U.S. patent application number 10/806573 was filed with the patent office on 2004-12-30 for use of genetic markers to diagnose familial dysautonomia.
Invention is credited to Blumenfeld, Anat, Breakefield, Xandra O., Gusella, James F., Slaugenhaupt, Susan.
Application Number | 20040265867 10/806573 |
Document ID | / |
Family ID | 26727422 |
Filed Date | 2004-12-30 |
United States Patent
Application |
20040265867 |
Kind Code |
A1 |
Blumenfeld, Anat ; et
al. |
December 30, 2004 |
Use of genetic markers to diagnose familial dysautonomia
Abstract
Familial dysautonomia (FD), the Riley-Day syndrome, is an
autosomal recessive disorder characterized by developmental loss of
neurons from the sensory and autonomic nervous system. It is
limited to the Ashkenazi Jewish population, where the carrier
frequency is 1 in 30. We have mapped the FD gene to the chromosome
region 9q31-q33 by linkage with ten DNA markers in twenty-six
families. The maximum lod score of 21.1 with no recombinants was
achieved with D9S58. This marker also showed strong linkage
disequilibrium with FD, with one allele present on 73% of all
affected chromosomes compared to 5.4% of control chromosomes
(X.sup.2=3142, 15 d.f. p<0.0001). The other nine markers,
distributed within 23 cM proximal or distal to D9S58, also yielded
significant linkage to FD. D9S53 and D9S105 represent the closest
flanking markers for the disease gene. This localization will
permit prenatal diagnosis of FD in affected families.
Inventors: |
Blumenfeld, Anat; (Mevaseret
Zion, IL) ; Gusella, James F.; (Framingham, MA)
; Breakefield, Xandra O.; (Newton, MA) ;
Slaugenhaupt, Susan; (Quincy, MA) |
Correspondence
Address: |
MORGAN & FINNEGAN, L.L.P.
345 Park Avenue
New York
NY
10154-0053
US
|
Family ID: |
26727422 |
Appl. No.: |
10/806573 |
Filed: |
March 22, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10806573 |
Mar 22, 2004 |
|
|
|
09907190 |
Jul 17, 2001 |
|
|
|
09907190 |
Jul 17, 2001 |
|
|
|
09455683 |
Dec 7, 1999 |
|
|
|
6262250 |
|
|
|
|
09455683 |
Dec 7, 1999 |
|
|
|
08480655 |
Jun 7, 1995 |
|
|
|
5998133 |
|
|
|
|
08480655 |
Jun 7, 1995 |
|
|
|
08049678 |
Apr 16, 1993 |
|
|
|
08049678 |
Apr 16, 1993 |
|
|
|
07890719 |
May 29, 1992 |
|
|
|
5387506 |
|
|
|
|
Current U.S.
Class: |
435/6.13 ;
435/6.1 |
Current CPC
Class: |
Y10S 435/81 20130101;
C12Q 2600/156 20130101; C12Q 1/6858 20130101; C12Q 1/6883
20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Claims
1-17. (cancelled)
18. An isolated and purified nucleic acid sequence capable of
hybridizing to a region of the long arm of chromosome 9 between D9S
127 and D9S59, wherein said sequence is sufficiently linked to the
familial dysautonomia gene to diagnose familial dysautonomia with
the proviso that the nucleic acid sequence is not a sequence
selected from the group consisting of D9S58 and D9S59.
19. An isolated and purified nucleic acid sequence capable of
hybridizing to a region of the long arm of chromosome 9 between
D9S53 and D9S105, wherein said sequence is sufficiently linked to
the familial dysautonomia gene to diagnose familial dysautonomia
with the proviso that the nucleic acid sequence is not a sequence
selected from the group consisting of D9S58 and D9S59.
20. A method for detecting the presence in a subject of a
polymorphism linked to a gene associated with familial dysautonomia
which comprises: analyzing human chromosome 9 of the subject and
detecting the presence of a polymorphism located between D9S59 and
D9S127 inclusive and linked to the gene associated with familial
dysautonomia and wherein the presence of the polymorphism is
indicative of carriers of a gene associated with familial
dysautonomia.
21. The method according to claim 20, wherein the polymorphism is
located on the q31 band of the long arm of human chromosome 9.
22. The method according to claim 20, wherein the polymorphism is
located about 20 cM around D9S309.
23. The method according to claim 22, wherein the polymorphism is
located about 10 cM around D9S309.
24. The method according to claim 20, wherein the polymorphism is
located about 20 cM around D9S310.
25. The method according to claim 24, wherein the polymorphism is
located about 10 cM around D9S310.
26. The method according to claim 20, wherein the analyzing is
carried out by: (a) amplifying the polymorphism; (b) separating the
amplified polymorphism to generate a polymorphism pattern; (c)
correlating the presence or absence of the polymorphism with the
respective presence or absence of the gene associated with familial
dysautonomia by comparing a corresponding polymorphism pattern for
family members showing segregation between the familial
dysautonomia gene and the polymorphism.
27. The method according to claim 26, wherein the polymorphism is
detected by autoradiography.
28. The method according to claim 26, wherein the polymorphism
pattern of the subject is compared to the corresponding
polymorphism pattern for each parent of the subject which are
unaffected by familial dysautonomia disease and a family member
affected by familial dysautonomia disease.
29. A method for detecting the presence of polymorphisms linked to
a gene associated with familial dysautonomia in a subject,
comprising: (a) detecting a maternal polymorphism linked to the
gene associated with familial dysautonomia; (b) detecting a
paternal polymorphism linked to the gene associated with familial
dysautonomia; (c) typing the subject to determine the maternal
polymorphism and paternal polymorphism; (d) linking the
distribution of the maternal polymorphism and paternal polymorphism
with familial dysautonomia; and (e) determining if the subject has
the polymorphism located on the long arm of human chromosome 9
between D9S59 and D9S127, inclusive, linked to a gene associated
with familial dysautonomia.
30. A method for detecting the presence of polymorphisms linked to
a gene associated with familial dysautonomia in a subject
comprising typing blood relatives of a subject for a polymorphism
located on the long arm of human chromosome 9 located between D9S59
and D9S127, inclusive, and linked to the gene associated with
familial dysautonomia; and analyzing DNA from the subject and
detecting the presence of the polymorphism linked to the gene
associated with familial dysautonomia.
31. The method according to claim 30, wherein the polymorphism is
located within 10 cM of D9S309.
32. The method according to claim 30, wherein the polymorphism is
located within 10 cM of D9S310.
Description
[0001] This application is a continuation-in-part of U.S. patent
application Ser. No. 08/049,678 filed Apr. 16, 1993 which is a
continuation-in-part of U.S. patent application Ser. No. 07/890,719
filed May 29, 1992.
STATEMENT AS TO RIGHTS TO INVENTION
[0002] The present invention was developed at Massachusetts General
Hospital under obligation to assign the invention to the same. The
Dysautonomia Foundation has an option for an exclusive license for
the present invention.
FIELD OF THE INVENTION
[0003] This invention relates to genetic testing; more
specifically, to a method of detecting the presence of the familial
dysautonomia gene and also the identification of the location of
the familial dysautonomia gene in the genome.
BACKGROUND OF THE INVENTION
[0004] Familial dysautonomia, or the Riley-Day syndrome, is a rare
inherited neurological disease affecting the development and
survival of sensory, sympathetic and some parasympathetic neurons
(Riley, C. M. et al., Pediatrics 1949; 3:468-477; Axelrod, F. B.,
et al., Am. J. Dis. Child. 1984; 138:947-954; Axelrod, F. B., Cell.
Molec. Biol. Neuronal Dev. 1984; Ed.: Black, I. B., Plenum Press,
NY; 331-340). It is the most common and the best known of a group
of rare disorders, termed congenital sensory neuropathies, that are
characterized by widespread sensory, and variable autonomic
dysfunction. Patients with familial dysautonomia are affected from
birth with a variety of symptoms such as decreased sensitivity to
pain and temperature, vomiting crises and cardiovascular
instability all of which might result from a deficiency in a
neuronal growth factor pathway (Breakefield, X. O., et al., Proc.
Natl. Acad. Sci. USA 1984; 81:4213-4216; Breakefield, X. O., et
al., Mol. Biol. Med. 1986; 3:483-494). Neuropathological findings
have clearly differentiated familial dysautonomia from other
congenital sensory neuropathies (Axelrod, F. B., et al., Am. J.
Dis. Child., supra, Axelrod, F. B., Cell, Molec. Biol. Neuronal
Dev., supra.) The disorder is inherited as an autosomal recessive
with complete penetrance and is currently confined to individuals
of Ashkenazi Jewish descent (Brunt, P. W., et al., Medicine 1970;
49:343-374). In this population, the estimated carrier frequency is
1 in 30 with a disease incidence of 1 in 3600 births (Maayan, C.,
et al., Clinical Genet. 1987; 32:106-108). The clear-cut pattern of
transmission, apparent restriction to one ethnic population and
lack of confounding phenocopies suggest that all cases of familial
dysautonomia might have descended from a single mutation (Axelrod,
F. B., et al., Am. J. Dis. Child., supra, Axelrod, F. B., Cell.
Molec. Biol. Neuronal Dev., supra).
[0005] For more than 40 years, familial dysautonomia related
research concentrated on biochemical, physiological and
histological-pathological aspects of the disorder. Although those
studies contributed to a better understanding of the nature of the
disease, and indicated that a deficiency in a neuronal growth
factor pathway might be the cause of familial dysautonomia, they
did not result in identification of the familial dysautonomia gene,
thus, those studies did not contribute to the availability of a
genetic test for familial dysautonomia.
[0006] Chromosomal localization of the gene causing familial
dysautonomia can facilitate genetic counseling and prenatal
diagnosis in affected families. Subsequent delineation of closely
linked markers which show strong linkage disequilibrium with the
disorder and ultimately, identification of the defective gene can
allow screening of the entire at-risk population to identify
carriers, and potentially reduce the incidence of new cases.
[0007] Linkage analysis can be used to find the location of a gene
causing a hereditary disorder and does not require any knowledge of
the biochemical nature of the disease, i.e. the mutated protein
that is believed to cause the disease. Traditional approaches
depend on assumptions concerning the disease process that might
implicate a known protein as a candidate to be evaluated. The
genetic localization approach using linkage analysis (positional
cloning) can be used to first find the chromosomal region in which
the defective gene is located and then to gradually reduce the size
of the region in order to determine the location of the specific
mutated gene as precisely as possible. After the gene itself is
identified within the candidate region, the messenger RNA and the
protein are identified and along with the DNA, are checked for
mutations.
[0008] This latter approach has practical implications since the
location of the gene can be used for prenatal diagnosis even before
the altered gene that causes the disease is found. Identification
of DNA markers linked to the disease gene will enable molecular
diagnosis of carriers of the disease gene for familial dysautonomia
and the determination of the probability of having the disease.
This identification of the presence of the disease gene also
enables persons to evaluate either genetic probability of passing
this gene to their offspring or the presence of the mutated gene in
an unborn child. The mutation(s) in the specific gene responsible
for the pathogenesis of familial dysautonomia has its origin in the
Ashkenazi Jewish population. Accordingly, individuals of Ashkenazi
Jewish descent are at greatest risk of carrying the altered
gene.
[0009] The transmission of a disease within families, then, can be
used to find the defective gene. This approach to molecular
etiology is especially useful in studies of inherited neurologic
disorders, as only several thousands of the hundred-or-so thousand
genes active in the nervous system are known, and nervous tissue is
hard to obtain for biochemical analysis.
[0010] Linkage analysis is possible because of the nature of
inheritance of chromosomes from parents to offspring. During
meiosis the two homologues pair to guide their proper separation to
daughter cells. While they are lined up and paired, the two
homologues exchange pieces of the chromosomes, in an event called
"crossing over" or "recombination". The resulting chromosomes are
chimeric, that is, they contain parts that originate from both
parental homologues. The closer together two sequences are on the
chromosome, the less likely that a recombination event will occur
between them, and the more closely linked they are. In a linkage
analysis experiment, two positions on a chromosome are followed
from one generation to the next to determine the frequency of
recombination between them. In a study of an inherited disease, one
of the chromosomal positions is marked by the disease gene or its
normal counterpart, i.e. the inheritance of the chromosomal region
can be determined by examining whether the individual displays
symptoms of the disorder or is a parent of an affected individual
(carrier) or not. The other position is marked by a DNA sequence
that shows natural variation in the population such that the two
homologues can be distinguished based on the copy of the "marker"
sequence that they possess. In every family, the inheritance of the
genetic marker sequence is compared to the inheritance of the
disease state. If within a family carrying a recessive disorder
such as familial dysautonomia every affected individual carries the
same form of the marker and all the unaffected individuals carry at
least one different form of the marker, there is a great
probability that the disease gene and the marker are located close
to each other. In this way, chromosomes may be systematically
checked with known markers and compared to the disease state. The
data obtained from the different families is combined, and analyzed
together by a computer using statistical methods. The result is
information indicating the probability of linkage between the
genetic marker and the disease gene at different distance
intervals. A positive result indicates that the disease is very
close to the marker, while a negative result indicates that it is
far away on that chromosome, or on an entirely different
chromosome.
[0011] Linkage analysis is performed by typing all members of the
affected family at a given marker locus and evaluating the
co-inheritance of a particular disease gene with the marker probe,
thereby determining whether the two of them are close to each other
in the genome. The recombination frequency can be used as a measure
of the genetic distance between two gene loci. A recombination
frequency of 1% is equivalent to 1 map unit, or 1 centiMorgan (cM),
which is roughly equivalent to 1,000 kb of DNA. This relationship
holds up to frequencies of about 20% (or 20 cM).
[0012] The entire human genome is 3,300 cM long. In order to find
an unknown disease gene within 5-10 CM of a marker locus, the whole
human genome can be searched with 165-330 informative marker loci
spaced at 5-10 cM intervals (Botstein, D. R. I., et al., Am. J.
Hum. Genet. 1980; 32:314-331). The reliability of linkage results
is established by using a number of statistical methods.
[0013] The method most commonly used for the analysis of linkage in
humans is the LOD score method, developed by Morton, 1955; and
incorporated into the computer program LIPED by Ott, 1976. LOD
scores are the logarithm of the ratio of the likelihood that two
loci are linked at a given distance to that they are not linked
(>50 cM apart). The advantage of using logarithmic values is
that they can be summed among families with the same disease. This
becomes necessary given the relatively small size of human
families.
[0014] By convention, a total lod score greater than +3.0 (that is,
odds of linkage at the specified recombination frequency being 1000
times greater than odds of no linkage) is considered to be
significant evidence for linkage at that particular recombination
frequency; a total lod score of less than -2.0 (that is, odds of no
linkage being 100 times greater than odds of linkage at the
specified frequency) is considered to be strong evidence that the
two loci under consideration are not linked at that particular
recombination frequency.
[0015] Until recently, most linkage analyses have been performed on
the basis of two-point data; that is, the relationship between the
disorder under consideration and a particular genetic marker.
However, as a result of the rapid advances in mapping the human
genome over the last few years, and concomitant improvements in
computer methodology, it has become feasible to carry out linkage
analyses using multi-point data; that is, a simultaneous analysis
of linkage between the disease and several linked genetic markers,
when the recombination (genetic) distance among the markers is
known.
[0016] Multi-point analysis is advantageous for two reasons. First,
the informativeness of the pedigree is usually increased. Each
pedigree has a certain amount of potential information, dependent
on the number of parents heterozygous for the marker loci and the
number of affected individuals in the family. However, not all
markers are sufficiently polymorphic as to be informative in all
those individuals. If multiple markers are considered
simultaneously, then the probability of an individual being
heterozygous for at least one of the markers is greatly increased.
Second, and more important, an indication of the position of the
disease gene among the markers may be determined. This may allow
identification of flanking markers, and thus eventually allows
isolation of a small region in which the disease gene resides.
Lathrop, G. M., et al., Proc. Natl. Acad. Sci. USA 1984;
81:3443-3446 have written the most widely used computer package,
LINKAGE, for multi-point analysis.
[0017] When two loci are extremely close together, recombination
between them is very rare. In fact, the rate at which the two
neighboring loci recombine can be so slow as to be unobservable
except over many generations. The resulting allelic association is
generally referred to as linkage disequilibrium. Linkage
disequilibrium is defined as specific alleles at two loci that are
observed together on a chromosome more often than expected from
their frequencies in the population. Such results are strongly
influenced by founder and subpopulation effects, so it is generally
necessary to examine data only within one ethnic group or
population isolate, which is the case for familial dysautonomia,
which is only found in individuals of Ashkenazi Jewish descent.
Linkage disequilibrium is usually used to further define the
chromosomal region containing the disease gene, once linkage has
been demonstrated in a specific region. When disequilibrium is
suspected, the affected individuals are checked for increased
frequency of specific alleles for the marker loci. An excess
frequency of any allele, as measured against general population
frequencies (using the Chi-square statistics) would indicate
linkage disequilibrium. The major advantage of disequilibrium study
over standard linkage analysis is the need to test only a single
affected individual per family, which is the usual case with rare
recessive disorders, thus increasing the population amenable for
analysis.
[0018] The marker locus must be very tightly linked to the disease
locus in order for linkage disequilibrium to exist. Potentially,
markers within a few cM of the disease gene could be examined and
no linkage disequilibrium detected. Linkage disequilibrium has been
observed with markers within 500 kb of the cystic fibrosis gene
(Kerem, et al., Science 1989; 245:1073-1080). If linkage is found
with several marker loci that are spaced along several
centiMorgans, and none of them show recombination between the
marker tested and the disease status in affected families,
disequilibrium is the only genetic approach that can narrow down
the chromosomal region linked to the disease gene.
[0019] A specific DNA sequence in an individual can undergo many
different changes, such as deletion of a sequence of DNA, insertion
of a sequence that was duplicated, inversion of a sequence, or
conversion of a single nucleotide to another. Changes in a specific
DNA may be traced by using restriction enzymes that recognize
specific DNA sequences of 4-6 nucleotides. Restriction enzymes, cut
(digest) the DNA at their specific recognized sequence, resulting
in one million or so pieces. When a difference exists that changes
a sequence recognized by a restriction enzyme to one not
recognized, the piece of DNA produced by cutting the region will be
of a different size. The various possible fragment sizes from a
given region therefore depend on the precise sequence of DNA in the
region. Variation in the fragments produced is termed "restriction
fragment length polymorphism" (RFLP). The different sized-fragments
reflecting different variant DNA sequences can be visualized by
separating the digested DNA according to its size on an agarose gel
and visualizing the individual fragments by annealing to a
radioactively labeled, DNA "probe". Each individual can carry two
different forms of the specific sequence. When the two homologues
carry the same form of the polymorphism, one band will be seen.
More than two forms of a polymorphism may exist for a specific DNA
marker in the population, but in one family just four forms are
possible; two from each parent. Each child inherits one form of the
polymorphism from each parent. Thus, the origin of each chromosome
can be traced (maternal or paternal origin).
[0020] RFLPs have proven to be somewhat limiting in that they
usually give only two alleles at a locus and not all parents are
heterozygous for these alleles and thus informative for linkage.
Newer methods take advantage of the presence of DNA sequences that
are repeated in tandem, variable numbers of time and that are
scattered throughout the human genome. The first of these described
were variable number tandem repeats of core sequences (VNTRs)
(Jeffreys, A. J. V., et al., Nature 1985; 314:67-73; Nakamura, Y.
M., et al., Science 1987; 235:1616-1622). VNTRs are detected using
unique sequences of DNA adjacent to the tandem repeat as marker
probes, and digesting the DNA with restriction enzymes that do not
recognize sites within the core sequence. However, highly
informative VNTR loci have not been found on all chromosome arms,
and those which have been identified are often situated near
telomeres (Royle, et al., Genomics 1988; 3:352-360), leaving large
regions of the genome out of reach of these multiallelic marker
loci.
[0021] Recently, it was discovered that eukaryotic DNA has tandem
repeats of very short simple sequences termed SSRs (Simple Sequence
Repeat polymorphisms) such as (dC-dA).sub.n(dG-dT).sub.n where
n=10-60 (termed GT repeat). The (dG-dT) repeats occur every 30-60
kb along the genome (Weber, J. L., et al., Am. J. Hum. Genet.,
1989; 44:388-396; Litt, M., et al. Am. J. Hum. Genet., 1989;
44:397-401), and Alu 3' (A)n repeats occur approximately every 5 kb
(Economou, Proc. Natl. Acad. Sci. U.S.A. 1990; 87:2951-4). Other
repeats, such as GA repeats, trinucleotide and tetranucleotide
repeats are less common.
[0022] Oligonucleotides encoding flanking regions of these repeats
are used as primers for the polymerase chain reaction (PCR) (Saiki,
Science 1988; 239:484-491) on a small sample of DNA. By amplifying
the DNA with radioactive nucleotides, the sample may be quickly
resolved on a sequencing gel and visualized by autoradiography.
Because these polymorphisms are comprised of alleles differing in
length by only a few base pairs, they are not detectable by
conventional Southern blotting as used in traditional RFLP
analysis.
[0023] The use of PCR to characterize SSRs such as GT polymorphic
markers enables the use of less DNA, typically only ten nanograms
of genomic DNA is needed, and is faster than standard RFLP
analysis, because it essentially only involves amplification and
electrophoresis (Weber, supra).
[0024] Consequently, the present invention comprises genetic
linkage analysis to identify an individual having the familial
dysautonomia gene. In addition, discovery of markers linked to the
familial dysautonomia gene will enable researchers to focus future
analysis on a small chromosomal region and will accelerate the
identification and sequencing of the familial dysautonomia
gene.
[0025] It is an object of the present invention to locate markers
linked to the familial dysautonomia gene and to identify the
location of the familial dysautonomia gene in the human genome.
[0026] It is a further object of the present invention to provide a
genetic test specific for the familial dysautonomia gene by
analysis of DNA markers linked to the familial dysautonomia
gene.
[0027] It is a still further object of the present invention to
provide a genetic test for the prenatal diagnosis and carrier
detection specific for the familial dysautonomia gene by analysis
of DNA markers linked to the familial dysautonomia gene.
[0028] It is yet another object of this invention to provide
nucleic acid sequences encoding primers useful for detecting
polymorphisms or markers linked to the familial dysautonomia
gene.
[0029] It is a further object of the present invention to isolate
and characterize the gene for familial dysautonomia by analysis of
DNA markers linked to the familial dysautonomia gene.
[0030] It is also an object of this invention to provide products
useful for carrying out the assay in individuals from affected
familial dysautonomia families, such as DNA probes, kits and the
like.
SUMMARY OF THE INVENTION
[0031] The present invention describes, for the first time, the
chromosomal location which carries the gene responsible for
familial dysautonomia and provides a method of detecting the
presence of a familial dysautonomia gene in a subject. The location
by applicants of the familial dysautonomia gene is on the long arm
of human chromosome 9 (q arm) more specifically between D9S59 and
D9S127. In addition, we have mapped the FD gene to the chromosome
region 9q31-q33. Within the chromosomal region defined by D9S59 and
D9S127, the closest flanking markers for the disease gene are
D9S105, and D9S172. Other markers encompassed by this region
include D9S53, D9S310, D9S309 AND D9S174. A most probable location
of the familial dysautonomia gene is close to D9S58.
[0032] Linkage analysis with markers located on the long arm of
human chromosome 9 is used to identify the inheritance of the
allele causing familial dysautonomia with 80-90% accuracy, or
greater, at the present time.
[0033] In particular, the test is carried out by studying the
heritability of a combination of two or more polymorphisms linked
to familial dysautonomia among any number of suitable family
members so as to allow the determination of phenotype. The test can
be used prenatally to screen a fetus or presymptomatically, to
screen a subject at risk through his/her family.
[0034] The invention also extends to products useful for carrying
out the assay, such as DNA probes (labelled or unlabelled), kits
and the like.
BRIEF DESCRIPTION OF THE DRAWINGS
[0035] FIG. 1--Pedigrees of twenty-six families affected with
familial dysautonomia that were used for linkage analysis. Symbols:
empty circle unaffected female; filled circle, affected female;
empty square, unaffected male; filled square, affected male;
slashed symbol, deceased; star symbol, blood not collected.
[0036] FIG. 2--Table of lod scores of different chromosome 9
markers in dysautonomia families. The lod scores were calculated
assuming conventional recombination values (.theta.) between
familial dysautonomia and the marker; 0, 0.05, 0.1, 0.2, 0.3, 0.4.
When there is at least one recombination event between a marker
tested and the disease, the lod score at .theta.=0 is minus
infinity. At other recombination values, lod scores can be positive
or negative. The highest lod score obtained by each marker
{circumflex over ((Z))}, and the recombination value in which that
lod score was calculated {circumflex over ((.theta.))}, are also
included. This gives a rough estimation of the genetic distance
between the marker and the disease. The markers are ordered
according to their location on chromosome 9, when D9S15 is the most
centromeric one, and ASS is the closest to the telomere. In some
cases, the order of the markers is unknown, because they were not
placed on the same genetic map and were not typed with the same
pedigrees (D9S109-D9S29-D9S127). In this case the order was
determined according to {circumflex over (.theta.)} and according
to recombination events that were detected while setting the phase
(maternal or paternal origin) of the chromosones in FD families.
Additional data from other markers is also presented in Table
2.
[0037] FIG. 3--Physical and genetic map of chromosome 9
markers.
[0038] Physical map of human chromosome 9 markers. The names of the
bands on chromosome 9 were determined according to Giemsa dyes. All
the markers that show linkage with familial dysautonomia (FIG. 2)
are located on the long arm (q arm) of chromosome 9, most of which
are on band 31.
[0039] The genetic map positions of those FD-linked markers whose
relative order was supported by odds of greater than 1000:1 was
determined from combining the CEPH panel and the Venezuelan
reference pedigree. The relative order of D9S109 and D9S127 could
not be determined. D9S29 could not be positioned, but data from the
FD families suggest that it maps as shown.
[0040] FIGS. 4A and 4B--Examples of recombination events localizing
FD.
[0041] The region cosegregating with FD is shown as a filled box in
two nuclear families (FIG. 4A: pedigree 21; FIG. 4B: pedigree 17).
Hatched boxes indicate uncertainty with respect to the precise
position of a crossover due to uniformativeness of D9S58 in the
mother of pedigree 21, and D9S109 in the mother of pedigree 17. The
recombination event in pedigree 21 is the only instance of all 26
FD families where a crossover occurred within the D9S53-D9S105
interval that could not be placed relative to D9S58.
[0042] FIG. 5--Multipoint linkage of FD to chromosome 9.
[0043] FD was mapped with respect to the following map generated
from the Venezuelan reference pedigree:
[0044] D9S53-7.5 cM-D9S58-3.1 cM-D9S105 1.7 cM-D9S59 Arrows denote
the map location of each marker locus.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0045] The present invention further describes, for the first time,
the location and chromosomal band which carries the gene
responsible for familial dysautonomia.
[0046] To find the chromosomal location of the familial
dysautonomia gene, polymorphic markers were typed in 26 families
(FIG. 1). All selected families have two or three dysautonomic
members (25 families), or consanguinity between the parents (one
family). Thirty other families with one surviving FD member and 125
patients whose parents were not collected were used for allelic
association studies. All families were collected in North America
or Israel. The diagnosis of FD was confirmed in all cases based on
standard criteria (Axelrod, F. B. & Pearson, J., Am. J. Dis.
Child. 1984; 138:947-954; Axelrod, F. B., Cell. and Molec. Biol. of
Neuronal Dev. 1984; Ed: Black IB Plenum Press, NY 331-340). DNAs
from all family members, carriers, affected and unaffected, were
tested with each marker. The result of the typing was compared to
the disease status of each individual. Linkage analysis computer
data management and statistical programs were employed and the lod
scores of the different families were pooled together to give the
lod score for each marker at different distances from the
disease.
[0047] Control individuals were unrelated members of Ashkenazi
Jewish families with idiopathic torsion dystonia (n=130, 260
chromosomes) who manifested no dystonic or dysautonomic symptoms.
The torsion dystonia gene (DYTI) was mapped to 9q34 (Kramer, P. L.
et al., Ann. Neurol. 1990; 27:114-120); and is tightly linked to
ABL and ASS, (ozelius, L. J. et al., Am. J. Hum. Genet 1992;
50:619-628); both of which were excluded for linkage with FD (Table
2). Unaffected chromosomes from the FD parents (110 chromosomes)
were not used in the linkage disequilibrium studies; however, they
yielded allele frequencies similar to the other control
population.
[0048] Over 250 DNA polymorphisms distributed on all 22 autosomes
were checked before linkage was found. Most of IS the polymorphisms
yielded negative lod scores values and, hence, allowed the
exclusion of chromosomal regions as possible sites for the familial
dysautonomia gene. The few that had positive lod scores at some
distances from the markers, were slightly positive but far from
+3.0, that is conventionally accepted as a minimal demand for
linkage. Moreover, those slightly positive markers were surrounded
by negative flanking markers, indicating that the familial
dysautonomia gene was not in the immediate vicinity of that
chromosomal region.
[0049] The present invention relates to the location of polymorphic
markers on the long arm of human chromosome 9, which are linked to
the familial dysautonomia gene and enables linkage analysis to
predict both an affected individual having both familial
dysautonomia genes and a carrier with only one familial
dysautonomia gene. Linkage analysis with these polymorphisms can
identify the inheritance of the familial dysautonomia allele with
at least 80-90% accuracy. Polymorphisms are DNA sequences located
on the long arm of human chromosome 9. More specifically those
polymorphisms are in, or immediately adjacent to the q31 band on
the long arm of chromosome 9. Even more specifically, the familial
dysautonomia gene is mapped to the chromosome region 9q31-q33 by
linkage with ten DNA markers in twenty-six families. The linkage
analysis of the invention can be carried out by using any
polymorphism linked to the familial dysautonomia allele. The use of
the term polymorphism is intended to encompass any marker DNA
sequence which is linked to the familial dysautonomia gene. The
polymorphism can be a polymorphic repeating sequence or allelic
forms of a gene. The polymorphism must be located close to, or be
the same as, the familial dysautonomia gene. If located close to
the familial dysautonomia gene, the polymorphism must be
sufficiently close to the familial dysautonomia gene such that the
familial dysautonomia gene and the marker are linked. Linkage may
be determined by a significant lod score or other acceptable
statistical linkage determination.
[0050] The marker can be detected by a variety of methods. The
preferred detection means uses radioactive nucleotides in PCR
amplification of the polymorphism, or randomly labeled probes in
hybridization reactions. Other detection methods such as the ligase
chain reaction (LCR) can also be used. The polymorphism can be
detectably labeled by a radioisotope or by chemical modification
enabling direct detection of the polymorphism. Fluorescent or
calorimetric means can also be used. Detection of the polymorphism
can be indirect, e.g. a radioactive complementary strand of DNA,
resulting from incorporation of radioactive nucleotides in a
polymerase chain reaction.
[0051] For typing restriction fragment length polymorphisms (RFLPs)
and VNTR polymorphisms, genomic DNA prepared from cell lines
derived from all members of families affected with familial
dysautonomia was digested with restriction endonuclease, resolved
by electrophoresis on 0.8% agarose gels and transferred to Hybond
N+ membranes. Genomic DNA was either prepared form cell lines using
the SDS-proteinase K method; (Blumenfeld, A. et al., J. Med. Genet.
1993; 30:47-52) or directly from blood using the Chelex method
(Walsh, P. S. et al., BioTech. 1991; 10:506-513). Blots were
hybridized with probe DNAs radioactively labeled by random priming
and visualized by autoradiography (Ozelius, L., et al., Neuron
1989; 2:1427-1434).
[0052] For typing simple sequence repeat polymorphisms, the method
described by Weber, Am. J. Hum. Genet., supra, was used with the
following modifications; PCR reaction volume was reduced to 10
.mu.l using 5-10 ng genomic DNA, 40 ng of each primer, and about
0.25 U Taq polymerase (Boehringer). In most cases
.alpha.-.sup.32P-dGTP (3,000 Ci/mmole, Amersham) was used as the
labelled nucleotide. PCR conditions varied as has been previously
described for the specific markers. Dried gels were subjected to
autoradiography for 4-16 hours using Kodak X-OMAT AR film.
[0053] The following markers were used: D9S7 (Ozelius, L. J. et
al., Genomics 1992; 14:715-720; NIH/CEPH Collaborative Mapping
Group, Science 1992; 258:67-86; Williamson, R. et al., Cytogenet.
Cell Genet. 1991; 58:1190-1833), D9S15 (Kwiatkowski, D. J., et al.,
Genomics 1992; 12:229-240; Genome DataBase, Welch WH Medical
Library, Baltimore, Md. 21205; Ozelius, L. J. et al., Genomics
1992; 14:715-720; NIH/CEPH Collaborative Mapping Group, Science
1992; 258, 67-86), D9S29 (Ozelius, L. J. et al., Genomics 1992;
14:715-720; Williamson, R. et al., Cytocenet. Cell Genet. 1991;
58:1190-1833), D9S53 (Genome Data Base, Welch WH Medical Library,
Baltimore, Md. 21205; Ozelius, L. J. et al., Genomics 1992;
14:715-720; NIH/CEPH. Collaborative Mapping Group, Science 1992;
258:67-86; Wilkie, P. J., et al., Genomics 1992; 12:607-609), D9S58
(Kwiatkowski, D. J. et al., Genomics 1992; 12:229-240; Ozelius, L.
J. et al., Genomics 1992; 14:715-720; NIH/CEPH Collaborative
Mapping Group, Science 1992; 258:67-86), D9S59 (Kwiatkowski, D. J.
et al., Genomics 1992; 12:229-240; Ozelius, L. J. et al., Genomics
1992; 14:715-720), D9S66 (Kwiatkowski, D. J. et al., Genomics 1992;
12:229-240; Ozelius, L. J. et al., Genomics 1992; 14:715-720;
NIH/CEPH Collaborative Mapping Group, Science 1992; 258:67-86),
D9S105 (NIH/CEPH Collaborative Mapping Group, Science 1992;
258:67-86; Wilkie, P. J. et al., Genomics 1992; 12:607-609), D9S106
(Wilkie, P. J. et al., Genomics 1992; 12:607-609), D9S109 (NIH/CEPH
Collaborative Mapping Group, Science 1992; 258:67-86; Furlong, R.
A. et al., Nucleic Acids Res. 1992; 20:925), D9S127 (NIH/CEPH
Collaborative Mapping Group, Science 1992; 258:67-86; Lyall, J. E.
W. et al., Nucleic Acids Res. 1992; 20:925), HXB (Ozelius, L. J. et
al., Genomics 1992; 14:715-720; NIH/CEPH Collaborative Mapping
Group, Science 1992; 258:67-86; Ozelius, L., et al., Hum. Molec.
Genet. 1992; 1:141; Povey, S. et al., Ann. Hum. Genet. 1992;
56:167-221), GSN (Ozelius, L. J. et al., Genomics 1992; 14:715-720;
NIH/CEPH Collaborative Mapping Group, Science 1992; 258:67-86;
Williamson, R. et al., Cytoaenet. Cell Genet. 1991; 58:1190-1833),
ABL (Kwiatkowski, D. J. et al., Genomics 1992; 12:229-240; Ozelius,
L. J. et al., Genomics 1992; 14:715-720; NIH/CEPH Collaborative
Mapping Group, Science 1992; 258:67-86), and ASS (Kwiatkowski, D.
J. et al., Genomics 1992; 12:229-240; Ozelius, L. J. et al.,
Genomics 1992; 14:715-720; NIH/CEPH Collaborative Mapping Group,
Science 1992; 258:67-86).
[0054] The LIPIN (v. 2.1) data management program was used for
entry of marker phenotypes into a VAX4500 computer. Pairwise lod
scores were calculated using MLINK (v. 3.5) and LINKMAP (V.4.9)
(Lathrop, G. M. et al. Proc. Natl. Acad. Sci. USA 1984;
81:3443-3446). For multipoint analysis, the loop in family 14 was
broken, and only the portion of family 16 with two surviving
affecteds was used. Consequently, the maximum multi-point lod score
was slightly lower than the maximum two-point score with D9S58.
Autosomal recessive inheritance, complete penetrance, no rate of
new mutations, and a gene frequency of {fraction (1/60)} were
assumed for familial dysautonomia.
[0055] The relative order of most of the markers has been
established previously in both the Venezuelan reference pedigree
and in the CEPH panel (Kwiatkowski, D. J. et al. Genomics 1992;
12:229-240; Ozelius, L. J. et al., Genomics 1992; 14:715-720;
NIH/CEPH Collaborative Mapping Group, Science 1992;
258:67-86;Wilkie, P. J. et al. Genomics 1992; 12:607-609; Povey, S.
et al., Ann. Hum. Genet. 1992; 56:167-221). To obtain accurate map
distances for the multi-point analysis, we genotyped D9S105 and
D9S53 in the original 17 sibships of the Venezuelan reference
pedigree (Tanzi, R. E. et al., Genomics 1988; 3:129-136. These data
were analyzed in conjunction with previously typed markers
(Kwiatkowski, D. J. et al., Genomics 1992; 12:229-240; Ozelius, L.
J. et al., Genomics 1992; 14:715-720) using the MAPMAKER program
(version 1.0) (Lander, E. S. et al., Genomics 1987; 1:174-181). For
comparison, we genotyped the CEPH panel for D9S59 and reanalyzed
the previously reported data, NIH/CEPH Collaborative Mapping Group,
Science 1992; 258:67-86; Wilkie, P. J. et al., Genomics 1992;
12:607-609). The distances used in the multi-point analysis (FIG.
5) were derived from the Venezuelan data set after error checking
of apparent double recombinants. In both reference pedigree sets,
the marker order was identical and the distances between adjacent
markers were similar.
[0056] The first DNA polymorphism that gave a significant positive
lod score (FIG. 2) was HXB which is located on the long arm of
chromosome 9 (FIG. 3). Table 1 provides the oligonucleotide primer
sequences for each polymorphism and the corresponding
reference.
1TABLE 1 Marker Oligonucleotide Primer Sequence* Ref. HXB**
ATAGCCAAAGAGAGGTGCCC 1 AGAGCCCTTCTGTCTTTTCC D9S127**
CCCTCAAAATTGCTGTCTAT 2 AGATTGATTGATACAAGGATTTG D9S58**
CCTGAGTAGCCGGGACTATA 3 TAGGCAACACATCAAGATCCT D9S59**
AAGGGAATTCATCCCCTGCT 3 TTACACTATACCAAGACTCC ASS
GGTTGGCCTAAGAAAACCAT 3 TGGGGAGCTATAAAAATGAC D9S66
CAGACCAGGAATGCATGAAG 3 CACGGGCACACATGTATGC D9S15
TAAAGATTGGGAGTCAAGTA 3 TTCACTTGATGGTGGTAATC D9S53**
GCTGCATACTTTAAACTAGC 4 GGAATATGTTTTTATTAGCTTG D9S105**
GATCATATTGCTTACAACCC 4 ACTTACTCATTAAATCTAGGG D9S109**
GCACAGGCTGCAATATAGAC 5 TTTACTGTATAAAAACTGAAGCTAA- TA D9S106**
ATTGTGTTGAAATTTGACCCCT 4 CCAGGCTTATTTCCACACCT ABL
TTTACACCTTCACCCAGAGA 3 GGCTGTGTTCAGTTAAACGT GSN**
CAGCCAGCTTTGGAGACAAC 6 TCGCAAGCATATGACTGTAA *Oligonucleotide primer
sequences are listed 5' to 3'. **Markers linked to the familial
dysautonomia gene. 1 Ozelius, L. et al., Human Mol. Genet. 1992;
1:141. 2 Lyall, J. E. W., et al., Nucl. Acids Res. 1992; 20:925. 3
Kwiatkowski, D. J., et al. Genomics 1992; 12:229-240. 4 Wilkie, P.
J., et al., Genomics 1992; 12:604-609. 5 Furlong, R. A., et al.,
Nucl. Acids Res. 1992; 20:925. 6 Kwiatkowski, D. J., et al. Nucl.
Acids Res. 1991; 19:967.
[0057] Based on the linkage results obtained with HXB, GT
polymorphism analysis of chromosome 9 was performed using a panel
of markers (See, Table 1) recently characterized in Kwiatkowski, D.
J., et al., Genomics 1992; 12:229-240 (incorporated by reference);
Lyall, J. E. W., et al., Nucl. Acid Res. 1992; 20(4):925
(incorporated by reference); Ozelius, L., et al., Hum. Mol. Genet.
1992; 1:141 (incorporated by reference); Wilkie, P. J., et al.,
Genomics 1992; 12:604-609 (incorporated by reference); Furlong, R.
A. et al., Nucl. Acids. Res. 1992; 10:925 (incorporated by
reference); Kwiatkowski, D. J. et al. Nucl. Acids Res. 1991; 19:967
(incorporated by reference) and D9S29 regular polymorphism
(Williamson, R., et al., Cytoaenet. Cell Genet. 1991; 58:1190-1833
(incorporated by reference)). Flanking markers on both sides of HXB
were tested. Markers that were located closer to the centromere
than HXB (e.g., D9SS9, D9S58, D9S105, D9S127) gave higher lod
scores, while those that were closer to the end (telomere) of the
long arm (e.g., ASS) gave lower lod scores. See, Table 2.
[0058] The highest lod score was found with D9S58 (Kwiatkowski, et
al., Genomics, supra) which has no recombinations between the
marker and the disease status in all 26 familial dysautonomia
families tested, and gave a lod score of 21.1 at zero distance.
That means that D9S58 is located genetically at the same place as
the familial dysautonomia gene with a ratio of 1:1021.1 in favor of
linkage, while a ratio of 1:10.sup.3 is sufficient to prove
linkage, and the maximal lod score possibly available with the 26
FD families is about 23.5 (1:10.sup.23.5 in favor of linkage). All
other markers that were typed, gave lower lod scores than D9S58,
and all of them also show recombination events between the marker
and the familial dysautonomia gene in some of the families. The
current lod scores on chromosome 9 markers that show some linkage
to the familial dysautonomia gene are summarized in FIG. 2 and
Table 2. Two flanking markers that are close to D9S58 are D9S59
(telomeric) and D9S127 (centromeric to D9S58). The closest flanking
markers of those analyzed are D9S53 and D9S105. These markers were
mapped genetically on both sides of D9S58 on large pedigrees, at
distances of 4cM for D9S59 and about 15 cM for D9S127, and were
mapped physically to the same chromosomal region as D9S58. D9S58
was mapped to a chromosomal band q31 (Kwiatkowski, et al.,
Genomics, supra); D9S127 was mapped to the same band (Lyall, et
al., Nucl. Acid Res., supra), and D9S59 to q31 or q32,
(Kwiatkowski, et al., Genomics, supra) (FIG. 1).
[0059] Thus, genetic and physical data help to map the dysautonomia
gene to chromosome 9q31, at the telomeric end of the band, and to a
genetic region of about 20 cM around D9S58, that correlates to
about 20 million nucleotides. Markers D9S53 and D9S105 further
restrict the location of the FD gene to within 10 cM, i.e., 10
million nucleotides, around DS958. Although D9S58 shows complete
cosegregation with the familial dysautonomia gene in all
dysautonomia families that were checked, it is not possible at this
stage of research to claim that D9S58 is located on top of the
gene. More markers flanking D9S58 at smaller genetic distances need
to be found and tested in order to locate the familial dysautonomia
gene in a region small enough that will provide higher quality
genetic tests for familial dysautonomia families (a region of 1-5
million nucleotides) and to specifically find the mutated gene.
Narrowing down the region in which the gene is located will lead to
identifying/cloning of the familial dysautonomia gene as well as
sequencing thereof. Further genetic analysis employing, for
example, new polymorphisms flanking D9S58 as well as the use of
cosmids, YAC (yeast artificial chromosomes) clones or mixtures
thereof, can be employed in the narrowing down process and
techniques such as PFGE (pulsed field gel electrophoresis) or
fingerprinting by Alu PCR. The next step in narrowing down will
include cloning of the chromosomal region 9q31 including proximal
and distal markers in a contig formed by overlapping cosmids.
Subsequent subcloning in cosmids, plasmids or phages will generate
additional probes for more detailed mapping.
[0060] The next step of cloning the gene will involve exon
trapping, screening of cDNA libraries, Northern blots or rtPCR
(reverse transcriptase PCR) of autopsy tissues from affected and
unaffected individuals, direct sequencing of exons or testing exons
by SSCP (single strand conformation polymorphism), RNase protection
or chemical cleavage, or any other state-of-art technique.
[0061] Further localization of the FD gene to chromosome 9 was
obtained as follows:
[0062] Linkage of FD to Chromosome 9
[0063] Twenty-six families useful for linkage analysis were
collected (FIG. 1). The first marker locus that showed a
significant positive lod score was HXB (FIG. 3) in 9q32-q33
({circumflex over (z)}-9.0 at .theta.-0.04) (Table 2). Fourteen
additional chromosome 9 markers, 9 mapping proximal to HXB and 5
mapping distal to HXB, were also tested (Table 2).
2TABLE 2 PAIRWISE LOD SCORES OF CHROMOSOME 9 MARKERS WITH FD
RECOMBINATION FRACTION (.crclbar.) Marker 0.00 0.01 0.05 0.10 0.20
0.30 0.40 z .crclbar. D9S15 -.infin. -16.5 -5.5 -1.8 0.5 0.8 0.4
0.8 0.27 D9S29 -.infin. 3.8 5.5 5.3 3.8 2.1 0.6 5.6 0.06 D9S109
-.infin. 3.7 5.9 5.8 4.1 2.2 0.6 6.0 0.07 D9S127 -.infin. 6.6 8.0
7.3 5.0 2.6 0.7 8.0 0.05 D9S53 -.infin. 10.4 10.8 9.5 6.3 3.2 0.9
11.0 0.03 D9S58 21.1 20.6 18.3 15.5 9.9 5.0 1.5 21.1 0.00 D9S105
-.infin. 13.8 12.8 11.0 7.2 3.7 1.1 13.8 0.01 D9S59 -.infin. 6.7
8.5 8.0 5.6 2.9 0.9 8.5 0.05 D9S106 -.infin. 10.1 10.5 9.4 6.3 3.3
0.9 10.7 0.03 HXB -.infin. 8.4 9.0 8.0 5.4 2.7 0.8 9.0 0.04 GSN
-.infin. 2.4 6.0 6.4 4.8 2.6 0.8 6.5 0.08 ABL -.infin. -7.9 -2.0
-0.1 0.7 0.5 0.1 0.7 0.21 ASS -.infin. -14.9 -5.0 -1.6 0.4 0.6 0.2
0.6 0.26 D9S66 -.infin. -17.6 -6.3 -2.4 0.1 0.4 0.2 0.5 0.29 D9S7
-.infin. -6.7 -2.8 -1.4 -0.4 -0.1 -0.0 0.0 0.50
[0064] Restriction fragment length polymorphisms were used for
D9S29 and D9S7, while the remaining loci were typed using SSR
polymorphisms. ASS was genotyped for both an RFLP and an SSR, and
the results were haplotyped. Ten of the 15 markers tested detected
significant linkage with FD although only D9S58 showed no
recombination events with the disease gene. These DNA markers all
map to 9q22.3-q33 (FIG. 3).
[0065] Definition of Flanking Markers
[0066] D9SSS, which showed complete cosegregation with FD, was
heterozygous in 59 of the 62 parents of affected children shown in
FIG. 1. the 1-lod -unit confidence interval for the separation
between FD and D9S58 is 1.8 cM. For the purpose of prenatal
diagnosis, however, use of a single marker is prone to potential
error occasioned by rare crossover events with the disease gene.
Thus, close flanking markers on either side of the FD gene are
required to maximize the informativeness and accuracy of prenatal
or carrier testing.
[0067] To define flanking loci, the phase of selected linked
markers was determined in the FD families. The order of these loci
as determined by combining data from the CEPH and Venezuelan
reference pedigrees is: cen--(D9S109,
D9S127)-D9S53-D9S58-D9S105-D9S59-HXB-tel (FIG. 3). Recombination
events in the FD families confirm this order and suggest that
D9S109 maps proximal to D9S127. Similarly, markers that did not map
with significant odds in the reference pedigree data could be
positioned tentatively as follows: D9S29 proximal to D9S109 and
D9S106 within the interval D9S59-HXB. FIGS. 4A and 4B shows
examples of recombination events detected within the FD pedigrees.
In FIG. 4A, recombination was detected between D9S53 and D9S105,
with FD segregating with the telomeric markers. Unfortunately, in
this instance the mother was homozygous at D9S58 limiting the
assignment of FD to a position distal to D9S53. FIG. 4B displays
two additional simple crossovers that place the FD gene proximal to
D9S105 and distal to D95S3, respectively. These, and additional
crossovers (not shown) are consistent with D9553 and D93105 being
the closest flanking markers.
[0068] To provide a statistical basis supporting the definition of
flanking markers, we performed multipoint linkage analysis. FD was
analyzed relative to four firmly mapped marker loci: D95S3, D95S8,
D9S105 and D9SS9 (FIG. 5). The genetic distances between the
markers were calculated from the Venezuelan references pedigree.
(Tanzi, R. E. et al., Genomics 1988; 3:129-136). This analysis
firmly positioned FD coincident with D9S58, between D9S53 and
D9S105. A localization within this interval-was favored by more
than 10.sup.5:1 over any other interval, confirming D9S53 and
D9S105 as flanking markers for genetic diagnosis.
[0069] Linkage Diseouitibrium with FD
[0070] The restriction of FD to individuals of Ashkenazi Jewish
ancestry suggests the possibility of a founder effect in which most
or all affected alleles share a common origin. Consequently, we
examined the closely linked markers for evidence of allele
association. Marker genotypes were obtained for 353 different FD
chromosomes from the 26 linkage families and 148 families with
single affected individuals. Four marker loci, D9S58, D9S59, D9S105
and D9S106, yielded X.sup.2 values significant at p<0.01. The
allele association with FD at D9S58 and D9S105 was particularly
striking (Table 3).
3TABLE 3 LINKAGE DISEQUILIBRIUM OF FD WITH D9S58 AND D9S105 NUMBER
OF CHROMOSOMES MARKER PCR PRODUCT CONTROL FD FD ALLELE SIZE (bp)
OBSERVED EXPECTED OBSERVED D9S58- 1 151 1 1 0 2 149 1 1 0 3 147 12
16 1 4 145 5 7 0 5 143 3 4 4 6 141 3 4 0 7 139 10 14 2 8 137 23 31
4 9 135 22 30 10 10 133 6 8 1 11 131 16 22 3 12 129 20 27 9 13 127
36 49 37 14 125 16 22 3 15 123 18 24 2 16 121 18 24 14 17 119 2 3 1
18 117 14 19 256 19 115 16 22 2 20 113 15 20 2 21 105 2 3 1 22 101
1 1 1 260 353 353 X.sup.2 = 3142 15 D.F.* P < 0.0001 D9S105 1
203 6 9 4 2 201 13 19 12 3 199 19 27 18 4 197 34 49 20 5 195 29 42
21 6 193 13 19 9 7 191 24 35 37 8 189 64 93 186 9 187 11 16 4 10
183 2 3 0 215 311 311 X.sup.2 = 147 8 D.F.* P < 0.0001 *For
D9S58 and D9S105 classes 1, 2, 5, 6, 17, 21 and 22 and classes 1
and 10, respectively, were clustered.
[0071] D9S58 displayed 22 alleles in a collection of 260 control
chromosomes from the Ashkenazi Jewish population (Table 3).
Eighteen of these alleles were seen on FD chromosomes, but the "18"
allele (117 bp)- was strikingly overrepresented. Of the 353 FD
chromosomes available, 256 or 73% displayed an "18" allele for
D9S58. This compares with a frequency of 5% (14 of 260) in the
control Ashkenazi Jewish population. The allele association with FD
was highly significant (X.sup.2=3142, 15 d.f. (based on pooling
classes with expected values less than 5), p<0.0001).
[0072] D9S105, located about 3 cM from D9S58, also displayed
significant linkage disequilibrium with FD (X.sup.2=147, 8 d.f.,
p<0.0001). D9S105 possessed 10 alleles in the control population
(Table 3). Allele "8" (189 bp), the most common allele in the
control population (30%) was overrepresented in FD (60%).
[0073] As expected, the most frequent haplotype of D9S58 and D9S105
on FD chromosomes was "18,8" (54%). This haplotype was rare in
control Ashkenazi Jews, representing just 2.5% of control
chromosomes. Since the carrier frequency for FD is estimated at
3.3%, many of the "18.8" chromosomes present in the normal
population may reflect FD chromosomes present in undetected
carriers.
[0074] X.sup.2 values for D9S59 and D9S106 were 18.1 (4 d.f.;
p<0.005) and 17.3 (6 d.f.; p<0.01), respectively. The next
markers proximal and distal (FIG. 3), D9S53 and HXB, showed no
allele association with FD (data not shown).
[0075] Additional Markers Linked with the Familial Dysautonomia
Gene
[0076] Additional markers linked to familial dysautonomia gene have
been identified while constructing a physical map of the familial
dysautonomia gene candidate region. Cosmids were screened for the
presence of repetitive DNA stretches (di, tri, tetranucleotide
respeats). When a cosmid is positive on hybridization with
synthetic oligonucleotides, the cosmid is subcloned into plasmids.
Plasmids positive for repeat sequences are sequenced and PCR
primers developed or designed to amplify the repetitive stretch
identified. The markers were tested for the presence of
polymorphism in a panel of control DNAs. D9S309 and D9S310 are two
polymorphisms or markers identified in the candidate region for the
familial dysautonomia gene by this method. (Slaugenhaupt, et al.
(Povey, et al., eds) "Report on the Third International Workshop on
Chromosome 9" Ann. Hum. Genet. (1994) 58: 177-250). D9S310 is
estimated to be about 0.5 cM proximal to D9S58 and D9S309 is also
proximal to D9S58 but there is no measurable genetic distance
between the two markers.
[0077] Therefore yet another embodiment of this invention relates
to nucleic acid sequences encoding oligonucleotides useful for
detecting markers or polymorphisms linked to the familial
dysautonomia gene. In particular this embodiment of the invention
relates to oligonucleotides encoding flanking regions of repeat
sequences which are used as primers for the polymerase chain
reaction (PCR). Amplication of DNA with these primers allows for
the detection of the polymorphisms D9S309 and D9S310. Such
oligonucleotides may be about 15 to about 40 bases pairs in length,
preferably about 17 to about 25 base pairs in length. In a
preferred embodiment the oligonucleotide primers used are
5'-GCCTGGGCAAACAGAGAC-3', 5'-GCAACTTATTGTTTAACCTG-3' for the D9S310
polymorphism and 5'-TAGAGCTCTACCCCCCAAC-3',
5'-TGAACAGCTATATATGCCATCC-3' for the D9S309 polymorphism. It will
be understood by one of skill in the art that variations in the
D9S309 and the D9S310 oligonucleotide primers may be made but still
result in nucleic acid sequences capable of amplifying those
sequences. These oligonucleotide primers may be used in the methods
described herein for detecting the presence in a subject of the
D9S309 and D9S310 polymorphisms which are linked to the FD
gene.
[0078] Two additional markers designated D9S172 and D9S174 were
tested and demonstrated to be linked to the familial dysautonomia
gene. D9S174 is approximately 2 cM distal to D9S58 and D9S172 is
estimated to be about 3-4 cM proximal to D9S58. The oligonucleotide
primer sequences encoding the flanking regions of the D9S172 and
D9S174 polymorphisms are as follows: D9S172:
5'-AACTACAGTGTTCAGTGTGGTG-3', 5'-ATGGGAATGAGTAGCAAACA-3' and
D9S174: 5'-TCCAAAGTTCCCCAGGTG-3', 5'-GTGTTTAATGACCCTTGTGGCTAC-3'
(Weissenbach, T., et al. (1992) Nature 359:794-801). The location
of the FD gene can now be further restricted by markers D9S172 and
D9S105 to within 6 cM, i.e. 6 million nucleotides around DS958.
[0079] Flanking markers on both sides of the familial dysautonomia
gene combined with D9S58, or a number of well-positioned markers
that cover the chromosomal region (q31) carrying the disease gene,
can give a high probability of affected or non-affected chromosomes
in the range of 80-90% accuracy, depending on the informativeness
of the markers used and their distance from the disease gene. Using
the current markers linked to the familial dysautonomia gene, or
preferably closer flanking markers when they are identified (using
the above methods), a genetic test for families with familial
dysautonomia-affected member is provided for both prenatal
diagnosis and carrier test in healthy siblings. Subsequent
delineation of even more closely linked markers which may show
strong disequilibrium with the disorder, or identification of the
defective gene, could also allow screening of the entire at-risk
population to identify carriers, and potentially reduce the
incidence of new cases of familial dysautonomia. Such closer
markers, for example, D9S53, D9S105, D9S310, D9S309, D9S174 and
D9S172 have now been identified and further map the location of the
FD gene in the chromosome region 9q31-q33.
[0080] The method lends itself readily to the formulation of kits
which can be utilized in diagnosis. Such a kit would comprise a
carrier being compartmentalized to receive in close confinement one
or more containers wherein a first container may contain DNA
containing coding sequences which may be used to identify a given
polymorphism, e.g. an SSR. A second container may contain a
different-set of sequences coding for a second SSR, and so on.
Other containers may contain reagents useful in the detection of
the labelled probes, such as enzyme substrates. Still other
containers may contain restriction enzymes, buffers, and the
like.
[0081] It will be obvious to those skilled in the art to which the
invention pertains, that various changes and modifications may be
made without departing from the scope IS of the invention defined
by the claims.
Sequence CWU 0
0
* * * * *