U.S. patent application number 10/727745 was filed with the patent office on 2004-12-16 for screening of phage displayed peptides without clearing of the cell culture.
This patent application is currently assigned to Zyomyx, Inc.. Invention is credited to Kassner, Paul D., Nock, Steffen.
Application Number | 20040253607 10/727745 |
Document ID | / |
Family ID | 26904223 |
Filed Date | 2004-12-16 |
United States Patent
Application |
20040253607 |
Kind Code |
A1 |
Nock, Steffen ; et
al. |
December 16, 2004 |
Screening of phage displayed peptides without clearing of the cell
culture
Abstract
This invention provides methods for screening populations of
phage-displayed polypeptides that are particularly well-suited for
high-throughput screening. The methods do not require the clearing
of cells from a culture used to obtain the population of phage or
other replicable genetic packages. Accordingly, the invention
provides methods for forming complexes between a replicable genetic
package displaying a polypeptide fusion and a target molecule in an
uncleared cell culture containing replicable genetic package.
Compositions made up of an uncleared cell culture containing
replicable genetic packages displaying a polypeptide fusion and a
target molecule are provided in the invention as well.
Inventors: |
Nock, Steffen; (Redwood
City, CA) ; Kassner, Paul D.; (San Mateo,
CA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER
EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
Zyomyx, Inc.
Hayward
CA
|
Family ID: |
26904223 |
Appl. No.: |
10/727745 |
Filed: |
December 3, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10727745 |
Dec 3, 2003 |
|
|
|
09874547 |
Jun 4, 2001 |
|
|
|
6686154 |
|
|
|
|
60209503 |
Jun 5, 2000 |
|
|
|
Current U.S.
Class: |
435/6.14 |
Current CPC
Class: |
C40B 40/02 20130101;
C12N 15/1037 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 5, 2001 |
WO |
PCT/US01/18421 |
Claims
1-19. (canceled)
20. An uncleared cell culture comprising: (a) a population of
replicable genetic packages, each of which displays on its surface
a fusion protein that comprises a surface-displayed replicable
genetic package polypeptide and an exogenous polypeptide; (b) a
complex that comprises a target molecule and one or more members of
the population of replicable genetic packages that specifically
bind to said target molecule via said exogenous polypeptide; and
(c) cells in which the replicable genetic packages were amplified
prior to contact with the target molecule.
21. The uncleared cell culture of claim 20, wherein said replicable
genetic packages are selected from the group consisting of
bacteriophage and eukaryotic viruses.
22. The uncleared cell culture of claim 20, wherein said target
molecule is immobilized on a solid support.
23. The uncleared cell culture of claim 22, wherein said solid
support is selected from the group consisting of: a bead, a chip, a
microtiter plate, a prokaryotic cell and a eukaryotic cell.
24. The uncleared cell culture of claim 20, wherein said target
molecule is selected from the group consisting of: a polypeptide, a
nucleic acid, an RNA, a DNA, a small organic molecule, and a
carbohydrate.
25. The uncleared cell culture of claim 20, wherein said exogenous
polypeptide is an antibody.
26. The uncleared cell culture of claim 25, wherein said antibody
is a scFv or a Fab.
27. The uncleared cell culture of claim 20, wherein the uncleared
cell culture further comprises a detection reagent that
specifically binds to the replicable genetic packages.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Patent application Ser. No. 60/209503, filed on Jun. 5, 2000, the
teachings of which are herein incorporated by reference.
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH AND DEVELOPMENT
[0002] Not applicable.
BACKGROUND OF THE INVENTION
[0003] Phage display and related techniques have become powerful
methods for the discovery of affinity binding reagents (Smith
(1985) Science 228: 1315-1317). Linear and constrained peptides,
antibody fragments (e.g., scFvs, Fvs and Fabs), as well as a number
of alternative binding domains have all been displayed on phage
particles, for example, via fusion to one of the phage coat
proteins. Although several phage proteins (derived from gVIII, gVI,
gVHI and gIX) have all been used as fusion partners for display of
recombinant proteins, gIII is the most widely used. Phagemids
containing a phage origin of replication, an antibiotic resistance
marker, and a gene encoding a binding domain/gill fusion protein
are readily constructed via conventional molecular biology
techniques. Through large-scale ligation and transformation as well
as recombination strategies, large libraries of 10.sup.8 to
10.sup.11 different recombinants are now being generated for use in
affinity selection strategies (de Haard et al. (1999) J. Biol.
Chem. 274: 18218-18230; Sblattero and Bradbury (2000) Nat.
Biotechnol. 18: 75-80); Sheets et al. (1998) Proc. Natl. Acad.
Sci., U.S.A. 95:6157-6162, published erratum appears in Proc. Natl.
Acad. Sci., U.S.A. (1999) 96: 795).
[0004] Once a library of phage displaying potential binding agents
is generated, individual phage with the capacity to bind to a
chosen target must be isolated from an enormous excess of
non-binding phage. To screen large numbers of phage to identify
those that display polypeptides having a desired activity, it is
desirable to develop high-throughput screening (HTS) methods.
Preferably, such HTS methods would automate the phage screening
process so that large numbers of phage could be screened with
little human intervention. Although HTS methods are available for
many types of screening, previously known phage display protocols
include steps that are not readily automatable. In particular,
phage display protocols require, prior to screening, separation of
the phage from the host cells in which the phage are amplified.
[0005] Traditionally, overnight cultures of bacteria producing
phage are centrifuged or filtered to pellet bacteria and phage
supernatants are used in the screening (See generally, Kay et al.,
eds. (1996) Phage display of peptides and proteins: a laboratory
manual. Academic Press Inc., San Diego Calif.). Alternatively,
phage can be purified and concentrated from cleared supernatants by
precipitation (e.g., with polyethylene glycol). However, these
clearing methods are not readily performed by robotic systems
(e.g., automated workstations). Therefore, time-consuming and
expensive human intervention is required. These drawbacks are
exacerbated as the numbers of samples are increased and during
high-throughput screening. Therefore, a need exists for more fully
automated methods for screening of phage display libraries. The
present invention fulfills this and other needs.
SUMMARY OF THE INVENTION
[0006] The present invention provides methods for screening a
population of replicable genetic packages (e.g., phage, eukaryotic
viruses, and the like) to obtain particles that display on their
surface a fusion protein that specifically binds to a target
molecule. Unlike previous methods, which involve clearing a culture
of cells prior to screening the methods of the present invention
involve contacting a target molecule with an uncleared cell culture
that contains a population of replicable genetic packages. Each
replicable genetic package displays on its surface a fusion protein
that has a surface-displayed replicable genetic package polypeptide
and a potential binding polypeptide. The replicable genetic package
that specifically bind to the target molecule form complexes
containing replicable genetic packages and target molecules. In
some cases, the potential binding polypeptide can be encoded by a
member of a library of nucleic acid molecules. For example, the
nucleic acid molecules can be cDNA molecules or recombinant
products. In other cases, the potential binding polypeptide can be,
for example, an antibody, or derivative of an antibody. For
example, the potential binding polypeptide can be a scFv or a
Fab.
[0007] The methods of the invention are useful for obtaining
polypeptides that bind to essentially any molecule. For example,
the target molecule can be a polypeptide, an RNA, a DNA, a small
organic molecule and a carbohydrate. The target molecules can be
immobilized directly or indirectly to a solid support. Solid
supports such as a bead, a chip, a microtiter plate, a eukaryotic
cell, or a prokaryotic cell are present in some embodiments of the
invention. The solid supports of the present invention can contain
a variety of materials, such as Sepharose, polystyrene, glass,
silicon oxide, etc.
[0008] In some embodiments, the methods also involve obtaining
replicable genetic packages that specifically bind to the target
molecule. For example, the replicable genetic packages that
specifically bind to the target molecule can be separated from the
bacterial cells after the binding of the phage to the target
molecule. For example, the uncleared cell culture can be separated
from a replicable genetic package-target complex(es) using
aspiration. Once the replicable genetic packages are bound to the
target molecule, some embodiments of the invention can further
involve eluting the replicable genetic packages from the target
molecule. Also, some embodiments involve identifying the replicable
genetic packages that specifically bind to the target molecule with
a detection reagent.
[0009] The present invention also provides compositions containing
an uncleared cell culture, which contains: (a) a population of
replicable genetic packages that display on their surfaces a fusion
protein that includes a surface-displayed replicable genetic
package polypeptide and a potential binding polypeptide; (b) a
complex that is composed of one or members of the library of
replicable genetic packages that specifically bind to the target
molecule; and (c) cells in which the replicable genetic packages
were amplified.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIGS. 1A and 1B show that the binding of HP6054-scFv and
HP6054-Fab phage to human lambda light chain is not affected by the
presence of bacteria in the sample. Antigens were immobilized on
96-well plates (Nunc, Denmark) at 10 .mu.g/ml. A phage ELISA was
conducted using either an uncleared bacterial culture, or
supernatants clarified by centrifugation or filtration. Each bar
represents the mean.+-.s.d. of duplicate samples. FIG. 1A depicts
representative results from the HP6054 scFv-phage, and FIG. 1B is
representative of HP6054 Fab-phage.
[0011] FIG. 2 shows that the sensitivity of phage ELISA is not
impaired by the presence of bacteria. Overnight cultures of HP6002
scFv-phage and HP6025 scFv-phage were mixed at various ratios and
then supernatants or uncleared culture was tested in the phage
ELISA against hIgG2 and hIgG4 (each at 10 .mu.g/ml). Each bar
represents the mean.+-.s.d. of duplicate samples.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS
[0012] Definitions
[0013] "Replicable genetic packages" include virions of
bacteriophage, filamentous phage, or any other eukaryotic virus,
bacterial virus or phage. The term "phage" as used herein
encompasses not only bacteriophage but also other types of
replicable genetic packages, except where the term is used in a
context that dictates a more specific meaning.
[0014] A molecule is "display(ed) on their surface" of a replicable
genetic package if at least part of the molecule is accessible to
the milieu surrounding a replicable genetic package.
[0015] The phrase "specifically (or selectively) binds to" in the
context of a replicable genetic package refers to a binding
reaction which is determinative of the presence of a replicable
genetic package binding to a target molecule(s) in the presence of
a population of other proteins, biologics, and replicable genetic
packages. Thus, under designated binding conditions, a specifically
binding replicable genetic package will bind to a particular
molecule (e.g., target molecule) and under the same designated
binding conditions, native replicable genetic packages do not bind
to a particular molecule in a significant amount. Typically, a
replicable genetic package "specifically" binds to a target
molecule when the number of replicable genetic packages displaying
a potential binding polypeptide that are bound to the target
molecules is at least twice the background binding observed using a
native replicable genetic package as a control.
[0016] An "uncleared cell culture" is an aqueous medium containing
bacterial or eukaryotic cells. Typically, the "uncleared cell
culture" is a growth of bacterial or eukaryotic cells infected with
one or more replicable genetic package clones.
[0017] A "target molecule" is essentially any molecule that is
being used as a probe to identify molecules that will bind to the
target molecule. Examples of target molecules include, without
limitation, amino acids, peptides, proteins, polypeptides,
carbohydrates, small organic molecules, inorganic molecules,
etc.
[0018] A "surface-displayed replicable genetic package polypeptide"
is a polypeptide that is, at least in part, exposed to the milieu
surrounding the virion. Examples of "surface-displayed replicable
genetic package polypeptides" include, without limitation, pIII and
pVIII.
[0019] A "potential binding polypeptide" is a polypeptide that may
possibly bind to the target molecule. A "potential binding
polypeptide" can be screened for its ability to bind to a target
molecule of choice.
[0020] A "replicable genetic package-target complex" is a complex
in which a target molecule is bound to a replicable genetic
package. The target molecule is bound to the replicable genetic
package through the binding domain portion of a polypeptide
displayed on the surface of a replicable genetic package.
[0021] An "antibody" can be derived from sequence of a mammal,
non-mammal (e.g., birds, chickens, fish, etc.), or fully synthetic
antibody sequences. A "mammal" is a member of the class Mammalia.
Examples of mammals include, without limitation, humans, primates,
chimpanzees, rodents, mice, rats, rabbits, sheep, and cows. The
term "antibody" also refers to fragments and substitutes for
antibodies such as F(ab').sub.2, Fab', and Fab fragments.
Additionally the "antibodies" can be single chain antibodies known
as ScFv fragments, which are obtained by recombinantly fusing the
variable regions of the light and heavy chains of the antigen
binding fragment of interest.
[0022] I. Introduction
[0023] The present invention provides methods and compositions for
screening replicable genetic package particles (e.g., phage,
viruses, etc.) that display polypeptides for their ability to bind
to a target molecule. Traditionally, such screening methods
required clearing the host cells or bacteria from an uncleared cell
culture and/or isolating a replicable genetic package stock before
incubation with the target molecule. The methods of the present
invention, however, do not require these procedures. Therefore, the
invention provides significant advantages over previously available
methods for screening phage and other particles, particularly when
used in a high-throughput format.
[0024] Briefly, methods of the invention involve infecting bacteria
or other suitable host cells with phage particles (or incubating
cells that are transfected with a phagemid expression vector with
helper phage) to generate an uncleared cell culture that contains a
library of phage particles. This uncleared culture is then
incubated with a target molecule. Phage particles that display a
polypeptide that binds to the target molecule form a complex with
the target molecule. After an incubation period, the bacterial or
other cells used to amplify the phage can be separated from the
phage particles that bind to the target molecule. The phage
particles that were able to bind to the target molecule can then be
further purified, characterized, amplified, and/or detected, etc.
These methods and compositions will be described in more detail
below.
[0025] II. Replicable Genetic Package Display Libraries
[0026] The methods of the invention are useful for screening a wide
variety of phage display libraries. Phage display and related
techniques provides a powerful method for selecting proteins of
interest from large libraries (Bass et al. (1990) Proteins: Struct.
Funct. Genet. 8: 309; Lowman and Wells (1991) Methods: A Companion
to Methods Enz. 3(3);205-216. Lowman and Wells (1993) J. Mol. Biol.
234;564-578). Each phage or other particle displays a unique
variant protein on its surface and packages the gene encoding that
particular variant. For example, the libraries can be composed of
homogenous or heterogenous populations of phage particles. That is,
each phage in the library can display the same potential binding
polypeptide, or each phage can display a different potential
binding polypeptide. Potential binding polypeptides can serve as
epitopes, ligands, agonists, antagonists, enzymes, etc. For
example, the potential binding polypeptides can encode scFvs and
Fabs.
[0027] Some recent reviews on the phage display technique include,
for example, McGregor (1996) Mol Biotechnol. 6(2): 155-62; Dunn
(1996) Curr. Opin. Biotechnol. 7(5):547-53; Hill et al. (1996) Mol
Microbiol 20(4):685-92; Phage Display of peptides and Proteins: A
Laboratory Manual. B K. Kay, J. Winter, J, McCafferty eds.,
Academic Press 1996; O'Neil et al. (1995) Curr. Opin. Struct. Biol.
5(4):443-9; Phizicky et al. (1995) Microbiol. Rev. 59(1):94123;
Clackson et al. (1994) Trends Biotechnol. 12(5):173-84; Felici et
al. (1995) Biotechnol. Annu. Rev. 1:149-83; Burton (1995)
Immunotechnology 1(2):87-94.) See, also, Cwirla et al., Proc. Natl.
Acad. Sci. USA 87:6378-6382 (1990); Devlin et al., Science 249:
404-406 (1990), Scott & Smith, Science 249: 386-388 (1990);
Ladner et al., U.S. Pat. No. 5,571,698.
[0028] The methods of the invention are applicable to any of the
genetic packages most frequently used for phage display libraries.
These include, for example, bacteriophage, particularly filamentous
phage, and especially phage M13, Fd and F1. (Webster (1996) Chapter
1, Biology of the Filamentous Bacteriophage, in Kay et al., eds.
(1996) Phage Display of Peptides and Proteins). Microbiological
methods for growing, titering, and preparing filamentous phage
particles, and phage DNA are known in the art (Rider et al. (1996)
Chapter 4, Microbiological Methods, in Kay et al., eds. (1996)) and
their genomes are very well characterized. These filamentous phage
have genes which encode the various capsid proteins and are known
as genes III, VI, VII, VIII, and IX (Webster et al., (1996),
supra). The proteins the genes encode are known as pIII, pVI, pVII,
pVIII, and pIX, respectively. The most abundant capsid protein is
pVIII, which has 2700 copies on the surface of the phage.
Approximately 5 copies of pIII are displayed on the phage
particle.
[0029] Typically, libraries of nucleic acid molecules are ligated
into a phage-display vector and introduced into bacteria to create
a library of particles displaying fusion proteins that consist of a
surface-displayed phage polypeptide and a potential binding
polypeptide. Most work has involved inserting nucleic acid
libraries encoding polypeptides to be displayed into either a gIII
or gVIII expression vector in order to produce phage-displayed
fusion protein(s) (See, e.g., Dower, WO 91/19818; Devlin, WO
91/18989; MacCafferty, WO 92/01047 (gene III); Huse, WO 92/06204;
Kang, WO 92/18619 (gene VIII)). These fusion proteins generally
included a signal sequence, usually but not necessarily, from the
phage coat protein, a polypeptide to be displayed and either the
gene III or gene VIII protein or a fragment thereof. Exogenous
coding sequences are often inserted at or near the N-terminus of
gene III or gene VIII, although other insertion sites are possible.
pVIII, however, can only tolerate short inserts--about 5 to 6 amino
acid residues. (Armstrong et al., (1996), supra). Larger peptides
can be displayed as pVIII fusions if pVIII wild-type coat proteins
are interspersed with the recombinant pVIII (Malik et al. (1996)
Chapter 8, Multiple Display of Foreign Peptide Epitopes on
Filamentoisa Bacteriophage Virions, in Kay et al., eds.
(1996)).
[0030] A variety of vectors for displaying pIII and pVIII fusion
proteins in a phage display library have been described (Armstrong
et al. (1996) Chapter 3, Vectors for Phage Display, in Kay et al.,
eds. (1996); Dottavio (1996) Chapter 7, Phagemid-Displayed Peptide
Libraries, in Kay et al., eds. (1996); (Malik et al. (1996) Chapter
8, Multiple Display of Foreign Peptide Epitopes on Filamentous
Bacteriophage Virions, in Kay et al., eds. (1996)) and are
commercially available (e.g., pCANTAB5E, Pharmacia;
.lambda.SurfZap, Stratagene).
[0031] Eukaryotic replicable genetic packages such as eukaryotic
viruses can also be used to display polypeptides in an analogous
manner. For example, display of human heregulin fused to gp70 of
Moloney murine leukemia virus has been reported by Han et al.,
(1995) Proc. Nat'l. Acad. Sci. USA 92: 9747-9751.
[0032] Alternatively, prokaryotic spores can be used as replicable
genetic packages. In this case, polypeptides are displayed from the
outer surface of the spore. For example, spores from B. subtilis
have been reported to be suitable. Sequences of coat proteins of
these spores are described in Donovan et al., J. Mol. Biol. 196:
1-10 (1987). Thus, spores can be used to display the potential
binding polypeptides.
[0033] The nucleic acid libraries encoding the potential binding
polypeptides can be constructed from nucleic acids from a variety
of sources, including cDNA, genomic DNA, synthetic nucleotides
and/or from oligomers encoding randomized peptides (see, e.g., Adey
et al. (1996) Chapter 5, Construction of Random Peptide Libraries
in Bacteriophage M13, in Kay et al., eds. (1996) for descriptions
of randomized peptide libraries). Random peptide libraries have
been constructed using synthetic degenerate oligonucleotides and
expressed as fusions with pIII (Adey et al, (1996), supra). Also,
libraries of antibody and antibody fragments (Fv, scFv and Fab) can
be expressed in phage display systems with pIII (McCafferty and
Johnson (1996) Chapter 6, Construction and Screening of Antibody
Display Libraries, in Kay et al., eds. (1996)). One method of
constructing an antibody phage display library involves generating
nucleic acids encoding antibody fragments from the amplification of
variable domain gene sequences (McCafferty and Johnson (1996),
supra). The fragments can be amplified from nucleic acids isolated
from antigen immunized or non-immunized sources. The nucleic acids
encoding variable heavy and light chain domains are then spliced
together using overlap PCR and ligated into a phage-display vector
to subsequently generate the antibody phage display library
(McCafferty and Johnson (19.96), supra).
[0034] Molecular biological methods that can be used to isolate,
manipulate, and generate the nucleic acid libraries of the present
invention are well known in the art and are detailed in Sambrook et
al., Molecular Cloning, A Laboratory Manual (2.sup.nd ed. 1989);
Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990);
and Current Protocols in Molecular Biology (Ausubel et al., eds.,
(1994)).
[0035] Numerous other methods for constructing phage display
libraries are known in the art. For example, libraries expressing
fragments of a protein can be used to map the epitopes of an
antibody, which can serve as the target molecule (Plessis and
Jordaan (1996) Chapter 9, Phage Libraries Displaying Random
Peptides Derived from a Target Sequence, in Kay et al., eds.
(1996)). Also, once a recombinant phage has been isolated or
constructed, it can be used to construct a second-generation
phage-display library through DNA shuffling (Adey et al. (1996)
Chapter 16, Preparation of Second-Generation Phage Libraries, in
Kay et al., eds. (1996)).
[0036] Once the nucleic acids have been introduced into an
appropriate expression vector, phage particles are obtained. The
vectors are introduced into appropriate host cells and amplified.
Uncleared cell cultures containing libraries of phage particles can
be generated using methods well known in the art (see, e.g., Sparks
et al. (1996) Chapter 13, Screening Phage-Displayed Random Peptide
Libraries, in Kay et al., eds. (1996)). For example, libraries of
phage particles displaying the potential binding polypeptides can
be used to infect bacteria (e.g, E. coli) in order to generate an
uncleared cell culture. Alternatively, a library of nucleic acid
molecules encoding the potential phage binding polypeptides (e.g.,
phagemid vectors) can be introduced into bacteria, which are
subsequently infected with a helper phage (see, e.g., Sparks et
al., (1996) Ch. 13, supra). These procedures can generate a library
of phage particles in an uncleared cell culture.
[0037] III. Screening Replicable Genetic Package-Display
Libraries
[0038] Phage display libraries are screened to obtain phage that
display on their surfaces a polypeptide that has a desired activity
(e.g., the ability to bind to a target molecule). Methods for
screening phage-displayed libraries are known in the art (Sparks et
al. (1996) Chapter 13, supra); McCafferty and Johnson (1996)
Chapter 6, supra; McCafferty (1996) Chapter 15, Phage Display:
Factors Affecting Panning Efficiency, in Kay et al., eds. (1996)).
To date, however, these methods involve either clearing a cell
culture (e.g., by centrifugation, filtration) or isolating the
entire phage library in the culture (e.g., by precipitation,
centrifugation, etc.) for subsequent screening. This represents an
extra step that necessitates the expenditure of extra time and
effort to transfer the container or plate containing the uncleared
cell culture to another format suitable for centrifugation,
filtration, etc. For example, centrifugation of uncleared cell
cultures that have been transferred to or grown in a microtiter
plate requires transferring the plate to a centrifuge. This
requires an operator to move the plate from the bench to the
centrifuge, wait for the centrifugation to take place, and then
remove the cleared culture from the plate to continue with the
screening. These time consuming and unnecessary steps for clarifyng
a bacterial culture in the screening of a phage display library can
be eliminated using the methods of the present invention.
[0039] Screening involves selecting phage that display on their
surface a polypeptide that has a desired biological activity. Often
screening entails identifying phage whose potential binding
polypeptides can bind to a target molecule. In general, enough
clones or pfu should be screened to ensure an adequate
representation of displayed peptides is being screened. Preferably
about 10.sup.5-10.sup.6 pfu would be screened, more preferably at
least about 10.sup.9 pfus would be screened, still more preferably
at least about 10.sup.11-10.sup.12 pfu, would be screened. Often
more than one round of screening will be necessary to identify or
sufficiently enrich the phage particles of interest.
[0040] Suitable target molecules include a wide variety of
molecules and include a molecule for which a practitioner desires
to identify or isolate a polypeptide that will bind to the target
molecule. For example, the target molecule can be an antigen where
a library of phage displaying antibodies (e.g., scFv or Fab) are
being screened to identify antibody sequences that bind to that
particular antigen. Thus, a variety of targets (e.g., peptides,
proteins, carbohydrates, nucleic acids, peptide nucleic acids, RNA,
DNA, small organic molecules (i.e., carbon containing molecules of
100 kDa or less, more preferably 50 kDa or less, still more
preferably 10 kDa or less), inorganic molecules, etc.) can be used
to probe a phage-display library. Essentially, the target can be
any substance that can serve as a ligand for the potential binding
polypeptide of the phage-displayed polypeptide. If possible, a
positive control for the retention of binding activity of the
target for a potential binding polypeptide of interest should be
included in the screening process to ensure proper conditions for
identifying the phage are maintained.
[0041] The immobilization of a target or target-binding molecule to
a solid support can facilitate separation of replicable genetic
packages that can bind to the target molecule from the cells and
unbound replicable genetic packages that are present in the
uncleared cell culture. One or more species of target molecules can
be immobilized directly or indirectly as an array (i.e., a two or
three-dimensional arrangement of molecules) on a solid support.
[0042] Those of skill in the art will recognize a variety of
methods to immobilize a target molecule to a solid support. For
example, the target molecule(s) can be directly or indirectly
immobilized on a solid support (see below). The target molecule can
be immobilized directly to the solid support through covalent and
non-covalent bonds.
[0043] Alternatively, the target molecule can be indirectly bound
to the solid support by coating the solid support with a substance
or molecule that can bind to the target molecule. For example, the
solid support can be coated with strepavidin and the target
molecule can be biotinylated (Sparks et al. (1996), supra). Thus,
the biotinylated target molecules can be immobilized to the
strepavidin coated solid support through the biotin-strepavidin
interaction. Those of skill in the art will also recognize that
immobilized metal affinity substrates can be used in the present
invention to indirectly bind the target molecule to a solid support
(see Ausubel et al., eds., (1994) for review of immobilized metal
affinity technology). For example, solid supports containing Ni-NTA
(nickel-nitrilotriacetic acid) such as Ni-NTA Agarose (Qiagen) or
Ni-NTA Magnetic Agarose Beads (Qiagen) can be used to bind target
molecules having an N-terminal or C-terminal stretch of
poly-histidine (e.g., 6 or more histidines). Ni-NTA Magnetic
Agarose Beads are beads of agarose, containing magnetic particles
and nitrilotriacetic acid (NTA) groups on their surfaces. The
replicable genetic package-target molecule complexes can be
released from a Ni-NTA substrate by an increase in the
concentration of an imidazole in the solution sufficient to disrupt
the poly-histidine-Ni-NTA interaction. Other suitable methods of
indirectly immobilizing target molecules include the binding of a
target having a ligand binding protein moiety to a support that
contains a ligand for the binding protein, e.g., maltose binding
protein and amylose (New England Biolabs); an antibody with an Fc
domain and protein A (Sparks et al. (1996), supra); and
glutathione-S-transferase and glutathione agarose (see e.g.,
Ausubel et al., eds., (1994), supra).
[0044] Alternatively the target can be soluble, i.e., not
immobilized on a solid support. The uncleared cell culture is then
incubated with the soluble target. Any resulting replicable genetic
package-target complexes can subsequently be captured on a solid
support by a target-binding molecule (see, eg., Sparks et al.
(1996) Ch. 13, supra; see also, methods for indirectly binding a
target molecule above).
[0045] After immobilizing the target on the solid support,
non-specific binding of phage to the solid support can be decreased
with agents such as non-fat dry milk or BSA (bovine serum albumin).
Those of skill in the art will recognize other agents that can be
used alone or in combination to decrease non-specific binding such
as a non-ionic detergent (e.g., Tween-20 or Triton-X-100).
[0046] A variety of solid supports can be used in the present
invention. Examples of solid supports include, without limitation,
bead, microtiter plates, chips, prokaryotic and eukaryotic cells.
Beads can be composed of materials such as Sepharose, agarose,
polystyrene, etc. and can be paramagnetic. Microtiter plates are
commercially available in a variety of formats (e.g., 96, 384 and
1536 well plates) and materials (e.g., polystyrene). Chips can be
comprised of a variety of materials, layers and substrates (see,
e.g, WO 00/04389). For example, substances for use solid supports
can be selected from a group consisting of silicon, silica, quartz,
glass, controlled pore glass, carbon, alumina, titania, tantalum
oxide, germanium, silicon nitride, zeolites, and gallium arsenide.
Many metals such as gold, platinum, aluminum, copper, titanium, and
their alloys are also options for solid supports of the present
invention. In addition, many ceramics and polymers may also be used
as solid supports. Polymers which may be used as solid supports
include, but are not limited to, the following: polystyrene;
poly(tetra)fluoroethylene (PTFE); polyvinylidenedifluoride;
polycarbonate; polymethylmethacrylate; polyvinylethylene;
polyethyleneimine; poly(etherether)ketone; polyoxymethylene (POM);
polyvinylphenol; polylactides; polymethacrylimide (PMI);
polyatkenesulfone (PAS); polypropylene; polyethylene;
polyhydroxyethylmethacrylate (HEMA); polydimethylsiloxane;
polyacrylamide; polyimide; and block-copolymers. The solid support
on which the target resides may also be a combination of any of the
aforementioned solid support materials. The solid support can also
be comprised of a eukaryotic or prokaryotic cell.
[0047] IV. Separating the Replicable Genetic Package-Target
Complex(Es) from the Uncleared Cell Culture
[0048] If a population of phage or other particles include members
that can specifically bind to a target molecule, those particles
will bind to, and form a complex with, the target molecule. It is
often desirable to remove the unbound components of the uncleared
cell culture from complex (for example, removing the phage
particles that do not specifically bind to the target molecule, the
cells, and other components of the uncleared cell culture can be
removed). In cases where the target is immobilized, directly or
indirectly, on a solid support, the uncleared culture can be
separated from the replicable genetic package-target complex using
variety of separation methods known in the art. There are many
separation methods known in the art (e.g., filtering, sedimenting,
centrifuging, decanting, precipitation, etc.) that can be used or
adapted for use in the present invention. For example, the where
the target is immobilized on a microtiter plate, the uncleared cell
culture can be aspirated from the well, leaving behind those
replicable genetic packages that are bound to the immobilized
target. Alternatively, the target can be immobilized on a bead and
the uncleared cell culture can be passed through a filter with a
pore size smaller than the bead, but larger than a bacterial cell
(or a eukaryotic cell when using eukaryotic host cells). Another
separation method is the immobilization of a target on a
paramagnetic bead, and the decantation of the uncleared cell
culture leaving the replicable genetic package-target molecule
complex behind bound to the paramagnetic bead held in place with a
magnetic field.
[0049] If a target is used that is free in solution, any resulting
replicable genetic package-target molecule complex(es) can be
subsequently separated from the uncleared cell culture. For
example, the replicable genetic package-target complex can be
incubated in the presence of a third molecule, a target
complex-binding molecule, that is immobilized on a solid support
and does not disrupt the replicable genetic package-target molecule
complex(es). The target complex-binding molecule can bind to either
the soluble target molecule or to the replicable genetic package.
This permits the replicable genetic package-target complex to bind
to the target-binding molecule, thereby indirectly immobilizing the
replicable genetic package-target complex. The uncleared cell
culture can then be separated from the replicable genetic packages
that bind specifically to the target molecule using the separation
methods described above for the first category of replicable
genetic package-target complexes.
[0050] In preferred embodiments, at least 70% of the cells are
separated from the replicable genetic packages that are
specifically bound to the target molecule, more preferably, at
least 80% of the cells are separated from the replicable genetic
packages that are specifically bound to the target molecule, still
more preferably, at least 90% of the cells are separated from the
replicable genetic packages that are specifically bound to the
target molecule, yet still more preferably, substantially all of
the bacterial cells are separated from the replicable genetic
packages that are specifically bound to the target molecule.
[0051] It is sometimes desirable to wash the replicable genetic
package-target complex. The wash can remove undesirable components
of the cell cultures from the specifically bound replicable genetic
packages. The wash can remove cells, non-specifically bound
replicable genetic packages, etc. Often, a wash buffer is used. The
wash buffer can contain a detergent, or other agents, and
compositions that are compatible with replicable genetic
package-target binding to increase the stringency of the screening
process. For example, a wash buffer that can be used in the present
invention is a solution of Tris buffered saline with 0.05%
Tween-20, pH 7.4 (TBST).
[0052] For some applications, it is desirable to elute the
replicable genetic packages that specifically bind to the target
molecule. The replicable genetic packages can then be used for, for
example, further rounds of screening, amplification, detection, or
characterization (e.g., nucleic acid sequencing). Elution can be
accomplished using a variety of methods known in the art. The
replicable genetic packages can be eluted using pH changes, protein
denaturants, or EGTA/EDTA if a metal ion is necessary for
replicable genetic package-target interaction (See e.g., Sparks et
al. (1996) Ch. 13, supra for elution techniques using
phage-display). For example, the replicable genetic packages can be
eluted using an acidic buffer (e.g., glycine-HCl, pH 2) (see, e.g.,
Sparks et al. (1996) Ch. 13, supra). The eluate can then be removed
and neutralized with the addition of a second buffer (e.g.,
NaPO.sub.4 buffer pH 7.5) (see, e.g., Sparks et al. (1996) Ch. 13,
supra). Alternatively, natural or synthetic ligands that interrupt
the replicable genetic package-target complex can be used to elute
the replicable genetic package from the target (Sparks et al.
(1996) Ch. 13, supra).
[0053] If desired, the replicable genetic package(s) can be
amplified in order to increase the number of replicable genetic
package, thus potentially increasing the chance that enough of the
replicable genetic package(s) will be present in the next round for
isolation, identification, or detection, etc. Methods for
amplifying replicable genetic packages in solid and liquid culture
are known in the art (see, e.g., Sparks (1996), Ch. 13, supra, and
Rider et al. (1996) Ch. 4, supra, for methods of amplifying
filamentous bacteriophage).
[0054] Those of skill in the art will recognize that screening
methods of the present invention can be optimized. Furthermore,
skilled artisans will recognize methods of optimizing to determine
the effectiveness of steps and to increase the chances of
identifying the replicable genetic package of interest. For
example, the inclusion of positive and negative controls in the
screening process can facilitate the trouble-shooting and/or
optimization of a screening process.
[0055] V. Detection and Characterization of Replicable Genetic
Packages
[0056] Another aspect of the present invention is that the presence
of cells and other components of an uncleared culture do not
interfere with the detection of particles that specifically bind to
a target molecule. Accordingly, some methods of the present
invention involve contacting the particle-target molecule complex
with a detection reagent prior to removing the cells and/or other
components of the uncleared cell culture.
[0057] The presence of replicable genetic packages that bind to a
target molecule can be detected using a variety of materials and
methods known to those of skill in the art. For example, the
replicable genetic package-target complexes can be incubated with a
detection reagent. Typically, a detection reagent is labeled with a
substance that permits the qualitative or quantitative
determination of the presence or absence of the replicable genetic
package-target complex. The term "labeled" refers to a composition
is that is detectable, either directly or indirectly, by
spectroscopic, photochemical, biochemical, immunochemical, or
chemical means. For example, useful labels include radiolabels
(e.g., H.sup.3, C.sup.13, C.sup.14, P.sup.32, S.sup.35, I.sup.125),
fluorescent dyes, fluorophores, electrondense reagents, enzymes and
their substrates (e.g., as commonly used in enzyme-linked
immunoassays, e.g., alkaline phosphatase and horse radish
peroxidase), biotin-streptavidin, digoxigenin, or haptens and
proteins for which antisera or monoclonal antibodies are available.
The label or detectable moiety is typically bound, either
covalently, through a linker or chemical bound, or through ionic,
van der Waals or hydrogen bonds to the molecule to be detected.
[0058] Detection reagents can include antibodies--such as
antibodies that react with the native form of the phage being used,
e.g., anti-M13KO7 antibody. The antibody itself can be labeled. For
example, horseradish peroxidase (HRP) can be conjugated to an
anti-M13 antibody (Amersham-Pharmacia Biotech, Piscataway, N.J.).
The absorbance of the reaction produce of HRP and
o-Phenylenediamine Dihydrochloride (OPD; Sigma, St. Louis Mo.) can
be monitored with a 490 nm filter (Biorad, Hercules Calif.) after
stopping the reaction with acid.
[0059] The detection of the replicable genetic package-target
complex on the chip could be analyzed using a physical spectroscopy
method, such as mass spectroscopy or surface plasmon resonance
(U.S. Pat. No. 5,641,640). Surface plasmon-resonance has been used
to detect phage-displayed antibody-target interactions (de Haard et
al., (1999)). Chips and surface plasmon resonance instruments are
commercially available (e.g., BIACORE, Uppsala, Sweden) for the
detection of analytes.
[0060] Fluorescence polarization could also be employed by
modifying the target molecule with an appropriate fluorescence
label or fluorophore (Burke et al. (1996) Chapter 18, Measurement
of Peptide Binding Affinities Using Fluorescence Polarization, in
Kay et al., eds. (1996)).
[0061] The replicable genetic package that are bound to a target
can be further characterized as to the genetic or protein makeup of
their potential binding polypeptide(s). In some embodiments, the
nucleic acid sequence of the potential binding polypeptide can be
determined by sequencing the phagemid vector contained in a
particular phage (see e.g., Masecar et al. (1996) Chapter 17,
Nonradioactive Sequencing of Random Peptide Recombinant Phage, in
Kay et al., eds. (1996)). The protein makeup of a phage could be
determined using methods known in the art, such as immunological
assays (e.g., Western blots), two-dimensional gels, mass
spectrometry, etc.
[0062] VI. High-Throughput Screening on an Automated
Workstation.
[0063] In the present invention, high-throughput analysis and
screening of replicable genetic package-display libraries can be
performed on a automated workstation (see e.g., U.S. Pat. No.
5,139,744, "Automated laboratory workstation having module
identification means."). An "automated workstation" is typically a
computer-controlled apparatus which can, through robotic functions,
transfer, mix, and remove liquids from microtiter plates. An
automated workstation can also contain a built-in plate reader,
which can read the absorbance of a liquid in a microtiter well. The
automated workstation can be programmed to carry out a series of
mixing, transfer, and/or removal steps. The automated workstation
will typically have a multi-channel pipettor which can pipette
small amounts of liquid (e.g., microliter amounts) from a vessel to
the well.
[0064] For example, in some embodiments of the present invention,
the automated workstation can transfer uncleared cell culture(s)
into a micro-titer plate. The microtiter plate can have
pre-immobilized target molecule(s) already in the wells. The
automated workstation can subsequently be used to remove uncleared
cell cultures from the wells, wash the wells, or elute the
replicable genetic packages from the immobilized target. Detection
of a replicable genetic package bound to an immobilized target
molecule can also be carried out using an automated workstation.
The automated workstation can be used to add a detection reagent to
the wells. The automated workstation, when equipped with a plate
reader, can monitor the absorbance of the reaction of the detection
reagent in the wells.
EXAMPLES
[0065] The following examples are offered to illustrate, but not to
limit the present invention.
[0066] Example 1
Comparison of Detection of Phage from Uncleared Bacterial Cultures
and Cleared Bacterial Cultures
[0067] This Example describes experiments in which alternatives to
centrifugation or filtration prior to the screening of a
phage-display library were explored. Phage displaying scFvs or Fabs
were generated by PCR amplification of cDNA corresponding to the
heavy and light chain variable regions from the HP6002, HP6025, and
HP6054 hybridomas (Reimer et al. (1984) Hybridoma 3: 263-275)
(cells obtained from ATCC Manassas, Va.; CRL-1788, CRL-1775 and
CRL-1763 respectively). The regions were amplified using the
primers (SEQ ID NOS: 1-84) set out in Table 1:
1TABLE 1 Primer sequences for ScFv and Fab library generation Name
Mer Sequence MCH1-G1R 48 ATTGGCGCGCCTTATTAACAATCCCTGG
GCACAATTTTCTTGTCCACC MCH1-G2A 44 ATTGGCGCGCCTTATTAACAGGGCTTGA
TTGTGGGCCCTCTGGG MCH1-G2B 45 ATTGGCGCGCCTTATTAACAGGGG- TTGA
TTGTTGAAATGGGCCCG MHV-Back1 50 TTATTACTCGCGGCCCAGCCGGCCATGG
CCGATGTGAAGCTTCAGGAGTC MHV-Back2 50 TTATTACTCGCGGCCCAGCCGGCCATGG
CCCAGGTGCAGCTGAAGGAGTC MHV-Back3 50 TTATTACTCGCGGCCCAGCCGGCCATGG
CCCAGGTGCAGCTGAAGCAGTC MHV-Back4 50 TTATTACTCGCGGCCCAGCCGGCCATGG
CCCAGGTTACTCTGAAAGAGTC MHV-Back5 51 TTATTACTCGCGGCCCAGCCGGCCATGG
CCGAGGTCCAGCTGCAACAATCT MHV-Back6 50 TTATTACTCGCGGCCCAGCCGGCCATGG
CCGAGGTCCAGCTGCAGCAGTC MHV-Back7 51 TTATTACTCGCGGCCCAGCCGGCCATGG
CCCAGGTCCAACTGCAGCAGCCT MHV-Back8 50 TTATTACTCGCGGCCCAGCCGGCCATGG
CCGAGGTGAAGCTGGTGGAGTC MHV-Back9 50 TTATTACTCGCGGCCCAGCCGGCCATGG
CCGAGGTGAAGCTGGTGGAATC MHV-Back10 50 TTATTACTCGCGGCCCAGCCGGCCATGG
CCGATGTGAACTTGGAAGTGTC MHV-For1 33 ACCTGGCGCGCCTGCAGAGACAGTGACC
AGAGT MHV-for1b 42 ACCGCCTCCACCTGGCGCGCCTGCAGAG ACAGTGACCAGAGT
MHV-For2 33 ACCTGGCGCGCCTGAGGAGACTGTGAGA GTGGT MHV-for2b 42
ACCGCCTCCACCTGGCGCGCCTGAGGAG ACTGTGAGAGTGGT MHV-For3 33
ACCTGGCGCGCCTGAGGAGACGGTGACT GAGGT MHV-for3b 42
ACCGCCTCCACCTGGCGCGCCTGAGGAG ACGGTGACTGAGGT MHV-For4 33
ACCTGGCGCGCCTGAGGAGACGGTGACC GTGGT MHV-for4b 42
ACCGCCTCCACCTGGCGCGCCTGAGGAG ACGGTGACCGTGGT MKV-back1 39
TCTGGCGGTGGCGGATCGGATGTTTTG- A TGACCCAAACT MKV-Back2 39
TCTGGCGGTGGCGGATCGGATATTGTGA TGACGCAGGCT MKV-Back3 36
TCTGGCGGTGGCGGATCGGATATTGTGA TAACCCAG MKV-Back4 39
TCTGGCGGTGGCGGATCGGACATTGTGC TGACCCAATCT MKV-Back5 39
TCTGGCGGTGGCGGATCGGACATTGTGA TGACCCAGTCT MKV-Back6 39
TCTGGCGGTGGCGGATCGGATATTGTGC TAACTCAGTCT MKV-Back7 39
TCTGGCGGTGGCGGATCGGATATCCAGA TGACACAGACT MKV-Back8 39
TCTGGCGGTGGCGGATCGGACATCCAGC TGACTCAGTCT MKV-Back9 39
TCTGGCGGTGGCGGATCGCAAATTGTTC TCACCCAGTCT MKV-For1 38
GATGGTGATGTGCGGCCGCCCGTTTCAG CTCCAGCTTG MKV-For2 40
GATGGTGATGTGCGGCCGCCCGTTTTAT TTCCAGCTTGGT MKV-For3 39
GATGGTGATGTGCGGCCGCCCGTTTTAT TTCCAACTTTG MKV-For4 40
GATGGTGATGTGCGGCCGCGGATACAGT TGGTGCAGCATC MVH1 55
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAGGTRMAGCTTCAGGAGTCAG- GAC MVH2 55
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAGGTSCAGCTKCAGCAGTCAGGAC MVH3 53
CCTTTCTATGCGGCCCAGCCGGCCATGG CCCAGGTGCAGCTGAAGSASTCAG- G MVH4 55
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAGCTGCAGCTTCAGGAGTCSGGAC MVH5 55
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGARGTCCAGCTGCAACAGTCYG- GAC MVH6 53
CCTTTCTATGCGGCCCAGCCGGCCATGG CCCAGGTCCAGCTKCAGCAATCTGG MVH7 53
CCTTTCTATGCGGCCCAGCCGGCCATGG CCCAGSTBCAGCTGCAGCAGTCTG- G MVH8 55
CCTTTCTATGCGGCCCAGCCGGCCATGG CCCAGGTYCAGCTGCAGCAGTCTGGRC MVH9 53
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAGGTYCAGCTYCAGCAGTCTG- G MVH10 56
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAGGTCCARCTGCAACAATCTGGACC MVH11 54
CCTTTCTATGCGGCCCAGCCGGCCATGG CCCAGGTCCACGTGAAGCAGTCTG- GG MVH12 52
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAGGTGAASSTGGTGGAATCTG MVH13 52
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAVGTGAAGYTGGTGGAGTCTG MVH14 55
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAGGTGCAGSKGGTGGAGTCTGGGG MVH15 54
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAKGTGCAMCTGGTGCAGTCTG- GG MVH16 53
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAGGTGAAGCTGATGGARTCTGG MVH17 55
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAGGTGCARCTTGTTGAGTCTG- GTG MVH18 54
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGARGTRAAGCTTCTCGAGTCTGGA MVH19 53
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAAGTGAARSTTGAGGAGTCTG- G MVH20 54
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAAGTGATGCTGGTGGAGTCTGGG MVH21 55
CCTTTCTATGCGGCCCAGCCGGCCATGG CCCAGGTTACTCTRAAAGWGTSTG- GCC MVH22 53
CCTTTCTATGCGGCCCAGCCGGCCATGG CCCAGGTCCAACTVCAGCARCCTGG MVH23 52
CCTTTCTATGCGGCCCAGCCGGCCATGG CCCAGGTYCARCTGCAGCAGTCTG MVH24 53
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGATGTGAACTTGGAAGTGTCTGG MVH25 53
CCTTTCTATGCGGCCCAGCCGGCCATGG CCGAGGTGAAGGTCATCGAGTCTG- G MVK1 38
TTACTCCGGTCCGCGGACATTGTTCTCA CCCAGTCTCC MVK2 38
TTACTCCGGTCCGCGGACATTGTGCTSA CCCAGTCTCC MVK3 38
TTACTCCGGTCCGCGGACATTGTGATGA CTCAGTCTCC MVK4 38
TTACTCCGGTCCGCGGACATTGTGCTMA CTCAGTCTCC MVK5 38
TTACTCCGGTCCGCGGACATTGTGYTRA CACAGTCTCC MVK6 38
TTACTCCGGTCCGCGGACATTGTRATGA CACAGTCTCC MVK7 38
TTACTCCGGTCCGCGGACATTMAG- ATRA CCCAGTCTCC MVK8 38
TTACTCCGGTCCGCGGACATTCAGATGA MCCAGTCTCC MVK9 38
TTACTCCGGTCCGCGGACATTCAGATGA CDCAGTCTCC MVK10 38
TTACTCCGGTCCGCGGACATTCAGATGA CACAGACTAC MVK11 38
TTACTCCGGTCCGCGGACATTCAGATCA TTCAGTCTCC MVK12 38
TTACTCCGGTCCGCGGACATTGTTCTCA WCCAGTCTCC MVK13 38
TTACTCCGGTCCGCGGACATTGTTCTCT CCCAGTCTCC MVK14 38
TTACTCCGGTCCGCGGACATTGWGCTSA CCCAATCTCC MVK15 37
TTACTCCGGTCCGCGGACATTSTGATGA CCCARTCTC MVK16 38
TTACTCCGGTCCGCGGACATTKTGATGA CCCARACTCC MVK17 38
TTACTCCGGTCCGCGGACATTGTGATGA CTCAGGCTAC MVK18 38
TTACTCCGGTCCGCGGACATTGTGATGA CBCAGGCTGC MVK19 37
TTACTCCGGTCCGCGGACATTGTGATAA CYCAGGATG MVK20 38
TTACTCCGGTCCGCGGACATTGTGATGA CCCAGTTTCG MVK21 38
TTACTCCGGTCCGCGGACATTGTGATGA CACAACCTGC MVK22 38
TTACTCCGGTCCGCGGACATTTTGCTGA CTCAGTCTCC MVK23 38
TTACTCCGGTCCGCGGACATTTTGCTGA CTCAGTCTCC MVK24 38
TTACTCCGGTCCGCGGACATTGTAATGA CCCAATCTCC MVK25 38
TTACTCCGGTCCGCGGACATTGTGATGA CCCACACTCC
[0068] Assembled scFv or Fab DNA sequences were digested with SfiI
and NotI, subcloned into the pCANTAB5E vector (Amersham-Pharmacia
Biotech, Piscataway, N.J.), and transformed into TG1 or XL1-Blue
competent E.coli. Individual clones capable of specific binding to
the target antigen were isolated by conventional methods and then
used to explore alternatives to centrifugation. Single colonies
were picked into 0.1 ml cultures (2.times.YT supplemented with 2%
glucose and 100 .mu.g/ml Ampicillin) in a deep well 96-well plate
and incubated at 37.degree. C. with shaking for 5-6 hours when
cultures reached mid-log phase. Cultures received M13KO7 helper
phage (.about.1.times.10.sup.9 pfu in 5 .mu.l) and were incubated
for 1 hour at 37.degree. C. with shaking. A 50 .mu.l aliquot was
removed to a duplicate deep well plate and 1 ml of media
(2.times.YT supplemented with 100 .mu.g/ml Ampicillin, 50 .mu.g/ml
Kanamycin with or without 1 mM IPTG) was added to wells for
overnight growth at 30.degree. C. Polystyrene plates were coated
with protein antigens (hIgG1.kappa., hIgG1.lambda., or rabbit IgG)
(1-10 .mu.g/ml in 0.1 M sodium bicarbonate pH 9.6) overnight at
4.degree. C., blocked with 3% non-fat dry milk (NFM) in Tris
buffered saline with 0.05% Tween-20 (pH 7.4, TBST), and washed
3.times. in TBST. Aliquots of bacterial culture were removed to a
separate microtiter plate, or to wells in a 96-well filtration
plate (MultiScreen plates from Millipore, Bedford Mass.), a vacuum
was applied slowly, and filtrate collected in a microtiter plate.
The remainder of the culture in the deep well plates was
centrifuged at 1,725.times.g (3,500 rpm in an Eppendorf 5804
equipped with an A2MTP rotor) for 30 minutes at room temperature
(RT).
[0069] Aliquots (80 .mu.l), of clarified phage supernatant,
filtrate, or uncleared bacterial culture were added to the ELISA
plate and mixed with 20 .mu.l of 10% NFM/5.times.PBS directly in
the wells. Plates were incubated without shaking for 1.5 hours at
37.degree. C., then washed 4.times. with TBST (using a Wellwash 4
MK2 platewasher, Labsystems).
[0070] Horseradish peroxidase (HRP)-conjugated anti-M13
antibody(Amersham-Pharmacia Biotech, Piscataway, N.J.) was diluted
1:5000 into 3% NFM/TBST and incubated in wells for 1 hour at
37.degree. C. Following 4 washes with TBST, 100 .mu.l of
o-Phenylenediamine Dihydrochloride (OPD; Sigma, St. Louis Mo.)
substrate was added to wells for approximately 5 minutes prior to
stopping the reaction with 25 .mu.l 3N HCl. Plates were read on a
microplate reader with a 490 nm filter (Biorad, Hercules Calif.).
Assays were performed in duplicate and repeated 2 or 3 times with
similar results.
[0071] The scFv display phage derived from HP6054 bind to the human
lambda light chain antigen (in association with IgG1), but not to
the kappa light chain (hIgG1 Kappa) or to Rabbit IgG (FIG. 1A).
Filtrate generated from the same culture yields an equivalent level
of binding as observed for the supernatant. The uncleared bacterial
culture demonstrated similar levels of binding to the immobilized
antigen, indicating that removal of bacteria by time consuming
centrifugation or costly filtration is not necessary. Furthermore,
no increase in binding was observed to either of the two
non-specific antigens tested, hIgG1.kappa. and rabbit IgG.
[0072] Similar results were observed for phage displaying a Fab
also derived from HP6054 (FIG. 1B). Addition of IPTG adversely
affects the binding of HP6054 scFv-phage (due to reduced bacterial
growth and phage production) and increases the binding of HP6054
Fab-phage (due to increased Fab:gIII fusion production). Although
the level of IPTG did affect the overall binding of the phage
populations, there were no significant differences in levels of
binding observed when ELISA was performed directly on bacteria
containing cultures, or cultures that were clarified by
centrifugation or filtration.
Example 2
Sensitivity of Phase ELISA is not Impaired by the Presence of
Bacteria
[0073] In some applications, assay of a polyclonal population of
phage producing bacteria would be necessary, e.g, library
screening. For example, following several rounds of selection, one
might wish to test the population by ELISA to verify that binding
members have been selected and are present in the population. To
demonstrate that bacteria remaining during the ELISA would not
present a problem when low levels of binding were expected, we grew
independent cultures prior to mixing them at various ratios and
then performed the ELISA on the mixed cultures or
centrifuge-clarified culture supernatants derived from the same
mixtures. A mixture of cultures from two clones was used as a model
system to simulate a polyclonal culture. Growth of a polyclonal
culture involves competition between individuals, which affects the
yield of specific phage. However, the bias that is introduced
during polyclonal growth would exist regardless of the means of
analysis of that culture.
[0074] E.coli carrying phagemid expressing scFv derived from HP6002
(recognizing hIgG2) or HP6025 (recognizing hIgG4) were grown
overnight in the absence of IPTG. Cultures that attained different
densities (OD.sub.600 for HP6002 was 1.2 and 1.0, and HP6025 was
2.1 and 3.3 in two separate trials) were mixed on the basis of
volume. Final volume ratios ranged from a 0.001 to 1000 of
HP6025/HP6002. Aliquots of the mixed culture were compared to
supernatants clarified by centrifugation in the phage ELISA. FIG. 2
demonstrates that clarified phage supernatant and bacterial culture
do not exhibit significant differences in binding at any of the
ratios tested. Therefore, sensitivity of the ELISA does not appear
to be compromised by the presence of bacteria during the binding of
the phage an immobilized antigen.
[0075] Our results demonstrate the phage ELISAs can be performed
directly on bacterial culture and that there is no need to clarify
by centrifugation or filtration. We have successfully used culture
from scFv (5 different antibodies) and Fab (2 different antibodies)
display-phage in our ELISA.
[0076] Additionally, we have used this method for analysis of both
peptides and proteins displayed on the major coat protein (gene
VIII protein) of filamentous phage. To date, no significant
differences between culture and clarified supernatant have been
observed for any display agents or antigen tested by this
method.
[0077] Furthermore, this procedure has worked well with two common
E.coli strains (TG1 cells and XL1-Blue) and overnight cultures of
various densities (OD.sub.600 from 0.1 to 3.3).
[0078] It is understood that the examples and embodiments described
herein are for illustrative purposes only and that various
modifications or changes in light thereof will be suggested to
persons skilled in the art and are to be included within the spirit
and purview of this application and scope of the appended claims.
All publications, patents, and patent applications cited herein are
hereby incorporated by reference for all purposes.
Sequence CWU 1
1
84 1 48 DNA Artificial Sequence Primers for ScFv and Fab library
generation (Table I)- MCH1G1R 1 attggcgcgc cttattaaca atccctgggc
acaattttct tgtccacc 48 2 44 DNA Artificial Sequence Primers for
ScFv and Fab library generation (Table I)- MCH1-G2A 2 attggcgcgc
cttattaaca gggcttgatt gtgggccctc tggg 44 3 45 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table
I)-MCH1-G2B 3 attggcgcgc cttattaaca ggggttgatt gttgaaatgg gcccg 45
4 50 DNA Artificial Sequence Primers for ScFv and Fab library
generation (Table I)- MHV-Back2 4 ttattactcg cggcccagcc ggccatggcc
gatgtgaagc ttcaggagtc 50 5 50 DNA Artificial Sequence Primers for
ScFv and Fab library generation (Table I)- MHC-Back2 5 ttattactcg
cggcccagcc ggccatggcc caggtgcagc tgaaggagtc 50 6 50 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MHC-Back3 6 ttattactcg cggcccagcc ggccatggcc caggtgcagc tgaagcagtc
50 7 50 DNA Artificial Sequence Primers for ScFv and Fab library
generation (Table I)- MHV-Back4 7 ttattactcg cggcccagcc ggccatggcc
caggttactc tgaaagagtc 50 8 51 DNA Artificial Sequence Primers for
ScFv and Fab library generation (Table I)- MHV-Back5 8 ttattactcg
cggcccagcc ggccatggcc gaggtccagc tgcaacaatc t 51 9 50 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MHV-Back6 9 ttattactcg cggcccagcc ggccatggcc gaggtccagc
tgcagcagtc 50 10 51 DNA Artificial Sequence Primers for ScFv and
Fab library generation (Table I)- MHV-Back7 10 ttattactcg
cggcccagcc ggccatggcc caggtccaac tgcagcagcc t 51 11 50 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MHV-Back8 11 ttattactcg cggcccagcc ggccatggcc gaggtgaagc
tggtggagtc 50 12 50 DNA Artificial Sequence Primers for ScFv and
Fab library generation (Table I)- MHV-Back9 12 ttattactcg
cggcccagcc ggccatggcc gaggtgaagc tggtggaatc 50 13 50 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MHV-Back10 13 ttattactcg cggcccagcc ggccatggcc gatgtgaact
tggaagtgtc 50 14 33 DNA Artificial Sequence Primers for ScFv and
Fab library generation (Table I)- MHV-For1 14 acctggcgcg cctgcagaga
cagtgaccag agt 33 15 42 DNA Artificial Sequence Primers for ScFv
and Fab library generation (Table I)- MHV-For1b 15 accgcctcca
cctggcgcgc ctgcagagac agtgaccaga gt 42 16 33 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MHV-For2 16 acctggcgcg cctgaggaga ctgtgagagt ggt 33 17 42 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MHV-for2b 17 accgcctcca cctggcgcgc ctgaggagac tgtgagagtg
gt 42 18 33 DNA Artificial Sequence Primers for ScFv and Fab
library generation (Table I)- MHV-For3 18 acctggcgcg cctgaggaga
cggtgactga ggt 33 19 42 DNA Artificial Sequence Primers for ScFv
and Fab library generation (Table I)- MHV-for3b 19 accgcctcca
cctggcgcgc ctgaggagac ggtgactgag gt 42 20 33 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MHV-For4 20 acctggcgcg cctgaggaga cggtgaccgt ggt 33 21 42 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MHV-for4b 21 accgcctcca cctggcgcgc ctgaggagac ggtgaccgtg
gt 42 22 39 DNA Artificial Sequence Primers for ScFv and Fab
library generation (Table I)- MKV-back1 22 tctggcggtg gcggatcgga
tgttttgatg acccaaact 39 23 39 DNA Artificial Sequence Primers for
ScFv and Fab library generation (Table I)- MKV-Back2 23 tctggcggtg
gcggatcgga tattgtgatg acgcaggct 39 24 36 DNA Artificial Sequence
Primers for ScFv and Fab library generation (Table I)- MKV-Back3 24
tctggcggtg gcggatcgga tattgtgata acccag 36 25 39 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MKV-Back4 25 tctggcggtg gcggatcgga cattgtgctg acccaatct 39 26 39
DNA Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MKV-Back5 26 tctggcggtg gcggatcgga cattgtgatg acccagtct
39 27 39 DNA Artificial Sequence Primers for ScFv and Fab library
generation (Table I)- MKV-Back6 27 tctggcggtg gcggatcgga tattgtgcta
actcagtct 39 28 39 DNA Artificial Sequence Primers for ScFv and Fab
library generation (Table I)- MKV-Back7 28 tctggcggtg gcggatcgga
tatccagatg acacagact 39 29 39 DNA Artificial Sequence Primers for
ScFv and Fab library generation (Table I)- MKV-Back8 29 tctggcggtg
gcggatcgga catccagctg actcagtct 39 30 39 DNA Artificial Sequence
Primers for ScFv and Fab library generation (Table I)- MKV-Back9 30
tctggcggtg gcggatcgca aattgttctc acccagtct 39 31 38 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MKV-For1 31 gatggtgatg tgcggccgcc cgtttcagct ccagcttg 38 32 40 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MKV-For2 32 gatggtgatg tgcggccgcc cgttttattt ccagcttggt
40 33 39 DNA Artificial Sequence Primers for ScFv and Fab library
generation (Table I)- MKV-For3 33 gatggtgatg tgcggccgcc cgttttattt
ccaactttg 39 34 40 DNA Artificial Sequence Primers for ScFv and Fab
library generation (Table I)-MKV-For4 34 gatggtgatg tgcggccgcg
gatacagttg gtgcagcatc 40 35 55 DNA Artificial Sequence Primers for
ScFv and Fab library generation (Table I)- MVH1 35 cctttctatg
cggcccagcc ggccatggcc gaggtrmagc ttcaggagtc aggac 55 36 55 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MVH2 36 cctttctatg cggcccagcc ggccatggcc gaggtscagc
tkcagcagtc aggac 55 37 53 DNA Artificial Sequence Primers for ScFv
and Fab library generation (Table I)- MVH3 37 cctttctatg cggcccagcc
ggccatggcc caggtgcagc tgaagsastc agg 53 38 55 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MVH4 38 cctttctatg cggcccagcc ggccatggcc gaggtgcagc ttcaggagtc
sggac 55 39 55 DNA Artificial Sequence Primers for ScFv and Fab
library generation (Table I)- MVH5 39 cctttctatg cggcccagcc
ggccatggcc gargtccagc tgcaacagtc yggac 55 40 53 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MVH6 40 cctttctatg cggcccagcc ggccatggcc caggtccagc tkcagcaatc tgg
53 41 53 DNA Artificial Sequence Primers for ScFv and Fab library
generation (Table I)- MVH7 41 cctttctatg cggcccagcc ggccatggcc
cagstbcagc tgcagcagtc tgg 53 42 55 DNA Artificial Sequence Primers
for ScFv and Fab library generation (Table I)- MVH8 42 cctttctatg
cggcccagcc ggccatggcc caggtycagc tgcagcagtc tggrc 55 43 53 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MHV9 43 cctttctatg cggcccagcc ggccatggcc gaggtycagc
tycagcagtc tgg 53 44 56 DNA Artificial Sequence Primers for ScFv
and Fab library generation (Table I)- MHV10 44 cctttctatg
cggcccagcc ggccatggcc gaggtccarc tgcaacaatc tggacc 56 45 54 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MHV11 45 cctttctatg cggcccagcc ggccatggcc caggtccacg
tgaagcagtc tggg 54 46 52 DNA Artificial Sequence Primers for ScFv
and Fab library generation (Table I)- MHV12 46 cctttctatg
cggcccagcc ggccatggcc gaggtgaass tggtggaatc tg 52 47 52 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MHV13 47 cctttctatg cggcccagcc ggccatggcc gavgtgaagy
tggtggagtc tg 52 48 55 DNA Artificial Sequence Primers for ScFv and
Fab library generation (Table I)- MHV14 48 cctttctatg cggcccagcc
ggccatggcc gaggtgcags kggtggagtc tgggg 55 49 54 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MVH15 49 cctttctatg cggcccagcc ggccatggcc gakgtgcamc tggtgcagtc
tggg 54 50 53 DNA Artificial Sequence Primers for ScFv and Fab
library generation (Table I)- MVH16 50 cctttctatg cggcccagcc
ggccatggcc gaggtgaagc tgatggartc tgg 53 51 55 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MVH17 51 cctttctatg cggcccagcc ggccatggcc gaggtgcarc ttgttgagtc
tggtg 55 52 54 DNA Artificial Sequence Primers for ScFv and Fab
library generation (Table I)- MVH18 52 cctttctatg cggcccagcc
ggccatggcc gargtraagc ttctcgagtc tgga 54 53 53 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)0
MVH19 53 cctttctatg cggcccagcc ggccatggcc gaagtgaars ttgaggagtc tgg
53 54 54 DNA Artificial Sequence Primers for ScFv and Fab library
generation (Table I)- MVH20 54 cctttctatg cggcccagcc ggccatggcc
gaagtgatgc tggtggagtc tggg 54 55 55 DNA Artificial Sequence Primers
for ScFv and Fab library generation (Table I)- MVH21 55 cctttctatg
cggcccagcc ggccatggcc caggttactc traaagwgts tggcc 55 56 53 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MVH22 56 cctttctatg cggcccagcc ggccatggcc caggtccaac
tvcagcarcc tgg 53 57 52 DNA Artificial Sequence Primers for ScFv
and Fab library generation (Table I)- MVH23 57 cctttctatg
cggcccagcc ggccatggcc caggtycarc tgcagcagtc tg 52 58 53 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)-MVH24 58 cctttctatg cggcccagcc ggccatggcc gatgtgaact
tggaagtgtc tgg 53 59 53 DNA Artificial Sequence Primers for ScFv
and Fab library generation (Table I)- MVH25 59 cctttctatg
cggcccagcc ggccatggcc gaggtgaagg tcatcgagtc tgg 53 60 38 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MVK1 60 ttactccggt ccgcggacat tgttctcacc cagtctcc 38 61
38 DNA Artificial Sequence Primers for ScFv and Fab library
generation (Table I)- MVK2 61 ttactccggt ccgcggacat tgtgctsacc
cagtctcc 38 62 38 DNA Artificial Sequence Primers for ScFv and Fab
library generation (Table I)- MVK3 62 ttactccggt ccgcggacat
tgtgatgact cagtctcc 38 63 38 DNA Artificial Sequence Primers for
ScFv and Fab library generation (Table I)MVK4 63 ttactccggt
ccgcggacat tgtgctmact cagtctcc 38 64 38 DNA Artificial Sequence
Primers for ScFv and Fab library generation (Table I)- MVK5 64
ttactccggt ccgcggacat tgtgytraca cagtctcc 38 65 38 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-MVK6
65 ttactccggt ccgcggacat tgtratgaca cagtctcc 38 66 38 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)-MVK7 66 ttactccggt ccgcggacat tmagatracc cagtctcc 38 67
38 DNA Artificial Sequence Primers for ScFv and Fab library
generation (Table I)-MVK8 67 ttactccggt ccgcggacat tcagatgamc
cagtctcc 38 68 38 DNA Artificial Sequence Primers for ScFv and Fab
library generation (Table I)- MVK9 68 ttactccggt ccgcggacat
tcagatgacd cagtctcc 38 69 38 DNA Artificial Sequence Primers for
ScFv and Fab library generation (Table I)- MVK10 69 ttactccggt
ccgcggacat tcagatgaca cagactac 38 70 38 DNA Artificial Sequence
Primers for ScFv and Fab library generation (Table I)- MVK11 70
ttactccggt ccgcggacat tcagatcatt cagtctcc 38 71 38 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MVK12 71 ttactccggt ccgcggacat tgttctcawc cagtctcc 38 72 38 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MVK13 72 ttactccggt ccgcggacat tgttctctcc cagtctcc 38 73
38 DNA Artificial Sequence Primers for ScFv and Fab library
generation (Table I)- MVK14 73 ttactccggt ccgcggacat tgwgctsacc
caatctcc 38 74 36 DNA Artificial Sequence Primers for ScFv and Fab
library generation (Table I)- MVK15 74 ttactccggt ccgcggacat
ttgatgaccc artctc 36 75 38 DNA Artificial Sequence Primers for ScFv
and Fab library generation (Table I)- MVK16 75 ttactccggt
ccgcggacat tktgatgacc caractcc 38 76 38 DNA Artificial Sequence
Primers for ScFv and Fab library generation (Table I)- MVK17 76
ttactccggt ccgcggacat tgtgatgact caggctac 38 77 38 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MVK18 77 ttactccggt ccgcggacat tgtgatgacb caggctgc 38 78 37 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MVK19 78 ttactccggt ccgcggacat tgtgataacy caggatg 37 79
38 DNA Artificial Sequence Primers for ScFv and Fab library
generation (Table I)- MVK20 79 ttactccggt ccgcggacat tgtgatgacc
cagtttcg 38 80 38 DNA Artificial Sequence Primers for ScFv and Fab
library generation (Table I)- MVK21 80 ttactccggt ccgcggacat
tgtgatgaca caacctgc 38 81 38 DNA Artificial Sequence Primers for
ScFv and Fab library generation (Table I)- MVK22 81 ttactccggt
ccgcggacat tttgctgact cagtctcc 38 82 38 DNA Artificial Sequence
Primers for ScFv and Fab library generation (Table I)- MVK23 82
ttactccggt ccgcggacat tttgctgact cagtctcc 38 83 38 DNA Artificial
Sequence Primers for ScFv and Fab library generation (Table I)-
MVK24 83 ttactccggt ccgcggacat tgtaatgacc caatctcc 38 84 38 DNA
Artificial Sequence Primers for ScFv and Fab library generation
(Table I)- MVK25 84 ttactccggt ccgcggacat tgtgatgacc cacactcc
38
* * * * *