U.S. patent application number 10/775501 was filed with the patent office on 2004-12-30 for identification of a dna variant associated with adult type hypolactasia.
This patent application is currently assigned to National Public Health Institute. Invention is credited to Enattah, Nabil, Jarvela, Irma, Peltonen, Leena, Sahi, Timo, Savilahti, Erkki, Terwilliger, Joseph.
Application Number | 20040265856 10/775501 |
Document ID | / |
Family ID | 27224216 |
Filed Date | 2004-12-30 |
United States Patent
Application |
20040265856 |
Kind Code |
A1 |
Peltonen, Leena ; et
al. |
December 30, 2004 |
Identification of a DNA variant associated with adult type
hypolactasia
Abstract
The present invention relates to a nucleic acid molecule
comprising a 5' portion of an intestinal lactase-phlorizine
hydrolase (LPH) gene contributing to or indicative of the
adult-type hypolactasia wherein said nucleic acid molecule is
selected from the group consisting of (a) a nucleic acid molecule
having or comprising the nucleic acid sequence of SEQ ID NO: 1, the
sequence of SEQ ID NO:1 is also depicted in FIG. 4 and comprised in
the sequence as depicted in FIG. 8; (b) a nucleic acid molecule
having or comprising the nucleic acid sequence of SEQ ID NO: 2, the
sequence of SEQ ID NO:2 is also depicted in FIG. 5 and comprised in
the sequence as depicted in FIG. 9; (c) a nucleic acid molecule of
at least 20 nucleotides the complementary strand of which
hybridizes under stringent conditions to the nucleic acid molecule
of (a) or (b), wherein said polynucleotide/nucleic acid molecule
has at a position corresponding to position -13910 5' from the LPH
gene a cytosine residue; and (d) a nucleic acid molecule of at
least 20 nucleotides the complementary strand of which hybridizes
under stringent conditions to the nucleic acid molecule of (a) or
(b), wherein said polynucleotide/nucleic acid molecule has at a
position corresponding to position -22018 5' from the LPH gene a
guanine residue. The present invention further relates to methods
for testing for the presence of or predisposition to adult-type
hypolactasia that are based on the analysis of an SNP contained in
the above recited nucleic acid molecule. Additionally, the present
invention relates to diagnostic composition and kit useful in the
detection of the presence of or predisposition to adult-type
hypolactasia.
Inventors: |
Peltonen, Leena; (Helsinki,
FI) ; Enattah, Nabil; (Helsinki, FI) ;
Jarvela, Irma; (Helsinki, FI) ; Sahi, Timo;
(Helsinki, FI) ; Savilahti, Erkki; (Hus, FI)
; Terwilliger, Joseph; (New York, NY) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER
EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
National Public Health
Institute
Helsinki
FI
FIN-00300
|
Family ID: |
27224216 |
Appl. No.: |
10/775501 |
Filed: |
February 9, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10775501 |
Feb 9, 2004 |
|
|
|
PCT/EP02/08963 |
Aug 9, 2002 |
|
|
|
60315955 |
Aug 31, 2001 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/200; 435/320.1; 435/325; 435/69.1; 536/23.2 |
Current CPC
Class: |
A61K 38/00 20130101;
C12Q 1/6883 20130101; C12Q 2600/156 20130101; A61P 3/00 20180101;
A01K 2217/05 20130101; C12Y 302/01023 20130101; C12N 9/2402
20130101; A61P 43/00 20180101; C12Y 302/01108 20130101; C12Y
302/01062 20130101; A61K 48/00 20130101; C12N 9/2468 20130101; C12N
9/2471 20130101 |
Class at
Publication: |
435/006 ;
435/069.1; 435/200; 435/320.1; 435/325; 536/023.2 |
International
Class: |
C12Q 001/68; C07H
021/04; C12N 009/24 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 10, 2001 |
EP |
EP01119377.8 |
Aug 14, 2001 |
EP |
EP01119528.6 |
Claims
1-40. Canceled
41. A nucleic acid molecule comprising a 5' portion of an
intestinal lactase-phlorizine hydrolase (LPH) gene contributing to
or indicative of adult-typo hypolactasia wherein said nucleic acid
molecule is selected from the group consisting of (a) a nucleic
acid molecule having or comprising the nucleic acid sequence of SEQ
ID NQ: 1, the sequence of SEQ ID NO: 1 is also depicted in FIG. 4
and comprised in the sequence as depicted in FIG. 8; (b) a nucleic
acid molecule having or comprising the nucleic acid sequence of SEQ
ID NO:2, the sequence of SEQ ID NO:2 is also depicted in FIG. 5 and
comprised in the sequence as depicted in FIG. 9; (c) a nucleic acid
molecule of at least 20 nucleotides the complementary strand of
which hybridizes under stringent conditions to the nucleic acid
molecule of (a) or (b), wherein said polynucleotide has at a
position corresponding to position -13910 5' from the LPH gene a
cytosine residue; and (d) a nucleic acid molecule of at least 20
nucleotides the complementary strand of which hybridizes under
stringent conditions to the nucleic acid molecule of (a) or (b),
wherein said polynucleotide has at a position corresponding to
position -22018 5'from the LPH gene a guanine residue wherein said
nucleic molecule extends, at a maximum, 30000 nucleotides over the
5' and/or 3' end of the nucleic acid molecule of SEQ ID NO: 1 or 2,
respectively.
42. A nucleic acid molecule comprising a 5' portion of an
intestinal lactase-phlorizine hydrolase (LPH) gene wherein said
nucleic acid molecule is selected from the group consisting of (a)
a nucleic acid molecule having or comprising the nucleic acid
sequence of SEQ ID NO:3, the sequence of SEQ ID NO:3 is also
depicted in FIG. 6; (b) a nucleic acid molecule having or
comprising the nucleic acid sequence of SEQ ID NO:4, the sequence
of SEQ ID NO:4 is also depicted in FIG. 7; (c) a nucleic acid
molecule the complementary strand of which hybridizes under
stringent conditions to the nucleic acid molecule of (a) or (b)
wherein said polynucleotide has at a position corresponding to
position -13910 of the LPH gene a thymidine residue and wherein
said hybridizing nucleic acid molecule comprises at least 100
nucleotides 5' and 3' of the position -13910 of the LPH gene; and
(d) a nucleic acid molecule the complementary strand of which
hybridizes under stringent conditions to the nucleic acid molecule
of (a) or (b), wherein said polynucleotide has at a position
corresponding to position -22013 of the LPH gene a adenosine
residue and wherein said hybridizing nucleic acid molecule
comprises at least 100 nucleotides 5' and 3' of the position -22015
of the; LPH gene.
43. The nucleic acid molecule of claim 41 or 42 which is genomic
DNA.
44. The nucleic acid molecule of claim 43 wherein said genomic DNA
is part of a gene.
45. A fragment of the nucleic acid molecule of any one of claim 41
or 42 having at least 14 nucleotides wherein said fragment
comprises nucleotide position -13910 or nucleotide position -22018
of the LPH gene.
46. A nucleic acid molecule which is complementary to the nucleic
acid molecule of claim 41 or 42.
47. A vector comprising the nucleic acid molecule of claim 42.
48. A vector comprising the nucleic acid molecule of claims 41 or
42.
49. A primer or primer pair, wherein the primer or primer pair
hybridizes under stringent conditions to the nucleic acid molecule
of claim 41 or 42, comprising nucleotide position -13910 or -22018
of the LPH gene or to the complementary strand thereof.
50. A primer or primer pair, wherein the primer or primer pair
hybridizes under stringent conditions to the nucleic acid molecule
of claim 41 or 42, comprising nucleotide position -13910 or -22018
of the LPH gene or to the complementary strand thereof.
51. A non-human host transformed with the vector of claim 46.
52. The non-human host of claim 51, which is a bacterium, a yeast
cell, an insect cell, a fungal cell, a mammalian cell, a plant
cell, a transgenic animal or a transgenic plant.
53. An antibody or aptamer or phage that specifically binds to the
mutant nucleic acid molecule of claim 41 or 42 but not to the
corresponding wild-type nucleic acid molecule, wherein a wild-type
nucleic acid molecule has at the position corresponding to the
position -13910 of the LPH gene a thymidine and/or at the position
corresponding to the position -22018 an adenosine, and a mutant
nucleic acid molecule has at the position corresponding to the
position -13910 a cytosine and/or at the position corresponding to
the position -22018 a guanine.
54. An antibody or aptamer or phage that specifically binds to the
wild-type nucleic acid molecule of claim 41 or 42, but not to the
corresponding mutant sequence contributing to or indicative of
adult-type hypolactasia, wherein a wild-type nucleic acid molecule
has at the position corresponding to the position -13910 of the LPH
gene a thymidine and/or at the position corresponding to the
position -22018 an adenosine, and a mutant nucleic acid molecule
has at the position corresponding to the position -13910 a cytosine
and/or at the position corresponding to the position -22018 a
guanine.
55. A pharmaceutical composition comprising the wild-type nucleic
acid molecule of claim 41 or 42, wherein a wild-type nucleic acid
molecule has at the position corresponding to the position -13910
of the LPH gene a thymidine and/or at the position corresponding to
the position -22018 an adenosine.
56. A diagnostic composition comprising the nucleic acid molecule
of claim 41 or 42.
57. A method for testing for the presence or predisposition of
adult-type hypolactasia comprising testing a sample obtained from a
prospective patient or from a person suspected of carrying such a
predisposition for the presence of the nucleic acid molecule of
claim 41 or 42 in a homozygous or heterozygous state.
58. A method for testing for the presence or predisposition of
adult-type hypolactasia or associated trait comprising testing a
sample obtained from a prospective patient or from a person
suspected of carrying such a predisposition for the presence of the
nucleic acid molecule of claim 41 or 42 in a homozygous or
heterozygous state.
59. The method of claim 57, wherein said testing comprises
hybridizing the complementary nucleic acid molecule of claim 46
which is complementary to the nucleic acid molecule contributing to
or indicative of adult-type hypolactasia or the nucleic acid
molecule of claim 46 which is complementary to the wild-type
sequence as a probe under stringent conditions to nucleic acid
molecules comprised in said sample and detecting said
hybridization, wherein a wild-type nucleic acid molecule has at the
position corresponding to the position -13910 of the LPH gene a
thymidine and/or at the position corresponding to the position
-22018 an adenosine, and a mutant nucleic acid molecule has at the
position corresponding to the position -13910 a cytosine and/or at
the position corresponding to the position -22018 a guanine.
60. The method of any one of claim 57, further comprising digesting
the product of said hybridization with a restriction endonuclease
or subjecting the product of said hybridization to digestion with a
restriction endonuclease and analyzing the product of said
digestion.
61. The method of claim 59, wherein said probe is detestably
labeled.
62. The method of claim 57, wherein said testing comprises
determining the nucleic acid sequence of at least a portion of the
nucleic acid molecule of any one of claims 1 to 7, said portion
comprising nucleotide position -13910 and/or nucleotide position
-22018 of the LPH gene.
63. The method of claim 62, wherein the determination of the
nucleic acid sequence is effected by solid-phase
minisequencing.
64. The method of claim 62 further comprising, prior to determining
said nucleic acid sequence, amplification of at least said portion
of said nucleic acid molecule.
65. The method of claim 57, wherein said testing comprises carrying
out an amplification reaction wherein at least one of the primers
employed in said amplification reaction is the primer of claim 50
or belongs to the primer pair of claim 50, comprising assaying for
an amplification product.
66. The method of claim 57, wherein said testing comprises carrying
out an amplification reaction wherein at least one of the primers
employed in said amplification reaction is the primer of claim 51
or belongs to the primer pair of claim 51, comprising assaying for
an amplification product.
67. The method of any one of claim 64 wherein said amplification is
effected by or said amplification is the polymerase chain reaction
(PGR).
68. A method for testing for the presence or predisposition of
adult-type hypolactasia comprising assaying a sample obtained from
a human for specific binding to the antibody or aptamer or phage of
claim 53.
69. A method for testing for the presence or predisposition of
adult-type hypolactasia comprising assaying a sample obtained from
a human for specific binding to the antibody or aptamer or phage of
claim 54.
70. The method of claim 68, wherein said antibody or aptamer or
phage is detestably labeled.
71. The method of claim 68, wherein the test is an
immuno-assay.
72. The method of claim 57, wherein said sample is blood, serum,
plasma, fetal tissue, saliva, urine, mucosal tissue, mucus, vaginal
tissue, fetal tissue obtained from the vagina, skin, hair, hair
follicle or another human tissue.
73. The method of claim 57, wherein said nucleic acid molecule from
said sample is fixed to a solid support.
74. The method of claim 73, wherein said solid support is a chip, a
silica wafer, a bead or a microtiter plate.
75. Kit comprising the nucleic acid molecule of claim 41 or 42.
Description
[0001] The present invention relates to a nucleic acid molecule
comprising a 5' portion of an intestinal lactase-phlorizine
hydrolase (LPH) gene contributing to or indicative of the
adult-type hypolactasia wherein said nucleic acid molecule is
selected from the group consisting of (a) a nucleic acid molecule
having or comprising the nucleic acid sequence of SEQ ID NO: 1, the
sequence of SEQ ID NO:1 is also depicted in FIG. 4 and comprised in
the sequence as depicted in FIG. 8; (b) a nucleic acid molecule
having or comprising the nucleic acid sequence of SEQ ID NO: 2, the
sequence of SEQ ID NO:2 is also depicted in FIG. 5 and comprised in
the sequence as depicted in FIG. 9; (c) a nucleic acid molecule of
at least 20 nucleotides the complementary strand of which
hybridizes under stringent conditions to the nucleic acid molecule
of (a) or (b), wherein said polynucleotide/nucleic acid molecule
has at a position corresponding to position -13910 5' from the LPH
gene a cytosine residue; and (d) a nucleic acid molecule of at
least 20 nucleotides the complementary strand of which hybridizes
under stringent conditions to the nucleic acid molecule of (a) or
(b), wherein said polynucleotide/nucleic acid molecule has at a
position corresponding to position -22018 5' from the LPH gene a
guanine residue. The present invention further relates to methods
for testing for the presence of or predisposition to adult-type
hypolactasia that are based on the analysis of an SNP contained in
the above recited nucleic acid molecule. Additionally, the present
invention relates to diagnostic composition and kit useful in the
detection of the presence of or predisposition to adult-type
hypolactasia.
[0002] A variety of documents is cited throughout this
specification. The disclosure content of these documents, including
manufacturer's manuals and catalogues, is herewith incorporated by
reference.
[0003] Lactase-phlorizin hydrolase enzyme (LPH), which is
exclusively expressed by intestinal epithelial cells, hydrolyses
lactose, sugar of milk, into glucose and galactose.sup.1. The
expression of the LPH enzyme dramatically declines to very low
levels at the weaning period in mammals when lactose is no longer
an essential part of the diet. In humans, the condition known as
adult-type hypolactasia or lactase non-persistence, affects most
populations and severely limits the use of fresh milk among adults
due to lactose intolerance. The age of onset of lactase
non-persistence status varies between populations, ranging from 1-2
years of age among the Thais to 10-20 years of age among the
Finns.sup.2-3. However, in Northern European and a few other ethnic
groups, LPH activity persists throughout life in the majority of
adults, a condition known as lactase persistence. The phenotype
lactase persistence/non-persistence has been shown to be
genetically determined, the persistent status being dominant over
the non-persistent status.sup.4-6.
[0004] The state of the art diagnosis of adult-type hypolactasia is
based on the lactose tolerance test (LTT). After overnight fasting
(10 hours), 1 g/kg of lactose is given as a 12.5% solution, the
maximum dose being 50 g. Capillary blood samples are taken before
and 20 and 30 min after lactose ingestion. The glucose
concentration is determined by the glucose oxidase method (Hjelm
and de Verdier 1963). Abdominal symptoms on the day of LTT are
noted. A maximum rise in blood glucose concentration of 1.1 mmol/l
or more was taken as a sign of lactose malabsorption (Gudman-Hoyer
and Harnum 1968, Jussila 1970, Sahi 1972). LTT contains a 10% risk
for false positive and negative diagnoses, i.e. the sensitivity and
specificity of LTT is about 90% (Isokoski et al. 1972, Newcomer et
al. 1975, Sahi 1983). The accuracy of LTT can be improved by giving
0.3 g/kg ethanol that inhibits the metabolism of galactose in the
liver (Tygstrup and Lundqvist 1962) and 15 min later 1 g/kg lactose
as 12.5% solution.
[0005] Children with maximum rises of less than 0.2 mg/100 ml in
the first or repeated LTT have been sent for small-intestinal
biopsy that is taken through gastroscopy. This is an invasive
procedure that needs expertise and is usually performed at
university hospitals by specialists in gastroenterology only.
Biopsy samples are examined with a dissection microscope and
histologically, and the mucosal maltase, sucrase and lactase
activities are determined (Launiala et al. 1964). The diagnosis of
hypolactasia in children is justified if the histology of the
intestinal biopsy is normal and lactase activity is less than 20
U/g protein and lactase/sucrase ratio less than 0.30, or in the LTT
with ethanol administration a maximum rise in blood glucose
concentration of less than 20 mg/100 ml and in galactose
concentration of 5 mg/100 ml or less (Sahi et al, 1972) is
demonstrated. As described above, the current methods to diagnose
adult-type hypolactasia are laborious. LTT is inexact and
therefore, an invasive procedure, gastroscopy is needed before the
diagnosis can be ascertained. Since adult-type hypolactasia is very
common and the major cause of nonspecific abdominal symptoms (in
one third of patients complaining stomach pain), there is a clear
need to improve the diagnostics of this common health problem.
[0006] Yet, so far no biochemical test that is easy to handle and,
at the same time, provides quick and accurate results has been
developed. Elucidation of the cause of the disease on the genomic
DNA/expression level has equally been unsuccessful. Thus, the
sequencing of the coding and promoter regions of the LPH gene in
adults has revealed no DNA-variations which correlate with lactase
persistence/non-persistence, nor has evidence emerged of splice
variants or mRNA editing variants associated with this
trait.sup.7-8. Previous studies have shown that the lactase
persistence/non-persistence trait is possibly controlled by
cis-acting element(s) residing within or adjacent to the lactase
gene, and strong linkage disequilibrium (LD) has been observed
across the 70 kb haplotype spanning the lactase gene.sup.9,10.
Several studies report evidence that the main control of the LPH
gene expression operates at the level of transcription
regulation.sup.11-13. However, it has been suggested that variation
influencing both transcriptional and posttranscriptional control of
expression of the LPH gene may be involved in the etiology of
adult-type hypolactasia.sup.14-15.
[0007] In view of the above, the technical problem underlying the
present invention was to provide means and methods that allow for
an accurate and convenient diagnosis of adult-type hypolactasia or
of a predisposition to this disease.
[0008] The solution to said technical problem is achieved by the
embodiments characterized in the claims.
[0009] Thus, the present invention relates to a nucleic acid
molecule comprising a 5' portion of an intestinal
lactase-phlorizine hydrolase (LPH) gene contributing to or
indicative of adult-type hypolactasia wherein said nucleic acid
molecule is selected from the group consisting of (a) a nucleic
acid molecule having or comprising the nucleic acid sequence of SEQ
ID NO: 1, the sequence of SEQ ID NO:1 is also depicted in FIG. 4
and comprised in the sequence as depicted in FIG. 8; (b) a nucleic
acid molecule having or comprising the nucleic acid sequence of SEQ
ID NO: 2, the sequence of SEQ ID NO:2 is also as depicted in FIG. 5
and comprised in the sequence as depicted in FIG. 9; (c) a nucleic
acid molecule of at least 20 nucleotides the complementary strand
of which hybridizes under stringent conditions to the nucleic acid
molecule of (a) or (b), wherein said polynucleotide/nucleic acid
molecule has at a position corresponding to position -13910 5' from
the LPH gene a cytosine residue; and (d) a nucleic acid molecule of
at least 20 nucleotides the complementary strand of which
hybridizes under stringent conditions to the nucleic acid molecule
of (a) or (b), wherein said polynucleotide/nucleic acid molecule
has at a position corresponding to position -22018 5' from the LPH
gene a guanine residue.
[0010] In accordance with the invention, the term "intestinal
lactase-phlorizine hydrolase (LPH) gene" denotes a gene that
encodes an enzyme having the activity of hydrolyzing lactose into
its components glucose and galactose. The enzyme is characterized
by E.C. 3.2.1.23.62.
[0011] The term "adult-type hypolactasia" refers to a condition
also known as lactose intolerance, which is an autosomal recessive
condition resulting from the "physiological" decline of the
lactase-phlorizin hydrolase (LPH) enzyme activity in intestinal
cells in a significant proportion of the global population.
[0012] The term "contributing to or indicative of adult-type
hypolactasia", refers to the fact that the SNPs and thus the
corresponding nucleic acid molecules found are indicative of the
condition and possibly also causative therefore. Accordingly, this
term necessarily requires that the recited 5' position is
indicative of the condition. Said term, on the other hand, does not
necessarily requite that the 5' portion is causative or contributes
to the condition. Yet, said term does not exclude a causative or
contributory role of either or both SNPs.
[0013] The term "which hybridizes under stringent conditions"
refers to hybridization conditions that are well known to or can be
established by the person skilled in the art according to
conventional protocols. The term most advantageously refers to
highly stringent conditions. Appropriate stringent conditions for
each sequence may be established on the basis of well-known
parameters such as temperature, composition of the nucleic acid
molecules, salt conditions etc.: see, for example, Sambrook et al.,
"Molecular Cloning, A Laboratory Manual"; CSH Press, Cold Spring
Harbor, 1989 or Higgins and Hames (eds.), "Nucleic acid
hybridization, a practical approach", IRL Press, Oxford 1985
(reference 54), see in particular the chapter "Hybridization
Strategy" by Britten & Davidson, 3 to 15. Typical (highly
stringent) conditions comprise hybridization at 65.degree. C. in
0.5.times.SSC and 0.1% SDS or hybridization at 42.degree. C. in 50%
formamide, 4.times.SSC and 0.1% SDS. Hybridization is usually
followed by washing to remove unspecific signal. Washing conditions
include conditions such as 65.degree. C., 0.2.times.SSC and 0.1%
SDS or 2.times.SSC and 0,1% SDS or 0,3.times.SSC and 0,1% SDS at
25.degree. C.-65.degree. C.
[0014] As disclosed herein above, the present invention also
relates to a hybridizing nucleic acid molecules of at least 20
nucleotides; see (c) and (d) herein above. Yet, the present
invention also relates to a nucleic acid molecule of at least 50,
at least 100, at least 150, or at least 200 nucleotides.
Preferably, said hybridizing fragments comprise at least 25, at
least 50, or at least 75 nucleotides, at least 100 nucleotides, 5'
and 3' of the position -13910 as defined in (c) or of position
-22018 ad defined in (d) herein above.
[0015] The term "nucleic acid molecule" refers both to naturally
and non-naturally occurring nucleic acid molecules. Non-naturally
occurring nucleic acid molecules include cDNA as well as
derivatives such as PNA.
[0016] The term "nucleic acid molecule [ . . . ] comprising the
nucleic acid sequence of SEQ ID NO:" throughout this specification
refers to nucleic acid molecules that are at least 1 nucleotide
longer than the nucleic acid molecule specified by the SEQ ID NO.
At the same time, these nucleic acid molecules extend, at a
maximum, 30000 nucleotides over the 5' and/or 3' end of the nucleic
acid molecule of the invention specified e.g. by the SEQ ID NO: 2
or 1, 3 or 4.
[0017] Surprisingly, it was found in accordance with the present
invention that the two hypolactasia-associated variants locate at a
considerable distance from the LPH gene, positioned in different
introns of the MCM6 gene. MCM6 is a member of a gene family (MCM
2-7), required for the initiation of DNA replication ensuring that
it takes place only once during the cell cycle.sup.31. MCM6, unlike
LPH, is not restricted in its tissue distribution and there is no
correlation in the levels of MCM6 and LPH transcripts.sup.18. These
findings would suggest that these two genes do not share any
functionally significant cis-acting elements providing tissue
specificity or developmental regulation.sup.18. Most probably the
identified variants have different functional significance for the
expression of the LPH and MCM6 genes. Further surprisingly, based
on complete association to hypolactasia they (or one of them) are
associated to age-dependent down regulation of the transcript level
of the LPH gene in the intestinal epithelium but have little or no
effect on the transcription of the MCM6.
[0018] Experimentally, using linkage, allelic association and
extended haplotype analysis carried out in nine extended Finnish
families the adult-type hypolactasia locus was restricted to a 47
kb interval on 2q21. The sequence analysis of the region revealed a
single nucleotide polymorphism (SNP), C/T-13910 that completely
cosegregated with adult-type hypolactasia in all Finnish families
and in a sample set of 236 individuals from four different
populations. Another SNP G/A-22018 residing 8 kb telomeric from C/T
-13910 was associated with the trait in all but 7 cases. The
prevalence of C/T -13910 SNP in 1047 DNA samples reflected the
reported prevalence of adult-type hypolactasia in three different
populations providing additional evidence for its importance for
the trait.
[0019] The surprising finding referred to above for the first time
allows the establishment of test systems that are based on the
molecular analysis of the recited single nucleotide polymorphisms
upstream of the LPH gene. Whereas both SNPs provide for a solid
basis for the diagnosis of or the diagnosis of a predisposition to
adult-type hypolactasia, it is preferred that the nucleotide
position -13910 is analyzed, either alone or in combination with
nucleotide position -22018. This is because the SNP at position
-13910 was associated in 100% of the analysed cases with the
disease whereas the SNP at position -22018 was associated in only
98% of all cases with adult-type hypolactasia. Nevertheless,
analyses of nucleotide position -22018 alone will usually also
provide a sound basis for a diagnosis of a predisposition to
adult-type hypolactasia.
[0020] Due to the abundance of established methods for assessing
for the presence of SNPs, it is now possible to conveniently, in a
short amount of time, at low cost, with high accuracy and without
significant trouble for the person under investigation, diagnose a
genetic predisposition to adult-type hypolactasia.
[0021] The invention further relates to a nucleic acid molecule
comprising a 5' portion of an intestinal lactase-phlorizine
hydrolase (LPH) gene wherein said nucleic acid molecule is selected
from the group consisting of (a) a nucleic acid molecule having or
comprising the nucleic acid sequence of SEQ ID NO:3, the sequence
of SEQ ID NO:3 is also depicted in FIG. 6; (b) a nucleic acid
molecule having or comprising the nucleic acid sequence of SEQ ID
NO:4, the sequence of SEQ ID NO:4 is also depicted in FIG. 7; (c) a
nucleic acid molecule the complementary strand of which hybridizes
under stringent conditions to the nucleic acid molecule of (a) or
(b), wherein said polynucleotide/nucleic acid molecule has at a
position corresponding to position -13910 of the LPH gene a
thymidine residue; and (d) a nucleic acid molecule the
complementary strand of which hybridizes under stringent conditions
to the nucleic acid molecule of (a) or (b), wherein said
polynucleotide/nucleic acid molecule has at a position
corresponding to position -22018 of the LPH gene a adenosine
residue.
[0022] This embodiment of the present invention may conveniently be
used to demonstrate that a person does not suffer from adult-type
hypolactasia and has no predisposition therefor. Further, this
nucleic acid molecule reflecting the "wild-type" situation of the
position -13910 or -22018 upstream of the LPH gene may be used as a
control means in experiments where a predisposition to adult-type
hypolactasia is tested for.
[0023] For testing, methods as described throughout this
specification may be used.
[0024] In a preferred embodiment of the invention the nucleic acid
molecule is genomic DNA.
[0025] This preferred embodiment of the invention reflects the fact
that usually the analysis would be carried out on the basis of
genomic DNA from body fluid, cells or tissue isolated from the
person under investigation.
[0026] In a further preferred embodiment of the nucleic acid
molecule of the invention said genomic DNA is part of a gene.
[0027] In accordance with the invention, it is preferred that at
least one of the introns of the MCM6 gene harboring position -13910
or position -22018 relative to the LPH gene is analyzed.
[0028] In addition, the invention relates to a fragment of the
nucleic acid molecule as described herein above having at least 14
nucleotides wherein said fragment comprises nucleotide position
-13910 or nucleotide position -22018 (upstream) of the LPH
gene.
[0029] The fragment of the invention may be of natural as well as
of (semi)synthetic origin. Thus, the fragment may, for example, be
a nucleic acid molecule that has been synthesized according to
conventional protocols of organic chemistry. Importantly, the
nucleic acid fragment of the invention comprises nucleotide
position -13910 or nucleotide position -22018 upstream of the LPH
gene. In these positions, the fragment may have either the
wild-type nucleotide or the nucleotide contributing to or
indicative of adult-type hypolactasia (also referred to as the
"mutant" sequence). Consequently, the fragment of the invention may
be used, for example, in assays differentiating between the
wild-type and the mutant sequence. It is further preferred that the
fragment of the invention consists of at least 17 nucleotides, more
preferred at least 21 nucleotides, and most preferred at least 25
nucleotides such as 30 nucleotides.
[0030] Furthermore, the invention relates to a nucleic acid
molecule which is complementary to the nucleic acid molecule as
described herein above.
[0031] This embodiment of the invention comprising at least 14
nucleotides and covering at least position -13910 or position
-22018 of the sequence upstream of the LPH gene is particularly
useful in the analysis of the genetic setup in the recited
positions in hybridization assays. Thus, for example, a 15 mer
exactly complementary either to the wild-type sequence (i.e. a T in
position -13910 or an A in position -22018) or to the variants
contributing to or indicative of adult-type hypolactasia (i.e. a C
in position -13910 or a G in position -22018) may be used to
differentiate between the polymorphic variants. This is because a
nucleic acid molecule labeled with a detectable label not exactly
complementary to the DNA in the analyzed sample will not give rise
to a detectable signal, if appropriate hybridization and washing
conditions are chosen.
[0032] In this regard, it is important to note that the nucleic
acid molecule of the invention, the fragment thereof as well as the
complementary nucleic acid molecule may be detectably labeled.
Detectable labels include radioactive labels such as .sup.3H, or
.sup.32P or fluorescent labels. Labeling of nucleic acids is well
understood in the art and described, for example, in Sambrook et
al., loc. cit.
[0033] In addition, the invention relates to a vector comprising
the nucleic acid molecule as described herein above. The vector of
the invention may either contain a nucleic acid molecule comprising
the wild-type sequence(s) or it may contain a nucleic acid molecule
comprising the mutant sequence(s).
[0034] The vectors may particularly be plasmids, cosmids, viruses
or bacteriophages used conventionally in genetic engineering that
comprise the nucleic acid molecule of the invention. Preferably,
said vector is an expression vector and/or a gene transfer or
targeting vector. Expression vectors derived from viruses such as
retroviruses, vaccinia virus, adeno-associated virus, herpes
viruses, or bovine papilloma virus, may be used for delivery of the
nucleic acid molecule of the invention into targeted cell
population. Methods which are well known to those skilled in the
art can be used to construct recombinant viral vectors; see, for
example, the techniques described in Sambrook et al., loc. cit. and
Ausubel et al., Current Protocols in Molecular Biology, Green
Publishing Associates and Wiley Interscience, N.Y. (1989).
Alternatively, the nucleic acid molecules and vectors of the
invention can be reconstituted into liposomes for delivery to
target cells. The vectors containing the nucleic acid molecules of
the invention can be transferred into the host cell by well-known
methods, which vary depending on the type of cellular host. For
example, calcium chloride transfection is commonly utilized for
prokaryotic cells, whereas, e.g., calcium phosphate or DEAE-Dextran
mediated transfection or electroporation may be used for other
cellular hosts; see Sambrook, supra.
[0035] Such vectors may comprise further genes such as marker genes
which allow for the selection of said vector in a suitable host
cell and under suitable conditions. Preferably, the nucleic acid
molecule of the invention is operatively linked to expression
control sequences allowing expression in prokaryotic or eukaryotic
cells. Expression of said polynucleotide comprises transcription of
the polynucleotide into a translatable mRNA. Regulatory elements
ensuring expression in eukaryotic cells, preferably mammalian
cells, are well known to those skilled in the art. They usually
comprise regulatory sequences ensuring initiation of transcription
and, optionally, a poly-A signal ensuring termination of
transcription and stabilization of the transcript, and/or an intron
further enhancing expression of said polynucleotide. Additional
regulatory elements may include transcriptional as well as
translational enhancers, and/or naturally-associated or
heterologous promoter regions. Possible regulatory elements
permitting expression in prokaryotic host cells comprise, e.g., the
PL, lac, trp or tac promoter in E. coli, and examples for
regulatory elements permitting expression in eukaryotic host cells
are the AOX1 or GAL1 promoter in yeast or the CMV-, SV40-,
RSV-promoter (Rous sarcoma virus), CMV-enhancer, SV40-enhancer or a
globin intron in mammalian and other animal cells. Beside elements
which are responsible for the initiation of transcription such
regulatory elements may also comprise transcription termination
signals, such as the SV40-poly-A site or the tk-poly-A site,
downstream of the polynucleotide. Optionally, the heterologous
sequence can encode a fusion protein including an C- or N-terminal
identification peptide imparting desired characteristics, e.g.,
stabilization or simplified purification of expressed recombinant
product. In this context, suitable expression vectors are known in
the art such as Okayama-Berg cDNA expression vector pcDV1
(Pharmacia), pCDM8, pRc/CMV, pcDNA1, pcDNA3, the Echo.TM. Cloning
System (Invitrogen), pSPORT1 (GIBCO BRL) or pRevTet-On/pRevTet-Off
or pCI (Promega). Preferably, the expression control sequences will
be eukaryotic promoter systems in vectors capable of transforming
or transfecting eukaryotic host cells, but control sequences for
prokaryotic hosts may also be used.
[0036] As mentioned above, the vector of the present invention may
also be a gene transfer or targeting vector. Gene therapy, which is
based on introducing therapeutic genes into cells by ex-vivo or
in-vivo techniques is one of the most important applications of
gene transfer. Suitable vectors and methods for in-vitro or in-vivo
gene therapy are described in the literature and are known to the
person skilled in the art; see, e.g., Giordano, Nature Medicine 2
(1996), 534-539; Schaper, Circ. Res. 79 (1996), 911-919; Anderson,
Science 256 (1992), 808-813; Isner, Lancet 348 (1996), 370-374;
Muhlhauser, Circ. Res. 77 (1995), 1077-1086; Wang, Nature Medicine
2 (1996), 714-716; WO94/29469; WO 97/00957, Schaper, Current
Opinion in Biotechnology 7 (1996), 635-640, or Kay et al. (2001)
Nature Medicine, 7, 3340) and references cited therein. The
polynucleotides and vectors of the invention may be designed for
direct introduction or for introduction via liposomes, or viral
vectors (e.g. adenoviral, retroviral) into the cell. Preferably,
said cell is a germ line cell, embryonic cell, or egg cell or
derived therefrom, most preferably said cell is a stem cell. Gene
therapy is envisaged with the wild-type nucleic acid molecule
only.
[0037] The invention as well relates to a primer or primer pair,
wherein the primer or primer pair hybridizes under (highly)
stringent conditions to the nucleic acid as described herein above
comprising nucleotide position -13910 or -22018 of the LPH gene or
to the complementary strand thereof.
[0038] Preferably, the primers of the invention have a length of at
least 14 nucleotides such as 17 or 21 nucleotides. It is further
preferred that the primers have a maximum length of 24 nucleotides.
Hybridization or lack of hybridization of a primer under
appropriate conditions to a genome sequence comprising either
position -13910 or position -22018 coupled with an appropriate
detection method such as an elongation reaction or an amplification
reaction may be used to differentiate between the polymorphic
variants and then draw conclusions with regard to, e.g., the
predisposition of the person under investigation for adult-type
hypolactasia. The present invention envisages two types of
primers/primer pairs. One type hybridizes to a sequence comprising
the mutant sequence. In other words, the primer is exactly
complementary to a sequence that contains the C in position -13910
or the G in position -22018 or to the complementary strand thereof.
The other type of primer is exactly complementary to a sequence
having a T in position -13910 or an A in position -22018 or to the
complementary strand thereof. Since hybridization conditions would
preferably be chosen to be stringent enough, contacting of e.g. a
primer exactly complementary to the mutant sequence with a
wild-type allele would not result in efficient hybridization due to
the mismatch formation. After washing, no signal would be detected
due to the removal of the primer.
[0039] Additionally, the invention relates to a non-human host
transformed with the vector of the invention as described herein
above. The host may either carry the mutant or the wild-type
sequence. Upon breeding etc. the host may be heterozygous or
homozygous for one or both SNPs.
[0040] The host of the invention may carry the vector of the
invention either transiently or stably integrated into the genome.
Methods for generating the non-human host of the invention are well
known in the art. For example, conventional transfection protocols
described in Sambrook et al., loc. cit., may be employed to
generate transformed bacteria (such as E. coli) or transformed
yeasts. The non-human host of the invention may be used, for
example, to elucidate the onset of adult-type hypolactasia.
[0041] In a preferred embodiment of the invention the non-human
host is a bacterium, a yeast cell, an insect cell, a fungal cell, a
mammalian cell, a plant cell, a transgenic animal or a transgenic
plant.
[0042] Whereas E. coli is a preferred bacterium, preferred yeast
cells are S. cerevisiae or Pichia pastoris cells. Preferred fungal
cells are Aspergillus cells and preferred insect cells include
Spodoptera frugiperda cells. Preferred mammalian cells are colon
carcinoma cell lines showing expression of the LPH enzyme and
include CaCo2-cells.
[0043] A method for the production of a transgenic non-human
animal, for example transgenic mouse, comprises introduction of the
aforementioned polynucleotide or targeting vector into a germ cell,
an embryonic cell, stem cell or an egg or a cell derived therefrom.
The non-human animal can be used in accordance with a screening
method of the invention described herein. Production of transgenic
embryos and screening of those can be performed, e.g., as described
by A. L. Joyner Ed., Gene Targeting, A Practical Approach (1993),
Oxford University Press. The DNA of the embryonal membranes of
embryos can be analyzed using, e.g., Southern blots with an
appropriate complementary nucleic acid molecule; see supra. A
general method for making transgenic non-human animals is described
in the art, see for example WO 94/24274. For making transgenic
non-human organisms (which include homologously targeted non-human
animals), embryonal stem cells (ES cells) are preferred. Murine ES
cells, such as AB-1 line grown on mitotically inactive SNL76/7 cell
feeder layers (McMahon and Bradley, Cell 62:1073-1085 (1990))
essentially as described (Robertson, E. J. (1987) in
Teratocarcinomas and Embryonic Stem Cells: A Practical Approach. E.
J. Robertson, ed. (Oxford: IRL Press), p. 71-112) may be used for
homologous gene targeting. Other suitable ES lines include, but are
not limited to, the E14 line (Hooper et al., Nature 326:292-295
(1987)), the D3 line (Doetschman et al., J. Embryol. Exp. Morph.
87:2745 (1985)), the CCE line (Robertson et al., Nature 323:445448
(1986)), the AK-7 line (Zhuang et al., Cell 77:875-884 (1994)). The
success of generating a mouse line from ES cells bearing a specific
targeted mutation depends on the pluripotence of the ES cells (i.
e., their ability, once injected into a host developing embryo,
such as a blastocyst or morula, to participate in embryogenesis and
contribute to the germ cells of the resulting animal). The
blastocysts containing the injected ES cells are allowed to develop
in the uteri of pseudopregnant nonhuman females and are born as
chimeric mice. The resultant transgenic mice are chimeric for cells
having the desired nucleic acid molecule are backcrossed and
screened for the presence of the correctly targeted transgene (s)
by PCR or Southern blot analysis on tail biopsy DNA of offspring so
as to identify transgenic mice heterozygous for the nucleic acid
molecule of the invention.
[0044] The transgenic non-human animals may, for example, be
transgenic mice, rats, hamsters, dogs, monkeys (apes), rabbits,
pigs, or cows. Preferably, said transgenic non-human animal is a
mouse. The transgenic animals of the invention are, inter alia,
useful to study the phenotypic expression/outcome of the nucleic
acids and vectors of the present invention. Furthermore, the
transgenic animals of the present invention are useful to study the
developmental expression of the LPH enzyme, for example in the
rodent intestine. It is furthermore envisaged, that the non-human
transgenic animals of the invention can be employed to test for
therapeutic agents/compositions or other possible therapies which
are useful to ameliorate adult-type hypolactasia.
[0045] In addition, the invention relates to an antibody or aptamer
or phage that specifically binds to the mutant nucleic acid
molecule of the invention but not to the corresponding wild type
nucleic acid molecule.
[0046] The antibody may be tested for binding and used in any
serologic technique well known in the art, such as agglutination
techniques in tubes, gels, solid phase and capture techniques with
or without secondary antibodies, or in flow cytometry with or
without immunofluorescence enhancement (see, for example,
techniques described in Harlow and Lane "Antibodies, A Laboratory
Manual", CSH Press, Cold Spring Harbor, USA, 1988 (see reference
53).
[0047] In line with the invention, the antibody specifically
recognizes an epitope comprising position -13910 (wherein the
nucleotide is C) or position -22018 (wherein the nucleotide is G).
It does not or essentially does not cross-react with an epitope
comprising position -13910 with a T in this position nor with the
epitope comprising position -22018 with a G in this position.
Specificity of an antibody which may be generated according to
standard protocols, may be tested by contacting with DNA molecules
carrying the wild-type and the mutant sequence such as in an ELISA
assay. Only those antibodies will be selected that produce a signal
over background with the mutant sequence but not with the wild-type
sequence.
[0048] The antibody of the invention may be a monoclonal antibody
or an antibody derived from or comprised in a polyclonal antiserum.
The term "antibody", as used in accordance with the present
invention, further comprises fragments of said antibody such as
Fab, F(ab').sub.2, Fv or scFv fragments; see, for example, Harlow
and Lane.sup.53, loc. cit. The antibody or the fragment thereof may
be of natural origin or may be (semi)synthetically produced. Such
synthetic products also comprise non-proteinaceous as
semi-proteinaceous material that has the same or essentially the
same binding specificity as the antibody of the invention. Such
products may, for example, be obtained by peptidomimetics.
[0049] The term "aptamer" is well known in the art and defined,
e.g., in Osborne et al., Curr. Opin. Chem. Biol. I (1997), 5-9 (see
reference 51) or in Stall and Szoka, Pharm. Res. 12 (1995), 465-483
(see reference 52).
[0050] Moreover, the invention relates to an antibody or aptamer or
phage that specifically binds to the wild-type nucleic acid
molecule as described herein above but not to the corresponding
mutant sequence contributing to or indicative of adult-type
hypolactasia. The statements with respect to specificity etc. made
for the antibody which is specific for the mutant sequence apply
mutatis mutandis here.
[0051] Furthermore, the invention relates to a pharmaceutical
composition comprising the wild-type nucleic acid molecule as
described herein above.
[0052] The pharmaceutical composition of the invention may be used
in gene therapy approaches, particularly in somatic gene
therapy.
[0053] The wild-type nucleic acid molecule referred to above and
contained in the pharmaceutical composition of the invention may be
combined with a pharmaceutically acceptable carrier and/or
diluent.
[0054] Examples of suitable pharmaceutical carriers are well known
in the art and include phosphate buffered saline solutions, water,
emulsions, such as oil/water emulsions, various types of wetting
agents, sterile solutions etc. Compositions comprising such
carriers can be formulated by well known conventional methods.
These pharmaceutical compositions can be administered to the
subject at a suitable dose. Administration of the suitable
compositions may be effected by different ways, e.g., by
intravenous, intraperitoneal, subcutaneous, intramuscular, topical,
intradermal, intranasal or intrabronchial administration. The
dosage regimen will be determined by the attending physician and
clinical factors. As is well known in the medical arts, dosages for
any one patient depends upon many factors, including the patient's
size, body surface area, age, the particular compound to be
administered, sex, time and route of administration, general
health, and other drugs being administered concurrently. A typical
dose can be, for example, in the range of 0.001 to 1000 .mu.g of
nucleic acid for expression or for inhibition of expression;
however, doses below or above this exemplary range are envisioned,
especially considering the aforementioned factors. Dosages will
vary but a preferred dosage for intravenous administration of DNA
is from approximately 10.sup.6 to 10.sup.12 copies of the DNA
molecule. Progress can be monitored by periodic assessment. The
compositions of the invention may be administered locally or
systemically. Administration will generally be parenterally, e.g.,
intravenously; DNA may also be administered directly to the target
site, e.g., by biolistic delivery to an internal or external target
site or by catheter to a site in an artery. Preparations for
parenteral administration include sterile aqueous or non-aqueous
solutions, suspensions, and emulsions. Examples of non-aqueous
solvents are propylene glycol, polyethylene glycol, vegetable oils
such as olive oil, and injectable organic esters such as ethyl
oleate. Aqueous carriers include water, alcoholic/aqueous
solutions, emulsions or suspensions, including saline and buffered
media. Parenteral vehicles include sodium chloride solution,
Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's,
or fixed oils. Intravenous vehicles include fluid and nutrient
replenishers, electrolyte replenishers (such as those based on
Ringer's dextrose), and the like. Preservatives and other additives
may also be present such as, for example, antimicrobials,
anti-oxidants, chelating agents, and inert gases and the like.
[0055] Additionally, the invention relates to a diagnostic
composition comprising the nucleic acid molecule as described
herein above, the vector as described herein above, the primer or
primer pair as described herein above, and/or the antibody aptamer
and/or phage as described herein above.
[0056] The diagnostic composition is useful for assessing the
genetic status of a person with respect to his or her
predisposition to develop adult-type hypolactasia or with regard to
the diagnosis of the acute condition. The various possible
components of the diagnostic composition may be packaged in one or
more vials, in a solvent or otherwise such as in lyophilized form.
If dissolved in a solvent, the diagnostic composition is preferably
cooled to at least +8.degree. C. to +4.degree. C. Freezing may be
preferred in other instances.
[0057] The invention also relates to a method for testing for the
presence or predisposition of adult-type hypolactasia or associated
trait comprising testing a sample obtained from a prospective
patient or from a person suspected of carrying such a
predisposition to the presence of the nucleic acid molecule as
described herein above in a homozygous or heterozygous state. In
varying embodiments, it may be tested either for the presence of
the wild-type sequence(s) or of the mutant sequence(s).
[0058] The method of the invention is useful for detecting the
genetic set-up of said person/patient and drawing appropriate
conclusions whether a condition from which said patient suffers is
adult-type hypolactasia. Alternatively, it may be assessed whether
a person not suffering from a condition carries a predisposition to
adult-type hypolactasia. With regard to position -13910 upstream of
the LPH gene, only if cytosine is found in a homozygous state, a
condition would be diagnosed as adult-type hypolactasia or a
corresponding predisposition would be manifest. On the other hand,
if thymidine is found in a homozygous state or if the individual is
heterozygous (C/T), then it may be concluded that a condition from
which a patient suffers is not related to adult-type hypolactasia
and further, that the patient does not carry a predisposition to
develop this condition. It may, however, be concluded that children
of persons carrying the heterozygous genotype may develop the
condition if chromosome carrying the C residue is matched with a
corresponding chromosome from the other parent.
[0059] The situation is similar and essentially the same
conclusions apply for the analysis of the SNP in position -22018. A
homozygously occurring G residue marks a predisposition to or the
occurrence of acute adult-type hypolactasia. A heterzygous G/A
state correlates with a high likelihood to not develop the
condition. Individuals carrying A in a homozygous state would not
be expected to develop the condition. Similarly, patients suffering
from a condition would be diagnosed not to suffer from adult-type
hypolactasia.
[0060] In a preferred embodiment of the method of the invention
said testing comprises hybridizing the complementary nucleic acid
molecule as described herein above which is complementary to the
nucleic acid molecule contributing to or indicative of adult-type
hypolactasia or the nucleic acid molecule as described herein above
which is complementary to the wild-type sequence as a probe under
(highly) stringent conditions to nucleic acid molecules comprised
in said sample and detecting said hybridization.
[0061] Again, depending on the nucleic acid probe used, either
wild-type or mutant sequences (i.e. sequences contributing to or
indicative of adult-type hypolactasia) would be detected. It is
understood that hybridization conditions would be chosen such that
a nucleic acid molecule complementary to wild-type sequences would
not or essentially not hybridize to the mutant sequence. Similarly,
a nucleic acid molecule complimentary to the mutant sequence would
not or would not essentially not hybridize to the wild-type
sequence. In order to differentiate between results obtained from
homozygous and heterozygous genotypes in the hybridization methods
of the invention, one can for example monitor/detect the
strength/intensity of the respective detection signal after the
hybridization. To differentiate between wild-type homozygous,
heterozygous and/or mutant homozygous allels in the hybridization
methods of the invention, internal control samples of the
corresponding genotypes will be included in the analysis.
[0062] In a further preferred embodiment, the method of the
invention further comprises digesting the product of said
hybridization with a restriction endonuclease or subjecting the
product of said hybridization to digestion with a restriction
endonuclease and analyzing the product of said digestion.
[0063] This preferred embodiment of the invention allows by
convenient means, the differentiation between an effective
hybridization and a non-effective hybridization. For example, if
the DNA sequence adjacent to position -13910 or position -22018
comprises an endonuclease restriction site, the hybridized product
will be cleavable by an appropriate restriction enzyme upon an
effective hybridization whereas a lack of hybridization will yield
no double-stranded product or will not comprise the recognizable
restriction site and, accordingly, will not be cleaved. In
particular, the restriction enzymes specific for the sequence of
the DNA-variant C/T.sub.-13910 is CviJ I, for the DNA-variant
G/A.sub.-22018 are HhaI and Aci I. Said restriction enzymes which
cut rg/cy where found by the use of the program Webcutter. The
analysis of the digestion product can be effected by conventional
means, such as by gel electrophoresis which may be optionally
combined by the staining of the nucleic acid with, for example,
ethidium bromide. Combinations with further techniques such as
Southern blotting are also envisaged.
[0064] Detection of said hybridization may be effected, for
example, by an anti-DNA double-strand antibody or by employing a
labeled oligonucleotide. Conveniently, the method of the invention
is employed together with blotting techniques such as Southern or
Northern blotting and related techniques. Labeling may be effected,
for example, by standard protocols and includes labeling with
radioactive markers, fluorescent, phosphorescent, chemiluminescent,
enzymatic labels, etc. (see also above).
[0065] In accordance with the above, in another preferred
embodiment of the method of the invention said probe is detectably
labeled, e.g. by the methods and with the labels described herein
above.
[0066] In yet another preferred embodiment of the method of the
invention said testing comprises determining the nucleic acid
sequence of at least a portion of the nucleic acid molecule as
described herein above, said portion comprising nucleotide position
-13910 and/or nucleotide position -22018 of the LPH gene.
[0067] Determination of the nucleic acid molecule may be effected
in accordance with one of the conventional protocols such as the
Sanger or Maxam/Gilbert protocols (see Sambrook et al., loc. cit.,
for further guidance).
[0068] In a further preferred embodiment of the method of the
invention the determination of the nucleic acid sequence is
effected by solid-phase minisequencing. Solid-phase minisequencing
is based on quantitative analysis of the wild type and mutant
nucleotide in a solution. First, the genomic region containing the
mutation is amplified by PCR with one biotinylated and
non-biotinylated primer where the biotinylated primer is attached
to a streptavidin (SA) coated plate. The PCR-product is denatured
to a single stranded form to allow a minisequencing primer to bind
to this strand just before the site of the mutation. The tritium
(H3) or fluorescence labeled mutated and wild type nucleotides
together with nonlabeled dNTPs are added to the minisequencing
reaction and sequenced using Taq-polymerase. The result is based on
the amount of wild type and mutant nucleotides in the reaction
measured by beta counter or fluorometer and expressed as an
R-ratio. See also Syvnen AC, Sajantila A, Lukka M. Am J Hum Genet
1993: 52,46-59 and Suomalainen A and Syvanen AC. Methods Mol Biol
1996;65:73-79.
[0069] A preferred embodiment of the method of the invention
further comprises, prior to determining said nucleic acid sequence,
amplification of at least said portion of said nucleic acid
molecule.
[0070] Preferably, amplification is effected by polymerase chain
reaction (PCR). Other amplification methods such as ligase chain
reaction may also be employed.
[0071] In a preferred embodiment of the method of the invention
said testing comprises carrying out an amplification reaction
wherein at least one of the primers employed in said amplification
reaction is the primer as described herein above or belongs to the
primer pair as described herein above, comprising assaying for an
amplification product. In this embodiment and depending on the
information the investigator/physician wishes to obtain, primers
hybridizing either to the wild-type or mutant sequences may be
employed.
[0072] The method of the invention will result in an amplification
of only the target sequence, if said target sequence carries a
sequence exactly complementary to the primer used for
hybridization. This is because the oligonucleotide primer will
under preferably (highly) stringent hybridization conditions not
hybridize to the wild-type/mutant sequence--depending which type of
primer is used--(with the consequence that no amplification product
is obtained) but only to the exactly matching sequence. Naturally,
combinations of primer pairs hybridizing to both SNPs may be used.
In this case, the analysis of the amplification products expected
(which may be no, one, two, three or four amplification product(s)
if the second, non-differentiating primer is the same for each
locus) will provide information on the genetic status of both
positions -13910 and -22018.
[0073] In a preferred embodiment of the method of the invention
said amplification is effected by or said amplification is the
polymerase chain reaction (PCR).
[0074] The PCR is well established in the art. Typical conditions
to be used in accordance with the present invention include for
example a total of 35 cycles in a total of 50 .mu.l volume
exemplified with a denaturation step at 93.degree. C. for 3
minutes; an annealing step at 55.degree. C. for 30 seconds; an
extension step at 72.degree. C. for 75 seconds and a final
extension step at 72.degree. C. for 10 minutes.
[0075] The invention furthermore relates to a method for testing
for the presence or predisposition of adult-type hypolactasia
comprising assaying a sample obtained from a human for specific
binding to the antibody or aptamer or phage as described herein
above. In this context a weaker staining for the presence of the
antigen of the invention compared to homozygous wild type control
samples (comprising two persistent allels) is indicative for the
heterozygous wild type (one persistent allele and one hypolactasic
allele, whereas for the homozygous hypolactasic individual no
staining is expected if the appropriate antibody is used.
Preferably, the method of the invention is performed in the
presence of control samples corresponding to all three possible
allelic combinations as internal controls. Testing may be carried
out with an antibody etc. specific for the wild-type or specific
for the mutant sequence.
[0076] Testing for binding may, again, involve the employment of
standard techniques such as ELISAs; see, for example, Harlow and
Lane.sup.53, loc. cit.
[0077] In a preferred embodiment of the method of the invention
said antibody or aptamer or phage is detectably labeled.
[0078] Whereas the aptamers are preferably radioactively labeled
with .sup.3H or .sup.32P or with a fluorescent marker as described
above, the phage or antibody may either be labeled in a
corresponding manner (with 131I as the preferred radioactive label)
or be labeled with a tag such as His-tag, FLAG-tag or myc-tag.
[0079] In a further preferred embodiment of the method of the
invention the test is an immuno-assay.
[0080] In another preferred embodiment of the method of the
invention said sample is blood, serum, plasma, fetal tissue,
saliva, urine, mucosal tissue, mucus, vaginal tissue, fetal tissue
obtained from the vagina, skin, hair, hair follicle or another
human tissue.
[0081] In an additional preferred embodiment of the method of the
invention said nucleic acid molecule from said sample is fixed to a
solid support.
[0082] Fixation of the nucleic acid molecule to a solid support
will allow an easy handling of the test assay and furthermore, at
least some solid supports such as chips, silica wafers or
microtiter plates allow for the simultaneous analysis of larger
numbers of samples. Ideally, the solid support allows for an
automated testing employing, for example, roboting devices.
[0083] In a particularly preferred embodiment of the method of the
invention said solid support is a chip, a silica wafer, a bead or a
microtiter plate.
[0084] Furthermore, the invention relates to the use of the nucleic
acid molecule as described herein above for the analysis of the
presence or predisposition of adult-type hypolactasia.
[0085] The nucleic acid molecule simultaneously allows for the
analysis of the absence of the condition or the predisposition to
the condition, as has been described in detail herein above.
[0086] In addition, the invention relates to a kit comprising the
nucleic acid molecule as described herein above, the primer or
primer pair as described herein above, the vector as described
herein above, and/or the antibody aptamer and/or phage as described
herein above in one or more containers.
[0087] The invention as well relates to the use of the nucleic acid
molecule as described herein above or the vector as described
herein above in gene therapy.
[0088] Gene therapy approaches have been discussed herein above in
connection with the vector of the invention and equally apply here.
It is of note that in accordance with this invention, also
fragments of the nucleic acid molecules as defined herein above and
as, in particular, depicted in SEQ ID NOS: 3 to 4 may be employed
in gene therapy approaches. Said fragments comprise the nucleotide
at position -13910 as defined in (c) herein above (and also shown
in SEQ ID NO: 3) or position -22018 as defined in (d) herein above
(and as shown in SEQ ID NO: 4). Preferably, said fragments comprise
at least 200, at least 250, at least 300, at least 400 and most
preferably at least 500 nucleotides.
[0089] In a preferred embodiment of the use of the invention said
gene therapy treats or prevents adult-type hypolactasia.
[0090] The figures show:
[0091] FIG. 1: The Finnish adult-type hypolactasia families
studied. Blackened symbols indicate hypolactasic individuals,
asterisk (*) indicate that no sample was available, question mark
(?) indicates unknown affection status. .Arrow-up bold. indicates
the individuals used for sequencing for SNP identification (Table
2).
[0092] FIG. 2: Physical map of adult-type hypolactasia locus. BAC
clones are shown above the horizontal line. The three genes LPH,
MCM6 and DARS are shown by thick black arrows with the tip pointed
toward the 3' end of the gene above the black boxes. The position
of ten polymorphic microsatellite markers used for fine mapping of
the locus are shown. The backslash in the horizontal line denotes a
gap in the sequence of the contig sequence. The position of marker
D2S2169 was confirmed by bridging the gap with PAC 106O20 isolated
from the PAC library as described before.sup.40. The organisation
of the MCM6 gene is shown including the position of the lactase
persistent phenotype-associated variants in introns 9 and 13
located 13.9 kb and 22 kb 5' of the first ATG of LPH.
[0093] FIG. 3: Extended haplotype analysis of the persistent
chromosomes derived from Finnish adult-type hypolactasia families
using seven closely liked microsatellite markers. The haplotypes
representing the ancestral founder persistent chromosome are
shaded. Only the haplotypes of non-persistent chromosomes that were
also present in the persistent chromosomes are shown. On the basis
of ancestral recombinations, the adult-type hypolactasia locus
could be restricted to 47 kb interval between markers LPH1 and
AC3.
[0094] FIG. 4: The sequence comprised in the sequence of intron 13
of the MCM6 gene (3220 bp) comprising the SNP at position -13910 in
which the T, which is specific for the lactase persistence, is
substituted by a C. Said position is indicated by the use of a
small letter. This sequence refers to SEQ ID NO:1.
[0095] FIG. 5: The sequence comprised in the sequence of intron 9
of the MCM6 gene(1295 bp) comprising the SNP at position -22018 in
which the A, which is specific for the lactase persisting-type
sequence is substituted by a G. Said position is indicated by the
use of a small letter. This sequence refers to SEQ ID NO:2.
[0096] FIG. 6: The sequence of the lactase persisting-type intron
13 of the MCM6 gene (3220 bp) comprising at position -13910 a T.
Said position is indicated by the use of a small letter. This
sequence refers to SEQ ID NO:3.
[0097] FIG. 7: The sequence of the lactase persisting-type intron 9
of the MCM6 gene(1295 bp) comprising at position -22018 an A. Said
position is indicated by the use of a small letter. This sequence
refers to SEQ ID NO:4.
[0098] FIG. 8: The sequence of intron 13 of the MCM6 gene (3220 bp)
comprising the SNP at position -13910 in which the T, which is
specific for the lactase persisting-type sequence is substituted by
a C. Said position is indicated by the use of a small letter. This
sequence refers to SEQ ID NO:5.
[0099] FIG. 9: The sequence of intron 9 of the MCM6 gene(1295 bp)
comprising the SNP at position -22018 in which the A, which is
specific for the lactase persisting-type sequence is substituted by
a G. Said position is indicated by the use of a small letter. This
sequence refers to SEQ ID NO:6.
[0100] The examples illustrate the invention.
EXAMPLE 1
Linkage and Linkage Disequilibrium Analysis
[0101] Seven polymorphic microsatellite markers between D2S114 and
D2S2385 flanking the LPH gene on 2q21 were analyzed in nine
extended Finnish hypolactasia families (FIG. 1). Significant
evidence for linkage was found with markers D2S314, D2S442, D2S2196
and D2S1334, with a maximum lod score of 7.67 at .theta.=0 obtained
with marker D2S2196 (Table 1). Obligatory recombination events were
detected with marker D2S114 (family B, IV3), which defines the
centromeric boundary for the lactase persistence/non-persistence
locus, and with marker D2S2385 (family B, IV17) (FIG. 1, Table 1),
which defines the telomeric boundary of the locus. To fine map the
critical region, nine additional polymorphic markers were analyzed
(Table 1). Linkage disequilibrium (LD) over the region was
monitored conditional on the detected linkage treating the allele
frequencies and the recombination fraction as nuisance
parameters.sup.16-17. Six out of nine markers (LPH13, LPH2, LPH1,
AC3, AC4, and AC10), spanning over .about.200 kb interval showed
highly significant evidence of LD (p<10.sup.-4) whereas markers
3' from the LPH gene showed no evidence of LD (Table 1). Two
markers, LPH2 and AC3, displayed the most significant linkage
disequilibrium in the lactase persistence alleles
(p<10.sup.-7).
[0102] The family material consisted of nine extended Finnish
pedigrees originally studied by Sahi.sup.5. All family material was
tested for adult-type hypolactasia in the 1970s. The family
material for this study was enlarged by collecting the DNA of the
family members in the younger generations. The family material in
this study consisted of 194 individuals in total (FIG. 1). The
phenotypic status of all family members was confirmed by lactose
tolerance tests with ethanol (LTTE).sup.4-5 in all but 49
individuals. Gluten enteropathy has been excluded in all affected
patients by measurement of the serum IgA anti-tissue
transglutaminase.sup.45. DNA was extracted from blood samples taken
from all participating family members in accordance with standard
protocols.sup.46, after obtaining informed consent. As a
case-control study 196 random DNA samples isolated from jejunal
biopsy specimens from which disaccharidase activities had been
measured.sup.47 at the Helsinki University Hospital were sequenced.
DNA was isolated from intestinal biopsies according to the standard
protocol.sup.46. These series comprised 137 lactase persistent and
59 non-persistent samples. In addition DNA from nine Italian,
kindly provided by M. Rossi, University of Naples, nine German DNA
samples, kindly provided by M. Lentze, University of Bonn and
twenty two South Korean, kindly provided by J. K. Seo, Seoul
National University, intestinal biopsy sample specimens were
analyzed (In the table: 23 Korean, 9 Italian and 7 Germans (One of
the cases from Germany originated from South Korea). The diagnosis
was based on the measurement of disaccharidase activities. Finally,
to determine the frequency of the C/T.sub.-13910 variant in the
Finnish population, the DNA of 938 anonymous Finnish blood donors
from small parishes from Eastern and Western Finland and the DNA of
109 parents belonging to the CEPH families.sup.19 were analyzed. In
addition, genomic DNA from a baboon (Papio hemedryas ussinus)
isolated from liver biopsy using standard protocols.sup.48 was
analyzed. The study was approved by the Ethical Committees of the
Helsinki University Hospital and the Finnish Red Cross Blood
Transfusion Service.
EXAMPLE 2
Extended Haplotype Analysis
[0103] In the first stage ten highly polymorphic microsatellite
markers flanking the LPH gene on 2q21 were analyzed as described
elsewhere.sup.40,55. Briefly, the ten highly polymorphic
microsatellite markers on 2q in the vicinity of the lactase gene
from The Gnthon Resource Center.sup.55 were analyzed with genetic
distances as follows: cen-D2S114-1 cM-D2S1334-0 cM-D2S2196-0
cM-D2S442-2 cM-D2S314-2 cM-D2S2385-1 cM-D2S2288-1 cM-D2S397-1
cM-D2S150-1 cM-D2S132. The order of the markers has been mostly
obtained from the physical YAC contig map of chromosome 2 (Chumakov
et al. 1995.sup.56) supplemented with the Gnthon map. PCR was
performed in a total volume of 15 ul containing 12 ng of template
DNA, 5 pmol of primers, 0.2 mM of each nucleotide, 20 mMTrisHCl (pH
8.8), 15 mM (NH.sub.4).sub.2S0.sub.4, 1.5 mM MgCl.sub.2, 0.1% Tween
20, 0.010/gelatin and 0.25U Taq polymerase (Dynazyme, Finnzymes).
One of the primers was radiolabeled at the 5' end with
.sup.32P-.gamma.ATP. The reactions were performed in a multiwell
microtitre plate for 35 cycles with denaturation at 94.degree. C.
for 30 s, annealing at various temperatures depending on the
primers for 30 s and extension at 72.degree. C. for 30 s;
denaturation was set at 3 min and final extension at 5 min. The
amplified fragments were separated on 6% polyacrylamide gel, and
autoradiography was performed.
[0104] In the second stage, nine additional microsatellite markers
within the contig constructed over the LPH gene were identified
from the published genomic sequence of the BACs (NH034L23,
NH0318L13, NH0218L22, and RP11-32911) using the Repeat Masker
program (http://ftp.genome.washin- gton.edu/cgi-bin/RepeatMasker).
Primers flanking the repeats were synthesized. PCR conditions were
as described elsewhere.sup.40. The amplified fragments were
separated on 6% polyacrylamide gel, and autoradiography was
performed.
[0105] Pairwise lod scores were calculated by use of the MLINK
option of the LINKAGE program package.sup.49. Autosomal recessive
inheritance for adult-type hypolactasia with complete penetrance,
no sex difference in recombination fractions, and a disease allele
frequency of 0.4 was assumed. Only individuals above 20 years of
age were included in the study as the condition is manifested by
that age in the Finnish population.sup.5-6. The affection status
for individuals not confirmed by LTTE was regarded as unknown.
Allele frequencies and heterozygosities for the markers were
estimated from family material using the Downfreq program for
purposes of the parametric linkage analysis.sup.49. Additionally,
pseudomarker linkage and linkage disequilibrium analyses were
performed, assuming autosomal recessive mode of inheritance.sup.16.
A test of LD was performed conditional on the detected linkage
treating the allele frequencies and the recombination fraction as
nuisance parameters.sup.16,49. P-values from these analyses are
shown in Table 1. Haplotypes were constructed manually for the
microsatellite markers in this order:
LPH1-LPH2-LPH13-AC7-AC3-AC4-AC5 (FIG. 3). A total of 54
non-persistent chromosomes and 33 persistent chromosomes in our
family material were available for haplotype analysis.
[0106] The order of the closely linked markers was confirmed by
assembling four BAC-clones NH0034L23, NH0218L22, NH0318L13 and
329I10 in the critical region into one uninterrupted sequence
segment. This contig extended from marker AC8 to the exon 10 of the
aspartyl-tRNA synthetase (DARS) gene and covered a total of 222,5
kb (FIG. 2). Based on this physical map of the linked region,
extended haplotypes with seven markers covering a 150 kb interval
(cen-LPH13-LPH2-LPH1-AC7-AC3-AC4-AC5-tel) (FIG. 3) were
constructed. One major haplotype was present in 20 persistence
alleles (60%) versus 3 of the non-persistence alleles (5%), whereas
a wide diversity of haplotypes was observed in non-persistence
alleles. The remaining 40% of the haplotypes in the persistence
alleles differed from the ancestral haplotype in a manner
consistent with a breakdown of the haplotype by historical
recombination events. Based on the conserved haplotype analysis,
the locus for lactase persistence could be restricted to a 47 kb
interval between markers LPH1 and AC3 (FIG. 3)
EXAMPLE 3
Sequence Analysis of the Adult-Type Hypolactasia Locus
[0107] The 47 kb region between the markers LPH1 and AC3 was
amplified in overlapping PCR fragments from genomic DNA of several
members of the nine hypolactase families and sequenced. The region
contains the minichromosome maintenance (MCM6) gene.sup.18, which
covers 36 kb of the critical 47 kb region (FIG. 2). No variations
were detected in the coding region of the MCM6 gene but total of 52
variants; 43 SNPs and 9 deletion/insertion polymorphisms, were
identified in the critical 47 kb region (Table 2). Only two of the
variants (C/T.sub.-13910, G/A.sub.-22018) were associated with the
lactase persistence/non-persiste- nce trait in the Finnish families
(Tables 2 and 3). The first associated variant, CT.sub.-13910,
resides in intron 13 of the MCM6 gene at position -13910 bp from
the first ATG-codon of the LPH gene. The second associated variant,
G/A.sub.22018, is located in intron 9 of the MCM6 gene at position
-22018 from the first ATG-codon of the LPH gene (FIG. 2). These two
variants, 8 kb apart from each other, completely cosegregated with
adult-type hypolactasia in nine extended Finnish families. All
hypolactasic (non-persistent) family members were homozygous for
both C.sub.-13910 and G.sub.-22018 (Table 3). Interestingly, both
these variants reside in repeat elements, C/T.sub.-13910 in an
L2-derived element and G/A.sub.-22018 in an Alu element.
[0108] Experimentally, three non-persistence, 2 homozygous
persistence and 2 heterozygous persistence individuals sharing a
similar haplotype across the critical region from our family
material were used for sequencing in the first stage (FIG. 1).
Using the published draft genomic sequence of the BACs: NH0034L23,
NH0218L22 NH0318L23, and RP-329I10 that covered the critical region
of adult-type hypolactasia were assembled to one contig using
Sequencher 4 software (Gene Codes Corporation). Oligonucleotide
primers spanning the critical region between markers LPH1 and AC3
were designed (a list of oligonucleotide primers described herein
below). PCR amplifications were carried out in a 50 .mu.l volume
with genomic DNA (100 ng), primers (20 ng each), dNTPs (200 .mu.M),
0.5 U of Taq polymerase (Dynazyme, Finnzymes) in a standard buffer.
Most PCR were amplified using the following PCR cycle conditions:
an initial round of denaturation at 94.degree. C. for 3 min, then
35 cycle at 94.degree. C. at 30 s, 55.degree. C. for 30 s, and
72.degree. C. for 1.25 min and a final extension of 72.degree. C.
for 10 min, except that in cases where the size of the PCR products
were more than 1 kb we used the Dynazyme extend kit (conditions are
described herein below). Purified PCR products (15-40 ng) were
cycle sequenced using BigDye terminator chemistry (PE Biosystems).
Data were analyzed using ABI Sequencing Analysis 3.3 (PE
Biosystems) and Sequencher 4.1 (Gene Codes).
[0109] Detection of the Lactase Variants by Sequencing:
[0110] PCR amplifications were carried out in a 50 .mu.l volume
with genomic DNA (100 ng), primers (20 ng each), dNTPs (200 .mu.M),
0.5 U of Taq polymerase (Dynazyme, Finnzymes) in a standard buffer.
Both PCRs were amplified using the following PCR cycle conditions:
an initial round of denaturation at 94.degree. C. for 3 min, then
35 cycles at 94.degree. C. at 30 s, 55.degree. C. for 30 s, and
72.degree. C. for 1.25 min and a final extension of 72.degree. C.
for 10 min. PCR were purified by enzymatic reaction. Purified PCR
products (15-40 ng) were cycle sequenced using BigDye terminator
chemistry (PE Biosystems). Data were analyzed using ABI Sequencing
Analysis 3.3 (PE Biosystems) and Sequencher 4.1 (Gene Codes).
[0111] Screening of the Lactase Variants by Solid-Phase
Minisequencing:
[0112] The DNA fragment spanning the C/T.sub.-13910 variant was
amplified using one biotinylated
(5'-Bio-CCTCGTTAATACCCACTGAcCTA-3') primer and unbiotinylated
(5'-GTCACTTTGATATGATGAGAGCA-3') primer. For G/A.sub.-22018
biotinylated (5'-Bio-TGCTCAGGACATGCTGATCAA-3') and one
unbiotinylated (5'-CTACCCTATCAGTAAAGGCCTA-3') primer were used
under conditions described above. 10 .mu.l of the PCR product was
captured in a streptavidin coated microtiter well (Lab systems,
Finland). The wells were washed, and bound DNA was denaturated as
described by Syvnen et al. (Am J Hum Genet. (1993), 52, 46-59) and
Syvnen and Landegren (Hum Mutat. (1994), 3, 172-9). 50 .mu.l of the
minisequencing reaction mixture contained 10 pmoles of the
minisequencing primers for C/T.sub.-13915
(5'-GGCAATACAGATAAGATAATGTAG-3'), G/A.sub.-22018
(5'-AAAAACAGCATTCTCAGCTG- GGC-3'), and 0.1 .mu.l of either H-dCTP,
H-dGTP corresponding to the lactase non-persistence allele (115
Ci/mmol; Ammersham, UK) or H-dTTP, H-sATP corresponding to the
lactase persistence allele and 0.05 units of DNA polymerase
(Dynazyme II, Finnzymes) in its buffer was added to each well. The
microtiter plates were incubated for 20 min at 50.degree. C., and
the wells ere washed. The detection was eluted, and the eluted
radioactivity was measured in a liquid scintillation counter
(Rackbeta 1209, Wallac, Finland). Two parallel minisequencing
reactions were carried out for each PCR product.
1 PCR primers and detection primer for the C/T.sub.-13910 variant:
Forward PCR primer: GTCACTTTGATATGATGAGAGCA Tm 58 SEQ ID NO: 8
Detection primer: GGCAATACAGATAAGATAATGTAG Tm 58 SEQ ID NO: 10
Bio-Reverse primer: Bio-CCTCGTTAATACCCACTGACCTA Tm 62 SEQ ID NO: 9
or Bio-TAGGTCAGTGGGTATTAACGAGGT SEQ ID NO: 7 PCR primers and
detection primer for the G/A.sub.-22018 variant: Forward PCR
primer: CTACCCTATCAGTAAAGGCCTA Tm 58 SEQ ID NO: 12 Detection
primer: AAAAACAGCATTCTCAGCTGGGC Tm 62 SEQ ID NO: 14 Bio-Reverse
primer: Bio-TGCTCAGGACATGCTGATC- AA Tm 62 SEQ ID NO: 13 or
Bio-TTGATCAGCATGTCCTGAGCA SEQ ID NO: 11
EXAMPLE 4
Monitoring the DNA-Variants in a Case/Control Study Sample
[0113] The frequency of the C/T.sub.-13910 and G/A.sub.-22018
variants was analyzed in DNA samples isolated from a total of 196
intestinal biopsy samples specimens which had been analyzed for
disaccharidase activity as a diagnostic test for hypolactasia. A
total of 59 samples showed primary lactase deficiency. Six out of
59 cases (Table 3) were heterozygous GA for the G/A.sub.-22018
variant, the remaining 53 being homozygous for the G allele. All 59
samples were homozygous for the C allele of the variant
C/T.sub.-13910.
[0114] Among the 137 cases showing lactase persistence, 74 were
found to be homozygous for alleles T and A, 63 being heterozygous
CT and GA and none being homozygous for alleles C and G at
C/T.sub.-13910 and G/A.sub.-22018, respectively (Table 3).
[0115] To analyze these variants in other populations, DNA samples
isolated from intestinal biopsy specimens from 40 non-Finnish cases
with established disaccharidase deficiency were sequenced: 23 cases
originated from South Korea, 9 from Italy and 8 from Germany. One
Italian case was heterozygous GA for G/A.sub.-22018 whereas all
remaining 39 cases were homozygous CC and GG for C/T.sub.-13910 and
G/A.sub.-22018 respectively (Table 3). An extended study gave rise
to the data provided in Table 7 representing data of the complete
association of C/T.sub.-13910 variant with the biochimcally
verified hypolactasia (lactase non-persistence) in 400 individuals
for 6 different populations. The G/A.sub.-22018 variant was
associated with the lactase non-persistence in 400 out of 401
cases.
EXAMPLE 5
Molecular Epidemiology of the Lactase Persistence Variant
C/T.sub.-13910
[0116] To monitor for the prevalence of the hypolactasia-associated
variant in the Finnish population a solid-phase minisequencing
method.sup.19,20 was used to screen DNA samples of 938 anonymous
Finnish blood donors originating either from the Western early
settlement region or the Eastern late settlement region of Finland
(Table 4). Experimentally, the DNA fragment spanning the
C/T.sub.-13910 variant was amplified using one biotinylated
(5'-CCTCGTTMTACCCCTGACCTA-3') primer and unbiotinylated
(5'-GTCACTTTGATATGATGAGAGCA-3') primer. For G/A.sub.-22018 we used
one biotinylated (5'-AGTCTGTGGCATGTGTCTTCATG-3') and one
unbiotinylated ('5-TGCTCAGGACATGCTGATCMCT-3') primer under
conditions described above. 10 .mu.l of the PCR product was
captured in a streptavidin coated microtitre well (Lab system,
Finland). The wells were washed, and the bound DNA was denatured as
described previously.sup.19,20, 50 .mu.l of the minisequencing
reaction mixture contain 10 pmoles of the minisequencing primers
for G/A.sub.-22005 (5'-GACAAAGGTGTGAGCCACCG-3'), G/A.sub.-13915
(5'-GGCMTACAGATMGATMTGTAG-3'- ) and 0,1 .mu.l of either H-dCTP
corresponding to the lactase non-persistence allele (115 Ci/mmol;
Amersham, UK) or H-dTTP corresponding to the lactase persistence
allele and 0.05 units of DNA polymerase (Dynazyme II, Finnzymes) in
its buffer was added to each well. The microtiter plates were
incubated for 20 min at 50.degree. C., and the wells were washed.
The detection primer was eluted, and the eluted radioactivity was
measured in a liquid scintillation counter (Rackbeta 1209, Wallac,
Finland). Two parallel minisequencing reactions were carried out
for each PCR product. The overall prevalence of the putative
hypolactasia genotype CC.sub.-13910 (170 cases) was 18.1%, with
higher prevalence (16.8% versus 18.9%) in the western than in the
eastern sample (Table 4). These values are in good agreement with
the epidemiological study reporting the prevalence of 17% among
Finnish speaking Finns with an increasing gradient from West to
East.sup.2. The same set of samples for the G/A.sub.-22018
polymorphism was also genotyped, and the LD between these two SNPs
monitored using the D' statistic.sup.21. They were found to be in
almost complete LD (D'=0.98, p=7.62.times.10.sup.-11, Table 5).
[0117] The prevalence of hypolactasia in different populations is
known to vary greatly from less than 5% to almost 100%.sup.3,6. To
determine whether these changes in hypolactasia prevalence would
correlate with the distribution of the genotype CC.sub.-13910, the
DNA of the parents of CEPH families.sup.22 was analyzed. CEPH
families have been mainly collected from France, with reported
prevalence of hypolactasia around 37% .sup.23 and Utah, the Utah
populations originating from Northern Europe with prevalence of
hypolactasia less than 5%.sup.24. Genotyping of the parents in CEPH
families revealed that 41,2% (7 out of 17 samples) of French
families have the genotype CC whereas only 7,6% (7 out of 92
samples) of Utah families have the genotype CC (Table 4). Again,
despite the small number of analyzed samples these figures agree
with the values obtained in the epidemiological studies of
hypolactasia in these populations.sup.23,24.
[0118] Table 8 demonstrates that the observed prevalence of the
variants well agrees with the described population frequencies of
the lactose intolerance.
EXAMPLE 6
The Genealogy of the Lactase Persistence Variant C/T.sub.-13910
[0119] Haplotype analysis in the Finnish families suggested that
most if not all, lactase persistence alleles in Finland have
descended from one common ancestor. Linkage disequilibrium was used
to estimate the time of the introduction of the persistence allele
into the Finnish population.sup.25. Assuming 20 years generation
time, this estimate would indicate that the founder mutation was
introduced into the Finnish population some 9000-11400 years ago
(Table 6). This is in good agreement with earliest signs of
settlement in the Finnish mainland some 8000-9000 years ago.sup.26
and would reasonably well coincide with the beginning of the dairy
farming in 8000-10.000 BC.sup.27. More importantly, the presence of
the same DNA-variant in persistence alleles in different
populations would suggest that this variant is even more ancient
and the mutation has occurred before differentiation of the
analyzed populations.
[0120] To get some insight into the phylogenetic origin of the
lactase allele, intron 9 and part of intron 13 of the MCM6 gene of
a Baboon (Papio Hamadryas) were sequenced. Genotype GG and CC was
present in Baboons DNA at both G/A.sub.-22018 and C/T.sub.-13910.
This could suggest that alleles G and C, respectively reflect the
appearance of the ancestral allele, presenting the non-persistence
type and a mutation has transformed this allele to create the
persistence allele. This assumption is supported by the
identification of the LD and shared haplotype in the persistence
alleles versus a high diversity of alleles found in non-persistence
alleles.
EXAMPLE 7
Pairwise LD of C/T and G/A Variants.
[0121] Pairwise LD between C/T.sub.-13910 and G/A.sub.-22018 was
estimated using the D' statistic.sup.21. Haplotype frequencies were
estimated by Maximum likelihood using the EH program.sup.50. D' is
calculated as max(D/D.sub.max, D/D.sub.min): where disequilibrium
measure D=h.sub.pq-pq, where h.sub.pq is the frequency of the
haplotype with rare allele at each locus, p and q are frequency of
the rare alleles at loci 1 and 2 , and D.sub.max=min p(1-p),q(1-q)
if D>0, and D.sub.min=-min pq, (1-p)(1-q) if D<0. The
significance of devitationf of D' from 0 was determined using the
statistic 1 D 2 N p ( 1 - p ) q ( 1 - q )
[0122] which is distributed as .chi..sup.2 with 1 df.sup.21
[0123] Gene Accessions Numbers.
[0124] For BACs NH0218L22, N0034L34, NH0318L13, and RP11-329I10 are
AC012551, AC011893, AC011999 and AC016516 respectively. The
accession numbers for human polymorphisms are GenBank
AF395607-AF395615.
[0125] References
[0126] 1. Flatz, G. & Rotthauwe, H. The human lactase
polymorphism: physiology and genetics of lactose absorption and
malabsorption. Prog. Med. Genet. 2, 205-249 (1977).
[0127] 2. Sahi, T., Isokoski, M., Jussila, J. & Launiala, K.
Lactose malabsorption in Finnish children of school age. Acta
Paediatr Scand.61, 11-16 (1972).
[0128] 3. Wang, Y. et al. The genetically programmed
down-regulation of lactase in children. Gastroenterology.
114:1230-1236 (1998).
[0129] 4. Sahi, T., Isokoski, M., Jussila, J., Launiala, K. &
Pyorl, K. Recessive inheritance of adult-type lactose
malabsorption. Lancet.823-826 (1973).
[0130] 5. Sahi, T. The inheritance of selective adult-type lactose
malabsorption. Scand. J. Gastroenterol. suppl. 30, 1-73(1974).
[0131] 6. Sahi, T. Genetics and epidemiology of adult-type
hypolactasia. Scand. J. Gastroenterol. Suppl.202, 7-20 (1994).
[0132] 7. Boll, W., Wagner, P. & Mantei, N. Structure of the
chromosomal gene and cDNAs coding for lactase-phlorizin hydrolase
in human with adult-type hypolactasia or persistence of lactase. Am
.J. Hum. Genet. 48, 889-902 (1991).
[0133] 8. Mantei, N. et al. Complete primary structure of human and
rabbit lactase-phlorizin hydrolase: implications for biosynthesis,
membrane anchoring and evolution of the enzyme. EMBO J. 7,
2705-2713 (1988).
[0134] 9. Wang, Y. et al. The lactase persistence/non-persistence
polymorphism is controlled by a cis-acting element. Hum. Mol.
Genet.4, 657-662 (1995).
[0135] 10. Harvey, C. B., Pratt, W. S., Islam, I., Whitehouse, D.
B. & Swallow, D. M. DNA polymorphisms in the lactase gene:
linkage disequilibrium across the 70 kb region. Eur J. Hum. Genet.
3, 27-41 (1995).
[0136] 11. Escher, J. C et al. Molecular basis of lactase levels in
adult humans. J. Clin. Invest. 89, 480-483 (1992).
[0137] 12. Lloyd, M et al. Regulation of intestinal lactase in
adult hypolactasia. J. Clin. Invest. 89, 524-529 (1992).
[0138] 13. Fajardo, O., Naim, H. Y. & Lacey, S. W. The
polymorphic expression of lactase in adults is regulated at the
messenger RNA level. Gastroenterology 106, 1233-
[0139] 14. Luigi, M. et al. Mosaic regulation of lactase in human
adult-type Gastroenterology 112, 1506-1514 (1997).
[0140] 15. Rossi, M. et al. Lactase persistence versus decline in
human adults:Multifactorial events are involved in down-regulation
after weaning. Gastroenterology 112, 1506-1514 (1997).
[0141] 16. Goring, H. H. H. & Terwilliger, J. D. Linkage
analysis in the presence of errors IV: Joint pseudomarker analysis
of linkage and/or linkage disequilibrium on a mixture of pedigrees
and singletons when mode of inheritance cannot be accurately
specified. Am. J. Hum. Genet. 66,1310-1327 (2000).
[0142] 17. Terwilliger, J. D. & Goring, H. H. H. Gene mapping
in the 20th and 21st centuries: Statistical methods, data analysis,
and experimental design. Hum. Biol. 72, 63-132 (2000).
[0143] 18. Harvey, C. B. et al. Regional localization of the
lactase-phlorizin hydrolase, LCT, to chromosome 2q21. Ann. Hum.
Genet. 57,179-185 (1993).
[0144] 19. Syvnen, A-C., Sajantila, A., Lukka, M. Identification of
individuals by analysis of biallelic DNA markers, using PCR and
solid-phase minisequencing. Am. J. Hum. Genet. 52, 46-59
(1993).
[0145] 20. Syvnen, A-C. & Landegren, U. Detection of point
mutations by solid-phase methods. Hum. Mutat. 3,172-179 (1994)
[0146] 21. Thompson, E. A., Deeb, S., Walker, D. & Motulsky, A.
G. The detection of Linkage disequilibrium between closely linked
markers:RFLPs at the AI-CIII Apolipoprotein genes. Am. J. Hum.
Genet. 42,113-124 (1998).
[0147] 22. Dausset, J. et al. Centre d'tude du polymorphisme humain
(CEPH): Collaborative genetic mapping of human genome. Genomics 6,
575-577 (1990).
[0148] 23. Cuddenec, Y., Delbrock, H. & Flatz, G. Distribution
of the adult lactase phenotypes-lactose absorber and malabsorber-in
a group of 131 army recruit Gastroenterol. Clin. Biol. 6, 776-779
(1982).
[0149] 24. McLellan, T., Jorde, L. B. & Skolnick, M. H. Genetic
distance between the Utah Mormons and related populations. Am. J.
Hum. Genet. 36, 836-857 (1984).
[0150] 25. Terwilliger, J. D. A powerful likelihood method for the
analysis of linkage disequilibrium between trait loci and one or
more polymorphic marker loci. Am. J. Hum. Genet. 56, 777-787
(1995).
[0151] 26. Nunez, M. G. A model of the early settlement of Finland.
Fennosscandia archaelogica IV, 3-18 (1997).
[0152] 27. Simoons, F. J. Primary adult lactose intolerance and the
milking habit: a problem in biological and cultural
interrelations.II. A cultural historical hypolthesis. Am. J. Dig.
Dis. 16, 695-710 (1970).
[0153] 28. Varilo, T. et al The age of human mutation:genealogical
and linkage disequilibrium analysis of the CLN5 mutation in the
Finnish population. Am. J. Hum. Genet. 58, 506-512 (1996).
[0154] 29. Hstbacka, J. et al. Linkage disequilibrium mapping in
isolated founder populations: diastrophic dysplasia in Finland.
Nature Genet. 2: 204-211 (1992).
[0155] 30. Harvey C. B. et al. Lactase haplotype frequencies in
Caucasians: association with the lactase persistence/non
persistence polymorphism. Ann Hum Genet 62, 215-223 (1998).
[0156] 31. Ohtani, K. et al. Cell growth-regulated expression of
mammalian MCM5 and MCM6 genes mediated by the transcription factor
E2F. Oncogene 18, 2299-2309 (1999).
[0157] 32. Smith, A. F. A. The origin of interspersed repeats in
the human genome. Curr. Opin. Genet. Dev. 6, 743-748 (1996).
[0158] 33. Kazazian, H. H. & Moran, J. V. The impact of L1
retrotransposons on the human genome. Nature Genet. 19, 19-24
(1998).
[0159] 34. Moran, J. V., DeBerardinis, R. J. & Kazazian, H. H.
Exon shuffling by L1 retrotransposition. Science 283, 1530-1534
(1999).
[0160] 35. Wei, W. et al. Human L1 retrotransposition: cis
preference versus trans complementation. Mol. Cell. Biol.
21,1429-1439 (2001).
[0161] 36. Donnelly, S. R., Hawkins. T. E. & Moss, S. E. A
conserved nuclear element with a role in mammalian gene regulation.
Hum. Mol. Genet. vol. 8, 9,1723-1728 (1999).
[0162] 37. Boeke, J. D. LINEs and Alus--the polyA connection.
Nature Genet. 16, 6-7 (1997).
[0163] 38. Jurka, J. Sequence patterns indicate an enzymatic
involvement in integration of mammalians retroposons. Proc. Natl.
Acad. Sci. U.S.A. 94, 1872-1877 (1997).
[0164] 39. Savilahti E, Launiala K, Kuitunen P. Congenital lactase
deficiency. Arch. Dis. Child. 58, 246-252 (1983).
[0165] 40. Jrvel, I. et al. Assignment of the locus for congenital
lactase deficiency to 2q21, in the vicinity of but separate from
the lactase-phlorizin hydrolase gene. Am. J. Hum. Genet.
63,1078-1085 (1998).
[0166] 41. Simoons, F. J. The geographic hypothesis and lactose
malabsorption. A weighing of the evidence. Am. J. Dig. Dis. 23,
963-980 (1978).
[0167] 42. Flatz, G. & Rotthauwe, H, W. The human lactase
polymorphism: physiology and genetics of lactose absorption and
malabsorption. Prog. Med. Genet. 2, 205-249 (1977).
[0168] 43. McCracken, R. D. Lactase deficiency: an example of
dietary evolution. Curr. Anthropol. 12, 479-517 (1971).
[0169] 44. Arola, H. et al. Diagnosis of hypolactasia and lactose
malabsorption. Scand. J. Gastroenterol. Suppl. 202, 26-35
(1994).
[0170] 45. Sulkanen, S. et al. Tissue transglutaminase autoantibody
enzyme-linked immunosorbent assay in detecting celiac disease.
Gastroenterology 115 (6), 1322-1328 (1998).
[0171] 46. Sambrook, J., Fritsch, E. F. & Maniatis, T.
Molecular cloning: a laboratory manual, (2nd ed). Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
[0172] 47. Messer, M. & Dahlqvist. A. A one-step ultramicro
method for the assay of intestinal disaccharidases. Anal. Biochem.
14 (3), 376-92 (1966).
[0173] 48. Cottingham, Jr. R. W., Idury, R. M. & Schaffer, A.
A. Faster sequential genetic linkage computations. Am. J. Hum..
Genet. 53, 252-263 (1993).
[0174] 49. Goring, H. H. H. & Terwilliger, J. D. Linkage
analysis in the presence of errors III: Marker loci and their map
as nuisance parameters. Am. J. Hum. Genet. 66,1298-1309 (2000).
[0175] 50. Terwilliger, J. D. & Ott, J. Hand book of human
genetic analysis. Johns Hopkins University Press, Baltimore
(1994).
[0176] 51. Osborne et al., Curr. Opin. Chem. Biol. I (1997),
5-9
[0177] 52. Stall and Szoka, Pharm. Res. 12 (1995), 465-483
[0178] 53. Harlow and Lane "Antibodies, A Laboratory Manual", CSH
Press, Cold Spring Harbor, USA, 1988
[0179] 54. Higgins and Hames (eds.), "Nucleic acid hybridization, a
practical approach", IRL Press, Oxford 1985
[0180] 55. Dib C, Faure S, Fizames C, Samson D, Drouot N, Vignal A,
Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G,
Morissette J, Weissenbach J. A comprehensive genetic map of the
human genome based on 5,264 microsatellites. Nature. 1996 Mar
14;380(6570): 152-4.
[0181] 56. Chumakov I M, Rigault P, Le Gall I, Bellanne-Chantelot
C, Billault A, Guillou S, Soularue P, Guasconi G, Poullier E, Gros
I, et al. A YAC contig map of the human genome. Nature. 1995 Sep
28;377(6547 Suppl):175-297
2TABLE 1 Linkage and Linkage Disequilibrium Analyses in adult-type
hypolactasia families (fine mapping markers shown in bold) Lod
score(Z) at .THETA. Marker 0.0 0.1 0.2 0.3 0.4 p-value.sup.a D2S114
-.infin. 2.44 1.92 1.13 0.41 0.87195 P6112 2.76 2.20 1.45 0.75 0.22
0.66207 D2S1334 3.15 2.45 1.61 0.84 0.25 0.91039 AC8 2.26 1.99 1.36
0.71 0.21 0.53670 LPH13 3.67 2.94 1.96 1.03 0.31 4 .times.
10.sup.-6 LPH2 4.09 3.07 2.00 1.00 0.26 5.7 .times. 10.sup.-7 LPH1
5.91 4.52 2.96 1.53 0.46 5 .times. 10.sup.-6 AC7 3.63 2.60 1.66
0.83 0.23 0.03471 AC3 6.63 4.88 3.16 1.61 0.44 3.2 .times.
10.sup.-8 AC4 3.07 2.22 1.42 0.71 0.19 4 .times. 10.sup.-5 AC5 5.33
4.10 2.72 1.39 0.39 0.02166 AC10 6.60 4.99 3.25 1.65 0.46 1 .times.
10.sup.-5 D2S2196 7.67 5.62 3.62 1.85 0.54 0.00010 D2S442 3.81 3.08
2.08 1.03 0.27 0.22805 D2S314 4.22 3.61 2.50 1.37 0.45 0.27535
D2S2385 -.infin. 2.79 1.92 1.01 0.28 0.46457 .sup.ap-values
produced using linkage disequilibrium test given
linkage.sup.16,49
[0182]
3TABLE 2 The variations identified within adult-type hypolactasia
locus in the Finnish Families Lactase Lactase persistence
persistence Lactase (Homozygous) (Heterozygous) non-persistence
Position.sup.a Variant BIV4 AIV3 BIV8 CIV3 BIV9 DIV4 EIII2.sup.b
-694 A.fwdarw.G AA AA AG AA GG N.sup.c AA -1640/50
T.sub.13.fwdarw.T.sub.12 T.sub.13/13 T.sub.13/13 T.sub.13/13
T.sub.13/13 T.sub.13/13 T.sub.12/12 T.sub.12/12 -2131 C.fwdarw.T CC
CC CT CC TT CT* TT -3058/72 T.sub.15.fwdarw.T.sub.16 T.sub.15/15
T.sub.15/15 T.sub.15/15 T.sub.15/15 T.sub.15/15 T.sub.16/16
T.sub.16/16 -3075 G.fwdarw.T GG GG GG GG GG GG TT -4480 T.fwdarw.A
TT TT TA TT AA TT TT -5440 C.fwdarw.T CC CC CT CC TT CC CC -5926
A.fwdarw.T AA AA AA AA AA TA TT -8540 G.fwdarw.A GG GG GA GA AA AG
AA -8630 C.fwdarw.G CC CC CG CG GG GC GG -13495 T.fwdarw.C TT TT TC
TT CC CT CC -13910 T.fwdarw.C TT TT TC TC CC CC CC -15239
G.fwdarw.A GG GG GA GG AA AG AA -15862 T.fwdarw.C CC CC CT CC TT TC
TT -16568/79 T.sub.11.fwdarw.T.sub.12 T.sub.11/11 T.sub.11/11
T.sub.11/12 T.sub.11/11 T.sub.12/12 T.sub.11/11 T.sub.12/12 -16888
A.fwdarw.G AA AA GA AA GG GA GG -17300 C.fwdarw.T CC CC CC CC CC CT
TT -19044 T.fwdarw.C TT TT TC TT CC CT CC -19519 T.fwdarw.C TT TT
TC TT CC TT TT -20077 C.fwdarw.G CC CC CG CC GG GC GG -20486
G.fwdarw.A GG GG GA GG AA GG GG -21721/28 A.sub.7.fwdarw.A.sub.6
A.sub.7/7 A.sub.7/7 A.sub.7/7 A.sub.7/7 A.sub.7/7 A.sub.7/A.sub.6
A.sub.7/7 -21731 A.fwdarw.C AA AA AA AA AA CC AA -21736/43
A.sub.9.fwdarw.A.sub.8 A.sub.9/9 A.sub.9/9 A.sub.9/A.sub.8
A.sub.9/9 A.sub.8/8 A.sub.8/8 A.sub.8/8 -22018 G.fwdarw.A AA AA AG
AG GG GG GG -22741 C.fwdarw.T CC CC CC CC CC N TT -22788 A.fwdarw.G
AA AA AG AA GG N GG -23069 A.fwdarw.G AA AA AG AA GG N GG -23442
A.fwdarw.G AA AA AA AA AA N GG -23771 T.fwdarw.C TT TT TT TT TT N
CC -25093/23 .DELTA.3Obp .DELTA..DELTA. .DELTA..DELTA.
.DELTA..DELTA. .DELTA..DELTA. .DELTA..DELTA. N II -27310
A.fwdarw./G AA AA AG AA GG GA GG -27480 G.fwdarw.A GG GG GA GG AA
AG AA -27807 A.fwdarw.C AA AA AA AA AA AC CC -30183 A.fwdarw.G AA
AA AG AA GG AA AA -31268 A.fwdarw.G AA AA AG AA GG AA AA -31342
T.fwdarw.C TT TT TT TT TT CT CC -33645 C.fwdarw.T CC CC CT CC TT CC
CC -35176 T.fwdarw.C TT TT TC TT CC CT CC -36254 C.fwdarw.T CC CC
CT CC TT TC TT -36296 G.fwdarw.T TT TT TG TT GG TG N -36501
A.fwdarw.T AA AA AT AA TT AT N -36506/14 .DELTA. 9bp .DELTA..DELTA.
.DELTA..DELTA. .DELTA.I .DELTA..DELTA. II .DELTA.I N -36671/77
T7.fwdarw.T6 T.sub.7/7 T.sub.7/7 T.sub.7/6 T.sub.7/7 T.sub.6/6
T.sub.7/7 T.sub.7/7 -37565 T.fwdarw.G TT TT TG TT GG GG TG -38276
G.fwdarw.C GG GG GC GG CC GG GG -39036 G.fwdarw.C GG N GC N CC N N
-40608 G.fwdarw.C GG GG GG GG GG GG CC -41590 T.fwdarw.C TT TT TC
TT CC CT CC 42081/82 .DELTA.AG AG AG AG/.DELTA. AG .DELTA..DELTA.
AG AG -42618 T.fwdarw.C TT TT TC TT CC TT TT -42893 G.fwdarw.A GG
GG GA GG AA GG GG a: The Number is from initiation translation
codon (ATG) of the LPH gene using the compiled genomic sequence of
the BACs NH034L23, NH0218L22, NH0318L13 and RP11-329I10, b: the
individuals sequenced from the Finnish families studied and showed
by arrow in FIG. 1, c: not determined
[0183]
4TABLE 3 Distribution of C/T.sub.-13910 & G/A.sub.-22018
genotypes in lactase persistent/non-persistent alleles
C/T.sub.-13910 G/A.sub.-22018 Genotype CC CT TT GG GA AA Total
Family members Lactase non-persistence 45 0 0 45 0 0 45 Lactase
persistence 0 32 13 0 32 13 45 Case-control samples Finnish Lactase
non-persistence 59 0 0 53 6 0 59 Lactase persistence 0 63 74 0 63
74 137 Non-Finnish.sup.a Lactase non-persistence 40 0 0 39 1 0 40
Lactase persistence 0 5 0 0 5 0 5 Total Lactase non-persistence 0
144 Lactase persistence 187 .sup.anon-Finnish samples consist of 23
South Korean, 9 Italian and 7 German individuals
[0184]
5TABLE 4 Prevalence of the C/T-13910 variant in population samples
Allele frequency DNA samples Genotype (%) % (CC) analysed CC CT TT
Total C T genotype I. Finnish population: 1. Eastern regions 108
287 176 571 0.440 0.560 18.9% 2. Western 62 159 146 367 0.385 0.615
16.8% regions Total 170 446 322 938 0.418 0.582 18.1% II. CEPH
parents: 1. Utah families 7 33 52 92 0.255 0.745 7.6% 2. French
families 7 9 1 17 0.676 0.324 41.2%
[0185] A total of 938 DNA samples of anonymous Finnish blood donors
from small parishes from Eastern and Western parts within Finland,
and 109 DNA samples from CEPH parents. The prevalence of
hypolactasia in the reflected by the genotype frequencies of CC
alleles.
6TABLE 5 LD between C/T-13910 and G/A-220018 variants in random
Finnish samples Genotype Genotype at at C/T.sub.-3910
G/A.sub.-220018 CC CT TT Total D' x.sup.2(1 df) P-value GG 162 2 1
165 GA 6 440 3 449 AA 2 4 318 324 Total 170 446 322 938 0.984 42.41
7.62 .times. 10.sup.-11 LD was calculated using D'
statistic.sup.18, p value is the significance of D' from 0 as
described in methods.sup.18.
[0186]
7TABLE 6 Estimation of the introduction of the C/T-13910 variant
into Finnish population using DISLAMB program. AC3 LPH2 Marker
Lactase non- Lactase Lactase non- Allele Lactase persistence
persistence persistence persistence 1 0 1 0 1 2 31 10 0 20 3 0 1 0
14 4 2 9 32 15 5 0 31 0 2 .lambda..sup.a 0.838 0.999 .THETA..sup.b
0.00031 (0,000038-0.00099) 0.0000(0.00000-0.00052) n.sup.c 570 450
.sup.a.lambda. is the proportion of increase of a certain allele in
disease chromosomes (lactase persistence allele) relative to its
population frequency(0.60). .sup.b.THETA. is the recombination
fraction, reflected by the distance of the mutation from the
closest marker, assuming 1 cM = 1 Mb. .sup.cn is the number of
generation since the introduction of the founder mutation into a
population Applying .lambda. = .varies. (1 - .THETA.).sup.n
formula. d: Hypothetical allele used in the calculations as .THETA.
is zero and .varies. is one.
[0187]
8TABLE 7 Prevalence of lactose intolerance variants in
biochemically verified samples Num- C/T.sub.13910 G/A.sub.22018
Population ber CC CT TT GG GA AA 1. Finnish Lactase persistence 182
0 95 87 0 95 87 Lactase non-persistence 116 116 0 0 110 6 0 2.
Italian Lactase persistence 7 0 7 0 0 7 0 Lactase non-persistence
23 23 0 0 22 1 0 3. German Lactase persistence 0 0 0 0 0 0 0
Lactase non-persistence 8 8 0 0 8 0 0 4. Somalian Lactase
persistence 0 0 0 0 0 0 0 Lactase non-persistence 42 42 0 0 42 0 0
6. South koreans Lactase persistence 0 0 0 0 0 0 0 Lactase
non-persistence 23 23 0 0 23 0 0 Total 401 212 102 87 205 109
87
[0188]
9TABLE 8 Prevalence of lactose-intolerance variants in various
population samples Genotype % Prevalence C/T13910 G/A22018 of
Lactase Population Number CC CT TT GG GA AA Persistence allele
South Koreans 23 23 0 0 23 0 0 0* France 17 7 9 1 6 10 1 59*
Basques 85 7 44 34 13 35 37 92* Southern Italians 100 89 11 0 88 12
0 11* Somalians 79 74 5 0 78 1 0 6 Utah 92 7 33 52 7 30 55 92*
AfricanAmericans 96 76 15 5 78 12 5 21* Marrocans 90 62 25 3 65 22
3 31* Sarawhi (African) 57 29 26 2 28 26 3 49* Saami 30 20 10 0 21
9 0 33* Tibet 23 23 0 0 23 0 0 0 Eastern Finnish 571 108 287 176
107 288 176 81* Western Finnish 367 62 159 146 58 161 148 83*
Finn-ugrian tribes Xan 20 19 1 0 19 1 0 5 Xm 20 19 1 0 19 1 0 5
Mansi 22 20 2 0 20 2 0 9 Lkomi 10 7 3 0 7 3 0 30 Erza 30 17 10 3 19
9 2 43 Moksa 30 13 17 0 14 16 0 57* Udmort 30 12 16 2 11 15 4 60*
Pakistanian tribes Kalash 30 30 0 0 28 2 0 0 Burusho 30 29 1 0 27 3
0 3 Hazara 14 13 1 0 11 3 0 7 Kashmiri 20 15 5 0 14 6 0 25 Makrani
Baluch 29 19 10 0 19 8 1 34 Brahui 30 17 10 3 16 11 3 43 Makrani
(Negroid) 29 16 10 3 16 10 3 45 Pathan 29 12 16 1 13 14 2 59*
Indian 29 11 13 5 10 12 5 62* Total 2032 *The prevelance of lactase
persistence allele is correlated very well with the reported
prevelances for the lactase persistence allele (Simoons Fj. The
geographic hypothesis and lactose malabsorption Am J Dig Dis 1978
23 (11): 963-80)
[0189]
Sequence CWU 1
1
17 1 180 DNA Homo sapiens lactase persistence type intron 13 of the
MCM6 gene with single nucleotide polymorphism (SNP) t substituted
by c at position -13910 5' from the intestinal lactase-phlorizine
hydrolase (LPH) gene 1 acctttcatt caggaaaaat gtacttagac cctacaatgt
actagtaggc ctctgcgctg 60 gcaatacaga taagataatg tagcccctgg
cctcaaagga actctcctcc ttaggttgca 120 tttgtataat gtttgatttt
tagattgttc tttgagccct gcattccacg aggataggtc 180 2 180 DNA Homo
sapiens lactase persistence type intron 9 of the MCM6 gene with
single nucleotide polymorphism (SNP) a substituted by g at position
-22018 5' from the intestinal lactase-phlorizine hydrolase (LPH)
gene 2 taagaacatt ttacactctt cagtataaag aagtcagaat acccctaccc
tatcagtaaa 60 ggcctataag ttaccattaa aaagatgtcc ttaaaaacag
cattctcagc tgggcgcggt 120 ggctcacacc tttgtcccag tactttggga
agccgaggtg ggtggatcac ctgaggtcag 180 3 3213 DNA Homo sapiens
lactase persistence type intron 13 of the MCM6 gene with single
nucleotide polymorphism (SNP) t at position -13910 5' from the
intestinal lactase-phlorizine hydrolase (LPH) gene 3 atcagagtca
ctttgatatg atgagagcag agataaacag atttgttgca tgtttttaat 60
ctttggtatg ggacatacta gaattcactg caaatacatt tttatgtaac tgttgaatgc
120 tcatacgacc atggaattct tccctttaaa gagcttggta agcatttgag
tgtagttgtt 180 agacggagac gatcacgtca tagtttatag agtgcataaa
gacgtaagtt accatttaat 240 acctttcatt caggaaaaat gtacttagac
cctacaatgt actagtaggc ctctgcgctg 300 gcaatacaga taagataatg
tagtccctgg cctcaaagga actctcctcc ttaggttgca 360 tttgtataat
gtttgatttt tagattgttc tttgagccct gcattccacg aggataggtc 420
agtgggtatt aacgaggtaa aaggggagta gtacgaaagg gcattcaagc gtcccatctt
480 cgcttcaacc aaagcagccc tgcgttttcc tagttttatt aataggtttg
atgtaaggtc 540 gtctttgaaa agggggtttg gctttttttt acagtgtgac
tgaggtataa tttataaaaa 600 gggaaatgta tggcatggtg agttttttca
catacatcct tgtgaatacc cagctcaaga 660 tccaaaacat ttccataatt
tcagaaagtt ccaaacccct gcctcttttc agtcttagcc 720 ctcttcccct
gaagtaacca ctgttccgac ttcaatcact acttttatcc cacaggttaa 780
ttttttggct tttttccact aaattttcaa attctttgat atggtacttt actattgacg
840 aagtactttc acactaggtt atttaatatt ctttgattca cccaatattt
agggaacacc 900 tgtaggggac aaaaaatgaa tgagagcccc tgccttccat
tgctgctaat ctggtgggaa 960 cgagacatgt atttaattaa gcatgtaaaa
aatagagtgg gtgatgaaat aatctatata 1020 ctaaatcccc atgacacaca
gtttacctat gtaacaaacc tgcatgtgta cccccgaacc 1080 taaaatataa
gttggaaatt aaaaaaaaac gagagggaga atagagcatc acaaccagag 1140
tgctgagatg aattacttta ttaccaaaga aggaggagga ctcagggagg tgccgacgtt
1200 taaacccagt cactgaaggg tgtgcagaat ttggataggc aagataccct
gggacaaggt 1260 cattctaaaa ccatgctaac atttgtactt tttttttcat
tgtgatagtt cctgaaatga 1320 gttgcataaa actggtacat gtcttagggc
agtctctaat tgatttttat tttgttctat 1380 ttttaaaaat tagtcttcaa
atagcagatt cacatgatat taaaatatat gcacataaat 1440 tatatacaca
aatatatttt ctgaatgaaa tttagtatct gcatatattt aagagctatt 1500
tctgtctcat atgttcataa tcttcatcca ttaaaaaaac ttttgttagg cctttctcac
1560 tctaagatta taaaaaattc tcccattatt tacctagcta gttttctagt
tgttccaaaa 1620 ccatttattg aacaatccat ctttttgaca ctggtttggc
atgccttaat tatatattct 1680 tgtgtgtgtt aggatctcct tttggacttt
ccattctgtt cattgagtct tatcagctcc 1740 tcttacattg gtaccatgat
gttttaatct atggggcttt gtagtttaaa tgtagggcta 1800 gttccagcgc
attgttctct atcagctgtt aggaacttag aaatcagctt gctctgtttt 1860
aaagaaaaac ctggtatttt tttatcagta taacattcta tttatattaa cttgaagaat
1920 tgaaaacatc tatgattttt cctattcagt aacgtatcac ttagaatagg
ttaggttgta 1980 ctactataaa atctcagctg cataaaacaa tttttttttg
cttgtgctac acatccatta 2040 ggtcatcaag ggactcacct tgtcaagtta
ctcagagatt caggctgata taaaggtttg 2100 atcttgacat acgctttcat
gatgacagaa agcagggaag agaaggtggt gagccatgtg 2160 ctttctcccc
cttctatcca gaaatgacac atactcacat ttcattcgcc agagaaatta 2220
acatggcccc tcctaagttc aaatggatag agaaatgcct tcctaccagg tgcccagaat
2280 tagaagagca aacatttgtg aacagttctg agtaccacaa ataccgttat
ctttccactt 2340 aagtcttctg tttcactcag tagtgcttta aacttttctt
catatgtttt tcagtgtttc 2400 ttgttgaatt tcttgatatt ttatcatgtt
tgttcgtact gggagtagcc tttttttcca 2460 tttcattttc tggctggttt
cattgctggt tgtttttttg ttttgttttg tttttgagat 2520 ggagtctcac
tctgtcgccc aggctggagt gcagtgtcac aatctcggct cactgcaacc 2580
tctgcctccc aggttcaagc gattcttctt tctcagcctc ctgagtagct gggattacag
2640 gcatgtgcca ccatgcccag ctaatttttt atatttttag tagagatggg
gtttctccat 2700 gttggtcagg ctggtctcaa actcccaatc tcaggtgatc
cgcctgcctc tgccttccaa 2760 agtgctggga ttatagacat gagccaccgt
gcctggccta gttcttatgg gatgtatatg 2820 tctttggatt catatgatat
gtatatatgt ttatatttct acaagtacat acctaggagt 2880 ggaattgttg
ggtcataggt taatgcatgt ttttctgcca aacagttgtg tcaatttctg 2940
ttttcaccgc tgtgaatgag agttgttcta ccttcttgac aacacttgat attgtcagtc
3000 attttagcca ttctggtgaa tttatagtgc tatttctgtg tgtgtaagag
agagaatgag 3060 agagggtgtt tgtgagaaaa ccaaagcaac actgtgagag
tgtgtgtgtt tgtgagaaaa 3120 ccaaaataca tactactgtg atttcattgg
gagaaaatct gtttggtata tcaaaaaaag 3180 tagcttaatt acttcatcat
tattggttta ggt 3213 4 1296 DNA Homo sapiens lactase persistence
type intron 9 of the MCM6 gene with single nucleotide polymorphism
(SNP) a at position -22018 5' from the intestinal
lactase-phlorizine hydrolase (LPH) gene 4 taagaacatt ttacactctt
cagtataaag aagtcagaat acccctaccc tatcagtaaa 60 ggcctataag
ttaccattaa aaagatgtcc ttaaaaacag cattctcagc tgggcacggt 120
ggctcacacc tttgtcccag tactttggga agccgaggtg ggtggatcac ctgaggtcag
180 gagttcgaga ccagcctggc caacatggcg aaaacccatt ttctctacta
aaaatacaaa 240 aattagccgg gcatggtggc gggtgcttgt ggtcccagct
actcaagagg ctgaggtggg 300 aggatcactg agcccaggag gtggaggctg
cattgagcca agattgtgcc actgcactcc 360 agcctgggtg acagagcgag
actctgtctc aaaaaaacca aaacaaaaaa aacccagcat 420 tctttagtaa
ataattcata gttttcttca tctagaattt aaaattgtga tagttgatca 480
gcatgtcctg agcacgtgtg tttgctgtta ctagtttaga tcggtagatg tgtatataag
540 ttataggtat aaaatcaatc ctgagttgac acaaggtttt gatgttgagt
acaagtacag 600 taagtgtata tttttagtta tgctcttagt tttaagtcaa
ttgtgtggtt ctttctagct 660 ttaggatctg ttgaattatc ttccttagaa
aagggagtta agaatcttca cttacctatc 720 ttctacttgt ttggagaata
gaagagtccc tgtggtagca gactttgtga gtttacttgt 780 aattttccat
ctgaaagact gttcttgttt ttcgtgatga agtcttgctc tgtcgcccag 840
gctggagtgc agtggtgcaa ccttggctca ctgcaacctc tgcctcccgg gttcaagcaa
900 ttctcctgcc tcagcctccc gagtatctgg gattacaggt gcacaccacc
acacctggct 960 aatttttgta ttttcagtag agacggggtt tcaccatgtt
ggccaggctg gtctcgaact 1020 cttgacctca tgatcagccc acctcagcct
tccaaagtgc tgggattaca ggtgtgagcc 1080 cccacactcg gccgttgttg
ttttttaaga gacagggtct cactctgtca cctaacctgg 1140 agtacagtgg
caatcatggc tcactgtaac ctcaaatgcc cggccttagt gaagcgttct 1200
tcctgccttg gcctcccaaa gtgctgggat tacaagtgtg agccatgcat ccagcttgaa
1260 agacagcttc ttaggcttga tttgtttggt tacagg 1296 5 3213 DNA Homo
sapiens lactase persistence type intron 13 of the MCM6 gene with
single nucleotide polymorphism (SNP) t substituted by c at position
-13910 5' from the intestinal lactase-phlorizine hydrolase (LPH)
gene 5 atcagagtca ctttgatatg atgagagcag agataaacag atttgttgca
tgtttttaat 60 ctttggtatg ggacatacta gaattcactg caaatacatt
tttatgtaac tgttgaatgc 120 tcatacgacc atggaattct tccctttaaa
gagcttggta agcatttgag tgtagttgtt 180 agacggagac gatcacgtca
tagtttatag agtgcataaa gacgtaagtt accatttaat 240 acctttcatt
caggaaaaat gtacttagac cctacaatgt actagtaggc ctctgcgctg 300
gcaatacaga taagataatg tagcccctgg cctcaaagga actctcctcc ttaggttgca
360 tttgtataat gtttgatttt tagattgttc tttgagccct gcattccacg
aggataggtc 420 agtgggtatt aacgaggtaa aaggggagta gtacgaaagg
gcattcaagc gtcccatctt 480 cgcttcaacc aaagcagccc tgcgttttcc
tagttttatt aataggtttg atgtaaggtc 540 gtctttgaaa agggggtttg
gctttttttt acagtgtgac tgaggtataa tttataaaaa 600 gggaaatgta
tggcatggtg agttttttca catacatcct tgtgaatacc cagctcaaga 660
tccaaaacat ttccataatt tcagaaagtt ccaaacccct gcctcttttc agtcttagcc
720 ctcttcccct gaagtaacca ctgttccgac ttcaatcact acttttatcc
cacaggttaa 780 ttttttggct tttttccact aaattttcaa attctttgat
atggtacttt actattgacg 840 aagtactttc acactaggtt atttaatatt
ctttgattca cccaatattt agggaacacc 900 tgtaggggac aaaaaatgaa
tgagagcccc tgccttccat tgctgctaat ctggtgggaa 960 cgagacatgt
atttaattaa gcatgtaaaa aatagagtgg gtgatgaaat aatctatata 1020
ctaaatcccc atgacacaca gtttacctat gtaacaaacc tgcatgtgta cccccgaacc
1080 taaaatataa gttggaaatt aaaaaaaaac gagagggaga atagagcatc
acaaccagag 1140 tgctgagatg aattacttta ttaccaaaga aggaggagga
ctcagggagg tgccgacgtt 1200 taaacccagt cactgaaggg tgtgcagaat
ttggataggc aagataccct gggacaaggt 1260 cattctaaaa ccatgctaac
atttgtactt tttttttcat tgtgatagtt cctgaaatga 1320 gttgcataaa
actggtacat gtcttagggc agtctctaat tgatttttat tttgttctat 1380
ttttaaaaat tagtcttcaa atagcagatt cacatgatat taaaatatat gcacataaat
1440 tatatacaca aatatatttt ctgaatgaaa tttagtatct gcatatattt
aagagctatt 1500 tctgtctcat atgttcataa tcttcatcca ttaaaaaaac
ttttgttagg cctttctcac 1560 tctaagatta taaaaaattc tcccattatt
tacctagcta gttttctagt tgttccaaaa 1620 ccatttattg aacaatccat
ctttttgaca ctggtttggc atgccttaat tatatattct 1680 tgtgtgtgtt
aggatctcct tttggacttt ccattctgtt cattgagtct tatcagctcc 1740
tcttacattg gtaccatgat gttttaatct atggggcttt gtagtttaaa tgtagggcta
1800 gttccagcgc attgttctct atcagctgtt aggaacttag aaatcagctt
gctctgtttt 1860 aaagaaaaac ctggtatttt tttatcagta taacattcta
tttatattaa cttgaagaat 1920 tgaaaacatc tatgattttt cctattcagt
aacgtatcac ttagaatagg ttaggttgta 1980 ctactataaa atctcagctg
cataaaacaa tttttttttg cttgtgctac acatccatta 2040 ggtcatcaag
ggactcacct tgtcaagtta ctcagagatt caggctgata taaaggtttg 2100
atcttgacat acgctttcat gatgacagaa agcagggaag agaaggtggt gagccatgtg
2160 ctttctcccc cttctatcca gaaatgacac atactcacat ttcattcgcc
agagaaatta 2220 acatggcccc tcctaagttc aaatggatag agaaatgcct
tcctaccagg tgcccagaat 2280 tagaagagca aacatttgtg aacagttctg
agtaccacaa ataccgttat ctttccactt 2340 aagtcttctg tttcactcag
tagtgcttta aacttttctt catatgtttt tcagtgtttc 2400 ttgttgaatt
tcttgatatt ttatcatgtt tgttcgtact gggagtagcc tttttttcca 2460
tttcattttc tggctggttt cattgctggt tgtttttttg ttttgttttg tttttgagat
2520 ggagtctcac tctgtcgccc aggctggagt gcagtgtcac aatctcggct
cactgcaacc 2580 tctgcctccc aggttcaagc gattcttctt tctcagcctc
ctgagtagct gggattacag 2640 gcatgtgcca ccatgcccag ctaatttttt
atatttttag tagagatggg gtttctccat 2700 gttggtcagg ctggtctcaa
actcccaatc tcaggtgatc cgcctgcctc tgccttccaa 2760 agtgctggga
ttatagacat gagccaccgt gcctggccta gttcttatgg gatgtatatg 2820
tctttggatt catatgatat gtatatatgt ttatatttct acaagtacat acctaggagt
2880 ggaattgttg ggtcataggt taatgcatgt ttttctgcca aacagttgtg
tcaatttctg 2940 ttttcaccgc tgtgaatgag agttgttcta ccttcttgac
aacacttgat attgtcagtc 3000 attttagcca ttctggtgaa tttatagtgc
tatttctgtg tgtgtaagag agagaatgag 3060 agagggtgtt tgtgagaaaa
ccaaagcaac actgtgagag tgtgtgtgtt tgtgagaaaa 3120 ccaaaataca
tactactgtg atttcattgg gagaaaatct gtttggtata tcaaaaaaag 3180
tagcttaatt acttcatcat tattggttta ggt 3213 6 1296 DNA Homo sapiens
lactase persistence type intron 9 of the MCM6 gene with single
nucleotide polymorphism (SNP) a substituted by g at position -22018
5' from the intestinal lactase-phlorizine hydrolase (LPH) gene 6
taagaacatt ttacactctt cagtataaag aagtcagaat acccctaccc tatcagtaaa
60 ggcctataag ttaccattaa aaagatgtcc ttaaaaacag cattctcagc
tgggcgcggt 120 ggctcacacc tttgtcccag tactttggga agccgaggtg
ggtggatcac ctgaggtcag 180 gagttcgaga ccagcctggc caacatggcg
aaaacccatt ttctctacta aaaatacaaa 240 aattagccgg gcatggtggc
gggtgcttgt ggtcccagct actcaagagg ctgaggtggg 300 aggatcactg
agcccaggag gtggaggctg cattgagcca agattgtgcc actgcactcc 360
agcctgggtg acagagcgag actctgtctc aaaaaaacca aaacaaaaaa aacccagcat
420 tctttagtaa ataattcata gttttcttca tctagaattt aaaattgtga
tagttgatca 480 gcatgtcctg agcacgtgtg tttgctgtta ctagtttaga
tcggtagatg tgtatataag 540 ttataggtat aaaatcaatc ctgagttgac
acaaggtttt gatgttgagt acaagtacag 600 taagtgtata tttttagtta
tgctcttagt tttaagtcaa ttgtgtggtt ctttctagct 660 ttaggatctg
ttgaattatc ttccttagaa aagggagtta agaatcttca cttacctatc 720
ttctacttgt ttggagaata gaagagtccc tgtggtagca gactttgtga gtttacttgt
780 aattttccat ctgaaagact gttcttgttt ttcgtgatga agtcttgctc
tgtcgcccag 840 gctggagtgc agtggtgcaa ccttggctca ctgcaacctc
tgcctcccgg gttcaagcaa 900 ttctcctgcc tcagcctccc gagtatctgg
gattacaggt gcacaccacc acacctggct 960 aatttttgta ttttcagtag
agacggggtt tcaccatgtt ggccaggctg gtctcgaact 1020 cttgacctca
tgatcagccc acctcagcct tccaaagtgc tgggattaca ggtgtgagcc 1080
cccacactcg gccgttgttg ttttttaaga gacagggtct cactctgtca cctaacctgg
1140 agtacagtgg caatcatggc tcactgtaac ctcaaatgcc cggccttagt
gaagcgttct 1200 tcctgccttg gcctcccaaa gtgctgggat tacaagtgtg
agccatgcat ccagcttgaa 1260 agacagcttc ttaggcttga tttgtttggt tacagg
1296 7 24 DNA Artificial Sequence Description of Artificial
Sequencebiotinylated PCR amplification primer (Bio-Reverse primer)
for C/T-13910 variant 7 naggtcagtg ggtattaacg aggt 24 8 23 DNA
Artificial Sequence Description of Artificial Sequence
unbiotinylated PCR amplification primer (Forward PCR primer) for
C/T-13910 variant 8 gtcactttga tatgatgaga gca 23 9 23 DNA
Artificial Sequence Description of Artificial Sequence biotinylated
PCR amplification primer (Bio-Reverse primer) for C/T-13910 variant
9 nctcgttaat acccactgac cta 23 10 24 DNA Artificial Sequence
Description of Artificial Sequence minisequencing primer for
C/T-13910 variant, detection primer for C/T-13910 variant 10
ggcaatacag ataagataat gtag 24 11 21 DNA Artificial Sequence
Description of Artificial Sequence biotinylated PCR amplification
primer (Bio-Reverse primer) for G/A-22018 variant 11 ntgatcagca
tgtcctgagc a 21 12 22 DNA Artificial Sequence Description of
Artificial Sequence unbiotinylated PCR amplification primer
(Forward PCR primer) for G/A-22018 variant 12 ctaccctatc agtaaaggcc
ta 22 13 21 DNA Artificial Sequence Description of Artificial
Sequencebiotinylated PCR amplification primer (Bio-Reverse primer)
for G/A-22018 variant 13 ngctcaggac atgctgatca a 21 14 23 DNA
Artificial Sequence Description of Artificial Sequence
minisequencing primer, detection primer for G/A-22018 variant 14
aaaaacagca ttctcagctg ggc 23 15 23 DNA Artificial Sequence
Description of Artificial Sequence biotinylated PCR amplification
primer for G/A-22018 variant 15 ngtctgtggc atgtgtcttc atg 23 16 23
DNA Artificial Sequence Description of Artificial Sequence
unbiotinylated PCR amplification primer for G/A-22018 variant 16
tgctcaggac atgctgatca act 23 17 20 DNA Artificial Sequence
Description of Artificial Sequence minisequencing primer for
G/A-22018 variant 17 gacaaaggtg tgagccaccg 20
* * * * *
References