U.S. patent application number 10/698121 was filed with the patent office on 2004-12-16 for inducible ligand for alpha1beta1 integrin and uses.
This patent application is currently assigned to BOYS TOWN NATIONAL RESEARCH HOSPITAL. Invention is credited to Cosgrove, Dominic.
Application Number | 20040253241 10/698121 |
Document ID | / |
Family ID | 32312635 |
Filed Date | 2004-12-16 |
United States Patent
Application |
20040253241 |
Kind Code |
A1 |
Cosgrove, Dominic |
December 16, 2004 |
Inducible ligand for alpha1beta1 integrin and uses
Abstract
The present invention is directed to the identification and use
of agents, particularly peptides and monoclonal antibodies that
disrupt the interaction between Collagen XIII and .alpha.1.beta.1
integrin.
Inventors: |
Cosgrove, Dominic; (Omaha,
NE) |
Correspondence
Address: |
MUETING, RAASCH & GEBHARDT, P.A.
P.O. BOX 581415
MINNEAPOLIS
MN
55458
US
|
Assignee: |
BOYS TOWN NATIONAL RESEARCH
HOSPITAL
Omaha
NE
|
Family ID: |
32312635 |
Appl. No.: |
10/698121 |
Filed: |
October 31, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60423297 |
Nov 1, 2002 |
|
|
|
Current U.S.
Class: |
424/145.1 |
Current CPC
Class: |
A61P 1/16 20180101; A61P
13/12 20180101; C07K 2317/76 20130101; A61P 19/02 20180101; A61P
37/00 20180101; C07K 16/18 20130101; C07K 2317/34 20130101; C07K
16/2803 20130101; A61P 11/00 20180101; A61P 1/04 20180101; A61P
17/06 20180101; A61P 29/00 20180101 |
Class at
Publication: |
424/145.1 |
International
Class: |
A61K 039/395 |
Claims
What is claimed is:
1. A method of treating a patient having a chronic inflammatory
disease, the method comprising administering to the patient a
blocking agent to neutralize the capacity of Collagen XIII to bind
to a .alpha.1.beta.1 integrin.
2. The method of claim 1 wherein the chronic inflammatory disease
is characterized by progressive pathogenesis resulting from
infiltrating monocytes, lymphocytes, or both.
3. The method of claim 1 wherein the chronic inflammatory disease
is renal fibrosis, lung fibrosis, liver fibrosis, rheumatoid
arthritis, psoriasis, experimental colitis, or crescentic
glomerulonephritis.
4. The method of claim 1 wherein the blocking agent is a
peptide.
5. The method of claim 1 wherein the blocking agent is a
neutralizing antibody.
6. The method of claim 1 wherein the blocking agent blocks the
interaction of .alpha.1.beta.1 integrin on peripheral blood
monocytes and/or lymphocytes with Collagen XIII on vascular
endothelium of chronically inflamed tissues.
7. A method for treating a subject having an inflammatory disease
or other condition where integrin .alpha.1.beta.1-positive
interstitial monocyte and/or lymphocyte accumulation is observed,
the method comprising administering to the subject an active agent
that distrupts the interaction between Collagen XIII and
.alpha.1.beta.1 integrin.
8. The method of claim 7 wherein the active agent blocks binding of
Collagen XIII and .alpha.1.beta.1 integrin.
9. The method of claim 8 wherein the blocking agent is a
peptide.
10. The method of claim 8 wherein the blocking agent is an
antibody.
11. The method of claim 7 wherein the inflammatory disease or other
condition is renal fibrosis, lung fibrosis, liver fibrosis,
rheumatoid arthritis, psoriasis, experimental colitis, or
crescentic glomerulonephritis.
12. The method of claim 7 wherein the active agent blocks the
interaction of .alpha.1.beta.1 integrin on peripheral blood
monocytes and/or lymphocytes with Collagen XIII on vascular
endothelium of chronically inflamed tissues.
13. A method of reducing selective efflux of integrin
.alpha.1.beta.1-positive monocytes into the interstitium of
chronically inflamed tissues, the method comprising contacting the
.alpha.1.beta.1 integrin on peripheral blood monocytes and/or
lymphocytes with an active agent that interferes with the
interaction between Collagen XIII and .alpha.1.beta.1 integrin.
14. The method of claim 13 wherein reducing selective efflux of
integrin .alpha.1.beta.1-positive monocytes into the interstitium
of chronically inflamed tissues comprises contacting the alol
integrin with a peptide having at least a portion of the amino acid
sequence of Collagen XIII that binds specifically to
.alpha.1.beta.1 integrin.
15. The method of claim 13 wherein reducing selective efflux of
integrin .alpha.1.beta.1-positive monocytes into the interstitium
of chronically inflamed tissues comprises contacting an antibody
that binds to the Collagen XIII ligand on the cell surface of the
vascular/capillary endothelial cells of inflamed tissues under
conditions effective to block the binding site for Collagen
XIII.
16. The method of claim 13 wherein reducing selective efflux of
integrin .alpha.1.beta.1-positive monocytes into the interstitium
of chronically inflamed tissues comprises contacting the vascular
endothelium with small inhibitory RNAs under conditions effective
to prevent the expression of Collagen XIII protein on the cell
surface.
17. A method of reducing the rate of monocyte and/or lymphocyte
efflux into the interstitial space of chronically inflamed tissues,
the method comprising blocking Collagen XIII from binding with
.alpha.1.beta.1 integrin.
18. The method of claim 17 wherein the blocking comprises blocking
the Collagen XIII ligand.
19. The method of claim 17 wherein the blocking comprises blocking
.alpha.1.beta.1 integrin.
20. The method of claim 17 wherein blocking comprises contacting
the integrin with a peptide fragment of Collagen XIII containing
the binding site for .alpha.1.beta.1 integrin.
21. The method of claim 17 wherein blocking comprises contacting
the Collagen XIII ligand with a mono-specific antibody.
22. A method of reducing the rate of monocyte and/or lymphocyte
efflux into the interstitial space of chronically inflamed tissues,
the method comprising blocking Collagen XIII from binding with
.alpha.1.beta.1 integrin.
23. A method of blocking the interaction of .alpha.1.beta.1
integrin on peripheral blood monocytes and/or lymphocytes with
Collagen XIII on vascular endothelium of chronically inflamed
tissues, the method comprising contacting the monocytes and/or
lympocytes, the vascular endothelium, or both with an agent that
either occupies the Collagen XIII binding site on .alpha.1.beta.1
integrin or blocks the .alpha.1.beta.1 binding site on Collagen
XIII.
24. The method of claim 23 wherein the agent that occupies the
Collagen XIII binding site on .alpha.1.beta.1 integrin is a peptide
inhibitor.
25. The method of claim 23 wherein the agent that blocks the
.alpha.1.beta.1 binding site on Collagen XIII is a neutralizing
monoclonal antibody.
26. A method of identifying an agent that inhibits the efflux of
monocytes into the interstitial space of a model where interstitial
monocytes or lymphocytes are implicated, the method comprising
identifying an agent that distrupts the interaction between
Collagen XIII and .alpha.1.beta.1 integrin.
27. The method of claim 26 wherein the agent inhibits binding of
Alexa-conjugated purified .alpha.1.beta.1 integrin to MCP-1 treated
primary endothelial cells.
28. The method of claim 26 wherein the agent is an antibody that
blocks the interaction of Alexa-conjugated purified .alpha.1.beta.1
integrin to MCP-1-treated vascular endothelial cells in
culture.
29. An isolated peptide having the sequence GAEGSPGL (SEQ ID NO.
1), wherein the peptide distrupts the interaction between Collagen
XIII and .alpha.1.beta.1 integrin.
30. The isolated peptide of claim 29 having the sequence
GEKGAEGSPGLL (SEQ ID NO:2).
31. The isolated peptide of claim 29 having 8-16 amino acids.
32. The isolated peptide of claim 31 having 12-16 amino acids.
33. An isolated peptide consisting of GAEGSPGL (SEQ ID NO. 1).
34. An isolated peptide consisting of GEKGAEGSPGLL (SEQ ID
NO:2).
35. An isolated peptide having an amino acid sequence that has at
least 70% sequence identity to GAEGSPGL (SEQ ID NO. 1), wherein the
peptide distrupts the interaction between Collagen XIII and
.alpha.1.beta.1 integrin.
36. An isolated peptide having an amino acid sequence that has at
least 70% sequence identity to GEKGAEGSPGLL (SEQ ID NO:2), wherein
the peptide distrupts the interaction between Collagen XIII and
.alpha.1.beta.1 integrin.
37. An antibody to the peptide of claim 29.
38. An antibody to the peptide of claim 30.
39. An antibody to the peptide of claim 33.
40. An antibody to the peptide of claim 34.
41. An antibody to the peptide of claim 35.
42. An antibody to the peptide of claim 36.
Description
BACKGROUND
[0001] A specific integrin receptor, integrin .alpha.1.beta.1,
plays a role in the progression of interstitial disease associated
with Alport syndrome. This effect was illustrated by crossing the
Alport mouse with a knockout mouse for the integrin .alpha.1 gene
(Cosgrove et al., Am. J. Path., 157, 1649-1659 (2000)). The
integrin knockout mutation has no obvious effect on renal
development or function in normal mice, even though it is widely
expressed in the kidney (Gardner et al., Dev. Biol. 175, 301-313
(1996)). When the .alpha.1 integrin mutation was added to the
genetic background of the Alport mouse, however, both glomerular
and tubulointerstitial disease were markedly attenuated.
Attenuation of the glomerular pathogenesis was linked to the effect
on mesangial expansion and the deposition of mesangial laminins in
the GBM (Cosgrove et al., Am. J. Path., 157, 1649-1659 (2000)). The
effect of the .alpha.1 integrin null mutation on tubulointerstitial
disease, however, was less clear.
SUMMARY
[0002] The present invention is based on the discovery of the
presence of a specific inducible ligand on the vascular endothelial
cell surface of Alport mouse kidneys. Significantly, this provides
for a wide variety of therapeutic methods and for methods of
identifying compounds (e.g., small organic molecules and peptides)
suitable for use in such therapeutic methods.
[0003] Preferably, the specific inducible ligand is present on the
vascular endothelial cell surface of Alport mouse kidneys, but not
normal kidneys. The ligand binds to purified integrin
.alpha.1.beta.1, and monocytes in Alport kidneys are integrin
.alpha.1.beta.1-positive. Newly effluxed monocytes, based on
monocyte trafficking assays, are integrin
.alpha.1.beta.1-postitive, while only a fraction of the bone
marrow-derived monocytes (10%) are integrin
.alpha.1.beta.1-positive. The rate of monocyte efflux in integrin
.alpha.1.beta.1-deficient Alport (DKO) mice is much slower than
that no Alport mice. Functionally blocking the ligand by injection
with purified integrin .alpha.1.beta.1 (purchased from Chemicon,
Temecula, Calif.) reduces the rate of monocyte efflux into the
interstitial space of Alport kidneys. Combined, this evidence
proves the existence of an inducible ligand for integrin
.alpha.1.beta.1 on Alport vascular endothelium, which mediates
selective efflux of integrin .alpha.1.beta.1-positive monocytes
into the interstitium. The DKO data showing delayed onset of efflux
with a much slower rate of efflux, combined with the ligand
blocking data by injection of purified .alpha.1.beta.1 integrin,
illustrate that functionally blocking this ligand (defined as the
substance in the kidneys that binds Alexa-labeled integrin
.alpha.1.beta.1, within 6 hours of injecting this reagent into the
tail vein of a 7 week old Alport mouse in a pure 129 Sv/J genetic
background) will reduce the rate of monocyte efflux, which would be
therapeutically beneficial for any chronic inflammatory disease
where integrin .alpha.1.beta.1-positive interstitial
monocyte/lymphocyte accumulation is observed.
[0004] In one embodiment, the present invention provides a method
of treating a patient having a chronic inflammatory disease. The
method includes administering to the patient a blocking agent
(e.g., a peptide or a neutralizing antibody) to neutralize the
capacity of Collagen XIII to bind to a .alpha.1.beta.1 integrin.
The chronic inflammatory disease is preferably characterized by
progressive pathogenesis resulting from infiltrating monocytes,
lymphocytes, or both. Examples of such chronic inflammatory
diseases include renal fibrosis, lung fibrosis, liver fibrosis,
rheumatoid arthritis, psoriasis, experimental colitis, or
crescentic glomerulonephritis. Preferably, the blocking agent
blocks the interaction of .alpha.1.beta.1 integrin on peripheral
blood monocytes and/or lymphocytes with Collagen XIII on vascular
endothelium of chronically inflamed tissues.
[0005] In another embodiment, the present invention provides a
method for treating a subject having an inflammatory disease or
other condition where integrin .alpha.1.beta.1-positive
interstitial monocyte and/or lymphocyte accumulation is observed.
The method involves administering to the subject an active agent
that disrupts the interaction between Collagen XIII and
.alpha.1.beta.1 integrin. Preferably, the active agent blocks
binding of Collagen XIII (on vascular endothelium of chronically
inflamed tissues) and .alpha.1.beta.1 integrin (on peripheral blood
monocytes and/or lymphocytes). Preferably, the blocking agent is a
peptide or an antibody. Preferably, the inflammatory disease or
other condition is renal fibrosis, lung fibrosis, liver fibrosis,
rheumatoid arthritis, psoriasis, experimental colitis, or
crescentic glomerulonephritis.
[0006] In another embodiment, the present invention provides a
method of reducing selective efflux of integrin
.alpha.1.beta.1-positive monocytes into the interstitium of
chronically inflamed tissues. The method involves contacting the
.alpha.1.beta.1 integrin on peripheral blood monocytes and/or
lymphocytes with an active agent that interferes with the
interaction between Collagen XIII and .alpha.1.beta.1 integrin.
This can be accomplished in several different ways. For example,
reducing selective efflux of integrin .alpha.1.beta.1-positive
monocytes into the interstitium of chronically inflamed tissues
involves contacting the .alpha.1.beta.1 integrin with a peptide
having at least a portion of the amino acid sequence of Collagen
XIII that binds specifically to .alpha.1.beta.1 integrin.
Alternatively, reducing selective efflux of integrin
.alpha.1.beta.1-positive monocytes into the interstitium of
chronically inflamed tissues involves contacting an antibody that
binds to the Collagen XIII ligand on the cell surface of the
vascular/capillary endothelial cells of inflamed tissues under
conditions effective to block the binding site for Collagen XIII.
In yet another alternative embodiment, reducing selective efflux of
integrin .alpha.1.beta.1-positiv- e monocytes into the interstitium
of chronically inflamed tissues involves contacting the vascular
endothelium with small inhibitory RNAs under conditions effective
to prevent the expression of Collagen XIII protein on the cell
surface.
[0007] In another embodiment, the present invention provides a
method of reducing the rate of monocyte and/or lymphocyte efflux
into the interstitial space of chronically inflamed tissues. The
method involves blocking Collagen XIII from binding with
.alpha.1.beta.1 integrin. This can occur by blocking the Collagen
XIII ligand or it can occur by blocking .alpha.1.beta.1 integrin.
In one embodiment, the blocking agent is a peptide fragment of
Collagen XIII containing the binding site for .alpha.1.beta.1
integrin. In an alternative embodiment, the blocking agent is a
mono-specific antibody that binds Collagen XIII on the
vascular/capillary endothelial cell surface of inflamed
tissues.
[0008] In yet another embodiment, the present invention provides a
method of reducing the rate of monocyte and/or lymphocyte efflux
into the interstitial space of chronically inflamed tissues. The
method involves blocking Collagen XIII from binding with
.alpha.1.beta.1 integrin.
[0009] In another embodiment, the present invention provides a
method of blocking the interaction of .alpha.1.beta.1 integrin on
peripheral blood monocytes and/or lymphocytes with Collagen XIII on
vascular endothelium of chronically inflamed tissues. The method
involves contacting the monocytes and/or lympocytes, the vascular
endothelium, or both with an agent that either occupies the
Collagen XIII binding site on .alpha.1.beta.1 integrin (e.g., a
peptide inhibitor) or blocks the .alpha.1.beta.1 binding site on
Collagen XIII (e.g., a neutralizing monoclonal antibody).
[0010] The present invention provides a method of identifying an
agent that inhibits the efflux of monocytes into the interstitial
space of a model where interstitial monocytes or lymphocytes are
implicated. The method involves identifying an agent that distrupts
the interaction between Collagen XIII and .alpha.1.beta.1 integrin.
In one embodiment, the agent inhibits binding of Alexa-conjugated
purified .alpha.1.beta.1 integrin to MCP-1 treated primary
endothelial cells. In an alternative embodiment, the agent is an
antibody that blocks the interaction of Alexa-conjugated purified
.alpha.1.beta.1 integrin to MCP-1-treated vascular endothelial
cells in culture.
[0011] The present invention also provides an isolated peptide
having the sequence GAEGSPGL (SEQ ID NO. 1), wherein the peptide
distrupts (e.g., blocks) the interaction between Collagen XIII and
.alpha.1.beta.1 integrin. Preferably, the isolated peptide has the
sequence GEKGAEGSPGLL (SEQ ID NO:2). In certain embodiments, the
isolated peptide is 8-16 amino acids in length. In other
embodiments, the isolated peptide is 12-16 amino acids in length.
For certain embodiments, the isolated peptide consists of GAEGSPGL
(SEQ ID NO. 1). For certain embodiments, the isolated peptide
consists of GEKGAEGSPGLL (SEQ ID NO:2).
[0012] The present invention also provides an isolated peptide
having an amino acid sequence that has at least 70% sequence
identity to GAEGSPGL (SEQ ID NO. 1), wherein the peptide distrupts
the interaction between Collagen XIII and .alpha.1.beta.1 integrin.
In another embodiment, the present invention provides an isolated
peptide having an amino acid sequence that has at least 70%
sequence identity to GEKGAEGSPGLL (SEQ ID NO:2), wherein the
peptide distrupts the interaction between Collagen XIII and
.alpha.1.beta.1 integrin.
[0013] The present invention also provides antibodies to the
peptides described herein.
[0014] As used herein, "a" or "an" means one or more (or at least
one), such that combinations of active agents (i.e., active
oxidative stress regulators), for example, can be used in the
compositions and methods of the invention. Thus, a composition that
includes "a" polypeptide refers to a composition that includes one
or more polypeptides.
[0015] "Amino acid" is used herein to refer to a chemical compound
with the general formula: NH.sub.2--CRH--COOH, where R, the side
chain, is H or an organic group. Where R is organic, R can vary and
is either polar or nonpolar (i.e., hydrophobic). The amino acids of
this invention can be naturally occurring or synthetic (often
referred to as nonproteinogenic). As used herein, an organic group
is a hydrocarbon group that is classified as an aliphatic group, a
cyclic group or combination of aliphatic and cyclic groups. The
term "aliphatic group" means a saturated or unsaturated linear or
branched hydrocarbon group. This term is used to encompass alkyl,
alkenyl, and alkynyl groups, for example. The term "cyclic group"
means a closed ring hydrocarbon group that is classified as an
alicyclic group, aromatic group, or heterocyclic group. The term
"alicyclic group" means a cyclic hydrocarbon group having
properties resembling those of aliphatic groups. The term "aromatic
group" refers to mono- or polycyclic aromatic hydrocarbon groups.
As used herein, an organic group can be substituted or
unsubstituted.
[0016] The terms "polypeptide" and "peptide" are used
interchangeably herein to refer to a polymer of amino acids. These
terms do not connote a specific length of a polymer of amino acids.
Thus, for example, the terms oligopeptide, protein, and enzyme are
included within the definition of polypeptide or peptide, whether
produced using recombinant techniques, chemical or enzymatic
synthesis, or naturally occurring. This term also includes
polypeptides that have been modified or derivatized, such as by
glycosylation, acetylation, phosphorylation, and the like.
[0017] The following abbreviations are used throughout the
application:
1 A = Ala = Alanine T = Thr = Threonine V = Val = Valine C = Cys =
Cysteine L = Leu = Leucine Y = Tyr = Tyrosine I = Ile = Isoleucine
N = Asn = Asparagine P = Pro = Proline Q = Gln = Glutamine F = Phe
= Phenylalanine D = Asp = Aspartic Acid W = Trp = Tryptophan E =
Glu = Glutamic Acid M = Met = Methionine K = Lys = Lysine G = Gly =
Glycine R = Arg = Arginine S = Ser = Serine H = His = Histidine
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIGS. 1A and 1B. Monocytes in Alport interstitium are
predominantly integrin .alpha.1.beta.1-positive. Panels show
immunofluorescence immunostaining of tissue sections from Alport
renal cortex at indicated ages using antibodies against CD11b (FIG.
1A) and integrin .alpha.1.beta.1 (FIG. 1B). Note that all monocytes
are immunopositive for .alpha.1.beta.1 integrin.
[0019] FIGS. 2A-2E. About 10% of bone marrow-derived monocytes
express integrin .alpha.1.beta.1. Fluorescence activated cell
sorting (FACS) using antibody markers for monocytes (CD11 bPE) and
integrin .alpha.1.beta.1 (VLA Alexa), and isotype matched control
antibodies were used for two color analysis of bone marrow-derived
lymphocytes. About 10% of the CD11b-positive cells were also
positive for integrin .alpha.1.beta.1 (FIG. 2E, double-positive
cells in the upper right hand quadrant of the histogram).
[0020] FIGS. 3A-3D. Tail vein injection of Alexa 568-labeled
dextrans allows trafficking of CD11b-positive monocytes; all
monocytes recruited to the tubulointerstitium of Alport mice are
positive for integrin .alpha.1.beta.1. A 7-week-old Alport mouse
was injected with 1 .mu.g of Alexa-568-conjugated dextrans. Three
days following the injection, kidneys were harvested, embedded in
OCT aqueous embedding media, and cryosectioned. Tissue sections
were immunostained with either FITC-conjugated anti integrin
.alpha.1.beta.1-specific antibodies (FIG. 3C), or FITC-conjugated
anti-CD11b antibodies (FIG. 3A). The results clearly indicate that
the Alexa-labeled cells newly infiltrated into the Alport
tubulointerstitium are all monocytes, and are all integrin
.alpha.1.beta.1-positive. FIGS. 3B and 3D show the
Alexa568-positive cells in the interstitium of Alport kidneys 3
days following tail vein injection of Alexa 568-conjugated
dextrans. Only monocytes (CD11b is a specific marker for monocytes)
are labeled (all fluorescent signals in FIG. 3B line up with
fluorescent signals in FIG. 3A). Newly effluxed monocytes (FIG. 3D)
are all immuno-positive for integrin a1b1 (VLA1, FIG. 3C).
[0021] FIGS. 4A and 4B. Monocyte efflux is delayed, and the rate of
monocyte efflux is reduced in the renal cortex of integrin
.alpha.1.beta.1-deficient Alport mice relative to Alport mice.
Blocking this ligand using purified .alpha.1.beta.1 integrin may
reduce the rate of monocyte efflux into the interstitium. FIG. 4A.
Monocyte trafficking assessed via tail vein injection of Alexa
568-labelled dextrans was analyzed in Alport mice relative to
.alpha.1.beta.1-integrin-deficient (DKO) Alport mice as a function
of renal disease development. Data points represent twenty fields
(at 200.times. magnification) for two independent animals. Only
CD11b-positive/Alexa-positive signals were scored, using Image
Pro-Plus (Media Cybernetics, Bethesda, Md.) software. The clearly
data indicate that the onset of monocyte efflux is delayed in DKO
mice relative to Alport mice. The slopes of the curves (derived
from linear regression using Sigma Plot (Sigma, St. Louis, Mo.)
software) indicate that the rate of monocyte efflux in DKO mice is
markedly lower than that for Alport mice. FIG. 4B. Alport mice were
either injected or not with 5 .mu.g of purified .alpha.1.beta.1
integrin one day before injection with labeled dextrans, and
boosted with 5 .mu.g each day until three days following labeled
dextran injection. Cryosections were stained for monocytes
(anti-cd11b) and dual labeled cells counted as above. Results
indicate a reduction in monocyte efflux in mice injected with the
purified integrin, defining that the functions to mediate efflux
monocytes into the tubulointerstitial space. Bars represent
standard error.
[0022] FIGS. 5A-5C. .alpha.1.beta.1 integrin binds the vascular
endothelium of Alport kidneys, but not normal kidneys. Purified
.alpha.1.beta.1 integrin was conjugated to Alexa 568 fluorochrome
and injected in to the tail vein of normal (A) and Alport (B) mice.
After 24 hours, kidneys were harvested, cryosectioned, and imaged
using a fluorescence microscope. FIG. 5C shows that Alexa-labeled
integrin binding is not phagocytized integrin in monocytes, since
the two signals (compare the location of signal in FIG. 5B with
signal in FIG. 5C) do not co-localize.
[0023] FIG. 6. Collagen XIII mRNA is induced in vascular
endothelial cells from Alport mice compared to controls.
Endothelial cells were isolated from wild type and Alport kidneys
then RNA extracted. Reverse transcribed RNA with oligo dT primers.
PCR amplified with GAPDH (lanes 1-3) and Collagen XIII-880 bp
(lanes 4-6). Lane 1: Water control GAPDH; Lane 2: Wild type GAPDH;
Lane 3: Alport GAPDH; Lane 4: Water control Col XIII; Lane 5: Wild
type Col XIII; Lane 6: Alport Col XIII; and Lane M: 100 bp
ladder.
[0024] FIG. 7. MCP-1 promotes endothelial cell binding of VLA1
recombinant protein in vitro. Cultured primary endothelial cells
from mouse kidenys were treated with the indicated concentrations
of recombinant MCP-1. Triplicate wells were analyzed for the
capacity to bind to purified fluorochrome-conjugated integrin
.alpha.1.beta.1. Data represents the mean and standard deviation
for three independent experiments.
[0025] FIG. 8. Hydrogen peroxide promotes endothelial cell binding
of VLA1 recombinant protein in vitro. Cultured primary endothelial
cells from mouse kidneys were treated with the indicated
concentrations of hydrogen peroxide. Triplicate wells wre analyzed
for the capacity to bind to purified fluorochrome-conjugated
integrin .alpha.1.beta.1. Data represents the mean and standard
deviation for three independent experiments.
[0026] FIG. 9. Indirect immunoprecipitation of Collagen XIII from
cultured renal endothelial cells. Either untreated or MCP-1 treated
primary endothelial cells were subjected to indirect
immunoprecipitation analysis. Cells were lysed and purified
.alpha.1.beta.1 integrin added to the lysate. Complexes were
immunoprecipitated with anti-.alpha.1 integrin antibodies. The
immunoprecipitate was analyzed by western blot probed with
anti-collagen XIII antibodies. The expected bands for Collagen XIII
(93 and 115 kilodaltons, respectively) are denoted with
arrowheads.
[0027] FIG. 10. Collagen XIII co-localizes with the vascular
endothelial cells marker CD31 in Alport kidneys, but not normal
kidneys. Immunofluorescence analysis was performed on kidney
cryosections from normal controls and Alport mice using antibodies
against either Collagen XIII or CD31. In the boxed in regions is an
area where Collagen XIII is clearly lining up with the vascular
endothelium. These regions were only observed in fibrosing
kidneys.
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS OF THE
INVENTION
[0028] The present invention is based on the discovery of the
presence of a specific inducible ligand on the vascular endothelial
cell surface of Alport mouse kidneys. Significantly, this provides
for a wide variety of therapeutic methods aimed at distrupting the
interaction between the inducible ligand and its receptor
(.alpha.1.beta.1 integrin).
[0029] The specific inducible ligand is Collagen XIII. Collagen
XIII mRNA is induced in endothelial cells from Alport kidneys
relative to controls. The binding of purified .alpha.1.beta.1
integrin is induced by MCP-1 and hydrogen peroxide. Labeled
.alpha.1.beta.1 integrin injected into the tail vein of Alport
mice, but not normal mice, binds to the vascular endothelium. It
should be noted, however, that basal levels of Collagen XIII
expression are observed on vascular endothelium of normal mice and
untreated endothelial cell cultures. It is likely that other
factors contribute to the "inducible" binding. Likely candidates
are the selectins, which are a family of proteins that promote
"slow rolling" of lymphocytes, monocytes, and b-cells on the
vascular endothelium. This slow rolling is required to promote firm
adhesion via more classical ligand/receptor interactions. The
selectins are induced on the vascular endothelium of inflammatory
tissues, but not normal tissues.
[0030] Significantly, the present invention provides methods for
treating inflammatory diseases or other conditions where integrin
.alpha.1.beta.1-positive interstitial monocyte and/or lymphocyte
accumulation is observed. Such methods involve administering to a
subject afflicted with such a condition an active agent that
distrupts (e.g., blocks or otherwise neutralizes) the interaction
between the inducible ligand Collagen XIII and its receptor
.alpha.1.beta.1 integrin. Such conditions include, for example,
renal fibrosis, lung fibrosis, liver fibrosis, rheumatoid
arthritis, psoriasis, experimental colitis, and crescentic
glomerulonephritis. The present invention also provides methods of
identifying agents (e.g., small organic molecules, peptides,
antibodies, SiRNAs) suitable for use in such therapeutic
methods.
[0031] Specifically, the following discoveries are presented
herein: the inducible ligand binds to purified integrin
.alpha.1.beta.1; all monocytes in Alport kidneys are integrin
.alpha.1.beta.1-positive; newly effluxed monocytes, based on
monocyte trafficking assays, are all integrin
.alpha.1.beta.1-postitive, while only a fraction of the bone
marrow-derived monocytes (10%) are integrin
.alpha.1.beta.1-positive; the rate of monocyte efflux in integrin
.alpha.1.beta.1-deficient Alport (DKO) mice is much slower than
that no Alport mice; and functionally blocking the ligand by
injection with purified integrin .alpha.1.beta.1 reduces the rate
of monocyte efflux into the interstitial space of Alport kidneys.
Combined, this evidence proves the existence of an inducible ligand
for integrin .alpha.1.beta.1 on Alport vascular endothelium, which
mediates selective efflux of integrin .alpha.1.beta.1-positive
monocytes into the interstitium.
[0032] Thus, the present invention provides a method of
blocking/reducing selective efflux of integrin
.alpha.1.beta.1-positive monocytes into the interstitium of
chronically inflamed tissues. This method involves contacting the
.alpha.1.beta.1 integrin on circulating peripheral blood
monocytes/lymphocytes with an active agent described herein (e.g.,
a peptide with the composition of the portion of Collagen XIII that
binds specifically to .alpha.1.beta.1 integrin). Alternatively,
this method involves the administration of an active agent (e.g., a
humanized mono-specific antibody preparation) that will bind to the
Collagen XIII ligand on the cell surface of the vascular/capillary
endothelial cells of inflamed tissues in such a way that the bound
active agent (e.g., antibody) blocks the binding site for Collagen
XIII, thus preventing the binding of .alpha.1.beta.1 integrin on
the peripheral blood monocytes/lymphocytes with the Collagen XIII
on the vascular/capillary endothelial cells. Further, this method
can involve the use of active agents (e.g., small inhibitory RNAs)
that are targeted to the vascular endothelium in such a way as to
prevent the expression of Collagen XIII protein on the cell
surface, thus preventing/reducing the adhesion/transendothelial
migration of .alpha.1.beta.1 integrin-positive
monocytes/lymphocytes into inflamed tissues.
[0033] The DKO data showing delayed onset of efflux with a much
slower rate of efflux, combined with the ligand blocking data by
injection of purified .alpha.1.beta.1 integrin, illustrate that
functionally blocking this ligand (defined as the substance in the
kidneys that binds Alexa-labeled integrin .alpha.1.beta.1, within 6
hours of injecting this reagent into the tail vein of a 7 week old
Alport mouse in a pure 129 Sv/J genetic background) will reduce the
rate of monocyte efflux.
[0034] Thus, the present invention provides a method of reducing
the rate of monocyte (and/or lymphocyte) efflux into the
interstitial space of chronically inflamed tissues. This method
involves blocking Collagen XIII from binding with .alpha.1.beta.1
integrin, especially as the .alpha.1.beta.1 integrin receptor is
presented to the Collagen XIII ligand on the surface of circulating
peripheral blood monocytes or lymphocytes, by contacting the
.alpha.1.beta.1 integrin on the cell surface of lymphocytes and/or
monocytes with an agent that distrupts (e.g., blocks or otherwise
neutralizes) the interaction between Collagen XIII and
.alpha.1.beta.1 integrin. This can result from the use of an active
agent such as apeptide fragment of Collagen XIII containing the
binding site for .alpha.1.beta.1 integrin, for example.
Alternatively, this method can involve the use of an active agent,
such as a mono-specific antibody, that binds Collagen XIII on the
vascular/capillary endothelial cell surface of inflamed tissues in
such a way as to block the ability of Collagen XIII on the vascular
endothelial cells from interacting (e.g., binding) with
.alpha.1.beta.1 integrin on the circulating peripheral blood
monocytes/lymphocytes, thus preventing/reducing adhesion and
transmigration of integrin .alpha.1.sym.1-positive
lymphocytes/monocytes into the interstitial spaces of the inflamed
tissues.
[0035] Bone marrow transfer studies with Alexa-568 dextran-loaded
monocytes showed a significant decrease in the rate of monocyte
efflux for cells derived from .alpha.1 integrin null mice compared
to controls. Using a phage display approach for detecting
interacting binding partners, Collagen XIII was identified as the
endothelial cell ligand for .alpha.1.beta.1 integrin. This unique
membrane bound collagen has been previously shown to bind
.alpha.1.beta.1 integrin, but its function prior to the findings
documented herein, was unknown. Elevated expression of Collagen
XIII occurs on endothelial cells from Alport mice relative to
controls. Collagen XIII is induced in kidney endothelial cell
cultures by monocyte chemo-attractive protein 1 (MCP-1), a
chemokine previously documented as induced in Alport kidneys, and
well characterized for its role in monocyte recruitment in
chronically inflamed tissues. Blocking the ability of Collagen XIII
to bind to .alpha.1.beta.1 integrin will be therapeutically
beneficial for any chronic inflammatory disease where integrin
.alpha.1.beta.1-positive interstitial monocyte accumulation is
observed. Thus, the present invention provides a method of treating
a chronic inflammatory disease, such as renal fibrosis, lung
fibrosis, liver fibrosis, rheumatoid arthritis, psoriasis,
experimental colitis, and crescentic glomerulonephritis. The method
involves blocking binding (or otherwise neutralizing the
interaction) of Collagen XIII to .alpha.1.beta.1 integrin. In this
context, "treating" means that there is improvement in at least one
clinical symptom of the condition. For example, treating can
involve slowing or arresting the progression of a chronic
inflammatory condition by inhibiting or reducing the efflux of
monocytes/lymphocytes into the interstitial spaces of the site(s)
of chronic inflammation.
[0036] Using the Alexa-conjugated dextran injection approach
described herein, one skilled in the art could assay for a
therapeutic agent (i.e., an active agent) for its ability to
inhibit the efflux of monocytes into the interstitial space of a
model (e.g., a mouse model) where interstitial monocytes or
lymphocytes are implicated. In this context, "inhibit" means to
arrest or reduce the rate transendothelial migration of
lymphocytes/monocytes from the peripheral blood circulation into
the interstitial spaces of the inflamed tissues by blocking or
reducing the adhesion of the .alpha.1.beta.1 integrin receptor on
the peripheral blood lymphocyte/monocyte cell surface to the
Collagen XIII ligand on the vascular/capillary endothelium of the
inflamed tissue.
[0037] Such assays include, for example, at least two experimental
strategies. The first assay includes an analysis of the capacity of
the therapeutic agent in question to inhibit binding of
Alexa-conjugated purified .alpha.1.beta.1 integrin to MCP-1 treated
primary endothelial cells. This can be done, for example, using a
96-well microtiter plate format and a fluorescence plate reader as
described in the specific methods. Formulations can be titrated
into the binding assay, and their relative efficacy judged by the
concentration required to inhibit binding. Peptides, antibodies, or
SiRNAs can then be introduced into the Alport mouse model at
various doses. Efficacy in vivo can be quantitatively assessed by
injection of Alexa fluorochrome-conjugated dextrans according to
the specific methods described herein. Labeled cells in the
interstitium are all monocytes (for example, see FIGS. 3A and 3B).
The percentage (%) decrease in the number of Alexa-labeled
monocytes compared to age and sex matched vehicle-injected Alport
mice can be considered a direct measure of the efficacy in vivo for
the particular agent in question.
[0038] The second assay involves the use of mono-specific
antibodies. These antibodies are raised by injecting the peptide
antigen comprising the integrin binding domain of Collagen XIII
(e.g., SEQ ID NO: 2) into mice or into rats so as to elicit an
immuno response to the peptide antigen. Antibody-producing B-cells
from these animals are isolated from the spleen and fused to
myoloma cells using conventional techniques (polyethylene glycol
fusion method). The culture supernatant from clonal populations of
antibody producing cells (hybridomas) contains the mono-specific
(or monoclonal) antibody. Antibodies prepared in this way are
assayed first for their ability to block the interaction of
Alexa-conjugated purified .alpha.1.beta.1 integrin to MCP-1-treated
vascular endothelial cells in culture as described herein.
Mono-specific antibodies that have this property will be assayed in
vivo. The antibody is purified from the culture supernatant by
binding to, and then eluting from protein-A sepharose, which is a
standardized procedure for the purification/concentration of
antibodies from hybridoma supernatants. An effective amount of the
antibody will be injected into the Alport mouse model and 24 hours
later the same mouse will be injected with Alexa-conjugated
dextrans. Three days following the injection of dextrans, the
kidneys will be harvested, and cryosections counterstained with
FITC-conjugated anti-CD11b antibodies (to label the monocytes), and
the Alexa-positive monocytes counted. The number of Alexa-positive
monocytes is compared with that for age and sex matched Alport mice
given an equivelent dose of an isotype-matched irrelavent antibody.
A significant reduction in Alexa-positive (newly effluxed)
monocytes indicates an antibody with potential therapeutic
benefits. Such therapeutic agents include, but are not limited to,
small organic molecules, isolated peptides having the sequence
GAEGSPGL (SEQ ID NO. 1), or more particularly, GEKGAEGSPGLL (SEQ ID
NO:2), antibodies to such peptides, and small inhibitory RNAs
(SiRNAs). Herein, an "isolated" peptide is one that is naturally
occurring or synthetically derived and is not in its natural
environment.
[0039] Preferably, the isolated peptides can have at least 8 amino
acids. More preferably, they have at least 12 amino acids. The
length of the peptides is sufficient to obtain the desired
function. For certain embodiments, they are no larger than 16 amino
acids in length.
[0040] This sequence of amino acids on Collagen XIII on the
vascular endothelium interacts with the .alpha.1.beta.1 integrin on
circulating white blood cells. Additionally, active peptides (i.e.,
active analogs of SEQ ID NOs: 1 or 2) can include those having a
sequence that has at least 70% sequence identity to GAEGSPGL (SEQ
ID NO. 1), or more particularly, GEKGAEGSPGLL (SEQ ID NO:2).
Preferably, an active analog has a structural similarity to one of
SEQ ID NOs:1 or 2 of at least 80% identity, more preferably, at
least 90% identity, and even more preferably, at least 95%
identity. Such peptides do not include Collagen XIII.
[0041] Neutralizing antibodies made against at least one of these
peptides or against .alpha.1.beta.1 integrin can also be used to
disrupt the capacity of Collagen XIII to bind to .alpha.1.beta.1
integrin. Small inhibitory RNAs (SiRNAs) delivered to the
endothelial cells resulting in the intracellular destruction of
Collagen XIII transcripts, and thus preventing translated Collagen
XIII protein from reaching the endothelial cell surface, can also
be used.
[0042] These agents can be used alone or together to partially or
wholly inhibit the transendothelial migration of integrin
.alpha.1.beta.1-posititive monocytes/lymphocytes into the
interstitial space of chronically inflamed tissues.
[0043] Such inhibitors are referred to herein as "active agents."
Significantly, such active agents can be administered alone or in
various combinations to a patient (e.g., animals including humans)
as a medication or dietary (e.g., nutrient) supplement in a dose
sufficient to produce the desired effect throughout the patient's
body, in a specific tissue site, or in a collection of tissues
(organs).
[0044] The polypeptides described herein (e.g., those that include
the amino acids of SEQ ID NO:1 or SEQ ID NO:2) can be in their free
acid form or they can be amidated at the C-terminal carboxylate
group.
[0045] As discussed above, the present invention also includes
analogs of the polypeptides of SEQ ID NO:1 and SEQ ID NO:2, which
include polypeptides having structural similarity. These peptides
can also form a part of a larger peptide. An "analog" of a
polypeptide includes at least a portion of the polypeptide, wherein
the portion contains deletions or additions of one or more
contiguous or noncontiguous amino acids, or containing one or more
amino acid substitutions. An "analog" can thus include additional
amino acids at one or both of the termini of the polypeptides
listed above. Substitutes for an amino acid in the polypeptides of
the invention are preferably conservative substitutions, which are
selected from other members of the class to which the amino acid
belongs. For example, it is well known in the art of protein
biochemistry that an amino acid belonging to a grouping of amino
acids having a particular size or characteristic (such as charge,
hydrophobicity and hydrophilicity) can generally be substituted for
another amino acid without substantially altering the structure of
a polypeptide.
[0046] For the purposes of this invention, conservative amino acid
substitutions are defined to result from exchange of amino acids
residues from within one of the following classes of residues:
Class I: Ala, Gly, Ser, Thr, and Pro (representing small aliphatic
side chains and hydroxyl group side chains); Class II: Cys, Ser,
Thr and Tyr (representing side chains including an --OH or --SH
group); Class III: Glu, Asp, Asn and Gln (carboxyl group containing
side chains): Class IV: His, Arg and Lys (representing basic side
chains); Class V: Ile, Val, Leu, Phe and Met (representing
hydrophobic side chains); and Class VI: Phe, Trp, Tyr and His
(representing aromatic side chains). The classes also include
related amino acids such as 3Hyp and 4Hyp in Class I; homocysteine
in Class II; 2-aminoadipic acid, 2-aminopimelic acid,
.gamma.-carboxyglutamic acid, .beta.-carboxyaspartic acid, and the
corresponding amino acid amides in Class III; ornithine,
homoarginine, N-methyl lysine, dimethyl lysine, trimethyl lysine,
2,3-diaminopropionic acid, 2,4-diaminobutyric acid, homoarginine,
sarcosine and hydroxylysine in Class IV; substituted
phenylalanines, norleucine, norvaline, 2-aminooctanoic acid,
2-aminoheptanoic acid, statine and .beta.-valine in Class V; and
naphthylalanines, substituted phenylalanines,
tetrahydroisoquinoline-3-ca- rboxylic acid, and halogenated
tyrosines in Class VI.
[0047] As stated above, active analogs include polypeptides having
structural similarity (i.e., sequence identity). Structural
similarity is generally determined by aligning the residues of the
two amino acid sequences to optimize the number of identical amino
acids along the lengths of their sequences; gaps in either or both
sequences are permitted in making the alignment in order to
optimize the number of identical amino acids, although the amino
acids in each sequence must nonetheless remain in their proper
order. Preferably, two amino acid sequences are compared using the
NCBI BLASTB, version 2.2.6, of the BLAST 2 search algorithm.
Preferably, the default values for all BLAST 2 search parameters
are used with slight variations for Protein: Search for Short
Nearly Exact Matches available at
http://www.ncbi.nlm.nih.gov/BLAST/Blast-
.cgi?CMD=Web&LAYOUT=TwoWindows&AUTO_FORMAT=Semiauto&ALIGNMENTS=50&ALIGNMEN-
T.sub.--VIEW=Pairwise&CLIENT=web&DATABASE=nr&DESCRIPTIONS=100&ENTREZQUERY=-
%28none
%29&EXPECT=20000&FORMAT_OBJECT=Alignment&FORMAT_TYPE=HTML&GAPCOSTS-
=9+1&I_THRESH=0.005&MATRIX_NAME=PAM30&NCBI_GI=on&PAGE=Proteins&PROGRAM=bla-
stp&SERVICE=plain&SET_DEFAULTS.x=24&SET_DEFAULTS.y=10&SHOW_OVERVIEW=on&WOR-
D_SIZE=2&END_OF_HTTPGET=Yes&SHOW_LINKOUT=yes&GETSEQUENCE=yes
including matrix=PAM30; open gap penalty=10, extension gap
penalty=1, expect=20000, wordsize=3, and filter on=low complexity.
In the comparison of two amino acid sequences using the BLAST
search algorithm, structural similarity is referred to as
"identity."
[0048] Such peptide inhibitors can be derived (preferably, isolated
and purified) naturally such as by phage display or yeast
two-hybrid methods for identifying interacting proteins, or they
can be synthetically constructed using known peptide polymerization
techniques. Whether naturally occurring or synthetically
constructed, such peptides are referred to herein as "isolated."
For example, the peptides of the invention may be synthesized by
the solid phase method using standard methods based on either
t-butyloxycarbonyl (BOC) or 9-fluorenylmethoxy-carbonyl (FMOC)
protecting groups. This methodology is described by G. B. Fields et
al. in Synthetic Peptides: A User's Guide, W.M. Freeman &
Company, New York, N.Y., pp. 77-183 (1992).
[0049] The peptides used in the methods of the present invention
may be employed in a monovalent state (i.e., free peptide or a
single peptide fragment coupled to a carrier molecule). The
peptides may also be employed as conjugates having more than one
(same or different) peptide fragment bound to a single carrier
molecule. The carrier may be a biological carrier molecule (e.g., a
glycosaminoglycan, a proteoglycan, albumin or the like) or a
synthetic polymer (e.g., a polyalkyleneglycol or a synthetic
chromatography support). Typically, ovalbumin, human serum albumin,
other proteins, polyethylene glycol, or the like are employed as
the carrier. Such modifications may increase the apparent affinity
and/or change the stability of a peptide. The number of peptide
fragments associated with or bound to each carrier can vary, but
from about 4 to 8 peptides per carrier molecule are typically
obtained under standard coupling conditions.
[0050] For instance, peptide/carrier molecule conjugates may be
prepared by treating a mixture of peptides and carrier molecules
with a coupling agent, such as a carbodiimide. The coupling agent
may activate a carboxyl group on either the peptide or the carrier
molecule so that the carboxyl group can react with a nucleophile
(e.g., an amino or hydroxyl group) on the other member of the
peptide/carrier molecule, resulting in the covalent linkage of the
peptide and the carrier molecule. For example, conjugates of a
peptide coupled to ovalbumin may be prepared by dissolving equal
amounts of lyophilized peptide and ovalbumin in a small volume of
water. In a second tube, 1-ethyl-3-(3-dimethylamino-propyl)-car-
boiimide hydrochloride (EDC; ten times the amount of peptide) is
dissolved in a small amount of water. The EDC solution was added to
the peptide/ovalbumin mixture and allowed to react for a number of
hours. The mixture may then dialyzed (e.g., into phosphate buffered
saline) to obtain a purified solution of peptide/ovalbumin
conjugate. Peptide/carrier molecule conjugates prepared by this
method typically contain about 4 to 5 peptides per ovalbumin
molecule.
[0051] The invention further provides to an antibody capable of
specifically binding to a peptide having at least a 70% (more
preferably, at least 80%, even more preferably, at least 90%, and
even more preferably, at least 95%) sequence identity to a peptide
that includes the amino acids of SEQ ID NO:1 or SEQ ID N:2. In one
embodiment, the antibody is a monoclonal antibody and in another
embodiment, the antibody is a polyclonal antibody. In another
embodiment the antibody is an antibody fragment, which is included
in the use of the term antibody. The antibody can be obtained from
a mouse, a rat, human or a rabbit. Methods for preparing antibodies
to peptodes are well known to one of skill in the art. In a
preferred example, the antibodies can be human derived, rat
derived, mouse derived, or rabbit derived. Protein-binding antibody
fragments and chimeric fragments are also known and are within the
scope of this invention.
[0052] The present invention also provides a composition that
includes one or more active agents of the invention and one or more
carriers, preferably a pharmaceutically acceptable carrier. The
methods of the invention include administering to, or applying to
the skin of, a patient (i.e., a subject), preferably a mammal, and
more preferably a human, a composition of the invention in an
amount effective to produce the desired effect. The active agents
of the present invention are formulated for enternal administration
(oral, rectal, etc.) or parenteral administration (injection,
internal pump, etc.). The administration can be via direct
injection into tissue, interarterial injection, intervenous
injection, or other internal administration procedures, such as
through the use of an implanted pump, or via contacting the
composition with a mucous membrane in a carrier designed to
facilitate transmission of the composition across the mucous
membrane such as a suppository, eye drops, inhaler, or other
similar administration method or via oral administration in the
form of a syrup, a liquid, a pill, capsule, gel coated tablet, or
other similar oral administration method. The active agents can be
incorporated into an adhesive plaster, a patch, a gum, and the
like, or it can be encapsulated or incorporated into a bio-erodible
matrix for controlled release.
[0053] The carriers for internal administration can be any carriers
commonly used to facilitate the internal administration of
compositions such as plasma, sterile saline solution, IV solutions
or the like. Carriers for administration through mucous membranes
can be any well-known in the art. Carriers for administration
orally can be any carrier well-known in the art.
[0054] The formulations may be conveniently presented in unit
dosage form and may be prepared by any of the methods well known in
the art of pharmacy. All methods include the step of bringing the
active agent into association with a carrier, which constitutes one
or more accessory ingredients. In general, the formulations are
prepared by uniformly and intimately bringing the active agent into
association with a liquid carrier, a finely divided solid carrier,
or both, and then, if necessary, shaping the product into the
desired formulations.
[0055] Formulations suitable for parenteral administration
conveniently include a sterile aqueous preparation of the active
agent, or dispersions of sterile powders of the active agent, which
are preferably isotonic with the blood of the recipient. Isotonic
agents that can be included in the liquid preparation include
sugars, buffers, and sodium chloride. Solutions of the active agent
can be prepared in water, optionally mixed with a nontoxic
surfactant. Dispersions of the active agent can be prepared in
water, ethanol, a polyol (such as glycerol, propylene glycol,
liquid polyethylene glycols, and the like), vegetable oils,
glycerol esters, and mixtures thereof. The ultimate dosage form is
sterile, fluid, and stable under the conditions of manufacture and
storage. The necessary fluidity can be achieved, for example, by
using liposomes, by employing the appropriate particle size in the
case of dispersions, or by using surfactants. Sterilization of a
liquid preparation can be achieved by any convenient method that
preserves the bioactivity of the active agent, preferably by filter
sterilization. Preferred methods for preparing powders include
vacuum drying and freeze drying of the sterile injectible
solutions. Subsequent microbial contamination can be prevented
using various antimicrobial agents, for example, antibacterial,
antiviral and antifungal agents including parabens, chlorobutanol,
phenol, sorbic acid, thimerosal, and the like. Absorption of the
active agents over a prolonged period can be achieved by including
agents for delaying, for example, aluminum monostearate and
gelatin.
[0056] Formulations of the present invention suitable for oral
administration may be presented as discrete units such as tablets,
troches, capsules, lozenges, wafers, or cachets, each containing a
predetermined amount of the active agent as a powder or granules,
as liposomes containing the active agent, or as a solution or
suspension in an aqueous liquor or non-aqueous liquid such as a
syrup, an elixir, an emulsion, or a draught. The amount of active
agent is such that the dosage level will be effective to produce
the desired result in the subject.
[0057] Nasal spray formulations include purified aqueous solutions
of the active agent with preservative agents and isotonic agents.
Such formulations are preferably adjusted to a pH and isotonic
state compatible with the nasal mucous membranes. Formulations for
rectal or vaginal administration may be presented as a suppository
with a suitable carrier such as cocoa butter, or hydrogenated fats
or hydrogenated fatty carboxylic acids.
[0058] Ophthalmic formulations are prepared by a similar method to
the nasal spray, except that the pH and isotonic factors are
preferably adjusted to match that of the eye.
[0059] Topical formulations include the active agent dissolved or
suspended in one or more media such as mineral oil, DMSO,
polyhydroxy alcohols, or other bases used for topical
pharmaceutical formulations.
[0060] Useful dosages of the active agents can be determined by
comparing their in vitro activity and the in vivo activity in
animal models. Methods for extrapolation of effective dosages in
mice, and other animals, to humans are known in the art.
[0061] The tablets, troches, pills, capsules, and the like may also
contain one or more of the following: a binder such as gum
tragacanth, acacia, corn starch or gelatin; an excipient such as
dicalcium phosphate; a disintegrating agent such as corn starch,
potato starch, alginic acid and the like; a lubricant such as
magnesium stearate; a sweetening agent such as sucrose, fructose,
lactose or aspartame; and a natural or artificial flavoring agent.
When the unit dosage form is a capsule, it may further contain a
liquid carrier, such as a vegetable oil or a polyethylene glycol.
Various other materials may be present as coatings or to otherwise
modify the physical form of the solid unit dosage form. For
instance, tablets, pills, or capsules may be coated with gelatin,
wax, shellac, or sugar and the like. A syrup or elixir may contain
one or more of a sweetening agent, a preservative such as methyl-
or propylparaben, an agent to retard crystallization of the sugar,
an agent to increase the solubility of any other ingredient, such
as a polyhydric alcohol, for example glycerol or sorbitol, a dye,
and flavoring agent. The material used in preparing any unit dosage
form is substantially nontoxic in the amounts employed. The active
agent may be incorporated into sustained-release preparations and
devices.
[0062] Objects and advantages of this invention are further
illustrated by the following examples, but the particular materials
and amounts thereof recited in these examples, as well as other
conditions and details, should not be construed to unduly limit
this invention.
EXAMPLES
[0063] Introduction
[0064] In order to gain insight into the mechanism underlying the
role of integrin .alpha.1 in Alport interstitial disease, a global
analysis of gene expression using the Affymetrix gene chip method
was employed. These experiments are described in Sampson et al., J.
Biol. Chem., 276, 34182-34188 (2001). Alport mice at 7 weeks of age
were compared with 7 week old DKO (double knockout mice null at
both integrin .alpha.1 and collagen .alpha.3(IV)). Genes that were
up or down-regulated were sorted using the classification scheme of
Adams et al., Nature, 377, 3-174 (1995), and clustered within
categories using the GENE CLUSTER and TREEVIEW programs. Among the
observations made, it was noted that a number of
monocyte/macrophage-specific transcripts were observed in the
Alport mouse. These included macrophage chemoattractive protein 1
(MCP-1), macrophage inducible protein (IP-10), macrophage colony
stimulating factor (M-CSF), macrophage mannose receptor, and F4/80.
All of these transcripts were elevated between 6 and 24-fold in the
Alport mice relative to control littermates. In kidneys from
7-week-old DKO mice, expression for all of these genes was restored
to wild type levels. These studies led us to conclude that the
effect of integrin .alpha.1 on Alport tubulointerstitial disease
might be mediated by tissue monocytes. Immunostaining with a
monocyte specific marker (CD11b) confirmed these suspicions, as it
was clear that there were very few monocytes in the DKO mice, while
they are abundant in the interstitium of Alport mice (Sampson et
al., J. Biol. Chem., 276, 34182-34188 (2001)). T-cells and B-cells
are virtually absent in Alport renal fibrosis (Rodgers et al.,
Kidney Int., 63, 1338-1355 (2003)).
[0065] Blocking .alpha.1.beta.1 integrin has been shown to
attenuate the progression of other chronic inflammatory disease
models, including rheumatoid arthritis, experimental colitis, and
crescentic glomerulonephritis. It has been proposed that this
influence might involve the inhibition of leukocyte migration into
tissues; however, the mechanism driving this proposed influence has
remained unclear. It has recently been shown that the monocytes are
mediating cellular destruction associated with progressive
inflammation of the kidney in the Alport mouse model (Rodgers et
al., Kidney Int., 63, 1338-1355 (2003)) underscoring the importance
of interstitial monocyte accumulation in the pathology associated
with chronic inflammatory diseases.
[0066] Herein, it is shown that a small population of monocytes in
the bone marrow expresses .alpha.1.beta.1 integrin, and that
monocytes in the tubulointerstitium of Alport mice are positive for
.alpha.1.beta.1 integrin. Monocyte trafficking assays were used to
show markedly attenuated efflux of monocytes in
.alpha.1.beta.1-null Alport mice compared to Alport mice, an that
virtually all newly effluxed monocytes in Alport mice express
.alpha.1.beta.1 integrin. Using Alexa-conjugated purified
.alpha.1.beta.1 integrin, it was demonstrated that the integrin
binds the vascular endothelial cells of Alport mice, but not normal
mice, and that injection of the purified integrin suppresses
monocyte efflux. Further, labeled monocytes from normal mice
transplanted into .alpha.1 integrin-null Alport mice efflux more
efficiently into the cortical interstitial space than monocytes
from integrin .alpha.1 null mice. Combined, these data strongly
suggest the existence of an inducible ligand for .alpha.1.beta.1
integrin on the vascular endothelium of the kidney, which mediates
efflux of .alpha.1.beta.1 integrin-positive monocytes into the
vascular endothelium. Using an endothelial cell-derived phage
display library combined with a "biopanning" approach, Collagen
XIII was identified as the endothelial cell ligand for
.alpha.1.beta.1 integrin. Interaction of .alpha.1.beta.1 integrin
on monocytes mediates transmigration into the interstitial space in
chronic inflammatory diseases. In earlier work, compelling evidence
was provided that the monocytes are responsible for the
tubulointerstitial damage associated with the fibrotic process
(Rodgers et al., Kidney Int., 63, 1338-1355 (2003). Thus,
identification of the endothelial cell-specific ligand may provide
a therapeutic target of significant importance. Blocking the ligand
with a neutralizing antibody or peptide inhibitor might be applied
alone or in combination with blocking .alpha.1.beta.1 integrin on
the peripheral blood monocytes. This strategy will have
implications for other chronic inflammatory diseases.
[0067] Methods
[0068] Alexa 568 Dextran Complex Protocol
[0069] Fluorescent dextrans were prepared according to the methods
described by Luby-Phelps (Methods in Cell Biology, Vol. 29, Chap.
4, pp59-73, (1989)). Briefly, 1 mg of the fluorescent probe, Alexa
568 (Molecular Probes, Inc. Eugene, Oreg.) was combined with 39 mg
of dextran (Mol. Wt. Approximately 144,000) in the presence of
pyridine, dimethylsulfoxide (DMSO), and tin dilaurate
(Sigma-Aldrich Co. St. Louis, Mo.). Labeled dextran was
precipitated with 95% ethanol, dialyzed in glass-distilled water
and lyophilized. The dried product was then stored in 500
micrograms (.mu.g) aliquots at -20.degree. C. in a dessicator,
protected from light.
[0070] Male wild type 129SV and 129SVJ mice (4-12 weeks old) along
with collagen IV .alpha.3 (-/-) (Alport: 5-8 weeks old) and
collagen IV .alpha.3 (-/-)/integrin .alpha.1 (-/-) double knock out
(DKO: 8-12 weeks old) mice were tail vein injected with 50 .mu.g of
Alexa 568 labeled dextran reconstituted in 100 microliters (.mu.L)
Hanks Balanced Salt Solution (pH 7.2). Three days post injection
animals were given a lethal injection of averitin (0.55 grams per
kilogram (g/kg) body weight; ip) followed by cardiac perfusion with
ice cold PBS. Kidneys were removed and immersed in increasing
concentrations of ice cold sucrose (30% max) then embedded in
Tissue Tek OCT mounting medium (Sakura Finetek USA, Inc., Torrence,
Calif.) and stored at -80.degree. C.
[0071] Fresh frozen tissue sections (4 .mu.m) were fixed in 2%
paraformaldehyde for 5 minutes and allowed to dry overnight at
4.degree. C. followed by extended storage at -20.degree. C. or
immunohistochemical detection of monocytes using rat monoclonal
.alpha.-CD11b (Cedar Lane laboratories, Hornby, Ontario) and Goat
anti rat Alexa 488 (Molecular Probes, Inc. Eugene, Oreg.)
antibodies at 1:100 and 1:200 dilutions respectively. Sections were
cover slipped with vectorshield mounting medium (Vector Corp.
Burlingme, Calif.). Approximately ten pictures were taken for each
of three sections at least 100 micrometers (.mu.m) apart using an
Olympus BH2-RFCA microscope complete with green and red filters.
Green fluorescence alone as well as co-localized dual fluorescence
were measured using Image Pro Plus software (Media Cybernetics,
Inc. Silver Spring, Md.).
[0072] ADC568 Labeled Monocyte Transplant
[0073] Seven-week old DKO mice were given an iv injection of Alexa
568 conjugated dextran (ADC568) labeled monocytes isolated from
either .alpha.1 integrin deficient or wild type mouse bone marrow.
Bone marrow was collected by flushing the marrow cavities of the
femura and tibiae with Dulbecco's Modified EagleMedium (DMEM)
supplemented with 2% fetal calf serum (FCS) and
Penicillin/Streptomycin. Wash cells 2.times. in 1.times.
phosphate-buffered saline (PBS) (or Hanks' Balanced Salt Solution
(HBSS)). Red blood cells were removed with ammonium chloride (20 mM
Tris, 140 mM NH.sub.4Cl, pH 7.2) followed by 2 washes in DMEM with
2% FCS and a final wash with HBSS. Cells were cultured for 24 hours
in DMEM supplemented with 2% FCS, Pen/Strep at 37.degree. C. in a
humidified chamber with 5% CO.sub.2. Cells were washed 2.times.
with HBSS and 125 .mu.g ADC568/ml of fresh culture medium were
added. Washed cells were resuspended in ADC568 solution and
incubate for 24 hours at 37.degree. C. in a humidified chamber with
5% CO.sub.2 (try to minimize prolonged exposure to light). Cells
were washed 3.times. with HBSS. Cells were counted and a cell
sample prepared to confirm ADC568 labeling with fluorescent
microscope. Labeled monocytes were injected into recipient DKO mice
via tail vein injection (mice were injected with an equal amount of
.alpha.1 integrin-null or Wild type monocytes). Kidneys were
harvested from recipient mice 72 hours post tail vein injection.
Fresh frozen blocks were prepared and cut into 4 .mu.m
non-consecutive sections for visualization with fluorescent scope
and analysis with Image Pro Plus.
[0074] .alpha.1.beta.1 integrin/CD31 cDNA Library and Phage
Display
[0075] Preparation of Recombinant VLA1 coated metallic beads: M450
metallic beads (DYNAL Inc., Lake Success, N.Y.) were coated with
recombinant protein according to the manufacturers protocol.
Briefly, 1.times.10.sup.8 beads were washed in phosphate buffer
(0.26 g NaH.sub.2PO.sub.4, 1.44 g Na.sub.2HPO.sub.4 in 100 mL
ddH.sub.2O, pH 7.4) using a magnetic chamber. Beads (/10.sup.7
beads/5 mg protein) were mixed with 50 .mu.g purified human
.alpha.1.beta.1 integrin (Chemicon International, Inc., Temecula
Calif.) and placed on a nutator at 37.degree. C. for 16 hours.
Beads were washed, 2.times.in buffer D {PBS: 0.88 g NaCl, 0.26 g
NaH.sub.2PO.sub.4, 1.44 g Na.sub.2HPO.sub.4 in 100 ml ddH.sub.2O,
pH 7.4 with 0.1% BSA} for 5 minutes at 4.degree. C., 1.times.in
buffer E {0.2M Tris pH 8.5 with 0.1% BSA} for 4 hours at 37.degree.
C. Beads were stored at +4.degree. C. in buffer D. Incubate cells
with .alpha.1.beta.1 integrin coated beads in buffer D supplemented
with 1 mM MgCl.sub.2 and 1 mM CaCl.sub.2 for 30 minutes at
4.degree. C.
[0076] Preparation of anti-CD31 magnetic beads: Streptavidin linked
metallic beads (DNase I recognition domain linker) (DYNAL Inc.,
Lake Success, N.Y.) were washed in phosphate buffer and combined
with biotinylated anti-CD31 antibody (ABCAM, Ltd., Cambridgeshire
UK) at 1.0 .mu.g/1.times.10.sup.7 beads. The metallic
bead/anti-CD31 mixture was placed on a nutator at room temperature
for 30 minutes. Following the incubation, beads were washed 2 s in
phosphate buffer followed by an additional wash in buffer D. Beads
were stored 4.degree. C.
[0077] Isolating mRNA from VLA1 binding mouse kidney endothelial
cells: Four DKO mice were given a lethal dose of avertin at 10
weeks of age. Animals were perfused with ice cold PBS. Kidneys were
harvested and immediately placed on ice in HBSS (Gibco BRL).
Kidneys were minced and digested in 20 mL (4 minced kidneys
digested in 20 mL Collagenase A) of a 1 milligram per milliliter
(mg/mL) Collagenase A (Roche Diagnostics Corp., Indianapolis, Ind.)
HBSS solution at 37.degree. C. for 45 minutes with gentle
agitation. Digested material was filtered through 70 .mu.m nylon
mesh and collected in 50 mL conicle tubes.
[0078] Cells were recovered from the digest (1000 revolutions per
minute (rpm) for 5 minutes (min) at room temperature) and washed
2.times. in PBS followed by a final wash in buffer D. The yield
from the tissue digest was resuspended in 6 mL of buffer D for
every 20 mL of Collagenase A. One milliliter (1 mL) of cell
suspension was combined with 1.times.10.sup.7 anti-CD31 metallic
beads and mixed on a nutator for 30 minutes at 4.degree. C.
Rosetted cells were washed 4.times. in PBS with 0.1% BSA. The
metallic beads were liberated from the isolated endothelial cells
by incubating rosettes for 15 minutes at room temperature in DNase
solution (releasing buffer). Endothelial cells were resuspended in
PBS with 0.1% BSA, combined with VLA1 conjugated metallic beads
then kept at 4.degree. C. with nutation for 30 minutes. Rosetted
cells were washed 4.times. in PBS with 0.1% BSA. Each wash was
saved and unbound endothelial cells were sedimented, resuspended in
lysis buffer (Ambion Inc., Austin Tex.) and mRNA extracted. After
the final wash, rosetted cells were resuspended in lysis buffer
(Ambion Inc, Austin Tex.). After 5 minutes at room temperature,
metallic beads were removed and mRNA extracted from the VLA1
binding endothelial cells.
[0079] Preparing cDNA Library in T7 Select Phage using Orient
express (Novagen, Inc., Madison Wis.): Superscript III (Invitrogen,
Corp., Carlsbad Calif.) Reverse transcriptase and methylated dNTPs
were used along with HIND HI Random primers (Novagen, Inc., Madison
W) to generate cDNA that is indigestible with restriction enzymes.
Standard dNTPs and T4 DNA polymerase was used to generate flush
digestable ends on the Methylated cDNA and ligated to EcoRI/HIND
III linkers, followed by digestion with HINDIII and EcoRI
restriction enzymes. The digested product was filtered through a
size fractionation column (Novagen, Inc., Madison Wis.) and cDNA
larger than 300 base pairs (bp) was collected. The collected cDNA
was then ligated to T7 select vector arms for preparation of the
phage library using T7 select phage packaging extract (Novagen,
Inc., Madison Wis.) and the number of recombinants was determined
by plaque assay using bacterial strain BLT5403 (Novagen, Inc.,
Madison Wis.). Following the plaque assay, the phage libraries were
amplified by plate lysate amplification, eluted with extraction
buffer (20 millimolar (mM) Tris-HCL, pH 8.0, 100 mM NaCl, 6 mM
MgSO.sub.4), tittered and prepared for long-term storage at
-70.degree. C. by addition of 0.1 volume of sterile 80%
glycerol.
[0080] The complete synthesis of the CD31/VLA1 cDNA phage library
was confirmed by PCR using T7 select primers, the following
reagents: 10 .mu.L phage lysate; 5 .mu.L 10.times. NOVATAQ with
MgCl.sub.2 buffer (Novagen); 1 .mu.L T7 select up primer
(GGAGCTGTCGTATTCCAGTC (SEQ ID NO:3)); 1 L T7 select down primer
(AACCCCTCAAGACCCGTTTA (SEQ ID NO:4)); 1 .mu.L dNTP mix (10 mM
each); 1.25U NOVATAQ DNA polymerase (Novagen); and qs to 50 .mu.L
with PCR grade water. The reaction was heated to 80.degree. C. for
two minutes followed by 94.degree. C. for 50 seconds (sec),
50.degree. C. for 1 min, and 72.degree. C. for 1 min for 35 cycles.
The final extension was at 72.degree. C. for 6 minutes.
[0081] Biopanning for VLA1 binding expressed protein sequence: 96
well high bond plastic plates were coated with recombinant human
.alpha.1.beta.1 integrin (VLA1) at 5 .mu.g/mL in coating buffer
(0.035M NaHCO.sub.3, 0.015M Na.sub.2CO.sub.3) overnight at
4.degree. C. After coating with VLA1 wells were washed 3.times.
with 1.times.20 mM Tris.Cl (pH 7.4).sub.--0.5M NaCl (TBS), blocked
with 5% nonfat milk TBS buffer then washed 5.times. with distilled
water. Based on the calculated titer of the amplified phage
libraries, 8.times.10.sup.8 (VLA1-CD31) and 5.9.times.10.sup.8
(CD31) phage preps were added to VLA1 coated wells in 200 .mu. 1 L
biopanning buffer (10 mM Tris-HCl at pH 8.0, 0.15M NaCl, 0.1%
Tween-20, 1 mM MgCl.sub.2, 1 mM CaCl.sub.2) and kept at room
temperature for 45 minutes. Wells were washed 5.times. with
biopanning buffer and bound phage were eluted with elution buffer
(20 mM Tris at neutral pH, 1.0% SDS) for 20 minutes. BLT5403
bacterial cells were then added to the coated wells to recover high
affinity phage that may not have been collected in the eluate.
Ninety percent (90%) of the eluted phage were combined with 50 ml
bacterial cell culture at OD.sub.600=0.5 and amplified for three
hours at 37.degree. C. with shaking. The remaining 10% was used to
determine the number of phage recovered from each round of
biopanning. Amplified phage from each round of biopanning was
tittered by plaque assay. The biopanning procedure was repeated
3.times. with 1.times.10.sup.8 phage/VLA1 coated well and no more
than two coated wells for each library being screened for a total
of 4 rounds of biopanning.
[0082] PCR and sequencing of VLA1 selected plaques: Amplified phage
libraries collected after fourth round of biopanning were diluted
sufficiently to generate no more than 100 pfu/plate. Twelve
individual plaques were scraped and plugs of each plaque scraped
were collected for each library. One milliliter phage extraction
buffer was added to each plug and stored at 4.degree. C. Plaques
collected by scraping top agarose with a pipette tip were dispersed
in 100 .mu.L of 10 mM EDTA, pH 8.0, vortexed and kept at 65.degree.
C. for 10 minutes. Samples were cooled to room temperature and
centrifuged at 14000.times.g for 3 minutes.
[0083] PCR was run using the following reagents: 2 .mu.L clarified
phage lysate; 5 .mu.L 10.times.TAQ Gold Buffer (Perkin Elmer); 5
.mu.L 25 mM MgCl.sub.2; 1 .mu.L T7 select up primer
(GGAGCTGTCGTATTCCAGTC (SEQ ID NO:3)); 1 .mu.L T7 select down primer
(AACCCCTCAAGACCCGTTTA (SEQ ID NO:4)); 1 .mu.L dNTP mix (10 mM
each); 0.5 .mu.L TAQ Gold DNA polymerase (Perkin Elmer); and qs to
50 .mu.L with PCR grade water. The reaction was heated to
94.degree. C. with DNA polymerase for 2 minutes followed by
94.degree. C. for 50 sec, 50.degree. C. for 1 min, and 72.degree.
C. for 1 min for 35 cycles. The final extension was at 72.degree.
C. for 6 minutes.
[0084] -Ten microliters (10 .mu.L) of the PCR reaction were run on
a 1% agarose gel prepared with TAE (40 mM Tris, 10 mM EDTA, 20 mM
glacial acetic acid) and EtBr (10 .mu.g/ml). The remaining PCR
reaction was adjusted to 150 .mu.L with distilled water. This was
transferred to MANU 030 plate and the plate was vacuum dried for 20
minutes. The PCR product was recovered by adding 40 .mu.L nanopure
water to the appropriate wells in the plate. Five microliters (5
.mu.L) of product was mixed with 1 .mu.L of either forward or
reverse primer, 2 .mu.L Ready Reaction Mix (Applied Biosystems
Inc., Foster City, Calif.) and 2 .mu..LAMBDA. of 5.times. Buffer
(Applied Biosystems Inc).
[0085] After cycle sequencing, 40 .mu.L of 70% ethanol (EtOH) were
added and the mixture incubated at room temperature for 15 minutes.
The mixture was then centrifuged for 30 minutes at 3400 rpm, caps
to PCR tubes were removed, tubes inverted, and spun briefly (1
minute) at 1000 rpm. The precipitated product was allowed to dry
for 30 minutes to 1 hour. The products were resuspended in
formamide loading dye solution, the mixture incubated at 96.degree.
C. for 3 minutes, placed on ice for 2 minutes, then samples were
loaded onto sequencing gel within 15 minutes of adding formamide
solution.
[0086] Endothelial Cell MCP-1H.sub.2O.sub.2 Experiment
[0087] Primary endothelial cells were isolated from wild type mouse
kidneys using anti-CD31 coated metallic beads. Cells were cultured
in endothelial cell medium (DMEM/F12, 50 .mu.g/ml Endothelial
mitogen, 1% penicillin/streptomycin, 20 mM L-Glutamine, and 1 U/mL
heparin prepared fresh not filtered) containing 20% FCS. Thirty-two
wells of 5.times.10.sup.4 cells/well in a 96 well plate coated with
1% gelatin in sterile PBS were set up. Cells were maintained in
endothelial cell media with 20% FCS until cells reached confluence.
Confluent cells were washed with HBSS, then covered with
endothelial cell media without serum at 200 .mu.L/well and kept in
a humidified chamber at 37.degree. C., 5% CO.sub.2. Twenty-four
hours later fresh endothelial cell medium was added without serum
and various concentrations of MCP-1 and H.sub.2O.sub.2 were added
at 24 or 48 hours (hrs) prior to conducting the assay for cell
binding to .alpha.1.beta.1 integrin as shown in the following Table
1.
2TABLE I Control 800 .mu.M 1200 pg 100 .mu.M 800 pg 50 .mu.M
H.sub.2O.sub.2 MCP-1 H.sub.2O.sub.2 MCP-1 H.sub.2O.sub.2 48 hrs 24
hrs 24 hrs 48 hrs 48 hrs Control 800 .mu.M 1200 pg 100 .mu.M 1200
pg 50 .mu.M H.sub.2O.sub.2 MCP-1 H.sub.2O.sub.2 MCP-1
H.sub.2O.sub.2 24 hrs 24 hrs 24 hrs 48 hrs 48 hrs Control 800 .mu.M
1600 pg 100 .mu.M 1200 pg 100 .mu.M H.sub.2O.sub.2 MCP-1
H.sub.2O.sub.2 MCP-1 H.sub.2O.sub.2 24 hrs 24 hrs 24 hrs 48 hrs 48
hrs Control 800 .mu.M 1600 pg 200 .mu.M 1200 pg 100 .mu.M VLA1
H.sub.2O.sub.2 MCP-1 H.sub.2O.sub.2 MCP-1 H.sub.2O.sub.2 24 hrs 24
hrs 24 hrs 48 hrs 48 hrs Control 800 pg 1600 pg 200 .mu.M 1600 pg
100 .mu.M VLA1 MCP-1 MCP-1 H.sub.2O.sub.2 MCP-1 H.sub.2O.sub.2 24
hrs 24 hrs 24 hrs 48 hrs 48 hrs Control 800 pg 50 .mu.M 200 .mu.M
1600 pg 200 .mu.M VLA1 MCP-1 H.sub.2O.sub.2 H.sub.2O.sub.2 MCP-1
H.sub.2O.sub.2 24 hrs 24 hrs 24 hrs 48 hrs 48 hrs 800 .mu.M 800 pg
50 .mu.M 800 pg 1600 pg 200 .mu.M H.sub.2O.sub.2 MCP-1
H.sub.2O.sub.2 MCP-1 MCP-1 H.sub.2O.sub.2 48 hrs 24 hrs 24 hrs 48
hrs 48 hrs 48 hrs 800 .mu.M 1200 pg 50 .mu.M 800 pg 50 .mu.M 200
.mu.M H.sub.2O.sub.2 MCP-1 H.sub.2O.sub.2 MCP-1 H.sub.2O.sub.2
H.sub.2O.sub.2 48 hrs 24 hrs 24 hrs 48 hrs 48 hrs 48 hrs
[0088] Immunoprecipitation
[0089] Endothelial cell cultures were grown to confluency and
placed in serum free endothelial cell medium for 24 hours. Cells
were then treated with 1600 pigograms (pg) human recombinant MCP-1
or 200 .mu.M H.sub.2O.sub.2 for 48 hours under serum free
conditions. Cells were washed 2.times. with ice cold HBSS and cell
were sonicated on ice (10.times. for 15 sec pulses) in integrin
lysis buffer (50 mM Hepes pH 7.4, 100 mM NaCl, 0.4% Triton X-100, 1
mM CaCl.sub.2, 1 mM MgCl.sub.2, 10% glycerol) with protease
inhibitors. Protein concentrations were determined by Bradford
Assay (BioRad). Equal concentrations of lysates were pre-cleared
with protein-A sepharose beads. Recombinant human VLA1 (0.2 .mu.g)
was added to the pre-cleared lysates and incubated at 4.degree. C.
for 1 hour followed by addition of rabbit anti VLA1 antibody
(Chemicon) and protein-A sepharose beads. Samples were incubated
over night at 4.degree. C. with nutation. Beads were washed
6.times. with integrin lysis buffer and protease inhibitors at
4.degree. C. then combined with 50 .mu.L 6.times. Laemmli sample
buffer, boiled for 5 minutes and kept on ice.
[0090] Samples were run on 10% SDS PAGE gels and transferred to
PVDF membrane (BioRad). Membrane was incubated overnight at
4.degree. C. with Collagen XIII antibody, raised in rabbit against
a synthetic peptide of the NC3 domain provided by Dr. Taina
Pihlajaniemi (Hagg et al., J. Biol. Chem. 273, 15590-15597),
diluted 1:2000 in 1% BSA, 0.05% Tween 20.sub.--20 mM Tris.Cl (pH
7.4).sub.--0.5M NaC (TTBS). The membrane was washed several times
in TTBS the incubated with Goat anti rabbit-HRP was diluted 1:25000
in 1% BSA TTBS for 1 hour. Bands were detected with
chemiluminescence detection kit (Amersham) and X-ray film.
[0091] RT-PCR
[0092] Total RNA was prepared using Trizol (GibCo/BRL,
Gaithersberg, Md.) as per the manufacturer's instructions. Two
micrograms of total RNA was reverse-transcribed by using a first
strand cDNA synthesis kit SuperScript III (GibCo BRL). Collagen
XIII mRNA transcripts were analyzed semi-quantitatively using
specific primers by RT-PCR. As an internal standard, expression of
glyceraldehydes 3-phosphate dehydrogenase (GAPDH), a cellular
housekeeping gene, was also analyzed. PCR reactions were carried
out in PTC 100 (M.J. Research, Waltham, Mass.) using amplitaq gold
(Applied Biosystems, Branchburg, N.J.) with 1 cycle of 94.degree.
C. for 2 min, 30 cycles of 94.degree. C. for 60 sec, 60.degree. C.
for 60 sec, 72.degree. C. for 90 sec followed by 72.degree. C. for
10 min, then held at 4.degree. C. Oligonucleotide primer pairs used
are listed below in Table 2.
3 TABLE 2 Target Primer pair size (bp) GAPDH 5'-GGT GAA GGT CGG AGT
CAA CGG 236 ATT TGG TCG-3'(SEQ ID NO: 5) 5'-GGA TCT CGC TCC TGG AAG
ATG GTG ATG GG-3'(SEQ ID NO: 6) Collagen 5'-GAGCGGGGCATGCCAGGAAT-3'
254 XIII (SEQ ID NO: 7) 5'-TGGCCATCAACACCAGCTTC-3' (SEQ ID NO: 8)
Collagen 5'-CTGCGCTCCAACCCGATAATGTCC-3' 880 XIII (SEQ ID NO: 9)
5'-CTGGGGGCCTGCTTGTCCTGTCT-- 3' (SEQ ID NO: 10)
[0093] Primers were designed based on the published sequences.
Amplified products were separated on 2% agarose gel, visualized by
UV transilluminator after staining with ethidium bromide, and
photographed. All PCR experiments included control reactions, which
contained all components except complementary DNA. No bands were
detectable in these control reactions. All PCR products were
confirmed by DNA sequencing.
[0094] Immunofluoresence.
[0095] Four-micron fresh frozen kidney sections were mounted on
slides and fixed with ice-cold acetone. Tissue sections were
examined by immunofluorescence microscopy using primary antibodies
specific for endothelial cells (anti-mouse CD31, (Abcam)) or
Collagen XIII (gift from Dr. TainaPihlajaniemi (Hagg et al., J.
Biol. Chem. 273, 15590-15597) at a concentration of 1:100 and 1:200
in 1% BSA, 5% mouse serum, 1.times.PBS respectively. Kidney
sections were incubated in primary antibody for 60 minutes, washed
3.times. with 1.times.PBS then incubated with anti-rabbit Alexa
fluor 568 (red-colXIII), anti-rat Alexa fluor 488 (green-CD31)
(Molecular Probes, Inc. Eugene, Oreg., USA) each prepared in 1%
BSA, 5% Mouse serum, 1.times.PBS at a concentration of 1:200 for 60
minutes. After washing 3.times. with 1.times.PBS, mounting medium
(0.1 g N-propyl-gallate, 5 ml 1.times.PBS, 5 ml glycerol) was added
and the samples were coverslipped.
[0096] Immunostaining was visualized and captured with an Olympus
BH2-RFCA fluorescent microscope (Hitschfel Instruments Inc., St.
Louis, Mo.) mounted with a SPOT-RT-Slider imaging system and
software (Diagnostic Instruments Inc., Sterling Heights, Mich.) at
200.times. magnification.
[0097] Results
[0098] Monocyte efflux into Alport kidneys is mediated via an
endothelial cell surface ligand for integrin .alpha.1.beta.1.
[0099] In an earlier report (Sampson et al., J. Biol. Chem., 276,
34182-34188 (2001)), it was shown that the number of monocytes and
myofibroblasts present in the kidneys of Alport mice that are also
null for integrin .alpha.1.beta.1 (DKO's) is much lower than that
for age matched Alport mice. While this data certainly indicated a
role for .alpha.1.beta.1 integrin in fibrosis, it did not clarify
the mechanism(s) underlying the observation. While numerous
possible explanations exist (.alpha.1.beta.1 integrin effects on
chemokine/cytokine expression by tubular epithelial cells or
downstream effects of slowed glomerular pathology, for example),
the direct role for .alpha.1.beta.1 integrin in monocyte efflux
into the tubulointerstitium was explored. The monocytes in the
Alport tubulointerstitium were predominantly positive for
.alpha.1.beta.1 integrin (FIG. 1). This may reflect recruitment of
.alpha.1.beta.1 integrin-positive monocytes from the peripheral
blood, or activation of .alpha.1.beta.1 integrin expression in
monocytes following entry into the tubulointerstitial space.
[0100] Bone marrow-derived monocytes were analyzed by
fluorescence-activated cell sorting (FACS), using
fluorescence-tagged antibodies against CD11b (a marker for
monocytes, fluorescence intensity monitored on the Y-axis of
histograms in FIG. 2) and .alpha.1.beta.1 integrin (fluorescence
intensity monitored along the X-axis of histograms in FIG. 2). The
results shown in FIG. 2 illustrate that a fraction (about 10%) of
the monocytes in bone marrow express .alpha.1.beta.1 integrin. To
determine whether newly effluxed monocytes express .alpha.1.beta.1
integrin, dextrans were labeled with Alexa 568 (red fluorescence
tag from Molecular Probes). Since monocytes are the only phagocytic
cells in the peripheral blood, only monocytes are labeled when
these dextrans are injected into the tail vein. Three days
following injection, kidneys were harvested and cryosections
immunostained with FITC-conjugated (green) anti-CD11b antibody. The
results in FIGS. 3A and 3B show that Alexa-labeled cells are
monocytes. A second section was immunostained with FITC-conjugated
anti .alpha.1.beta.1 integrin antibody. FIGS. 3C and 3D illustrate
that Alexa-labeled cells are immunopositive for .alpha.1.beta.1
integrin. Combined, these data illustrate the specificity of the
labeled dextran approach for monitoring monocyte trafficking into
the tubulointerstitium, and illustrate that newly effluxed
monocytes express .alpha.1.beta.1 integrin, supporting the
possibility for a direct role for this integrin in facilitating
entry into the tubulointerstitial space.
[0101] If .alpha.1.beta.1 integrin mediates monocyte efflux, then
the rate of efflux in Alport mice should be faster than that for
.alpha.1.beta.1-deficient Alport (DKO) mice. These two models were
injected with labeled dextrans in a timecourse study. Three days
following injection, kidneys were harvested and immunostained with
FITC-conjugated anti-CD11b. Labeled monocytes were counted in 20
fields for 10 sections 100 .mu.M apart. Two independent animals
were used for each timepoint. The results in FIG. 4 show that the
onset of monocyte efflux in the DKO mice is much later than that in
Alport mice. More importantly, the rate at which monocytes are
entering the tubulointerstitial space is much slower in the DKO
mice relative to the Alport mice, providing further evidence for a
direct role for .alpha.1.beta.1 integrin in mediating monocyte
efflux into the tubulointerstitium. Bars in FIG. 4 represent
standard error, not standard deviation. Because monocyte efflux is
patchy, fields representing the entire peripheral renal cortex of a
longitudinal cryosection are imaged and counted.
[0102] If such a direct role exists, there must be a ligand for
.alpha.1.beta.1 integrin on the renal cortical vascular endothelium
of Alport mice that is absent on normal mice. To test for the
presence of such a ligand, purified .alpha.1.beta.1 integrin
(purchased from Chemicon, Temecula, Calif.) was labeled with Alexa
568, and the labeled integrin injected into the tail vein of
normal, Alport, and DKO mice. Twenty-four hours following the
injection, kidneys were harvested, and cryosections examined. The
results in FIG. 5A illustrate the absence of label in control mice,
while Alport mice show strong labeling in the vascular endothelium
(FIG. 5B). Since monocytes phagocytize labeled dextrans, what is
interpreted as integrin might be phagocytized integrin in
monocytes. Comparing FIG. 5B and % C shows that monocytes and
Alexa-labeled integrin .alpha.1.beta.1 do not co-localize (since
there is no overlapping fluorescence in the two panels). These data
illustrate the presence of a ligand for .alpha.1.beta.1 integrin in
Alport vascular endothelium. Its presence in age matched DKO mice
further suggests the absence of .alpha.1.beta.1 integrin in these
mice may explain the slowed rate of monocyte efflux.
[0103] In an attempt to provide a more definitive test for the
function of .alpha.1.beta.1 in monocyte efflux into diseased
kidneys, 5 .mu.g of purified .alpha.1.beta.1 integrin was injected
into the tail vein of Alport mice daily, starting one day before
injection of labeled dextrans, and kidneys harvested three days
following injection of dextrans. Pilot studies with
Alexa-conjugated integrin .alpha.1.beta.1 were conducted to assess
the stability prior to the blocking experiments. The purified
integrin was found to be stable for at least 72 hours (data not
shown). If transendothelial migration of monocytes into the
interstitial space is mediated, in part, through binding a ligand
on endothelial cells, a decrease in labeled monocytes in Alport
mice treated with .alpha.1.beta.1 integrin compared to untreated
age-matched Alport mice should be observed, since the purified
integrin should occupy ligand, making less available for binding to
monocytes. The results in FIG. 4B illustrate a trend for a
reduction in monocyte efflux for mice treated with the purified
.alpha.1.beta.1 integrin. It suggests that the ligand may indeed
function in recruitment of monocytes to the interstitial space in
Alport kidneys.
[0104] To further test whether the influence of .alpha.1.beta.1
integrin on peripheral blood monocytes facilitates transmigration
into the interstitial space of fibrosing kidneys, a transplantation
approach was used. Irradiation and chemical myoloablation
strategies proved toxic in the Alport mouse, accelerating fibrosis.
A passive transplantation approach was chosen where bone marrow
derived monocytes from either normal controls or .alpha.1 integrin
null mice were labeled by culturing cells in the presence of
Alexa-568 fluorochrome-conjugated dextrans. The labeled cells were
injected into integrin .alpha.1-deficient Alport (DKO) mice and the
rate of transendothelial migration assessed by counting fluorescent
cells in the interstitium three days following transplantation.
Table 3, below, shows the results for 5 independent experiments.
While the numbers varied from one experimental set of animals to
another, in all cases there was a significant reduction in the
number of transmigrated monocytes in mice transplanted with
integrin .alpha.1-deficient monocytes compared to those
transplanted with normal monocytes.
4TABLE 3 ADC568 labeled monocytes injected into Experiment 1
Experiment 2 Experiment 3 Experiment 4 Experiment 5 DKO mice. WT
.mu.L.sup.-/- WT .mu.L.sup.-/- WT .mu.L.sup.-/- WT .mu.L.sup.-/- WT
.mu.L.sup.-/- Number of cells injected 2.5 .times. 10.sup.6 3.0
.times. 10.sup.6 3.0 .times. 10.sup.6 2.0 .times. 10.sup.6 2.0
.times. 10.sup.6 Number of cells/3 sections 190 103 338 299 934 773
351 265 260 233 Percentage of cells in 0.0076 0.00412 0.011 0.0099
0.031 0.026 0.018 0.013 0.013 0.012 kidney Percent reduction
(.mu.L.sup.-/-) 45.8 10 16.1 27.8 7.7
[0105] Cloning and identification of the vascular endothelial cell
ligand for integrin .alpha.1.beta.1, Collagen XIII.
[0106] The data presented thus far predicts that a ligand for
.alpha.1.beta.1 integrin is expressed on vascular endothelial cells
of kidneys during progressive fibrosis. While a number of
approaches were pursued to clone the ligand, a biopanning approach
of a kidney endothelial cell-specific phage display library was
successfully used. Endothelial cells from .alpha.1 integrin
deficient Alport mice were isolated using antibodies conjugated to
magnetic beads. Kidneys were minced and treated with collagenase to
free cells from interstitial matrix. The cells were mixed with
magnetic beads that were chemically conjugated to a commercially
available antibody specific for endothelial cells (anti-CD31).
Bound cells were separated from unbound cells using a magnet, and
washed several times. The resulting cells were either used directly
to prepare RNA or further selected using magnetic beads conjugated
to purified .alpha.1.beta.1 integrin, then used for RNA
preparation. The two different RNA preparations were subjected to
poly-A selection, and the PolyA+ RNA used to construct a
filamentous phage display library. The filamentous phage is
engineered to display a small portion of cloned cDNAs as peptides
on one end of the filament. Specific interacting peptides can be
selected using an approach referred to as "biopanning." Plastic
micotiter plates are coated with the protein for which interactive
binding partners are sought (in this case, this is purified
.alpha.1.beta.1 integrin). The library of phage is then allowed to
react to the coated plate under conditions that typically promote
integrin/ligand interactions. Phage that fail to react are washed
away, and the bound phage eluted and amplified. This process is
repeated several times in serial, which after three or more
successive binding and amplification steps results in the
purification of phage that specifically interact with the protein
used to coat the plates. In this case, only a single phage clone
was purified using this technique. DNA sequence analysis of the
insert revealed that the phage was presenting a fragment of
Collagen XIII, which is a plasma membrane bound collagen (Hagg et
al., J. Biol. Chem., 273, 15590-15597, 1998). Interestingly, the
only receptor that has been shown to bind to Collagen XIII is
.alpha.1.beta.1 integrin (Nykvist et al., J. Biol. Chem., 275,
8255-8261, 2000). The biological function of the Collagen
XII/.alpha.1.beta.1 interaction is completely unknown, but is
thought to have something to do with cell/cell adhesion. It should
be emphasized that, by virtue of the mechanics of the phage display
assay, Collagen XIII has been identified as the endothelial cell
ligand for .alpha.1.beta.1 integrin. Because of the small size of
the inserted DNA in the phage that is homologous to Collagen XIII,
the binding site for .alpha.1.beta.1 integrin has also been
identified. This is a significant fact, since it allows for the
testing of the efficacy of peptide inhibitors comprising this amino
acid sequence. The amino acid sequence of the cloned fragment
(i.e., the portion of Collagen XIII involved in binding
.alpha.1.beta.1 integrin is as follows: GEKGAEEGSPGLL (SEQ ID
NO:2).
[0107] Collagen XIII is induced on vascular endothelial cells from
chronically inflamed kidneys.
[0108] Endothelial cell polyA+ mRNA was prepared from normal and
7-week-old Alport (advanced fibrotic) kidneys as described above
and analyzed for Collagen XIII expression using RT-PCR. As shown in
FIG. 6, expression of Collagen XIII is induced in vascular
endothelial cells of Alport kidneys relative to normal mice.
Parallel reactions amplified GAPDH, a housekeeping gene, as a
control. GAPDH transcripts were very similar in the two
samples.
[0109] It has been previously shown that monocyte chemo-attractive
protein-1 (MCP-1) is markedly induced in Alport kidneys relative to
normal kidneys (Sampson et al., J. Biol. Chem., 276, 34182-34188
(2001)). There is wide documentation for the capacity of this
powerful chemokine to promote monocyte and lymphocyte
transmigration into the interstitium of inflamed tissues (reviewed
in Conti et al., Allergy Asthma Proc., 22, 133-7 (2001)). This is
thought to be mediated largely through the induction of adhesion
molecules and/or their respective ligands (Kim, J. Neurol. Sci.,
137, 69-78 (1996)). Based on this, primary kidney endothelial cell
cultures were treated with varying concentrations of recombinant
MCP-1 and measured adhesion to Alexa-568-conjugated .alpha.1.beta.1
integrin. FIG. 7 illustrates significantly elevated adhesion of
.alpha.1.beta.1 integrin to endothelial cells pre-treated with
MCP-1 compared to untreated cells. The increased adhesion was both
time and dose dependent.
[0110] In addition to chemokines, oxidative stress has been
associated with the induction of cytokines, matrix proteins,
metalloproteinases, and cell adhesion molecules in the endothelium
of inflammatory tissues (Yoon et al., 2002 J. Biol. Chem., 277,
30271-30282); Roebuck, Int. J. Mol. Med., 4, 223-30 (1999)). In
vivo, this is largely due to elevated expression of endothelial
nitric oxide synthetase (eNOS) and inducible nitric oxide
synthetase (iNOS), which leads to the production of hydrogen
peroxide (Heeringa et al., J. Pathology, 193, 224-32 (2001). In
FIG. 8, it is illustrated that hydrogen peroxide promotes the
binding of Alexa-conjugated .alpha.1.beta.1 integrin to cultured
primary kidney endothelial cells. This effect is both concentration
and time-dependent.
[0111] To determine whether the .alpha.1.beta.1 integrin binding
activity on cultured vascular endothelial cells was indeed Collagen
XIII, an indirect co-immunoprecipitation assay was performed.
Endothelial cells were cultured in the presence or absence of MCP-1
for 48 hours. The cells were lysed in integrin binding buffer, and
purified integrin .alpha.1.beta.1 added to the cleared mix.
Following incubation, anti-integrin .alpha.1-specific antibodies
were added, and complexes immunoprecipitated with protein A
sepharose beads. The immunoprecipitated material was fractionated
by polyacrylamide gel electrophoresis (PAGE) and analyzed by
western blot using anti-collagen XIII antibodies. The results in
FIG. 9 illustrate one bands with the appropriate molecular size for
type XIII collagen (between 85 and 95 kDa) consistent with earlier
reports (Hgg et al., J. Biol. Chem. 273, 15590-15597 (1998); Hgg et
al., Matrix Biology, 19, 727-742 (2001)).
[0112] To determine whether Collagen XIII is induced on the
vascular endothelium in vivo, dual immunofluorescence analysis of
kidney cryosections from normal and Alport mice was performed using
antibodies specific for Collagen XIII and CD31 (a specific
endothelial cell marker). The data shown in FIG. 10 illustrates
areas of obvious co-localization for Collagen XIII and CD31 in the
Alport renal cortex (boxed in areas). No co-localization for these
two proteins was observed in controls.
[0113] Discussion
[0114] Previous work has shown that the progression of interstitial
fibrosis was slower in integrin .alpha.1 null Alport (DKO) mice
than Alport mice of the same inbred background (129 Sv) (Cosgrove
et al., Am. J. Path., 157, 1649-1659 (2000); Rodgers et al., Kidney
Int., 63, 1338-1355 (2003). This work was extended in related
studies using both the integrin .alpha.1 null mouse model (Gardner
et al., Dev. Biol., 175, 301-313 (1999)) and a neutralizing
antibody approach to be effective in slowing the rate of
progression for other inflammatory diseases including rheumatoid
arthritis (De Fougerolles et al., The Journal of Clinical
Investigation, 105, 721-729 (2000)), crescentic glomerulonephritis
(Cook et al., Am. J. Path., 161, 1265-1272 (2002)), and
experimental colitis (Krieglstein et al., J. Clin. Invest., 110,
1173-1782 (2002)). While the beneficial effect of integrin
.alpha.1.beta.1 neutralization was significant in all cases, the
mechanism underlying these observations was not known.
[0115] Studies performed aimed at defining the relative roles of
monocytes and myofibroblasts in interstitial destruction
overwhelmingly concluded that the tissue monocytes mediate
apoptosis of kidney cells contributing to the tissue destruction
associated with progressive renal fibrosis (Rodgers et al., Kidney
Int., 63, 1338-1355 (2003)). Herein it is shown that the
accumulation of interstitial monocytes in integrin .alpha.1-null
Alport mice is markedly attenuated compared to that in Alport mice.
This slowed rate of accumulation may be due to a decrease in the
rate at which monocytes efflux into the interstitial space and/or
an influence on interstitial monocyte proliferation. In this
application it was demonstrate via injection of fluorochrome
conjugated dextrans that the rate at which monocytes efflux into
the interstitial space is much slower in integrin
.alpha.1-deficient Alport mice compared to Alport mice. Indeed, the
fluorochrome-labeled monocytes observed in the Alport interstitium
in this assay were predominantly integrin .alpha.1.beta.1-positive
cells. Transplant studies using fluorochrome labeled cultured
monocytes from the bone marrow of wild type and integrin
.alpha.1-deficient mice confirm a significant reduction in the rate
of efflux when injected into .alpha.1 integrin-deficient Alport
mice, directly demonstrating that integrin .alpha.1.beta.1 on
peripheral blood monocytes enhances their rate of transendothelial
migration into the interstitial space of chronically inflamed
kidneys.
[0116] Given this, and additional supporting evidence, it was
surmised that there must be a ligand for a .alpha.1.beta.1 integrin
on the endothelial cell surface of Alport kidneys undergoing active
fibrosis. Injection of fluorochrome-conjugated purified
.alpha.1.beta.1 integrin into the tail vein of Alport, integrin
.alpha.1-deficient Alport, and normal control mice confirmed that
the integrin adheres to the vascular endothelium of the diseased
mice, but not the normal mice. A phage display approach for
identifying interacting proteins (Ruoslahti et al., Cancer Biology,
10, 435-442 (2000); Laakkonen et al., Nature Medicine, 8, 751-755
(2002)) was used to identify Collagen XIII as the endothelial cell
receptor for .alpha.1.beta.1-positive peripheral blood monocytes.
Collagen XIII is a plasma membrane collagen (Hgg et al., J. Biol.
Chem., 273, 15590-15597 (1998)). It has been characterized as a
specific ligand for .alpha.1.beta.1 integrin (Nykvist et al., J.
Biol. Chem., 275, 8255-8261 (2000)), but the functional role of the
interaction has remained unclear. Interestingly, the amino acid
sequence of the Collagen XIII peptide identified in our phage
display assay is homologous (67% identity in amino acid sequence)
to the collagenous domain of a class A scavenger receptor, which
has been identified as a mechanism for macrophage adhesion to
collagens (Gowen et al., J. Leuk. Biol., 69, 575-582 (2001);
Kosswig et al., J. Biol. Chem., 278, 34219-34225 (2003)).
[0117] A previous report suggested that collagen binding integrins
.alpha.1.beta.1 and .alpha.2.beta.1 are involved in transmigration
of activated T-cells into inflammatory tissues, but the cellular
mechanism mediating this effect was not addressed (Andreasen et
al., J. Immunol., 171, 2804-2811 (2003)). In humans with arthritis,
integrin .alpha.1.beta.1-positive lymhocytes were found to be a
subset of T-cells primed for adhesion to type IV collagen (Bank et
al., Clinical Immunol., 105, 247-258 (2002)), suggesting a specific
role for .alpha.1.beta.1-postitive lymphocytes in promoting chronic
inflammation in humans.
[0118] The studies presented herein bring these concepts together,
offering an explanation for how inflamed tissues select this
subpopulation of circulating monocytes and lymphocytes. The
biological reason for selecting these cells for transmigration
however remains a mystery. It is possible that activation of these
cells via .alpha.1.beta.1 integrin signaling imparts
characteristics normally beneficial to resolving the inflammatory
state. It was observed that while inflammation-associated monocytes
were immunopositive for TGF-.beta.1, resident monocytes were not
(Rodgers et al., Kidney Int., 63, 1338-1355 (2003)). While acute
elevations may be beneficial to resolving an inflammatory state,
sustained exposure to elevated TGF-.beta. is notoriously
destructive (Border et al., Nature (London), 346, 371-374
(1990)).
[0119] While the biological reason for this mechanism remains
unclear, the potential therapeutic benefit of blocking
.alpha.1.beta.1 integrin-mediated trasmigration of
lymphocytes/monocytes for controlling tissue destruction associated
with chronic inflammatory disorders, based on the work described in
this application, is apparent. The transplantation data presented
herein show that .alpha.1.beta.1 neutralization has a significant,
albeit marginal effect on monocyte transmigration into the renal
interstitium. Clearly there are other mechanisms driving the
infiltration of monocytes in this chronic inflammatory model.
Directed therapeutic paradigms aimed at limiting
lymphocyte/monocyte transmigration have been effective at slowing
the progression of chronic inflammatory disorders such as
psoriasis, inflammatory bowel disease and multiple sclerosis in
humans (Harlan et al., Crit. Care Med., 30, S214-9 (2002)). Some of
the better-characterized approaches involve the blocking of both
the receptor and its ligand usually via neutralizing monoclonal
antibodies. This approach has been successfully applied to
LFA-1/ICAM-1 interaction (suppressing efflux of leukocytes into
inflammatory tissues) and the VLA-4/VCAM-1 interaction (suppressing
efflux of lymphocytes and monocytes into inflammatory tissues)
(Yusuf-Makagiansar et al., Med. Res. Rev., 22, 146-67 (2002)).
Recently, a new adhesion molecule expressed on endothelial cells,
vascular adhesion protein-1 (VAP-1), was implicated as playing a
key role in adhesion and transmigration of lymphocytes associated
with chronic inflammation of the liver (Lalor et al., J. Immunol.,
169, 983-92 (2002)). Combined, this body of research underscores
the diversity of mechanisms influencing the binding, activation,
and efflux of inflammatory cells into sites of chronically inflamed
tissues.
[0120] Given the evidence provided herein, it is obvious that the
integrin .alpha.1.beta.1/Collagen XIII interaction plays an
important role in mediating efflux of monocytes into chronically
inflamed kidneys. Studies employing .alpha.1.beta.1
integrin-specific neutralizing antibodies and/or integrin
.alpha.1-deficient mice implicate that this mechanism is involved
in rheumatoid arthritis, crescentic glomerulonephritis, and
experimental colitis. This therapeutic approach will likely provide
benefit for any chronic inflammatory disease where .alpha.1.beta.1
integrin-positive lymphocytes/monocytes are involved.
[0121] The complete disclosures of all patents, patent
applications, publications, and nucleic acid and protein database
entries, including for example GenBank accession numbers and EMBL
accession numbers, that are cited herein are hereby incorporated by
reference as if individually incorporated. Various modifications
and alterations of this invention will become apparent to those
skilled in the art without departing from the scope and spirit of
this invention, and it should be understood that this invention is
not to be unduly limited to the illustrative embodiments set forth
herein.
5 SEQUENCE FREE TEXT SEQ ID NO:1 Peptide SEQ ID NO:2 Peptide SEQ ID
NO:3 Primer SEQ ID NO:4 Primer SEQ ID NO:5 Primer SEQ ID NO:6
Primer SEQ ID NO:7 Primer SEQ ID NO:8 Primer SEQ ID NO:9 Primer SEQ
ID NO:10 Primer
[0122]
Sequence CWU 1
1
10 1 8 PRT artificial sequence artificially synthesized peptide 1
Gly Ala Glu Gly Ser Pro Gly Leu 1 5 2 12 PRT artificial sequence
artificially synthesized peptide 2 Gly Glu Lys Gly Ala Glu Gly Ser
Pro Gly Leu Leu 1 5 10 3 20 DNA artificial sequence oligonucleotide
primer 3 ggagctgtcg tattccagtc 20 4 20 DNA artificial sequence
oligonucleotide primer 4 aacccctcaa gacccgttta 20 5 30 DNA
artificial sequence oligonucleotide primer 5 ggtgaaggtc ggagtcaacg
gatttggtcg 30 6 29 DNA artificial sequence oligonucleotide primer 6
ggatctcgct cctggaagat ggtgatggg 29 7 20 DNA artificial sequence
oligonucleotide primer 7 gagcggggca tgccaggaat 20 8 20 DNA
artificial sequence oligonucleotide primer 8 tggccatcaa caccagcttc
20 9 24 DNA artificial sequence oligonucleotide primer 9 ctgcgctcca
acccgataat gtcc 24 10 22 DNA artificial sequence oligonucleotide
primer 10 tgggggcctg cttgtcctgt ct 22
* * * * *
References