U.S. patent application number 10/409554 was filed with the patent office on 2004-12-23 for antibodies to analogs of macrophage stimulating protein and uses thereof.
This patent application is currently assigned to Amgen Inc.. Invention is credited to Wahl, Robert C..
Application Number | 20040260064 10/409554 |
Document ID | / |
Family ID | 25078115 |
Filed Date | 2004-12-23 |
United States Patent
Application |
20040260064 |
Kind Code |
A1 |
Wahl, Robert C. |
December 23, 2004 |
Antibodies to analogs of macrophage stimulating protein and uses
thereof
Abstract
Antibodies that specifically bind to Macrophage Stimulating
Protein (MSP) analogs are provided. In certain embodiments, these
antibodies may be used, for example, to detect MSP analogs in
tissues when such analogs are used therapeutically.
Inventors: |
Wahl, Robert C.; (Thousand
Oaks, CA) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT & DUNNER
LLP
1300 I STREET, NW
WASHINGTON
DC
20005
US
|
Assignee: |
Amgen Inc.
Thousand Oaks
CA
|
Family ID: |
25078115 |
Appl. No.: |
10/409554 |
Filed: |
April 7, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10409554 |
Apr 7, 2003 |
|
|
|
09835360 |
Apr 17, 2001 |
|
|
|
09835360 |
Apr 17, 2001 |
|
|
|
09296219 |
Apr 22, 1999 |
|
|
|
6248560 |
|
|
|
|
09296219 |
Apr 22, 1999 |
|
|
|
08766982 |
Dec 16, 1996 |
|
|
|
5948892 |
|
|
|
|
Current U.S.
Class: |
530/351 |
Current CPC
Class: |
C07K 14/4753 20130101;
A61K 38/00 20130101 |
Class at
Publication: |
530/351 |
International
Class: |
C07K 014/52 |
Claims
1-37. (Cancelled).
38. An antibody or fragment thereof, which specifically binds to a
macrophage stimulating protein (MSP) analog comprising at least one
unpaired cysteine residue substituted with another amino acid, and
which does not bind to wild-type MSP.
39. The antibody or fragment according to claim 38, which is a
monoclonal antibody.
40. The antibody or fragment according to claim 38, which
specifically binds to an MSP analog having a cysteine residue at
position 677 of SEQ ID NO: 1 substituted with another amino
acid.
41. The antibody or fragment according to claim 38, which
specifically binds to an MSP analog having a cysteine residue at
position 672 of SEQ ID NO: 2 substituted with another amino
acid.
42. The antibody or fragment according to claim 38, which
specifically binds to an analog of human MSP.
43. The antibody or fragment according to claim 38, further
comprising a detectable label conjugated to said antibody or
fragment.
44. A method for detecting the presence of a macrophage stimulating
protein (MSP) analog in a biological sample, comprising: incubating
the sample with the antibody according to claim 38 under conditions
that allow binding of the antibody to the MSP analog, and detecting
the bound antibody.
Description
FIELD OF THE INVENTION
[0001] The invention generally relates to analogs of macrophage
stimulating protein, or MSP. More particularly, the invention
relates to analogs of MSP which promote multimer formation and have
enhanced biological activity.
BACKGROUND OF THE INVENTION
[0002] Macrophage Stimulating Protein, or MSP, has been previously
identified as an activity present in mammalian blood plasma which
makes mouse peritoneal macrophages responsive to chemoattractants
such as complement C5a (Leonard et al. Exp. Cell. Res. 102, 434
(1976); Leonard et al. Exp. Cell Res. 114, 117 (1978). MSP was
purified from human serum as described in U.S. Pat. No. 5,219,991
and the DNA sequence encoding human MSP was reported in U.S. Pat.
No. 5,315,000. MSP is synthesized in a prepro form which is
secreted as a single chain polypeptide. The pro form is
proteolytically cleaved to form a disulfide-linked heterodimer
having an .alpha. and .beta. chain of molecular weights 53 kDa and
25 kDa, respectively. The heterodimer is the biologically active
form of MSP. It has not been established which protease is
responsible for the in vivo activation of MSP, but several
proteases, such as human plasma kallikrein are reported to
efficiently activate MSP in vitro (Wang et al. J. Biol. Chem. 269,
3436-3440 (1994)).
[0003] MSP is a member of a family of proteins having triple
disulfide loop structures, or kringle domains (Donate et al.
Protein Science 3, 2378-2394 (1994)). Family members include
plasminogen and hepatocyte growth factor (HGF). MSP also exhibits
sequence homology to both plasminogen and HGF and its proteolytic
activation occurs at Arg-Val residues which are also conserved in
other family members.
[0004] A variety of in vitro biological activities have been
reported for MSP. MSP was initially purified based upon stimulation
of a chemotactic response of mouse resident peritoneal macrophages
(Leonard et al., supra) and was believed to play a role in cell
motility. MSP stimulated megakaryocyte maturation and thrombocyte
production from isolated bone marrow preparations (PCT Application
No. WO96/14082). The in vivo activity of MSP remains to be
elucidated.
[0005] Recently, it has been reported that MSP is a ligand for RON,
a cell membrane protein tyrosine kinase which is a member of the
c-met family of protein tyrosine kinases (Wang et al. Science 226,
117-119 (1994); Gaudino et al. EMBO J. 13, 3524-3532 (1994); Ronsin
et al. Oncogene 8, 1195-1202 (1993)). The expression of RON in
human tissues and cell lines was examined (Gaudino et al., supra)
and RON was found to be expressed in colon, skin, lung and bone
marrow, and in granulocytes and adherent monocytes. Epithelial cell
lines derived from gastric, pancreatic and mammary carcinoma, and
hematopoietic cell lines also showed RON expression. MSP induced
tyrosine phosphorylation of RON and stimulated DNA synthesis in a
mammary carcinoma cell line. These observations suggest that MSP
may act on a variety of cell types. MSP promotes colony formation
by mouse colon crypts as shown in co-owned and co-pending U.S. Ser.
No. 08/622,720, suggesting that MSP may be useful in protecting and
regenerating the intestinal epithelium.
[0006] In view of the useful biological activities exhibited by
MSP. it is desirable to find forms of MSP which have enhanced
biological activity. Such forms could provide a more favorable
therapeutic regimen in that they can be administered at lower
dosages and/or less frequently than MSP.
SUMMARY OF THE INVENTION
[0007] The invention provides for analogs of MSP which have
increased heterodimer formation and enchanced biological activity
compared to recombinant human MSP. The analogs of the present
invention are constructed by substituting a cysteine residue with
another amino acid such that interchain disulfide bonds will form
efficiently and promote MSP heterodimer formation. The resulting
MSP analog forms heterodimers of one a (kringle-containing) chain
and one .beta. (serine protease) chain to a greater extent than
recombinant human MSP. DNA sequences encoding MSP analogs,
expression vectors comprising the DNA sequences and modified host
cells which express MSP analogs are also provided by the invention.
Pharmaceutical compositions of MSP analogs may be used to treat
conditions treatable by MSP including gastrointestinal and
hematopoietic disorders.
DESCRIPTION OF THE FIGURES
[0008] FIG. 1 shows a diagram of the major structural domains of
human MSP and human plasminogen, namely the kringle domains and the
serine protease domain. Dotted lines show intra and interchain
disulfide bridges. Cysteine residues at positions 527, 562 and 672
of MSP represent additional unpaired cysteine which are not
conserved in human plasminogen. The asterisk indicates the
activation cleavage site which separates the a (kringle) and .beta.
(serine protease) domains.
[0009] FIG. 2 shows the configuration of conserved Cys residues in
the serine protease domains of human MSP, plasminogen, and trypsin.
Solid lines indicate the pattern of intrachain disulfide bonds.
[0010] FIG. 3 shows a three-dimensional representation of the
serine protease domain of human trypsin. Indicated with labels are
the analogous positions of the unpaired and intersubunit cysteine
residues of MSP in the three-dimensional structure of human
trypsin.
[0011] FIG. 4 shows 10% PAGE of purified murine (MMSP) or human
(hMSP) with Coomassie Blue staining. Some samples were treated with
kallikrein (+). Disulfide bonds in some samples were reduced
(+.beta.-mercaptoethano- l).
[0012] FIG. 5 shows activity of purified murine and C677A MSP in
crypt attachment assay. Purified mMSP mutant C677A protein was
assayed in parallel with wild-type mMSP for biological activity in
murine crypt attachment assay. Samples were treated with Kallikrein
at 15 .mu.g/ml for 30 minutes at 37.degree. C., then added to mouse
colonic crypts at the final concentrations as shown. Treated crypts
were plated in the wells of collagen-coated tissue culture plates,
and were allowed to incubate overnight, followed by staining and
counting of attached crypts. Values are plotted as fold stimulation
over untreated wells. Purified bovine MSP was used as a positive
control in this assay Kallikrein-cleaved mutant MSP gives
approximately 10-fold higher specific activity than cleaved wild
type MSP in this assay.
[0013] FIG. 6 shows activity of purified human MSP and C672A MSP
mutant in crypt attachment assay.
[0014] FIG. 7 shows .sup.3H thymidine uptake by NIH 3T3 cells
expressing RON at the cell surface by purified human MSP and C672A
MSP mutant.
DETAILED DESCRIPTION OF THE INVENTION
[0015] As used herein, the term "macrophage stimulating protein" or
MSP, refers to a protein having kringle domains characteristic of
those found in a family that includes plasminogen, prothrombin, and
HGF. Macrophage stimulating protein refers to the prepro, pro or
mature forms and may be produced recombinantly or by chemical
synthesis. MSP may be a single chain precursor or a heterodimer.
References to positions in the MSP amino acid sequence are
according to the murine and human sequences provided in GenBank
accession nos. M74180 and L11924, respectively (also SEQ ID NO:1
and SEQ ID NO:2 for murine and human MSP, respectively).
[0016] The term "analog of macrophage stimulating protein" refers
to a polypeptide having one or more changes in the amino acid
sequence of MSP which enhances heterodimer formation. An MSP
heterodimer comprises an a chain of kringle domains linked to a
.beta. chain having a serine protease domain.
[0017] Expression of recombinant murine MSP in transfected CHO
cells was carried out as described in Example 1. After activation
in vitro with kallikrein, the resultant material had low specific
activity, compared to a sample of active MSP which was purified
from bovine serum-containing conditioned media as described in
co-owned and co-pending U.S. Ser. No. 08/622,720. Active MSP
isolated from human plasma was reported to be a disulfide-linked
heterodimer after in vitro kallikrein activation. (Wang et al.
surra.) However, recombinant human or mouse MSP was <5%
disulfide linked, as judged by SDS-PAGE performed under nonreducing
conditions, suggesting that the low activity of recombinant MSP was
due to reduced dimer formation.
[0018] In order to generate highly active recombinant MSP, MSP
analogs were constructed that exhibited highly efficient dimer
formation. These analogs were constructed with the aid of a model
for MSP structure based upon the homology of MSP with plasminogen
and other related family members. A comparison of the serine
protease (.beta.) domain and disulfide structures of MSP and
plasminogen revealed the presence of unpaired cysteine residues in
the serine protease domain of MSP, but not in plasminogen. The
additional unpaired cysteine residues were also not conserved in
HGF. It was postulated that one of the additional unpaired cysteine
residues may be interfering with proper intersubunit disulfide bond
formation. To determine which residues might be involved, the
position of the MSP cysteines was overlaid onto the
three-dimensional structure of human trypsin (the structure of
diisopropylfluorophosphate-i- nhibited human trypsin is available
from the Brookhaven Protein Database and is reproduced in FIG. 3).
Trypsin has only a serine protease domain and lacks kringle
regions. As shown in FIG. 3, the use of human trypsin as a
framework for visualizing the spatial arrangment of MSP cysteines
in the serine protease domain reveals close proximity of Cys 672
with Cys 588, the latter known to be involved in intersubunit
disulfide bonding.
[0019] Substitution of cysteine residues at postion 672 in human
MSP and position 677 in murine MSP is described in Examples 4 and
5. The resulting purified analogs showed enhanced activity in a
mouse colon crypt assay compared to recombinant human or murine
MSP. In addition, the human analog shows greater stimulation of
.sup.3H thymidine uptake in RON-expressing cells than human MSP
(Example 7).
[0020] Accordingly, the invention provides for the first time
biologically active MSP analogs. The MSP analogs form heterodimers
with greater efficiency than human MSP. In the present embodiment,
the MSP analogs have at least one cysteine residue substituted with
another amino acid such that interchain disulfide bonds will form
efficiently and promote MSP heterodimers. Any unpaired cysteine
residue in MSP which interferes with interchain disulfide bonding
may be replaced with another amino acid, however it is preferred
that a cysteine residue located at positions 677 of murine MSP (SEQ
ID NO:1) and position 672 of human MSP (SEQ ID NO:2) be
altered.
[0021] MSP analogs are constructed and expressed using standard
recombinant DNA techniques as described in Examples 4 and 5 of the
specification. Unpaired cysteine residues may be replaced by any
other amino acid provided the substitution does not perturb the
secondary or teritary structure of MSP. It is preferred that
substitutions are conservative ones, such as cysteine to serine or
alanine.
[0022] Expression vectors containing nucleic acid sequences
encoding MSP analogs, host cells transformed with said vectors and
methods for the production of MSP analogs are also provided by the
invention. An overview of expression of recombinant proteins is
found in Methods of Enzymology v. 185 (Goeddel, D. V. ed.) Academic
Press (1990).
[0023] Host cells for the production of MSP analogs include
procaryotic host cells, such as bacterial, yeast, plant, insect and
mammalian host cells. Bacterial strains such as E. coli HB101 or
JM101 are suitable for expression. Preferred mammalian host cells
include COS, CHOd-, 293, CV-1, 3T3, baby hamster kidney (BHK) cells
and others. Mammalian host cells are preferred when
post-translational modifications, such as glycosylation and
polypeptide processing, are important for MSP activity. Mammalian
expression allows for the production of secreted polypeptides which
may be recovered from the growth medium.
[0024] Vectors for the expression of MSP analogs contain at a
minimum sequences required for vector propogation and for
expression of the cloned insert. These sequences include a
replication origin, selection marker, promoter, ribosome binding
site, enhancer sequences, RNA splice sites and transcription
termination site. Vectors suitable for expression in the mammalian,
bacterial, plant, yeast, insect host cells are readily available
and the nucleic acids of the invention are inserted into the
vectors using standard recombinant DNA techniques. Vectors for
tissue-specific expression of an MSP analog are also included. Such
vectors include promoters which function specifically in liver,
kidney or other organs for production in mice, and viral vectors
for the expression of an MSP analog in targeted human cells.
[0025] Using an appropriate host-vector system, MSP analogs are
produced recombinantly by culturing a host cell transformed with an
expression vector containing nucleic acid sequences encoding MSP
under conditions such that MSP is produced, and isolating the
product of expression. MSP is produced in the supernatant of
transfected mammalian cells or in inclusion bodies of transformed
bacterial host cells. MSP so produced may be purified by procedures
known to one skilled in the art as described below. The expression
of MSP analogs is described in Example 4 and 5 below. It is
anticipated that the specific plasmids and host cells described are
for illustrative purpose and that other available plasmids and host
cells could also be used to express the polypeptides.
[0026] The invention also provides for purified and isolated MSP
analogs. The polypeptides of the invention are purified from other
polypeptides present in transformed host cells expressing an MSP
analog, or are purified from components in cell cultures containing
the secreted protein. In one embodiment, the polypeptide is free
from association with other human proteins, such as the expression
product of a bacterial host cell. The purified protein may be a pro
form of an MSP analog, a heterodimer, or isolated .alpha. and
.beta. chains.
[0027] Modifications of MSP analog polypeptides are encompassed by
the invention and include post-translational modifications (e.g.,
N-linked or .beta.-linked carbohydrate chains, processing of
N-terminal or C-terminal ends), attachment of chemical moieties to
the amino acid backbone, chemical modifications of N-linked or
O-linked carbohydrate chains, and addition of an N-terminal
methionine residue as a result of procaryotic host cell expression.
The polypeptides may also be modified with a detectable label, such
as an enzymatic, fluorescent, isotopic or affinity label to allow
for detection and isolation of the protein.
[0028] Also provided by the invention are chemically modified
derivatives of MSP analogs which may provide additional advantages
such as increasing stability and circulating time of the
polypeptide, or decreasing immunogenicity (see U.S. Pat. No.
4,179,337). The chemical moieties for derivitization may be
selected from water soluble polymers such as polyethylene glycol,
ethylene glycol/propylene glycol copolymers,
carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
The polypeptides may be modified at random positions within the
molecule, or at predetermined positions within the molecule, and
may include one, two, three or more attached chemical moieties. In
a preferred embodiment, the MSP analogs are selectively derivatized
at the amino-terminus of the polypeptide.
[0029] The invention provides for MSP analog chimeric proteins
wherein an analog is fused to a heterologous amino acid sequence.
The heterologous sequence may be any sequence which allows the
resulting fusion protein to retain the activity of MSP. The
heterologous sequences include for example, immunoglobulin fusions,
such as Fc fusions, which may aid in purification of the protein. A
heterologous sequence which promotes formation of MSP heterodimers
is preferred.
[0030] A method for the purification of MSP analogs is also
included. The purification process may employ one or more standard
protein purification steps in an appropriate order to obtain
purified protein. The chromatography steps can include ion
exchange, gel filtration, hydrophobic interaction, reverse phase,
chromatofocusing, and affinity chromatography.
[0031] MSP analogs are used advantageously for the treatment of any
condition requiring MSP. Examples of such conditions include
gastrointestinal disorders and hematopoietic disorders. As the
analogs of the present invention have a higher activity compared to
human MSP, the analogs may be therapeutically effective with a
smaller dosage and/or less frequent administration than human
MSP.
[0032] The invention provides for the treatment of disorders of the
lining of the gastrointestinal tract by administration of a
therapeutically effective amount of an MSP analog. The treatment
provided herein is particularly useful for disorders involving the
intestinal epithelium. The factors of the present invention can
modulate the proliferation or differentiation of intestinal
epithelium, thereby protecting healthy epithelium from damage and
inducing repair and/or regeneration of damaged or depleted
epithelium. Administration of an MSP analog may occur prior to,
concurrent with, or after the onset of a disorder of the
gastrointestinal tract lining for a time and a concentration
sufficient to protect, repair and/or regenerate the gut lining.
[0033] As used herein, a "therapeutically effective amount" refers
to that amount of MSP which provides a therapeutic effect for a
given condition and administrative regimen. Said amount may vary
from 0.1 .mu.g/kg body weight to 1000 mg/kg body weight and may be
more precisely determined by one skilled in the art.
[0034] Efforts to aggressively treat cancer have led to the
administration of higher doses of chemotherapeutic agents or the
use of whole body radiation, but such regimens can lead first to
bone marrow toxicity (depletion of red blood cells and white blood
cells) followed by gut toxicity (depletion of intestinal
epithelium). It is usual that a dose reduction or a cessation of
therapy occurs until the toxicity is overcome. A preferred method
of treatment is the use of MSP as an adjunct to chemotherapy or
radiation therapy, either prior to or concurrent with such therapy.
MSP may help maintain or repair epithelial cell linings in the
intestinal tract and thereby prevent or reduce the occurrences of
reduction or cessation of therapy.
[0035] Certain disease states may also lead to damage or depletion
of intestinal epithelium and may be treated by administration of
MSP. Examples include inflammatory bowel disease, a class of
diseases including ulcerative colitis and Crohn's disease, duodenal
ulcers or infections. Administration of MSP will help restore
normal intestinal mucosa where damage has occurred.
[0036] It is understood that MSP may be used alone or in
conjunction with other factors for the treatment of intestinal
epithelial disorders. In one embodiment, MSP is used in conjunction
with a therapeutically effective amount of a factor which promotes
epithelial cell growth. Such factors include insulin growth
factor-1 (IGF-1), insulin growth factor-2 (IGF-2), epidermal growth
factor (EGF), transforming growth factor-a (TGF-a), acidic and
basic fibroblast growth factor (FGF), platelet derived growth
factor (PDGF), keratinocyte growth factor (KGF), interleukin-6
(IL-6) or interleukin-11 (IL-11).
[0037] The invention provides for the treatment of hematopoietic
disorders involving a deficiency in megakaryocytes or thrombocytes
by administering a therapeutically effective amount of an MSP
analog. Such conditions can arise from disease or exposure to
myelosuppressive agents. In one embodiment, an MSP analog may be
used to treat thrombocytopenia resulting from exposure to radiation
or chemotherapy. An MSP analog may be used alone or in conjunction
with other hematopoietic factors which stimulate megakaryocyte or
thrombocyte levels. Hematopoietic factors to be used in conjunction
with MSP include erythropoietin (EPO), granulocyte colony
stimulating factor (G-CSF), megakaryocyte growth and
differentiation factor (MGDF), granulocyte macrophage colony
stimulating factor (GM-CSF), stem cell factor (SCF), interleukin-3
(IL-3) or interleukin-6 (IL-6).
[0038] MSP may be administered by a variety of routes including
parenteral, oral, nasal or rectal administration. Parenteral
administration may occur by intravenous, subcutaneous, intradermal,
intramuscular, intraarcticular and intrathecal injection. Oral
administration involving adsorption through the gastrointestinal
tract uses compressed tablets, capsules, pills, troches, cahcets
and pellets. Adminstration by the nasal or oral respiratory route
may employ powdered or liquid polypeptide delivered as an aerosol.
Nasal delivery includes administration by drops or sprays. Rectal
administration may employ suppositories. The route of
administration to be chosen will depend upon several variables,
including the pharmacokinetic properties of MSP and the nature and
severity of the condition being treated.
[0039] The invention provides for a pharmaceutical composition
comprising a therapeutically effective amount of an MSP analog and
a pharmaceutically acceptable diluent, carrier, preservative,
emulsifier, and/or solubilizer. Diluents include Tris, acetate or
phosphate buffers; solubilizers include Tween, Polysorbate;
carriers include human serum albumin; preservatives include
thimerosol and benzyl alcohol; and anti-oxidants include ascorbic
acid. MSP analogs may also be conjugated with water soluble
polymers (e.g, polyethylene glycol) using materials and method
available to one skilled in the art in order to improve solubility,
serum half-life, stability and bioavailability.
[0040] MSP analogs may be present in formulations for use in
particular delivery systems. As an example, MSP analogs may be
formulated for controlled delivery over a period of time. Such
formulations include but are not limited to the following:
encapsulation in a water insoluble polymer of hardened gelatin,
methyl and ethyl celluloses, polyhydroxymethacrylate,
hydroxypropylcellulose, polyvinylacetate and various waxes used
alone or in combination; dispersion in an inert polymeric matrix of
insoluble plastic, hydrophilic polymers, or fatty compounds; and
coating with a water soluble polymer such as a shellac, wax,
starch, cellulose acetate phthalate or polyvinylpyrrolidone. MSP
analogs may also be formulated for a targeted delivery system by
entrapment within phospholipid vesicles. In a preferred embodiment,
MSP analogs may be incoporated in a cocoa butter or polyethylene
glycol base for inclusion in a suppository for rectal delivery. In
another preferred embodiment, MSP analogs may be incorporated into
a colon-specific drug release formulation such as that described in
PCT Application No. WO95/28963.
[0041] A more extensive survey of components commonly found in
pharmaceutical compositions and formulations is presented in
Remington's Pharmaceutical Sciences, 18th ed. A. R. Gennaro, ed.
Mack, Easton, Pa. (1990), the relevant portions of which are
incorporated by reference.
[0042] The following examples are offered to more fully illustrate
the invention, but are not construed as limiting the scope
thereof.
EXAMPLE 1
Mouse Colon Crypt Colony Formation Assay
[0043] An assay for colony formation by isolated mouse colon crypts
was previously described in co-pending and co-owned U.S. Ser. No.
08/622,720 hereby incorporated by reference. The assay is performed
as follows. Mouse colon crypts were prepared as described in
Whitehead et al. (In Vitro Cellular & Developmental Biology,
23, 436-442 (1987)). Mice were sacrificed with lethal dose of
CO.sub.2, and large intestines were isolated. The large intestine
was cut longitudinally, rinsed with PBS containing 0.3 mg/ml
L-Glutamine, 100 units/ml penicillin, 100 units/ml streptomycin
(Buffer A), and sliced to 0.5 cm pieces. The sliced colon pieces
were washed several times with buffer A in a 50 ml conical tube.
The clean tissue was washed with the extraction buffer (0.5 mM DTT,
2 mM EDTA in buffer A), and then incubated with 10 ml of fresh
extraction buffer for 1 hour. The extraction buffer was then
removed, and tissue was washed with Solution A. The crypts were
harvested by shaking the tissue in 5 ml of Solution A.
[0044] Harvested crypts were plated on collagen type IV coated 6
well plates (Collaborative Biomedical Products, Bedford, Mass.) at
a density of 500 crypts per well in 4 ml medium (RPMI 1640, 0.3
mg/ml L-Glutamine, 100 units/ml penicillin, 100 units/ml
streptomycin, and 10% fetal bovine serum (FBS; GIBCO-BRL.
Gaithersburg, Md.). After 24 hours incubation at 37.degree. C.,
colonies of attached cells were stained with crystal violet, and
counted under microscope. To confirm that the cells in the colonies
are derived from crypt epithelium, the colonies were stained with
McManus' Periodic Acid-Schiff method and and Trichosantes kirilowii
as described (Carson, Histotechnology: A Self-Instructional Text
American Society of Clinical Pathologist Press pp. 158-160 (1990);
(Falk et al. Am. J. Physiol. 266, G987-1003 (1994)). The colonies
were compared to mouse colon paraffin sections stained with the
same methods. The results of crypt cell staining revealed that both
methods are specific for epithelial cells in the colon sections and
stained positive for the colonies.
EXAMPLE 2
Activity of Natural Bovine MSP and Recombinant MSP
[0045] The colony forming activity of natural bovine MSP and
recombinant murine MSP was compared in the mouse colon crypt assay
described in Example 1. Bovine MSP was isolated from bovine fetal
serum as described in U.S. Ser. No. 08/622,720. Recombinant murine
MSP was prepared as follows: A 2266 bp fragment was amplified from
cDNA made from mouse liver poly(A)+RNA by using the following
oligonucleotide primers:
1 ATCCTGAAGGGACAGATTTC (SEQ ID NO:_) and TTTGAGAAGTCTTGACATCTC (SEQ
ID NO:_)
[0046] The primers were based on the published mouse MSP sequence
(Degen et al. Biochemistry 3, 9781-9791 (1991)). Due to the
presence of several mutations in the coding region of the PCR
product, the cloned fragment was used as a probe to screen a mouse
liver cDNA library (Clonetech). A positive clone with 2.2 kb insert
was isolated and sequenced. The DNA sequence that was obtained
indicated that this clone contains the coding region of mouse MSP
except for the first two amino acids. To obtain the full-length
cDNA, an adaptor including the optimal context for initiation of
translation and the missing nucleotides was synthesized based upon
the published sequence, and ligated to the 2.2 kb insert. The cDNA
was subcloned into pcDNA3 vector (Invitrogen). The mouse MSP
plasmid DNA was tranfected into COS-7 cells with lipofectamine
transfection system (GIBCO BRL). Serum-free condition media were
harvested two days after transfection. Murine MSP was purified as
described in Example 6 below.
[0047] The colony forming activity of natural bovine MSP and
recombinant murine MSP was assayed at 2 ng/ml and 10 ng/ml and the
results shown in Table 1. Recombinant murine MSP stimulated colony
formation by murine crypts about 3 to 7-fold lower than natural
bovine MSP.
2TABLE 1 Comparison of crypt colony forming activity of native
bovine MSP and recombinant murine MSP Sample concentration % of
colonies no addition not applicable 16 fetal bovine serum 10% 118
native bovine MSP 2 ng/ml 234 native bovine MSP 10 ng/ml 336
recombinant murine MSP 2 ng/ml 28 recombinant murine MSP 10 ng/ml
118
EXAMPLE 3
Modelling of MSP Interchain Disulfide Bonding
[0048] The domain and disulfide structures of plasminogen and
plasminogen-related growth factors are shown in FIG. 1. From the
N-terminus, the domain structure of plasminogen may be summarized
to contain a secretion signal peptide, an N-terminal "hairpin"
domain, 5 kringle domains, and a serine proteinase domain (SPD).
The domain structures of MSP and HGF are very similiar to that of
plasminogen. The main difference is that MSP and HGF have only four
kringles due to the deletion of kringle 5 of plasminogen. The
disulfide structure of plasminogen contains intra and inter-domain
disulfide bonds: The intradomain disulfide bonds may be listed as
follows: the hairpin domain contains two disulfides, each kringle
contains 3 disulfides and the SPD contains 4 disulfides. There is
an interdomain disulfide between the second and third kringle, and
two disulfides between the last kringle of the a subunit and the
SPD. As shown in FIG. 2 of Thery et al. (Dev. Genetics 17, 90-101
(1995) and in FIG. 1 below, every disulfide that is present in
plasminogen is also present in HGF and MSP, with one exception:HGF
and MSP have only a single disulfide between the kringle-containing
(.alpha.) subunit and the serine proteinase domain (.beta.). HGF
from chicken, mouse and human contain no extra Cys or disulfides
other than those which are homologous to plasminogen. MSP, however
contains extra Cys, some of which are conserved in chicken, mouse,
and human. Thus, murine MSP has a Cys residue in the signal
sequence, and MSP from mouse and human contain an extra Cys in the
hairpin domain. MSP from all three species contain 3 extra
conserved Cys in the SPD compared to both plasminogen and HGF.
Since recombinant HGF of high specific activity is available
commercially and recombinant MSP is not, we considered whether the
extra conserved Cys residues of MSP were involved with the disufide
bonding defect that we observed with our recombinant MSP
preparation.
[0049] Although high resolution structural information is not
available for plasminogen, MSP or HGF, this information is
available for other serine proteinases, such as trypsin. Mature
trypsin contains only a serine proteinase domain, which is formed
by the removal of a 15 residue signal peptide and a 9 residue
activation peptide. Since trypsin has very high sequence homology
to the serine proteinase domain of MSP (or plasminogen), we used
the structure of trypsin as a surrogate for the SPD of MSP. The
Brookhaven data file 1trn, which is a structure of
diisopropylfluorophosphate-inhibited human trypsin, was used for
our modelling (See FIG. 3). Trypsin has ten Cys residues that form
five disulfide bonds. Four of the trypsin disulfide bonds have
homologs in MSP (and plasminogen). The residue numbering system for
human trypsin in the structure file from Brookhaven (1trn) is based
upon the conventional chymotrypsinogen relative amino acid
numbering (Gaboriaud et al. J. Mol. Biol. 2, 995-1010 (1996)) and
differs from the residue numbering system in the human trypsin
sequence file from Swiss-Prot (tryl_human.swiss). Therefore, the
residue numbers from the various database files are correlated in
Table 2 for clarification.
3TABLE 2 Correlation of residue numbers of human MSP and trypsin
from various database files Cysteines of interest in human MSP are
compared to chosen homologous residues of human trypsin. Human
MSP.sup.a Cys527 Cys562 Cys588 Cys672 Human trypsin.sup.b Lys66
Arg95 Ser127 Gln209 Human trypsin.sup.c Lys60 Arg90 Ser122 Gln204
.sup.aResidue numbers as in Swiss-Prot database file
HGF1_human.swiss .sup.bResidue numbers as in Swiss-Prot database
file tyr1_human.swiss .sup.cResidue numbers as in Brookhaven
database file 1trn
[0050] Using the the numbering from the structural file, the
following trypsin residues were chosen as homologs of the three
"extra" Cys residues in MSP: Cys537=trypsin Lys60, Cys562=trypsin
Arg90, Cys672=trypsin Gln209, and the intersubunit Cys588=trypsin
Ser122. Lys60 and Arg90 are located on the surface of trypsin on
the opposite side of the protein from the Ser122. Gln209 and Ser122
are located on the surface in very close proximity, the distance
between the a carbons of these residues is 6.1 A. For comparison,
the distances between the .alpha. carbons of the disulfide bonded
Cys residues of trypsin range from 4.2 to 6.2 A. Thus, the
suggested close proximity of Cys672 to Cys588 suggests that intra
subunit disulfide formation between these two Cys might interfere
with intersubunit disulfide formation by Cys 588. It should be
noted that Cys672 apparently has no other Cys residue other than
Cys588 with which to interact.
EXAMPLE 4
Construction and Expression of Murine MSP Analog
[0051] Construction of C677A Mutant of Murine MSP
[0052] To mutate the cysteine residue which is suspected of
interfering with interchain disulfide bond formation, we employed a
two-step PCR process. First, murine MSP plasmid template was
amplified with a mutant primer (which incorporated a change from TG
to GC at nucleotides 2029 and 2030, resulting in a Cys to Ala
mutation) and a downstream primer complementary to vector pCDNA3.
Primer sequences are:
4 Mutant: 5' CCA TGA CGC CTG GGT CCT ACA G 3' (SEQ ID NO: _)
Downstream: 5' CTG GCA ACT AGA AGG CAC AGT CG 3' (SEQ ID NO: _)
[0053] Cycling conditions were: 96.degree. C., 30 sec.; 62.degree.
C., 30 sec; 72.degree. C., 1 min for 5 cycles, followed by an
additional 15 cycles at 96.degree. C., 30 sec; 67.degree. C., 30
sec; 72.degree. C., 1 min. A primary 334 base pair product was
purified from an agarose gel.
[0054] Next, the primary PCR product (containing the Cys to Ala
mutation) was combined with a small amount of the original MSP
plasmid and cycled in the absence of oligonucleotide primers for 5
cycles. This allowed the upstream and downstream extension of the
mutated PCR product. Primers corresponding to an upstream region
(nucleotides 1735-1759) of mMSP and the downstream vector primer
(above) were added, and 20 more cycles were performed at 96.degree.
C., 30 sec; 67.degree. C., 30 sec; 72.degree. C., 1 min. Upstream
primer sequence is
5 5' CTG GAG AGA CCT GTG ATC CTG AAC C (SEQ ID NO: _) 3'
[0055] Secondary product of 621 base pairs was isolated from
agarose gel as above, then digested with KpnI and XbaI to generate
474 base pair mutated MSP fragment corresponding to nucleotides
1804 through 2290.
[0056] Mutated fragment was subcloned into pCDNA3/mMSP for
transient expression in 293/E1 cells and into pDSRaX2/mMSP for
stable expression in CHO D- cells. Both constructs were sequenced
to verify the presence of Cys to Ala mutation. Nucleotide positions
refer to those of murine MSP RNA sequence, Genbank accession number
M74181.
[0057] Transient expression of muring MSP C677A mutant in 293/E1
Cells
[0058] 293/E1 cells were seeded at a density of 1.times.10.sup.6
cells per 10 cm dish in complete medium (DMEM, high glucose,
supplemented with 10% FBS and 0.3 mg/ml L-glutamine) and allowed to
incubate overnight at 37.degree., 5% CO.sub.2. Shortly before
transfecting, complete medium was removed and replaced with DMEM+5%
FBS+0.3 mg/ml L-glutamine, 4 ml per dish.
[0059] Plasmid DNAs pCDNA3/mMSP C677A and pCDNA3/mMSP wild type
were diluted to 10 ug per 500 ul serum-free DMEM and filter
sterilized. A mock sample containing no DNA was also prepared in
parallel. Lipofectamine reagent (Life Sciences, Inc., Gaithersburg,
Md.) was diluted to 0.2 mg/ml in serum-free DHEM and combined with
filter-sterilized plasmid DNA; final concentration for each sample
was 10 ug/ml DNA and 0.1 mg/ml lipofectamine in 1 ml each.
DNA/lipofectamine mixtures were incubated at room temperature, 30
minutes, then added to cell monolayers. Treated cells were returned
to 37.degree. C. for approximately 6 hours, then medium was removed
and replaced with fresh DMEM+5% FBS+0.3 mg/ml L-glutamine and cells
were allowed to recover overnight.
[0060] Transfected cells were then washed once with serum-free DMEM
and conditioned for 48 hours in serum-free DMEM+0.3 mg/ml
L-glutamine at 9 ml per dish. Conditioned media were harvested,
filtered to remove cell debris, and concentrated to 5.times. in
Centriprep-10 concentration units (Amicon, Inc., Beverly, Mass.).
Expression of MSP was verified for C677A and wild type samples by
Western blot; no expression was seen in mock sample. All three
conditioned media samples were assayed for biological activity in
murine crypt attachment assay.
[0061] Stable Expression of C677A in CHO D- cells
[0062] CHO D- cells were seeded at 8.times.10.sup.5 cells per 60 mm
dish in complete medium (DMEM, high glucose, with 10% FBS,
1.times.PSG, 1.times.NEAA and 1.times.HT supplement) in 5 ml per
dish and allowed to attach overnight at 37.degree. C. in 5%
CO.sub.2. Medium was replaced with 5 ml fresh complete medium
approximately 3 hours prior to transfection.
[0063] Plasmid DNA pDSRa2/mMSP C677A was diluted to 60 ng/ul in
0.25M CaCl.sub.2 and filter sterilized. A mock sample containing no
DNA was also prepared in parallel. Following sterilization, 250 ul
of each sample was combined with 250 ul of 2.times. HEPES-buffered
saline and incubated at room temperature for 30 minutes to allow
CaPO.sub.4 precipitates to form. Medium was aspirated and
CaPO.sub.4/DNA samples were added to cells; following a 30 minute
incubation at room temperature, cells were fed with 5 ml complete
medium per plate and allowed to recover overnight at 37.degree. C.
Cells were re-fed with fresh complete medium the next day.
[0064] At approximately 72 hours post-transfection, cells were
split into selective medium (DMEM with 5% dialyzed FBS,
1.times.PSG, and 1.times.NEAA) at a ratio of 1:20 in 10 cm dishes.
Viable colonies appeared after about 10 days, and were isolated by
ring cloning and expanded for analysis. Mock-transfected cells
produced no viable colonies.
[0065] Conditioned medium was generated from individual colonies
plated into 24-well dishes; serum-free DMEM containing 1.times.NEAA
and 1.times.PSG was incubated on 80% confluent monolayers at 400 ul
per well for 72 hours, then harvested and filtered to remove
cellular debris. Following concentration in Microcon-10
concentration units, the equivalent of 30 ul of 1.times.
conditioned medium per well was run on an 8% SDS-PAGE reducing gel.
Proteins were electrophoretically transferred to nitrocellulose
membrane and blotted with a rabbit polyclonal antibody raised
against MSP. Blot was then exposed to horseradish
peroxidase-conjugated anti-rabbit secondary antibody and visualized
using Enhanced Chemiluminescence (ECL) system (Amersham, Inc.). The
highest expression of MSP was seen for clone 2, which was selected
for further expansion.
[0066] To generate large scale amounts of mMSP C677A mutant
protein, CHO/C677A clone 2 cells were seeded into 100 roller
bottles in 50% DMEM/50% Ham's F-12 medium supplemented with 5% FBS,
1.times.NEAA and 1.times.PSG. When monolayers reached 80%
confluency, cells were washed with PBS to remove residual serum and
conditioned in serum-free 50% DMEM/50% F-12 with 1.times.NEAA and
1.times.PSG for 4 days. A total of 20 liters of conditioned medium
was harvested for purification.
EXAMPLE 5
Construction and Expression of Human MSP Mutant
[0067] Construction of C672A Mutant of Human MSP
[0068] To mutate the Cys residue suspected of interfering with
interchain disulfide bond formation, a two-step PCR process was
employed. First, human MSP plasmid template was amplified with a
mutant primer (which incorporated a change from TG to GC at
nucleotides 2024 and 2025, resulting in a Cys to Ala mutation) and
a downstream primer complementary to vector pCDNA3 (Invitrogen, San
Diego, Calif.). Primer sequences are:
6 Mutant: 5' CAC AAC GCC TGG GTC CTG GAA G 3' (SEQ ID NO: _)
Downstream: 5' CTG GCA ACT AGA AGG CAC AGT CG 3' (SEQ ID NO: _)
[0069] Cycling conditions were: 96.degree. C., 30 sec.; 62.degree.
C., 30 sec.; 72.degree. C., 1' for 5 cycles, followed by an
additional 15 cycles at 96.degree. C., 30 sec; 67.degree. C., 30
sec; 72.degree. C., 1 min. The primary 323 base pair product was
isolated from an agarose gel and purified to remove agarose.
[0070] The primary PCR product containing the Cys to Ala mutation
was combined with a small amount of the original MSP plasmid
template and cycled in the absence of oligonucleotide primers for 5
cycles. This allowed the upstream and downstream extension of the
mutated PCR product. Primers corresponding to an upstream region
(nucleotides 1576-1598) of huMSP and the downstream vector primer
(above) were added, and 20 more cycles were performed at 96.degree.
C.,30 sec; 67.degree. C., 30 sec; 72.degree. C., 1 min. Upstream
primer sequence is
7 5' GTG CTT CTC CTC CTG CCA TAT GC 3' (SEQ ID NO: _)
[0071] Secondary product of 765 base pairs was isolated from
agarose gel as above, then digested with Bgl II and Xba I to
generate a 528 base pair mutated MSP fragment corresponding to
nucleotides 1736 through 2219, plus a portion of the pCDNA3
multiple cloning site.
[0072] The mutated fragment was subcloned into pCDNA3/huMSP for
transient expression in 293/E1 cells and into pDSR.alpha.2/huMSP
for stable expression in CHO D- cells. Both constructs were
sequenced to verify the presence of Cys to Ala mutation. Nucleotide
positions refer to those of published human MSP cDNA sequence
having GenBank accession number L11924 (Yoshimura et al, J. Biol.
Chem 268 15461-15468 (1993)).
[0073] Tranqient Expression of Human MSP C672A Mutant in 293/E1
Cells
[0074] 293/E1 cells were seeded at a density of 1.times.10.sup.6
cells per 10 cm dish in complete medium (DMEM, high glucose,
supplemented with 10% FBS and 0.3 mg/ml L-glutamine) and allowed to
incubate overnight at 37.degree., 5% CO.sub.2. Shortly before
transfecting, complete medium was removed and replaced with DMEM+5%
FBS+0.3 mg/ml L-glutamine, 4 ml per dish.
[0075] Plasmid DNAs pCDNA3/huMSP C672A and pCDNA3/huMSP wild type
were diluted to 10 ug per 500 ul serum-free DMEM and filter
sterilized. A mock sample containing no DNA was also prepared in
parallel. Lipofectamine reagent (Life Sciences, Inc., Gaithersburg,
Md.) was diluted to 0.2 mg/ml in serum-free DMEM and combined with
filter-sterilized plasmid DNA; final concentration for each sample
was 10 ug/ml DNA and 0.1 mg/ml lipofectamine in 1 ml each.
DNA/lipofectamine mixtures were incubated at room temperature, 30
minutes, then added to cell monolayers. Treated cells were returned
to 37.degree. C. for approximately 6 hours, then medium was removed
and replaced with fresh DMEM+5% FBS+0.3 mg/ml L-glutamine and cells
were allowed to recover overnight.
[0076] Transfected cells were then washed once with serum-free DMEM
and conditioned for 48 hours in serum-free DMEM+0.3 mg/ml
L-glutamine at 9 ml per dish. Conditioned media were harvested,
filtered to remove cell debris, and concentrated to 5.times. in
Centriprep-10 concentration units (Amicon, Inc., Beverly, Mass.).
Expression of MSP was verified for C672A and wild type samples by
Western blot; no expression was seen in mock sample. All three
conditioned media samples were assayed for biological activity in
murine crypt attachment assay.
[0077] Stable Expression of C672A in CHO D- cells CHO D- cells were
seeded at 8.times.10.sup.5 cells per 60 mm dish in complete medium
(DMEM, high glucose, with 10% FBS, 1.times.PSG, 1.times.NEAA and
1.times.HT supplement) in 5 ml per dish and allowed to attach
overnight at 37.degree. C. in 5% CO.sub.2. Medium was replaced with
5 ml fresh complete medium approximately 3 hours prior to
transfection.
[0078] Plasmid DNA pDSR.alpha.2/huMSP C672A was diluted to 60 ng/ul
in 0.25M CaCl.sub.2 and filter sterilized. A mock sample containing
no DNA was also prepared in parallel. Following sterilization, 250
ul of each sample was combined with 250 ul of 2.times.
HEPES-buffered saline and incubated at room temperature for 30
minutes to allow CaPO.sub.4 precipitates to form. Medium was
aspirated and CaPO.sub.4/DNA samples were added to cells; following
a 30 minute incubation at room temperature, cells were fed with 5
ml complete medium per plate and allowed to recover overnight at
37.degree. C. Cells were re-fed with fresh complete medium the next
day.
[0079] At approximately 72 hours post-transfection, cells were
split into selective medium (DMEM with 5% dialyzed FBS,
1.times.PSG, and 1.times.NEAA) at a ratio of 1:20 in 10 cm dishes.
Viable colonies appeared after about 10 days, and were isolated by
ring cloning and expanded for analysis. Mock-transfected cells
produced no viable colonies.
[0080] Conditioned medium was generated from individual colonies
plated into 24-well dishes; serum-free DMEM containing 1.times.NEAA
and 1.times.PSG was incubated on 80% confluent monolayers at 400 ul
per well for 48 hours, then harvested and filtered to remove
cellular debris. Following concentration in Microcon-10
concentration units, the equivalent of 30 ul of 1.times.
conditioned medium per well was run on an 8% SDS-PAGE reducing gel.
Proteins were electrophoretically transferred to nitrocellulose
membrane and blotted with a mouse monoclonal antibody raised
against MSP. Blot was then exposed to horseradish
peroxidase-conjugated anti-mouse secondary antibody and visualized
using Enhanced Chemiluminescence (ECL) system (Amersham, Inc.). The
highest expression of MSP was seen for clone 3, which was selected
for further expansion.
EXAMPLE 6
Purification of Recombinant MSP
[0081] Conditioned media, with or without concentration by
diafiltration, and without salt or pH adjustment, was
chromatographed by absorption onto heparin-Sepharose (Pharmacia),
and elution with a salt gradient in 20 mM sodium phosphate, pH 7.
MSP eluted at 0.4 M NaCl. Pooled fractions were dialyzed with 0.02
M Tris, pH 8.5 and chromatographed by absorption on Q Sepharose HP
(Pharmacia), and elution with a salt gradient in 0.02 M Tris pH
8.5. MSP eluted at 0.1 M salt.
[0082] MSP was activated by either by incubation at 37.degree. C.
for one hour with 10 .mu.g/ml human kallikrein (Enzyme System
Products), followed by addition of 1 mM pefabloc (Boeringher
Mannheim) or by passing through a column of kallikrein-Sepharose (1
mg/ml human kallikrein/ml cyanogen bromide activated Sepharose, 4
ml total). Active samples were dialyzed versus phosphate buffered
saline
[0083] MSP was analyzed with 10% PAGE gels from Novex. Non reduced
samples were mixed with sample buffer containing SDS but were not
heated. Reduced samples were heated at 90.degree. C. for three
minutes in sample buffer which contained SDS and 5%
.beta.-mercaptoethanol. The results are shown in FIG. 4. Purified
recombinant murine and human MSP and murine C677A and human C672
analogs appear as a proform consisting of a single band of about 80
kDa when analyzed by SDS-PAGE under reducing (lanes 1 or 3) or
nonreducing conditions (lanes 5 or 7), with Coomassie blue
staining. Kallikrein treatment efficiently cleaves proMSP or proMSP
analog between the .alpha. and .beta. subunits, as shown by
SDS-PAGE under reducing conditions (lanes 2 and 6). However, the
subunits of kallikrein-treated, recombinant, nonmutant MSP do not
remain linked during SDS-PAGE under nonreducing conditions (lane
4). The kallikrein-treated analog of MSP described does remain
linked during SDS-PAGE under nonreducing conditions, apparently due
to the sparing of the intersubunit disulfide bond (lane 8).
EXAMPLE 7
Activity of Recombinant MSP and MSP Analogs
[0084] Recombinant murine MSP and C677A analog expressed and
purified as described in Example 4 and recombinant human MSP and
C672A analog expressed and purified as described in Example 5 were
assayed for colony forming activity as described in Example 1. The
results for murine MSP are shown in FIG. 5 and the results for
human MSP are shown in FIG. 6.
[0085] Recombinant human MSP and the C672A analog were assayed for
stimulation of .sup.3H thymidine uptake by cells expressing the
stk/RON receptor. The full length cDNA for murine stk/RON (GenBank
accession number .times.74736) was cloned using standard
techniques, subcloned into the mammalian expression vector, pEV7,
and tritiated thymidine uptake was measured in NIH 3T3 cells
expressing stk/RON as described (Zhang et al. J. Biol. Chem. 221,
3884-3890 (1996)). The results are shown in FIG. 7.
[0086] While the invention has been described in what it considered
to be its preferred embodiments, it is not limited to the disclosed
embodiments, but on the contrary, is intended to cover various
modifications and equivalents included within the spirit and scope
of the appended claims, which scope is to be accorded the broadest
interpretation so as to encompass all such modifications and
equivalents.
Sequence CWU 1
1
* * * * *