U.S. patent application number 10/773905 was filed with the patent office on 2004-12-23 for detection of fusarium species infecting corn using the polymerase chain reaction.
This patent application is currently assigned to Syngenta participations AG. Invention is credited to Barnett, Charles Jason, Beck, James Joseph.
Application Number | 20040259121 10/773905 |
Document ID | / |
Family ID | 25504945 |
Filed Date | 2004-12-23 |
United States Patent
Application |
20040259121 |
Kind Code |
A1 |
Beck, James Joseph ; et
al. |
December 23, 2004 |
Detection of fusarium species infecting corn using the polymerase
chain reaction
Abstract
The present invention relates to the use of primers in
polymerase chain reaction assays for the detection of a Fusarium
proliferatum, F. verticillioides and F subglutinans. Specific
primers are identified as being useful for the identification of
fungal isolates using PCR based techniques.
Inventors: |
Beck, James Joseph;
(Research Triangle Park, NC) ; Barnett, Charles
Jason; (Research Triangle Park, NC) |
Correspondence
Address: |
SYNGENTA BIOTECHNOLOGY, INC.
PATENT DEPARTMENT
3054 CORNWALLIS ROAD
P.O. BOX 12257
RESEARCH TRIANGLE PARK
NC
27709-2257
US
|
Assignee: |
Syngenta participations AG
|
Family ID: |
25504945 |
Appl. No.: |
10/773905 |
Filed: |
February 6, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10773905 |
Feb 6, 2004 |
|
|
|
09961755 |
Sep 24, 2001 |
|
|
|
Current U.S.
Class: |
435/6.12 |
Current CPC
Class: |
C12Q 1/6895 20130101;
C12Q 1/686 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Claims
1-6. (canceled)
7. A method for the detection of a fungal pathogen, comprising the
steps of: (a) isolating DNA from a plant leaf infected with a
pathogen; (b) subjecting said DNA to polymerase chain reaction
amplification using a pair of primers wherein each primer has
sequence identity with at least 10 contiguous nucleotides of a
mitochondrial small subunit rDNA gene from from Fusarium
subglutinans and wherein at least one primer comprises the
nucleotide sequence of SEQ ID NOS:13, 15 or 16; and (c) detecting
said fungal pathogen by visualizing the product or products of said
polymerase chain reaction amplification.
8-12. (canceled)
13. The method of claim 7, wherein the primers comprise: SEQ ID
NO:15 and SEQ ID NO:16.
14-16. (canceled)
17. A diagnostic kit used in detecting Fusarium subglutinans
comprising at least one primer having the nucleotide sequence of
SEQ ID NO: 13, 15 or 16.
18. A diagnostic kit used in detecting Fusarium proliferatum a
fungal comprising a pair of primers of: SEQ ID NO:15 and SEQ ID
NO:16.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to the use of primers in
polymerase chain reaction assays for the detection of maize
Fusarium ear rot pathogens Fusarium subglutinans, F. proliferatum,
and F. verticillioides (syn. F. moniliforme). The use of these
primers enables the detection of specific isolates of fungal
pathogens and the monitoring of disease development in plant
populations.
BACKGROUND OF THE INVENTION
[0002] Diseases in plants cause considerable crop loss from year to
year resulting both in economic deprivation to farmers and, in many
parts of the world, to shortfalls in the nutritional provision for
local populations. The widespread use of fungicides has provided
considerable security against plant pathogen attack; however,
despite $1 billion worth of expenditure on fungicides, worldwide
crop losses amounted to approximately 10% of crop value in 1981
(James, 1981, Seed Sci. & Technol. 9: 679-685).
[0003] The severity of the destructive process of disease depends
on the aggressiveness of the pathogen and the response of the host.
One aim of most plant breeding programs is to increase the
resistance of host plants to disease. Typically, different races of
pathogens interact with different varieties of the same crop
species differentially, and many sources of host resistance only
protect against specific pathogen races. Furthermore, some pathogen
races show early signs of disease symptoms, but cause little damage
to the crop. Jones and Clifford (1983, Cereal Diseases, John Wiley)
report that virulent forms of the pathogen are expected to emerge
in the pathogen population in response to the introduction of
resistance into host cultivars and that it is therefore necessary
to monitor pathogen populations. In addition, there are several
documented cases of the evolution of fungal strains that are
resistant to particular fungicides. As early as 1981, Fletcher and
Wolfe (1981, Proc. 1981 Brit. Crop Prot. Conf.) contended that 24%
of the powdery mildew populations from spring barley and 53% from
winter barley showed considerable variation in response to the
fungicide triadimenol and that the distribution of these
populations varied between varieties, with the most susceptible
variety also giving the highest incidence of less susceptible
types. Similar variation in the sensitivity of fungi to fungicides
has been documented for wheat mildew (also to triadimenol),
Botrytis (to benomyl), Pyrenophora (to organomercury),
Pseudocercosporella (to MBC-type fungicides) and Mycosphaerella
fijiensis to triazoles to mention just a few (Jones and Clifford,
Cereal Diseases, John Wiley, 1983).
[0004] Maize Fusarium ear rots are caused by Fusarium
verticillioides, F. proliferatum, and F. subglutinans. The
importance of the disease is derived from the production of the
mycotoxin fumonisin by the causal organisms (Compendium of Corn
Diseases, 3.sup.rd ed., D. White Ed., APS Press, 1999).
Contaminated grain can cause serious problems for the maize feed
and food industries (Munkvold and Desjardins, 1997, Plant Disease
81(6):556-565). Fumonisins inhibit the biosynthesis of
sphingolipids, changing the sphingolipid composition of a number of
target tissues, and can cause a variety of diseases in animals that
eat contaminated feeds (Munkvold and Desjardins, 1997). Consumption
of maize contaminated with high levels of fumonisins has been
epidemiologically associated with high levels of esophageal cancer
in human populations in parts of the world where maize is a staple
food (Munkvold and Desjardins, 1997). This situation is further
complicated by the common occurrence of fumonisins in symptomless
infected kernels (Desjardins and Plattner, 1998, Plant Disease
82(8):953-958). Though Fusarium ear rots typically do not
significantly affect yield, they do introduce mycotoxins to the
grain, leading to the loss of grain and seed quality.
[0005] In view of the above, there is a real need for the
development of technology that will allow the identification of
specific races of pathogen fungi early in the infection process. By
identifying the specific race of a pathogen before disease symptoms
become evident in the crop stand, the agriculturist can assess the
likely effects of further development of the pathogen in the crop
variety in which it has been identified and can choose an
appropriate fungicide if such application is deemed necessary.
SUMMARY OF THE INVENTION
[0006] The present invention is drawn to methods of identification
of different pathotypes of plant pathogenic fungi. The invention
provides primers derived from either the mitochondrial Small
Subunit Ribosomal DNA sequences or Internal Transcribed Spacer
(ITS) sequences of the nuclear ribosomal RNA gene (rDNA) of
different fungal pathotypes. These primers generate unique
fragments in PCR reactions in which the DNA template is provided by
specific fungal pathotypes and can thus be used to identify the
presence or absence of specific pathotypes in host plant material
before the onset of disease symptoms.
[0007] In a preferred embodiment, the invention provides diagnostic
primers from Mitochondrial Small Subunit (SSU) rDNA or the Internal
Transcribed Spacer (ITS) sequences of the nuclear ribosomal RNA
gene for the detection of Fusarium subglutinans, F. proliferatum,
and F. verticillioides.
[0008] This invention provides the possibility of assessing
potential damage in a specific crop variety-pathogen strain
relationship and of utilizing judiciously the diverse armory of
fungicides that is available. Furthermore, the invention can be
used to provide detailed information on the development and spread
of specific pathogen races over extended geographical areas. The
invention provides a method of detection that is especially
suitable for diseases with a long latent phase.
[0009] Kits useful in the practice of the invention are also
provided. The kits find particular use in the identification of
Fusarium subglutinans, F. proliferatum, and F. verticillioides.
BRIEF DESCRIPTION OF THE SEQUENCES IN THE SEQUENCE LISTING
[0010] SEQ ID NO:1 Fusarium verticillioides (syn. F. moniliforme)
small subunit ribosomal RNA, mitochondrial gene encoding
mitochondrial RNA, partial sequence. GenBank Accession Number
U34497.
[0011] SEQ ID NO:2 Fusarium proliferatum NRRL 22944 small subunit
ribosomal RNA, mitochondrial gene encoding mitochondrial RNA,
partial sequence. GenBank Accession Number U34500.
[0012] SEQ ID NO:3 Gibberella zeae (syn. Fusarium graminearum)
small subunit ribosomal RNA, mitochondrial gene encoding
mitochondrial RNA, partial sequence. GenBank Accession Number
U34520.
[0013] SEQ ID NO:4 Fusarium subglutinans small subunit ribosomal
RNA, mitochondrial gene encoding mitochondrial RNA, partial
sequence. GenBank Accession Number U34501.
[0014] SEQ ID NO:5 Fusarium subglutinans internal transcribed
spacer RNA. GenBank Accession Number U34559.
[0015] SEQ ID NO:6 Gibberella zeae NRRL 5883 internal transcribed
spacer RNA. GenBank Accession Number U34578.
[0016] SEQ ID NO:7 Fusarium proliferatum NRRL 22944 internal
transcribed spacer RNA. GenBank Accession Number U34558.
[0017] SEQ ID NO:8 Fusarium verticillioides (syn. F. moniliforme)
internal transcribed spacer RNA. GenBank Accession Number
U34555.
[0018] SEQ ID NO:9 Oligonucleotide Primer ITS1
[0019] SEQ ID NO: 10 Oligonucleotide Primer ITS2
[0020] SEQ ID NO: 11 Oligonucleotide Primer ITS3
[0021] SEQ ID NO: 12 Oligonucleotide Primer ITS4
[0022] SEQ ID NO: 13 Oligonucleotide Primer FCORN1
[0023] SEQ ID NO: 14 Oligonucleotide Primer FCORN2
[0024] SEQ ID NO: 15 Oligonucleotide Primer FSUB1
[0025] SEQ ID NO: 16 Oligonucleotide Primer FSUB2
[0026] SEQ ID NO: 17 Oligonucleotide Primer FSUB3
[0027] SEQ ID NO: 18 Oligonucleotide Primer FVERT1
[0028] SEQ ID NO: 19 Oligonucleotide Primer FVERT2
[0029] SEQ ID NO:20 Oligonucleotide Primer FPRO1
[0030] SEQ ID NO:21 Oligonucleotide Primer FPRO2
[0031] SEQ ID NO:22 Oligonucleotide Primer FPRO3
[0032] SEQ ID NO:23 Oligonucleotide Primer MS1
[0033] SEQ ID NO:24 Oligonucleotide Primer MS2
DETAILED DESCRIPTION OF THE INVENTION
[0034] The present invention provides unique DNA sequences that are
useful in identifying different pathotypes of plant pathogenic
fungi. Particularly, the DNA sequences can be used as primers in
PCR-based analysis for the identification of fungal pathotypes. The
DNA sequences of the invention include primers derived from partial
sequences of the mitochondrial small subunit ribosomal RNA genes
(SSU rDNA) or the Internal Transcribed Spacer (ITS) sequences of
the nuclear ribosomal RNA gene regions of particular fungal
pathogens that are capable of identifying the particular
pathogen.
[0035] Biomedical researchers have used PCR-based techniques for
some time and with moderate success to detect pathogens in infected
animal tissues. Only recently, however, has this technique been
applied to detect plant pathogens. The presence of Gaumannomyces
graminis in infected wheat has been detected using PCR of sequences
specific to the pathogen mitochondrial genome (Schlesser et al.,
1991, Applied and Environ. Microbiol. 57: 553-556), and random
amplified polymorphic DNA (i.e. RAPD) markers were able to
distinguish numerous races of Gremmeniella abietina, the causal
agent of scleroderris canker in conifers. U.S. Pat. No. 5,585,238
(herein incorporated by reference in its entirety) describes
primers derived from the ITS sequences of the ribosomal RNA gene
region of strains of Septoria, Pseudocercosporella, and
Mycosphaerella and their use in the identification of these fungal
isolates using PCR-based techniques. In addition, U.S. Pat. No.
5,955,274 (herein incorporated by reference in its entirety)
describes primers derived from the ITS sequences of the ribosomal
RNA gene region of strains of Fusarium and their use in the
identification of these fungal isolates using PCR-based techniques.
Furthermore, U.S. Pat. No. 5,800,997 (herein incorporated by
reference in its entirety) describes primers derived from the ITS
sequences of the ribosomal RNA gene region of strains of
Cercospora, Helminthosporium, Kabatiella, and Puccinia and their
use in the identification of these fungal isolates using PCR-based
techniques.
[0036] Ribosomal genes are suitable for use as molecular probe
targets because of their high copy number. Despite the high
conservation between mature rRNA sequences, the non-transcribed and
transcribed spacer sequences are usually poorly conserved and are
thus suitable as target sequences for the detection of recent
evolutionary divergence. Fungal rRNA genes are organized in units,
each of which encodes three mature subunits of 18S (small subunit),
5.8S, and 28S (large subunit). These subunits are separated by two
Internal Transcribed Spacers, ITS1 and ITS2, of around 300 bp
(White et al., 1990, in PCR Protocols, Innes et al., Eds., pages
315-322). In addition, the transcriptional units are separated by
non-transcribed spacer sequences (NTSs). ITS and NTS sequences are
particularly suitable for the detection of specific pathotypes of
different fungal pathogens.
[0037] Mitochondrial small subunit rDNA sequences similarly evolve
more quickly than nuclear small subunit rDNA sequences and are thus
more useful in differentiating more closely related species. As
with the more quickly evolving ITS region sequences the
mitochondrial small subunit rDNA sequences are composed of regions
of higher and lesser variability which allow the use of conserved
primers such as MS1 and MS2 described by White et al. (1990, in PCR
Protocols, Innes et al., Eds., pages 315-322) to amplify out
regions that contain more variability.
[0038] The DNA sequences of the invention are from partial
sequences of the mitochondrial small subunit ribosomal RNA genes
(SSU rDNA) or the Internal Transcribed Spacer sequences of the
ribosomal RNA gene region of different plant pathogens. The
mitrochondrial SSU rDNA and nuclear ITS region DNA sequences from
different pathotypes within a pathogen species or genus vary among
the different members of the species or genus. Once the sequences
of either of these regions has been determined for a given
pathogen, these sequences can be aligned with other respective
sequences from the same region for other pathogens. In this manner,
primers can be derived from the mitrochondrial SSU rDNA or nuclear
ITS region sequences that are specific for a given pathogen. That
is, primers can be designed based on regions within either the
mitrochondrial SSU or nuclear ITS region sequences that contain the
greatest differences in sequence among the fungal pathotypes when
similar regions are compared. These sequences and primers based on
these sequences can be used to identify specific pathogens.
[0039] The present invention provides oligonucleotide primers for
use in amplification-based detection of a fungal Internal
Transcribed Spacer DNA sequence, wherein said primer has sequence
identity with at least 10 contiguous nucleotides of the Internal
Transcribed Spacer sequence from Fusarium spp., such as but not
limited to F. subglutinans, F. proliferatum, or F. verticillioides.
In a preferred embodiment, the fungal specis is Fusarium
proliferatum. In other preferred embodiments, the ITS comprises the
nucleotides sequence of SEQ ID NO:5, 6, 7 or 8, more preferably,
SEQ ID NO:7.
[0040] In preferred embodiments, oligonucleotide primers derived
from ITS sequences comprises or consists of a nucleotide sequence
of SEQ ID NOs: 9-12, 21 or 22. The primers are useful in the
PCR-based identification of Fusarium proliferatum.
[0041] The present invention also provides oligonucleotide primers
for use in amplification-based detection of a fungal mitochondrial
small subunit rDNA sequence, wherein said primer has sequence
identity with at least 10 contiguous nucleotides of the
mitochondrial small subunit ribosomal DNA sequence from Fusarium
spp., in particular but not limited to, F. subglutinans, F.
verticillioides, or F. proliferatum. More particularly, the mtSSU
rDNA comprises the nucleotides sequence of SEQ ID NOs: 1-4.
[0042] In preferred embodiments, oligonucleotide primers derived
from mitochondrial SSU rDNA comprise a nucleotide sequence of SEQ
ID NOs: 13-20, 23, or 24. The primers are useful in the PCR-based
identification of the Fusarium spp. pathogens of interest. In
particular, the Fusarium spp. include, but are not limited to, F.
subglutinans or F. verticillioides (syn. F. moniliforme). The
present invention also provides for pairs of oligonucleotide
primers. In one embodiment, a pair of oligonucleotide primers for
use in the amplification-based detection of a fungal Internal
Transcribed Spacer DNA sequence, wherein at least one of said
primers is the oligonucleotide primer has sequence identity with at
least 10 contiguous nucleotides of the Internal Transcribed Spacer
sequence from Fusarium spp. such as but not limited to SEQ ID NO:
5, 6, 7 or 8. In another embodiment, the invention provides a pair
of oligonucleotide primers, wherein at least one of said primers is
the oligonucleotide primer of with at least 10 contiguous
nucleotides of the Internal Transcribed Spacer sequence from a
Fusarium proliferatum, such as but not limited to SEQ ID NO:7.
[0043] In a preferred embodiment, the invention provides a pair of
oligonucleotide primers wherein at least one primer consists of the
nucleotide sequence of SEQ ID NOS:9-12, 21 or 22. Preferred pairs
of primers are: ITS1 (SEQ ID NO:9) and FPRO2 (SEQ ID NO:21); ITS1
(SEQ ID NO:9) and FPRO3 (SEQ ID NO:22); ITS3 (SEQ ID NO: 11) and
FPRO2 (SEQ ID NO:21); and ITS3 (SEQ ID NO:I 1) and FPRO3 (SEQ ID
NO:22).
[0044] In another embodiment, a pair of oligonucleotide primers for
use in the amplification-based detection of a fungal mitochondrial
small subunit ribosomal DNA sequence, wherein at least one of said
primers is the oligonucleotide primer has sequence identity with at
least 10 contiguous nucleotides of the mitochondrial small subunit
ribosomal DNA sequence from Fusarium spp., such as but not limited
to SEQ ID NOS: 14. In another embodiment, the invention provides a
pair of oligonucleotide primers, wherein at least one of said
primers is the oligonucleotide primer of with at least 10
contiguous nucleotides of the mitochondrial small subunit ribosomal
DNA sequence from a Fusarium spp., such as but not limited to SEQ
ID NOS:1-4. In particular, the Fusarium spp. are but are not
limited to, Fusarium subglutinans, Fusarium proliferatum and/or
Fusarium verticillioides (syn. F. moniliforme).
[0045] In a preferred embodiment, the a pair of oligonucleotide
primers wherein one primer consists of a mitochondrial small
subunit ribosomal DNA derived oligonucleotide primer of SEQ ID NOS:
13-20, 23, or 24.
[0046] In other more preferred embodiments, the invention provides
pairs of oligonucleotide primers wherein said pair consists of SEQ
ID NO: 15 and SEQ ID NO: 16; wherein said pair consists of SEQ ID
NO: 13 and SEQ ID NO: 16; wherein said pair consists of SEQ ID NO:
14 and SEQ ID NO: 18; wherein said pair consists of SEQ ID NO: 14
and SEQ ID NO: 19; or wherein said pair consists of SEQ ID NO: 14
and SEQ ID NO:20.
[0047] Methods for the use of the primer sequences of the invention
in PCR analysis are well known in the art. For example, see U.S.
Pat. Nos. 4,683,195 and 4,683,202, as well as Schlesser et al.
(1991) Applied and Environ. Microbiol. 57:553-556. See also, Nazar
et al. (1991, Physiol. and Molec. Plant Pathol. 39:1 -11), which
used PCR amplification to exploit differences in the ITS regions of
Verticillium albo-atrum and Verticillium dahliae and therefore
distinguish between the two species; and Johanson and Jeger (1993,
Mycol. Res. 97: 670-674), who used similar techniques to
distinguish the banana pathogens Mycosphaerella fjiensis and
Mycosphaerella musicola.
[0048] The target DNA sequences of the invention can be cloned from
fungal pathogens by methods known in the art. In general, the
methods for the isolation of DNA from fungal isolates are known.
See, Raeder & Broda (1985) Letters in Applied Microbiology
2:17-20; Lee et al. (1990) Fungal Genetics Newsletter 35:23-24; and
Lee and Taylor (1990) In: PCR Protocols: A Guide to Methods and
Applications, Innes et al. (Eds.); pages 282-287.
[0049] The published mitochondrial SSU rDNA or ITS rDNA sequences
are compared within each pathogen group to locate divergences that
might be useful to test in PCR to distinguish the different species
and/or strains. From the identification of divergences, numerous
primers are synthesized and tested in PCR-amplification. Templates
used for PCR-amplification testing are firstly purified pathogen
DNA, and subsequently DNA isolated from infected host plant tissue.
Thus, it is possible to identify pairs of primers that are
diagnostic, i.e. that identified one particular pathogen species or
strain but not another species or strain of the same pathogen.
Primers are also designed to regions highly conserved among the
species to develop genus-specific primers as well as primers that
will identify any of several fungal pathogens that cause a
particular disease. For example, primers are developed to
differentiate species of Fusarium: F. proliferatum, F.
verticillioides, and F. subglutinans.
[0050] Preferred primer combinations are able to distinguish
between the different species or strains in infected host tissue,
i.e. host tissue that has previously been infected with a specific
pathogen species or strain. This invention provides numerous primer
combinations that distinguish Fusarium proliferatum, F.
verticillioides, and F. subglutinans. The primers of the invention
are designed based on sequence differences among either the
mitochondrial SSU rDNA or the ITS rDNA regions. A minimum of one
base pair difference between sequences can permit design of a
discriminatory primer. Primers designed to a specific fungal DNA
sequence can be used in combination with a primer made to a
conserved sequence region flanking the region containing
divergences to amplify species-specific PCR fragments. In general,
primers should have a theoretical melting temperature between about
60 to about 70 degree .degree. C. to achieve good sensitivity and
should be void of significant secondary structure and 3' overlaps
between primer combinations. In preferred embodiments, primers are
anywhere from approximately 5-30 nucleotide bases long.
[0051] In one embodiment, the present invention provides a method
for the detection of a fungal pathogen, comprising the steps
of:
[0052] (a) isolating DNA from a plant tissue infected with a
pathogen;
[0053] (b) subjecting said DNA to polymerase chain reaction
amplification using at least one primer having sequence identity
with at least 10 contiguous nucleotides of an Internal Transcribed
Spacer sequence of a Fusarium spp.; and
[0054] (c) detecting said fungal pathogen by visualizing the
product or products of said polymerase chain reaction
amplification.
[0055] In preferred embodiments, the method detects infections with
a pathogen, wherein said fungal pathogen Fusarium subglutinans,
Fusarium proliferatum or Fusarium verticillioides. In another
preferred embodiment, the ITS sequences have the nucleotide
sequence of SEQ ID NO:5, 6, 7, or 8.
[0056] In another preferred embodiment, the method uses at least
one primer having the nucleotide sequence of SEQ ID NOS: 9-12, 20
or 21. In another embodiment, the present invention provides for a
method for the detection of a fungal pathogen, comprising the steps
of:
[0057] (a) isolating DNA from a plant tissue infected with a
pathogen;
[0058] (b) subjecting said DNA to polymerase chain reaction
amplification using at least one primer having sequence identity
with at least 10 contiguous nucleotides of a mitochondrial small
subunit rDNA sequence of a Fusarium spp. ; and
[0059] (c) detecting said fungal pathogen by visualizing the
product or products of said polymerase chain reaction
amplification.
[0060] In preferred embodiments, the method detects the fungal
pathogens of Fusarium subglutinans, Fusarium proliferatum or
Fusarium verticillioides.
[0061] In another preferred embodiment, the method uses at least
one primer having the nucleotide sequence of SEQ ID NOS: 13-20, 23
or 24.
[0062] In more preferred embodiments, the methods uses a pairs of
oligonucleotide primers wherein said pair consists of SEQ ID NO: 15
and SEQ ID NO: 16; wherein said pair consists of SEQ ID NO:13 and
SEQ ID NO:16; wherein said pair consists of SEQ ID NO:14 and SEQ ID
NO:18; wherein said pair consists of SEQ ID NO:14 and SEQ ID NO:19;
or wherein said pair consists of SEQ ID NO:14 and SEQ ID NO:20.
[0063] The present invention lends itself readily to the
preparation of "kits" containing the elements necessary to carry
out the process. Such a kit may comprise a carrier being
compartmentalized to receive in close confinement therein one or
more container, such as tubes or vials. One of the containers may
contain unlabeled or detectably labeled DNA primers. The labeled
DNA primers may be present in lyophilized form or in an appropriate
buffer as necessary. One or more containers may contain one or more
enzymes or reagents to be utilized in PCR reactions. These enzymes
may be present by themselves or in admixtures, in lyophilized form
or in appropriate buffers.
[0064] In one embodiment, the diagnostic kit used in detecting a
fungal pathogen, comprises at least one primer of SEQ ID NOs: 9-12,
21 or 22 for ITS derived primers or SEQ ID NOs: 13-20, 23, or 24
for primers derived from mitochondrial small subunit ribosomal
DNA.
[0065] In more preferred embodiments, the diagnostic kit used in
detecting a fungal pathogen, comprises the pair of primers
described above. More preferably, the pairs of primers are SEQ ID
NO: 15 and SEQ ID NO: 16; SEQ ID NO: 13 and SEQ ID NO: 16; SEQ ID
NO: 14 and SEQ ID NO: 18; SEQ ID NO: 14 and SEQ ID NO: 19; or SEQ
ID NO: 14 and SEQ ID NO:20.
[0066] Finally, the kit may contain all of the additional elements
necessary to carry out the technique of the invention, such as
buffers, extraction reagents, enzymes, pipettes, plates, nucleic
acids, nucleoside triphosphates, filter paper, gel materials,
transfer materials, autoradiography supplies, and the like.
[0067] The examples below show typical experimental protocols that
can be used in the selection of suitable primer sequences, the
testing of primers for selective and diagnostic efficacy, and the
use of such primers for disease and fungal isolate detection. Such
examples are provided by way of illustration and not by way of
limitation.
[0068] Numerous references cited above are all incorporated herein
in their entireties.
EXAMPLES
[0069] Standard recombinant DNA and molecular cloning techniques
used here are well known in the art and are described by J.
Sambrook, E. F. Fritsch and T. Maniatis, Molecular Cloning: A
Laboratory manual, Cold Spring Harbor laboratory, Cold Spring
Harbor, N.Y. (1989) and by T. J. Silhavy, M. L. Berman, and L. W.
Enquist, Experiments with Gene Fusions, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. (1984) and by Ausubel, F. M.
et al., Current Protocols in Molecular Biology, pub. by Greene
Publishing Assoc. and Wiley-Interscience (1987).
Example 1
Fungal Isolates and Genomic Fungal DNA Extraction
[0070] See Tables 1 and 2 for listings of the fungal isolates used
and their sources. Isolates used to validate the assays in the
following examples were obtained from a number of academic
institutions and collections (Table 1).
1TABLE 1 Source of Test Isolates Isolate Source Isolation
Geographic Origin Fusarium moniliforme M-1231 Penn State.sup.1 Rice
Philippines Fusarium moniliforme M-1264 Penn State.sup.1 Rice
Sierra Leone Fusarium moniliforme M-1329 Penn State.sup.1 Rice
California, USA Fusarium moniliforme M-3120 Penn State.sup.1 Maize
California, USA Fusarium moniliforme M-3125 Penn State.sup.1 Maize
California, USA Fusarium sporotrichioides 3299 NRRL.sup.2 Fusarium
subglutinans M-3693 Penn State.sup.1 Maize Iowa, USA Fusarium
subglutinans M-3696 Penn State.sup.1 Maize Iowa, USA Fusarium
moniliforme M-3744 Penn State.sup.1 Rice Australia Fusarium
moniliforme M-5167 Penn State.sup.1 Rice Iran Fusarium moniliforme
M-5587 Penn State.sup.1 Date Palm Iraq Fusarium moniliforme M-5605
Penn State.sup.1 Poland Fusarium proliferatum M-5991 Penn
State.sup.1 Swine Feed Iowa, USA Fusarium moniliforme M-6173 Penn
State.sup.1 Rice Malaysia Fusarium sambucinum- R-6380 Penn
State.sup.1 Potato Germany sulphureum Fusarium moniliforme M-6471
Penn State.sup.1 Maize Kansas Fusarium moniliforme M-8510 Penn
State.sup.1 Rice Nepal Fusarium moniliforme 6396 NRRL.sup.2 Chicken
Arkansas, USA Feed Fusarium moniliforme 13563 NRRL.sup.2 Pinus
taeda North Carolina, USA Fusarium moniliforme 25029 NRRL.sup.2
Nilaparvata India lugens Fusarium subglutinans 13588 NRRL.sup.2
Maize Iowa, USA Fusarium subglutinans 13599 NRRL.sup.2 Maize Zambia
Fusarium subglutinans 20844 NRRL.sup.2 Maize Germany Fusarium
proliferatum 94-041 Iowa State.sup.3 Maize Iowa Fusarium
proliferatum 94-066 Iowa State.sup.3 Maize Iowa Fusarium
proliferatum 94-129 Iowa State.sup.3 Maize Iowa Fusarium
proliferatum 95-122 Iowa State.sup.3 Maize Iowa Fusarium
proliferatum 95-135 Iowa State.sup.3 Maize Iowa Fusarium
proliferatum 95-289 Iowa State.sup.3 Maize Iowa Fusarium culmorum
R-5126 Penn State.sup.1 Minnesota, USA Fusarium graminearum R-8637
Penn State.sup.1 Settat, Morocco Microdochium nivale 15N1 S.
Edwards.sup.4 United Kingdom M. nivale var. majus 93 Novartis,
Basel.sup.5 -- Fusarium poae T-427 Penn State.sup.1 Pennsylvannia,
USA Fusarium avenaceum 64452 ATCC.sup.6 Wheat Poland Diplodia
maydis 5139 C. Naidoo.sup.7 Illinois, USA Macrophomina phaseolina
MP97 J. Mihail.sup.8 Missouri, USA Aspergillus flavus 3557 NRRL
Collection.sup.2 Kabatiella zeae 18594 ATCC.sup.6 Maize Wisconsin,
USA Cercospora zeae-maydis 69281L C. Naidoo.sup.7 Illinois, USA
Cercospora zeae-maydis 26158 ATCC.sup.6 Maize New York, USA
Puccinia sorghi VA Helminthosporium maydis 24772 ATCC.sup.6 Maize
North Carolina, USA Helminthosporium maydis 11534 ATCC.sup.6 Maize
Maryland, USA Helminthosporium 16185 ATCC.sup.6 Maize Virginia, USA
carbonum Helminthosporium 24962 ATCC.sup.6 Maize Illinois, USA
carbonum Helminthosporium turcicum 26306 ATCC.sup.6 Maize Illinois,
USA Fusarium culmorum 62215 ATCC.sup.6 Wheat seed Switzerland
Fusarium culmorum R-5106 Darling Downs, Australia .sup.1Fusarium
Research Center; Pennsylvania State University; University Park,
PA, USA .sup.2USDA Agricultural Research Service Culture Collection
(NRRL); Peoria, IL, USA .sup.3Dept. of Plant Pathology; Iowa State
University; Ames, IA, USA .sup.4Dr. Simon Edwards; Harper Adams
University College; Newport, United Kingdom .sup.5Novartis Crop
Protection Limited; Basel, Switzerland .sup.6American Type Culture
Collection; Rockville, MD, USA .sup.7Dr. Charmaine Naidoo, Ciba
Seeds Research, Bloomington, IL, USA .sup.8Dr. Jeanne Mihail,
University of Missouri, Columbia, MO, USA
[0071] Unknown ear rot isolates cultured from field grown maize
were obtained from the Novartis Seeds research station in Stanton,
Minn., USA and are described in Table 2. Fungi are grown on PDA
(Potato Dextrose Agar) plates. Cultures are incubated for up to 10
days at 28.degree. C. Mycelia are ground in liquid nitrogen, and
total genomic DNA is extracted using the protocol of Lee and Taylor
(1990; In: PCR Protocols: A Guide to Methods and Applications;
Eds.: Innes et al.; pages 282-287).
2TABLE 2 Geographical Source of Unknown Ear Rot Isolates Isolate
Geographical Designation Region Fm001 Nebraska Fm002 Georgia Fm003
Iowa Fm004 Ohio Fm005 Illinois Fm006 Illinois Fm007 Illinois Fm008
Illinois Fm009 Ohio Fm010 Ohio Fm011 Fm012 Ohio Fm013 Kentucky
Fm014 Illinois Fm034 Kentucky Fm035 Illinois Fm036 Fm037 Fm039
Hawaii Fm040 Hawaii Fm041 North Carolina Fm042 North Carolina Fm043
Colorado Fm044 Mississippi Fm045 Hawaii Fm046 Hawaii Fm047 Hawaii
Fm048 Hawaii Fm049 Hawaii Fm050 Hawaii Fm051 Hawaii Fm052 Hawaii
Fm053 Hawaii Fm054 Hawaii Fm055 Hawaii Fm056 Hawaii Fsub1 Minnesota
Fsub2 Minnesota Fsub3 Minnesota Fsub4 Minnesota BC3 189
Minnesota
Example 2
DNA Extraction from Maize Tissues
[0072] DNA is extracted from maize tissues by one of two methods.
The method described in Example 2A is used for bulk extractions of
maize leaves taken from some 10 -15 plants at either the ear, the
node above the ear, or the node below the ear. Example 2B describes
a method used for extracting DNA from maize tissues in 1.5 mL
tubes. This method may be used for concentrating the sample around
one lesion or for testing anther or axil material.
Example 2A
Large-Scale DNA Extraction from Maize Leaves
[0073] DNA is extracted from maize leaves in a bulk maceration as
follows:
[0074] (1) A sample consists of whole maize leaves collected from
some 20 plants from the same position on the plant (ear leaf, third
ear below leaf, etc.) and kept separated accordingly. The top third
of each leaf is taken and extracted in bulk.
[0075] (2) The sample is placed in a Bioreba (Reinach, Switzerland)
heavy duty plastic bag (cat#490100). The plant tissue is weighed,
plastic bag with leaves minus the tare (weight of the plastic
bag).
[0076] (3) An equal volume (ml) of CTAB Extraction Buffer (100 mM
Tris, pH 8.0; 1.4 M NaCl; 20 mM Na.sub.2-EDTA; 2%
Hexadecyltrimethyl ammonium bromide (CTAB); 2 % Polyvinylpyrolidine
(PVPP); 0.1% ascorbic acid; 0.2% .beta.-mercaptoethanol) is added
perweight (g) of maize tissue. The tissue is macerated using a
Bioreba Homex 6 homogenizer set at 70. The tissue is ground until
fibrous.
[0077] (4) The extraction juice is homogenized and is aliquoted
into eppendorf tubes on ice.
[0078] (a) The concentrated extract is boiled for 5 minutes.
[0079] (b) The boiled extract is placed on ice for two minutes. The
boiled extract 5 is then centrifuged for 5 minutes at
10,000.times.G.
[0080] (c) 1:40 dilutions of the supernatant from the microfuged
extract in cold dH.sub.20 are made and used as sample DNA template
in PCR assays.
[0081] (d) The diluted extracts are stored on ice until ready to
use.
[0082] For the purpose of showing that the assays do not
cross-react with maize tissue, a 1o sample of field-grown maize
visually assessed as healthy obtained from Franklin, Id., USA near
the end of June 1999 is used to test for background effects. DNA
preparations are made from the sample using the protocol outlined
in this example (The extract is designated 1999 Maize sample
#1).
Example 2B
Small-Scale DNA Extraction From Anther, Axil, and Husk Tissues
Collected from Field-Grown Maize.
[0083] Samples of Maize tissues consisting of anther, axil, or husk
material are received in eppendorf tubes. Sample sizes are limited
to occupying 1/5 volume of the 1.5 mL tube:
[0084] (1) Check/set the temperature of the dry bath is at
90.degree. C. Transport samples on Dry-ice to Sawz-all. Keep
samples on Dry-ice or at minus 80.degree. C. before and after
grinding.
[0085] (2) Place samples in box with lid to fit in a high velocity
shaking apparatus.
[0086] (3) Secure the box in the shaking apparatus with extra lid
and cardboard to ensure a tight fit. Grind for one minute. Remove
box. Rotate 180.degree. and grind for an additional 25 minute.
[0087] (4) Add 500 .mu.L of extraction buffer (100 mM Tris 8.0, 10
mM EDTA, 1% Sarkosyl)
[0088] (5) Vortex tubes
[0089] (6) Place tubes in a 90.degree. C. dry bath. Incubate
samples for 30 minutes.
[0090] (7) Remove tubes from bath and cool on ice >5
minutes.
[0091] (8) Centrifuge sample at 10,000 rpm for 5 minutes at room
temperature.
[0092] (9) 1 .mu.L of a 1:20 dilution of the supernatant serves as
template for PCR. Diluted samples should be stored at minus
20.degree. C. and kept on ice for all manipulations.
[0093] Maize tissue samples extracted by the above method and used
in the following Examples are listed in Table 3.
3TABLE 3 Maize Tissue Samples.sup.1 Sample Designation Tissue H-5
Husk H-9 Husk SBP-2 Husk associated with Sap Beetle .sup.1Samples
were collected in Mason County, Illinois, USA and received from Pat
Dowd, USDA-ARS, Peoria, IL
Example 3
Polymerase Chain Reaction (PCR) Amplification
[0094] Polymerase chain reactions are performed with the GeneAmp
Kit from Perkin-Elmer (Foster City, Calif.; part no. N808-0009)
using 50 mM KCl, 2.5 mM MgCl.sub.2, 10 mM Tris-HCl, pH8.3,
containing 200 .mu.M of each dTTP, DATP, dCTP, and dGTP in 25 .mu.L
reactions containing 25 pmol each primer, 1.25 units of Taq
polymerase and 10 ng of genomic DNA. Reactions are run for 30-40
cycles of 15 s at 94.degree. C., 15 s at 50.degree. C.-70.degree.
C., and 45 s at 72.degree. C. in a Perkin-Elmer Model 9600 or 9700
thermal cycler. The products are analyzed by loading 10 .mu.l of
each PCR sample on a 1.0% agarose gel and electrophoresing.
Example 4
Synthesis and Purification of Oligonucleotides Oligonucleotides
(Primers) are Synthesized by, for Example, either Integrated DNA
Technologies (Coralville, Iowa) or Midland Certified Reagent
Company (Midland, Tex.).
Example 5
Design of Species-Specific PCR Primers
[0095] Sequences are obtained from the GenBank database of the
National Center for Biotechnology Information
(www.ncbi.nlm.nih.gov) for partial sequence listings of small
subunit ribosomal RNA and mitochondrial gene for F. verticillioides
(SEQ ID NO: 1); F. proliferatum (SEQ ID NO:2); F. graminearum (syn.
Gibberella zeae) (SEQ ID NO:3); and F. subglutinans (SEQ ID NO:4).
A multiple sequence alignment is made of these sequences. The
alignment is analyzed for divergences among the four sequences. The
divergences permit the development of primers that will
specifically amplify one of the four target sequences in PCR
reactions. Oligonucleotide primers are designed to target regions
that contain the greatest differences in sequence among the species
analyzed (Table 4). FSUB1 (SEQ ID NO: 15), FSUB2 (SEQ ID NO: 16),
and FSUB3 (SEQ ID NO: 17) are designed to target the mitochondrial
small subunit (mtSSU) rDNA of Fusarium subglutinans. FPRO1 (SEQ ID
NO:20) is designed to target the mtSSU rDNA of Fusarium
proliferatum. The mtSSU rDNA of Fusarium verticillioides is the
target of primers FVERT1 (SEQ ID NO: 18) and FVERT2 (SEQ ID NO:
19). These primers may be used in combination with primers FCORN1
(SEQ ID NO: 13) and FCORN2 (SEQ ID NO: 14) that target mtSSU rDNA
conserved between the three targeted species of Fusarium.
[0096] Similarly, ITS region rDNA sequence listings for F.
subglutinans (SEQ ID NO:5), F. graminearum (syn. Gibberella zeae)
(SEQ ID NO:6), F. proliferatum (SEQ ID NO:7), and F.
verticillioides (syn. F. verticillioides) (SEQ ID NO:8) were
obtained. An alignment of ITS region sequences is used as above to
develop specific primers. In addition, the published ribosomal
gene-specific primers ITS1, ITS2, ITS3 and ITS4 (White et al.,
1990; In: PCR Protocols; Eds.: Innes et al. pages 315-322) are
synthesized for testing in combination with the primers specific
for the ITS regions. Primers FPRO2 and FPRO3 target the nuclear
rDNA ITS 2 region of Fusarium proliferatum. They may be used with
ITS1, the conserved fungal nuclear rDNA primer targeting the ITS1
region. The species-specific primers as well as the conserved
fungal ITS region primers are shown in Table 4.
4TABLE 4 Primers Designed for Detection of Fusarium Ear Rot
Pathogens Fusarium subglutinans, F. proliferatum, and F.
verticillioides Name Oligo Sequence (5'.fwdarw.3') Target
Identifier ITS1 TCCGTAGGTGAACCTGCGG Fungal Nuclear rDNA ITS region
SEQ-ID-NO:9 ITS2 GCTGCGTTCTTCATCGATGC Fungal Nuclear rDNA ITS
region SEQ-ID-NO:10 ITS3 GCATCGATGAAGAACGCAGC Fungal Nuclear rDNA
ITS region SEQ-ID-NO:11 ITS4 TCCTCCGCTTATTGATATGG Fungal Nuclear
rDNA ITS region SEQ-ID-NO:12 FCORN1 GCAACTTGGAGAAGTGGCAAG Fusarium
sp. Mitochondrial SEQ-ID-NO:13 small subunit rDNA FCORN2
AAGTCTTCCAGTATGGGGAG Fusarium sp. Mitochondrial SEQ-ID-NO:14 small
subunit rDNA FSUB1 GTGCGATATCTTTAGGAGGC Fusarium subglutinans
SEQ-ID-NO:15 Mitochondrial small subunit rDNA FSUB2
TGAACTAGACTACCAACTCAG Fusarium subglutinans SEQ-ID-NO:16
Mitochondrial small subunit rDNA FSUB3 CAAATCTAAGGCTGGCTTGTA
Fusarium subglutinans SEQ-ID-NO:17 Mitochondrial small subunit rDNA
FVERT1 TGGTGGACTAGTCTGAATCC Fusarium verticillioides SEQ-ID-NO:18
Mitochondrial small subunit rDNA FVERT2 TGAACTACGAGTAACCCACC
Fusarium verticillioides SEQ-ID-NO:19 Mitochondrial small subunit
rDNA FPRO1 TAAACTAACTCAACTAGACGAG Fusarium proliferatum
SEQ-ID-NO:20 Mitochondrial small subunit rDNA FPRO2
GATTTCGGGGCCGGCTTGC Fusarium proliferatum nuclear SEQ-ID-NO:21 rDNA
ITS region FPRO3 CGCAAGGGCTCGCCGATC Fusarium proliferatum nuclear
SEQ-ID-NO:22 rDNA ITS region MS1 CAGCAGTCAAGAATATTAGTCAATG Fungal
mitochondrial small subunit SEQ-ID-NO:23 rDNA region MS2
GCGGATTATCGAATTAAATAAC Fungal mitochondrial small subunit
SEQ-ID-NO:24 rDNA region
Example 6
Determination of Primer Specificity to Purified Fungal Genomic
DNA
[0097] PCRs are performed according to Example 3 using different
primer combinations (Table 5) in an attempt to amplify single
specific fragments. Specific PCR amplification products are
produced from primers designed from the mitochondrial small subunit
rDNA or the nuclear rDNA ITS regions of each fungal strain of
interest.
[0098] In an initial screen for specificity, PCR reaction mixtures
are made according to Example 3 for each of the primer combinations
in Table 5. These are run against a negative control (no DNA
added), a healthy maize tissue control (prepared in Example 2A) to
test for background amplification, and 10 ng of DNA from the
following isolates in Table 1: Fusarium moniliforme M-3120;
Fusarium subglutinans M-3693; Fusarium subglutinans M-3696;
Fusarium proliferatum M-5991; Fusarium culmorum R-5126; Fusarium
graminearum R-8637; Microdochium nivale 15N1; M. nivale var. majus
93; Fusarium poae T427; and Fusarium avenaceum 64452 prepared as
described in Example 1.
5TABLE 5 Possible Combinations of PCR Primers for the Specific
Amplification of Fusarium subglutinans, F. verticillioides, and F.
proliferatum. Target Approximate Pathogen 5' primer 3' primer
Product Size (bp) Fusarium subglutinans FCORN1 (SEQ ID NO: 13)
FSUB2 (SEQ ID NO: 16) 513 Fusarium subglutinans FCORN2 (SEQ ID NO:
14) FSUB2 (SEQ ID NO: 16) .sup. 495.sup.1 Fusarium subglutinans
FSUB1 (SEQ ID NO: 15) FSUB2 (SEQ ID NO: 16) 456 Fusarium
subglutinans FCORN1 (SEQ ID NO: 13) FSUB3 (SEQ ID NO: 17) .sup.
559.sup.2 Fusarium subglutinans FCORN2 (SEQ ID NO: 14) FSUB3 (SEQ
ID NO: 17) .sup. 541.sup.3 Fusarium subglutinans FSUB1 (SEQ ID NO:
15) FSUB3 (SEQ ID NO: 17) .sup. 502.sup.4 Fusarium verticillioides
FCORN1 (SEQ ID NO: 13) FVERT1 (SEQ ID NO: 18) .sup. 544.sup.5
Fusarium verticillioides FCORN2 (SEQ ID NO: 14) FVERT1 (SEQ ID NO:
18) 526 Fusarium verticillioides FCORN1 (SEQ ID NO: 13) FVERT2 (SEQ
ID NO: 19) .sup. 505.sup.6 Fusarium verticillioides FCORN2 (SEQ ID
NO: 14) FVERT2 (SEQ ID NO: 19) 487 Fusarium proliferatum FCORN1
(SEQ ID NO: 13) FPRO1 (SEQ ID NO: 20) .sup. 520.sup.7 Fusarium
proliferatum FCORN2 (SEQ ID NO: 14) FPRO1 (SEQ ID NO: 20) 502
Fusarium proliferatum ITS1 (SEQ ID NO: 9) FPRO2 (SEQ ID NO: 21)
.sup. 385.sup.8 Fusarium proliferatum ITS1 (SEQ ID NO: 9) FPRO3
(SEQ ID NO: 22) .sup. 370.sup.9 Fusarium proliferatum ITS3 (SEQ ID
NO: 11) FPRO2 (SEQ ID NO: 21) 180 Fusarium proliferatum ITS3 (SEQ
ID NO: 11) FPRO3 (SEQ ID NO: 22) 160 Fungal ITS region ITS1 (SEQ ID
NO: 9) ITS4 (SEQ ID NO: 12) 530 Fungal ITS region ITS1 (SEQ ID NO:
9) ITS2 (SEQ ID NO: 10) 210 Fungal ITS region 1TS3 (SEQ ID NO: 9)
ITS4 (SEQ ID NO: 12) 330 .sup.1Amplifies F. subglutinans target
well, but produces a high molecular weight nonspecific with F.
culmorum and F. graminearum .sup.2Did not react with one isolate of
F. subglutinans target DNA, produced a high molecular weight
nonspecific with F. culmorum .sup.3Amplifies F. subglutinans target
well, but produces a high molecular weight nonspecific with F.
culmorum .sup.4Amplifies F. subglutinans target well, but produces
a low molecular weight nonspecific with all DNAs tested and the
negative control .sup.5Amplifies F. verticillioides target to a
lesser extent than other primers tested and produces a low
molecular weight nonspecific with the negative control
.sup.6Amplifies F. verticillioides target well, but also amplifies
a product with F. proliferatum .sup.7Amplifies F. proliferatum
target well, but produces a nonspecifics with Michrodochium nivale
var. majus and F. culmorum .sup.8Amplifies from one F. proliferatum
isolate but not from others and produces nonspecifics with all
isolates tested in the initial screen with the exception of F. poae
and F. avenaceum .sup.9Amplifies F. proliferatum target well, but
produces a nonspecifics with F. subglutinans M3696 and F.
verticillioides
[0099] When visualized on an ethidium bromide stained gel, several
primer pairs amplified single products from target DNA with all
other reactions (negative control, maize background, and other
fungal DNAs) free of both specific and nonspecific reaction
products. The primer pairs that give the best amplification for
their specific targets with no cross-amplification are summarized
in Table 6. See footnotes (Table 5) for information on those primer
pairs that amplified target DNA but with less satisfactory results
in terms of specificity.
6TABLE 6 PCR Primer Pairs Providing Specific and Sensitive
Amplification of Target DNA for Fusarium subglutinans, F.
verticillioides, and F. proliferatum PCR Assays. Target Approximate
Pathogen 5' primer 3' primer Product Size (bp) Fusarium
subglutinans FSUB 1 (SEQ ID NO: 15) FSUB2 (SEQ ID NO: 16) 456
Fusarium subglutinans FCORN1 (SEQ ID NO: 13) FSUB2 (SEQ ID NO: 16)
513 Fusarium verticillioides FCORN2 (SEQ ID NO: 14) FVERT1 (SEQ ID
NO: 18) 526 Fusarium verticillioides FCORN2 (SEQ ID NO: 14) FVERT2
(SEQ ID NO: 19) 487 Fusarium proliferatum FCORN2 (SEQ ID NO: 14)
FPRO1 (SEQ ID NO: 20) 502
Example 7
Validation of Fusarium subglutinans, F. verticillioides, and F.
proliferatum
[0100] PCR Assays Showing Reactivity of Multiple Isolates for a
Given Target.
[0101] One of the primer pairs in Table 6 is chosen for each target
DNA for further characterization and testing: FSUB1 and FSUB2 for
Fusarium subglutinans, FCORN2 and FVERT1 for F. verticillioides,
and FCORN2 with FPRO1 for F. proliferatum. Each is run in PCR
mastermixes against DNAs from a panel of fungal species (all
isolates in Table 1) prepared as in Example 1. Products are
visualized on an ethidium bromide stained gel. Results are scored
as either positive (+) or negative (-) for the amplification of
target DNA with any product visible, of the correct size, being
considered a positive and with nonspecifics recorded if present.
Results of each of these tests are shown in Tables 7-9. Table 7
shows that primers FSUB1 (SEQ ID NO:15) and FSUB2 (SEQ ID NO:16),
when prepared in PCR reactions as described in Example 3, amplify
target DNA from only the isolates identified as Fusarium
subglutinans. The primers do not react with isolates of Fusarium
proliferatum, F. verticillioides, or with other fungal species
known to infect or colonize maize tissue. This experiment also
shows that the F. subglutinans specific primers do not react with a
preparation of maize DNA described in Example 2A.
7TABLE 7 Results of F. subglutinans PCR Assay Against a Panel of
Ear Rot Pathogen DNAs and a Maize Background Check. F. subglutinans
Fungal species Isolate Isolation Geographic Origin PCR Result
Fusarium proliferatum M-5991 Swine Feed Iowa, USA - Fusarium
proliferatum 94-041 Maize Iowa, USA - Fusarium proliferatum 94-066
Maize Iowa, USA - Fusarium proliferatum 94-129 Maize Iowa, USA -
Fusarium proliferatum 95-122 Maize Iowa, USA - Fusarium
proliferatum 95-135 Maize Iowa, USA - Fusarium proliferatum 95-289
Maize Iowa, USA - Fusarium proliferatum M-1231 Rice Phillipines -
Fusarium proliferatum M-1264 Rice Sierra Leone - Fusarium
proliferatum M-1329 Rice California, USA - Fusarium proliferatum
M-3744 Rice Australia - Fusarium proliferatum M-5167 Rice Iran -
Fusarium proliferatum M-5587 Date Palm Iraq - Fusarium proliferatum
M-5605 Poland - Fusarium proliferatum M-6173 Rice Malaysia -
Fusarium proliferatum M-6471 Maize Kansas, USA - Fusarium
proliferatum M-8510 Rice Nepal, USA - Fusarium verticillioides NRRL
Chicken Arkansas, USA - 6396 Feed Fusarium verticillioides NRRL
Pinus taeda North Carolina, - 13563 USA Fusarium verticillioides
M-3120 Maize California, USA - Fusarium verticillioides M-3125
Maize California, USA - Fusarium subglutinans NRRL Maize Iowa, USA
+ 13588 Fusarium subglutinans NRRL Maize Zambia + 13599 Fusarium
subglutinans NRRL Maize Germany + 20844 Fusarium subglutinans M3693
Maize Iowa, USA + Fusarium subglutinans M3696 Maize Iowa, USA +
Fusarium sambucinium- R-6380 Maize Iowa, USA - sulphureum Fusarium
3299 - sporotrichioides Fusarium culmorum R-5126 Minnesota, USA -
Fusarium graminearum R-8637 Settat, Morocco - Microdochium nivale
15N1 United Kingdom - Microdochium nivale #093 - var. majus
Fusarium poae T-427 Pennsylvannia, - USA Fusarium avenaceum ATCC
Poland - 64452 Diplodia maydis 5139 Macrophomina MP97 phaseolina
Aspergillus flavus 3557 Kabatiella zeae 18594 Maize Wisconsin, USA
- Cercospora zeae-maydis 6928IL Cercospora zeae-maydis 26158 Maize
New York, USA - Puccinia sorghi VA - Helminthosporium 24772 Maize
North Carolina, - maydis USA Helminthosporium 11534 Maize Maryland,
USA - maydis Helminthosporium 16185 Maize Virginia, USA - carbonum
Helminthosporium 24962 Maize Illinois, USA - carbonum
Helminthosporium 26306 Maize Illinois, USA - turcicum Fusarium
culmorum 62215 Wheat seed Switzerland - Fusarium culmorum R-5106
Darling Downs, - Australia 1999 Maize sample #1 -- -- Iowa, USA
-
[0102] Table 8 shows that primers FCORN2 (SEQ ID NO: 14) and FPRO1
(SEQ ID NO:20), when prepared in PCR reactions as described in
Example 3, amplify target DNA from only the isolates identified as
Fusarium proliferatum and with all isolates in this study that were
identified as F. proliferatum. The primers do not react with maize
DNA (1999 Maize sample #1) or with other fungal species known to
infect or colonize maize tissue including F. verticillioides and F.
subglutinans.
8TABLE 8 Results of F. proliferatum PCR Assay Against a Panel of
Ear Rot Pathogen DNAs and a Maize Background Check. F. proliferatum
Fungal species Isolate Isolation Geographic Origin PCR Result
Fusarium proliferatum M-5991 Swine Feed Iowa, USA + Fusarium
proliferatum 94-041 Maize Iowa, USA + Fusarium proliferatum 94-066
Maize Iowa, USA + Fusarium proliferatum 94-129 Maize Iowa, USA +
Fusarium proliferatum 95-122 Maize Iowa, USA + Fusarium
proliferatum 95-135 Maize Iowa, USA + Fusarium proliferatum 95-289
Maize Iowa, USA + Fusarium proliferatum M-1231 Rice Phillipines +
Fusarium proliferatum M-1264 Rice Sierra Leone + Fusarium
proliferatum M-1329 Rice California, USA + Fusarium proliferatum
M-3744 Rice Australia + Fusarium proliferatum M-5167 Rice Iran +
Fusarium proliferatum M-5587 Date Palm Iraq + Fusarium proliferatum
M-5605 Poland + Fusarium proliferatum M-6173 Rice Malaysia +
Fusarium proliferatum M-6471 Maize Kansas, USA + Fusarium
proliferatum M-8510 Rice Nepal, USA + Fusarium verticillioides NRRL
Chicken Arkansas, USA - 6396 Feed Fusarium verticillioides NRRL
Pinus taeda North Carolina, - 13563 USA Fusarium verticillioides
M-3120 Maize California, USA - Fusarium verticillioides M-3125
Maize California, USA - Fusarium subglutinans NRRL Maize Iowa, USA
- 13588 Fusarium subglutinans NRRL Maize Zambia - 13599 Fusarium
subglutinans NRRL Maize Germany - 20844 Fusarium subglutinans M3693
Maize Iowa, USA - Fusarium subglutinans M3696 Maize Iowa, USA -
Fusarium sambucinium- R-6380 Maize Iowa, USA - sulphureum Fusarium
3299 sporotrichioides Fusarium culmorum R-5126 Minnesota, USA -
Fusarium graminearum R-8637 Settat, Morocco - Microdochium nivale
15N1 United Kingdom - Microdochium nivale #093 var. majus Fusarium
poae T-427 Pennsylvannia, - USA Fusarium avenaceum ATCC Poland -
64452 Diplodia maydis 5139 Macrophomina MP97 phaseolina Aspergillus
flavus 3557 Kabatiella zeae 18594 Maize Wisconsin, USA - Cercospora
zeae-maydis 6928IL Cercospora zeae-maydis 26158 Maize New York, USA
- Puccinia sorghi VA Helminthosporium 24772 Maize North Carolina, -
maydis USA Helminthosporium 11534 Maize Maryland, USA - maydis
Helminthosporium 16185 Maize Virginia, USA - carbonum
Helminthosporium 24962 Maize Illinois, USA - carbonum
Helminthosporium 26306 Maize Illinois, USA - turcicum Fusarium
culmorum 62215 Wheat seed Switzerland - Fusarium culmorum R-5106
Darling Downs, - Australia 1999 Maize sample #1 -- -- Iowa, USA
-
[0103] The primers FCORN2 (SEQ ID NO: 14) and FVERT1 (SEQ ID NO:
18) were run against the same DNA preparations of fungal isolates
and maize tissue that were tested using the F. subglutinans and F.
proliferatum specific primers (results in Tables 7 and 8,
respectively). The F. verticillioides specific primers, when
prepared in PCR reactions as described in Example 3, amplify target
DNA from only the isolates identified as Fusarium verticillioides
(Table 9). The primers do not react with isolates of Fusarium
subglutinans, F. proliferatum, or with other fungal species known
to infect or colonize maize tissue. Table 9 also shows that FCORN2
and FVERT1 do not react with a preparation of maize DNA.
9TABLE 9 Results of F. verticillioides PCR Assay Against a Panel of
Ear Rot Pathogen DNAs and a Maize Background Check. Geographic F.
verticillioides Fungal species Isolate Isolation Origin PCR Result
Fusarium proliferatum M-5991 Swine Feed Iowa, USA - Fusarium
proliferatum 94-041 Maize Iowa, USA - Fusarium proliferatum 94-066
Maize Iowa, USA - Fusarium proliferatum 94-129 Maize Iowa, USA -
Fusarium proliferatum 95-122 Maize Iowa, USA - Fusarium
proliferatum 95-135 Maize Iowa, USA - Fusarium proliferatum 95-289
Maize Iowa, USA - Fusarium proliferatum M-1231 Rice Phillipines -
Fusarium proliferatum M-1264 Rice Sierra Leone - Fusarium
proliferatum M-1329 Rice California, USA - Fusarium proliferatum
M-3744 Rice Australia - Fusarium proliferatum M-5167 Rice Iran -
Fusarium proliferatum M-5587 Date Palm Iraq - Fusarium proliferatum
M-5605 Poland - Fusarium proliferatum M-6173 Rice Malaysia -
Fusarium proliferatum M-6471 Maize Kansas, USA - Fusarium
proliferatum M-8510 Rice Nepal, USA - Fusarium verticillioides NRRL
Chicken Arkansas, USA + 6396 Feed Fusarium verticillioides NRRL
Pinus taeda North Carolina, + 13563 USA Fusarium verticillioides
M-3120 Maize California, USA + Fusarium verticillioides M-3125
Maize California, USA + Fusarium subglutinans NRRL Maize Iowa, USA
- 13588 Fusarium subglutinans NRRL Maize Zambia - 13599 Fusarium
subglutinans NRRL Maize Germany - 20844 Fusarium subglutinans M3693
Maize Iowa, USA - Fusarium subglutinans M3696 Maize Iowa, USA -
Fusarium sambucinium- R-6380 Maize Iowa, USA - sulphureum Fusarium
sporotrichioides 3299 - Fusarium culmorum R-5126 Minnesota, USA -
Fusarium graminearum R-8637 Settat, Morocco - Microdochium nivale
15N1 United Kingdom - Microdochium nivale #093 - var. majus
Fusarium poae T-427 Pennsylvannia, - USA Fusarium avenaceum ATCC
Poland - 64452 Diplodia maydis 5139 - Macrophomina phaseolina MP97
- Aspergillus flavus 3557 - Kabatiella zeae 18594 Maize Wisconsin,
USA - Cercospora zeae-maydis 6928IL - Cercospora zeae-maydis 26158
Maize New York, USA - Puccinia sorghi VA - Helminthosporium maydis
24772 Maize North Carolina, - USA Helminthosporium maydis 11534
Maize Maryland, USA - Helminthosporium 16185 Maize Virginia, USA -
carbonum Helminthosporium 24962 Maize Illinois, USA - carbonum
Helminthosporium 26306 Maize Illinois, USA - turcicum Fusarium
culmorum 62215 Wheat seed Switzerland - Fusarium culmorum R-5106
Darling Downs, - Australia 1999 Maize sample #1 -- -- Iowa, USA
-
[0104] In summary, assays using FSUB1 and FSUB2 for Fusarium
subglutinans, FCORN2 and FVERT1 for F. verticillioides, and FCORN2
with FPRO1 for F. proliferatum amplified DNAs only from target
species for each PCR assay. No cross-reactivity with any of the
other DNAs was observed. FSUB1 when used with FSUB2 in PCR
reactions, when prepared as in Example 3, amplify only the isolates
in Table 1 identified as Fusarium subglutinans. Likewise, primers
FCORN2 and FVERT1 amplify products only with isolates identified as
the target Fusarium verticillioides and primers FCORN2 and FPRO1
amplify from Fusarium proliferatum isolates only. No
cross-reactivity is observed among preparations of non-target DNA
from maize and other fungal pathogens. Furthermore, nonspecific
amplification products are absent in all reactions performed.
Example 8
Use of Fusarium subglutinans, F. verticillioides, and F.
proliferatum PCR Assays for Determination of Fungal Species
Cultured from Field Samples
[0105] The maize ear rot PCR assays documented in the above
examples are used to establish the speciation of unknown ear rot
isolates cultured from field-grown maize in Stanton, Minn., USA
(Table 2). PCRs are performed as described in Example 3 using
optimal primer pairs (FSUB1 and FSUB2 for Fusarium subglutinans,
FCORN2 and FVERT1 for F. verticillioides, and FCORN2 with FPRO1 for
F. proliferatum) against DNA from the field isolates prepared as
described in Example 1. Products are visualized on an ethidium
bromide stained gel. Results are scored as either positive (+) or
negative (-) for the amplification of target DNA. Any PCR product
visible, of the correct size, is considered a positive and
nonspecifics are recorded if present. Results of each of these
tests are shown in Tables 10 -12.
10TABLE 10 Results of F. subglutinans PCR Assays Against Isolates
Collected from Field-grown Maize. F. subglutinans Isolate PCR
Result Fm001 - Fm002 - Fm003 + Fm004 - Fm005 - Fm006 - Fm007 -
Fm008 - Fm009 - Fm010 - Fm011 - Fm012 - Fm013 - Fm014 - Fm034 -
Fm035 - Fm036 - Fm037 - Fm041 - Fm042 - Fm043 - Fm044 - Fm045 -
Fm046 - Fm047 - Fm048 - Fm049 - Fm050 - Fm051 - Fm052 - Fm053 -
Fm054 - Fm055 - Fm056 - BC3SO 189 - Fsub1 + Fsub2 + Fsub3 + Fsub4
+
[0106] Five of the forty-one isolates cultured from field-grown
maize react with the Fusarium subglutinans primers.
11TABLE 11 Results of F. proliferatum PCR Assays Against Isolates
Collected from Field-grown Maize. F. proliferatum Isolate PCR
Result Fm001 - Fm002 - Fm003 - Fm004 - Fm005 - Fm006 - Fm007 -
Fm008 - Fm009 - Fm010 + Fm011 - Fm012 - Fm013 - Fm014 + Fm034 -
Fm035 - Fm036 - Fm037A + Fm041 - Fm042 - Fm043 - Fm044A + Fm045 -
Fm046 - Fm047A + Fm048 - Fm049 - Fm050 - Fm051 - Fm052 - Fm053 -
Fm054 - Fm055 - Fm056 - BC3SO 189 - Fsub1 - Fsub2 - Fsub3 - Fsub4
-
[0107] The Fusarium proliferatum specific primers react with five
of the forty-one isolates cultured from field-grown maize.
12TABLE 12 Results of F. verticillioides PCR Assay Against Isolates
Collected from Field-grown Maize. F. verticillioides Isolate PCR
Result Fm001 + Fm002 + Fm003 - Fm004 + Fm005 + Fm006 + Fm007 +
Fm008 + Fm009 + Fm010 - Fm011 + Fm012 + Fm013 + Fm014 - Fm034 +
Fm035 + Fm036 + Fm037 - Fm041 + Fm042 + Fm043 + Fm044 - Fm045 +
Fm046 + Fm047 - Fm048 + Fm049 + Fm050 + Fm051 + Fm052 + Fm053 +
Fm054 + Fm055 + Fm056 + BC3SO 189 - Fsub1 - Fsub2 - Fsub3 - Fsub4
-
[0108] Twenty-eight of the isolates cultured from field-grown maize
were identified as Fusarium verticillioides with the
species-specific PCR primers FCORN2 and FVERT1. For the forty-one
isolates tested, none react with more than one of the three tests.
These experiments demonstrate the utility of the diagnostic PCR
primers for characterizing isolates of maize ear rot.
Example 9
Use of Fusarium subglutinans, F. verticillioides, and F.
proliferatum PCR Assays for Detection and Differentiation of Fungal
Species Infecting Husk Tissues Collected from Field-Grown
Maize.
[0109] The maize ear rot PCR assays are used to establish the
speciation of ear rot pathogens present in husk tissue samples
taken from field-grown maize (Table 2). PCRs are performed as
described in Example 3 using FSUB1 and FSUB2 for Fusarium
subglutinans, FCORN2 and FVERT1 for F. verticillioides, and FCORN2
with FPRO1 for F. proliferatum against DNA from the field isolates
prepared as in Example 2B. Products are visualized on an ethidium
bromide stained gel. Results are scored as either positive (+) or
negative (-) for the amplification of target DNA. Products are
compared to a molecular size marker and positive controls on the
gel to determine that the products scored are of the correct size
and any nonspecific amplification products are recorded if present.
Results of the Fusarium subglutinans test are shown in Table
13.
13TABLE 13 Results of F. subglutinans Assay Against Various Maize
Tissues Sample F. subglutinans Designation Tissue PCR Result H-5
Husk + H-9 Husk + SBP-2 Husk +
[0110] The three maize tissues tested are identified as positive
for the presence of Fusarium subglutinans target DNA. Fusarium
proliferatum and F. verticillioides tests are also run against
these husk tissues. No target DNA is detected in the maize tissues
using the F. proliferatum or F. verticillioides assays. The results
of these experiments show the utility of the maize ear rot assays
in identifying and distinguishing species present in maize tissue
samples without having to first culture the organism out of the
tissue. The primers in Example 6 can be used in PCR assays to
directly characterize extractions of maize tissue.
Example 10
Determination of Primer Specificity to Purified Fungal Genomic DNA
Using MS 1 or MS2 primer Combinations
[0111] Primers MS1 and MS2 from the literature are designed to
amplify mitochondrial small subunit rDNA. The MS 1 priming site
lies upstream of the reverse primers FSUB2, FSUB3, FVERT1, FVERT2,
and FPRO1. Using the conserved MS1 primer in combination with 3'
primers specific to a fungus such as a Fusarium spp. in polymerase
chain reactions performed as in Example 3 produces am assau ised tp
detect the specific fungus. For example, MS 1 is combined with a 3'
primer listed in Table 5 such as: FSUB2 or FSUB3 to detect F.
subglutinans; FVERT 1 or FVERT2 to detect F. verticillioides; and
FPRO1 to detect F. proliferatum.
[0112] Similarly, the MS2 reverse primer in combination with 5'
primers specific to a fungus such as Fusarium spp. are used to
detect one or more specific fungi in PCR reactions performed as in
Example 3. For example, MS2 is combined with a 5' primer listed in
Table 5 such asFSUB1 to detect F. subglutinants; and FCORN1 or
FCORN2 to Fusarium spp. in general Such an assay for Fusarium spp.
could have utility in situations where detection of Fusarium spp.
without differentiation of the species present is desired.
[0113] While the present invention has been described with
reference to specific embodiments thereof, it will be appreciated
that numerous variations, modifications, and further embodiments
are possible, and accordingly, all such variations, modifications
and embodiments are to be regarded as being within the scope of the
present invention.
[0114] Numerous patents, applications and references are discussed
or cited within this specification, and all are incorporated by
reference in their entireties.
Sequence CWU 1
1
24 1 682 DNA Fusarium verticillioides (syn. F. moniliforme) 1
gctaacggct gaactggcaa cttggagaag tggcaagtct tccagtatgg ggagcaaaac
60 agctatgggt caagtccgat atctttagga gaagtcttat tgtgagggcg
agttttataa 120 caccatagga ctggccgccc catatgaaaa gattatatta
gaattgaatg aagctttgtt 180 tatatattga taatgacagt atatatatcg
tgtcttgact aattgcgtgc cagcagtcgc 240 ggtaatacgt aagagactag
tgttattcat cttaattagg tttaaagggt acccagacgg 300 tcaatatagc
ttataaaatg ttagtacttg actagagttt tatgtaagag ggcagtactt 360
gaggaggaga gatgaaattt cgtgatacca aagggactct gtaaaggcga aggcagccct
420 ctatgtaaaa actgacgttg aaggacgaag gcacagagaa caaacaggat
tagataccca 480 agtagtcttt gcagtaaatg atgaatgcca taggttagat
gggtgggtta gtcgtagttg 540 agttagttta gcaaactaat ggattcagac
tagtccacca tatatttggt ctataaatga 600 aagtgtaagc atttcacctc
aagagtaatg tggcaacgca ggaactgaaa tcactagacc 660 gtttctgaca
ccagtagtga ag 682 2 689 DNA Fusarium proliferatum 2 gctaacggct
gaactggcaa cttggagaag tggcaagtct tccagtatgg ggagcaaaac 60
agctatgggt caagtctgat atctttagga ggggcgaagc tcctcttatt gtgagggcga
120 gttatataac accataggac tggccgcccc atatgaaaag attatattag
aattgaatga 180 agctttgttt atatattgat aatgacagta tatatatcgt
gtcttgacta attgcgtgcc 240 agcagtcgcg gtaatacgta agagactagt
gttattcatc ttaattaggt ttaaagggta 300 cccagacggt caatatagct
tataaaatgt tagtacttga ctagagtttt atgtaagagg 360 gcagtacttg
aggaggagag atgaaatttc gtgataccaa agggactctg taaaggcgaa 420
ggcagccctc tatgtaaaaa ctgacgttga aggacgaagg cacagagaac aaacaggatt
480 agatacccaa gtagtctttg cagtaaatga tgaatgccat aggttagatg
ggtgggctcg 540 tctagttgag ttagtttagc aaactaatga tctagacgag
cccaccgtat atttggtcta 600 taaatgaaag tgtaagcatt tcacctcaag
agtaatgtgg caacgcagga actgaaatca 660 ctagaccgtt tctgacacca
gtagtgaag 689 3 726 DNA gibberella zeae (syn. Fusarium graminearum)
3 gctaacggct gaactggcaa cttggagaag tggcaagtct tccagtatgg ggagcaaaca
60 gctatgggtc aagcccgata cctttaagag aagtcttatt gtgagggcga
gttgtataac 120 accatagggc tggccgcccc atatgaaaag attttattag
aattgaatga aactttgttt 180 atatattgat aatgacagta tatatatcgt
gtcttgacta attgcgtgcc agcagtcgcg 240 gtaatacgta agagactagt
gttattcatc ttaattaggt ttaaagggta cccagacggt 300 ctatatagct
tataaaatgt tagtataaga ctagagtttt atgtaagagg gcagtacttg 360
aggaggagag atgaaatttc gtgataccaa agggactctg taaaggcgaa ggcagccctc
420 tatgtaaaaa ctgacgttga aggacgaagg cacagagaac aaacaggatt
agatacccaa 480 gtagtctttg cagtaaatga tgaatgccat aggttagatc
tatatttcta ttataataat 540 acatttctat tatttattat aaaacgcatt
ccttatatag cttcgcgcta taatatattt 600 tatatatagt gcagcagaaa
tttttgtatc tggtctataa atgaaagtgt aagcatttca 660 cctcaagagt
aatgtggcaa cgcaggaact gaaatcacta gaccgtttct gacaccagta 720 gtgaag
726 4 690 DNA Fusarium subglutinans 4 gctaacggct gaactggcaa
cttggagaag tggcaagtct tccagtatgg ggagcaaaac 60 agctatgggt
caagtccgat atctttagga ggcgcgaagc tcctcttatt gtgagggcga 120
gttttataac accataggac tggccgcccc atatgaaaag attatattag aattgaatga
180 agctttgttt atatattgat aatgacagta tatatatcgt gtcttgacta
attgcgtgcc 240 agcagtcgcg gtaatacgta agagactagt gttattcatc
ttaattaggt ttaaagggta 300 cccagacggt caatatagct tataaaatgt
tagtacttga ctagagtttt atgtaagagg 360 gcagtacttg aggaggagag
atgaaatttc gtgataccaa agggactcgg taaaggcgaa 420 ggcagccctc
taggtaaaaa ctgacgttga aggacgaagg cacagagaac aaacaggatt 480
agatacccaa gtagtctttg cagtaaatga tgaatgccat aggttagatc tgagttggta
540 gtctagttga gttagtttac taaactaatg atctatacaa gccagcctta
gatttggtct 600 ataaatgaaa gtgtaagcat ttcacctcaa gagtaatgtg
gcaacgcagg aactgaaatc 660 actagaccgt ttctgacacc agtagtgaag 690 5
522 DNA Fusarium subglutinans 5 tccgttggtg aaccagcgga gggatcatta
ccgagtttac aactcccaaa cccctgtgaa 60 cataccaatt gttgcctcgg
cggatcagcc cgctcccggt aaaacgggac ggcccgccag 120 aggaccccta
aactctgttt ctatatgtaa cttctgagta aaaccataaa taaatcaaaa 180
ctttcaacaa cggatctctt ggttctggca tcgatgaaga acgcagcaaa atgcgataag
240 taatgtgaat tgcagaattc agtgaatcat cgaatctttg aacgcacatt
gcgcccgcca 300 gtattctggc gggcatgcct gttcgagcgt catttcaacc
ctcaagccca gcttggtgtt 360 gggactcgcg agtcaaatcg cgttccccaa
attgattggc ggtcacgtcg agcttccata 420 gcgtagtagt aaaaccctcg
ttactggtaa tcgtcgcggc cacgccgtta aaccccaact 480 tctgaatgtt
gacctcggat caggtaggaa tacccgctga ac 522 6 521 DNA Gibberella zeae 6
tccgttggtg aaccagcgga gggatcatta ccgagtttac aactcccaaa cccctgtgaa
60 cataccttat gttgcctcgg cggatcagcc cgcgccccgt aaaaagggac
ggcccgccgc 120 aggaacccta aactctgttt ttagtggaac ttctgagtat
aaaaaacaaa taaatcaaaa 180 ctttcaacaa cggatctctt ggttctggca
tcgatgaaga acgcagcaaa atgcgataag 240 taatgtgaat tgcagaattc
agtgaatcat cgaatctttg aacgcacatt gcgcccgcca 300 gtattctggc
gggcatgcct gttcgagcgt catttcaacc ctcaagccca gcttggtgtt 360
gggagctgca gtcctgctgc actccccaaa tacattggcg gtcacgtcga gcttccatag
420 cgtagtaatt tacacatcgt tactggtaat cgtcgcggcc acgccgttaa
accccaactt 480 ctgaatgttg acctcggatc aggtaggaat acccgctgaa c 521 7
534 DNA Fusarium proliferatum 7 tccgttggtg aaccagcgga gggatcatta
ccgagtttac aactcccaaa cccctgtgaa 60 cataccaatt gttgcctcgg
cggatcagcc cgctcccggt aaaacgggac ggcccgccag 120 aggaccccta
aactctgttt ctatatgtaa cttctgagta aaaccataaa taaatcaaaa 180
ctttcaacaa cggatctctt ggttctggca tcgatgaaga acgcagcaaa atgcgataag
240 taatgtgaat tgcagaattc agtgaatcat cgaatctttg aacgcacatt
gcgcccgcca 300 gtattctggc gggcatgcct gttcgagcgt catttcaacc
ctcaagcccc cgggtttggt 360 gttggggatc ggcgagccct tgcggcaagc
cggccccgaa atctagtggc ggtctcgctg 420 cagcttccat tgcgtagtag
taaaaccctc gcaactggta cgcggcgcgg ccaagccgtt 480 aaacccccaa
cttctgaatg ttgacctcgg atcaggtagg aatacccgct gaac 534 8 522 DNA
Fusarium verticillioides (syn. F. moniliforme) 8 tccgttggtg
aaccagcgga gggatcatta ccgagtttac aactcccaaa cccctgtgaa 60
cataccaatt gttgcctcgg cggatcagcc cgctcccggt aaaacgggac ggcccgccag
120 aggaccccta aactctgttt ctatatgtaa cttctgagta aaaccataaa
taaatcaaaa 180 ctttcaacaa cggatctctt ggttctggca tcgatgaaga
acgcagcaaa atgcgataag 240 taatgtgaat tgcagaattc agtgaatcat
cgaatctttg aacgcacatt gcgcccgcca 300 gtattctggc gggcatgcct
gttcgagcgt catttcaacc ctcaagccca gcttggtgtt 360 gggactcgcg
agtcaaatcg cgttccccaa attgattggc ggtcacgtcg agcttccata 420
gcgtagtagt aaaaccctcg ttactggtaa tcgtcgcggc cacgccgtta aaccccaact
480 tctgaatgtt gacctcggat caggtaggaa tacccgctga ac 522 9 19 DNA
Artificial sequence misc_feature (1)..(19) Primer ITS1 9 tccgtaggtg
aacctgcgg 19 10 20 DNA Artificial sequence misc_feature (1)..(20)
Primer ITS2 10 gctgcgttct tcatcgatgc 20 11 20 DNA Artificial
sequence misc_feature (1)..(20) Primer ITS3 11 gcatcgatga
agaacgcagc 20 12 20 DNA Artificial sequence misc_feature (1)..(20)
Primer ITS4 12 tcctccgctt attgatatgc 20 13 21 DNA Artificial
sequence misc_feature (1)..(20) Primer FCORN1 13 gcaacttgga
gaagtggcaa g 21 14 20 DNA Artificial sequence misc_feature
(1)..(20) Primer FCORN2 14 aagtcttcca gtatggggag 20 15 20 DNA
Artificial sequence misc_feature (1)..(20) Primer FSUB1 15
gtccgatatc tttaggaggc 20 16 21 DNA Artificial sequence misc_feature
(1)..(21) Primer FSUB2 16 tcaactagac taccaactca g 21 17 21 DNA
Artificial sequence misc_feature (1)..(21) Primer FSUB3 17
caaatctaag gctggcttgt a 21 18 20 DNA Artificial sequence
misc_feature (1)..(20) Primer FVERT1 18 tggtggacta gtctgaatcc 20 19
20 DNA Artificial sequence misc_feature (1)..(20) Primer FVERT2 19
tcaactacga ctaacccacc 20 20 22 DNA Artificial Sequence misc_feature
(1)..(22) Primer FPRO1 20 taaactaact caactagacg ag 22 21 19 DNA
Artificial sequence misc_feature (1)..(19) Primer FPRO2 21
gatttcgggg ccggcttgc 19 22 18 DNA Artificial sequence misc_feature
(1)..(18) Primer FPRO3 22 cgcaagggct cgccgatc 18 23 25 DNA
Artificial sequence misc_feature (1)..(25) Primer MS1 23 cagcagtcaa
gaatattagt caatg 25 24 22 DNA Artificial sequence misc_feature
(1)..(22) Primer MS2 24 gcggattatc gaattaaata ac 22
* * * * *