U.S. patent application number 10/167645 was filed with the patent office on 2004-12-23 for process for the preparation of d-pantothenic acid and/or salts thereof.
This patent application is currently assigned to DEGUSSA AG. Invention is credited to Hermann, Thomas, Kruse, Daniela, Rieping, Mechthild, Witteck, Birgit.
Application Number | 20040259214 10/167645 |
Document ID | / |
Family ID | 7688209 |
Filed Date | 2004-12-23 |
United States Patent
Application |
20040259214 |
Kind Code |
A1 |
Hermann, Thomas ; et
al. |
December 23, 2004 |
Process for the preparation of D-pantothenic acid and/or salts
thereof
Abstract
A process for the preparation of D-pantothenic acid and/or salts
thereof or feedstuffs additives comprising these by fermentation of
microorganisms of the Enterobacteriaceae family, in particular
those which already produce D-pantothenic acid, in which the
nucleotide sequence(s) in the microorganisms which code(s) for the
cysK gene is/are enhanced, in particular over-expressed.
Inventors: |
Hermann, Thomas; (Bielefeld,
DE) ; Witteck, Birgit; (Dissen, DE) ; Rieping,
Mechthild; (Bielefeld, DE) ; Kruse, Daniela;
(Bielefeld, DE) |
Correspondence
Address: |
OBLON, SPIVAK, MCCLELLAND, MAIER & NEUSTADT, P.C.
1940 DUKE STREET
ALEXANDRIA
VA
22314
US
|
Assignee: |
DEGUSSA AG
Duesseldorf
DE
D-40474
|
Family ID: |
7688209 |
Appl. No.: |
10/167645 |
Filed: |
June 13, 2002 |
Current U.S.
Class: |
435/106 ;
435/193; 435/252.33; 435/320.1; 435/69.1; 536/23.2 |
Current CPC
Class: |
C12P 13/04 20130101;
A23K 20/174 20160501 |
Class at
Publication: |
435/106 ;
435/069.1; 435/193; 435/252.33; 435/320.1; 536/023.2 |
International
Class: |
C12P 013/04; C12Q
001/68; C07H 021/04; C12N 009/10; C12N 001/21; C12P 021/02; C12N
015/74 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 13, 2001 |
DE |
101 28 780.1 |
Claims
1. A process for the preparation of D-pantothenic acid and/or a
salt thereof or a feedstuffs additive comprising this/these
compound(s), comprising fermenting at least one microorganism of
the Enterobacteriaceae family, in which at least the nucleotide
sequence(s) which code(s) for the cysK gene is/are enhanced, under
conditions suitable for the formation of the cysK gene product
cysteine synthase A.
2. The process according to claim 1, wherein the microorganism
naturally produces D-pantothenic acid.
3. The process according to claim 1, wherein the nucleotide
sequence(s) which code(s) for the cysK gene is/are
over-expressed.
4. The process according to claim 1, wherein the microorganism is
transformed with at least one plasmid which carries the cysK
gene.
5. The process according to claim 4, wherein the cysK gene is
integrated into the chromosome in the transformed
microorganism.
6. The process according to claim 1, wherein in the microorganism
the promoter and regulation region upstream of the structural gene
is mutated to achieve the enhancement.
7. The process according to claim 1, wherein in the microorganism
at least one expression cassette is incorporated upstream of the
structural gene to achieve the enhancement.
8. The process according to claim 1, wherein to achieve the
enhancement, the life of the mRNA read off as the matrix from the
above-mentioned sequences is prolonged and/or the breakdown of the
corresponding enzyme protein(s) is prevented.
9. The process according to claim 1, wherein the microorganism has
additional metabolite or antimetabolite resistance mutations,
individually or together.
10. The process according to claim 1, wherein to achieve the
over-expression the microorganisms are fermented in an
appropriately modified culture medium or the fermentation procedure
is modified.
11. The process according to claim 1, in which a) the D-pantothenic
acid and/or the salt thereof is concentrated in the fermentation
broth or in the cells of the microorganism, and b) after the end of
the fermentation the desired product(s) is/are isolated, the
biomass and/or further constituents of the fermentation broth being
separated off in an amount of .gtoreq.0 to 100%.
12. The process according to claim 1, wherein the microorganism of
the Enterobacteriaceae family belongs to the genus Escherichia.
13. The process according to claim 1, wherein the microorganism is
an Escherichia coli.
14. The process according to claim 1, wherein one or more of the
genes selected from the group consisting of the following is or are
additionally enhanced: the ilvGM operon which codes for
acetohydroxy-acid synthase II, the panB gene which codes for
ketopantoate hydroxymethyl transferase, the panE gene which codes
for ketopantoate reductase, the panD gene which codes for aspartate
decarboxylase, the panC gene which codes for pantothenate
synthetase, individually or together, the genes gcvT, gcvH and gcvP
which code for the glycine cleavage system the glyA gene which
codes for serine hydroxymethyl transferase, the serA gene which
codes for phosphoglyceric acid dehydrogenase, the serA(FBR) allele
which codes for "feed back" resistant variants of phosphoglyceric
acid dehydrogenase, the serC gene which codes for phosphoserine
transaminase, the bfr gene which codes for bacterioferrin, the hns
gene which codes for the DNA-binding protein HLP-II, the pgm gene
which codes for phosphoglucomutase, the mdh gene which codes for
malate dehydrogenase, the fda gene which codes for fructose
bisphosphate aldolase (class II), the dldH gene which codes for
NADH-dependent lipoamide dehydrogenase, the pepB gene which codes
for peptidase, the aldH gene which codes for NADP-dependent
aldehyde dehydrogenase, and the adk gene which codes for adenylate
kinase.
15. The process according to claim 14, wherein said one or more of
the genes is or are overexpressed.
16. The process according to claim 1, wherein in the microorganism
one or more genes which code for the metabolic pathways which
reduce the formation of D-pantothenic acid are at least partly
eliminated.
17. The process according to claim 16, wherein said one or more
genes which code for the metabolic pathways which reduce the
formation of D-pantothenic acid are avtA gene which codes for
transaminase C, and/or the pckA gene which codes for PEP
carboxykinase.
18. The process according to claim 1, wherein the expression of the
polynucleotide(s) which code(s) for the poxB gene is
attenuated.
19. The process according to claim 1, wherein the expression of the
polynucleotide(s) which code(s) for the poxB gene is
eliminated.
20. A process for the preparation of a feedstuffs additive
comprising D-pantothenic and/or a salt thereof comprising: a)
separating the biomass and/or a portion of the constituents in an
amount of .gtoreq.0 to 100% from a fermentation broth obtained by
fermenting at least one microorganism of the Enterobacteriaceae
family, in which at least the nucleotide sequence(s) which code(s)
for the cysK gene is/are enhanced, and comprising D-pantothenic
acid, b) optionally, concentrating the mixture from a), and c)
converting the mixture into a finely divided powder to produce a a
free-flowing animal feedstuffs additive with a particle size
distribution of 20 to 2000 .mu.m.
21. The process according to claim 20, wherein the particle size
distribution is100 to 1400 .mu.m.
22. The process according to claim 20, wherein the animal
feedstuffs additive contains a salt of D-pantothenic acid selected
from the group consisting of the magnesium and the calcium salt,
wherein the fermentation of the microorganism is carried out in the
presence of compounds of Ca or Mg, these being fed in continuously
or discontinuously.
23. The process according to claim 22, in which stoichiometric
amounts of the compounds of Ca or Mg are fed in continuously or
discontinuously.
24. The process according to claim 20, wherein the animal
feedstuffs additive contains a salt of D-pantothenic acid selected
from the group consisting of the magnesium and the calcium salt,
wherein after the fermentation compounds of calcium or magnesium
are added to the fermentation broth, optionally after separating
off .gtoreq.0 to 100% of the biomass formed.
25. The process according to claim 24, wherein the compounds of
calcium or magnesium are added to the fermentation broth in
stoichiometric amounts.
26. The process according to claim 20, wherein before or after the
concentration, D-pantothenic acid or one or more salts thereof
is/are added to the fermentation broth, the amount of compounds
added being such that the total concentration thereof in the animal
feedstuffs additive is in the range from 20 to 80 wt. % (dry
weight).
27. The process according to claim 20, wherein the animal
feedstuffs additive with the desired particle size is obtained from
the fermentation broth, optionally after addition of D-pantothenic
acid and/or salts thereof, and optionally after addition of organic
or inorganic auxiliaries, by a) drying and compacting, or b) spray
drying, or c) spray drying and granulation, or d) spray drying and
build-up granulation.
28. The process according to claim 20, wherein the fermentation
broth is applied to an inorganic auxiliary, optionally after
removal of the biomass.
29. The process according to claim 28, wherein the inorganic
auxiliary is a silica or silicate.
30. A microorganism of the Enterobacteriaceae family which produces
pantothenic acid and in which the cysK gene is present in enhanced
form.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] The present invention relates to a process for the
preparation of D-pantothenic acid and salts thereof or mixtures
comprising these compounds using microorganisms of the
Enterobacteriaceae family in which at least the cysK gene is
enhanced.
[0003] 2. Description of the Background
[0004] Pantothenic acid is produced worldwide in an order of
magnitude of several thousand tons a year. It is used inter alia in
human medicine, in the pharmaceuticals industry and in the
foodstuffs industry. A large portion of the pantothenic acid
produced is used for nutrition of stock animals such as poultry and
pigs.
[0005] Pantothenic acid can be prepared by chemical synthesis, or
biotechnologically by fermentation of suitable microorganisms in
suitable nutrient solutions. In the chemical synthesis,
DL-pantolactone is an important precursor. It is prepared in a
multi-stage process from formaldehyde, isobutylaldehyde and
cyanide, and in further process steps, the racemic mixture is
separated, D-pantolactone is subjected to a condensation reaction
with .beta.-alanine, and D-pantothenic acid is obtained in this
way.
[0006] The typical commercial form is the calcium salt of
D-pantothenic acid. The calcium salt of the racemic mixture of
D,L-pantothenic acid is also customary.
[0007] The advantage of the fermentative preparation by
microorganisms lies in the direct formation of the desired
stereoisomeric form, that is to say the D-form, which is free from
L-pantothenic acid.
[0008] Various types of bacteria, such as e.g. Escherichia coli (E.
coli), Arthrobacter ureafaciens, Corynebacterium erythrogenes,
Brevibacterium ammoniagenes, and also yeasts, such as e.g.
Debaromyces castellii, can produce D-pantothenic acid in a nutrient
solution which comprises glucose, DL-pantoic acid and
.beta.-alanine, as shown in EP-A 0 493 060. EP-A 0 493 060
furthermore shows that in the case of E. coli, the formation of
D-pantothenic acid is improved by amplification of pantothenic acid
biosynthesis genes from E. coli which are contained on the plasmids
pFV3 and pFV5 in a nutrient solution comprising glucose, DL-pantoic
acid and .beta.-alanine.
[0009] EP-A 0 590 857 and U.S. Pat. No. 5,518,906 describe mutants
derived from E. coli strain IF03547, such as FV5714, FV525, FV814,
FV521, FV221, FV6051 and FV5069, which carry resistances to various
antimetabolites, such as salicylic acid, .alpha.-ketobutyric acid,
.beta.-hydroxyaspartic acid, O-methylthreonine and
.alpha.-ketoisovaleric acid. They produce pantoic acid in a
nutrient solution comprising glucose, and D-pantothenic acid in a
nutrient solution comprising glucose and .beta.-alanine. It is
furthermore stated in EP-A 0 590 857 and U.S. Pat. No. 5,518,906
that after amplification of the pantothenic acid biosynthesis genes
panB, panC and panD, which are said to be contained on the plasmid
pFV31, in the above-mentioned strains the production of D-pantoic
acid in nutrient solutions comprising glucose and the production of
D-pantothenic acid in a nutrient solution comprising glucose and
.beta.-alanine is improved.
[0010] WO 97/10340 furthermore reports on the favorable effect of
the enhancement of the ilvGM operon on the production of
D-pantothenic acid. Finally, EP-A-1001027 reports on the effect of
the enhancement of the panE gene on the formation of D-pantothenic
acid.
[0011] According to known procedures, the D-pantothenic acid or the
corresponding salt is isolated from the fermentation broth and
purified (EP-A-0590857 and WO 96/33283) and used accordingly in
purified form, or the fermentation broth comprising D-pantothenic
acid is dried in total (EP-A-1050219) and used in particular as a
feedstuffs additive.
SUMMARY OF THE INVENTION
[0012] It is an object of the invention to provide new methods for
improved fermentative preparation of D-pantothenic acid and/or
salts thereof, and animal feedstuffs additives comprising these
compounds.
[0013] The invention provides a process for the preparation of
D-pantothenic acid and/or salts thereof using microorganisms of the
Enterobacteriaceae family which in particular already produce
D-pantothenic acid and in which at least one, preferably endogenous
nucleotide sequence(s) which code(s) for the cysK gene is enhanced,
in particular over-expressed.
[0014] In particular, the process is a process which is
characterized in that the following steps are carried out:
[0015] a) fermentation of microorganisms of the Enterobacteriaceae
family which produce D-pantothenic acid and in which at least the
cysK gene is enhanced, in particular over-expressed;
[0016] the gene which codes for cysteine synthase A and optionally
alleles of this gene are enhanced, in particular over-expressed,
under conditions suitable for the formation of the gene
product;
[0017] further genes of the pantothenic acid biosynthesis pathway
are optionally attenuated or enhanced at the same time in order to
increase the production of pantothenic acid;
[0018] b) the fermentation is optionally carried out in the
presence of alkaline earth metal compounds, these being added to
the fermentation broth continuously or discontinuously in
preferably stoichiometric amounts;
[0019] c) concentration of the D-pantothenic acid or the
corresponding salts in the medium or the fermentation broth or
optionally in the cells of the microorganisms of the
Enterobacteriaceae family; and
[0020] d) after conclusion of the fermentation, isolation of the
D-pantothenic acid, and/or of the corresponding salt(s).
[0021] The invention also provides a process in which, after
conclusion of the fermentation, some or all (.gtoreq.0 to 100%) of
the biomass remains in the fermentation broth, and the broth
obtained in this way is processed, optionally after concentration,
to a solid mixture which comprises D-pantothenic acid and/or salts
thereof and preferably comprises further constituents from the
fermentation broth.
[0022] These further constituents are, above all, the dissolved
compounds which originate from the feed medium and soluble organic
compounds which are formed.
[0023] A more complete appreciation of the invention and many of
the attendant advantages thereof will be readily obtained as the
same becomes better understood by reference to the following
Figures in conjunction with the detailed description below.
BRIEF DESCRIPTION OF THE FIGURES
[0024] FIG. 1: Map of the plasmid pTrc99AcysK containing the cysK
gene.
[0025] The length data are to be understood as approx. data. The
abbreviations and designations used have the following meaning:
[0026] Amp: Ampicillin resistance gene
[0027] lacI: Gene for the repressor protein of the trc promoter
[0028] Ptrc: trc promoter region, IPTG-inducible
[0029] cysK: Coding region of the cysK gene
[0030] 5S: 5S rRNA region
[0031] rrnBT: rRNA terminator region
[0032] bps Base pairs
[0033] The abbreviations for the restriction enzymes have the
following meaning:
[0034] HindIII: Restriction endonuclease from Haemophilus
influenzae R.sub.d
[0035] PvuII: Restriction endonuclease from Proteus vulgaris
[0036] XbaI: Restriction endonuclease from Xanthomonas
campestris
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0037] When D-pantothenic acid or pantothenic acid or pantothenate
are mentioned in the following text, this means not only the free
acids but also the salts of D-pantothenic acid, such as e.g. the
calcium, sodium, ammonium or potassium salt.
[0038] "Endogenous genes" or "endogenous nucleotide sequences" are
understood as meaning the genes or nucleotide sequences present in
the population of a species.
[0039] The term "enhancement" in this connection describes the
increase in the intracellular activity of one or more enzymes or
proteins in a microorganism which are coded by the corresponding
DNA, for example by increasing the number of copies of the gene or
genes, of the ORF (Open Reading Frame) or ORFs, using a potent
promoter or a gene or allele or ORF which codes for a corresponding
enzyme or protein with a high activity, and optionally combining
these measures.
[0040] By enhancement measures, in particular over-expression, the
activity or concentration of the corresponding enzyme or protein is
in general increased by at least 10%, 25%, 50%, 75%, 100%, 150%,
200%, 300%, 400% or 500%, up to a maximum of 1000% or 2000%, based
on that of the wild-type protein or wild-type enzyme or the
activity or concentration of the protein or enzyme in the starting
microorganism.
[0041] The microorganisms which the present invention provides can
produce D-pantothenic acid from glucose, sucrose, lactose,
fructose, maltose, molasses, starch, cellulose or from glycerol and
ethanol. They are representatives of Enterobacteriaceae, in
particular of the genus Escherichia. Of the genus Escherichia, the
specie Escherichia coli is to be mentioned in particular. Within
the species Escherichia coli the so-called K-12 strains, such as e.
g. the strains MG1655 or W3110 (Neidhard et al.: Escherichia coli
and Salmonella. Cellular and Molecular Biology (ASM Press,
Washington D.C.)) or the Escherichia coli wild type strain IFO3547
(Institute of Fermentation, Osaka, Japan) and mutants derived from
these which have the ability to produce D-pantothenic acid are
suitable.
[0042] Suitable D-pantothenic acid-producing strains of the genus
Escherichia, in particular of the species Escherichia coli, are,
for example
[0043] Escherichia coli FV5069/pFV31
[0044] Escherichia coli FV5069/pFV202
[0045] Escherichia coli FE6/pFE80 and
[0046] Escherichia coli KE3
[0047] It has been found that Enterobacteriaceae produce
D-pantothenic acid in an improved manner after enhancement, in
particular over-expression of the cysK gene. The use of endogenous
genes is preferred.
[0048] The nucleotide sequences of the genes or open reading frames
(ORF) of Escherichia coli are known, and can also be found in the
genome sequence of Escherichia coli published by Blattner et al.
(Science 277, 1453-1462 (1997)).
[0049] The following information, inter alia, on the cysK gene can
be found in the following:
[0050] Description: Cysteine synthase A, O-acetylserine
sulfhydrylase A
[0051] Alternative gene name: cysZ
[0052] EC No.: 4.2.99.8
[0053] Reference: Boronat et al., Journal of General
Microbiology
[0054] 130:673-685 (1984)
[0055] Accession No.: AE000329
[0056] The gene described in the reference cited above can be used
according to the invention. Alleles of the gene or open reading
frames which result from the degeneracy of the genetic code or due
to sense mutations of neutral function can furthermore be used, the
activity of the proteins being substantially unchanged.
[0057] To achieve an over-expression, the number of copies of the
corresponding genes can be increased, or the promoter and
regulation region or the ribosome binding site upstream of the
structural gene can be mutated. Expression cassettes which are
incorporated upstream of the structural gene act in the same way.
By inducible promoters, it is additionally possible to increase the
expression in the course of fermentative D-pantothenic acid
production. The expression is likewise improved by measures to
prolong the life of the m-RNA. Furthermore, the enzyme activity is
also increased by preventing the degradation of the enzyme protein.
The genes or gene constructs can either be present in plasmids with
a varying number of copies, or can be integrated and amplified in
the chromosome. Alternatively, an over-expression of the genes in
question can furthermore be achieved by changing the composition of
the media and the culture procedure.
[0058] Instructions in this context can be found by one skilled in
the art, inter alia, in Chang and Cohen (Journal of Bacteriology
134:1141-1156 (1978)), in Hartley and Gregori (Gene 13:347-353
(1981)), in Amann and Brosius (Gene 40:183-190 (1985)), in de Broer
et al. (Proceedings of the National Academy of Sciences of the
United States of America 80:21-25 (1983)), in LaVallie et al.
(BIO/TECHNOLOGY 11, 187-193 (1993)), in PCT/US97/13359, in Llosa et
al. (Plasmid 26:222-224 (1991)), in Quandt and Klipp (Gene
80:161-169 (1989)), in Hamilton (Journal of Bacteriology
171:4617-4622 (1989), in Jensen and Hammer (Biotechnology and
Bioengineering 58, 191-195 (1998) and in known textbooks of
genetics and molecular biology.
[0059] Plasmid vectors which are capable of replication in
Enterobacteriaceae, such as e.g. cloning vectors derived from
pACYC184 (Bartolom et al.; Gene 102, 75-78 (1991)), pTrc99A (Amann
et al.; (Gene 69:301-315 (1988)) or pSC101 derivatives (Vocke and
Bastia, Proceedings of the National Academy of Science USA 80
(21):6557-6561 (1983)) can be used. A strain transformed with one
or more plasmid vectors where the plasmid vector(s) carries at
least one nucleotide sequence which codes for the cysK gene can be
employed in a process according to the invention.
[0060] It may furthermore be advantageous for the production of
D-pantothenic acid with strains of the Enterobacteriaceae family,
in addition to the enhancement of the cysK gene, for one or more of
the genes chosen from the group consisting of
[0061] the ilvGM operon which codes for acetohydroxy-acid synthase
II (WO 97/10340),
[0062] the panB gene which codes for ketopantoate hydroxymethyl
transferase (U.S. Pat. No. 5,518,906),
[0063] the panE gene which codes for ketopantoate reductase
(EP-A-1001027),
[0064] the panD gene which codes for aspartate decarboxylase (U.S.
Pat. No. 5,518,906),
[0065] the panC gene which codes for pantothenate synthetase (U.S.
Pat. No. 5,518,906),
[0066] the glyA gene which codes for serine hydroxymethyl
transferase (Plamann et al., Nucleic Acids Research
11(7):2065-2075(1983)),
[0067] the genes gcvT, gcvH and gcvP which code for the glycine
cleavage system (Okamura-Ikeda et al., European Journal of
Biochemistry 216, 539-548 (1993)),
[0068] the serA gene which codes for phosphoglyceric acid
dehydrogenase (Tobey und Grant, Journal of Biological Chemistry
261:12179-12183 (1986)),
[0069] the serA(FBR) allele which codes for "feed back" resistant
variants of phosphoglyceric acid dehydrogenase (DE-A-4232468),
[0070] the serC gene which codes for phosphoserine transaminase
(Duncan und Coggins, Biochemical Journal 234:49-57 (1986)),
[0071] the bfr gene which codes for bacterioferrin (Andrews et al.,
Journal of Bacteriology 171:3940-3947 (1989)),
[0072] the hns gene which codes for the DNA-binding protein HLP-II
(reference: Pon et al., Molecular and General Genetics 212:199-202
(1988)),
[0073] the pgm gene which codes for phosphoglucomutase (Lu and
Kleckner, Journal of Bacteriology 176:5847-5851 (1994)),
[0074] the mdh gene which codes for malate dehydrogenase
(Sutherland und McAlister-Henn, Journal of Bacteriology 1985
163:1074-1079 (1985)),
[0075] the fda gene which codes for fructose bisphosphate aldolase
(class II) (Alefounder et al., Biochemical Journal 257:529-534
(1989)),
[0076] the dldH gene which codes for NADH-dependent lipoamide
dehydrogenase (reference: Stephens et al., European Journal of
Biochemistry 135:519-527 (1983)),
[0077] the pepB gene which codes for peptidase B (Hermsdorf et al.,
International Journal of Peptide and Protein Research 13:146-151
(1979); Suzuki et al., Journal of Fermentation and Bioengineering
82:392-397 (1996); Suzuki et at., Journal of Bacteriology
183(4):1489-1490, (2001)),
[0078] the aldH gene which codes for NADP-dependent aldehyde
dehydrogenase (Heim and Strehler, Gene 99:15-23 (1991)) and
[0079] the adk gene which codes for adenylate kinase (Brune et al.,
Nucleic Acids Research 13:7139-7151 (1985))
[0080] to be enhanced, in particular over-expressed, individually
or together. The use of endogenous genes is preferred.
[0081] Finally, it may be advantageous for the production of
D-pantothenic acid with strains of the Enterobacteriaceae family,
in addition to the enhancement of the cysK gene, for one or more of
the genes chosen from the group consisting of
[0082] the avtA gene which codes for transaminase C
(EP-A-1001027)
[0083] the poxB gene which codes for pyruvate oxidase (Grabau and
Cronan, Nucleic Acids Research. 14 (13), 5449-5460 (1986))
[0084] the pckA gene which codes for PEP carboxykinase (Medina et
al., Journal of Bacteriology 172, 7151-7156 (1990))
[0085] to be attenuated, in particular eliminated or expressed at a
low level, individually or together.
[0086] The term "attenuation" in this connection describes the
reduction or elimination of the intracellular activity of one or
more enzymes or proteins in a microorganism which are coded by the
corresponding DNA, for example by using a weak promoter or using a
gene or allele which codes for a corresponding enzyme or protein
with a low activity or inactivates the corresponding gene or enzyme
(protein), and optionally combining these measures.
[0087] By attenuation measures, including reduction in expression,
the activity or concentration of the corresponding protein is in
general reduced to 0 to 75%, 0 to 50%, 0 to 25%, 0 to 10% or 0 to
5% of the activity or concentration of the wild-type protein or of
the activity or concentration of the protein in the starting
microorganism.
[0088] In addition to over-expression of the cysK gene it may
furthermore be advantageous for the production of D-pantothenic
acid to eliminate undesirable side reactions (Nakayama: "Breeding
of Amino Acid Producing Microorganisms", in: Overproduction of
Microbial Products, Krumphanzl, Sikyta, Vanek (eds.), Academic
Press, London, UK, 1982). Bacteria in which the metabolic pathways
which reduce the formation of D-pantothenic acid are at least
partly eliminated can be employed in the process according to the
invention.
[0089] The microorganisms produced according to the invention can
be cultured in the batch process (batch culture), the fed batch
(feed process) or the repeated fed batch process (repetitive feed
process). A summary of known culture methods is described in the
textbook by Chmiel (Bioprozesstechnik 1. Einfuhrung in die
Bioverfahrenstechnik [Bioprocess Technology 1. Introduction to
Bioprocess Technology (Gustav Fischer Verlag, Stuttgart, 1991)) or
in the textbook by Storhas (Bioreaktoren und periphere
Einrichtungen [Bioreactors and Peripheral Equipment] (Vieweg
Verlag, Braunschweig/Wiesbaden, 1994)).
[0090] The culture medium to be used must meet the requirements of
the particular strains in a suitable manner. Descriptions of
culture media for various microorganisms are contained in the
handbook "Manual of Methods for General Bacteriology" of the
American Society for Bacteriology (Washington D.C., USA, 1981).
Sugars and carbohydrates, such as e.g. glucose, sucrose, lactose,
fructose, maltose, molasses, starch and cellulose, oils and fats,
such as e.g. soya oil, sunflower oil, groundnut oil and coconut
fat, fatty acids, such as e.g. palmitic acid, stearic acid and
linoleic acid, alcohols, such as e.g. glycerol and ethanol, and
organic acids, such as e.g. acetic acid, can be used as the source
of carbon. These substances can be used individually or as a
mixture.
[0091] Organic nitrogen-containing compounds, such as peptones,
yeast extract, meat extract, malt extract, corn steep liquor, soya
bean flour and urea, or inorganic compounds, such as ammonium
sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate
and ammonium nitrate, can be used as the source of nitrogen. The
sources of nitrogen can be used individually or as a mixture.
[0092] Phosphoric acid, potassium dihydrogen phosphate or
dipotassium hydrogen phosphate or the corresponding
sodium-containing salts can be used as the source of phosphorus.
The culture medium must furthermore comprise salts of metals, such
as e.g. magnesium sulfate or iron sulfate, which are necessary for
growth. Finally, essential growth substances, such as amino acids
and vitamins, can be employed in addition to the abovementioned
substances. Precursors of pantothenic acid, such as aspartate,
.beta.-alanine, ketoisovalerate, ketopantoic acid or pantoic acid
and optionally salts thereof, can moreover be added to the culture
medium. The starting substances mentioned can be added to the
culture in the form of a single batch, or can be fed in during the
culture in a suitable manner.
[0093] Basic compounds, such as sodium hydroxide, potassium
hydroxide, ammonia or aqueous ammonia, or acid compounds, such as
phosphoric acid or sulfiric acid, can be employed in a suitable
manner to control the pH of the culture.
[0094] For the preparation of alkaline earth metal salts of
pantothenic acid, in particular the calcium salt or magnesium salt,
it is equally possible to add the suspension or solution of an
inorganic compound containing an alkaline earth metal, such as, for
example, calcium hydroxide or MgO, or of an organic compound, such
as the alkaline earth metal salt of an organic acid, for example
calcium acetate, continuously or discontinuously during the
fermentation. For this purpose, the cation necessary for
preparation of the desired alkaline earth metal salt of
D-pantothenic acid is introduced into the fermentation broth
directly in the desired amount, preferably in an amount of 0.95 to
1.1 equivalents.
[0095] However, the salts can also be formed after conclusion of
the fermentation by addition of the inorganic or organic compounds
to the fermentation broth, from which the biomass has optionally
been removed beforehand.
[0096] Antifoams, such as e.g. fatty acid polyglycol esters, can be
employed to control the development of foam. Suitable substances
having a selective action, e.g. antibiotics, can be added to the
medium to maintain the stability of plasmids. To maintain aerobic
conditions, oxygen or oxygen-containing gas mixtures, such as e.g.
air, are introduced into the culture. The temperature of the
culture is usually 25.degree. C. to 45.degree. C., and preferably
30.degree. C. to 40.degree. C. The pH is in general between 5.0 to
8.0, preferably 5.5 to 7.6. The fermentation is continued until a
maximum of D-pantothenic acid has formed. This target is usually
reached within 10 hours to 160 hours.
[0097] The D-pantothenic acid or the corresponding salts of
D-pantothenic acid contained in the fermentation broth can then be
isolated and purified in accordance with known procedures.
[0098] It is also possible for the fermentation broths comprising
D-pantothenic acid and/or salts thereof preferably first to be
freed from all or some of the biomass by known separation methods,
such as, for example, centrifugation, filtration, decanting or a
combination thereof. However, it is also possible to leave the
biomass in its entirety in the fermentation broth. In general, the
suspension or solution is preferably concentrated and then worked
up to a powder, for example with the aid of a spray dryer or a
freeze-drying unit. This powder is then in general converted by
suitable compacting or granulating processes, e. g. also build-up
granulation, into a coarser-grained, free-flowing, storable and
largely dust-free product with a particle size distribution of
preferably 20 to 2000 .mu.m, in particular 100 to 1400 .mu.m. In
the granulation or compacting it is advantageous to employ
conventional organic or inorganic auxiliary substances or carriers,
such as starch, gelatin, cellulose derivatives or similar
substances, such as are conventionally used as binders, gelling
agents or thickeners in foodstuffs or feedstuffs processing, or
further substances, such as, for example, silicas, silicates or
stearates.
[0099] Alternatively, the fermentation product, with or without
further of the conventional fermentation constituents, can be
absorbed, in particular sprayed, on to an organic or inorganic
carrier substance which is known and conventional in feedstuffs
processing, such as, for example, silicas, silicates, grits, brans,
meals, starches, sugars or others, and/or stabilized with
conventional thickeners or binders. Use examples and processes in
this context are described in the literature (Die
Muhle+Mischfuttertechnik 132 (1995) 49, page 817).
[0100] These mixtures comprising the carrier substances can also be
processed to a product with the desired particle size distribution
by granulation processes.
[0101] D-Pantothenic acid and/or the desired salt of D-pantothenic
acid or a formulation comprising these compounds is optionally
added in a suitable process stage during or after the fermentation
in order to achieve or establish the content of pantothenic acid
desired in the product or the desired salt.
[0102] The desired content of pantothenic acid and/or the desired
salt is in general in the range from 20 to 80 wt. % (based on the
dry weight).
[0103] The concentration of pantothenic acid can be determined with
known chemical (Velisek; Chromatographic Science 60, 515-560
(1992)) or microbiological methods, such as e.g. the Lactobacillus
plantarum test (DIFCO MANUAL, 10.sub.th Edition, p. 1100-1102;
Michigan, USA).
[0104] The present invention is explained in more detail in the
following with the aid of embodiment examples.
[0105] The minimal (M9) and complete media (LB) for Escherichia
coli used are described by J. H. Miller (A Short Course in
Bacterial Genetics (1992), Cold Spring Harbor Laboratory Press).
The isolation of plasmid DNA from Escherichia coli and all
techniques of restriction, ligation, Klenow and alkaline
phosphatase treatment are carried out by the method of Sambrook et
al. (Molecular cloning--A laboratory manual (1989), Cold Spring
Harbor Laboratory Press). The transformation of Escherichia coli is
carried out by the method of Chung et al. (Proceedings of the
National Academy of Sciences of the United States of America (1989)
86: 2172-2175) or by the method of Chuang et. al. (Nucleic Acids
Research (1995) 23: 1641).
EXAMPLES
[0106] Having generally described this invention, a further
understanding can be obtained by reference to certain specific
examples which are provided herein for purposes of illustration
only and are not intended to be limiting unless otherwise
specified.
Example 1
Construction of the Expression Plasmid pTrc99AcysK
[0107] The cysK gene from E. coli K12 is amplified using the
polymerase chain reaction (PCR) and synthetic oligonucleotides.
Starting from the nucleotide sequence of the cysK gene in E. coli
K12 MG1655 (Accession Number AE000329, Blattner et al. (Science
277, 1453-1462 (1997)), PCR primers are synthesized (MWG Biotech,
Ebersberg, Germany).
1 Primer cysK5': 5' - CAGTTAAGGACAGGCCATGAG - 3' (SEQ ID No. 1)
Primer cysK3': 5' - GCTGGCATTACTGTTGCAATTC - 3' (SEQ ID No. 2)
[0108] The chromosomal E. coli K12 MG1655 DNA employed for the PCR
is isolated according to the manufacturer's instructions with
"Qiagen Genomic-tips 100/G" (QIAGEN, Hilden, Germany). A DNA
fragment approx. 1000 bp in size can be amplified with the specific
primers under standard PCR conditions (Innis et al. (1990) PCR
Protocols. A Guide to Methods and Applications, Academic Press)
with Pfu-DNA polymerase (Promega Corporation, Madison, USA). The
PCR product is ligated according to the manufacturer's instructions
with the vector pCR-Blunt II-TOPO (Zero Blunt TOPO PCR Cloning Kit,
Invitrogen, Groningen, The Netherlands) and transformed into the E.
coli strain TOP10. Selection of plasmid-carrying cells takes place
on LB agar, to which 50 .mu.g/ml kanamycin are added. After
isolation of the plasmid DNA, the vector pCR-Blunt II-TOPO-cysK is
cleaved with the restriction enzymes SpeI and XbaI and, after
separation in 0.8% agarose gel, the cysK fragment is isolated with
the aid of the QIAquick Gel Extraction Kit (QIAGEN, Hilden,
Germany). The vector pTrc99A (Amersham Biosciences, Freiburg,
Germany) is cleaved with the enzyme XbaI, subsequently
dephosphorylated with alkaline phosphatase according to the
manufacturer's instructions (Amersham Biosciences, Freiburg,
Germany) and ligated with the cysK fragment isolated. The E. coli
strain XL1-Blue MRF' (Stratagene, La Jolla, USA) is transformed
with the ligation batch and plasmid-carrying cells are selected on
LB agar, to which 50 .mu.g/ml ampicillin is added. Successful
cloning can be demonstrated after plasmid DNA isolation by control
cleavage with the enzymes HindIII and PvuII. The plasmid is called
pTrc99AcysK (FIG. 1).
Example 2
Preparation of the Strains FE6-1/pTrc99A and FE6-1/pTrc99AcysK
[0109] The E. coli strain FE6 is a valine-resistant mutant of E.
coli K12 MG 1655 (U.S. Pat. No. 6,171,845) and is deposited as
DSM12379 at the Deutsche Sammlung fur Mikroorganismen und
Zellkulturen (DSMZ=German Collection of Microorganisms and Cell
Cultures, Braunschweig, Germany). Starting from FE6, after
incubation at 37.degree. C. on minimal agar, to which 2 g/L glucose
and 1 g/L .beta.-hydroxyaspartic acid are added, spontaneous
mutants are isolated. A selected .beta.-hydroxyaspartic
acid-resistant individual colony is then incubated on minimal agar,
which comprises 2 g/L glucose and 0.2 g/L O-methylthreonine, at
37.degree. C. After this step, a mutant called FE6-1 is resistant
to L-valines, .alpha.-ketoisovaleric acid, .beta.-hydroxyaspartic
acid and O-methylthreonine. A pure culture of the strain FE6-1 was
deposited on 8 Sep. 2000 as DSM13721 at the Deutsche Sammlung fur
Mikroorganismen und Zellkulturen (DSMZ=German Collection of
Microorganisms and Cell Cultures, Braunschweig, Germany).
[0110] The plasmids pTrc99A and pTrc99AcysK are transformed
individually into the strain FE6-1 and plasmid-carrying cells are
selected on LB agar, to which 50 .mu.g/ml ampicillin are added. The
strains obtained are called FE6-1/pTrc99A and FE6-1pTrc99AcysK.
Example 3
Preparation of D-Pantothenic Acid with Strains Derived From
FE6-1
[0111] The pantothenate production of the E. coli strains
FE6-1/pTrc99A and FE6-1/pTrc99AcysK is checked in batch cultures of
10 ml contained in 100 ml conical flasks. For this, 10 ml of
preculture medium of the following composition: 2 g/l yeast
extract, 10 g/l (NH.sub.4).sub.2SO.sub.4, 1 g/l KH.sub.2PO.sub.4,
0,5 g/l MgSO.sub.4*7H.sub.2O, 15 g/l CaCO.sub.3, 20 g/l glucose, 50
mg/l ampicillin are inoculated with an individual colony and
incubated for 20 hours at 33.degree. C. and 200 rpm on an ESR
incubator from Kuhner AG (Birsfelden, Switzerland). In each case
200 .mu.l of this preculture are transinoculated into 10 ml of
production medium (25 g/l (NH.sub.4).sub.2SO.sub.4, 2 g/l
KH.sub.2PO.sub.4, 1 g/l MgSO.sub.4*7H.sub.2O, 0.03 g/l. glucose, 50
mg/l ampicillin are inoculated with an individual colony and
incubated for 20 hours at 33.degree. C. and 200 rpm on an ESR
incubator from Kuhner AG (Birsfelden, Switzerland). In each case
200 .mu.l of this preculture are transinoculated into 10 ml of
production medium (25 g/l (NH.sub.4).sub.2SO.sub.4, 2 g/l
KH.sub.2PO.sub.41 g/l MgSO.sub.4*7H.sub.2O, 0.03 g/l
FeSO.sub.4*7H.sub.2O, 0.018 g/l MnSO.sub.4*1H.sub.2O, 30 g/l
CaCO.sub.3, 20 g/l glucose, 20 g/l .beta.-alanine, 250 mg/l
thiamine) and the batch is incubated for 48 hours at 37.degree. C.
After the incubation the optical density (OD) of the culture
suspension is determined with an LP2W photometer from Dr. Lange
(Dusseldorf, Germany) at a measurement wavelength of 660 nm.
[0112] The concentration of the D-pantothenate formed is then
determined in the culture supernatant centrifuged off by means of
High Performance Liquid Chromatography [column: Reversed Phase
MZ-Aqua Perfect (diameter 4,6 mm), mobile Phase 25 mM acetate
buffer with 10% methanol, flow rate 1 ml/min, RI detector].
[0113] The result of the experiment is shown in Table 1.
2 TABLE 1 OD Pantothenate Strain (660 nm) mg/l FE6-1/pTrc99A 8.7 47
FE6- 8.35 55 1/pTrc99AcysK
[0114] The publications cited in the Detailed Description of the
Invention and the Examples above are incorporated herein by
reference.
[0115] Obviously, numerous modifications and variations of the
present invention are possible in light of the above teachings. It
is therefore to be understood that within the scope of the appended
claims, the invention may be practiced otherwise than as
specifically described herein.
[0116] This application is based on German Patent Application
Serial No. 101 28 780.1, filed on Jun. 13, 2001, and incorporated
herein by reference.
Sequence CWU 1
1
2 1 21 DNA ARTIFICIAL SEQUENCE SYNTHETIC DNA 1 cagttaagga
caggccatga g 21 2 22 DNA ARTIFICIAL SEQUENCE SYNTHETIC DNA 2
gctggcatta ctgttgcaat tc 22
* * * * *