sequence information at unprecedented
rates, and coupled with computational analyses, allow the assembly
of overlapping sequences into entire genome and the identification
of polypeptide-encoding regions. Comparison of a predicted amino
acid sequence against a database compilation of known amino acid
sequences can allow one to determine the extent of homology to
previously identified sequence and/or structure landmarks. Cloning
and expression of a polypeptide-encoding region of a nucleic acid
molecule provides a polypeptide product for structural and
functional analysis. Manipulation of nucleic acid molecules and
encoded polypeptides to produce variants and derivatives thereof
may confer advantageous properties on a product for use as a
therapeutic.
[0004] However, in spite of the significant technical advances in
genome research over the past decade, the potential for development
of novel therapeutics based on the human genome is-still largely
unrealized. While a number of genes encoding potentially beneficial
protein therapeutics, or those encoding polypeptides which may act
as "targets" for therapeutic molecules, have been identified using
recombinant DNA technology, the structure and function of a vast
number of genes in the genome of mammals are yet unknown.
[0005] Identification and Characterization of TNF-Family of Ligands
and Receptors
[0006] Tumor necrosis factor (TNF) was first identified in the
serum of mice and rabbits which had been infected with bacillus of
Calmette and Guerin(BCG) and which had been injected with
endotoxin. TNF activity in the serum of these animals was
recognized on the basis of its cytotoxic and anti-tumor activities.
This TNF activity, referred to as TNF-.alpha., is produced
particularly by activated monocytes and macrophages, and has been
implicated in normal growth processes as well as in a variety of
diseases.
[0007] Following the discovery of TNF-.alpha., independent research
led to the identification of another cytokine associated with
inflammatory responses lymphotoxin-.alpha. (LT-.alpha.), which was
shown to be produced exclusively by lymphocytes. LT-.alpha. was
subsequently shown to be 30% homologous with TNF-.alpha., and was
renamed TNF-.beta.. It is now clear that TNF-.alpha. and TNF-.beta.
are members of a gene family that includes yet another member
termed LT-.beta. (Browning et al., Cell 72:847-856, 1993). The
three genes are tightly linked within the MHC complex and show
similar organization. Moreover, the biologically active forms of
TNF-.alpha. and TNF-.beta. are homotrimers and share many of the
same biological activities including competing for the same
cell-surface receptors (Agarwal et al., Nature 318:665-667, 1985).
Two distinct but structurally homologous receptors have been
identified, and each has been shown to bind both the ligands and
mediate their effects.
[0008] However, it has been recognized that TNFs are only
representative members of the rapidly expanding supergene familiy
that includes TNF-.alpha., TNF-.beta./lymphotoxin-.alpha.
(LT-.alpha.), lymphotoxin-.beta. (LT-.beta.), FasL, CD40L, CD30L,
CD27L, 4-1BBL, and TNF-related apoptosis-inducing ligand (TRAIL),
RANKL, GITRL and TNF-2. See generally Orlinick-et al., Cell Signal,
10(8): 543-551(1998). The distinctive but overlapping cellular
responses induced by members of the TNF family of ligands following
their interaction(s) with their cognate cell-surface receptors
result in clearly defined developmental and regulatory changes in
cells of the lymphoid, hematopoietic, and other lineages. For
example, the TNF family of ligands are involved in growth
regulation and differentiation of cells which are involved in
inflamation, immune processes and hematopoiesis (Bayert, R. and
Fiers, W., Tumor Necrosis Factor and Lymphokines in: Cytokines eds.
Anthony Mire-Sluis and Robin Thorpe, Academic Press San Diego
Calif., 1998). The TNF family of ligands activates the immune
defenses against parasites, and act directly or indirectly as
mediators in immune reactions and inflammatory processes. However,
administration of TNF and/or other members of the TNF family can
also be accompanied by harmful phenomena such as shock and tissue
damage (Bayert, R. and Fiers, W., supra). The main physiological
role of the TNF family of ligands is the activation of first-line
reaction of an organism to microbial, parasitic, viral infections,
or to mechanical stress and cancer. For example, TNF-related
apoptosis-inducing ligand (TRAIL) has been demonstrated to induce
apoptosis of a number of different types of cancer cells as well as
virally infected cells.
[0009] Furthermore, a number of observations have also led to the
conclusion that the TNF family of ligands are also involved in a
variety of pathological conditions including cachexia, toxic shock
syndrome, inflammatory diseases such as rheumatoid and
osteoarthritis, and in lethality resulting from graft-versus-host
reaction (GVHR) rapid necrosis of tumors, apoptosis,
immunostimulation and resistance to parasites and viruses. (Bayert,
R. and Fiers, W., supra).
[0010] Like other cytokines, the members of the TNF family of
ligands act via specific cell-surface receptors. The receptors,
with two exceptions, are type 1 membrane-associated proteins.
Sequence homology amongst them is almost entirely confined to their
extracellular domains. For example, two TNF receptors have been
cloned which differ in size and in binding affinity (Bayert, R. and
Fiers, W., supra). Both receptors bind TNF-.alpha. and TNF-.beta.
and are membrane associated proteins. The two receptors consist of
extracellular domains which bind TNF (and are homologous for 28%),
single transmembrane domains, and intracellular domains which are
totally different from each other and which do not contain any
recognizable structural motifs that have been associated with any
particular function. Based on similarities in their extracellular
domains, these receptors belong to a receptor gene superfamily that
includes the low-affinity nerve growth factor (NGF) receptor, the
Fas antigen, the human B-lymphocyte activation molecule CD40, CD27,
4-1BB, PV-T2, CD30, TNFR-RP, TRAIL-R, PV-A53R, RANK, GITR, and the
OX40 antigen found on activated T-cells (Smith et al., Cell,
76(6):959-962, 1994; Baker and Reddy, Oncogene, 12(1):1-9,
1996).
[0011] In addition to the membrane associated receptor molecules
described above, a number the receptors belonging to the
TNF-receptor supergene family exist as soluble ligand binding
proteins. Many of the soluble forms of the transmembrane receptors
were subsequently identified as containing only the extracellular
ligand binding domain(s) of the receptors. For example, a soluble
form of TNF receptor has been found in urine and serum (See U.S.
Pat. No. 5,843,789 and Nophar et al., EMBOJ., 9(10):3269-3278,
1990), and has been shown to arise by proteolytic cleavage of cell
surface TNF-receptors (Wallach et al., Agents Actions Suppl.,
35:51-57 1991). These soluble forms of receptor molecules have been
implicated in the modulation of TNF activity by not only
interfering with TNF binding to its receptor, but also by
stabilizing the TNF structure and preserving its activity, thus
prolonging some of its effects (Aderka et al, Cytokine & Growth
Factor Reviews, 7(3):231-240, 1996).
[0012] The activity of members of the TNF family of ligands is
tightly regulated at the levels of secretion and receptor
expression. Additional regulatory mechanisms are provided by action
of specific inhibitory proteins present on cell surfaces and in
biological fluids. While some of these inhibitory proteins have
been identified as soluble forms of receptor molecules, the
identity of many of these cytokine regulatory proteins are as yet
unknown. However, abnormalities in the production of these
substances might contribute to the pathophysiology of a variety of
diseases including immune and neoplastic diseases. Besides their
role in regulating cytokine activity in vivo, these regulatory
molecules hold significant potential for therapeutic use as very
specific inhibitors/anti-cytokine agents, and as indicators in
diagnosis and assessment of immune function and growth parameters
in a variety of autoimmune and malignant diseases.
[0013] Because of the important role of the TNF family of ligands
(and their receptors) in health and disease, a need exists to
identify, isolate, and characterize additional members of the
family, for use in diagnosing and treating disease and pathological
conditions.
SUMMARY OF THE INVENTION
[0014] The present invention relates to a novel serine/threonine
kinase family and uses thereof. More specifically, the present
invention relates to novel Fhm nucleic acid molecules and encoded
polypeptides, and uses thereof.
[0015] The invention provides for an isolated nucleic acid molecule
comprising a nucleotide sequence selected from the group consisting
of:
[0016] (a) the nucleotide sequence set forth in SEQ ID NO: 3;
[0017] (b) a nucleotide sequence encoding the polypeptide set forth
in SEQ ID NO: 4;
[0018] (c) a nucleotide sequence which hybridizes under moderately
or highly stringent conditions to the complement of (a) or (b),
wherein the encoded polypeptide has an activity of the polypeptide
set forth in SEQ ID NO: 3; and
[0019] (d) a nucleotide sequence complementary to any of (a)
through (c).
[0020] The invention also provides for an isolated nucleic acid
molecule comprising a nucleotide sequence selected from the group
consisting of:
[0021] (a) a nucleotide sequence encoding a polypeptide that is at
least about 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99 percent
identical to the polypeptide set forth in 4, wherein the
polypeptide has an activity of the encoded polypeptide set forth in
SEQ ID NO: 4 as determined using a computer program selected from
the group consisting of GAP, BLASTP, BLASTN, FASTA, BLASTA, BLASTX,
BestFit, and the Smith-Waterman algorithm;
[0022] (b) a nucleotide sequence encoding an allelic variant or
splice variant of the nucleotide sequence set forth in SEQ ID NO:
3, wherein the encoded polypeptide has an activity of the
polypeptide set forth in SEQ ID NO: 4;
[0023] (c) a nucleotide sequence of SEQ ID NO: 3, (a), or (b)
encoding a polypeptide fragment of at least about 25 amino acid
residues, wherein the polypeptide has an activity of the
polypeptide set forth in SEQ ID NO: 4;
[0024] (d) a nucleotide sequence encoding a polypeptide that has a
substitution and/or deletion of 1 to 251 amino acid residues set
forth in any of SEQ ID NOS: 3-4 wherein the encoded polypeptide has
an activity of the polypeptide set forth in SEQ ID NO: 4;
[0025] (e) a nucleotide sequence of SEQ ID NO: 3, or (a)-(d)
comprising a fragment of at least about 16 nucleotides;
[0026] (f) a nucleotide sequence which hybridizes under moderately
or highly stringent conditions to the complement of any of (a)-(e),
wherein the encoded polypeptide has an activity of the polypeptide
set forth in SEQ ID NO:4; and
[0027] (g) a nucleotide sequence complementary to any of
(a)-(e).
[0028] The invention further provides for an isolated nucleic acid
molecule comprising a nucleotide sequence selected from the group
consisting of:
[0029] (a) a nucleotide sequence encoding a polypeptide set forth
in SEQ ID NO: 4 with at least one conservative amino acid
substitution, wherein the encoded polypeptide has an activity of
the polypeptide set forth in SEQ ID NO: 4;
[0030] (b) a nucleotide sequence encoding a polypeptide set forth
in SEQ ID NO: 4 with at least one amino acid insertion, wherein the
encoded polypeptide has an activity of the polypeptide set forth in
SEQ ID NO: 4;
[0031] (c) a nucleotide sequence encoding a polypeptide set -forth
in SEQ ID NO: 4 with at least one amino acid deletion, wherein the
encoded polypeptide has an activity of the polypeptide set forth in
SEQ ID NO: 4;
[0032] (d) a nucleotide sequence encoding a polypeptide set forth
in SEQ ID NO: 4 which has a C- and/or N-terminal truncation,
wherein the encoded polypeptide has an activity of the polypeptide
set forth in SEQ ID NO: 4;
[0033] (e) a nucleotide sequence encoding a polypeptide set forth
in SEQ ID NO: 4 with at least one modification selected from the
group consisting of amino acid substitutions, amino acid
insertions, amino acid deletions, C-terminal truncation, and
N-terminal truncation, wherein the polypeptide has an activity of
the encoded polypeptide set forth in SEQ ID NO: 4;
[0034] (f) a nucleotide sequence of (a)-(e) comprising a fragment
of at least about 16 nucleotides;
[0035] (g) a nucleotide sequence which hybridizes under moderately
or highly stringent conditions to the complement of any of (a)-(f),
wherein the encoded polypeptide has an activity of the polypeptide
set forth in SEQ ID NO: 4; and
[0036] (h) a nucleotide sequence complementary to any of
(a)-(e).
[0037] The invention also provides for an isolated polypeptide
comprising the amino acid sequence selected from the group
consisting of:
[0038] (a) the mature amino acid sequence set forth in SEQ ID NO: 4
comprising a mature amino terminus at residue 1, and optionally
further comprising an amino-terminal methionine;
[0039] (b) an amino acid sequence for an ortholog of SEQ ID NO: 4,
wherein the polypeptide has an activity of the polypeptide set
forth in SEQ ID NO: 4;
[0040] (c) an amino acid sequence that is at least about 70, 75,
80, 85, 90, 95, 96, 97, 98, or 99 percent identical to the amino
acid sequence of SEQ ID NO: 4, wherein the polypeptide has an
activity of the polypeptide set forth in SEQ ID NO: 4 as determined
using a computer program selected from the group consisting of GAP,
BLASTP, BLASTN, FASTA, BLASTA, BLASTX, BestFit, and the
Smith-Waterman algorithm;
[0041] (d) a fragment of the amino acid sequence set forth in SEQ
ID NO: 4 comprising at least about 25 amino acid residues, wherein
the polypeptide has an activity of the polypeptide set forth in SEQ
ID NO: 4;
[0042] (e) an amino acid sequence for an allelic variant or splice
variant of either the amino acid sequence set forth in SEQ ID NO:
4, or at least one of (a)-(c) wherein the polypeptide has an
activity of the polypeptide set forth in SEQ ID NO: 4.
[0043] The invention further provides for an isolated polypeptide
comprising the amino acid sequence selected from the group
consisting of:
[0044] (a) the amino acid sequence set forth in SEQ ID NO: 4 with
at least one conservative amino acid substitution, wherein the
polypeptide has an activity of the polypeptide set forth in SEQ ID
NO: 4;
[0045] (b) the amino acid sequence set forth in SEQ ID NO: 4 with
at least one amino acid insertion, wherein the polypeptide has an
activity of the polypeptide set forth in SEQ ID NO: 4;
[0046] (c) the amino acid sequence set forth in SEQ ID NO: 4 with
at least one amino acid deletion, wherein the polypeptide has an
activity of the polypeptide set forth in SEQ ID NO:4;
[0047] (d) the amino acid sequence set forth in SEQ ID NO: 4 which
has a C- and/or N-terminal truncation, wherein the polypeptide has
an activity of the polypeptide set forth in SEQ ID NO: 4; and
[0048] (e) the amino acid sequence set forth in SEQ ID NO: 4, with
at least one modification selected from the group consisting of
amino acid substitutions, amino acid insertions, amino acid
deletions, C-terminal truncation, and N-terminal truncation,
wherein the polypeptide has an activity of the polypeptide set
forth in SEQ ID NO: 4.
[0049] Also provided are fusion polypeptides comprising the
polypeptide sequences of (a)-(e) above of the preceding
paragraphs.
[0050] The present invention also provides for an expression vector
comprising the isolated nucleic acid molecules set forth herein ,
recombinant host cells comprising recombinant nucleic acid
molecules set forth herein , and a method of producing a Fhm
polypeptide comprising culturing the host cells and optionally
isolating the polypeptide so produced.
[0051] A transgenic non-human animal comprising a nucleic acid
molecule encoding a Fhm polypeptide is also encompassed by the
invention. The Fhm nucleic acid molecules are introduced into the
animal in a manner that allows expression and increased levels of
the Fhm polypeptide, which may include increased circulating
levels. The transgenic non-human animal is preferably a mammal.
[0052] Also provided are derivatives of the Fhm polypeptides of the
present invention.
[0053] Additionally provided are selective binding agents such as
antibodies and peptides capable of specifically binding the Fhm
polypeptides of the invention. Such antibodies and peptides may be
agonistic or antagonistic.
[0054] Pharmaceutical compositions comprising the nucleotides,
polypeptides, or selective binding agents of the present invention
and one or more pharmaceutically acceptable formulation agents are
also encompassed by the invention. The pharmaceutical compositions
are used to provide therapeutically effective amounts of the
nucleotides or polypeptides of the present invention. The invention
is also directed to methods of using the polypeptides, nucleic acid
molecules, and selective binding agents. The invention also
provides for devices to administer a Fhm polypeptide encapsulated
in a membrane.
[0055] The Fhm polypeptides and nucleic acid molecules of the
present invention may be used to treat, prevent, ameliorate,
diagnose and/or detect diseases and disorders, including those
recited herein. Expression analysis in biological, cellular or
tissue samples suggests that Fhm polypeptide may play a role in the
diagnosis and/or treatment of TNF-related diseases including, but
not limited to, acquired-immunodeficiency syndrome (AIDS), anemia,
autoimmune diseases, cachexia, cancer, cerebral malaria, diabetes
mellitus, disseminated intravascular coagulopathy, erythryoid sick
syndrome, hemorrhagic shock, hepatitis, insulin resistance,
leprosy, leukemia, lymphoma, meningitis, multiple sclerosis,
myocardial ischaemia, obesity, rejection of transplanted organs,
rheumatoid arthritis, septic shock syndrome, stroke, adult
respiratory distress syndrome (ARDS), tuberculosis, and a number of
viral diseases. This expression can de detected with a diagnostic
agent such as Fhm nucleotide.
[0056] The invention encompasses diagnosing a pathological
condition or a susceptibility to a pathological condition in a
subject caused by or resulting from abnormal levels of Fhm
polypeptide comprising determining the presence or amount of
expression of the Fhm polypeptide in a sample; and comparing the
level of said polypeptide in a biological, tissue or cellular
sample from either normal subjects or the subject at an earlier
time, wherein susceptibility to a pathological condition is based
on the presence or amount of expression of the polypeptide.
[0057] The present invention also provides a method of assaying
test molecules to identify a test molecule which binds to a Fhm
polypeptide. The method comprises contacting a Fhm polypeptide with
a test molecule and to determine the extent of binding of the test
molecule to the polypeptide. The method further comprises
determining whether such test molecules are agonists or antagonists
of a Fhm polypeptide. The present invention further provides a
method of testing the impact of molecules on the expression of Fhm
polypeptide or on the activity of Fhm polypeptide.
[0058] Methods of regulating expression and modulating (i.e.,
increasing or decreasing) levels of a Fhm polypeptide are also
encompassed by the invention. One method comprises administering to
an animal a nucleic acid molecule encoding a Fhm polypeptide. In
another method, a nucleic acid molecule comprising elements that
regulate or modulate the expression of a Fhm polypeptide may be
administered. Exampless of these methods include gene therapy, cell
therapy, and anti-sense therapy as further described herein.
[0059] Surprisingly, a Fhm polypeptide was highly expressed in a
wide range of primary human tumors. Therefore, the present
polypeptide, and its useful nucleid acid intermediates, have
demonstrated utility in differentiating transformed cells from the
background.
[0060] In another aspect of the present invention, the Fhm
polypeptides may be used for identifying receptors or binding
partners thereof ("Fhm receptors" or "Fhm binding partners").
Various forms of "expression cloning" have been extensively used to
clone receptors for protein or co-factors. See, for example,
Simonsen and Lodish, Trends in Pharmacological Sciences, 15:
437-441, 1994, and Tartaglia et al, Cell, 83:1263-1271, 1995. The
isolation of the Fhm receptor(s) or Fhm binding partner(s) is
useful for identifying or developing novel agonists and antagonists
of the Fhm polypeptide-signaling pathway.
[0061] Such agonists and antagonists include soluble Fhm ligand(s),
anti-Fhm selective binding agents (such as Fhm antibodies and
derivatives thereof), small molecules, peptides or derivatives
thereof capable of binding Fhm polypeptides, or antisense
oligonucleotides, any of which can be used for potentially treating
one or more diseases or disorders, including those recited
herein.
[0062] In certain embodiments, a Fhm polypeptide agonist or
antagonist may be a protein, peptide, carbohydrate, lipid, or small
molecular weight molecule which interacts with Fhm polypeptide to
regulate its activity.
[0063] In another aspect of the present invention, the Fhm
polypeptides may be used for identifying receptors thereof ("Fhm
receptors"). Various forms of "expression cloning" have been
extensively used for cloningto clone receptors for protein ligands.
See for example, H. Simonsen and H. F. Lodish, Trends in
Pharmacological Sciences, vol. 15, 437-44115:437-44, 1994, and
Tartaglia et al., Cell, 83:1263-1271, 1995. The isolation of the
Fhm receptor(s) is useful for identifying or developing novel
agonists and antagonists of the Fhm polypeptide-signaling pathway.
Such agonists and antagonists include soluble Fhm receptor(s),
anti-Fhm receptor selectivereceptor-selective binding agents (such
as antibodies and derivatives thereof), small molecules, and
antisense oligonucleotides, any of which can be used for treating
one or more of the diseases or disorders, including those recited
herein.
DESCRIPTION OF THE FIGURE
[0064] FIG. 1 presents an alignment of the predicted amino acid
sequence of Fhm polypeptide (SEQ ID NO: 4) is aligned with the
corresponding regions of human FasL, mouse FasL, rat FasL, human
CD40L, mouse CD40L, mouse OPGL, human OPGL, human TRAIL, mouse
TRAIL, human CD30L, human CD30L, human LyT-.beta., mouse
LyT-.beta., human TNF-.beta., mouse TNF-.beta., human TNF-.alpha.
and mouse TNF-.alpha.. (SEQ ID NOS: 5-21) using the Pileup program
(Wisconsin GCG Program Package ver. 8.1).
DETAILED DESCRIPTION OF THE INVENTION
[0065] The section headings herein are for organizational purposes
only and are not to be construed as limiting the subject matter
described therein.
[0066] Definitions:
[0067] The terms "Fhm gene", "Fhm nucleic acid molecule", or "Fhm
polynucleotide" refer to a nucleic acid molecule comprising or
consisting essentially of a nucleotide sequence as set forth in SEQ
ID NO: 3, comprising or consisting essentially of a nucleotide
sequence encoding the polypeptide as set forth in SEQ ID NO: 4, or
nucleic acid molecules related thereto. "Related" nucleic acid
molecules comprise or consist essentially of a nucleotide sequence
that is about 70 percent identical to the nucleotide sequence as
shown in SEQ ID NO: 3, or comprise or consist essentially of a
nucleotide sequence encoding a polypeptide having an amino acid
sequence that is about 70 percent identical to the amino acid
sequence set forth in SEQ ID NO: 4. In preferred embodiments, the
nucleotide sequences are about 75 percent, or about 80 percent, or
about 85 percent, or about 90 percent, or about 95, 96, 97, 98, or
99 percent identical to the nucleotide sequence as shown in SEQ ID
NO: 3, or the nucleotide sequences encode a polypeptide that is
about 75 percent, or about 80 percent, or about 85 percent, or
about 90 percent, or about 95, 96, 97, 98, or 99 percent identical
to the polypeptide sequence as set forth in SEQ ID NO: 4. Related
nucleic acid molecules also include fragments of the above Fhm
nucleic acid molecules which are at least about 10 contiguous
nucleotides, or about 15, or about 20, or about 25, or about 50, or
about 75, or about 100, or greater than about 100 contiguous
nucleotides. Related nucleic acid molecules also include fragments
of the above Fhm nucleic acid molecules which encode a polypeptide
of at least about 25 amino acid residues, or about 50, or about 75,
or about 100, or greater than about 100 amino acid residues.
Related nucleic acid molecules also include a nucleotide sequence
encoding a polypeptide comprising or consisting essentially of a
substitution and/or a deletion of one to 251 amino acid residues
compared to the polypeptide in SEQ ID NO: 4. Related Fhm ligand
nucleic acid molecules include those molecules which comprise
nucleotide sequences which hybridize under moderate or highly
stringent conditions as defined herein with any of the above
nucleic acid molecules. In preferred embodiments, the related
nucleic acid molecules comprise sequences which hybridize under
moderate or highly stringent conditions with the sequence as shown
in SEQ ID NO:3, or with a molecule encoding a polypeptide, which
polypeptide comprises the amino acid sequence as shown in SEQ ID
NO:4, or with a nucleic acid fragment as defined above, or with a
nucleic acid fragment encoding a polypeptide as defined above. It
is also understood that related nucleic acid molecules include
allelic or splice variants of any of the above nucleic acids, and
include sequences which are complementary to any of the above
nucleotide sequences.
[0068] The term "Fhm polypeptide allelic variant" refers to one of
several possible naturally occurring alternate forms of a gene
occupying a given locus on a chromosome of an organism or a
population of organisms.
[0069] The term "Fhm polypeptide splice variant" refers to a
nucleic acid molecule, usually RNA, which is generated by
alternative processing of intron sequences in an RNA transcript of
Fhm polypeptide amino acid sequence set forth in SEQ ID NO:4.
[0070] The term "expression vector" refers to a vector which is
suitable for use in a host cell and contains nucleic acid sequences
which direct and/or control the expression of inserted heterologous
nucleic acid sequences. Expression includes, but is not limited to,
processes such as transcription, translation, and RNA splicing, if
introns are present.
[0071] The term "Fhm polypeptide" refers to a polypeptide
comprising the amino acid sequence of SEQ ID NO: 4, and related
polypeptides. Related polypeptides includes: Fhm allelic variants,
Fhm splice variants, Fhm fragments, Fhm derivatives,
Fhm-substitution, -deletion, and/or insertion variants, Fhm fusion
polypeptides, and Fhm orthologs. Fhm polypeptides may be mature
polypeptides, as defined herein, and may or may not have an amino
terminal methionine residue, depending on the method by which they
are prepared.
[0072] The term Fhm polypeptide fragment refers to a peptide or
polypeptide that comprises less than the full length amino acid
sequence of a Fhm polypeptide as set forth in SEQ ID. NO: 4. Such a
fragment may arise, for example, from a truncation at the amino
terminus (with or without a leader sequence), a truncation at the
carboxy terminus, and/or an internal deletion of the amino acid
sequence (wherein the resulting polypeptide is at lease 6 amino
acids or more in length). Fhm fragments may result from alternative
RNA splicing or from in vivo protease activity.
[0073] In preferred embodiments, truncations comprise about 10
amino acids, or about 20 amino acids, or about 50 amino acids, or
about 75 amino acids, or about 100 amino acids, or more than about
100 amino acids. The polypeptide fragments so produced will
comprise about 25 contiguous amino acids, or about 50 amino acids,
or about 75 amino acids, or about 100 amino acids, or about 150
amino acids, or about 200 amino acids. Such Fhm polypeptide
fragments may optionally comprise an amino terminal methionine
residue. It will be appreciated that such fragments can be used,
for example, to generate antibodies to Fhm polypeptides.
[0074] The term "Fhm polypeptide variants" refers to Fhm
polypeptides comprising amino acid sequences which contain one or
more amino acid sequence substitutions, deletions (such as internal
deletions and/or Fhm fragments), and/or additions (such as internal
additions and/or Fhm fusion polypeptides) as compared to the Fhm
polypeptide amino acid sequence set forth in SEQ ID NO: 4 (with or
without leader sequences). Variants may be naturally occurring
(e.g., Fhm polypeptide allelic variants, Fhm polypeptide orthologs
or Fhm splice variants) or artificially constructed. Such
Fhm-polypeptide variants may be prepared from the corresponding
nucleic acid molecules encoding said variants, which have a DNA
sequence that varies accordingly from the DNA sequences for wild
type Fhm-receptor polypeptides as set forth in SEQ ID NO: 3.
[0075] The term "Fhm fusion polypeptide" "Fhm fusion polypeptide"
refers to a fusion of one or more amino acids (such as a
heterologous peptide or polypeptide) at the amino or carboxy
terminus of the polypeptide as set forth in SEQ IDNO: 4, Fhm
polypeptide allelic variants, Fhm polypeptide orthologs, Fhm
polypeptide splice variants, or Fhm polypeptide variants having one
or more amino acid deletions, substitutions or internal additions
as compared to the Fhm polypeptide amino acid sequence set forth in
SEQ ID NO: 4.
[0076] The term "Fhm polypeptide derivatives" refers to Fhm
polypeptides, variants, or fragments thereof, that have been
chemically modified, as for example, by covalent attachment of one
or more water soluble polymers, N-linked or O-linked carbohydrates,
sugars, phosphates, and/or other such molecules. Such modifications
may be introduced into the molecule by reacting targeted amino acid
residues of the. purified or crude protein with an organic
derivatizing agent that is capable of reacting with selected side
chains or terminal residues. The resulting covalent derivatives are
also useful in programs directed at identifying residues important
for biological activity. The derivatives are modified in a manner
that is different from naturally occurring Fhm polypeptide either
in the type or location of the molecules attached to the
polypeptide. Derivatives further include deletion of one or more
chemical groups naturally attached to the Fhm polypeptide.
[0077] The terms "biologically active Fhm polypeptides",
"biologically active Fhm polypeptide fragments", "biologically
active Fhm polypeptide variants", and "biologically active Fhm
polypeptide derivatives" refer to Fhm polypeptides having at least
one activity characteristic of a Fhm polypeptide comprising the
amino acid sequence of SEQ ID NO: 4, such as the ability to bind to
one or more members of the TNF-receptor super gene (protein) family
in biological assays. Immunogenic fragments of Fhm polypeptides are
those capable of inducing in a host animal antibodies directed to
the Fhm fragment.
[0078] The term "Fhm polypeptide ortholog" refers to a polypeptide
from another species that corresponds to a Fhm polypeptide amino
acid sequence set forth as SEQ ID NO: 4. For example, mouse and
human Fhm polypeptides are considered orthologs of each other.
[0079] The term "mature Fhm polypeptide" refers to a Fhm
polypeptide lacking a leader sequence. a mature Fhm polypeptide may
also include other modifications of a polypeptide such as
proteolytic processing of the amino terminus (with or without a
leader sequence) and/or the carboxy terminus, cleavage of a smaller
polypeptide from a larger precursor, N-linked and/or O-linked
glycosylation, and the like.
[0080] The term "antigen" refers to a molecule or a portion of a
molecule capable of being bound by a selective binding agent, such
as an antibody, and additionally capable of being used in an animal
to produce antibodies capable of binding to an epitope of thateach
antigen. An antigen may have one or more epitopes.
[0081] The term "mutein" refers to a mutant protein, polypeptide,
variants, analogs or fragments of Fhm polypeptide. Muteins of Fhm
may be prepared by deletion, insertion, substitution, point
mutation, truncation, addition, transposition, PCR amplification,
site-directed mutagenesis or other methods known in the art.
[0082] The terms "effective amount" and "therapeutically effective
amount" refer to the amount of a Fhm polypeptide (or Fhm
antagonist) necessary to support an observable change in the level
of one or more biological activities of one or more members of the
TNF-receptor gene family as set forth above, to bring about a
meaningful patient benefit, i.e. treatment, healing, prevention, or
amelioration of a condition. When applied to an individual active
ingredient, administered alone, the term refers to that ingredient
alone. When applied to a combination, the term refers to combined
amounts of active ingredients that result in therapeutic effect,
when administered in combination, serially or simultaneously. The
Fhm polypeptides that have use in practicing the present invention
may be naturally occurring full length polypeptides, or truncated
polypeptides or variant homologs or analogs or derivatives or
peptide fragments. Illustrative analogs include those in which one
or more divergent amino acids between two species are substituted
with the divergent amino acid from another species. Divergent amino
acids may also be substituted with any other amino acid whether it
be a conservative or a non-conservative amino acid.
[0083] The term "identity", as known in the art, refers to a
relationship between the sequences of two or more polypeptide
molecules or two or more nucleic acid molecules, as determined by
comparing the sequences. In the art, "identity" also means the
degree of sequence relatedness nucleic acid molecules or
polypeptides sequences, as the case may be, as determined by the
match between strings of two or more nucleotide or two or more
amino acid sequences. "Identity" measures the percent of identical
matches between the smaller of two or more sequences with gap
alignments (if any) addressed by particular a mathematical model of
computer program (i.e., "algorithms"). The term "similarity" is a
related concept, but in contrast to "identity", refers to a measure
of similarity which includes both identical matches and
conservative substitution matches. If two polypeptide sequences
have, for example, 10/20 identical amino acids, and the remainder
are all non-conservative substitutions, then the percent identity
and similarity would both be 50%. If, in the same example, there
are 5 more positions where there are conservative substitutions,
then the percent identity remains 50%, but the per cent similarity
would be 75% (15/20). Therefore, in cases where there are
conservative substitutions, the degree of percent similarity
between two polypeptide sequences will be higher than the percent
identity between those two sequences.
[0084] The term "isolated nucleic acid molecule" refers to a
nucleic acid molecule of the invention that (1) has been separated
from at least about 50 percent of proteins, lipids, carbohydrates
or other materials with which it is naturally found when total DNA
is isolated from the source cells, (2) is not linked to all or a
portion of a polynucleotide to which the "isolated" isolated
nucleic acid molecule "molecule" is linked in nature, (3) is
operably linked to a polynucleotide which it is not linked to in
nature, or (4) does not occur in nature as part of a larger
polynucleotide sequence. Preferably, the isolated nucleic acid
molecule of the present invention is substantially free from any
other contaminating nucleic acid molecule(s) or other contaminants
that are found in its natural environment that would interfere with
its use in polypeptide production or its therapeutic, diagnostic,
prophylactic or research use.
[0085] The term "isolated polypeptide" refers to a polypeptide of
the present invention that (1) has been separated from at least
about 50 percent of polynucleotides, lipids, carbohydrates or other
materials with which it is naturally found when isolated from the
source cell, (2) is not linked (by covalent or noncovalent
interaction) to all or a portion of a polypeptide to which the
"isolated polypeptide" is linked in nature, (3) is operably linked
(by covalent or noncovalent interaction) to a polypeptide with
which it is not linked in nature, or (4) does not occur in nature.
Preferably, the isolated polypeptide is substantially free from any
other contaminating polypeptides or other contaminants that are
found in its natural environment that would interfere with its
therapeutic, diagnostic, prophylactic or research use.
[0086] The terms "nucleic acid sequence" or "nucleic acid molecule"
refer to a DNA or RNA sequence. The term encompassesterms encompass
molecules formed from any of the known base analogs of DNA and RNA
such as, but not limited to 4-4-acetylcytosine,
8-hydroxy-N6-methyladenosine, aziridinyl-cytosine,
pseudoisocytosine, 5-(carboxyhydroxylmethyl) uracil,
5-fluorouracil, 5-bromouracil,
5-carboxymethylaminomethyl-2-thiouracil,
5-carboxy-methylaminomethyluracil, dihydrouracil, inosine,
N6-iso-pentenyladenine, 1-methyladenine, 1-methylpseudouracil,
1-methylguanine, 1-methylinosine, 2,2-dimethyl-guanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-methyladenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyamino-methyl-2-thiou- racil,
beta-D-mannosylqueosine, 5'-methoxycarbonyl-methyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid,
oxybutoxosine, pseudouracil, queosine, 2-thiocytosine,
5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil,
N-uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid,
pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.
[0087] The term "naturally occurring" or "native" when used in
connection with biological materials such as nucleic acid
molecules, polypeptides, host cells, and the like, refers to
materials which are found in nature and are not manipulated by man.
Similarly, "non-naturally occurring" or "non-native" "non-naturally
occurring" or "non-native" as used herein refers to a material that
is not found in nature or that has been structurally modified or
synthesized by man.
[0088] The term "operably linked" "operably linked" is used herein
to refer to an arrangementa method of flanking sequences wherein
the flanking sequences so described are configured or assembled so
as to perform their usual function. Thus, a flanking sequence
operably linked to a coding sequence may be capable of effecting
the replication, transcription and/or translation of the coding
sequence. For example, a coding sequence is operably linked to a
promoter when the promoter is capable of directing transcription of
that coding sequence. A flanking sequence need not be contiguous
with the coding sequence, so long as it functions correctly. Thus,
for example, intervening untranslated yet transcribed sequences can
be present between a promoter sequence and the coding sequence, and
the promoter sequence can still be considered "operably linked"
"operably linked" to the coding sequence.
[0089] The term "pharmaceutically acceptable carrier" or
"physiologically acceptable carrier" as used herein refersterms
"pharmaceutically acceptable carrier" or "physiologically
acceptable carrier" as used herein refer to one or more formulation
materials suitable for accomplishing or enhancing the delivery of
the Fhm polypeptide, Fhm nucleic acid molecule or Fhm selective
binding agent as a pharmaceutical composition.
[0090] The term "selective binding agent" refers to a molecule or
molecules having specificity for an Fhm polypeptide. As used
herein, the terms, "specific" and "specificity" refer to the
ability of the selective binding agents to bind to human Fhm
polypeptides and not to bind to human non-Fhm polypeptides. It will
be appreciated, however, that the selective binding agents may also
bind orthologs of the polypeptide as set forth in SEQ ID NO: 4,
that is, interspecies versions thereof, such as mouse and rat
polypeptides.
[0091] The term "transduction" is used to refer to the transfer of
genes from one bacterium to another, usually by a phage.
"Transduction" also refers to the acquisition and transfer of
eukaryotic cellular sequences by retroviruses.
[0092] The term "transfection" is used to refer to the uptake of
foreign or exogenous DNA by a cell, and a cell has been
"transfected" when the exogenous DNA has been introduced inside the
cell membrane. A number of transfection techniques are well known
in the art and are disclosed herein. See, for example, Graham et
al., Virology, 52:456, 1973; Sambrook et al., Molecular Cloning, a
Laboratory Manual, Cold Spring Harbor Laboratories, New York, 1989;
Davis et al., Basic Methods in Molecular Biology, Elsevier, 1986;
and Chu et al., Gene, 13:197, 1981. Such techniques can be used to
introduce one or more exogenous DNA moieties into suitable host
cells.
[0093] The term "transformation" as used herein refers to a change
in a cell's genetic characteristics, and a cell has been
transformed when it has been modified to containa new DNA. For
example, a cell is transformed where it is genetically modified
from its native state. Following transfection or transduction, the
transforming DNA may recombine with that of the cell by physically
integrating into a chromosome of the cell, it may be maintained
transiently as an episomal element without being replicated, or I
may replicate independently as a plasmid. A cell is considered to
have been stably transformed when the DNA is replicated with the
division of the cell.
[0094] The term "vector" is used to refer to any molecule (e.g.,
nucleic acid, plasmid, or virus) used to transfer coding
information to a host cell.
[0095] Relatedness of Nucleic Acid Molecules and/or
Polypeptides
[0096] It is understood that related nucleic acid molecules include
allelic or splice variants of the nucleic acid molecule of SEQ ID
NO: 3, and include sequences which are complementary to any of the
above nucleotide sequences. Related nucleic acid molecules also
include a nucleotide sequence encoding a polypeptide comprising or
consisting essentially of a substitution, modification, addition
and/ora deletion of one or more amino acid residues compared to the
polypeptide in SEQ ID NO: 4.
[0097] Fragments include molecules which encode a polypeptide of at
least about 25 amino acid residues, or about 50, or about 75, or
about 100, or greater than about 100, amino acid residues of the
polypeptide of SEQ ID NO: 4.
[0098] In addition, related Fhm nucleic acid molecules include
those molecules which comprise nucleotide sequences which hybridize
under moderately or highly stringent conditions as defined herein
with the fully complementary sequence of the nucleic acid molecule
of SEQ ID NO: 3, or of a molecule encoding a polypeptide, which
polypeptide comprises the amino acid sequence as shown in SEQ ID
NO: 4, or of a nucleic acid fragment as defined herein, or of a
nucleic acid fragment encoding a polypeptide as defined herein.
Hybridization probes may be prepared using the Fhm sequences
provided herein to screen cDNA, genomic or synthetic DNA libraries
for related sequences. Regions of the DNA and/or amino acid
sequence of Fhm polypeptide that exhibit significant identity to
known sequences are readily determined using sequence alignment
algorithms as described herein, and those regions may be used to
design probes for screening.
[0099] The term "highly stringent conditions" refers to those
conditions that are designed to permit hybridization of DNA strands
whose sequences are highly complementary, and to exclude
hybridization of significantly mismatched DNAs. Hybridization
stringency is principally determined by temperature, ionic
strength, and the concentration of denaturing agents such as
formamide. Examples of "highly stringent conditions" for
hybridization and washing are 0.015 M sodium chloride, 0.0015 M
sodium citrate at 65-68.degree. C. or 0.015 M sodium chloride,
0.0015 M sodium citrate, and 50% formamide at 42.degree. C. See
Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory
Manual, 2nd Ed., Cold Spring Harbor Laboratory, (Cold Spring
Harbor, N.Y. 1989); and Anderson et al., Nucleic Acid
Hybridization: a Practical approach, Ch. 4, IRL Press Limited
(Oxford, England). Limited, Oxford, England. More stringent
conditions (such as higher temperature, lower ionic strength,
higher formamide, or other denaturing agent) may also be used,
used; however, the rate of hybridization will be affected. Other
agents may be included in the hybridization and washing buffers for
the purpose of reducing non-specific and/or background
hybridization. Examples are 0.1% bovine serum albumin, 0.1%
polyvinyl-pyrrolidone, 0.1% sodium pyrophosphate, 0.1% sodium
dodecylsulfate (NaDodSO4 or SDS), ficoll, Denhardt's solution,
sonicated salmon sperm DNA (or another non-complementary DNA), and
dextran sulfate, although other suitable agents can also be used.
The concentration and types of these additives can be changed
without substantially affecting the stringency of the hybridization
conditions. Hybridization experiments are usually carried out at pH
6.8-7.4,6.8-7.4; however, at typical ionic strength conditions, the
rate of hybridization is nearly independent of pH. See Anderson et
al., Nucleic Acid Hybridization: a Practical Approach, Ch. 4, IRL
Press Limited (Oxford, England).
[0100] Factors affecting the stability of a DNA duplex include base
composition, length, and degree of base pair mismatch.
Hybridization conditions can be adjusted by one skilled in the art
in order to accommodate these variables and allow DNAs of different
sequence relatedness to form hybrids. The melting temperature of a
perfectly matched DNA duplex can be estimated by the following
equation:
Tm(.degree. C.)=81.5+16.6(log[Na+])+0.41(% G+C)-600/N-0.72(%
formamide)
[0101] where N is the length of the duplex formed, [Na+] is the
molar concentration of the sodium ion in the hybridization or
washing solution, % G+C is the percentage of (guanine+cytosine)
bases in the hybrid. For imperfectly matched hybrids, the melting
temperature is reduced by approximately 1.degree. C. for each 1%
mismatch.
[0102] The term "moderately" stringent conditions" "refers to
conditions under which a DNA duplex with a greater degree of base
pair mismatching than could occur under "highly stringent
conditions" is able to form. Examples of typical "moderately
stringent conditions" are 0.015 M sodium chloride, 0.0015 M sodium
citrate at 50-65.degree. C. or 0.015 M sodium chloride, 0.0015 M
sodium citrate, and 20% formamide at 37-50.degree. C. Byway of
example, a "moderately stringent" condition of 50.degree. C. in
0.015 M sodium ion will allow about a 21% mismatch.
[0103] It will be appreciated by those skilled in the art that
there is no absolute distinction between "highly" and "moderately"
stringent conditions. For example, at 0.01 5M sodium ion (no
formamide), the melting temperature of perfectly matched long DNA
is about 71.degree. C. With a wash at 65.degree. C. (at the same
ionic strength), this would allow for approximately a 6% mismatch.
To capture more distantly related sequences, one skilled in the art
can simply lower the temperature or raise the ionic strength.
[0104] A good estimate of the melting temperature in 1 M NaCl* for
oligonucleotide probes up to about 20 nt is given by:
Tm=2.degree. C. per A-T base pair+4.degree. C. per G-C base
pair
[0105] *The sodium ion concentration in 6.times. salt sodium
citrate (SSC) is 1 M. See Suggs et al., Developmental Biology Using
Purified Genes, p. 683, Brown and Fox (eds.) (1981). High
stringency washing conditions for oligonucleotides are usually at a
temperature of 0-5.degree. C. below the Tm of the oligonucleotide
in 6.times.SSC, 0.1% SDS.
[0106] In another embodiment, related nucleic acid molecules
comprise or consist of a nucleotide sequence that is about 70
percent (70%) identical to the nucleotide sequence as shown in SEQ
ID NO: 3, or comprise or consist essentially of a nucleotide
sequence encoding a polypeptide that is about 70 percent (70%)
identical to the polypeptide as set forth in SEQ ID NO: 4. In
preferred embodiments, the nucleotide sequences are about 75
percent, or about 80 percent, or about 85 percent, or about 90
percent, or about 95, 96, 97, 98, or 99 percent identical to the
nucleotide sequence as shown in SEQ ID NO: 3, or the nucleotide
sequences encode a polypeptide that is about 75 percent, or about
80 percent, or about 85 percent, or about 90 percent, or about 95,
96, 97, 98, or 99 percent identical to the polypeptide sequence as
set forth in SEQ ID NO:4.
[0107] Differences in the nucleic acid sequence may result in
conservative and/or non-conservative modifications of the amino
acid sequence relative to the amino acid sequence of SEQ ID NO:
4.
[0108] Conservative modifications to the amino acid sequence of SEQ
ID NO: 4 (and corresponding modifications to the encoding
nucleotides) will produce Fhm polypeptides having functional and
chemical characteristics similar to those of a naturally occurring
Fhm polypeptide. In contrast, substantial modifications in the
functional and/or chemical characteristics of Fhm polypeptides may
be accomplished by selecting substitutions in the amino acid
sequence of SEQ ID NO: 4 that differ significantly in their effect
on maintaining (a) the structure of the molecular backbone in the
area of the substitution, for example, as a sheet or helical
conformation, (b) the charge or hydrophobicity of the molecule at
the target site, or (c) the bulk of the side chain.
[0109] For example, a "conservative amino acid substitution"
"conservative amino acid substitution" may involve a substitution
of a native amino acid residue with a nonnative residue such that
there is little or no effect on the polarity or charge of the amino
acid residue at that position. Furthermore, any native residue in
the polypeptide may also be substituted with alanine, as has been
previously described for "alanine scanning mutagenesis."
[0110] Naturally occurring residues may be divided into groups
based on common side chain properties:
[0111] 1) hydrophobic: norleucine, Met, Ala, Val, Leu, Ile;
[0112] 2) neutral hydrophilic: Cys, Ser, Thr;
[0113] 3) acidic: Asp, Glu;
[0114] 4) basic: Asn, Gln, His, Lys, Arg;
[0115] 5) residues that influence chain orientation: Gly, Pro;
and
[0116] 6) aromatic: Trp, Tyr, Phe.
[0117] Non-conservative substitutions may involve the exchange of a
member of one of these classes for a member from another class.
Such substituted residues may be introduced into regions of the
human Fhm polypeptide that are homologous with non-human Fhm
polypeptide orthologs, or into the non-homologous regions of the
molecule.
[0118] In making such changes, the hydropathic index of amino acids
may be considered. Each amino acid has been assigned a hydropathic
index on the basis of its hydrophobicity and charge
characteristics. They are: isoleucine (+4.5); valine (+4.2);
leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5);
methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine
(-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline
(-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5);
aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine
(-4.5).
[0119] The importance of the hydropathic amino acid index in
conferring interactive biological function on a protein is
understood in the art. Kyte et al., J. Mol. Biol., 157:105-131,
1982. It is known that certain amino acids may be substituted for
other amino acids having a similar hydropathic index or score and
still retain a similar biological activity. In making changes based
upon the hydropathic index, the substitution of amino acids whose
hydropathic indices are within .+-.2 is preferred, those which are
within .+-.1 are particularly preferred, and those within .+-.0.5
are even more particularly preferred.
[0120] It is also understood in the art that the substitution of
like amino acids can be made effectively on the basis of
hydrophilicity, particularly where the biologically functionally
equivalent protein or peptide thereby created is intended for use
in immunological embodiments, as in the present case. The greatest
local average hydrophilicity of a protein, as governed by the
hydrophilicity of its adjacent amino acids, correlates with its
immunogenicity and antigenicity, i.e., with a biological property
of the protein.
[0121] The following hydrophilicity values have been assigned to
these amino acid residues: arginine (+3.0); lysine (+3.0);
aspartate (+3.0.+-.1); glutamate (+3.0.+-.1); serine (+0.3);
asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4);
proline (-0.5.+-.1); alanine (-0.5); histidine (-0.5); cysteine
(-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8);
isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); (-2.5)
and tryptophan (-3.4). In making changes based upon similar
hydrophilicity values, the substitution of amino acids whose
hydrophilicity values are within .+-.2 is preferred, those which
are within .+-.1 are particularly preferred, and those within
.+-.0.5 are even more particularly preferred. One may also identify
epitopes from primary amino acid sequences on the basis of
hydrophilicity. These regions are also referred to as "epitopic
core regions."
[0122] Desired amino acid substitutions (whether conservative or
non-conservative) can be determined by those skilled in the art at
the time such substitutions are desired. For example, amino acid
substitutions can be used to identify important residues of the Fhm
polypeptide, or to increase or decrease the affinity of the Fhm
polypeptides described herein.
[0123] Exemplary amino acid substitutions are set forth in Table
I.
1TABLE I Amino Acid Substitutions Original Preferred Residues
Exemplary Substitutions Substitutions Ala Val, Leu, Ile Val Arg
Lys, Gln, Asn Lys Asn Gln Gln Asp Glu Glu Cys Ser, Ala Ser Gln Asn
Asn Glu Asp Asp Gly Pro, Ala Ala His Asn, Gln, Lys, Arg Arg Ile
Leu, Val, Met, Ala, Leu Phe, Norleucine Leu Norleucine, Ile, Ile
Val, Met, Ala, Phe Lys Arg, 1,4 Diamino-butyric Arg Acid, Gln, Asn
Met Leu, Phe, Ile Leu Phe Leu, Val, Ile, Ala, Leu Tyr Pro Ala Gly
Ser Thr, Ala, Cys Thr Thr Ser Ser Trp Tyr, Phe Tyr Tyr Trp, Phe,
Thr, Ser Phe Val Ile, Met, Leu, Phe, Leu Ala, Norleucine
[0124] A skilled artisan will be able to determine suitable
variants of the polypeptide as set forth in SEQ ID NO: 4 using well
known techniques. For identifying suitable areas of the molecule
that may be changed without destroying activity, one skilled in the
art may target areas not believed to be important for activity. For
example, when similar polypeptides with similar activities from the
same species or from other species are known, one skilled in the
art may compare the amino acid sequence of an Fhm polypeptide to
such similar polypeptides. With such a comparison, one can identify
residues and portions of the molecules that are conserved among
similar polypeptides. It will be appreciated that changes in areas
of an Fhm polypeptide that are not conserved relative to such
similar polypeptides would be less likely to adversely affect the
biological activity and/or structure of the Fhm polypeptide. One
skilled in the art would also know that, even in relatively
conserved regions, one may substitute chemically similar amino
acids for the naturally occurring residues while retaining activity
(conservative amino acid residue substitutions). Therefore, even
areas that may be important for biological activity or for
structure may be subject to conservative amino acid substitutions
without destroying the biological activity or without adversely
affecting the polypeptide structure.
[0125] Additionally, one skilled in the art can review
structure-function studies identifying residues in similar
polypeptides that are important for activity or structure. In view
of such a comparison, one can predict the importance of amino acid
residues in an Fhm polypeptide that correspond to amino acid
residues thatwhich are important for activity or structure in
similar polypeptides. One skilled in the art may opt for chemically
similar amino acid substitutions for such predicted important amino
acid residues of Fhm polypeptides.
[0126] One skilled in the art can also analyze the
three-dimensional structure and amino acid sequence in relation to
that structure in similar polypeptides. In view of such
information, one skilled in the art may predict the alignment of
amino acid residues of an Fhm polypeptide with respect to its three
dimensional structure. One skilled in the art may choose not to
make radical changes to amino acid residues predicted to be on the
surface of the protein, since such residues may be involved in
important interactions with other molecules. Moreover, one skilled
in the art may generate test variants containing a single amino
acid substitution at each desired amino acid residue. The variants
can then be screened using activity assays know to those skilled in
the art. Such variants could be used to gather information about
suitable variants. For example, if one discovered that a change to
a particular amino acid residue resulted in destroyed, undesirably
reduced, or unsuitable activity, variants with such a change would
be avoided. In other words, based on information gathered from such
routine experiments, one skilled in the art can readily determine
the amino acids where further substitutions should be avoided
either alone or in combination with other mutations.
[0127] A number of scientific publications have been devoted to the
prediction of secondary structure. (See Moult J., Curr. Op. in
Biotech., 7(4):422-427, 1996, Chou et al., Biochemistry,
13(2):222-245, 1974; Chou et al., Biochemistry, 113(2):211-222,
1974; Chou et al., Adv. Enzymol. Relat. Areas Mol. Biol.,
47:45-148, 1978; Chou et al., Ann. Rev. Biochem., 47:251-276 and
Chou et al., Biophys. J., 26:367-384, 1979). Moreover, computer
programs are currently available to assist with predicting
secondary structure. One method of predicting secondary structure
is based upon homology modeling. For example, two polypeptides or
proteins which have a sequence identity of greater than 30%, or
similarity greater than 40% often have similar structural
topologies. The recent growth of the protein structural data base
(PDB) has provided enhanced predictability of secondary structure,
including the potential number of folds within a polypeptide's or
protein's structure. See Holm et al., Nucl. Acid. Res.,
27(1):244-247, 1999. It has been suggested (Brenner et al., Curr.
Op. Struct. Biol., 7(3):369-376, 1997) that there are a limited
number of folds in a given polypeptide or protein and that once a
critical number of structures have been resolved, structural
prediction will become dramatically in more accurate.
[0128] Additional methods of predicting secondary structure include
"threading" (Jones, D., Curr. Opin. Struct. Biol., 7(3):377-87,
1997; Sippl et al., Structure, 4(1):15-9, 1996), "profile analysis"
(Bowie et al., Science, 253:164-170,1991); Gribskov et al., Meth.
Enzym., 183:146-159, 1990; Gribskov et al., Proc. Nat. Acad. Sci.,
84(13):4355-4358 1987), and "evolutionary linkage" (See Home,
supra, and Brenner, supra).
[0129] Preferred Fhm polypeptide variants include glycosylation
variants wherein the number and/or type of glycosylation sites has
been altered compared to the amino acid sequence set forth in SEQ
ID NO: 4. In one embodiment, Fhm polypeptide variants comprise a
greater or a lesser number of N-linked glycosylation sites than the
amino acid sequence set forth in SEQ ID NO: 4. An N-linked
glycosylation site is characterized by the sequence: Asn-X-Ser or
Asn-X-Thr, wherein the amino acid residue designated as X may be
any amino acid residue except proline. The substitution(s) of amino
acid residues to create this sequence provides a potential new site
for the addition of an N-linked carbohydrate chain. Alternatively,
substitutions which eliminate this sequence will remove an existing
N-linked carbohydrate chain. Also provided is a rearrangement of
N-linked carbohydrate chains wherein one or more N-linked
glycosylation sites (typically those that are naturally occurring)
are eliminated and one or more new N-linked sites are created.
[0130] Additional preferred Fhm variants include cysteine variants,
wherein one or more cysteine residues are deleted from or
substituted for another amino acid (e.g., serine) as compared to
the amino acid sequence set forth in SEQ ID NO: 4. Cysteine
variants are useful when Fhm polypeptides must be refolded into a
biologically active conformation such as after the isolation of
insoluble inclusion bodies. Cysteine variants generally have fewer
cysteine residues than the native protein, and typically have an
even number to minimize interactions resulting from unpaired
cysteines.
[0131] In addition, the polypeptide comprising the amino acid
sequence of SEQ ID NO: 4 or an Fhm polypeptide variant may be fused
to a homologous polypeptide to form a homodimer or to a
heterologous polypeptide to form a heterodimer. Heterologous
peptides and polypeptides include, but are not limited to: an
epitope to allow for the detection and/or isolation of an Fhm
fusion polypeptide; a transmembrane receptor protein or a portion
thereof, such as an extracellular domain, or a transmembrane and
intracellular domain; a ligand or a portion thereof which binds to
a transmembrane receptor protein; an enzyme or portion thereof
which is catalytically active; a polypeptide or peptide which
promotes oligomerization, such as a leucine zipper domain; a
polypeptide or peptide which increases stability, such as an
immunoglobulin constant region; and a polypeptide which has a
therapeutic activity different from the polypeptide comprising the
amino acid sequence as set forth in SEQ ID NO: 4 or an Fhm
polypeptide variant.
[0132] Fusions can be made either at the amino terminus or at the
carboxy terminus of the polypeptide comprising the amino acid
sequence set forth in SEQ ID NO: 4 or an Fhm polypeptide variant.
Fusions may be direct with no linker or adapter molecule, or
indirect using a linker or adapter molecule. A linker or adapter
molecule may be one or more amino acid residues, typically up
tofrom about 20 to about 50 amino acid residues. A linker or
adapter molecule may also be designed with a cleavage site for a
DNA restriction endonuclease or for a protease to allow for the
separation of the fused moieties. It will be appreciated that once
constructed, the fusion polypeptides can be derivatized according
to the methods described herein.
[0133] In a further embodiment of the invention, the polypeptide
comprising the amino acid sequence of SEQ ID NO: 4 or an Fhm
polypeptide variant is fused to one or more domains of an Fc region
of human IgG. Antibodies comprise two functionally independent
parts, a variable domain known as "Fab", which binds antigens, and
a constant domain known as "Fc", which is involved in effector
functions such as complement activation and attack by phagocytic
cells. An Fc has a long serum half-life, whereas an Fab is
short-lived. (Capon et al., Nature, 337:525-31, 1989). When
constructed together with a therapeutic protein, an Fc domain can
provide longer half-life or incorporate such functions as Fc
receptor binding, protein A binding, complement fixation and
perhaps even placental transfer. Id. Table II summarizes the use of
certain Fc fusions known in the art.
2TABLE II Fc Fusion with Therapeutic Proteins Therapeutic Form of
Fc Fusion partner implications Reference IgG1 N-terminus of
Hodgkin's disease; U.S. Pat. No. CD30-L anaplastic lymphoma; T-cell
5,480,981 leukemia Murine Fcg2a IL-10 anti-inflammatory; Zheng et
al. transplant rejection (1995), J. Immunol., 154: 5590-5600 IgG1
TNF receptor septic shock Fisher et al. (1996), N. Engl. J. Med.,
334: 1697-1702; Van Zee et al., (1996), J. Immunol., 156: 2221-2230
IgG, IgA, IgM, TNF receptor inflammation, U.S. Pat. No. or IgE
autoimmune disorders 5,808,029, issued (excluding the Sep. 15, 1998
first domain) IgG1 CD4 receptor AIDS Capon et al. (1989), Nature
337: 525-531 IgG1, N-terminus anti-cancer, antiviral Harvill et al.
IgG3 of IL-2 (1995), Immunotech., 1: 95-105 IgG1 C-terminus of
osteoarthritis; WO 97/23614, OPG bone density published Jul. 3,
1997 IgG1 N-terminus of anti-obesity PCT/US leptin 97/23183, filed
Dec. 11, 1997 Human Ig Cg1 CTLA-4 autoimmune disorders Linsley
(1991), J. Exp. Med., 174: 561-569
[0134] In one example, all or a portion of the human IgG hinge, CH2
and CH3 regions may be fused at either the N-terminus or C-terminus
of the Fhm polypeptides using methods known to the skilled artisan.
The resulting Fhm fusion polypeptide may be purified by use of a
Protein A affinity column. Peptides and proteins fused to an Fc
region have been found to exhibit a substantially greater half-life
in vivo than the unfused counterpart. Also, a fusion to an Fc
region allows for dimerization/multimerization of the fusion
polypeptide. The Fc region may be a naturally occurring Fc region,
or may be altered to improve certain qualities, such as therapeutic
qualities, circulation time, reduce aggregation, etc.
[0135] Identity and similarity of related nucleic acid molecules
and polypeptides can be readily calculated by known methods. Such
methods include, but are not limited to, those described in
Computational Molecular Biology, Lesk, A. M., ed., Oxford
University Press, New York, 1988; Biocomputing: Informatics and
Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993;
Computer Analysis of Sequence Data, Part 1, Griffin, A. M., and
Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence
Analysis in Molecular Biology, von Heinje, G., Academic Press,
1987; Sequence Analysis Primer, Gribskov, M. and Devereux, J.,
eds., M. Stockton Press, New York, 1991; and Carillo et al., SIAM
J. Applied Math., 48:1073, 1988.
[0136] Preferred methods to determine identity and/or similarity
are designed to give the largest match between the sequences
tested. Methods to determine identity and similarity are described
in publicly available computer programs. Preferred computer program
methods to determine identity and similarity between two sequences
include, but are not limited to, the GCG program package, including
GAP (Devereux et al., Nucl. Acid. Res., 12:387, 1984; Genetics
Computer Group, University of Wisconsin, Madison, Wis.), BLASTP,
BLASTN, and FASTA (Altschul et al., J. Mol. Biol., 215:403-410,
1990). The BLASTX program is publicly available from the National
Center for Biotechnology Information (NCBI) and other sources
(BLAST Manual, Altschul et al. NCB/NLM/NIH Bethesda, Md. 20894;
Altschul et al., supra). The well-known Smith Waterman algorithm
may also be used to determine identity.
[0137] Certain alignment schemes for aligning two amino acid
sequences may result in the matching of only a short region of the
two sequences, and this small aligned region may have very high
sequence identity even though there is no significant relationship
between the two full-length sequences. Accordingly, in a preferred
embodiment, the selected alignment method (GAP program) will result
in an alignment that spans at least 50 contiguous amino acids of
the target polypeptide.
[0138] For example, using the computer algorithm GAP (Genetics
Computer Group, University of Wisconsin, Madison, Wis.), two
polypeptides for which the percent sequence identity is to be
determined are aligned for optimal matching of their respective
amino acids (the "matched span", as determined by the algorithm). A
gap opening penalty (which is calculated as 3.times. the average
diagonal; the "average diagonal" is the average of the diagonal of
the comparison matrix being used; the "diagonal" is the score or
number assigned to each perfect amino acid match by the particular
comparison matrix) and a gap extension penalty (which is usually
1/10 times the gap opening penalty), as well as a comparison matrix
such as PAM 250 or BLOSUM 62 are used in conjunction with the
algorithm. A standard comparison matrix (see Dayhoff et al., Atlas
of Protein Sequence and Structure, vol. 5, supp. 35(3), 1978 for
the PAM 250 comparison matrix; Henikoff et al., Proc. Natl. Acad.
Sci USA, 89:10915-10919, 1992 for the BLOSUM 62 comparison matrix)
is also used by the algorithm.
[0139] Preferred parameters for polypeptide sequence comparison
include the following:
[0140] Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453
(1970),
[0141] Comparison matrix: BLOSUM 62 from Henikoff and Henikoff,
Proc. Natl. Acad. Sci. USA 89:10915-10919 (1992).
[0142] Gap Penalty: 12
[0143] Gap Length Penalty: 4
[0144] Threshold of Similarity: 0
[0145] The GAP program is useful with the above parameters. The
aforementioned parameters are the default parameters for
polypeptide comparisons (along with no penalty for end gaps) using
the GAP algorithm.
[0146] Preferred parameters for nucleic acid molecule sequence
comparison include the following:
[0147] Algorithm: Needleman and Wunsch, J. Mol Biol. 48:443-4,
1970
[0148] Comparison matrix: matches=+10, mismatch=0
[0149] Gap Penalty: 50
[0150] Gap Length Penalty: 3
[0151] The GAP program is also useful with the above parameters.
The aforementioned parameters are the default parameters for
nucleic acid molecule comparisons.
[0152] Other exemplary algorithms, gap opening penalties, gap
extension penalties, comparison matrices, thresholds of similarity,
etc. may be used by those of skill in the art, including those set
forth in the Program Manual, Wisconsin Package, Version 9,
September, 1997. The particular choices to be made will be apparent
to those of skill in the art and will depend on the specific
comparison to be made, such as DNA-to-DNA, protein-to-protein,
protein-to-DNA; and additionally, whether the comparison is between
pairs of sequences (in which case GAP or BestFit are generally
preferred) or between one sequence and a large database of
sequences (in which case FASTA or BLASTA are preferred).
[0153] Synthesis
[0154] It will be appreciated by those skilled in the art the
nucleic acid and polypeptide molecules described herein may be
produced by recombinant and other means.
[0155] Nucleic Acid Molecules
[0156] The nucleic acid molecules encode a polypeptide comprising
the amino acid sequence of an Fhm polypeptide and can readily be
obtained in a variety of ways including, without limitation,
chemical synthesis, cDNA or genomic library screening, expression
library screening and/or PCR amplification of cDNA
[0157] Recombinant DNA methods used herein are generally, those set
forth in Sambrook et al. (Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989)) and/or Ausubel et al., eds., (Current Protocols in
Molecular Biology, Green Publishers Inc. and Wiley and Sons, NY
(1994)).
[0158] The present invention provides for nucleic acid molecules as
described herein and methods for obtaining such molecules. Where a
gene encoding Fhm polypeptide has been identified from one species,
all or a portion of that gene may be used as a probe to identify
orthologs or related genes from the same species. The probes or
primers may be used to screen cDNA libraries from various tissue
sources believed to express the Fhm polypeptide
[0159] In addition, part or all of a nucleic acid molecule having
the sequence as set forth in SEQ ID NO: 3 may be used to screen a
genomic library to identify and isolate a gene encoding Fhm.
Typically, conditions of moderate or high stringency will be
employed for screening to minimize the number of false positives
obtained from the screen.
[0160] Nucleic acid molecules encoding the amino acid sequence of
Fhm polypeptides may also be identified by expression cloning,
which employs the detection of positive clones based upon a
property of the expressed protein. Typically, nucleic acid
libraries are screened by the binding of an antibody or other
binding partner (e.g., receptor or ligand) to cloned proteins which
are expressed and displayed on a host cell surface. The antibody or
binding partner is modified with a detectable label to identify
those cells expressing the desired clone.
[0161] Recombinant expression techniques conducted in accordance
with the descriptions set forth below may be followed to produce
these polynucleotides and to express the encoded polypeptides. For
example, by inserting a nucleic acid sequence which encodes the
amino acid sequence of an Fhm polypeptide into an appropriate
vector, one skilled in the art can readily produce large quantities
of the desired nucleotide sequence. The sequences can then be used
to generate detection probes or amplification primers.
Alternatively, a polynucleotide encoding the amino acid sequence of
an Fhm polypeptide can be inserted into an expression vector. By
introducing the expression vector into an appropriate host, the
encoded Fhm polypeptide may be produced in large amounts.
[0162] Another method for obtaining a suitable nucleic acid
sequence is the polymerase chain reaction (PCR). In this method,
cDNA is prepared from poly(A)+RNA or total RNA using the enzyme
reverse transcriptase. Two primers, typically complementary to two
separate regions of cDNA (oligonucleotides) encoding the amino acid
sequence of an Fhm polypeptide, are then added to the cDNA along
with a polymerase such as Taq polymerase, and the polymerase
amplifies the cDNA region between the two primers.
[0163] Another means of preparing a nucleic acid molecule encoding
the amino acid sequecne of Fhm polypeptide is by chemical synthesis
using methods well known to the skilled artisan such as those
described by Engels et al., Angew. Chem. Intl. Ed., 28:716-734,
1989. These methods include, inter alia, the phosphotriester,
phosphoramidite, and H-phosphonate methods for nucleic acid
synthesis. A preferred method for such chemical synthesis is
polymer-supported synthesis using standard phosphoramidite
chemistry. Typically, the DNA encoding the amino acid sequence of a
Fhm polypeptide will be several hundred nucleotides in length.
Nucleic acids larger than about 100 nucleotides can be synthesized
as several fragments using these methods. The fragments can then be
ligated together to form the full-length nucleotide sequence of a
Fhm polypeptide. Usually, the DNA fragment encoding the amino
terminus of the polypeptide will have an ATG, which encodes a
methionine residue. This methionine may or may not be present on
the mature form of the Fhm polypeptide, depending on whether the
polypeptide produce din the host cell is designed to be secreted
from the cell. Other methods known to the skilled artisan may be
used as well.
[0164] In certain embodiments, nucleic acid variants contain codons
which have been altered for the optimal expression of a Fhm
polypeptide in a given host cell. Particular codon alterations will
depend upon the Fhm polypeptide(s) and host cell(s) selected for
expression. Such "codon optimization" can be carried out by a
variety of methods, for example, by selecting codons which are
preferred for use in highly expressed genes in a given host cell.
Computer algorithms which incorporate codon frequency tables such
as "Ecohigh. cod" for codon preference of highly expressed
bacterial genes may be used and are provided by the University of
Wisconsin Package Version 9.0, Genetics Computer Group, Madison,
Wis. Other useful codon frequency tables include
"Celegans_high.cod", "Celegans_low.cod", "Drosophila_high.cod",
"Human_high.cod", "Maize_high.cod", and "Yeast_high.cod".
[0165] In other embodiments, nucleic acid molecules encode Fhm
variants with conservative amino acid substitutions as defined
above, Fhm variants comprising an. addition and/or a deletion of
one or more N-linked or O-linked glycosylation sites, or Fhm
polypeptide fragments as described above. In addition, nucleic acid
molecules may encode any combination of Fhm variants, fragments,
and fusion polypeptides described herein provided that DNA's
modified in this way code for polypeptides capable of finding one
or more members of TNF supergene family of ligands and
receptors.
[0166] Vectors and Host Cells
[0167] A nucleic acid molecule encoding the amino acid sequence of
a Fhm polypeptide may be inserted into an appropriate expression
vector using standard ligation techniques. The vector is typically
selected to be functional in the particular host cell employed
(i.e., the vector is compatible with the host cell machinery such
that amplification of the gene and/or expression of the gene can
occur). A nucleic acid molecule encoding the amino acid sequence of
a Fhm polypeptide may be amplified/expressed in prokaryotic, yeast,
insect (baculovirus systems), and/or eukaryotic host cells.
Selection of the host cell will depend in part on whether the Fhm
polypeptide is to be post-translationally modified (e.g.,
glycosylated and/or phosphorylated). If so, yeast, insect, or
mammalian host cells are preferable. For a review of expression
vectors see Meth. Enz. vol. 185 D. V. Goeddel ed., Academic Press,
Sna Diego Calif., 1990.
[0168] Typically, expression vectors used in any of the host cells
will contain sequences for plasmid maintenance and for cloning and
expression of exogenous nucleotide sequences. Such sequences,
collectively referred to as "flanking sequences" (in certain
embodiments will typically include one or more of the following
nucleotide sequences: a promoter, one or more enhancer sequences,
an origin of replication, a transcriptional termination sequence, a
complete intron sequence containing a donor and acceptor splice
site, a sequence encoding a leader sequence for secretion, a
ribosome binding site, a polyadenylation sequence, a polylinker
region for inserting the nucleic acid encoding the polypeptide to
be expressed, and a selectable marker element. Each of these
sequences is discussed below.
[0169] Optionally, the vector may contain a "tag" sequence, i.e.,
an oligonucleotide molecule located at the 5' or 3' end of the Fhm
polypeptide coding sequence; the oligonucleotide molecule encodes
polyHis (such as hexaHis), or another "tag" such as FLAG, HA
(hemaglutinin influenza virus) or myc for which commercially
available antibodies exist. Optionally, the Fhm gene can also be
fused in frame at the N-terminal for example to an IgG Fc region.
This tag is typically fused to the polypeptide upon expression of
the polypeptide, and can serve as a means for affinity purification
of the Fhm polypeptide from the host cell although it may also
prolong the circulatory half life of a Fhm polypeptide. Affinity
purification can be accomplished, for example, by column
chromatography using antibodies against the tag as an affinity
matrix. Optionally, the tag can subsequently be removed from the
purified Fhm polypeptide by various means such as using certain
peptidases for cleavage.
[0170] Flanking sequences may be homologous (i.e., from the same
species and/or strain as the host cell), heterologous (i.e, from a
species other than the host cell species or strain), hybrid (i.e.,
a combination of flanking sequences from more than one source), or
synthetic, orteh flanking sequence may be native sequences which
normally function to regulate Fhm expression. As such, the source
of flanking sequences may be any prokaryotic or eukaryotic
organism, any vertebrate or invertebrate organism, or any plant,
provided that a flanking sequence is functional in, and can be
activated by, the host cell machinery.
[0171] The flanking sequences useful in the vectors of this
invention may be obtained by any of several methods well known in
the art. Typically, flanking sequences useful herein other than the
sequences flanking the Fhm gene will have been previously
identified by mapping and/or by restriction endonuclease digestion
and can thus be isolated from the proper tissue source using the
appropriate restriction endonucleases. In some cases, the full
nucleotide sequence of a flanking sequence may be known. Here, the
flanking sequence may be synthesized using the methods described
herein for nucleic acid synthesis or cloning.
[0172] Where all or only a portion of the flanking sequence is
known, it may be obtained using PCR and/or by screening a genomic
library with suitable oligonucleotide and/or flanking sequence
fragments from the same or another species.
[0173] Where the flanking sequence is not known, a fragment of DNA
containing a flanking sequence may be isolated from a larger piece
of DNA that may contain, for example, a coding sequence or even
another gene or genes. Isolation may be accomplished by restriction
endonuclease digestion to produce the proper DNA fragment followed
by isolation using agarose gel purification, Qiagen.RTM. column
chromatography (Chatsworth, Calif.), or other method known to the
skilled artisan. The selection of suitable enzymes to accomplish
this purpose will be readily apparent to one of ordinary skill in
the art.
[0174] An origin of replication is typically a part of those
prokaryotic expression vectors purchased commercially, and the
origin aids in the amplification of the vector in a host cell.
Amplification of the vector to a certain copy number can, in some
cases, be important for the optimal expression of the Fhm
polypeptide. If the vector of choice does not contain an origin of
replication site, one may be chemically synthesized based on a
known sequence, and ligated into the vector. For example, the
origin of replication from the plasmid pBR322 (Product No. 303-3s,
New England Biolabs, Beverly, Mass.) is suitable for most
Gram-negative bacteria and various origins (e.g., SV40, polyoma,
adenovirus, vesicular stomatitus virus (VSV) or papillomaviruses
such as HPV or BPV) are useful for cloning vectors in mammalian
cells. Generally, the origin of replication component is not needed
for mammalian expression vectors (for example, the SV40 origin is
often used only because it contains the early promoter).
[0175] A transcription termination sequence is typically located 3'
of the end of a polypeptide coding regions and serves to terminate
transcription. Usually, a transcription termination sequence in
prokaryotic cells is a G-C rich fragment followed by a poly T
sequence. While the sequence is easily cloned from a library or
even purchased commercially as part of a vector, it can also be
readily synthesized using methods for nucleic acid synthesis such
as those described herein.
[0176] A selectable marker gene element encodes a protein necessary
for the survival and growth of a host cell grown in a selective
culture medium. Typical selection marker genes encode proteins that
(a) confer resistance to antibiotics or other toxins, e.g.,
ampicillin, tetracycline, or kanamycin for prokaryotic host cells,
(b) complement auxotrophic deficiencies of the cell; or (c) supply
critical nutrients not available from complex media. Preferred
selectable markers are the kanamycin resistance gene, the
ampicillin resistance gene, and the tetracycline resistance gene. A
neomycin resistance gene may also be used for selection in
prokaryotic and eukaryotic host cells.
[0177] Other selection genes may be used to amplify the gene which
will be expressed. Amplification is the process wherein genes which
are in greater demand for the production of a protein critical for
growth are reiterated in tandem within the chromosomes of
successive generations of recombinant cells. Examples of suitable
selectable markers for mammalian cells include dihydrofolate
reductase (DHFR) and thymidine kinase. The mammalian cell
transformants are placed under selection pressure which only the
transformants are uniquely adapted to survive by virtue of the
selection gene present in the vector. Selection pressure is imposed
by culturing the transformed cells under conditions in which the
concentration of selection agent in the medium is successively
changed, thereby leading to the amplification of both the selection
gene and the DNA that encodes Fhm. As a result, increased
quantities of Fhm are synthesized from the amplified DNA.
[0178] A ribosome binding site is usually necessary for translation
initiation of mRNA and is characterized by a Shine-Dalgarno
sequence (prokaryotes) or a Kozak sequence (eukaryotes). The
element is typically located 3' to the promoter and 5' to the
coding sequence of the Fhm polypeptide to be expressed. The
Shine-Dalgarno sequence is varied but is typically a polypurine
(i.e., having a high A-G content). Many Shine-Dalgarno sequences
have been identified, each of which can be readily synthesized
using methods set forth herein and used in a prokaryotic
vector.
[0179] A leader, or signal, sequence may be used to direct the
secretion of Fhm polypeptide out of the host cell where it is
synthesized. Typically, a nucleotide sequence encoding the signal
sequence is positioned in the coding region of the Fhm nucleic acid
molecule, or directly at the 5' end of the Fhm polypeptide coding
region. Many signal sequences have been identified, and any of
those that are functional in the selected host cell may be used in
conjunction with the Fhm gene or cDNA. Therefore, a signal sequence
may be homologous (naturally occurring) or heterologous to the Fhm
gene or cDNA, and may be homologous or heterologous to the Fhm gene
or cDNA. Additionally, a signal sequence may be chemically
synthesized using methods described herein. In most cases, the
secretion of an Fhm polypeptide from the host cell via the presence
of a signal peptide will result in the removal of the signal
peptide from the Fhm polypeptide.
[0180] The signal sequence may be a component of the vector, or it
may be a part of Fhm nucleic acid molecule that is inserted into
the vector. The native Fhm DNA encodes a signal sequence at the
amino terminus of the protein that is cleaved during
post-translational processing of the molecule to form the mature
Fhm protein product. Included within the scope of this invention
are Fhm nucleotides with the native signal sequence as well as Fhm
nucleotides wherein the native signal sequence is deleted and
replaced with a heterologous signal sequence. The heterologous
signal sequence selected should be one that is recognized and
processed, i.e., cleaved by a signal peptidase, by the host cell.
For prokaryotic host cells that do not recognize and process the
native Fhm signal sequence, the signal sequence is substituted by a
prokaryotic signal sequence selected, for example, from the group
of the alkaline phosphatase, penicillinase, or heat-stable
enterotoxin II leaders. For yeast secretion, the native Fhm signal
sequence may be substituted by the yeast invertase, alpha factor,
or acid phosphatase signal sequences. For mammalian cell expression
the native signal sequence of the Fhm polypeptideis satisfactory,
although other mammalian signal sequences may be suitable.
[0181] In some cases, such as where glycosylation is desired in a
eukaryotic host cell expression system, one may manipulate the
various presequences to improve glycosylation or yield. For
example, one may alter the peptidase cleavage site of a particular
signal peptide, or add presequences, which also may affect
glycosylation. The final protein product may have, in the -1
position (relative to the first amino acid of the mature protein),
one or more additional amino acid residues incident to expression,
which may not have been totally removed. For example, the final
protein product may have one or two amino acids found in the
peptidase cleavage site, attached to the N-terminus. Alternatively,
use of some enzyme cleavage sites may result in a slightly
truncated form of the desired Fhm polypeptide, if the enzyme cuts
at such area within the mature polypeptide.
[0182] In many cases, transcription of a nucleic acid molecule is
increased by the presence of one or more introns in the vector;
this is particularly true where a polypeptide is produced in
eukaryotic host cells, especially mammalian host cells. The introns
used may be naturally occurring within the Fhm gene, especially
where the gene used is a full length genomic sequence or a fragment
thereof Where the intron is not naturally occurring within the gene
(as for most cDNAs), the intron(s) may be obtained from another
source. The position of the intron with respect to flanking
sequences and the Fhm gene is generally important, as the intron
must be transcribed to be effective. Thus, when an Fhm cDNA
molecule is being transcribed, the preferred position for the
intron is 3' to the transcription start site, and 5' to the polyA
transcription termination sequence. Preferably, the intron or
introns will be located on one side or the other (i.e., 5' or 3')
of the cDNA such that it does not interrupt the this coding
sequence. Any intron from any source, including viral, prokaryotic
and eukaryotic (plant or animal) organisms, may be used to practice
this invention, provided that it is compatible with the host
cell(s) into which it is inserted. Also included herein are
synthetic introns. Optionally, more than one intron may be used in
the vector.
[0183] The expression and cloning vectors of the present invention
will each typically contain a promoter that is recognized by the
host organism and operably linked to the molecule encoding the Fhm
polypeptide.
[0184] Promoters are untranscribed sequences located upstream (5')
to the start codon of a structural gene (generally within about 100
to 1000 bp) that control the transcription and translation of a
particular molecule, such as that encoding Fhm. Promoters are
conventionally grouped into one of two classes, inducible promoters
and constitutive promoters. Inducible promoters initiate increased
levels of transcription from DNA under their control in response to
some change in culture conditions, such as the presence or absence
of a nutrient or a change in temperature. Constitutive promoters,
on the othere hand, initiate continuous gene production; that is,
there is little or no control over gene expression. A large number
of promoters, recognized by a variety of potential host cells, are
well known. A suitable promoter is operably linked to the DNA
encoding Fhm by removing the promoter from the source DNA by
restriction enzyme digestion and inserting the desired promoter
sequence into the vector. The native Fhm promoter sequence may be
used to direct amplification and/or expression of Fhm encoding
nucleic acid molecule. A heterologous promoter is preferred,
however, if it permits greater transcription and higher yields of
the expressed protein as compared to the native promoter, and if it
is compatible with the host cell system that has been selected for
use.
[0185] Promoters suitable for use with prokaryotic hosts include,
but are not limited to the beta-lactamase and lactose promoter
systems; alkaline phosphatase, a tryptophan (trp) promoter system;
and hybrid promoters such as the tac promoter. Other known
bacterial promoteres and also suitable. Their sequences have been
published, thereby enabling one skilled in the art to ligate them
to the desired DNA sequence(s), using linkers or adapters as needed
to supply any useful restriction sites.
[0186] Suitable promoters for use with yeast hosts are also well
known in the art. Yeast enhancers are advantageously used with
yeast promoters. Suitable promoters for use with mammalian host
cells are well known and include, but are not limited to, those
obtained from the genomes of viruses such as polyoma virus, fowl
pox virus, adenovirus (such as Adenovirus 2), bovine papilloma
virus, avian sarcoma virus, cytomegalovirus, retrovirus,
hepatitis-B virus, herpes virus and most preferably Simian Virus 40
(SV40). Other suitable mammalian promoters include heterologous
mammalian promoters, e.g., heat-shock promoters and the actin
promoter.
[0187] Additional promoters which may be of interest in controlling
Fhm transcription include, but are not limited to, the SV40 early
promoter region (Bemoist and Chambon, Nature, 290:304-310, 1981);
the CMV promoter; the promoter contained in the 3' long terminal
repeat (LTR) of Rous sarcoma virus (RSV) (Yamamoto, et al., Cell,
22:787-797, 1980); the herpes thymidine kinase (TK) promoter
(Wagner et al., Proc. Natl. Acad. Sci. U.S.A., 78:144-1445, 1981);
the regulatory sequences of the metallothionine gene (Brinster et
al., Nature, 296:39-42, 1982); prokaryotic expression vectors such
as the beta-lactamase promoter (Villa-Kamaroff, et al., Proc. Natl.
Acad. Sci. U.S.A., 75:3727-3731, 1978); or the tac promoter
(DeBoer, et al., Proc. Natl. Acad. Sci. U.S.A., 80:21-25, 1983).
Also of use are the following animal transcriptional control
regions, which exhibit tissue specificity and have been utilized in
transgenic animals: the elastase I gene control region which is
active in pancreatic acinar cells (Swift et al., Cell, 38:639-646,
1984; Omitz et al., Cold Spring Harbor Symp. Quant. Biol.
50:399-409, 1986; MacDonald, Hepatology, 7:425-515, 1987); the
insulin gene control region which is active in pancreatic beta
cells. (Hanahan, Nature, 315:115-122, 1985); the immunoglobulin
gene control region which is active in lymphoid cells (Grosschedl
et al., Cell, 38:647-658, 1984; Adames et al., Nature, 318:533-538,
1985; Alexander et al., Mol. Cell. Biol., 7:1436-1444, 1987); the
mouse mammary tumor virus control region which is active in
testicular, breast, lymphoid and mast cells (Leder et al., Cell,
45:485-495, 1986), the albumin gene control region which is active
in liver (Pinkert et al., Genes and Devel., 1:268-276, 1987); the
alphafetoprotein gene control region which is active in liver
(Krunlaufet al., Mol. Cell. Biol., 5:1639-1648, 1985; Hammer et
al., Science, 235:53-58, 1987); the alpha 1-antitrypsin gene
control region which is active in the liver (Kelsey et al., Genes
and Devel., 1:161-171, 1987); the beta-globin gene control region
which is active in myeloid cells (Mogram et al., Nature,
315:338-340, 1985; Kollias et al., Cell, 46:89-94, 1986); the
myelin basic protein gene control region which is active in
oligodendrocyte cells in the brain (Readhead et al., Cell,
48:703-712, 1987); the myosin light chain-2 gene control region
which is active in skeletal muscle (Sani, Nature, 314:283-286,
1985); and the gonadotropic releasing hormone gene control region
which is active in the hypothalamus (Mason et al., Science,
234:1372-1378, 1986).
[0188] An enhancer sequence may be inserted into the vector to
increase the transcription of a DNA encoding a Fhm polypeptide of
the present invention by higher eukaryotes. Enhancers are
cis-acting elements of DNA, usually about. 10-300 bp in length,
that act on the promoter to increase its transcription. Enhancers
are relatively orientation and position independent. They have been
found 5' and 3' to the transcription unit. Several enhancer
sequences available from mammalian genes are known (e.g., globin,
elastase, albumin, alpha-feto-protein and insulin). Typically,
however, an enhancer from a virus will be used. The SV40 enhancer,
the cytomegalovirus early promoter enhancer, the polyoma enhancer,
and adenovirus enhancers are exemplary enhancing elements for the
activation or upregulation of eukaryotic promoters. While an
enhancer may be spliced into the vector at a position 5' or 3' to
Fhm nucleic acid molecules, it is typically located at a site 5'
from the promoter.
[0189] Expression vectors of the invention may be constructed from
a starting vector such as a commercially available vector. Such
vectors may or may not contain all of the desired flanking
sequences. Where one or more of the desired flanking sequences set
forth above are not already present in the vector, they may be
individually obtained and ligated into the vector. Methods used for
obtaining each of the flanking sequences are well known to one
skilled in the art.
[0190] Preferred vectors for practicing this invention are those
which are compatible with bacterial, insect, and mammalian host
cells. Such vectors include, inter alia, pCRII, pCR3, and pcDNA3.1
(Invitrogen Company, Carlsbad, Calif.), pBSII (Stratagene Company,
La Jolla, Calif.), pET15 (Novagen, Madison, Wis.), pGEX (Pharmacia
Biotech, Piscataway, N.J.), pEGFP-N2 (Clontech, Palo Alto, Calif.),
pETL (BlueBacII; Invitrogen), pDSR-alpha (PCT Publ. No. WO
90/14364) and pFastBacDual (Gibco-Brl Grand Island, N.Y.).
[0191] Additional suitable vectors include, but are not limited to,
cosmids, plasmids or modified viruses, but it will be appreciated
that the vector system must be compatible with the selected host
cell. Such vectors include, but are not limited to plasmids such as
Bluescript.RTM. plasmid derivatives (a high copy number ColEl-based
phagemid, Stratagene Cloning Systems Inc., La Jolla Calif.), PCR
cloning plasmids designed for cloning Taq-amplified PCR products
(e.g., TOPO.TM. TA Cloning.RTM. Kit, PCR2.1.RTM. plasmid
derivatives, Invitrogen, Carlsbad, Calif.), and mammalian , yeast
or virus vectors such as a baculovirus expression system (pBacPAK
plasmid derivatives, Clontech, Palo Alto, Calif.).
[0192] After the vector has been constructed and a nucleic acid
molecule encoding an Fhm polypeptide has been inserted into the
proper site of the vector, the completed vector may be inserted
into a suitable host cell for amplification and/or polypeptide
expression. The transformation of an expression vector for an Fhm
polypeptide into a selected host cell may be accomplished by
well-known methods such as transfection, infection, calcium
chloride, electroporation, microinjection, lipofection or the
DEAE-dextran method or other known techniques. The method selected
will in part be a function of the type of host cell to be used.
These methods and other suitable methods are well known to the
skilled artisan, and are set forth, for example, in Sambrook et
al., supra.
[0193] Host cells may be prokaryotic host cells (such as E. coli)
or eukaryotic host cells (yeast, insect, or vertebrate cells). The
host cell, when cultured under appropriate conditions, synthesizes
an Fhm polypeptide which can subsequently be collected from the
culture medium (if the host cell secretes it into the medium) or
directly from the host cell producing it (if it is not secreted).
The selection of an appropriate host cell will depend upon various
factors, such as desired expression levels, polypeptide
modifications that desirable or necessary for activity, (such as
glycosylation or phosphorylation), and ease of folding into a
biologically active molecule.
[0194] Yeast and mammalian cells are preferred hosts of the present
invention. The use of such hosts provides substantial advantages in
that they can also carry out post-translational peptide
modifications including glycosylation. A number of recombinant DNA
strategies exist which utilize strong promoter sequences and high
copy number of plasmids which can be utilized for production of the
desired proteins in these hosts.
[0195] Yeast recognize leader sequences on cloned mammalian gene
products and secrete peptides bearing leader sequences (i.e.,
pre-peptides). Mammalian cells provide post-translational
modifications to protein molecules including correct folding or
glycosylation at correct sites.
[0196] Mammalian cells which may be useful as hosts include cells
of fibroblast origin such as VERO or CHO-K1, and their derivatives.
For a mammalian host, several possible vector systems are available
for the expression of the desired Fhm protein. A wide variety of
transcriptional and translational regulatory sequences may be
employed, depending upon the nature of the host. The
transcriptional and translational regulatory signals may be derived
from viral sources, such as adenovirus, bovine papilloma virus,
simian virus, or the like, where the regulatory signals are
associated with a particular gene which has a high level of
expression. Alternatively, promoters from mammalian expression
products, such as actin, collagen, myosin, etc., may be employed.
Transcriptional initiation regulatory signals may be selected which
allow for repression or activation, so that expression of the genes
can be modulated. Useful signals are regulatory signals which are
temperature-sensitive so that by varying the temperature,
expression can be repressed or initiated, or are subject to
chemical regulation, e.g., metabolite.
[0197] As is widely known, translation of eukaryotic mRNA is
initiated at the codon which encodes the first methionine. For this
reason, it is preferable to ensure that the linkage between a
eukaryotic promoter and a DNA sequence which encodes the desired
receptor molecule does not contain any intervening codons which are
capable of encoding a methionine (i.e., AUG). The presence of such
codons results either in the formation of a fusion protein (if the
AUG codon is in the same reading frame as the desired receptor
molecule encoding DNA sequence) or a frame-shift mutation (if the
AUG codon is not in the same reading frame as the desired Fhm
protein encoding sequence).
[0198] The expression of the Fhm proteins can also be accomplished
in procaryotic cells. Preferred prokaryotic hosts include bacteria
such as E. coli, Bacillus, Streptomyces, Pseudomonas, Salmonella,
Serratia, etc. The most preferred prokaryotic host is E. coli.
Bacterial hosts of particular interest include E. coli K12 strain
294 (ATCC 31446), E. coli X1776 (ATCC 31537), E. coli W3110
(F.sup.-, lambda.sup.-, prototrophic (ATCC 27325)), and other
enterobacteria (such as Salmonella typhimurium or Serratia
marcescens), and various Pseudomonas species. The prokaryotic host
must be compatible with the replicon and control sequences in the
expression plasmid.
[0199] To express the desired Fhm protein in a prokaryotic cell
(such as, for example, E. coli, B. subtilis, Pseudomonas,
Streptomyces, etc.), it is necessary to operably link the desired
receptor molecule encoding sequence to a functional prokaryotic
promoter. Such promoters may be either constitutive or, more
preferably, regulatable (i.e., inducible or derepressible).
Examples of constitutive promoters include the int promoter of
bacteriophage .lambda., and the bla promoter of the
.beta.-lactamase gene of pBR322, etc. Examples of inducible
prokaryotic promoters include the major right and left promoters,
of bacteriophage .lambda. (P.sub.L and P.sub.R), the trp, recA,
lacZ, lacI, gal, and tac promoters of E. coli, the .alpha.-amylase
(Ulmanen et al., J. Bacteriol. 162:176-182, 1985), the
.sigma.-28-specific promoters of B. subtilis (Gilma et al., Gene
32:11-20, 1984), the promoters of the bacteriophages of Bacillus
(Gryczan, T. J., In: The Molecular Biology of the Bacilli, Academic
Press, Inc., New York, 1982), and Streptomyces promoters (Ward et
al., Mol. Gen. Genet. 203:468-478 1986). Prokaryotic promoters are
reviewed by Glick, (J. Ind. Microbiol. 1:277-282, 1987);
Cenatiempo, Biochimie 68:505-516, 1986); and Gottesman, Ann. Rev.
Genet. 18:415-442 1984).
[0200] Proper expression in a prokaryotic cell also requires the
presence of a ribosome binding site upstream from the gene-encoding
sequence. Such ribosome binding sites are disclosed, for example,
by Gold et al. (Ann. Rev. Microbiol. 35:365-404, 1981).
[0201] The desired Fhm protein encoding sequence and an operably
linked promoter may be introduced into a recipient prokaryotic or
eukaryotic cell either as a non-replicating DNA (or RNA) molecule,
which may either be linear or, more preferably, a closed covalent
circular molecule. Since such molecules are incapable of autonomous
replication, the expression of the desired receptor molecule may
occur through the transient expression of the introduced sequence.
Alternatively, permanent expression may occur through the
integration of the introduced sequence into the host
chromosome.
[0202] In one embodiment, a vector is employed which is capable of
integrating the desired gene sequences into the host cell
chromosome. Cells which have stably integrated the introduced DNA
into their chromosomes can be selected by also introducing one or
more markers which allow for selection of host cells which contain
the expression vector. The marker may complement an auxotrophy in
the host (such as leu21, or ura3, which are common yeast
auxotrophic markers), biocide resistance, e.g., antibiotics, or
heavy metals, such as copper, or the like. The selectable marker
gene can either be directly linked to the DNA gene sequences to be
expressed, or introduced into the same cell by co-transfection.
[0203] In a preferred embodiment, the introduced sequence will be
incorporated into a plasmid or viral vector capable of autonomous
replication in the recipient host. Any of a wide variety of vectors
may be employed for this purpose. Factors of importance in
selecting a particular plasmid or viral vector include, for e.g.
the ease with which recipient cells that contain the vector may be
recognized and selected from those recipient cells which do not
contain the vector; the number of copies of the vector which are
desired in a particular host; and whether it is desirable to be
able to "shuttle" the vector between host cells of different
species.
[0204] Any of a series of yeast gene expression systems can also be
utilized. Examples of such expression vectors include the yeast
2-micron circle, the expression plasmids YEP13, YVP and YRP, etc.,
or their derivatives. Such plasmids are well known in the art
(Botstein, et al., Miami Wntr. Symp. 19:265-274 (1982); Broach, In:
The Molecular Biology of the Yeast Saccharomyces: Life Cycle and
Inheritance, Cold Spring Harbor Laboratory, Cold Spring Harbor,
N.Y., p. 445-470 (1981); Broach, Cell 28:203-204 1982).
[0205] For a mammalian host, several possible vector systems are
available for expression. One class of vectors utilize DNA elements
which provide autonomously replicating extra-chromosomal plasmids,
derived from animal viruses such as bovine papilloma virus, polyoma
virus, adenovirus, or SV40 virus. A second class of vectors relies
upon the integration of the desired gene sequences into the host
chromosome. Cells which have stably integrated the introduced DNA
into their chromosomes may be selected by also introducing one or
more markers which allow selection of host cells which contain the
expression vector. The marker may provide for prototropy to an
auxotrophic host, biocide resistance, e.g., antibiotics, or heavy
metals, such as copper or the like. The selectable marker gene can
either be directly linked to the DNA sequences to be expressed, or
introduced into the same cell by co-transformation. Additional
elements may also be needed for optimal synthesis of mRNA. These
elements may include splice signals, as well as transcription
promoters, enhancers, and termination signals. The cDNA expression
vectors incorporating such elements include those described by
Okayama, Mol. Cell. Biol. 3:280 1983, and others. Preferred
eukaryotic vectors include PWLNEO, PSV2CAT, POG44, PXT1, pSG,
pSVK3, pBPV, pMSG, pSVL (Pharmacia).
[0206] Preferred prokaryotic vectors include plasmids such as those
capable of replication in E. coli such as, for example, pBR322,
ColEl, pSC101, pACYC 184, .pi.VX, pQE70, pQE60, pQE9, pBG, pD10,
Phage script, psix174, pbmescript SK, pbsks, pNH8A, pNHIBa, pNH18A,
pNH46A (SL rare gone), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5.
Such plasmids are, for example, disclosed by Maniatis, T., et al.
(In: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor
Press, Cold Spring Harbor, N.Y. (1982)). Bacillus plasmids include
pC194, pC221, pT127, etc. Such plasmids are disclosed by Gryczan,
T. (In: The Molecular Biology of the Bacilli, Academic Press, New
York (1982), pp. 307-329). Suitable Streptomyces plasmids include
pISJ101 (Kendall, et al., J. Bacteriol. 169:4177-4183 1987), and
Streptomyces bacteriophages such as .phi.C31 (Chater, et al., In:
Sixth International Symposium on Actinomycetales Biology, Akademiai
Kaido, Budapest, Hungary, 1986, pp 45-541). Pseudomonas plasmids
are reviewed by John, et al. (Rev. Infect. Dis. 8:693-704, 1986,
and Izaki, K. (Jpn. J. Bacteriol.33:729-742 1978).
[0207] However, any other plasmid or vector may be used as long as
they are replicable and viable in the host cell.
[0208] Once the vector or DNA sequence containing the constructs
has been prepared for expression, the DNA constructs may be
introduced into an appropriate host. Various techniques may be
employed, such as a protoplast fusion, calcium phosphate
precipitation, electroporation or other conventional techniques.
After the fusion, the cells are grown in media and screened for
appropriate activities. Expression of the sequence results in the
production of the Fhm protein.
[0209] Suitable host cells or cell lines may be mammalian cells,
such as Chinese hamster ovary cells (CHO; ATCC No. CCL61), CHO DHFR
cells (Urlaub et al. Proc. Natl. Acad. Sci. U.S.A, 97: 4216-4220,
1980) human embryonic kidney (HEK), 293 or 293T cells (ATCC No. CRL
1573), or 3T3 cells (ATCC No. CRL920). The selection of suitable
mammalian host cells and methods for transformation, culture,
amplification, screening, product production and purification are
known in the art. Other suitable mammalian cell lines, are the
monkey COS-1 (ATCC No. CRL 1650) and COS-7 (ATCC No. CRL 1651) cell
lines, and the CV-1 (ATCC No. CCL70) cell line. Further exemplary
mammalian host cells include primate cell lines and rodent cell
lines, including transformed cell lines. Normal diploid cells, cell
strains derived from in vitro culture of primary tissue, as well as
primary explants, are also suitable. Candidate cells may be
genotypically deficient in the selection gene, or may contain a
dominant acting selection gene. Other suitable mammalian cell lines
include, but are not limited to, mouse neuroblastoma N2A cells,
HeLa, mouse L-929 cells, 3T3 lines derived from Swiss, Balb-c or
NIH mice, BHK or HaK hamster cell lines, which are available from
the ATCC. Each of these cell lines is known by and available to
those skilled in the art of protein expression.
[0210] Similarly useful as host cells suitable for the present
invention are bacterial cells. For example, the various strains of
E. coli (e.g., HB101, DH5.alpha. (ATCC No. 33694), DH10, and MC1061
(ATCC No. 53330)) are well-known as host cells in the field of
biotechnology. Various strains of B. subtilis, Pseudomonas spp.,
other Bacillus spp., Streptomyces spp., and the like may also be
employed in this method.
[0211] Many strains of yeast cells known to those skilled in the
art are also available as host cells for expression of the
polypeptides of the present invention. Preferred yeast strains
include, for example, Saccharomyces cerevisiae and Piclia
pastoris.
[0212] Additionally, where desired, insect cell systems may be
utilized in the methods of the present invention. Such systems are
described for example in Kitts et al. (Biotechniques, 14:810-817,
1993), Lucklow (Curr. Opin. Bioteclnol., 4:564-572, 1993) and
Lucklow et al. (J. Virol., 67:4566-4579, 1993). Preferred insect
cells are Sf-9 and Hi5 (Invitrogen, Carlsbad, Calif.).
[0213] One may also use transgenic animals to express glycosylated
Fhm polypeptides. For example, one may use a transgenic
milk-producing animal (e.g. a cow or goat) and obtain the present
glycosylated polypeptide in the animal milk. One may also use
plants to produce Fhm polypeptides; however, in general, the
glycosylation occurring in plants is different from that produced
in mammalian cells, and may result in a glycosylated product which
is not suitable for human therapeutic use.
[0214] Polypeptide Production
[0215] Host cells comprising an Fhm polypeptide expression vector
(i.e., transformed or transfected) may be cultured using standard
media well known to the skilled artisan. The media will usually
contain all nutrients necessary for the growth and survival of the
cells. Suitable media for culturing E. coli cells include for
example, Luria Broth (LB) and/or Terrific Broth (TB). Suitable
media for culturing eukaryotic cells are Rosewell Park Memorial
Media 1640 (RPMI 1640), Minimal Essential Media (MEM), Dulbecco's
Modified. Eagles Media (DMEM), all of which may be supplemented
with serum and/or growth factors asindicated by the particular cell
line being cultured. A suitable medium for insect cultures is
Grace's medium supplemented with yeastolate, lactalbumin
hydrolysate and/or fetal calf serum as necessary.
[0216] Typically, an antibiotic or other compound useful for
selective growth of transformed cells is added as a supplement to
the media. The compound to be used will be dictated by the
selectable marker element present on the plasmid with which the
host cell was transformed. For example, where the selectable marker
element is kanamycin resistance, the compound added to the culture
medium will be kanamycin. Other compunds for selctive growth media
include ampicillin, tetracycline and neomycin. The amount of Fhm
polypeptide produced by a host cell can be evaluated using standard
methods known in the art. Such methods include, without limitation,
Western blot analysis, SDS-polyacrylamide gel electrophoresis,
non-denaturing gel electrophoresis, HPLC separation,
immunoprecipitation, and/or activity assays such as DNA binding gel
shift assays.
[0217] If a Fhm polypeptide has been designed to be secreted from
the host cells, the majority of polypeptide may be found in the
cell culture medium. If however, the Fhm polypeptide is not
secreted from the host cells, it will be present in the cytoplasm
and/or nucleus (for eukaryotic host cells) or in the cytosol
(bacterial host cells).
[0218] The intracellular material (including inclusion bodies for
gram-negative bacteria) can be extracted from the host cell using
any standard technique known to the skilled artisan. For example,
the host cells can be lysed to release the contents of the
periplasm/cytoplasm by French press, homogenization, and/or
sonication followed by. centrifugation.
[0219] If a Fhm polypeptide has formed inclusion bodies in the
cytosol, the inclusion bodies can often bind to the inner and/or
outer cellular membranes and thus will be found primarily in the
pellet material after centrifugation. The pellet material can then
be treated at pH extremes or with a chaotropic agent such as a
detergent, guanidine, guanidine derivatives, urea, or urea
derivatives in the presence of a reducing agent such as
dithiothreitol at alkaline pH or tris carboxyethyl phosphine at
acid pH to release, break apart, and solubilize the inclusion
bodies. The Fhm polypeptide in its now soluble form can then be
analyzed using gel electrophoresis, immunoprecipitation or the
like. If it is desired to isolate the Fhm polypeptide, isolation
may be accomplished using standard methods such as those described
herein and in Marston et al. (Meth. Enz., 182:264-275 1990).
[0220] In some cases, a Fhm polypeptide may not be biologically
active upon isolation. Various methods for "refolding" or
converting the polypeptide to its tertiary structure and generating
disulfide linkages, can be used to restore biological activity.
Such methods include exposing the solubilized polypeptide to a pH
usually above 7 and in the presence of a particular concentration
of a chaotrope. The selection of chaotrope is very similar to the
choices used for inclusion body solubilization, but usually the
chaotrope is used at a lower concentration and is not necessarily
the same as chaotropes used for the solubilization. In most cases
the refolding/oxidation solution will also contain a reducing agent
or the reducing agent plus its oxidized form in a specific ratio to
generate a particular redox potential allowing for disulfide
shuffling to occur in the formation of the protein's cysteine
bridge(s). Some of the commonly used redox couples include
cysteine/cystamine, glutathione (GSH)/dithiobis GSH, cupric
chloride, dithiothreitol(DTT)/dithiane DTT,
2-mercaptoethanol(.beta.ME)/dithio-.beta.(ME). A cosolvent is
necessary to increase the efficiency of the refolding, and the more
common reagents used for this purpose include glycerol,
polyethylene glycol of various molecular weights, arginine and the
like.
[0221] If inclusion bodies are not formed to a significant degree
upon expression of a Fhm polypeptide, then the polypeptide will be
found primarily in the supernatant after centrifugation of the cell
homogenate . The polypeptide and may be further isolated from the
supernatant using methods such as those described herein.
[0222] The purification of an Fhm polypeptide from solution can be
accomplished using a variety of techniques. If the polypeptide has
been synthesized such that it contains a tag such as Hexahistidine
(Fhm polypeptide/hexaHis) or other small peptide such as FLAG
(Eastman Kodak Co., New Haven, Conn.) or myc (Invitrogen, Carlsbad,
Calif.) at either its carboxyl or amino terminus, it may be
purified in a one-step process by passing the solution through an
affinity column where the column matrix has a high affinity for the
tag.
[0223] For example, polyhistidine binds with great affinity and
specificity to nickel, thus annickel; thus affinity column of
nickel (such as the Qiagen.RTM. nickel columns) can be used for
purification of Fhm polypeptide/polyHis. See for example, Ausubel
et al., eds., Current Protocols in Molecular Biology, Section
10.11.8, John Wiley & Sons, New York 1993.
[0224] Additionally, the Fhm polypeptide may be purified throughthe
use of a monoclonal antibody which is capable of specifically
recognizing and binding to the Fhm polypeptide.
[0225] Suitable procedures for purification thus include, without
limitation, affinity chromatography, immunoaffinity chromatography,
ion exchange chromatography, molecular sieve chromatography, High
Performance Liquid Chromatography (HPLC), electrophoresis
(including native gel electrophoresis) followed by gel elution, and
preparative isoelectric focusing ("Isoprime" machine/technique,
Hoefer Scientific, San Francisco, Calif.). In some cases, two or
more purification techniques may be combined to achieve increased
purity.
[0226] Fhm polypeptides, fragments, and/or derivatives thereof may
also be prepared by chemical synthesis methods (such as solid phase
peptide synthesis) using techniques known in the art, such as those
set forth by Merrifield et al., (J. Am. Chem. Soc., 85:2149, 1963),
Houghten et al. (Proc Natl Acad. Sci. USA, 82:5132, 1985), and
Stewart and Young (Solid Phase Peptide Synthesis, Pierce Chemical
Co., Rockford, Ill., 1984). Such polypeptides may be synthesized
with or without a methionine on the amino terminus. Chemically
synthesized Fhm polypeptides or fragments may be oxidized using
methods set forth in these references to form disulfide bridges.
Chemically synthesized Fhm polypeptides, fragments or derivatives
are expected to have comparable biological activity to the
corresponding Fhm polypeptides, fragments or derivatives produced
recombinantly or purified from natural sources, and thus may be
used interchangeably with recombinant or natural Fhm
polypeptide.
[0227] Another means of obtaining Fhm polypeptide is via
purification from biological samples such as source tissues and/or
fluids in which the Fhm polypeptide is naturally found. Such
purification can be conducted using methods for protein
purification as described above. The presence of the Fhm
polypeptide during purification may be monitored, for example,
using an antibody prepared against recombinantly produced Fhm
polypeptide or peptide fragments thereof.
[0228] A number of additional methods for producing nucleic acids
and polypeptides are known in the art, and the methods can be used
to produce polypeptides having specificity for Fhm. See for
example, Roberts et al., Proc. Natl. Acad. Sci. USA,
94:12297-12303, 1997, which describes the production of fusion
proteins between an mRNA and its encoded peptide. See also Roberts,
Curr. Opin. Chem. Biol., 3:268-273, 1999.
[0229] Additionally, U.S. Pat. No. 5,824,469 describes methods of
obtaining oligonucleotides capable of carrying out a specific
biological function. The procedure involves generating a
heterogeneous pool of oligonucleotides, each having a 5' randomized
sequence, a central preselected sequence, and a 3' randomized
sequence. The resulting heterogeneous pool is introduced into a
population of cells that do not exhibit the desired biological
function. Subpopulations of the cells are then screened for those
which exhibit a predetermined biological function. From that
subpopulation, oligonucleotides capable of carrying out the desired
biological function are isolated. U.S. Pat. Nos. 5,763,192,
5,814,476, 5,723,323, and 5,817,483 describe processes for
producing peptides or polypeptides. This is done by producing
stochastic genes or fragments thereof, and then introducing these
genes into host cells which produce one or more proteins encoded by
the stochastic genes. The host cells are then screened to identify
those clones producing peptides or polypeptides having the desired
activity.
[0230] Another method for producing peptides or polypeptides is
described in PCT/US98/20094 (WO99/15650) filed by Athersys, Inc.
Known as "Random Activation of Gene Expression for Gene Discovery"
(RAGE-GD), the process involves the activation of endogenous gene
expression or over-expression of a gene by in situ recombination
methods. For example, expression of an endogenous gene is activated
or increased by integrating a regulatory sequence into the target
cell which is capable of activating expression of the gene by
non-homologous or illegitimate recombination. The target DNA is
first subjected to radiation, and a genetic promoter inserted. The
promoter eventually locates a break at the front of a gene,
initiating transcription of the gene. This results in expression of
the desired peptide or polypeptide.
[0231] It will be appreciated that these methods can also be used
to create comprehensive IL-17 like protein expression libraries,
which can subsequently be used for high throughput phenotypic
screening in a variety of assays, such as biochemical assays.
cellular assays, and whole organism assays (e.g., plant, mouse,
etc.).
[0232] Proteins, Polypeptides, Fragments, Variants and Muteins of
Fhm:
[0233] Polypeptides of the invention include isolated Fhm
polypeptides and polypeptides related thereto including fragments,
variants, fusion polypeptides, and derivatives as defined
hereinabove.
[0234] Fhm fragments of the invention may result from truncations
at the amino terminus (with or without a leader sequence),
truncations at the carboxy terminus, and/or deletions internal to
the polypeptide. Most deletions and insertions, and substitutions
in particular, are not expected to produce radical changes in the
characteristics of the Fhm protein. However, when it is difficult
to predict the exact effect of the substitution, deletion, or
insertion in advance of doing so, one skilled in the art will
appreciate that the effect will be evaluated by routine screening
assays. For example, a variant typically is made by site-specific
mutagenesis of the Fhm-encoding nucleic acid, expression of the
variant nucleic acid in recombinant cell culture, and, optionally,
purification from the cell culture, for example, by immunoaffinity
adsorption on a polyclonal anti-Fhm antibody column (to absorb the
variant by binding it to at least one remaining immune epitope). In
preferred embodiments, truncations and/or deletions comprise about
10 amino acids, or about 20. amino acids, or about 50 amino acids,
or about 75 amino acids, or about 100 amino acids, or more than
about 100 amino acids. The polypeptide fragments so produced will
comprise about 25 contiguous amino acids, or about 50 amino acids,
or about 75 amino acids, or about 100 amino acids, or about 150
amino acids, or about 200 amino acids. Such Fhm polypeptides
fragments may optionally comprise an amino terminal methionine
residue.
[0235] Fhm polypeptide variants of the invention include one or
more amino acid substitutions, additions and/or deletions as
compared to SEQ ID NO: 4. In preferred embodiments, the variants
have from 1 to 3, or from 1 to 5, or from 1 to 10, or from 1 to 15,
or from 1 to 20, or from 1 to 25, or from 1 to 50, or from 1 to 75,
or from 1 to 100, or more than 100 amino acid substitutions,
insertions, additions and/or deletions, wherein the substitutions
may be conservative, as defined above, or non-conservative or any
combination thereof. More particularly, Fhm variants may comprise
the amino acid sequence set out as SEQ ID NO: 4, wherein one or
more amino acids from the group consisting of amino acids 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,
57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73,
74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,
91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105,
106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118,
119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131,
132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144,
145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157,
158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170,
171, 172, 173, 174, 175, 176 up to 251 is substituted with another
amino acid. The variants may have additions of amino acid residues
either at the carboxy terminus or at the amino terminus (with or
without a leader sequence).
[0236] Preferred Fhm polypeptide variants include glycosylation
variants wherein the number and/or type of glycosylation sites has
been altered compared to native Fhm polypeptide. In one embodiment,
Fhm variants comprise a greater or a lesser number of N-linked
glycosylation sites. A N-linked glycosylation site is characterized
by the sequence: Asn-X-Ser or Thr, where the amino acid residue
designated as X may be any type of amino acid except proline.
Substitution(s) of amino acid residues to create this sequence
provides a potential new site for addition of a N-linked
carbohydrate chain. Alternatively, substitutions to eliminate this
sequence will remove an existing N-linked carbohydrate chain. Also
provided is a rearrangement of N-linked carbohydrate chains wherein
one or more N-linked glycosylation sites (typically those that are
naturally occurring) are eliminated and one or more new N-linked
sites are created.
[0237] One skilled in the art will be able to determine suitable
variants of the native Fhm polypeptide using well known techniques.
For example, one may be able to predict suitable areas of the
molecule that may be changed without destroying biological
activity. Also, one skilled in the art will realize that even areas
that may be important for biological activity or for structure may
be subject to conservative amino acid substitutions without
destroying the biological activity or without adversely affecting
the polypeptide structure.
[0238] For predicting suitable areas of the molecule that may be
changed without destroying activity, one skilled in the art may
target areas not believed to be important for activity. For
example, when similar polypeptides with similar activities from the
same species or from other species are known, one skilled in the
art may compare the amino acid sequence of Fhm polypeptide to such
similar polypeptides. After making such a comparison, one skilled
in the art would be able to determine residues and portions of the
molecules that are conserved among similar polypeptides. One
skilled in the art would know that changes in areas of the Fhm
molecule that are not conserved would be less likely to adversely
affect biological activity and/or structure. One skilled in the art
would also know that, even in relatively conserved regions, one
could have likely substituted chemically similar amino acids for
the naturally occurring residues while retaining activity (e.g.
conservative amino acid residue substitutions).
[0239] Also, one skilled in the art may review structure-function
studies identifying residues in similar polypeptides that are
important for activity or structure. In view of such a comparison,
one skilled in the art can predict the importance of amino acid
residues in Fhm that correspond to amino acid residues that are
important for activity or structure in similar polypeptides. One
skilled in the art may opt for chemically similar amino acid
substitutions for such predicted important amino acid residues of
Fhm.
[0240] If available, one skilled in the art can also analyze the
crystal structure and amino acid sequence in relation to that
structure in similar polypeptides. In view of that information, one
skilled in the art may be able to predict the alignment of amino
acid residues of Fhm polypeptide with respect to its three
dimensional structure. One skilled in the art may choose not to
make radical changes to amino acid residues predicted to be on the
surface of the protein, since such residues may be involved in
important interactions with other molecules.
[0241] Moreover, one skilled in the art can generate test variants
containing a single amino acid substitution at each amino acid
residue. The variants can be screened using activity assays
disclosed in this application. Such variants are used to gather
information about suitable variants. For example, if one discovered
that a change to a particular amino acid residue resulted in
destroyed activity, variants with such a change would be avoided.
Thus, based on information gathered from such experiments, when
attempting to find additional acceptable variants, one skilled in
the art can determine the amino acids where further substitutions
should be avoided either alone or in combination with other
mutations.
[0242] Fhm polypeptide analogs of the invention can be determined
by comparing the amino acid sequence of Fhm polypeptide with
related family members. Exemplary Fhm polypeptide related family
members include, but are not limited to, the TNF-.alpha.,
TNK-.beta., LyT-.beta., FasL, CD40L, CD30L, OPGL, and TRAIL. This
comparison can be accomplished by using a Pileup alignment
(Wisconsin GCG Program Package) or an equivalent (overlapping)
comparison with multiple family members within conserved and
non-conserved regions.
[0243] As shown in FIG. 1, the predicted amino acid sequence of Fhm
polypeptide (SEQ ID NO: 4) is aligned with the corresponding
regions of human FasL, mouse FasL, rat FasL, human CD40L, mouse
CD40L, mouse OPGL, human OPGL, human TRAIL, mouse TRAIL, human
CD30L, human CD30L, human LyT-.beta., mouse LyT-.beta., human
TNF-.beta., mouse TNF-.beta., human TNF-.alpha. and mouse
TNF-.alpha.. (SEQ ID NOS: 5-21). Other Fhm polypeptide analogs can
be determined using these or other methods known to those of skill
in the art. These overlapping sequences provide guidance for
conservative and non-conservative amino acids substitutions
resulting in additional Fhm analogs. It will be appreciated that
these amino acid substitutions can consist of naturally occurring
or non-naturally occurring amino acids. For example, as depicted in
FIG. 1, alignment of the B/B' loop and D/E loop of these ligands
indicates potential Fhm analogs may have the Val residue at
position 153 substituted with a Ile, Met, Leu, Phe, Ala or
Norleucine residue, the Tyr residue at position 147 may be
substituted with, or the Phe residue at position 154 may be
substituted with Leu, Val, Ile, Ala, or Tyr residue. Further, .the
Ser residue at position 151 may be substituted with Thr, Ala, or
Cys, the Gly residue at 145 may be substituted with Pro or Ala, and
the Tyr at position 150 may be substituted with Trp, Phe, Thr or
Ser.
[0244] Fhm fusion polypeptides of the invention comprise Fhm
polypeptides, fragments, variants, or derivatives fused to one or
more heterologous peptides or proteins. Heterologous peptides and
proteins include, but are not limited to, an epitope to allow for
detection and/or isolation of a Fhm fusion polypeptide, a
transmembrane receptor protein or a portion thereof, such as an
extracellular domain, or a transmembrane, a ligand or a portion
thereof which binds to a transmembrane receptor protein, an enzyme
or portion thereof which is catalytically active, a protein or
peptide which promotes oligomerization, such as leucine zipper
domain, and a protein or peptide which increase stability, such as
an immunoglobulin constant region. A Fhm polypeptide may be fused
to itself or to a fragment, variant, or derivative thereof. Fusions
may be made either at the amino terminus or at the carboxy terminus
of a Fhm polypeptide, and may be direct with no linker or adapter
molecule or may be through a linker or adapter molecule, such as
one or more amino acid residues up to about 20 amino acids
residues, or up to about 50 amino acid residues. Alternatively, the
Fhm fusion protein may comprise one or two Fhm polypeptides
covalently linked to one or two TNF ligand polypeptide(s), or a
member of the TNF ligand family or a cytokine receptor such as
interleukin-1 (IL-1) polypeptide. The ligands preferably are
produced as fusion proteins using recombinant DNA technology. A
linker or adapter molecule may also be designed with a cleavage
site for a DNA restriction endonuclease or for proteolytic cleavage
to allow for separation and subsequent folding of the fused
moieties.
[0245] Also envisioned as a part of the invention are circularly
permuted structural analogs of the Fhm polypeptide.
[0246] The development of recombinant DNA methods has made it
possible to study the effects of sequence transposition on protein
folding, structure and function. The approach used in creating new
sequences resembles that of naturally occurring pairs of proteins
that are related by linear reorganization of their amino acid
sequences (Cunningham, et al., Proc. Natl. Acad. Sci. U.S.A.
76:3218-3222, 1979; Teather & Erfle, J. Bacteriol.
172:3837-3841, 1990; Schimming et al., Eur. J. Biochem. 204:13-19,
1992; Yamiuchi and Minamikawa, FEBS Lett 260:127-130, 1991;
MacGregor et al., FEBS Lett. 378:263-266, 1996). The first in vitro
application of this type of rearrangement to proteins was described
by Goldenberg and Creighton (J. Mol. Biol. 165:407-413, 1983). A
new N-terminus is selected at an internal site (breakpoint) of the
original sequence, the new sequence having the same order of amino
acids as the original from the breakpoint until it reaches an amino
acid that is at or near the original C-terminus. At this point the
new sequence is joined, either directly or through an additional
portion of sequence (linker), to an amino acid that is at or near
the original N-terminus, and the new sequence continues with the
same sequence as the original until it reaches a point that is at
or near the amino acid that was N-terminal to the breakpoint site
of the original sequence, this residue forming the new C-terminus
of the chain.
[0247] This approach has been applied to proteins which range in
size from 58 to 462 amino acids (Goldenberg & Creighton, J.
Mol. Biol. 165:407-413, 1983; Li & Coffino, Mol. Cell. Biol.
13:2377-2383, 1993). The proteins examined have represented a broad
range of structural classes, including proteins that contain
predominantly .alpha.-helix (interleukin-4; Kreitman et al.,
Cytokine 7:311-318, 1995), predominantly .beta.-sheet
(interleukin-1; Horlick et al., Protein Eng. 5:427-431, 1992), or
mixtures of the two (yeast phosphoribosyl anthranilate isomerase;
Luger et al., Science 243:206-210, 1989).
[0248] In a preferred embodiment, a Fhm polypeptide, fragment,
variant and/or derivative is fused to an Fc region of human IgG. In
one example, a human IgG hinge, CH2 and CH3 region may be fused at
either the N-terminus or C-terminus of the Fhm polypeptides using
methods known to the skilled artisan. In another example, a portion
of a hinge regions and CH2 and CH3 regions may be fuse. The Fhm
Fc-fusion polypeptide so produced may be purified by use of a
Protein A affinity column (Pierce, Rockford, Ill.). In addition,
peptide and proteins fused to an Fc region have been found to
exhibit a substantially greater half-life in vivo than the unfused
counterpart. Also, a fusion to an Fc region allows for
dimerization/multimerization of the fusion polypeptide. The Fc
region may be naturally occurring Fc region, or may be altered to
improve certain qualities such as therapeutic qualities,
circulation time, reduce aggregation, etc.
[0249] Fhm polypeptide derivatives are also included in the scope
of the present invention. Covalent modifications of the Fhm
proteins of the present invention are included within the scope of
this invention. Variant Fhm proteins may be conveniently prepared
by in vitro synthesis. Such modifications may be introduced into
the molecule by reacting targeted amino acid residues of the
purified or crude protein with an organic derivatizing agent that
is capable of reacting with selected side chains or terminal
residues. The resulting covalent derivatives are useful in programs
directed at identifying residues important for biological
activity.
[0250] Cysteinyl residues most commonly are reacted with
.alpha.-haloacetates (and corresponding amines), such as
chloroacetic acid or chloroacetamide, to give carboxymethyl or
carbocyamidomethyl derivatives. Cysteinyl residues also are
derivatized by reaction with bromotrifluoroacetone,
.alpha.-bromo-.beta.(5-imidozoyl)propionic acid, chloroacetyl
phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl
2-pyridyl disulfide, p-chloromercuribenzoate,
2-chloromercuri-4-nitrophenol,
orchloro-7-nitrobenzo-2-oxa-1,3-diazole.
[0251] Histidyl residues are derivatized by reaction with
diethylprocarbonate at pH 5.5-7.0 because this agent is relatively
specific for the histidyl side chain. Para-bromophenacyl bromide
also is useful; the reaction is preferably performed in 0.1M sodium
cacodylate at pH 6.0.
[0252] Lysinyl and amino terminal residues are reacted with
succinic or carboxylic acid anhydrides. Derivatization with these
agents has the effect of reversing the charge of the lysinyl
residues. Other suitable reagents for derivatizing
.alpha.-amino-containing residues include imidoesters such as
methyl picolinimidate; pyridoxal phosphate; pyridoxal;
chloroborohydride; trinitrobenzenesulfonic acid; O-methylissurea;
2,4 pentanedione; and transaminase catalyzed reaction with
glyoxylate.
[0253] Arginyl residues are modified by reaction with one or
several conventional reagents, among them phenylglyoxal,
2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin.
Derivatization of arginine residues requires that the reaction be
performed in alkaline conditions because of the high pK.sub.a of
the guanidine functional group. Furthermore, these reagents may
react with the groups of lysine as well as the arginine
Epsilon-amino group.
[0254] The specific modification of tyrosyl residues per se has
been studied extensively, with particular interest in introducing
spectral labels into tyrosyl residues by reaction with aromatic
diazonium compounds or tetranitromethane. Most commonly,
N-acetylimidizol and tetranitromethane are used to form O-acetyl
tyrosyl species and 3-nitro derivatives, respectively. Tyrosyl
residues are iodinated using .sup.125I or .sup.131I to prepare
labeled proteins for use in radioimmunoassay, the chloramine T
method described above being suitable.
[0255] Carboxyl side groups (aspartyl or glutamyl) are selectively
modified by reaction with carbodiimides (R.sup.1) such as
1-cyclohexyl-3-(2-morpholinyl-(4-ethyl) carbodiimide or 1-ethyl-3
(4 azonia 4,4-dimethylpentyl) carbodiimide. Furthermore, aspartyl
and glutamyl residues are converted to asparaginyl and glutaminyl
residues by reaction with ammonium ions.
[0256] Derivatization with bifunctional agents is useful for
crosslinking the Fhm protein(s)/polypeptide to water-insoluble
support matrixes or surfaces for use in the method for cleaving the
Fhm protein fusion polypeptide to release and recover the cleaved
polypeptide. Commonly used crosslinking agents include, e.g.,
1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde,
N-hydroxysuccinimide esters, for example, esters with
4-azidosalicylic acid, homo-bifunctional imidoesters, including
disuccinimidyl esters such as
3,3'-dithiiobis(succinimidylpropioonate), and bifunctional
maleimides such as bix-N-maleimido-1,8-octane. Derivatizing agents
such as methyl-3-[p-azidophenyl) dithio]propioimidate yield
photoactivatable intermediates that are capable of forming cross
links in the presence of light. Alternatively, reactive
water-insoluble matrices such as cyanogen bromide-activated
carbohydrates and the reactive substrates described in U.S. Pat.
Nos. 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537; and
4,330,440, incorporated herein by reference, are employed for
protein immobilization.
[0257] Glutaminyl and asparaginyl residues are frequently
deamidated to the corresponding glutamyl and aspartyl residues.
Alternatively, these residues are deamidated under mildly acidic
conditions. Either form of these residues falls within the scope of
this invention.
[0258] Other modifications include hydroxylation of proline and
lysine, phosphorylation of hydroxyl groups of seryl or theonyl
residues, methylation of the .alpha.-amino groups of lysine,
arginine, and histidine side chains (T. E. Creighton, Proteins:
Structure and Molecule Properties, W. H. Freeman & Co., San
Francisco, pp. 79-86,1983), acetylation of the N-terminal amine,
and, in some instances, amidation of the C-terminal carboxyl
groups. Such derivatives are chemically modified Fhm polypeptide
compositions in which Fhm polypeptide is linked to a polymer. The
polymer selected is typically water soluble so that the protein to
which it is attached does not precipitate in an aqueous
environment, such as a physiological environment. The polymer
selected is usually modified to have a single reactive group, such
as an active ester for acylation or an aldehyde for alkylation, so
that the degree of polymerization may be controlled as provided for
in the present methods. The polymer may be of any molecular weight,
and may be branched or unbranched. Included within the scope of the
Fhm polypeptide polymers is a mixture of polymers. Preferably, for
therapeutic use of the end-product preparation, the polymer will be
pharmaceutically acceptable.
[0259] The polymers each may be of any molecular weight and may be
branched or unbranched. The polymers each typically have an average
molecular weight of between about 2 k kDa to about 100 kDa (the
term "about" indicating that in preparations of a water soluble
polymer, some molecules will weigh more, some less, than the stated
molecular weight). The average molecular weight of each polymer is
between about 5 kDa and 5 kDa, about 50 kDa, more preferably
between about 12 kDa to about 40 kDa and most preferably between
about 20 kDa to about 35 kDa.
[0260] Suitable water soluble polymers or mixtures thereof include,
but are not limited to, N-linked or O-linked carbohydrates, sugars,
phosphates, carbohydrates; sugars; phosphates; polyethylene glycol
(PEG) (including the forms of PEG that have been used to derivatize
proteins, including mono-(C1-C10) alkoxy- or aryloxy-polyethylene
glycol); monomethoxy-polyethylene glycol; dextran (such as low
molecular weight dextran, of, for example about 6 kD), cellulose;
cellulose; other carbohydrate-based polymers, poly-(N-vinyl
pyrrolidone) polyethylene glycol, propylene glycol homopolymers, a
polypropylene oxide/ethylene oxide co-polymer, polyoxyethylated
polyols (e.g., glycerol) and polyvinyl alcohol. Also encompassed by
the present invention are bifunctional crosslinking molecules which
may be used to prepare covalently attached multimers of the
polypeptide comprising the amino acid sequence of SEQ ID NO: 4 or
an Fhm polypeptide variant.
[0261] In general, chemical derivatization may be performed under
any suitable condition used to react a protein with an activated
polymer molecule. Methods for preparing chemical derivatives of
polypeptides will generally comprise the steps of (a) reacting the
polypeptide with the activated polymer molecule (such as a reactive
ester or aldehyde derivative of the polymer molecule) under
conditions whereby the polypeptide comprising the amino acid
sequence of SEQ ID NO: 4, or an Fhm polypeptide variant becomes
attached to one or more polymer molecules, and (b) obtaining the
reaction product(s). The optimal reaction conditions will be
determined based on known parameters and the desired result. For
example, the larger the ratio of polymer molecules:protein, the
greater the percentage of attached polymer molecule. In one
embodiment, the Fhm polypeptide derivative may have a single
polymer molecule moiety at the amino terminus. (See, e.g., U.S.
Pat. No. 5,234,784).
[0262] A particularly preferred water-soluble polymer for use
herein is polyethylene glycol, abbreviated PEG. As used herein,
polyethylene glycol is meant to encompass any of the forms of PEG
that have been used to derivatize other proteins, such as
mono-(C1-C10) alkoxy- or aryloxy-polyethylene glycol. PEG is a
linear or branched neutral polyether, available in a broad range of
molecular weights, and is soluble in water and most organic
solvants. PEG is effective at excluding other polymers or peptides
when present in water, primarily through its high dynamic chain
mobility and hydrophibic nature, thus creating a water shell or
hydration sphere when attached to other proteins or polymer
surfaces. PEG is nontoxic, non-immunogenic, and approved by the
Food and Drug Administration for internal consumption.
[0263] Proteins or enzymes when conjugated to PEG have demonstrated
bioactivity, non-antigenic properties, and decreased clearance
rates when administered in animals. F. M. Veronese et al.,
Preparation and Properties of Monomethoxypoly, (ethylene
glyco.)-modified Enzymes for Therapeutic Applications, in J. M.
Harris ed., Poly(Ethylene Clycol) Chemistry--Biotechnical and
Biomedical Applications 127-36, 1992, incorporated herein by
reference. This is due to the exclusion properties of PEG in
preventing recognition by the immune system. In addition, PEG has
been widely used in surface modification procedures to decrease
protein adsorption and improve blood compatibility. S. W. Kim et
al., Ann. N.Y. Acad. Sci. 516: 116-30 1987; Jacobs et al., Artif.
Organs 12: 500-501, 1988; Park et al., J. Poly. Sci, Part A
29:1725-31, 1991, incorporated herein by reference. Hydrophobic
polymer surfaces, such as polyurethanes and polystyrene were
modified by the grafting of PEG (MW 3,400) and employed as
nonthrombogenic surfaces. In these studies, surface properties
(contact angle) were more consistent with hydrophilic surfaces due
to the hydrating effect of PEG. More importantly, protein (albumin
and other plasma proteins) adsorption was greatly reduced,
resulting from the high chain motility, hydration sphere, and
protein exclusion properties of PEG.
[0264] PEG (MW 3,4000) was determined as an optimal size in surface
immobilization studies, Park et al., J. Biomed. Mat. Res.
26:739-45, 1992. while PEG (MW 5,000) was most beneficial in
decreasing protein antigenicity. (F. M. Veronese et al., In J. M.
Harris et., Poly(Ethlene Glycol) Chemistry--Biotechnical and
Biomedical Applications 127-36, supra., incorporated herein by
reference)
[0265] In general, chemical derivatization may be performed under
any suitable conditions used to react a biologically active
substance with an activated polymer molecule. Methods for preparing
pegylated Fhm polypeptides will generally comprise the steps of (a)
reacting the polypeptide with polyethylene glycol (such as a
reactive ester or aldehyde derivative of PEG) under conditions
whereby Fhm polypeptide becomes attached to one or more PEG groups,
and (b) obtaining the reaction product(s). In general, the optimal
reaction conditions for the acylation reactions will be determined
based on known parameters and the desired result. For example, the
larger the ratio of PEG: protein, the greater the percentage of
poly-pegylated product.
[0266] In a preferred embodiment, the Fhm polypeptide derivative
will have a single PEG moiety at the N terminus. See U.S. Pat. No.
8,234,784, herein incorporated by reference.
[0267] Generally, conditions which may be alleviated or modulated
by administration of the present Fhm polypeptide derivative include
those described herein for Fhm polypeptides. However, the Fhm
polypeptide derivative disclosed herein may have additional
activities, enhanced or reduced biological activity, or other
characteristics, such as increased or decreased half-life, as
compared to the non-derivatized molecules.
[0268] Genetically Engineered Non-Human Animals
[0269] Additionally included within the scope of the present
invention are non-human animals such as mice, rats, or other
rodents, rabbits, goats, or sheep, or other farm animals, in which
the gene (or genes) encoding the native Fhm polypeptide has (have)
been disrupted ("knocked out") such that the level of expression of
this gene or genes is(are) significantly decreased or completely
abolished. Such animals may be prepared using techniques and
methods such as those described in U.S. Pat. No. 5,557,032.
[0270] The present invention further includes non-human animals
such as mice, rats, or other rodents, rabbits, goats, sheep, or
other farm animals, in which either the native form of the Fhm
gene(s) for that animal or a heterologous Fhm gene(s) is (are)
over-expressed by the animal, thereby creating a "transgenic"
animal. Such transgenic animals may be prepared using well
knownwell-known methods such as those described in U.S. Pat. No.
5,489,743 and PCT application No. WO94/28122.Application No. WO
94/28122.
[0271] The present invention further includes non-human animals in
which the promoter for one or more of the Fhm polypeptides of the
present invention is either activated or inactivated (e.g., by
using homologous recombination methods) to alter the level of
expression of one or more of the native Fhm polypeptides.
[0272] These non-human animals may be used for drug candidate
screening. In such screening, the impact of a drug candidate on the
animal may be measured; for example, drug candidates may decrease
or increase the expression, of the Fhm gene. In certain
embodiments, the amount of Fhm polypeptide, that is produced may be
measured after the exposure of the animal to the drug candidate.
Additionally, in certain embodiments, one may detect the actual
impact of the drug candidate on the animal. For example, the
overexpression of a particular gene may result in, or be associated
with, a disease or pathological condition. In such cases, one may
test a drug candidate's ability to decrease expression of the gene
or its ability to prevent or inhibit a pathological condition. In
other examples, the production of a particular metabolic product
such as a fragment of a polypeptide, may result in, or be
associated with, a disease or pathological condition. In such
cases, one may test a drug candidate's ability to decrease the
production of such a metabolic product or its ability to prevent or
inhibit a pathological condition.
[0273] Microarray
[0274] It will be appreciated that DNA microarray technology can be
utilized in accordance with the present invention. DNA microarrays
are miniature, high density arrays of nucleic acids positioned on a
solid support, such as glass. Each cell or element within the array
has numerous copies of a single species of DNA which acts as a
target for hybridization for its cognate mRNA. In expression
profiling using DNA microarray technology, mRNA is first extracted
from a cell or tissue sample and then converted enzymatically to
fluorescently labeled cDNA. This material is hybridized to the
microarray and unbound cDNA is removed by washing. The expression
of discrete genes represented on the array is then visualized by
quantitating the amount of labeled cDNA which is specifically bound
to each target DNA. In this way, the expression of thousands of
genes can be quantitated in a high throughput, parallel manner from
a single sample of biological material.
[0275] This high throughput expression profiling has a broad range
of applications with respect to the Fhm molecules of the invention,
including, but not limited to: the identification and validation of
Fhm disease-related genes as targets for therapeutics; molecular
toxicology of Fhm molecules and inhibitors thereof, stratification
of populations and generation of surrogate markers for clinical
trials; and enhancing Fhm-related small molecule drug discovery by
aiding in the identification of selective compounds in high
throughput screens (HTS).
[0276] Selective Binding Agents
[0277] As used herein, the term "selective binding agent" refers to
a molecule which has specificity for one or more Fhm polypeptides.
Suitable selective binding agents include, but are not limited to,
antibodies and derivatives thereof, polypeptides, and small
molecules. Suitable selective binding agents may be prepared using
methods known in the art. An exemplary Fhm polypeptide selective
binding agent of the present invention is capable of binding a
certain portion of the Fhm polypeptide thereby inhibiting the
binding of the polypeptide to the Fhm polypeptide receptor(s).
[0278] Selective binding agents such as antibodies and antibody
fragments that bind Fhm polypeptides are within the scope of the
present invention. The antibodies may be polyclonal including
monospecific polyclonal, monoclonal (mAbs), recombinant, chimeric,
humanized such as CDR-grafted, human, single chain, and/or
bispecific, as well as fragments, variants or derivatives thereof.
Antibody fragments include those portions of the antibody which
bind to an epitope on the Fhm polypeptide. Examples of such
fragments include Fab and F(ab') fragments generated by enzymatic
cleavage of full-length antibodies. Other binding fragments include
those generated by recombinant DNA techniques, such as the
expression of recombinant plasmids containing nucleic acid
sequences encoding antibody variable regions.
[0279] Polyclonal antibodies directed toward a Fhm polypeptide
generally are produce in animals (e.g. rabbits or mice) by means of
multiple subcutaneous or intraperitoneal injections of Fhm and an
adjuvant. It may be useful to conjugate a Fhm polypeptide, or a
variant, fragment or derivative thereof to a carrier protein that
is immunogenic in the species to be immunized, such as keyhole
limpet heocyanin, serum, albumin, bovine thyroglobulin, or soybean
trypsin inhibitor. Also, aggregating agents such as alum are used
to enhance the immune response. After immunization, the animals are
bled and the serum is assayed for anti-Fhm antibody titer.
[0280] Monoclonal antibodies directed toward Fhm are produced using
any method which provides for the production of antibody molecules
by continuous cell lines in culture. Examples of suitable methods
for preparing monoclonal antibodies include the hybridoma method of
Kohler et al., Nature 256: 495-497, 1975, and the human B-cell
hybridoma method, Kozbor, J. Immunol. 133: 3001, 1984; Brodeur et
al., Monoclonal Antibody Production Techniques and Applications,
pp. 51-63 (Marcel Dekker, Inc., New York, 1987).
[0281] Also provided by the invention are hybridoma cell lines
which produce monoclonal antibodies reactive with Fhm
polypeptides.
[0282] Monoclonal antibodies of the invention may be modified for
use as therapeutics. One embodiment is a "chimeric" antibody in
which a portion of the heavy and/or light chain is identical with
or homologous to corresponding sequence in antibodies derived from
a particular species or belonging to a particular antibody class or
subclass. while the remainder of the chain(s) is/are identical with
or a homologous to corresponding sequence in antibodies derived
from another species or belonging to another antibody class or
subclass. Also included are fragments of such antibodies, so long
as they exhibit the desired biological activity (see U.S. Pat. No.
4,816,567; Morrison, et al., Proc. Natl. Acad. Sci. U.S.A. 81:
6851-6855, 1985; incorporated herein by reference).
[0283] In another embodiment, a monoclonal antibody of the
invention is a "humanized" antibody. Methods for humanizing
non-human antibodies are well known in the art (see U.S. Pat. No.
5,585,089 and 5,693,762). Generally, a humanized antibody has one
or more amino acid residues introduced into it from a source which
is non-human. Humanization can be performed, for example, methods
described in the art (Jones et al., Nature 321: 522-525, 1986;
Riechmann et al., Nature, 332: 323-327, 1988; Verhoeyen et al.,
Science 239: 1534-1536, 1988), by substituting at least a portion
of a rodent complementarity-determining region (CDR) for the
corresponding regions of a human antibody.
[0284] Also encompassed by the invention are fully human antibodies
which bind Fhm polypeptides, fragments, variants and/or
derivatives. Such antibodies are produced by immunization with a
Fhm antigen optionally conjugated to a carrier (i.e., at least
having 6 contiguous amino acids). Using transgenic animals (e.g.,
mice) that are capable of producing a repertoire of human
antibodies in the absence of endogenous immunoglobulin production.
See, for example, Jakobovits, et al., Proc. Natl. Acad. Sci. U.S.A.
90: 2551-2555, 1993; Jakobovits, et al., Nature 362: 255-258, 1993;
Bruggermann, et al., Year in Immuno. 7:33, 1993. In one method,
such transgenic animals are produced by incapacitating the
endogenous loci encoding the heavy and light immunoglobulin chains
therein, and inserting loci encoding human heavy and light chain
proteins into the genome thereof. Partially modified animals, that
is those having less than the full complement of modifications, are
then cross-bred to obtain an animal having all of the desired
immune system modifications. When administered an immunogen, these
transgenic animals produce antibodies with human (rather than e.g.,
murine) amino acid sequences, including variable regions which are
immunospecific for these antigens. See PCT Application Nos.
PCT/US96/05928 and PCT/US93/06926. Additional methods are described
in U.S. Pat. No. 5,545,807, PCT application Nos. PCT/US91/245,
PCT/GB89/01207, and in EP 546073B1 and EP 546073A1. Human
antibodies may also be produced by the expression of recombinant
DNA in host cells or by expression in hybridoma cells as described
herein.
[0285] In an alternative embodiment, human antibodies can be
produced in phage-display libraries (Hoogenboom, et al., J. Mol.
Biol. 227:381, 1991; Marks, et al., J. Mol. Biol. 222:581, 1991.
These processes mimic immune selection through the display of
antibody repertoires on the surface of filamentous bacteriophage,
and subsequent selection of phage by their binding to an antigen of
choice. One such technique is described in PCT Application No.
PCT/US98/17364, which describes the isolation of high affinity and
functional agonistic antibodies for MPL- and msk-receptors using
such an approach.
[0286] Chimeric, CDR grafted, and humanized antibodies are
typically produced by recombinant methods. Nucleic acids encoding
the antibodies are introduced into host cells and expressed using
materials and procedures described herein. In a preferred
embodiment, the antibodies are produced in mammalian host cells,
such as CHO cells. Monoclonal (e.g., human) antibodies may be
produced by the expression of recombinant DNA in host cells or by
expression in hybridoma cells as described herein.
[0287] The anti-Fhm antibodies of the invention may be employed in
any known assay method, such as competitive binding assays, direct
and indirect sandwich assays, and immunoprecipitation assays (Sola,
Monoclonal Antibodies: A Manual of Techniques, pp. 147-158 (CRC
Press, Inc., 1987)) for the detection and quantitation of Fhm
polypeptides. The antibodies will bind Fhm polypeptides with an
affinity which is appropriate for the assay method being
employed.
[0288] For diagnostic applications, in certain embodiments anti-Fhm
antibodies typically may be labeled with a detectable moiety. The
detectable moiety can be any one which is capable of producing,
either directly or indirectly, a detectable signal. For example,
the detectable moiety may be a radioisotope, such as .sup.3H,
.sup.14C, .sup.32P, .sup.35S, or .sup.125I, a fluorescent or
chemiluminescent compound, such as fluorescein isothiocyanate,
rhodamine, or luciferin; or an enzyme, such as alkaline
phosphatase, .beta.-galactosidase, or horseradish peroxidase. See
Bayer, et al., Meth. Enz. 184: 138-163, 1990.
[0289] The anti-Fhm antibodies of the invention may be employed in
any known assay method, such as competitive binding assays, direct
and indirect sandwich assays, and immunoprecipitation assays (Sola,
Monoclonal Antibodies: A Manual of Techniques, pp. 147-158 (CRC
Press, Inc., 1987)) for detection and quantitation of Fhm
polypeptides. The antibodies will bind Fhm polypeptides with an
affinity which is appropriate for the assay method being
employed.
[0290] The activity of the cell lysate or purified Fhm protein
variant is then screened in a suitable screening assay for the
desired characteristic. For example, a change in the binding
affinity for a ligand or immunological character of the Fhm
protein, such as affinity for a given antibody, is measured by a
competitive type immunoassay. Changes in immunomodulation activity
are measured by the appropriate assay. Modifications of such
protein properties as redox or thermal stability hydrophobicity,
susceptibility to proteolytic degradation or the tendency to
aggregate with carriers or into multimers are assayed by methods
well known to the ordinarily skilled artisan. Competitive binding
assays rely on the ability of a labeled standard (e.g., a Fhm
polypeptide, or an immunologically reactive portion thereof) to
compete with the test sample analyte (a Fhm polypeptide) for
binding with a limited amount of antibody. The amount of a Fhm
polypeptide in the test sample is inversely proportional to the
amount of standard that becomes bound to the antibodies. To
facilitate determining the amount of standard that becomes bound,
the antibodies typically are insolubilized before or after the
competition, so that the standard and analyte that are bound to the
antibodies may conveniently be separated from the standard and
analyte which remain unbound.
[0291] Sandwich imuno-assays typically involve the use of two
antibodies, each capable of binding to a different immunogenic
portion, or epitope, of the protein to be detected and/or
quantitated. In a sandwich assay, the test sample analyte typically
is bound by a first antibody which is immobilized on a solid
support, and thereafter a second antibody binds to the analyte,
thus forming an insoluble three-part complex. See e.g., U.S. Pat.
No. 4,376,110. The second antibody may itself be labeled with a
detectable moiety (direct sandwich assays) or may be measured using
an anti-immunoglobulin antibody that is labeled with a detectable
moiety (indirect sandwich assays). For example, one type of
sandwich assay is an enzyme linked immunosorbant assay (ELISA), in
which case the detectable moiety is an enzyme.
[0292] The selective binding agents, including anti-Fhm antibodies,
are also useful for in vivo imaging. An antibody labeled with a
detectable moiety may be administered to an animal, preferably into
the bloodstream, and the presence and location of the labeled
antibody in the host is assayed. The antibody may be labeled with
any moiety that is detectable in an animal, whether by nuclear
magnetic resonance, radiology, or other detection means known in
the art.
[0293] Selective binding agents, including antibodies of the
invention, may be used as therapeutics. These therapeutic
antibodies are generally agonists or antagonists, in that they
either enhance or reduce, respectively, at least one of the
biological activities of a Fhm polypeptide. In one embodiment,
antagonist antibodies of the invention are antibodies or binding
fragments thereof which are capable of specifically binding to a
Fhm polypeptide, fragment, variant and/or derivative, and which are
capable of inhibiting or eliminating the functional activity of a
Fhm polypeptide in vivo or in vitro. In preferred embodiments, an
antagonist antibody will inhibit the functional activity of a Fhm
polypeptide at least about 50%, preferably at least about 80%, more
preferably 90%, and most preferably 100%. In another embodiment,
the selective binding agent may be an antibody that is capable of
interacting with an Fhm binding partner (e.g., receptor) thereby
inhibiting or eliminating Fhm activity in vitro or in vivo.
Selective binding agents, including agonist and antagonist anti-Fhm
antibodies, are identified by screening assays which are well known
in the art.
[0294] The invention also relates to a kit comprising Fhm selective
binding agents (such as antibodies) and other reagents useful for
detecting Fhm polypeptide levels in biological samples. Such
reagents may include, a detectable label, blocking serum, positive
and negative control samples, and detection reagents.
[0295] The Fhm polypeptides of the present invention can be used to
clone Fhm receptors, using an expression cloning strategy.
Radiolabeled (.sup.125Iodine) Fhm polypeptide or
affinity/activity-tagged Fhm polypeptide (such as an Fc fusion or
an alkaline phosphatase fusion) can be used in binding assays to
identify a cell type or cell line or tissue that expresses Fhm
receptor(s). RNA isolated from such cells or tissues can be
converted to cDNA, cloned into a mammalian expression vector, and
transfected into mammalian cells (such as COS or 293 cells) to
create an expression library. A radiolabeled or tagged Fhm
polypeptide can then be used as an affinity ligand to identify and
isolate from this library the subset of cells which express the Fhm
receptor(s) on their surface. DNA can then be isolated from these
cells and transfected into mammalian cells to create a secondary
expression library in which the fraction of cells expressing Fhm
receptor(s) is many-fold higher than in the original library. This
enrichment process can be repeated iteratively until a single
recombinant clone containing an Fhm receptor is isolated. Isolation
of the Fhm receptor(s) is useful for identifying or developing
novel agonists and antagonists of the Fhm polypeptide signaling
pathway. Such agonists and antagonists include soluble Fhm
receptor(s), anti-Fhm receptor antibodies, small molecules, or
antisense oligonucleotides, and they may be used for treating,
preventing, or diagnosing one or more disease or disorder,
including those described herein.
[0296] Diagnostic Kits and Reagents
[0297] This invention also contemplates use of Fhm proteins,
fragments thereof, peptides, binding compositions, and their fusion
products in a variety of diagnostic kits and methods for detecting
the presence of receptors and/or antibodies. Typically the kit will
have a compartment containing a Fhm peptide or gene segment or a
reagent which recognizes one or the other, e.g., binding
reagents.
[0298] A kit for determining the binding affinity of a binding
partner or a test compound to the Fhm would typically comprise a
binding partner test compound; a labeled compound, for example an
antibody having known binding affinity for the protein; or a source
of binding partner (naturally occurring or recombinant), and a
means for separating bound from free labeled compound, such as a
solid phase for immobilizing the ligand or its binding partner.
Once compounds are screened, those having suitable binding affinity
to the ligand or its binding partner can be evaluated in suitable
biological assays, as are well known in the art, to determine
whether they act as agonists or antagonists of Fhm activity. The
availability of recombinant Fhm and/or receptor polypeptides also
provide well defined standards for calibrating such assays or as
positive control samples.
[0299] A preferred kit for determining the concentration of, for
example. Fhm-ligand and/or its cognate binding partner in a sample
would typically comprise a labeled compound, e.g., antibody, having
known binding affinity for the target, a source of ligand or
receptor (naturally occurring or recombinant), and a means for
separating the bound from free labeled compound, for example, a
solid phase for immobilizing the ligand or receptor. Compartments
containing reagents, and instructions for use or disposal, will
normally be provided.
[0300] Antibodies, including antigen binding fragments, specific
for the ligand or receptor, or fragments are useful in diagnostic
applications to detect the presence of elevated levels of ligand,
receptor, and/or its fragments. Such diagnostic assays can employ
lysates, live cells, fixed cells, immunofluorescence, cell
cultures, body fluids, and further can involve the detection of
antigens related to the ligand or receptor in serum, or the like.
Diagnostic assays may be homogeneous (without a separation step
between free reagent and antigen complex) or heterogeneous (with a
separation step). Various commercial assays exist, such as
radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA),
enzyme immunoassay (EIA), enzyme-multiplied immunoassay technique
(EMIT), substrate-labeled fluorescent immunoassay (SLFIA), and the
like. For example, unlabeled antibodies can be employed by using a
second antibody which is labeled and which recognizes the primary
antibody to a ligand or receptor or to a particular fragment
thereof. Similar assays have also been extensively discussed in the
literature. (See, e.g., Harlow and Lane (1988) Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory Press.)
[0301] Anti-idiotypic antibodies may have similar uses to diagnose
presence of antibodies against a ligand or receptor, as such may be
diagnostic of various abnormal states. For example, overproduction
of a ligand or receptor may result in production of various
immunological reactions which may be diagnostic of abnormal
physiological states, particularly in various inflammatory or
allergic conditions.
[0302] Frequently, the reagents for diagnostic assays are supplied
in kits, so as to optimize the sensitivity of the assay. For the
subject invention, depending upon the nature of the assay, the
protocol, and the label, either labeled or unlabeled antibody or
labeled ligand or receptor is provided. This is usually in
conjunction with other additives, such as buffers, stabilizers,
materials necessary for signal production such as substrates for
enzymes, and the like. Preferably, the kit will also contain
instructions for proper use and disposal of the contents after use.
Typically the kit has compartments or containers for each useful
reagent. Desirably, the reagents are provided as a dry lyophilized
powder, where the reagents may be reconstituted in an aqueous
medium providing appropriate concentrations of reagents for
performing the assay.
[0303] The aforementioned constituents of the drug screening and
the diagnostic assays may be used without modification or may be
modified in a variety of ways. For example, labeling may be
achieved by covalently or non-covalently joining a moiety which
directly or indirectly provides a- detectable signal. In any of
these assays, the ligand, test compound, receptor, or antibodies
thereto can be labeled either directly or indirectly. Possibilities
for direct labeling include label groups: radiolabels such as
.sup.125I, enzymes (U.S. Pat. No. 3,645,090) such as peroxidase and
alkaline phosphatase, and fluorescent labels (U.S. Pat. No.
3,940,475) capable of monitoring the change in fluorescence
intensity, wavelength shift, or fluorescence polarization.
Possibilities for indirect labeling include biotinylation of one
constituent followed by binding to avidin coupled to one of the
above label groups.
[0304] There are also numerous methods of separating bound from the
free ligand, or alternatively bound from free test compound. The
ligand or receptor can be immobilized on various matrixes, perhaps
with detergents or associated lipids, followed by washing. Suitable
matrixes include plastic such as an ELISA plate, filters, and
beads. Methods of immobilizing the ligand or receptor to a matrix
include, without limitation, direct adhesion to plastic, use of a
capture antibody, chemical coupling, and biotin-avidin. The last
step in this approach may involve the precipitation of
antigen/antibody complex by any of several methods including those
utilizing, e.g., an organic solvent such as polyethylene glycol or
a salt such as ammonium sulfate. Other suitable separation
techniques include, without limitation, the fluorescein antibody
magnetizable particle method described in Rattle et al. Clin.
Chem., 30:1457-1461, 1984, and the double antibody magnetic
particle separation as described in U.S. Pat. No. 4,659,6178,
incorporated herein by reference.
[0305] Methods for linking proteins or their fragments to the
various labels have been extensively reported in the literature and
do not require detailed discussion here. Many of the techniques
involve the use of activated carboxyl groups either through the use
of carbodiimide or active esters to form peptide bonds, the
formation of thioethers by reaction of a mercapto group with an
activated halogen such as chloroacetyl, or an activated olefin such
as maleimide, for linkage, or the like. Fusion proteins will also
find use in these applications.
[0306] Nucleic acid molecules of the invention may be used to map
the locations of the Fhm gene and related genes on chromosomes.
Mapping may be done by techniques known in the art, such as PCR
amplification, in situ hybridization, and FISH.
[0307] This invention is also related to the use of the Fhm gene as
part of a diagnostic assay for detecting diseases or susceptibility
to diseases related to the presence of mutated Fhm gene. Such
diseases are related to an abnormal expression of Fhm, for example,
abnormal cellular proliferation such as tumors and cancers.
[0308] Individuals carrying mutations in the human Fhm gene may be
detected at the DNA level by a variety of techniques. Nucleic acids
for diagnosis may be obtained from a patient's cells, such as from
blood, urine, saliva, tissue biopsy and autopsy material. The
genomic DNA may be used directly for detection or may be amplified
enzymatically by using PCR (Saiki et al., Nature, 324:163-166,
1986) prior to analysis. RNA or cDNA may also be used for the same
purpose. As an example, PCR primers complementary to the nucleic
acid encoding Fhm polypeptide can be used to identify and analyze
Fhm mutations. For example, deletions and insertions can be
detected by a change in size of the amplified product in comparison
to the normal genotype. Point mutations can be identified by
hybridizing amplified DNA to radiolabeled Fhm RNA or alternatively
radiolabeled Fhm antisense DNA sequences. Perfectly matched
sequences can be distinguished from mismatched duplexes by RNase A
digestion or by differences in melting temperatures.
[0309] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing, formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242, 1985).
[0310] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al., Proc. Natl.
Acad. Sci., USA, 85:4397-4401, 1985).
[0311] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0312] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0313] The present invention also relates to a diagnostic assay for
detecting altered levels of Fhm protein in various tissues since an
over-expression of the proteins compared to normal control tissue
samples may detect the presence of a disease or susceptibility to a
disease, for example, tumors, cerebral malaria and hereditary
periodic fever syndromes. Assays used to detect levels of Fhm
protein in a sample derived from a host are well-known to those of
skill in the art and include radioimmunoassays, competitive-binding
assays, Western Blot analysis, ELISA assays and "sandwich" assay.
An ELISA assay (Coligan, et al., Current Protocols in Immunology,
1(2), Chapter 6, 1991) partially comprises preparing an antibody
specific to the Fhm antigen, preferably a monoclonal antibody. In
addition a reporter antibody is prepared against the monoclonal
antibody. To the reporter antibody is attached a detectable reagent
such as radioactivity, fluorescence or in this example a
horseradish peroxidase enzyme. A sample is now removed from a host
and incubated on a solid support, e.g., a polystyrene dish, that
binds the proteins in the sample. Any free protein binding sites on
the dish are then covered by incubating with a non-specific protein
like bovine serum albumin (BSA). Next, the monoclonal antibody is
incubated in the dish during which time the monoclonal antibodies
attach to any Fhm proteins attached to the polystyrene dish. All
unbound monoclonal antibody is washed out with buffer. The reporter
antibody linked to horseradish peroxidase is now placed in the dish
resulting in binding of the reporter antibody to any monoclonal
antibody bound to Fhm. Unattached reporter antibody is then washed
out. Peroxidase substrates are then added to the dish and the
amount of color developed in a given time period is a measurement
of the amount of Fhm protein present in a given volume of patient
sample when compared against a standard curve.
[0314] A competition assay may be employed wherein antibodies
specific to Fhm are attached to a solid support and labeled Fhm and
a sample derived from the host are passed over the solid support
and the amount of label detected, for example, by liquid
scintillation chromotagraphy, can be correlated to a quantity of
Fhm in the sample. In addition, a sandwich immuno-assay as
described above may also be carried out to quantify the amount of
Fhm in a biological sample.
[0315] The sequences of the present invention are also valuable for
chromosome identification and mapping. The sequence can be
specifically targeted to and can hybridize with a particular
location on an individual human chromosome. Moreover, there is a
current need for identifying particular sites on the chromosome
wherein a gene can be localized. Few chromosome marking reagents
based on actual sequence data (repeat polymorphisms) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0316] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3'-untranslated region of the sequence is used to rapidly
select primers that do not span more than one exon in the genomic
DNA, thus complicating the amplification process. These primers are
then used for PCR screening of somatic cell hybrids containing
individual human chromosomes. Only those hybrids containing the
human gene corresponding to the primer will yield an amplified
fragment.
[0317] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map Fhm to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0318] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 500 or 600 bases; however, clones larger than
2,000 bp have a higher likelihood of binding to a unique
chromosomal location with sufficient signal intensity for simple
detection. FISH requires use of genomic clones or clones from which
the express sequence tag (EST) was derived, and the longer the
better. For example, 2,000 bp is good, 4,000 is better, and more
than 4,000 is probably not necessary to get good results a
reasonable percentage of the time. For a review of this technique
see Verma et al., Human Chromosomes: A Manual of Basic Techniques,
Pergamon Press, New York (1988).
[0319] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0320] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0321] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0322] The nucleic acid molecule(s) of the present invention are
also useful as anti-sense inhibitors of Fhm expression. Such
inhibition may be effected by nucleic acid molecules which are
complementary to and hybridize to expression control sequences
(triple helix formation) or to Fhm mRNA. Anti-sense probes may be
designed by available techniques using the sequence of Fhm
disclosed herein. Anti-sense inhibitors provide information
relating to the decrease or absence of a Fhm polypeptide in a cell
or organism.
[0323] The nucleic acid molecules of the invention may be used for
gene therapy. Nucleic acid molecules which express Fhm in vivo
provide information relating to the effects of the polypeptide in
cells or organisms. Fhm nucleic acid molecules, fragments, and/or
derivatives that do not themselves encode biologically active
polypeptides may be useful as hybridization probes in diagnostic
assays to test, either qualitatively or quantitatively, for the
presence of Fhm DNA or corresponding RNA in mammalian tissue or
bodily fluid samples.
[0324] Fhm polypeptide fragments, variants, and/or derivatives,
whether biologically active or not, are useful for preparing
antibodies that bind to an Fhm polypeptide. The antibodies may be
used for in vivo and in vitro diagnostic purposes, such as in
labeled form to detect the presence of Fhm polypeptide in a body
fluid or cell sample. The antibodies may bind to an Fhm polypeptide
so as to diminish or block at least one activity characteristic of
an Fhm polypeptide, or may bind to a polypeptide to increase an
activity.
[0325] Assaying for Modulators of Fhm Polypeptide Activity:
[0326] In some situations, it may be desirable to identify
molecules that are modulators, i.e., agonists or antagonists, of
the activity of Fhm polypeptide. Natural or synthetic molecules
that modulate Fhm polypeptide can be identified using one or more
of the screening assays, such as those described herein. Such
molecules may be administered either in an ex vivo manner, or in an
in vivo manner by local or intravenous (iv) injection, or by oral
delivery, implantation device, or the like.
[0327] "Test molecule(s)" refers to the molecule(s) that is/are
under evaluation for the ability to modulate (i.e., increase or
decrease) the activity of an Fhm polypeptide. Most commonly, a test
molecule will interact directly with an Fhm polypeptide. However,
it is also contemplated that a test molecule may also modulate Fhm
polypeptide activity indirectly, such as by affecting Fhm gene
expression, or by binding to an Fhm binding partner (e.g.,
receptor). In one embodiment, a test molecule will bind to an Fhm
polypeptide with an affinity constant of at least about 10.sup.-6
M, preferably about 10.sup.-8 M. more preferably about 10.sup.-9 M,
and even more preferably about 10.sup.-10 M.
[0328] Methods for identifying compounds which interact with Fhm
receptor polypeptides are encompassed by the invention. In certain
embodiments, a Fhm receptor polypeptide is incubated with a test
molecule under conditions which permit interaction of the test
molecule to the receptor polypeptide, in the presence or absence of
bioactive Fhm, and the extent of the interaction can be measured.
The test molecules can be screened in a substantially purified form
or in a crude mixture.
[0329] In certain embodiments, a Fhm polypeptide agonist or
antagonist may be a protein, peptide, carbohydrate, lipid, or small
molecular weight molecule which interacts with Fhm polypeptide to
regulate its activity. Molecules which regulate Fhm polypeptide
expression include nucleic acids which are complementary to nucleic
acids encoding an Fhm polypeptide, or are complementary to nucleic
acids acid sequences which direct or control the expression of Fhm
polypeptide, and which act as anti-sense regulators of
expression.
[0330] The measurement of the interaction of test molecules with
putative Fhm receptor polypeptide(s) in the presence or absence of
Fhm ligand may be carried out in several formats, including
cell-based binding assays, membrane binding assays, solution-phase
assays and immunoassays. In general, test molecules are incubated
with a putative Fhm receptor polypeptide for a specified period of
time and Fhm polypeptide activity is determined by one or more
assays measuring biological activity.
[0331] The interaction of test molecules with Fhm polypeptides may
also be assayed directly using polyclonal or monoclonal antibodies
in an immunoassay. Alternatively, modified forms of Fhm
polypeptides containing epitope tags as described herein may be
used in immunoassays.
[0332] Homogeneous assay technologies for radioactivity (SPA;
Amersham) and time resolved fluorescence (HTRF, Packard) can also
be implemented. Binding can be detected by labeling with
radioactive isotopes (.sup.125I, .sup.35S, .sup.3H), fluorescent
dyes (fluorescein), lanthanides such as Europeum (Eu .sup.3+)
chelates or cryptates, orbipyridyl-ruthenium (Ru .sup.2+)
complexes. It is understood that the choice of a labeled probe will
depend upon the detection system used. Alternatively, Fhm or
putative Fhm agonists or antagonists may be modified with an
unlabeled epitope tag (e.g., biotin, peptides, His6, myc, Fc) and
bound to proteins such as streptavidin, anti-peptide or
anti-protein antibodies which have a detectable label as described
above.
[0333] Binding of test molecules to putative Fhm receptor
polypeptides may also be assayed directly using polyclonal or
monoclonal antibodies in an immunoassay. Alternatively, modified
forms of putative Fhm-receptor polypeptide(s) containing epitope
tags as described above may be used in solution and
immunoassays.
[0334] In one embodiment, modulators of the Fhm-ligand may be a
protein, peptide, carbohydrate, lipid or small molecular weight
molecule. Potential protein antagonists of Fhm include antibodies
which bind to active regions of the polypeptide and inhibit or
eliminate binding of Fhm to its putative receptor. Molecules which
regulate Fhm polypeptide expression may include nucleic acids which
are complementary to nucleic acids encoding a Fhm polypeptide, or
are complementary to nucleic acids sequences which direct or
control expression of polypeptide, and which act as anti-sense
regulators of expression.
[0335] In the event that Fhm polypeptides display biological
activity through an interaction with a binding partner (e.g., a
receptor), a variety of in vitro assays may be used to measure
binding of Fhm polypeptide to a corresponding binding partner (such
as a selective binding agent or lignad). These assays may be used
to screen test molecules for their ability to increase or decrease
the rate and/or the extent of binding of a Fhm polypeptide to its
binding partner. In one assay, Fhm polypeptide is immobilized in
the wells of a microtiter plate. Radiolabeled Fhm binding partner
(for example, iodinated Fhm binding partner) and the test
molecule(s) can then be added either one at a time (in either
order) or simultaneously to the wells. After incubation, the wells
can be washed and counted (using a scintillation counter) for
radioactivity to determine the extent of binding to which the
binding partner bound to Fhm polypeptide. Typically, the molecules
will be tested over a range of concentrations, and a series of
control wells lacking one or more elements of the test assays can
be used for accuracy in the evaluation of the results. An
alternative to this method involves reversing the "positions" of
the proteins, i.e., immobilizing Fhm binding partner to the
microtiter plate wells, incubating with the test molecule and
radiolabeled Fhm and determining the extent of Fhm binding (see,
for example, Chapter 18 of Current Protocols in Molecular Biology,
Ausubel et al., eds., John Wiley& Sons, New York, N.Y.
,1995).
[0336] As an alternative to radiolabeling, a Fhm polypeptide or its
binding partner may be conjugated to biotin and the presence of
biotinylated protein can then be detected using streptavidin linked
to an enzyme, such as horseradish peroxidase (HRP) or alkaline
phosphatase (AP), that can be detected colorometrically, or by
fluorescent tagging of streptavidin. An antibody directed to an Fhm
polypeptide or to an Fhm binding partner and is conjugated to
biotin may also be used and can be detected after incubation with
enzyme-linked streptavidin linked to AP or HRP
[0337] A Fhm polypeptide and a Fhm binding partner can also be
immobilized by attachment to agarose beads, acrylic beads or other
types of such inert solid phase substrates. The substrate-protein
complex can be placed in a solution containing the complementary
protein and the test compound. After incubation, the beads can be
precipitated by centrifugation, and the amount of binding between
an Fhm polypeptide and its binding partner can be assessed using
the methods described above. Alternatively, the substrate-protein
complex can be immobilized in a column and the test molecule and
complementary protein passed over the column. Formation of a
complex between an Fhm polypeptide and its binding partner can then
be assessed using any of the techniques described herein, i.e.,
radiolabeling, antibody binding, or the like.
[0338] Another in vitro assay that is useful for identifying a test
molecule which increases or decreases the formation of a complex
between a Fhm binding protein and a Fhm binding partner is a
surface plasmon resonance detector system such as the BIAcore assay
system (Pharmacia, Piscataway, N.J.). The BIAcore system may be
carried out using the manufacturer's protocol. This assay
essentially involves the covalent binding of either Fhm or a Fhm
binding partner to a dextran-coated sensor chip which is located in
a detector. The test compound and the other complementary protein
can then be injected either simultaneously or sequentially into the
chamber containing the sensor chip. The amount of complementary
proteinbinds can be assessed based on the change in molecular mass
which is physically associated with the dextran-coated side of the
sensor chip; the change in molecular mass can be measured by the
detector system.
[0339] In some cases, it may be desirable to evaluate two or more
test compounds together for their ability to increase or decrease
the formation of a complex between a Fhm polypeptide and a Fhm
binding partner complex. In these cases, the assays described
herein can be readily modified by adding such additional test
compound(s) either simultaneous with, or subsequent to, the first
test compound. The remainder of the steps in the assay are as set
forth herein.
[0340] In vitro assays such as those described herein may be used
advantageously to screen rapidly large numbers of compounds for
effects on complex formation by Fhm and Fhm binding partner. The
assays may be automated to screen compounds generated in phage
display, synthetic peptide and chemical synthesis libraries.
[0341] Compounds which increase or decrease the formation of a
complex between a Fhm polypeptide and a Fhm binding partner may
also be screened in cell culture using cells and cell lines
expressing either Fhm or Fhm binding partner. Cells and cell lines
may be obtained from any mammal, but preferably will be from human
or other primate, canine, or rodent sources. The binding of an Fhm
polypeptide to cells expressing Fhm binding partner at the surface
is evaluated in the presence or absence of test molecules and the
extent of binding may be determined by, for example, flow cytometry
using a biotinylated antibody to an Fhm binding partner. Cell
culture assays may be used advantageously to further evaluate
compounds that score positive in protein binding assays described
herein.
[0342] Cell cultures can also be used to screen the impact of a
drug candidate. For example, drug candidates may decrease or
increase the expression of the Fhm gene. In certain embodiments,
the amount of Fhm polypeptide that is produced may be measured
after exposure of the cell culture to the drug candidate. In
certain embodiments, one may detect the actual impact of the drug
candidate on the cell culture. For example, the overexpression of a
particular gene may have a particular impact on the cell culture.
In such cases, one may test a drug candidate's ability to increase
or decrease the expression of the gene or its ability to prevent or
inhibit a particular impact on the cell culture. In other examples,
the production of a particular metabolic product such as a fragment
of a polypeptide, may result in, or be associated with, a disease
or pathological condition. In such cases, one may test a drug
candidate's ability to decrease the production of such a metabolic
product in a cell culture.
[0343] P38 Inhibitors
[0344] A new approach to intervention between the extracellular
stimulus and the secretion of IL-1 and TNF.alpha. from the cell
involves blocking signal transduction through inhibition of a
kinase which lies on the signal pathway. One example is through
inhibition of P-38 (also called "RK" or "SAPK-2", Lee et al.,
Nature, 372:739, 1994), a known ser/thr kinase (clone reported in
Han et al., Biochimica Biophysica Acta, 1265:224-227, 1995). A
linear relationship has been shown for effectiveness in a
competitive binding assay to P-38, and the same inhibitor
diminishing the levels of IL-1 secretion from monocytes following
LPS stimulation. Following LPS stimulation of monocytes, the levels
of messenger RNA for TNF-.alpha. have been shown to increase 100
fold, but the protein levels of TNF-.alpha. are increased 10,000
fold. Thus, a considerable amplification of the TNF signaling
occurs at the translational level. Following LPS stimulation of
monocytes in the presence of a P-38 inhibitor, the levels of mRNA
are not affected, but the levels of final TNF protein are
dramatically reduced (up to 80-90% depending on the effectiveness
of the P-38 inhibitor). Thus, the above experiments lend strong
support to the conclusion that inhibition of P-38 leads to
diminished translational efficiency. Further evidence that TNFa is
under translational control is found in the deletion experiments of
Beutler et al. and Lee, wherein segments of 3' untranslated mRNA
(3' UTR) are removed resulting in high translational efficiency for
TNF.alpha.. More importantly, the P-38 inhibitors did not have an
effect on the level of TNF.alpha. (i.e., translational efficiency)
when the appropriate segments of TNF.alpha. mRNA are deleted. Thus,
the correlative data between the level of binding of inhibitors to
P-38 and the diminished IL-1 and TNF.alpha. levels following LPS
stimulation with the same inhibitors, plus the above biochemical
evidence regarding the effect of P-38 inhibitors on translational
efficiency of both TNF.alpha. and IL-1 make a strong cause and
effect relationship. The role of P-38 in the cell is still being
delineated; so therefore, other beneficial effects regarding
inflammatory diseases or other disease states obtained from its
inhibition maybe forthcoming.
[0345] Elevated levels of TNF.alpha. and/or IL-1 may contribute to
the onset, etiology, or exacerbate a number of disease states,
including, but not limited to: rheumatoid arthritis;
osteoarthritis; rheumatoid spondylitis; gouty arthritis;
inflammatory bowel disease; adult respiratory distress syndrome
(ARDS); psoriasis; Crohn's disease; allergic rhinitis; ulcerative
colitis; anaphylaxis; contact dermatitis; asthma; antiviral therapy
including those viruses sensitive to TNF.alpha. inhibition--HIV-1,
HIV-2, HIV-3, cytomegalovirus (CMV), influenza, adenovirus, and the
herpes viruses including HSV-1, HSV-2, and herpes zoster; muscle
degeneration; cachexia; Reiter's syndrome; type II diabetes; bone
resorption diseases; graft vs. host reaction; ischemia reperfusion
injury; atherosclerosis; brain trauma; Alzheimer's disease;
multiple sclerosis; cerebral malaria; sepsis; septic shock; toxic
shock syndrome; fever and mylagias due to infection.
[0346] Substituted imidazole, pyrrole, pyridine, pyrimidine and the
like compounds have been described for use in the treatment of
cytokine mediated diseases by inhibition of proinflammatory
cytokines, such as IL-1, IL-6, IL-8 and TNF. Substituted imidazoles
for use in the treatment of cytokine mediated diseases have been
described in U.S. Pat. No. 5,593,992; WO 93/14081; WO 97/18626; WO
96/21452; WO 96/21654; WO 96/40143; WO 97/05878; WO 97/05878; (each
of which is incorporated herein by reference in its entirety).
Substituted imidazoles for use in the treatment of inflammation has
been described in U.S. Pat. No. 3,929,807 (which is incorporated
herein by reference in its entirety). Substituted pyrrole compounds
for use in the treatment of cytokine mediated diseases have been
described in WO 97/05877; WO 97/05878; WO 97/16426; WO 97/16441;
and WO 97/16442 (each of which is incorporated herein by reference
in its entirety). Substituted aryl and heteroaryl fused pyrrole
compounds for use in the treatment of cytokine mediated diseases
have been described in WO 98/22457 (which is incorporated herein by
reference in its entirety). Substituted pyridine, pyrimidine,
pyrimidinone and pyridazine compounds for use in the treatment of
cytokine mediated diseases have been described in WO 98/24780; WO
98/24782; WO 99/24404; and WO 99/32448 (each of which is
incorporated herein by reference in its entirety).
[0347] Internalizing Proteins
[0348] The TAT protein sequence (from HIV) can be used to
internalize proteins into a cell by targeting the lipid bi-layer
component of the cell membrane. See e.g., Falwell et al., Proc.
Natl. Acad. Sci., 91: 664-668, 1994. For example, an 11 amino acid
sequence (YGRKKRRQRRR; SEQ ID NO: 22) of the HIV TAT protein
(termed the "protein transduction domain", or TAT PDT) has been
shown to mediate delivery of large bioactive proteins such as
.beta.-galactosidase and p27Kip across the cytoplasmic membrane and
the nuclear membrane of a cell. See Schwarze et al., Science, 285:
1569-1572, 1999; and Nagahara et al., Nature Medicine, 4:
1449-1452, 1998. Schwartze et al. (Science, 285: 1569-72, 1999)
demonstrated that cultured cells acquired .beta.-gal activity when
exposed to a fusion of the TAT PDT and .beta.-galactosidase.
Injection of mice with the TAT-.beta.-gal fusion proteins resulted
in .beta.-gal expression in a number of tissues, including liver,
kidney, lung, heart, and brain tissue.
[0349] It will thus be appreciated that the TAT protein sequence
may be used to internalize a desired protein or polypeptide into a
cell. In the context of the present invention, the TAT protein
sequence can be fused to another molecule such as a Fhm antagonist
(i.e.: anti-Fhm selective binding agent or small molecule) and
administered intracellularly to inhibit the activity of the Fhm
molecule. Where desired, the Fhm protein itself, or a peptide
fragment or modified form of Fhm, may be fused to such a protein
transducer for administrating to cells using the procedures,
described above.
[0350] Therapeutic Uses
[0351] Members of the TNF ligand family have been implicated in
mediation of a number of diseases. The pleiotropic nature of TNF
and related ligand family members prevents generalization about
whether a particular polypeptide is beneficial or injurious. It is
clear that in some instances, the local effects of TNF and other
members of the TNF-ligand family of cytokines improve host defense
mechanisms by mobilizing substrate. increasing immune cell
function, stimulating inflammation, and in killing cancer cells.
However, in other cases the toxicity of TNF and related cytokines
may cause disease by mediating shock, tissue injury, or catabolic
injury. There are many diseases wherein injury that is mediated by
members of the TNF ligand family may be treated or ameliorated by
the administration of soluble forms of members of the TNF-receptor
gene family or TNF-like ligand molecules. These diseases include
acquired-immunodeficiency syndrome (AIDS), anemia, autoimmune
diseases, cachexia, cancer, cerebral malaria, diabetes mellitus,
disseminated intravascular coagulopathy, erythryoid sick syndrome,
hemorrhagic shock, hepatitis, insulin resistance, leprosy,
leukemia, lymphoma, meningitis, multiple sclerosis, myocardial
ischaemia, obesity, rejection of transplanted organs, rheumatoid
arthritis, septic shock syndrome, stroke, adult respiratory
distress syndrome (ARDS), tuberculosis, and a number of viral
diseases.
[0352] Fhm Compositions and Administration
[0353] Pharmaceutical compositions of Fhm polypeptides are within
the scope of the present invention for prophylactic and therapeutic
treatment of humans and animals for indications resulting from
abnormal expression of Fhm or where it is determined that
administration of Fhm polypeptide will result in the amelioration
or cure of the indications. Such compositions may comprise a
therapeutically effective amount of a Fhm polypeptide and/or its
binding partner, or therapeutically active fragment(s), variant(s),
or derivative(s) thereof in admixture with a pharmaceutically
acceptable additives and/or carriers. Suitable formulation
materials or pharmaceutically acceptable agents include, but are
not limited to, antioxidants, preservatives, colors, flavoring, and
diluting agents, emulsifying agents, suspending agents, solvents,
fillers, bulking agents, buffers, delivery vehicles, diluents,
excipients, and/or pharmaceutical adjuvants. Typically, a
therapeutic compound containing Fhm polypeptide(s) will be
administered in the form of a composition comprising purified
polypeptide, fragment(s), variant(s), or derivative(s) in
conjunction with one or more physiologically acceptable carriers,
excipients, or diluents. For example, a suitable vehicle may be
water for injection, physiological solution, or artificial
cerebrospinal fluid possibly supplemented with other materials
common in compositions for parenteral delivery.
[0354] Neutral buffered saline or saline mixed with serum albumin
are exemplary appropriate carriers. Preferably, the product is
formulated as a lyophilizate using appropriate excipients (e.g.,
sucrose). Other standard carriers, diluents, and excipients may be
included as desired. Other exemplary compositions comprise Tris
buffer of about pH 7.0-8.5, or acetate buffer of about pH 4.0-5.5,
which may further include sorbitol or a suitable substitute
therefor. The pH of the solution should also be selected based on
the relative solubility of Fhm at various pHs.
[0355] The primary solvent in a composition may be either aqueous
or non-aqueous in nature. In addition, the vehicle may contain
other formulation materials for modifying or maintaining the pH,
osmolarity, viscosity, clarity, color, sterility, stability,
isotonicity, rate of dissolution, or odor of the formulation.
Similarly, the composition may contain additional formulation
materials for modifying or maintaining the rate of release of Fhm
protein, or for promoting the absorption or penetration of Fhm
protein.
[0356] Compositions comprising the Fhm polypeptide compositions can
be administered parentally. Alternatively, the compositions may be
administered intravenously or subcutaneously. When systemically
administered, the therapeutic compositions for use in this
invention may be in the form of a pyrogen-free, parentally
acceptable aqueous solution. The preparation of such
pharmaceutically acceptable protein solutions, with due regard to
pH, isotonicity, stability and the like, is within the skill of the
art.
[0357] Therapeutic formulations of Fhm polypeptide compositions
useful for practicing the present invention may be prepared for
storage by mixing the selected composition having the desired
degree of purity with optional physiologically acceptable carriers,
excipients, or stabilizers (Remington's Pharmaceutical Sciences,
18th Edition, A. R. Gennaro, ed., Mack Publishing Company, 1990) in
the form of a lyophilized cake or an aqueous solution.
[0358] Acceptable carriers, excipients or stabilizers are nontoxic
to recipients and are preferably inert at the dosages and
concentrations employed, and include buffers such as phosphate,
citrate, or other organic acids; antioxidants such as ascorbic
acid; low molecular weight polypeptides; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, arginine or lysine; monosaccharides, disaccharides, and
other carbohydrates including glucose, mannose, or dextrins;
chelating agents such as EDTA; sugar alcohols such as mannitol or
sorbitol; salt-forming counterions such as sodium; and/or nonionic
surfactants such as Tween, pluronics or polyethylene glycol
(PEG).
[0359] An effective amount of the Fhm polypeptide(s) composition to
be employed therapeutically will depend, for example, upon the
therapeutic objectives such as the indication for which the
composition is being used, the route of administration (e.g.,
whether it is administered locally or systemically), and the
condition of the patient (e.g., patient's general health,
anaureuesis, age, weight, sex). It is essential, when determining
the therapeutically effective dose, to take into account the
quantity of Fhm or other members of the TNF family that are
responsible for the disease. Basically, it can be assumed that for
effective treatment of a disease triggered by the over expression
of cytokine(s) such as Fhm, at least the same molar amount of the
Fhm polypeptide(s) is required, and possibly a multiple excess
might be needed, although less may be needed depending on the
nature of the receptor and the nature of its interaction with Fhm.
Accordingly, it will be necessary for the therapist to titer the
dosage and/or in vivo modify the route of administration as
required to obtain the optimal therapeutic effect. A typical daily
dosage may range from about 0.1 mg/kg to up to 100 mg/kg or more,
depending on the factors mentioned above. Typically, a clinician
will administer the composition until a dosage is reached that
achieves the desired effect. The composition may therefore be
administered as a single dose, or as two or more doses (which may
or may not contain the same amount of Fhm polypeptide) over time,
or as a continuous infusion via implantation device or
catheter.
[0360] As further studies are conducted, information will emerge
regarding appropriate dosage levels for treatment of various
conditions in various patients, and the ordinary skilled worker,
considering the therapeutic context, the type of disorder under
treatment, the age and general health of the recipient, will be
able to ascertain proper dosing.
[0361] The Fhm polypeptide composition to be used for in vivo
administration must be sterile. This is readily accomplished by
filtration through sterile filtration membranes. Where the
composition is lyophilized, sterilization using thes method may be
conducted either prior to or following lyophilization and
reconstitution. The composition for parenteral administration
ordinarily will be stored in lyophilized form or in solution.
[0362] Therapeutic compositions generally are placed into a
container having a sterile access port, for example, an intravenous
solution bag or vial having a stopper pierceable by a hypodermic
injection needle. Once the pharmaceutical composition has been
formulated, it may be stored in sterile vials as a solution,
suspension, gel, emulsion, solid, or as a dehydrated or lyophilized
powder. Such formulations may be stored either in a ready-to-use
form or in a form (e.g., lyophilized) requiring reconstitution
prior to administration.
[0363] Effective administration forms, such as (1) slow-release
formulations, (2) inhalant mists, or (3) orally active formulations
are also envisioned. Pharmaceutical compositions comprising
thereapeutically effective dose of the Fhm polypeptide also may be
formulated for parenteral administration. Such parenterally
administered therapeutic compositions are typically in the form of
a pyrogen-free, parenterally acceptable aqueous solution comprising
Fhm in a pharmaceutically acceptable vehicle. The Fhm
pharmaceutical compositions also may include particulate
preparations of polymeric compounds such as polylactic acid,
polyglycolic acid, etc. or the introduction of Fhm into liposomes.
Hyaluronic acid may also be used, and this may have the effect of
promoting sustained duration in the circulation.
[0364] A particularly suitable vehicle for parenteral injection is
sterile distilled water in which Fhm is formulated as a sterile,
isotonic solution, properly preserved. Yet another preparation may
involve the formulation of Fhm with an agent, such as injectable
microspheres, bio-erodible particles or beads, or liposomes, that
provides for the controlled or sustained release of the protein
product which may then be delivered as a depot injection. Other
suitable means for the introduction of Fhm include implantable drug
delivery devices which contain the Fhm and/or its binding
partner.
[0365] The preparations of the present invention may include other
components, for example parenterally acceptable preservatives,
tonicity agents, cosolvents, wetting agents, complexing agents,
buffering agents, antimicrobials, antioxidants and surfactants, as
are well known in the art. For example, suitable tonicity enhancing
agents include alkali metal halides (preferably sodium or potassium
chloride), mannitol, sorbitol and the like. Suitable preservatives
include, but are not limited to, benzalkonium chloride, thimerosal,
phenethyl alcohol, methylparaben, propylparaben, chlorhexidine,
sorbic acid and the like. Hydrogen peroxide may also be used as
preservative. Suitable cosolvents are for example glycerin,
propylene glycol and polyethylene glycol. Suitable complexing
agents are for example caffeine, polyvinylpyrrolidone,
beta-cyclodextrin or hydroxypropyl-beta-cyclodextrin. Suitable
surfactants or wetting agents include sorbitan esters, polysorbates
such as polysorbate 80, tromethamine, lecithin, cholesterol,
tyloxapal and the like. The buffers can be conventional buffers
such as borate, citrate, phosphate, bicarbonate, or Tris-HCl.
[0366] The formulation components are present in concentration that
are acceptable to the site of administration. For example, buffers
are used to maintain the composition at physiological pH or at
slightly lower pH, typically within a pH range of from about 5 to
about 8.
[0367] When parenteral administration is contemplated, the
therapeutic compositions for use in this invention may be in the
form of a pyrogen-free, parenterally acceptable aqueous solution
comprising the desired Fhm molecule in a pharmaceutically
acceptable vehicle. A particularly suitable vehicle for parenteral
injection is sterile distilled water in which an Fhm molecule is
formulated as a sterile, isotonic solution, properly preserved. Yet
another preparation can involve the formulation of the desired
molecule with an agent, such as injectable microspheres,
bio-erodible particles, polymeric compounds (such as polylactic
acid or polyglycolic acid), or beads or liposomes, that provides
for the controlled or sustained release of the product which may
then be delivered via a depot injection. Hyaluronic acid may also
be used, and this may have the effect of promoting sustained
duration in the circulation. Other suitable means for the
introduction of the desired molecule include implantable drug
delivery devices.
[0368] A pharmaceutical composition may be formulated for
inhalation. For example, Fhm may be formulated as a dry powder for
inhalation. Fhm polypeptides or Fhm nucleic acid molecule
inhalation solutions may also be formulated with a d propellant for
aerosol delivery. In yet another embodiment, solutions may be
nebulized. Pulmonary administration is further described in PCT
Application No. PCT/US94/01875, which describes pulmonary delivery
of chemically modified proteins.
[0369] It is also contemplated that certain formulations containing
Fhm polypeptide(s) may be administered orally. In one embodiment,
the Fhm ligand which is administered in this fashion may be
formulated with or without those carriers customarily used in the
compounding of solid dosage forms such as tablets and capsules. For
example, a capsule may be designed to release the active portion of
the formulation at the point in the gastrointestinal tract when
bioavailability is maximized and pre-systemic degradation is
minimized. Additional agents can be included to facilitate
absorption of the Fhm polypeptide. Diluents, flavorings, low
melting point waxes, vegetable oils, lubricants, suspending agents,
tablet disintegrating agents, and binders may also be employed.
[0370] Another pharmaceutical composition may involve an effective
quantity of Fhm polypeptide in a mixture with non-toxic excipients
which are suitable for the manufacture of tablets. By dissolving
the tablets in sterile water, or other appropriate vehicle,
solutions can be prepared in unit dose form. Suitable excipients
include, but are not limited to, inert diluents, such as calcium
carbonate, sodium carbonate or bicarbonate, lactose, or calcium
phosphate; or binding agents, such as starch, gelatin, or acacia;
or lubricating agents such as magnesium stearate, stearic acid, or
talc.
[0371] Additional Fhm-polypeptide pharmaceutical compositions will
be evident to those skilled in the art, including formulations
involving Fhm-polypeptide in sustained or controlled delivery
formulations. Techniques for formulating a variety of other
sustained- or controlled-delivery means, such as liposome carriers,
bio-erodible microparticles or porous beads and depot injections,
are also known to those skilled in the art. See, for example, PCT
Application No. PCT/US93/00829 which describes the controlled
release porous polymeric microparticles for the delivery of
pharmaceutical compositions. Additional examples include
semipermeable polymer matrices in the form of shaped articles e.g.,
films or microspheres.
[0372] In a specific embodiment, the present invention is directed
to kits for producing a single-dose administration unit. The kits
may each contain both a first container having a dried protein and
a second container having an aqueous formulation. Also included
within the scope of this invention are kits containing single and
multi-chambered pre-filled syringes (e.g., liquid syringes and
lyosyringes).
[0373] The effective amount of an Fhm pharmaceutical composition to
be employed therapeutically will depend, for example, upon the
therapeutic context and objectives. One skilled in the art will
appreciate that the appropriate dosage levels for treatment will
thus vary depending, in part, upon the molecule delivered, the
indication for which the Fhm molecule is being used, the route of
administration, and the size (body weight, body surface or organ
size) and condition (the age and general health) of the patient.
Accordingly, the clinician may titer the dosage and modify the
route of administration to obtain the optimal therapeutic effect. A
typical dosage may range from about 0.1 mg/kg to up to about 100
mg/kg or more, depending on the factors mentioned above. In other
embodiments, the dosage may range from 0.1 mg/kg up to about 100
mg/kg; or 1 mg/kg up to about 100 mg/kg; or 5 mg/kg up to about 100
mg/kg.
[0374] The frequency of dosing will depend upon the pharmacokinetic
parameters of the Fhm molecule in the formulation used. Typicaly, a
clinician will administer the composition until a dosage is reached
that achieves the desired effect. The composition may therefore be
administered as a single dose, or as two or more doses (which may
or may not contain the same amount of the desired molecule) over
time, or as a continuous infusion via an implantation device or
catheter. Further refinement of the appropriate dosage is routinely
made by those of ordinary skill in the art and is within the ambit
of tasks routinely performed by them. Appropriate dosages may be
ascertained through use of appropriate dose-response data.
[0375] The route of administration of the pharmaceutical
composition is in accord with known methods, e.g. orally, through
injection by intravenous, intraperitoneal, intracerebral
(intra-parenchymal), intracerebroventricular, intramuscular,
intra-ocular, intraarterial, intraportal, or intralesional routes,
orroutes; by sustained release systems or by implantation devices.
Where desired, the compositions may be administered by bolus
injection or continuously by infusion, or by implantation
device.
[0376] Alternatively or additionally, the composition may be
administered locally via implantation of a membrane, sponge, or
another appropriate material on to which the desired molecule has
been absorbed or encapsulated. Where an implantation device is
used, the device may be implanted into any suitable tissue or
organ, and delivery of the desired molecule may be via diffusion,
timed-release bolus, or continuous administration.
[0377] One may further administer the present pharmaceutical
compositions by pulmonary administration, see, e.g., International
Publication No: WO 94/20069, which discloses pulmonary delivery of
chemically modified proteins, herein incorporated by reference. For
pulmonary delivery, the particle size should be suitable for
delivery to the distal lung. For example, the particle size may be
from 1 mm to 5 mm, however, larger particles may be used, for
example, if each particle is fairly porous. Alternatively or
additionally, the composition may be administered locally via
implantation into the affected area of a membrane, sponge, or other
appropriate material on to which receptor polypeptide has been
absorbed or encapsulated. Where an implantation device is used, the
device may be implanted into any suitable tissue or organ, and
delivery may be directly through the device via bolus, or via
continuous administration, or via catheter using continuous
infusion.
[0378] Fhm-ligand polypeptide(s) and/or its binding partner may
also be administered in a sustained release formulation or
preparation. Suitable polymer compositions preferably have
intrinsic and controllable biodegradability so that they persist
for about a week to about six months; are non-toxic containing no
significant toxic monomers and degrading into non-toxic components;
are biocompatible, are chemically compatible with substances to be
delivered, and tend not to denature the active substance; are
sufficiently porous to allow the incorporation of biologically
active molecules and their subsequent liberation from the polymer
by diffusion, erosion or a combination thereof; are able to remain
at the site of the application by adherence or by geometric
factions, such as being formed in place or softened and
subsequently molded or formed into microparticles which are trapped
at a desired location; are capable of being delivered by techniques
of minimum invasivity such as by catheter, laparoscope or
endoscope. Sustained release matrices include polyesters,
hydrogels, polylactides (U.S. Pat. No. 3,773,919, EP 58,481),
copolymers of L-glutamic acid and gamma ethyl-L-glutamate (Sidman
et al, Biopolymers, 22: 547-556, 1983), poly
(2-hydroxyethyl-methacrylate) (Langer et al., J. Biomed. Mater.
Res., 15: 167-277, 1981 and Langer, Chem. Tech., 12: 98-105, 1982),
ethylene vinyl acetate (Langer et al., supra) or
poly-D(-)-3-hydroxybutyric acid (EP 133,988). Sustained-release
compositions also may include liposomes, which can be prepared by
any of several methods known in the art (e.g., Eppstein et al.,
Proc. Natl. Acad. Sci. USA, 82: 3688-3692. 1985; EP 36,676; EP
88,046; EP 143,949, incorporated herein by reference).
[0379] The Fhm polypeptides, variants, derivatives or fragments
thereof, may be employed alone, together, or in combination with
other pharmaceutical compositions. The Fhm polypeptides, fragments,
variants, and derivatives may be used in combination with
cytokines, cytokine inhibitors, growth factors, antibiotics,
anti-inflammatories, and/or chemotherapeutic agents as is
appropriate for the indication being treated
[0380] In some cases, it may be desirable to use Fhm polypeptide
pharmaceutical compositions in an ex vivo manner. In such
instances, cells, tissues, or organs that have been removed from
the patient are exposed to Fhm polypeptide pharmaceutical
compositions after which the cells, tissues and/or organs are
subsequently implanted back into the patient.
[0381] In other cases, a Fhm polypeptide can be delivered by
implanting into patients certain cells that have been genetically
engineered, using methods such as those described herein, to
express and secrete the polypeptides, fragments, variants, or
derivatives. Such cells may be animal or human cells, and may
autologous, heterologous or xenogeneic. Optionally, the cells may
be immortalized. In order to decrease the chance of an
immunological response, it is preferred that the cells may be
encapsulated to avoid infiltration of surrounding tissues. The
encapsulation materials are typically biocompatible, semi-permeable
polymeric enclosures or membranes that allow the release of the
protein product(s) but prevent the destruction of the cells by the
patient's immune system or by other detrimental factors from the
surrounding tissues.
[0382] Methods used for membrane encapsulation of cells are
familiar to the skilled artisan, and preparation of encapsulated
cells and their implantation in patients may be accomplished
without undue experimentation. See, e.g., U.S. Pat. Nos. 4,892,538;
5,011,472; and 5,106,627, incorporated herein by reference. A
system for encapsulating living cells is described in International
Publication No: WO 91/10425. Techniques for formulating a variety
of other sustained or controlled delivery means, such as liposome
carriers, bio-erodible particles or beads, are also known to those
in the art, and are described, for example, in U.S. Pat. No.
5,653,975, incorporated herein by reference. The cells, with or
without encapsulation, may be implanted into suitable body tissues
or organs of the patient.
[0383] As discussed herein, it may be desirable to treat isolated
cell populations such as stem cells, lymphocytes, red blood cells,
chondrocytes, neurons, and the like; add as appropriate with one or
more Fhm polypeptides, variants, derivatives and/or fragments. This
can be accomplished by exposing the isolated cells to the
polypeptide, variant, derivative, or fragment directly, where it is
in a form that is permeable to the cell membrane.
[0384] The present invention relates to improved methods for both
the in vitro production of therapeutic proteins and for the
production and delivery of therapeutic proteins by gene
therapy.
[0385] Homologous Recombination
[0386] It is further envisioned that Fhm protein may be produced by
homologous recombination, or with recombinant production methods
utilizing control elements introduced into cells already containing
DNA encoding Fhm. For example, homologous recombination methods may
be used to modify a cell that contains a normally transcriptionally
silent Fhm gene, or under expressed gene, and thereby produce a
cell which expresses therapeutically efficacious amounts of Fhm.
Homologous recombination is a technique originally developed for
targeting genes to induce or correct mutations in transcriptionally
active genes (Kucherlapati, Prog. in Nucl. Acid Res. and Mol.
Biol., 36:301, 1989). The basic technique was developed as a method
for introducing specific mutations into specific regions of the
mammalian genome (Thomas et al., Cell, 44:419-428, 1986; Thomas and
Capecchi, Cell, 51:503-512, 1987; Doetschman et al., Proc. Natl.
Acad. Sci., 85:8583-8587, 1988) or to correct specific mutations
within defective genes (Doetschman et al., Nature, 330:576-578,
1987). Exemplary homologous recombination techniques are described
in U.S. Pat. No: 5,272,071, EP Publication No: 91 90 3051, EP
Publication No. 505 500; PCT/US90/07642, International Publication
No: WO 91/09955. incorporated herein by reference.
[0387] Through homologous recombination, the DNA sequence to be
inserted into the genome can be directed to a specific region of
the gene of interest by attaching it to targeting DNA. The
targeting DNA is a nucleotide sequence that is complementary
(homologous) to a region of the genomic DNA, into which insertion
of the sequence is sought. Small pieces of targeting DNA that are
complementary to a specific region of the genome are put in contact
with the parental strand during the DNA replication process. It is
a general property of DNA that has been inserted into a cell to
hybridize, and therefore, recombine with other pieces of endogenous
DNA through shared homologous regions. If this complementary strand
is attached to an oligonucleotide that contains a mutation or a
different sequence or an additional nucleotide, it too is
incorporated into the newly synthesized strand as a result of the
recombination. As a result of the proofreading function, it is
possible for the new sequence of DNA to serve as the template.
Thus, the transferred DNA is incorporated into the genome.
[0388] Attached to these pieces of targeting DNA are regions of DNA
which may interact with or control the expression of a Fhm
polypeptide, e.g. flanking sequences. For example, a
promoter/enhancer element, a suppresser, or an exogenous
transcription modulatory element is inserted in the genome of the
intended host cell in proximity and orientation sufficient to
influence the transcription of DNA encoding the desired Fhm
polypeptide. The control element controls a portion of the DNA
present in the host cell genome. Thus, the expression of Fhm
protein may be achieved not by transfection of DNA that encodes the
Fhm gene itself, but rather by the use of targeting DNA (containing
regions of homology with the endogenous gene of interest) coupled
with DNA regulatory segments that provide the endogenous gene
sequence with recognizable signals for transcription of a Fhm
protein.
[0389] In an exemplary method, expression of a desired targeted
gene in a cell (i.e., a desired endogenous cellular gene) is
altered by the introduction, by homologous recombination into the
cellular genome at a preselected site, by the introduction of DNA
which includes at least a regulatory sequence, an exon and a splice
donor site. These components are introduced into the chromosomal
(genomic) DNA in such a manner that this, in effect, results in the
production of a new transcription unit (in which the regulatory
sequence, the exon and the splice donor site present in the DNA
construct are operatively linked to the endogenous gene). As a
result of the introduction of these components into the chromosomal
DNA, the expression of the desired endogenous gene is altered.
[0390] Altered gene expression, as described herein, encompasses
activating (or causing to be expressed) a gene which is normally
silent (unexpressed) in the cell as obtained, as well as increasing
the expression of a gene which is not expressed at physiologically
significant levels in the cell as obtained. The embodiment s
further encompass changing the pattern of regulation or induction
such that it is different from the pattern of regualtion or
induction that occurs in the cell as obtained, and reducing
(including eliminating) expression of a gene which is expressed in
the cell as obtained.
[0391] One method by which homologous recombination can be used to
increase, or cause, Fhm polypeptide production from a cell's
endogenous Fhm gene involves first using homologous recombination
to place a recombination sequence from a site-specific
recombination system (e.g., Cre/loxP, FLP/FRT) (see, Sauer, Current
Opinion In Biotechnology, 5:521-527, 1994; and Sauer, Methods In
Enzymology, 225:890-900, 1993) upstream (that is, 5' to) of the
cell's endogenous genomic Fhm polypeptide coding region. A plasmid
containing a recombination site homologous to the site that was
placed just upstream of the genomic Fhm polypeptide coding region
is introduced into the modified cell line along with the
appropriate recombinase enzyme. This recombinase enzyme causes the
plasmid to integrate, via the plasmid's recombination site, into
the recombination site located just upstream of the genomic Fhm
polypeptide coding region in the cell line (Baubonis and Sauer,
Nucleic Acids Res., 21:2025-2029, 1993; and O'Gorman et al.,
Science, 251:1351-1355, 1991). Any flanking sequences known to
increase transcription (e.g., enhancer/promoter, intron, or
translational enhancer), if properly positioned in this plasmid,
would integrate in such a manner as to create a new or modified
transcriptional unit resulting in de novo or increased Fhm
polypeptide production from the cell's endogenous Fhm gene.
[0392] A further method to use the cell line in which the
site-specific recombination sequence has been placed just upstream
of the cell's endogenous genomic Fhm polypeptide coding region is
to use homologous recombination to introduce a second recombination
site elsewhere in the cell line's genome. The appropriate
recombinase enzyme is then introduced into the
two-recombination-site cell line, causing a recombination event
(deletion, inversion, or translocation) (Sauer, Current Opinion In
Biotechnology, supra, 1994; and Sauer, Methods In Enzymology,
supra, 1993) that would create a new or modified transcriptional
unit resulting in de novo or increased Fhm polypeptide production
from the cell's endogenous Fhm gene.
[0393] An additional approach for increasing, or causing, the
expression of Fhm polypeptide from a cell's endogenous Fhm gene
involves increasing, or causing, the expression of a gene or genes
(e.g., transcription factors) and/or decreasing the expression of a
gene or genes (e.g., transcriptional repressors) in a manner which
results in de novo or increased Fhm polypeptide production from the
cell's endogenous Fhm gene. This method includes the introduction
of a non-naturally occurring polypeptide (e.g., a polypeptide
comprising a site specificsite-specific DNA binding domain fused to
a transcriptional factor domain) into the cell such that de novo or
increased Fhm polypeptide production from the cell's endogenous Fhm
gene results.
[0394] The present invention further relates to DNA constructs
useful in the method of altering expression of a target gene. In
certain embodiments, the exemplary DNA constructs comprise: (a) on
or more targeting sequence; (b) a regulatory sequence; (c) an exon;
and (d) an unpaired splice-donor site. The targeting sequence in
the DNA construct directs the integration of elements (a)-(d) into
a target gene in a cell such that the elements (b)-(d) are
operatively linked to sequences of the endogenous target gene. In
another embodiment, the DNA constructs comprise: (a) one or more
targeting sequence, (b) a regulatory sequence, (c) an exon, (d) a
splice-donor site, (e) an intron, and (f) a splice-acceptor site,
wherein the targeting sequence directs the integration of elements
(a)-(f) such that the elements of (b)-(f) are operatively linked to
the endogenous gene. The targeting sequence is homologous to the
preselected site in the cellular chromosomal DNA with which
homologous recombination is to occur. In the construct, the exon is
generally 3' of the regulatory sequence and the splice-donor site
is 3' of the exon.
[0395] If the sequence of a particular gene is known, such as the
nucleic acid sequence of Fhm presented herein, a piece of DNA that
is complementary to a selected region of the gene can be
synthesized or otherwise obtained, such as by appropriate
restriction of the native DNA at specific recognition sites
bounding the region of interest. This piece serves as a targeting
sequence(s) upon insertion into the cell and will hybridize to its
homologous region within the genome. If this hybridization occurs
during DNA replication, this piece of DNA, and any additional
sequence attached thereto, will act as an Okazaki fragment and will
be incorporated into the newly synthesized daughter strand of DNA.
The present invention, therefore, includes nucleotides encoding
Fhm-polypeptide(s), which nucleotides may be used as targeting
sequences.
[0396] Alternatively, gene therapy can be employed as described
below.
[0397] Fhm Cell Therapy and Gene Therapy
[0398] Fhm cell therapy, e.g., the implantation of cells producing
Fhm, is also encompassed by the present invention. This embodiment
involves implanting cells capable of synthesizing and secreting a
biologically active form of the soluble Fhm. Such soluble Fhm
polypeptide producing cells may be cells that are natural producers
of Fhm or may be recombinant cells whose ability to produce Fhm has
been augmented by transformation with a gene encoding the desired
Fhm molecule or with a gene augmenting the expression of Fhm
polypeptide. Such a modification may be accomplished by means of a
vector suitable for delivering the gene as well as promoting its
expression and secretion. In order to minimize a potential
immunological reaction in patients being administered a Fhm
polypeptide as may occur with the adminstration of a polypeptide of
a foreign species, it is preferred that the natural cells producing
Fhm be of human origin and produce human Fhm. Likewise, it is
preferred that the recombinant cells producing Fhm be transformed
with an expression vector containing a gene encoding a human Fhm
polypeptide.
[0399] Implanted cells may be encapsulated to avoid the
infiltration of surrounding tissue. Human or non-human animal cells
may be implanted in patients in biocompatible, semipermeable
polymeric enclosures or membranes that allow release of Fhm
polypeptide but that prevent the destruction of the cells by the
patient's immune system or by other detrimental factors from the
surrounding tissue. Alternatively, the patient's own cells,
transformed to produce Fhm polypeptides ex vivo, may be implanted
directly into the patient without such encapsulation.
[0400] Techniques for the encapsulation of living cells are known
in the art, and the preparation of the encapsulated cells and their
implantation in patients may be accomplished without undue
experimentation. For example, Baetge et al. (WO 95105452 and
PCT/US94/09299) describe membrane capsules containing genetically
engineered cells for the effective delivery of biologically active
molecules. The capsules are biocompatible and are easily
retrievable. The capsules are biocompatible and are easily
retrievable. The capsules encapsulate cells transfected with
recombinant DNA molecules comprising DNA sequences coding for
biologically active molecules operatively linked to promoters that
are not subject to down-regulation in vivo upon implantation into a
mammalian host. The devices provide for the delivery of the
molecules from living cells to specific sites within a recipient.
In addition, see U.S. Pat. Nos. 4,892,538, 5,011,472, and
5,106,627, incorporated herein by reference. A system for
encapsulating living cells is described in International
Application WO 91/10425 of Aebischer et al., International
Application No. WO 91/10470 of Aebischer et al.; Winn et al.,
Exper. Neurol., 113:322-329, 1991, Aebischer et al., Exper.
Neurol., 111:269-275, 1991; and Tresco et al., ASAIO, 38:17-23,
1992, incorporated herein by reference.
[0401] In vivo and in vitro gene therapy delivery of Fhm is also
encompassed by the present invention. In vivo gene therapy may be
accomplished by introducing the gene encoding Fhm into cells via
local injection of a polynucleotide molecule or other appropriate
delivery vectors. (Hefti, J. Neurobiology,. 25:1418-1435, 1994).
For example, a polynucleotide molecule encoding Fhm may be
contained in an adeno-associated virus vector for delivery to the
targeted cells (See for e.g., International Publication No. WO
95/34670; International Application No. PCT/US95/07178). The
recombinant adeno-associated virus (AAV) genome typically contains
AAV inverted terminal repeats flanking a DNA sequence encoding Fhm
operably linked to functional promoter and polyadenylation
sequences.
[0402] Alternative viral vectors include, but are not limited to,
retrovirus, adenovirus, herpes simplex virus and papilloma virus
vectors. U.S. Pat. No. 5.672.344 (issued Sep. 30, 1997, Kelley et
al., University of Michigan) describes an in vivo viral-mediated
gene transfer system involving a recombinant neurotrophic HSV-1
vector. U.S. Pat. No.5,399,346 (issued Mar. 21, 1995, Anderson et
al., Department of Health and human Services) provides examples of
a process for providing a patient with a therapeutic protein by the
delivery of human cells which have been treated in vitro to insert
a DNA segment encoding a therapeutic protein. Additional methods
and materials for the practice of gene therapy techniques are
described in U.S. Pat. No. 5,631,236 (issued May 20, 1997, Woo et
al., Baylor College of Medicine) involving adenoviral vectors; U.S.
Pat. No. 5,672,510 (issued Sep. 30, 1997, Eglitis et al., Genetic
Therapy, Inc.) involving retroviral vectors; and U.S. Pat. No.
5,635,399 (issued Jun. 3, 1997, Kriegler et al., Chiron
Corporation) involving retroviral vectors expressing cytokines.
[0403] Nonviral delivery methods include liposome-mediated
transfer, naked DNA delivery (direct injection), receptor-mediated
transfer (ligand-DNA complex), electroporation, calcium phosphate
precipitation and microparticle bombardment (e.g., gene gun). Gene
therapy materials and methods may also include inducible promoters,
tissue-specific enhancer-promoters, DNA sequences designed for
site-specific integration, DNA sequences capable of providing a
selective advantage over the parent cell, labels to identify
transformed cells, negative selection systems and expression
control systems (safety measures), cell-specific binding agents
(for cell targeting), cell-specific internalization factors,
transcription factors to enhance expression by a vector as well as
methods of vector manufacture. Such additional methods and
materials for the practice of gene therapy techniques are described
in U.S. Pat. No. 4,970,154 (issued Nov. 13, 1990, D. C. Chang,
Baylor College of Medicine) electroporation techniques;
International Application No. WO 9640958 (published 961219, Smith
et al., Baylor College of Medicine) nuclear ligands; U.S. Pat. No.
5,679,559 (issued Oct. 21, 1997, Kim et al., University of Utah
Research Foundation) concerning a lipoprotein-containing system for
gene delivery; U.S. 5,676,954 (issued Oct. 14, 1997, K. L. Brigham,
Vanderbilt University involving liposome carriers; U.S. Pat. No.
5,593,875 (issued Jan. 14, 1997, Wurm et al., Genentech, Inc.)
concerning methods for calcium phosphate transfection; and U.S.
Pat. No. 4,945,050 (issued Jul. 31, 1990, Sanford et al., Cornell
Research Foundation) wherein biologically active particles are
propelled at cells at a speed whereby the particles penetrate the
surface of the cells and become incorporated into the interior of
the cells. Expression control techniques include chemical induced
regulation (e.g., International Application Nos. WO 9641865 and WO
9731899), the use of a progesterone antagonist in a modified
steroid hormone receptor system (e.g., U.S. Pat. No. 5,364,791),
ecdysone control systems (e.g., International Application No. WO
9637609), and positive tetracycline-controllable transactivators
(e.g., U.S. Pat. Nos. 5,589,362; 5,650,298; and 5,654,168).
[0404] It is also contemplated that Fhm gene therapy or cell
therapy can further include the delivery of a second protein. For
example, the host cell may be modified to express and release
soluble forms of both Fhm and TNF-.alpha., or Fhm and IL-1.
Alternatively, the Fhm and TNF-.alpha., or Fhm and IL-1, may be
expressed in and released from separate cells. Such cells may be
separately introduced into the patient or the cells may be
contained in a single implantable device, such as the encapsulating
membrane described above.
[0405] One manner in which gene therapy can be applied is to use
the Fhm gene (either genomic DNA, cDNA, and/or synthetic DNA
encoding a Fhm polypeptide, or a fragment, variant, or derivative
thereof) which may be operably linked to a constitutive or
inducible promoter to form a "gene therapy DNA construct". The
promoter may be homologous or heterologous to the endogenous Fhm
gene, provided that it is active in the cell or tissue type into
which the construct will be inserted. Other components of the gene
therapy DNA construct may optionally include, as required, DNA
molecules designed for site-specific integration (e.g., endogenous
flanking sequences useful for homologous recombination),
tissue-specific promoter, enhancer(s) or silencer(s), DNA molecules
capable of providing a selective advantage over the parent cell,
DNA molecules useful as labels to identify transformed cells,
negative selection systems, cell specific binding agents (for
example, for cell targeting) cell-specific internalization factors,
and transcription factors to enhance expression by a vector as well
as factors to enable vector manufacture.
[0406] A gene therapy DNA construct can then be introduced into the
patient's cells (either ex vivo or in vivo) using viral or
non-viral vectors . One means for introducing the gene therapy DNA
construct. Certain vectors, such as retroviral vectors, will
deliver the DNA construct to the chromosomal DNA of the cells, and
the gene can integrate into the chromosomal DNA. Other vectors will
function as episomes, and the gene therapy DNA construct will
remain in the cytoplasm. The use of gene therapy vectors is
described, for example, in U.S. Pat. Nos. 5,672,344; 5,399,346;
5,631,236; and 5,635,399, incorporated herein by reference.
[0407] In yet other embodiments, regulatory elements can be
included for the controlled expression of the Fhm gene in the
target cell. Such elements are turned on in response to an
appropriate effector. In this way, a therapeutic polypeptide can be
expressed when desired. One conventional control means involves the
use of small molecule dimerizers or rapalogs (as described in WO
9641865 (PCT/IUS96/099486); WO 9731898 (PCT/US97/03137) and
WO9731899 (PCT/US95/03157)WO 9731899 (PCT/US95/03157)) used to
dimerize chimeric proteins which contain a small molecule-binding
domain and a domain capable of initiating biological process, such
as a DNA-binding protein or a transcriptional activation protein.
The dimerization of the proteins can be used to initiate
transcription of the transgene.
[0408] An alternative regulation technology uses a method of
storing proteins expressed from the gene of interest inside the
cell as an aggregate or cluster. The gene of interest is expressed
as a fusion protein that includes a conditional aggregation domain
which results in the retention of the aggregated protein in the
endoplasmic reticulum. The stored proteins are stable and inactive
inside the cell. The proteins can be released, however, by
administering a drug (e.g., small molecule ligand) that removes the
conditional aggregation domain and thereby specifically breaks
apart the aggregates or clusters so that the proteins may be
secreted from the cell. See, Science 287:816-817, and 826-830
(2000).
[0409] Other suitable control means or gene switches include, but
are not limited to, the following systems. Mifepristone (RU486) is
used as a progesterone antagonist. The binding of a modified
progesterone receptor ligand-binding domain to the progesterone
antagonist activates transcription by forming a dimer of two
transcription factors which then pass into the nucleus to bind DNA.
The ligand bindingligand-binding domain is modified to eliminate
the ability of the receptor to bind to the natural ligand. The
modified steroid hormone receptor system is further described in
U.S. Pat. No. 5,364,791; WO9640911, and WO9710337,WO 9640911 and WO
9710337.
[0410] Yet another control system uses ecdysone (a fruit fly
steroid hormone) which binds to and activates an ecdysone receptor
(cytoplasmic receptor). The receptor then translocates to the
nucleus to bind a specific DNA response element (promoter from
ecdysone-responsive gene). The ecdysone receptor includes a
transactivation domain/DNA-binding domain/ligand-binding domain to
initiate transcription. The ecdysone system is further described in
U.S. Pat. No. 5,514,578; WO9738117; WO9637609;WO 9738117; WO
9637609 and WO9303162.
[0411] Another control means uses a positive
tetracycline-controllable transactivator. This system involves a
mutated tet repressor protein DNA-binding domain (mutated tet R-4
amino acid changes which resulted in a reverse
tetracycline-regulated transactivator protein, i.e., it binds to a
tet operator in the presence of tetracycline) linked to a
polypeptide which activates transcription. Such systems are
described in U.S. Pat. Nos. 5,464,758; 5,650,298 and 5,654,168.
[0412] Additional expression control systems and nucleic acid
constructs are described in U.S. Pat. Nos. 5,741,679 and 5,834,186,
to Innovir Laboratories Inc.
[0413] In vivo gene therapy may be accomplished by introducing the
gene encoding an Fhm polypeptide into cells via local injection of
an Fhm nucleic acid molecule or by other appropriate viral or
non-non-viral delivery vectors. (Hefti, Neurobiology, 25:1418-1435,
1994). For example, a nucleic acid molecule encoding an Fhm
polypeptide may be contained in an adeno-associated virus (AAV)
vector for delivery to the targeted cells (e.g., Johnson,
International Publication No. WO95/34670; and International
Application No. PCT/US95/07178). The recombinant AAV genome
typically contains AAV inverted terminal repeats flanking a DNA
sequence encoding an Fhm polypeptide operably linked to functional
promoter and polyadenylation sequences.
[0414] Alternative suitable viral vectors include, but are not
limited to, retrovirus, adenovirus, herpes simplex virus,
lentivirus, hepatitis virus, parvovirus, papovavirus, poxvirus,
alphavirus, coronavirus, rhabdovirus, paramyxovirus, and papilloma
virus vectors. U.S. Pat. No. 5,672,344 describes an in vivo
viral-mediated gene transfer system involving a recombinant
neurotrophic HSV-1 vector. U.S. Pat. No. 5,399,346 provides
examples of a process for providing a patient with a therapeutic
protein by the delivery of human cells which have been treated in
vitro to insert a DNA segment encoding a therapeutic protein.
Additional methods and materials for the practice of gene therapy
techniques are described in U.S. Pat. No. 5,631,236 involving
adenoviral vectors; U.S. Pat. No. 5,672,510 involving retroviral
vectors; and U.S. Pat. No. 5,635,399 involving retroviral vectors
expressing cytokines.
[0415] Nonviral delivery methods include, but are not limited to,
liposome-mediated transfer, naked DNA delivery (direct injection),
receptor-mediated transfer (ligand-DNA complex), electroporation,
calcium phosphate precipitation, and microparticle bombardment
(e.g., gene gun). Gene therapy materials and methods may also
include the use of inducible promoters, tissue-specific
enhancer-promoters, DNA sequences designed for site-specific
integration, DNA sequences capable of providing a selective
advantage over the parent cell, labels to identify transformed
cells, negative selection systems and expression control systems
(safety measures), cell-specific binding agents (for cell
targeting), cell-specific internalization factors, and
transcription factors to enhance expression by a vector as well as
methods of vector manufacture. Such additional methods and
materials for the practice of gene therapy techniques are described
in U.S. Pat. No. 4,970,154 involving electroporation techniques;
WO96/40958 involving nuclear ligands; U.S. Pat. No. 5,679,559
describing a lipoprotein-containing system for gene delivery; U.S.
Pat. No. 5,676,954 involving liposome carriers; U.S. Pat. No.
5,593,875 concerning methods for calcium phosphate transfection;
and U.S. Pat. No. 4,945,050 wherein biologically active particles
are propelled at cells at a speed whereby the particles penetrate
the surface of the cells and become incorporated into the interior
of the cells.
[0416] A means to increase endogenous Fhm polypeptide expression in
a cell via gene therapy is to insert one or more enhancer elements
into the Fhm polypeptide promoter, where the enhancer element(s)
can serve to increase transcriptional activity of the Fhm
polypeptides gene. The enhancer element(s) used will be selected
based on the tissue in which one desires to activate the gene(s);
enhancer elements known to confer promoter activation in that
tissue will be selected. For example, if a Fhm gene encoding a Fhm
polypeptide is to be "turned on" in T-cells, the ick promoter
enhancer element may be used. Here, the functional portion of the
transcriptional element to be added may be inserted into a fragment
of DNA containing the Fhm polypeptide promoter (and optionally,
inserted into a vector, 5' and/or 3' flanking sequence(s), etc.)
using standard cloning techniques. This construct, known as a
"homologous recombination construct", can then be introduced into
the desired cells either ex vivo or in vivo.
[0417] Gene therapy also can be used to decrease Fhm polypeptide
expression where desired by modifying the nucleotide sequence of
the endogenous promoter(s). Such modification is typically
accomplished via homologous recombination methods. For example, a
DNA molecule containing all or a portion of the promoter of the Fhm
gene(s) selected for inactivation can be engineered to remove
and/or replace pieces of the promoter that regulate transcription.
For example, the TATA box and/or the binding site of a
transcriptional activator of the promoter may be deleted using
standard molecular biology techniques; such deletion can inhibit
promoter activity thereby repressing the transcription of the
corresponding Fhm gene. The deletion of the TATA box or the
transcription activator binding site in the promoter may be
accomplished by generating a DNA construct comprising all or the
relevant portion of the Fhm polypeptide promoter(s) (from the same
or a related species as the Fhm gene(s) to be regulated) in which
one or more of the TATA box and/or transcriptional activator
binding site nucleotides are mutated via substitution, deletion
and/or insertion of one or more nucleotides. As a result, the TATA
box and/or activator binding site has decreased activity or is
rendered completely inactive. The construct, which also will
typically contain at least about 500 bases of DNA that correspond
to the native (endogenous) 5' and 3' DNA sequences adjacent to the
promoter segment that has been modified. The construct may be
introduced into the appropriate cells (either ex vivo or in vivo)
either directly or via a viral vector as described herein.
Typically, the integration of the construct into the genomic DNA of
the cells will be via homologous recombination, where the 5' and 3'
DNA sequences in the promoter construct can serve to help integrate
the modified promoter region via hybridization to the endogenous
chromosomal DNA.
[0418] Addititional Uses of Fhm Nucleic Acids and Polypeptides
[0419] Nucleic acid molecules of the present invention (including
those that do not themselves encode biologically active
polypeptides) may be used to map the locations of the Fhm gene and
related genes on chromosomes. Mapping may be done by techniques
known in the art, such as PCR amplification and in situ
hybridization.
[0420] Fhm nucleic acid molecules (including those that do not
themselves encode biologically active polypeptides), may be useful
as hybridization probes in diagnostic assays to test, either
qualitatively or quantitatively, for the presence of an Fhm DNA or
corresponding RNA in mammalian tissue or bodily fluid samples.
[0421] The Fhm polypeptides may be used (simultaneously or
sequentially) in combination with one or more cytokines, growth
factors, antibiotics, anti-inflammatories, and/or chemotherapeutic
agents as is appropriate for the indication being treated.
[0422] Other methods may also be employed where it is desirable to
inhibit the activity of one or more Fhm polypeptides. Such
inhibition may be effected by nucleic acid molecules which are
complementary to and which hybridize to expression control
sequences (triple helix formation) or to Fhm mRNA. For example,
antisense DNA or RNA molecules, which have a sequence that is
complementary to at least a portion of the selected Fhm gene(s) can
be introduced into the cell. Anti-sense probes may be designed by
available techniques using the sequence of Fhm polypeptide
disclosed herein. Typically, each such antisense molecule will be
complementary to the start site (5' end) of each selected Fhm gene.
When the antisense molecule then hybridizes to the corresponding
Fhm mRNA, translation of this mRNA is prevented or reduced.
Anti-sense inhibitors provide information relating to the decrease
or absence of an Fhm polypeptide in a cell or organism.
[0423] Alternatively, gene therapy may be employed to create a
dominant-negative inhibitor of one or more Fhm polypeptides. In
this situation, the DNA encoding a mutant polypeptide of each
selected Fhm polypeptide can be prepared and introduced into the
cells of a patient using either viral or non-viral methods as
described herein. Each such mutant is typically designed to compete
with endogenous polypeptide in its biological role.
[0424] In addition, an Fhm polypeptide, whether biologically active
or not, may be used as an immunogen, that is, the polypeptide
contains at least one epitope to which antibodies may be raised.
Selective binding agents that bind to an Fhm polypeptide (as
described herein) may be used for in vivo and in vitro diagnostic
purposes, including, but not limited to, use in labeled form to
detect the presence of Fhm polypeptide in a body fluid or cell
sample. The antibodies may also be used to prevent, treat, or
diagnose a number of diseases and disorders, including those
recited herein. The antibodies may bind to an Fhm polypeptide so as
to diminish or block at least one activity characteristic of an Fhm
polypeptide, or may bind to a polypeptide to increase at least one
activity characteristic of an Fhm polypeptide (including by
increasing the pharmacokinetics of the Fhm polypeptide). cDNA
encoding Fhm polypeptide in E. coli was deposited with the ATCC on
______ and having ATCC accession no. ______.
[0425] The following examples are intended for illustration
purposes only, and should not be construed as limiting the scope of
the invention in any way
EXAMPLE 1
Isolation of DNA Encoding Human Fhm
[0426] A TNF family profile search of the Amgen expressed sequence
tag (EST) database identified an EST clone designated
Fhm1-00016-g12 from a human macrophage cDNA library encoding a
potential TNF ligand family member. A full-length cDNA encoding Fhm
was obtained by PCR of first strand cDNA prepared from the 5637
cell line (ATCC # HTB-9) using the following primers:
3 1406-53: 5' GCCGAGGATCTGGGA CTGA (SEQ ID NO: 1) 1468-66 5'
TCGCCAATCCTCCAACCCATCTTA (SEQ ID NO: 2)
[0427] The Fhm cDNA comprises 819 nucleotides (SEQ ID NO: 3) and
encodes a polypeptide comprising 251 amino acids (SEQ ID NO: 4).
Fasta search of the SwissProt database with the predicted Fhm
protein sequence indicated that it is mostly related to TNFa with
28% identity in the C-terminal 162 amino acid overlap. Like other
TNF ligand family members. Fhm is a type II transmembrane protein,
containing a short N-terminal intracellular domain (amino acids
1-36), a hydrophobic transmembrane region (amino acids 37-56) and a
long C-terminal extracellular domain (amino acids 57-251). The
C-terminal extracellular domain of Fhm contained most of the
conserved region of the TNF ligand family (Smith et al., Cell
76:952-62, 1994).
EXAMPLE 2
Tissue Specific Expression of Fhm
[0428] Tissue specific expression patterns of Fhm gene may be
investigated by Northern blot analysis using a .sup.32P-labeled PCR
product as a probe to detect the presence of Fhm transcript in
various tissues.
[0429] Cytoplasmic and poly-A+ RNA is isolated from placenta,
developing embryos, and various adult tissues using standard
techniques Sambrook, J. et al, Molecular Cloning, Cold Spring
Harbor Laboratory Press, New York (1989). Cells/tissues are lysed
with 20 ml of TRIzol reagent (BRL), homogenized for 30 seconds, and
extracted with 4 ml of chloroform. The tubes were centrifuged at
4000 rpm for 30 minutes and the aqueous phase was transferred to
new tubes. RNA was precipitated by adding 10 ml isopropanol,
mixing, and centrifuging for 30 minutes at 4200 rpm. The RNA pellet
was washed with 10 ml of 70% ethanol, dried briefly, and
resuspended in 0.5 ml TE buffer. Poly A.sup.+ RNA is prepared by
using a commercially available mRNA purification kit (Pharmacia).
After elution of poly A.sup.+ RNA from the column in 750 .mu.l of
TE buffer, the sample was then ethanol precipitated by adding 40
.mu.l sample buffer and 1 ml ethanol and maintaining at -70.degree.
C. overnight. Poly A.sup.+ RNA was then fractionated using a
formaldehyde/agarose gel electrophoresis system. Following
electrophoresis, the gel is processed and the RNA transferred to a
nylon membrane. See Sambrook et al. Supra. Northern blots are then
prehybridized in 20 ml of prehybridization solution containing
5.times.SSPE, 50% formamide, 5.times. Denhardt's solution, 0.5% SDS
and 100 .mu.g/ml denatured salmon sperm DNA for 2-4 hours at
42.degree. C. The blots were then hybridized in 20 ml of
hybridization solution containing 6.times.SSPE, 50% formamide,
5.times. Denhardt's solution, 0.5% SDS, 100 ug/ml denatured salmon
sperm DNA. Approximately 5 ng/ml of random primed, .sup.32P-labeled
(RadPrime Kit, GIBCO) Fhm full length cDNA was used as a probe. The
blots were hybridized for 18-24 hours at 42.degree. C. The blots
were then washed in 0.1.times.SSC, 0.1% SDS at 55.degree. C. The
blots were then exposed to x-ray films for three days at 80.degree.
C. A weak expression of Fhm was detected in the kidneys.
EXAMPLE 3
Production of Fhm Polypeptides
[0430] A. Expression of Fhm Polypeptide in Bacteria
[0431] PCR are used to amplify template DNA sequences encoding an
Fhm polypeptide using primers corresponding to the 5' and 3' ends
of the sequence. The amplified DNA products may be modified to
contain restriction enzyme sites to allow for insertion into
expression vectors. PCR products are gel purified and inserted into
expression vectors using standard recombinant DNA methodology. An
exemplary vector, such as pAMG21 (ATCC No. 98113) containing the
lux promoter and a gene encoding kanamycin resistance is digested
with BamHI and NdeI for directional cloning of inserted DNA. The
ligated mixture is transformed into E. coli host strain 393 by
electroporation and transformants selected for kanamycin
resistance. Plasmid DNA from selected colonies is isolated and
subjected to DNA sequencing to confirm the presence of the
insert.
[0432] Transformed host cells are incubated in 2XYT medium
containing 30 .mu.g/ml kanamycin at 30.degree. C. prior to
induction. Gene expression can then be induced by addition of
N-(3-oxohexanoyl)-dl-homoserine lactone to a final concentration of
30 ng/ml followed by incubation at either 30.degree. C. or
37.degree. C. for six hours. Expression of Fhm polypeptide is
evaluated by centrifugation of the culture, resuspension and lysis
of the bacterial pellets, and analysis of host cell proteins by
SDS-polyacrylamide gel electrophoresis.
[0433] Inclusion bodies containing Fhm polypeptide are purified as
follows: Bacterial cells are pelleted by centrifugation and
resuspended in water. The cell suspension is lysed by sonication
and pelleted by centrifugation at 195,000.times.g for 5 to 10
minutes. The supernatant is discarded and the pellet washed and
transferred to a homogenizer. The pellet is homogenized in 5 ml. of
a Percoll solution (75% liquid Percoll. 0.15M NaCl) until uniformly
suspended and then diluted and centrifuged at 21,600.times.g for 30
minutes. Gradient fractions containing the inclusion bodies are
recovered and pooled. The isolated inclusion bodies are analyzed by
SDS-PAGE. Recombinant Fhm protein was purified as previously
described (WO 98/46751)
EXAMPLE 4
Production of Anti-Fhm Antibodies
[0434] Antibodies to Fhm polypeptides may be obtained by
immunization with purified Fhm protein or with Fhm peptides
produced by biological or chemical synthesis. Substantially pure
Fhm protein or polypeptide may be isolated from transfected cells
as described in Example 3. Concentration of protein in the final
preparation may be adjusted, for example, by concentration on an
amicon filter device, to the level of a few micrograms/ml.
Monoclonal or polyclonal antibodies to the protein can then be
prepared by any of the procedures known in the art for generating
antibodies such as those described in Hudson and Bay, "Practical
Immunology, Second Edition", Blackwell Scientific Publications,
incorporated herein by reference.
[0435] Polyclonal antiserum containing antibodies to heterogenous
epitopes of a single protein can be prepared by immunizing suitable
animals with the expressed protein described above, which can be
unmodified or modified to enhance immunogenicity. Effective
polyclonal antibody production is affected by many factors related
both to the antigen and the host species. For example, small
molecules tend to be less immunogenic than large molecules and may
require the use of carriers or adjuvants. Also, host animals vary
in response to site of inoculations and dose, with both inadequate
or excessive doses of antigen resulting in low titer antisera.
Small doses (ng levels) of antigen administered at multiple
intradermal sites appear to be most reliable. An effective
immunization protocol for rabbits can be found in Vaitukaitis, J.
et al. J. Clin. Endocrinol. Metab. 33: 988-991, 1971.
[0436] Booster injections can be given at regular intervals, and
antiserum harvested when antibody titer thereof, as determined
semi-quantitatively, for example, by double immunodiffusion in agar
against known concentrations of the antigen, begin to fall. See,
for example, Ouchterlony, O. et al., Chap. 19 in: Handbook of
Experimental Immunology ed. D. Weir, Blackwell, 1973. Plateau
concentration of antibody is usually in the range of 0.1 to 0.2
mg/ml of serum (about 12 um). Affinity of the antisera for the
antigen is determined by preparing competitive binding curves, as
described, for example, by Fisher, D., Chapt. 42 in; Manual of
Clinical Immunology, 2d Ed. (Rose and Friedman, eds.) Amer. Soc.
For Microbiol., Washington, D.C., 1980.
[0437] Alternative procedures for obtaining anti-Fhm antibodies may
also be employed, such as immunization of transgenic mice harboring
human Ig loci for production of fully human antibodies, and
screening of synthetic antibody libraries, such as those generated
by mutagenesis of an antibody variable domain.
EXAMPLE 5
Functional Analysis of the Role of Fhm
[0438] To determine the functional role of Fhm in vivo, the Fhm
gene is either over expressed in the germ line of animals or
inactivated in the germ line of mammals by homologous
recombination. See, e.g, U.S. Pat. No. 5,489,743 and Interantional
Patent Publication No. WO 94/28122, incorporated herein by
reference. Animals in which the gene is over expressed under the
regulatory control of exogenous or endogenous promoter elements are
known as transgenic animals. Animals in which an endogenous gene
has been inactivated by homologous recombination are also known as
"knockout" animals. Exemplary mammals include rabbits and rodent
species such as mice.
[0439] Transgenic animals allow for the determination of the
effect(s) of over expression or inappropriate expression of the Fhm
on development and disease processes. Fhm transgenic animals can
also serve as a model system to test compounds that can modulate
receptor mediated Fhm activity.
[0440] The "knockout" animals allow for the determination of the
role of Fhm in embryonic development, and in immune and
proliferative responses. The role of Fhm in development, and in
immune and proliferative response is determined by analysis the
effect(s) of gene knockout on the development of the embryo as well
as on the development and differentiation of various organs and
tissues such as the immune system in these animals. (as determined
by FACS analysis of cell populations at different stages of
development).
EXAMPLE 6
[0441] Specific Recognition of Fhm by Soluble TNF-Receptor Family
Member NTR3
[0442] For receptor binding assay, 2.times.10.sup.5 COS-7 cells
were seeded in 6-well plate. The next day, cells were transfected
with expression plasmid for Fhm by lipofectamin methods according
to the manufacturer's instructions (Gibco BRL). The eukaryotic
expression vector PCEP4 (Invitrogen) was used to generate the cDNA
contstruct. After 48 hours of transfection, the tissue culture
medium was replaced with tissue culture medium containing
TNF-receptor family member(s) fused with human IgG Fc portion.
After 1 hour incubation at room temperature (RT), cells were washed
three times with 5 ml PBS. Cells were then incubated in DMEM medium
containing 5% BSA and 1:500 dilution of goat anti-human IgG Fc
conjugated with alkaline phosphatase (Sigma) for another hour at
RT. After three washes with 5 ml TBS buffer, cells were stained
with Fast Red TR/AS-MX Substrate Kit (Pierce). Positive staining
was determined by visual examination under microscope. Fhm
transfected COS-7 cells were specifically recognized by NTR3Fc
fusion protein. The NTR3 protein, a member of the TNF receptor
supergene family, is described in detail in co-owned, co-filed
provisional U.S. patent application filed Aug. 4, 1999, Attorney
Docket No. 01017/35549, incorporated herein by reference in its
entirety.
[0443] While the present invention has been described in terms of
the preferred embodiments, it is understood that variations and
modifications will occur to those skilled in the art. Therefore, it
is intended that the appended claims cover all such equivalent
variations which come within the scope of the invention as claimed.
Sequence CWU 1
1
22 1 19 DNA Artificial Sequence Description of Artificial Sequence
PCR Primer for human FHM 1 gccgaggatc tgggactga 19 2 24 DNA
Artificial Sequence Description of Artificial Sequence PCR Primer
for human FHM 2 tcgccaatcc tccaacccat ctta 24 3 819 DNA Homo
sapiens CDS (37)..(789) Hu-Fhm 3 aagctgggta cagctgctag caagctctag
accacc atg gcc gag gat ctg gga 54 Met Ala Glu Asp Leu Gly 1 5 ctg
agc ttt ggg gaa aca gcc agt gtg gaa atg ctg cca gag cac ggc 102 Leu
Ser Phe Gly Glu Thr Ala Ser Val Glu Met Leu Pro Glu His Gly 10 15
20 agc tgc agg ccc aag gcc agg agc agc agc gca cgc tgg gct ctc acc
150 Ser Cys Arg Pro Lys Ala Arg Ser Ser Ser Ala Arg Trp Ala Leu Thr
25 30 35 tgc tgc ctg gtg ttg ctc ccc ttc ctt gca gga ctc acc aca
tac ctg 198 Cys Cys Leu Val Leu Leu Pro Phe Leu Ala Gly Leu Thr Thr
Tyr Leu 40 45 50 ctt gtc agc cag ctc cgg gcc cag gga gag gcc tgt
gtg cag ttc cag 246 Leu Val Ser Gln Leu Arg Ala Gln Gly Glu Ala Cys
Val Gln Phe Gln 55 60 65 70 gct cta aaa gga cag gag ttt gca cct tca
cat cag caa gtt tat gca 294 Ala Leu Lys Gly Gln Glu Phe Ala Pro Ser
His Gln Gln Val Tyr Ala 75 80 85 cct ctt aga gca gac gga gat aag
cca agg gca cac ctg aca gtt gtg 342 Pro Leu Arg Ala Asp Gly Asp Lys
Pro Arg Ala His Leu Thr Val Val 90 95 100 aga caa act ccc aca cag
cac ttt aaa aat cag ttc cca gct ctg cac 390 Arg Gln Thr Pro Thr Gln
His Phe Lys Asn Gln Phe Pro Ala Leu His 105 110 115 tgg gaa cat gaa
cta ggc ctg gcc ttc acc aag aac cga atg aac tat 438 Trp Glu His Glu
Leu Gly Leu Ala Phe Thr Lys Asn Arg Met Asn Tyr 120 125 130 acc aac
aaa ttc ctg ctg atc cca gag tcg gga gac tac ttc att tac 486 Thr Asn
Lys Phe Leu Leu Ile Pro Glu Ser Gly Asp Tyr Phe Ile Tyr 135 140 145
150 tcc cag gtc aca ttc cgt ggg atg acc tct gag tgc agt gaa atc aga
534 Ser Gln Val Thr Phe Arg Gly Met Thr Ser Glu Cys Ser Glu Ile Arg
155 160 165 cga gca ggc cga cca aac aag cca gac tcc atc act gtg gtc
atc acc 582 Arg Ala Gly Arg Pro Asn Lys Pro Asp Ser Ile Thr Val Val
Ile Thr 170 175 180 aag gta aca gac agc tac cct gag cca acc cag ctc
ctc atg ggg acc 630 Lys Val Thr Asp Ser Tyr Pro Glu Pro Thr Gln Leu
Leu Met Gly Thr 185 190 195 aag tct gta tgc gaa gta ggt agc aac tgg
ttc cag ccc atc tac ctc 678 Lys Ser Val Cys Glu Val Gly Ser Asn Trp
Phe Gln Pro Ile Tyr Leu 200 205 210 gga gcc atg ttc tcc ttg caa gaa
ggg gac aag cta atg gtg aac gtc 726 Gly Ala Met Phe Ser Leu Gln Glu
Gly Asp Lys Leu Met Val Asn Val 215 220 225 230 agt gac atc tct ttg
gtg gat tac aca aaa gaa gat aaa acc ttc ttt 774 Ser Asp Ile Ser Leu
Val Asp Tyr Thr Lys Glu Asp Lys Thr Phe Phe 235 240 245 gga gcc ttc
tta cta tagtaggtcg aggccggcaa ggccggatcc 819 Gly Ala Phe Leu Leu
250 4 251 PRT Homo sapiens 4 Met Ala Glu Asp Leu Gly Leu Ser Phe
Gly Glu Thr Ala Ser Val Glu 1 5 10 15 Met Leu Pro Glu His Gly Ser
Cys Arg Pro Lys Ala Arg Ser Ser Ser 20 25 30 Ala Arg Trp Ala Leu
Thr Cys Cys Leu Val Leu Leu Pro Phe Leu Ala 35 40 45 Gly Leu Thr
Thr Tyr Leu Leu Val Ser Gln Leu Arg Ala Gln Gly Glu 50 55 60 Ala
Cys Val Gln Phe Gln Ala Leu Lys Gly Gln Glu Phe Ala Pro Ser 65 70
75 80 His Gln Gln Val Tyr Ala Pro Leu Arg Ala Asp Gly Asp Lys Pro
Arg 85 90 95 Ala His Leu Thr Val Val Arg Gln Thr Pro Thr Gln His
Phe Lys Asn 100 105 110 Gln Phe Pro Ala Leu His Trp Glu His Glu Leu
Gly Leu Ala Phe Thr 115 120 125 Lys Asn Arg Met Asn Tyr Thr Asn Lys
Phe Leu Leu Ile Pro Glu Ser 130 135 140 Gly Asp Tyr Phe Ile Tyr Ser
Gln Val Thr Phe Arg Gly Met Thr Ser 145 150 155 160 Glu Cys Ser Glu
Ile Arg Arg Ala Gly Arg Pro Asn Lys Pro Asp Ser 165 170 175 Ile Thr
Val Val Ile Thr Lys Val Thr Asp Ser Tyr Pro Glu Pro Thr 180 185 190
Gln Leu Leu Met Gly Thr Lys Ser Val Cys Glu Val Gly Ser Asn Trp 195
200 205 Phe Gln Pro Ile Tyr Leu Gly Ala Met Phe Ser Leu Gln Glu Gly
Asp 210 215 220 Lys Leu Met Val Asn Val Ser Asp Ile Ser Leu Val Asp
Tyr Thr Lys 225 230 235 240 Glu Asp Lys Thr Phe Phe Gly Ala Phe Leu
Leu 245 250 5 69 PRT Homo sapiens 5 Glu Lys Lys Glu Leu Arg Lys Val
Ala His Leu Thr Gly Lys Ser Asn 1 5 10 15 Ser Arg Ser Met Pro Leu
Glu Trp Glu Asp Thr Tyr Gly Ile Val Leu 20 25 30 Leu Ser Gly Val
Lys Tyr Lys Lys Gly Gly Leu Val Ile Asn Glu Thr 35 40 45 Gly Leu
Tyr Phe Val Tyr Ser Lys Val Tyr Phe Arg Gly Gln Ser Cys 50 55 60
Asn Asn Leu Pro Leu 65 6 66 PRT Mouse 6 Glu Lys Lys Glu Pro Arg Ser
Val Ala His Leu Thr Gly Asn Pro His 1 5 10 15 Ser Arg Ser Ile Pro
Leu Glu Trp Glu Asp Thr Tyr Gly Thr Ala Leu 20 25 30 Ile Ser Gly
Val Lys Tyr Lys Lys Gly Gly Leu Val Ile Asn Glu Thr 35 40 45 Phe
Val Tyr Ser Lys Val Tyr Phe Arg Gly Gln Ser Cys Asn Asn Gln 50 55
60 Pro Leu 65 7 66 PRT Rat 7 Glu Thr Lys Lys Pro Arg Ser Val Ala
His Leu Thr Gly Asn Pro Arg 1 5 10 15 Ser Arg Ser Ile Pro Leu Glu
Trp Glu Asp Thr Tyr Gly Thr Ala Leu 20 25 30 Ile Ser Gly Val Lys
Tyr Lys Lys Gly Gly Leu Val Ile Asn Glu Ala 35 40 45 Phe Val Tyr
Ser Lys Val Tyr Phe Arg Gly Gln Ser Cys Asn Ser Gln 50 55 60 Pro
Leu 65 8 71 PRT Homo sapiens 8 Gly Asp Gln Asn Pro Gln Ile Ala Ala
His Val Ile Ser Glu Ala Ser 1 5 10 15 Ser Lys Thr Thr Ser Val Leu
Gln Trp Ala Glu Lys Gly Tyr Tyr Thr 20 25 30 Met Ser Asn Asn Leu
Val Thr Leu Glu Asn Gly Lys Gln Leu Thr Val 35 40 45 Lys Arg Gln
Tyr Ile Tyr Ala Gln Val Thr Phe Cys Ser Asn Arg Glu 50 55 60 Ala
Ser Ser Gln Ala Pro Phe 65 70 9 74 PRT Mouse 9 Gly Asp Glu Asp Pro
Gln Ile Ala Ala His Val Val Ser Glu Ala Asn 1 5 10 15 Ser Asn Ala
Ala Ser Val Leu Gln Trp Ala Lys Lys Gly Tyr Tyr Thr 20 25 30 Met
Lys Ser Asn Leu Val Met Leu Glu Asn Gly Lys Gln Leu Thr Val 35 40
45 Lys Arg Glu Gly Leu Tyr Tyr Val Tyr Thr Gln Val Thr Phe Cys Ser
50 55 60 Asn Arg Glu Pro Ser Ser Gln Arg Pro Phe 65 70 10 77 PRT
Mouse 10 Gly Lys Pro Glu Ala Gln Pro Phe Ala His Leu Thr Ile Asn
Ala Ala 1 5 10 15 Ser Ile Pro Ser Gly Ser His Lys Val Thr Leu Ser
Ser Trp Tyr His 20 25 30 Asp Arg Gly Trp Ala Lys Ile Ser Asn Met
Thr Leu Ser Asn Gly Lys 35 40 45 Leu Arg Val Asn Gln Asp Gly Phe
Tyr Tyr Leu Tyr Ala Asn Ile Cys 50 55 60 Phe Arg His His Glu Thr
Ser Gly Ser Val Pro Thr Asp 65 70 75 11 77 PRT Homo sapiens 11 Ser
Lys Leu Glu Ala Gln Pro Phe Ala His Leu Thr Ile Asn Ala Thr 1 5 10
15 Asp Ile Pro Ser Gly Ser His Lys Val Ser Leu Ser Ser Trp Tyr His
20 25 30 Asp Arg Gly Trp Ala Lys Ile Ser Asn Met Thr Phe Ser Asn
Gly Lys 35 40 45 Leu Ile Val Asn Gln Asp Gly Phe Tyr Tyr Leu Tyr
Ala Asn Ile Cys 50 55 60 Phe Arg His His Glu Thr Ser Gly Asp Leu
Ala Thr Glu 65 70 75 12 85 PRT Homo sapiens 12 Glu Arg Gly Pro Gln
Arg Val Ala Ala His Ile Thr Gly Thr Arg Gly 1 5 10 15 Arg Ser Asn
Thr Leu Ser Ser Pro Asn Ser Lys Asn Glu Lys Ala Leu 20 25 30 Gly
Arg Lys Ile Asn Ser Trp Glu Ser Ser Arg Ser Gly His Ser Phe 35 40
45 Leu Ser Asn Leu His Leu Arg Asn Gly Glu Leu Val Ile His Glu Lys
50 55 60 Gly Phe Tyr Tyr Ile Tyr Ser Gln Thr Tyr Phe Arg Phe Gln
Glu Glu 65 70 75 80 Ile Lys Glu Asn Thr 85 13 87 PRT Mouse 13 Gly
Gly Arg Pro Gln Lys Val Ala Ala His Ile Thr Gly Ile Thr Arg 1 5 10
15 Arg Ser Asn Ser Ala Leu Ile Pro Ile Ser Lys Asp Gly Lys Thr Leu
20 25 30 Gly Gln Lys Ile Glu Ser Trp Glu Ser Ser Arg Lys Gly His
Ser Phe 35 40 45 Leu Asn His Val Leu Phe Arg Asn Gly Glu Leu Val
Ile Glu Gln Glu 50 55 60 Tyr Ile Tyr Ser Gln Thr Tyr Phe Arg Phe
Gln Glu Ala Glu Asp Ala 65 70 75 80 Ser Lys Met Val Ser Lys Asp 85
14 64 PRT Homo sapiens 14 Arg Ala Pro Phe Lys Lys Ser Trp Ala Tyr
Leu Gln Val Ala Lys His 1 5 10 15 Leu Asn Lys Thr Lys Leu Ser Trp
Asn Lys Asp Gly Ile Leu His Gly 20 25 30 Val Arg Tyr Gln Asp Gly
Asn Leu Val Ile Gln Phe Pro Phe Ile Ile 35 40 45 Cys Gln Leu Gln
Phe Leu Val Gln Cys Pro Asn Asn Ser Val Asp Leu 50 55 60 15 64 PRT
Mouse 15 Ser Thr Pro Ser Lys Lys Ser Trp Ala Tyr Leu Gln Val Ser
Lys His 1 5 10 15 Leu Asn Asn Thr Lys Leu Ser Trp Asn Glu Asp Gly
Thr Ile His Gly 20 25 30 Leu Ile Tyr Gln Asp Gly Asn Leu Ile Val
Gln Phe Pro Phe Ile Val 35 40 45 Cys Gln Leu Gln Phe Leu Val Gln
Cys Ser Asn His Ser Val Asp Leu 50 55 60 16 73 PRT Homo sapiens 16
Asp Leu Ser Pro Gly Leu Pro Ala Ala His Leu Ile Gly Ala Pro Leu 1 5
10 15 Lys Gly Gln Gly Leu Gly Trp Glu Thr Thr Lys Glu Gln Ala Phe
Leu 20 25 30 Thr Ser Gly Thr Gln Phe Ser Asp Ala Glu Gly Leu Ala
Leu Pro Gln 35 40 45 Asp Tyr Leu Tyr Cys Leu Val Gly Tyr Arg Gly
Arg Ala Pro Pro Gly 50 55 60 Gly Gly Asp Pro Gln Gly Arg Ser Val 65
70 17 75 PRT Mouse 17 Asp Leu Asn Pro Glu Leu Pro Ala Ala His Leu
Ile Gly Ala Trp Met 1 5 10 15 Ser Gly Gln Gly Leu Ser Trp Glu Ala
Ser Gln Glu Glu Ala Phe Leu 20 25 30 Arg Ser Gly Ala Gln Phe Ser
Pro Thr His Gly Leu Ala Leu Pro Gln 35 40 45 Asp Gly Val Tyr Tyr
Leu Tyr Cys His Val Gly Tyr Arg Gly Arg Thr 50 55 60 Pro Pro Ala
Gly Arg Ser Arg Ala Arg Ser Leu 65 70 75 18 75 PRT Homo sapiens 18
Ala His Ser Thr Leu Lys Pro Ala Ala His Leu Ile Gly Asp Pro Ser 1 5
10 15 Lys Gln Asn Ser Leu Leu Trp Arg Ala Asn Thr Asp Arg Ala Phe
Leu 20 25 30 Gln Asp Gly Phe Ser Leu Ser Asn Asn Ser Leu Leu Val
Pro Thr Ser 35 40 45 Gly Ile Tyr Phe Val Tyr Ser Gln Val Val Phe
Ser Gly Lys Ala Tyr 50 55 60 Ser Pro Lys Ala Thr Ser Ser Pro Leu
Tyr Leu 65 70 75 19 72 PRT Mouse 19 Thr His Gly Ile Leu Lys Pro Ala
Ala His Leu Val Gly Tyr Pro Ser 1 5 10 15 Lys Gln Asn Ser Leu Leu
Trp Arg Ala Ser Thr Asp Arg Ala Phe Leu 20 25 30 Arg His Gly Phe
Ser Leu Ser Asn Asn Ser Leu Leu Ile Pro Thr Ser 35 40 45 Phe Val
Tyr Ser Gln Val Val Phe Ser Gly Glu Ser Cys Ser Pro Arg 50 55 60
Ala Ile Pro Thr Pro Ile Tyr Leu 65 70 20 71 PRT Homo sapiens 20 Arg
Thr Pro Ser Asp Lys Pro Val Ala His Val Val Ala Asn Pro Gln 1 5 10
15 Ala Glu Gly Gln Leu Gln Trp Leu Asn Arg Arg Ala Asn Ala Leu Leu
20 25 30 Ala Asn Gly Val Glu Leu Arg Asp Asn Gln Leu Val Val Pro
Ser Glu 35 40 45 Gly Leu Tyr Leu Ile Tyr Ser Gln Val Leu Phe Lys
Gly Gln Gly Cys 50 55 60 Pro Ser Thr His Val Leu Leu 65 70 21 70
PRT Mouse 21 Gln Asn Ser Ser Asp Lys Pro Val Ala His Val Val Ala
Asn His Gln 1 5 10 15 Val Glu Glu Gln Leu Glu Trp Leu Ser Gln Arg
Ala Asn Ala Leu Leu 20 25 30 Ala Asn Gly Met Asp Leu Lys Asp Asn
Gln Leu Val Val Pro Ala Asp 35 40 45 Gly Leu Tyr Leu Val Tyr Ser
Gln Val Leu Phe Lys Gly Gln Gly Cys 50 55 60 Pro Asp Tyr Val Leu
Leu 65 70 22 11 PRT Artificial Sequence Description of Artificial
Sequence Peptide from the HIV TAT protein 22 Tyr Gly Arg Lys Lys
Arg Arg Gln Arg Arg Arg 1 5 10
* * * * *