U.S. patent application number 10/639754 was filed with the patent office on 2004-12-09 for transgenic animals.
This patent application is currently assigned to INSTITUT PASTEUR. Invention is credited to Brulet, Philippe, Mouellic, Herve Le.
Application Number | 20040250301 10/639754 |
Document ID | / |
Family ID | 9379875 |
Filed Date | 2004-12-09 |
United States Patent
Application |
20040250301 |
Kind Code |
A1 |
Mouellic, Herve Le ; et
al. |
December 9, 2004 |
Transgenic animals
Abstract
Animals and animal embryos comprising cells having a genome
comprising a recombinant endogenous recipient gene are provided.
Methods of making animals and animal embryos comprising cells
having a genome comprising a recombinant endogenous recipient gene
are also provided.
Inventors: |
Mouellic, Herve Le; (Paris,
FR) ; Brulet, Philippe; (Maurepas, FR) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT & DUNNER
LLP
1300 I STREET, NW
WASHINGTON
DC
20005
US
|
Assignee: |
INSTITUT PASTEUR
|
Family ID: |
9379875 |
Appl. No.: |
10/639754 |
Filed: |
August 13, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10639754 |
Aug 13, 2003 |
|
|
|
08466699 |
Jun 6, 1995 |
|
|
|
6638768 |
|
|
|
|
08466699 |
Jun 6, 1995 |
|
|
|
08301037 |
Sep 6, 1994 |
|
|
|
6528313 |
|
|
|
|
08301037 |
Sep 6, 1994 |
|
|
|
08048056 |
Apr 19, 1993 |
|
|
|
08048056 |
Apr 19, 1993 |
|
|
|
07598679 |
Dec 19, 1990 |
|
|
|
Current U.S.
Class: |
800/8 |
Current CPC
Class: |
C12N 15/907 20130101;
C07K 14/47 20130101; C12N 2800/108 20130101; C12N 15/85 20130101;
A01K 67/0275 20130101; A01K 2227/105 20130101; C12N 15/8509
20130101; A61K 48/00 20130101; C12N 2800/30 20130101; C12N 2830/00
20130101; A01K 2217/05 20130101; A61K 38/00 20130101; C12N 2830/85
20130101 |
Class at
Publication: |
800/008 |
International
Class: |
A01K 067/00 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 19, 1990 |
WO |
PCT/FR90/00185 |
Mar 20, 1989 |
FR |
8903630 |
Claims
1. Process for specific replacement of a gene, in particular by
targetting of a DNA, called insertion DNA constituted by a part of
a gene capable of being made functional or whose functioning may be
made more effective, when it is recombined with a complementing DNA
so as thus to provide a complete recombinant gene in the genome of
a eucaryotic cell characterized in that the insertion site is
situated in a selected gene, called selected recipient gene,
containing the complementing DNA, and in that eucaryotic cells are
transfected with a vector containing an insert itself comprising
the insertion DNA and two so-called "flanking" sequences on either
side of the insertion DNA homologous, respectively, to two genomic
sequences which are adjacent to the desired insertion site in the
recipient gene, the insertion DNA being heterologous with respect
to the recipient gene, and the flanking sequences, being selected
from those which constitute the above-mentioned complementing DNA
and which allow, by means of homologous recombination with
corresponding sequences in the recipient gene, the reconstitution
of a complete recombinant gene in the genome of the eucaryotic
cell.
2. Process according to claim 1, the said insertion DNA containing
either a coding sequence or a regulatory sequence, characterized in
that the insertion site is located in a selected gene called
recipient gene and in that eucaryotic cells are transfected with a
vector containing an insert itself comprising the insertion DNA and
two so-called "flanking" sequences on either side of the insertion
DNA homologous, respectively, to two genomic sequences which are
adjacent to the desired insertion site in the recipient gene, the
insertion DNA being heterologous with respect to the recipient gene
and, the flanking sequences being selected so as to make possible
by homologous recombination depending on the circumstances, of
either the expression of the coding sequence of the entire
insertion DNA under the control of the regulatory sequences of the
recipient gene, or the expression of a coding sequence of the
recipient gene under the control of the regulatory sequences of the
insertion DNA.
3. Process according to claim 1 or 2, characterized in that the
insertion DNA contains a coding sequence lacking a regulatory
element , in particular a promoter which is intrinsic to it.
4. Process according to any one of the claims 1 to 3, characterized
in that the recipient gene is present in the genome of the
eucaryotic cell in at least two copies.
5. Process according to any one of the claims 1 to 4, characterized
in that each of the flanking sequences has a length greater than
150 base pairs and shorter than the length of the recipient
gene.
6. Process according to any one of the claims 1 to 5, characterized
in that the eucaryotic cells are embryonic stem (E.S.) cells.
7. Process according to one of the preceding claims, characterized
in that the gene to be inserted is a gene heterologous with respect
to the species transfected.
8. Process according to one of the preceding claims, characterized
in that the vector contains sequences intercalated between the gene
to be inserted and the flanking sequences.
9. Process according to claim 8, characterized in that the
intercalating sequences contain a sequence coding for a selective
agent making possible the selection of the transformants and, where
appropriate, a marker gene, for example the Lac Z.
10. Process according to one of the preceding claims, characterized
in that the transfection is carried out by electroporation.
11. Process according to one of the preceding claims, characterized
in that the technique of Polymerase Chain Reaction (P.C.R.) is used
to amplify the DNA sequence of the locus at which the insertion is
made in order to verify that the insertion occurred at the desired
site.
12. Process according to claim 1, characterized in that the
insertion DNA contains, between the flanking sequences, a DNA
sequence designed to be recombined with the complementing DNA in
the recipient gene in order to provide a recombinant gene, on the
one hand, and, on the other hand, a sequence coding for a selective
agent making possible the selection of the transformants and a
promoter allowing the expression of the selective agent, the
recipient gene and the recombinant gene coding for products of
expression not conferring a selectable phenotype.
13. Process for the production of transgenic animals, characterized
in that E.S. cells are transfected by the procedure according to
one of the claims 1 to 12 and selected for the homologous
recombination event, namely the correct integration of the foreign
gene, the cells are injected into embryos at a stage at which they
are capable of integrating the transfected cells, for example the
blastocyst stage, the latter are then reimplanted in a surrogate
mother and the chimeric individuals obtained at the term of
pregnancy and in which the colonization of the germ line by the
E.S. cells is observed, are mated in order to obtain transgenic
animals heterozygous for the replaced gene.
14. Plasmid capable of effecting the targetted insertion of a gene,
called insertion gene, in the genome of a eucaryotic cell,
characterized in that it contains an insert itself comprising the
insertion gene and two so-called "flanking" sequences on either
side of the gene to be inserted homologous, respectively, with two
genomic sequences which are adjacent to the desired insertion site
in the recipient gene.
15. Plasmid according to claim 14, characterized in that the insert
contains, between the flanking sequences, a DNA sequence designed
to be recombined with the complementing DNA in the recipient gene,
on the one hand, and, on the other hand, a sequence coding for a
selective agent making possible the selection of the transformants
and a promoter allowing the expression of the selective agent, the
DNA sequence designed to be recombined with the complementing DNA
being other than a gene coding for a selective agent.
16. Plasmid pGN as illustrated in FIG. 1.
17. Eucaryotic cells transformed by the procedure of claim 1.
18. Cells according to claim 17, characterized in that they are
E.S. cells.
19. Transgenic animal in which a single copy of a gene which is
present in the genome in at least two copies was inactivated by the
insertion of a gene which is different from the inactivated gene,
the inserted gene being inserted in a position which allows the
expression of this gene under the control of regulatory sequences
of the inactivated endogenous gene.
20. Use of the procedure according to any one of the claims 1 to 12
for gene therapy.
21. Use of the procedure according to any one of the claims 1 to 12
for the production of transgenic animals.
22. Use of the procedure of claim 9 for genetic marking of
animals.
23. Use of the procedure of claim 13 for the screening of
pharmaceutical products presumed to have an activity with respect
to the products of expression of a pathological gene associated
with a disease, characterized in that the gene to be inserted is
constituted by the pathological gene or a fragment of the latter
and in that the pharmaceutical product to be tested is administered
to the transgenic animal for the purpose of evaluating its activity
on the disease.
Description
[0001] The invention relates to a procedure for specific
replacement of a copy of a gene present in the genome of a
recipient eucaryotic organism by the integration of a gene
different from the inactivated gene. Preferably, the recipient gene
will be present in at least 2 copies in the transfected host cell.
The recipient gene is defined as being the gene where the insertion
of the different gene is made.
[0002] More particularly, the invention relates to the production
of transgenic animals in which the foreign gene has been introduced
in a targetted manner in order to make possible both the
maintenance of the normal genetic functions of the animal and the
expression of the foreign gene under the control of endogenous
promoters.
[0003] By "different or foreign gene" is meant any nucleotide
sequence corresponding to the totality or a part of a "foreign or
different" gene from the recipient gene such as is normally found
in the genome (RNA or DNA), or it also corresponds to an
artificially modified sequence of the normal gene or also to a
fragment of this sequence.
[0004] The invention also relates to the process for the production
of these transgenic animals.
[0005] In the production of transgenic animals, the conventional
methods used for the introduction of heterologous DNA sequences
into the germinal cell line do not make it possible to control the
site of integration of the foreign gene into the genome nor the
number of copies thus introduced. The integration of the foreign
gene occurs at random and, usually, several copies of the gene are
integrated at the same time, sometimes in the form of a
head-to-tail tandem, the site of integration and the number of
copies integrated varying from one transgenic animal to
another.
[0006] Thus, it may happen that endogenous cellular genes, situated
at the point of insertion, are thus inactivated without this being
easily detectable on account of the many random insertions. If the
product of these genes is important for the development of the
animal, the latter will be seriously perturbed. Moreover, the
random insertion of the foreign gene may occur at a site which is
not suitable for the expression of the gene. In addition, the fact
that there may be variation in the site and in the number of
insertions from animal to animal makes the interpretation of the
studies of expression extremely difficult.
[0007] A major problem encountered in the production of transgenic
animals is the obtaining of the expression of the foreign gene.
Generally speaking, two types of experiment have been made in
mice.
[0008] The genes introduced into the germ line are:
[0009] either "complete" genes, comprising coding sequences flanked
by their own regulatory sequences;
[0010] or composite genes, composed of the coding sequence of a
gene fused to a promoter sequence of another gene, the two
fragments even sometimes belonging to two different animal
species.
[0011] Thus, it has been possible to confirm that the specificity
of the expression of the genes in this or that tissue is determined
by their regulatory sequence(s).
[0012] The choice of the suitable promoter for the expression of
the foreign gene in the transgenic animal is thus of primordial
importance.
[0013] Furthermore, the directed mutagenesis of mouse genes in
embryonic stem cells has recently been carried out by resorting to
a technique of "gene targetting" (Thomas et-al., 1987; Thompson et
al., 1989).
[0014] In the first case, the mouse HPRT gene was mutated by
insertion and replacement and, in the second case, a mutated HPRT
gene was corrected. Thompson et al. have extended their experiments
to the production of chimeric mice and have observed the passage of
the genetic modification in the germ cell line.
[0015] In each of the documents cited, the precise site of
integration was targetted by homologous recombination between, on
the one hand, exogenous sequences bearing the mutation or
correction included in a vector under the control of an exogenous
promoter and, on the other hand, their genomic homologue. This
being so, it should be noted that the earlier authors carried out
their experiments on a specific gene (HPRT), the activation of
which by mutation is accompanied by a detectable phenotype. The
targetted mutation described by Thomas et al. had the effect of
inactivating the HPRT gene and, consequently, of causing the
normally detectable phenotype associated with the HPRT to
disappear. The selection gene Neo.sup.R, under the control of a
promoter TK, was thus incorporated into the DNA to be inserted in
order to make possible the selection of the transformants. It is to
be noted that the experiments described in the prior art implied a
selection by means of the recipient gene (e.g. HPRT) or by means of
the inserted gene (e.g. Neo.sup.R). The site of the insertion
and/or the type of gene inserted is thus limited to genes
conferring a selectable character.
[0016] Furthermore, in the prior art, the exogenous sequences on
the vector thus serve both to target the integration site and to
introduce the modification. Subsequent to homologous recombination,
the modified gene is always found in its normal genetic
environment.
[0017] Let it be recalled that a problem which arises in the course
of the production of transgenic animals is the danger of
inactivating an endogenous cell gene which is located at the point
of insertion of the foreign gene.
[0018] Depending on the function of the product of the inactivated
gene, such an inactivation may lead to extensive morphological or
physiological disorders in the transgenic animal, or may even
prevent its survival.
[0019] On the other hand, the inactivation of a gene might be
considered to be advantageous if the gene in question codes for a
receptor of a virus or other infectious agent.
[0020] The inventors have studied the possibility of avoiding the
disadvantages described above and associated, in some cases, with
the possible inactivation of one or several endogenous cell genes
with an important function in the course of the production of
transgenic animals.
[0021] The object of the invention is a process for specific
replacement, in particular by targetting of a DNA, called insertion
DNA, constituted by a part of a gene capable of being made
functional, or the function of which may be made more effective,
when it is recombined with a complementing DNA in order thus to
supply a complete recombinant gene in the genome of a eucaryotic
cell, characterized in that:
[0022] the site of insertion is located in a selected gene, called
the recipient gene, containing the complementing DNA and in
that
[0023] eucaryotic cells are transfected with a vector containing an
insert itself comprising the insertion DNA and two so-called
"flanking" sequences on either side of the DNA of insertion,
respectively homoloqous to two genomic sequences which are adjacent
to the desired insertion site in the recipient gene,
[0024] the insertion DNA being heterologous with respect to the
recipient gene, and
[0025] the flanking sequences being selected from those which
constitute the above-mentioned complementing DNA and which allow,
as a result of homologous recombination with corresponding
sequences in the recipient gene, the reconstitution of a complete
recombinant gene in the genome of the eucaryotic cell.
[0026] The invention also relates to a procedure for the production
of transgenic animals, characterized in that E.S. cells are
transfected under the conditions described above and selected for
the homologous recombination event, namely the correct integration
of the foreign gene, the transfected cells are injected into
embryos at a stage at which they are capable of integrating the
transfected cells (for example at the blastocyte stage), the latter
are then reimplanted in a surrogate mother and the chimeric
individuals obtained at the term of pregnancy are then mated. If
the E.S. cells have colonized the germ line of the chimeric animal,
transgenic animals heterozygous for the replaced gene will be
obtained by mating (F1) in the progeny.,
[0027] It is also possible to insert the gene, borne by the vector
of the invention, into the egg shortly after (i.e. less than 24
hours) fertilization. In this manner, the insertion is effected
while the egg is in the unicellular state.
[0028] The invention also relates to a plasmid capable of effecting
the targetted insertion of a recombinant gene, called inserted
gene, in the genome of a eucaryotic cell, characterized in that it
contains an insert itself comprising the insertion gene and two
so-called "flanking" sequences on either side of the insertion gene
respectively homologous to the two genomic sequences which are
adjacent to the desired insertion site in the recipient gene.
[0029] The invention also relates to transgenic animals in which at
least one endogenous gene has been inactivated by the insertion of
a gene which is different from the inactivated gene, the inserted
gene being inserted in a position which makes possible the
expression of this gene under the control of the regulatory
sequences of the inactivated endogenous gene.
[0030] Hence, as a consequence of the phenomenon of homologous
recombination, the process of the invention makes it possible to
insert in a targetted manner foreign genes, in particular coding
sequences lacking the promoter which is normally associated with
them, into the genome of a eucaryotic organism at a site which
allows their expression under the control of the endogenous
promoter of the gene into which the insertion is made, and
consequently, enables the targetted endogenous gene to be
inactivated.
[0031] According to a preferred embodiment of the invention, the
targetted recipient gene is a gene which is present in the genome
in at least two copies. The utilization of the technique of
electro-poration (Ref. 11) ensures the introduction of one copy
only of the foreign gene.
[0032] According to this variant of the invention, the targetted
insertion of the gene of interest (i.e. the so-called insertion
gene) has the effect of inactivating only that copy of the cellular
endogenous gene at which the insertion is made and of leaving
intact and functional the other copy or copies of this gene.
[0033] In this manner, the genetic functioning of the transgenic
animal is not or is only slightly perturbed by the introduction of
the foreign gene, even if the insertion inactivates a single copy
of a recipient gene essential for the development of the animal.
Thus either its development would be not effected by the insertion
of the foreign gene, or the minor perturbations possible in the
case of the inactivation of a critical gene would probably not be
lethal for the animal. The effects of the insertion of the foreign
gene in the homozygous state could be of any kind and would be
observed in the 2nd generation (F2) after cross breedings of
heterozygous individuals (F1) among themselves.
[0034] If, on the contrary, the inactivation of all of the copies
of a gene is desired, for example, in the case in which the gene
codes for a receptor of an infectious agent, multiple copies of the
foreign gene are introduced. The control of the quantity introduced
may be ensured by having resort to known methods.
[0035] The targetted insertion of the foreign gene thus makes
possible its introduction at a site at which its expression is
under the control of the regulatory sequences of the endogenous
gene where the insertion is made.
[0036] The process of the invention thus makes it possible to
insert the foreign gene behind an endogenous promoter which has the
desired functions (for example, specificity of expression in this
or that tissue), and to do so, if necessary, without inactivating
the other copies of the recipient gene.
[0037] According to a particularly preferred embodiment of the
invention, the insertion DNA contains between the two flanking
sequences, firstly a DNA sequence designed to be recombined with
the complementing DNA in the recipient gene in order to provide a
recombinant gene and, secondly, a sequence coding for a selective
agent making possible the selection of the transformants and a
promoter allowing the expression of the selective agent, the
recipient gene and the recombinant gene coding for expression
products which do not confer a selectable phenotype.
[0038] In this manner, the selection of the transformants is
entirely independent of the nature of the recipient gene and of the
inserted gene, in contrast to the procedures described hitherto in
which the inserted gene or the recipient gene had, of necessity, to
code for a product of expression making possible the selection of
the transformants. The system developed by the inventors allows
total flexibility with respect to the nature of the recipient gene
and the inserted gene or the gene formed by homologous
recombination. In a surprising manner, the inventors have observed
that the insertion of sequences of considerable size (for example
about 7.5 kb) does not effect the frequency of homologous
recombination.
[0039] The effect that the insertion of the DNA sequence may have
according to this aspect of the invention includes, for example,
depending on the type of sequence inserted, the replacement of a
coding sequence, the replacement of a regulatory sequence, the
inactivation or reactivation of a gene by mutation or the
improvement of the level of expression of a gene. It is possible,
according to the invention, to replace a coding phase or a part of
a coding phase by a heterologous sequence which commences at the
initiation codon of the replaced gene in order that the expression
of the inserted gene entirely replaces the expression of the
replaced gene. This avoids the formation of fusion proteins which
might be undesirable in a transgenic animal.
[0040] According to this embodiment of the invention, the inserted
DNA may contain between the flanking sequences a heterologous
coding sequence lacking a promoter, the coding sequence being other
than a gene coding for a selection agent. The insertion DNA may
contain in addition, downstream from the coding sequence and still
between the flanking sequences, a gene coding for a selection
agent, associated with a promoter making possible its expression in
the target cell.
[0041] In this manner, the heterologous coding sequence may be
inserted behind an endogenous promoter which has the desired
properties, for example a certain specificity of expression, or
range of transcription etc., the selectibility of the transformed
cells being entirely independent of the expression of the
heterologous coding sequence. This type of construction makes it
possible, for example, to select the transformants even though the
gene replaced by the heterologous coding sequence is not normally
expressed in the target cells. This is particularly important in
the production of transgenic animals from embryonic stem cells
since a considerable proportion of the genes remain inactive until
a more advanced stage of development of the animal. The Hox-3.1
gene is an example of this type of gene. Furthermore, if the coding
sequence codes for an easily detectable protein, for example the
.beta.-Gal, the development of the transcription pattern of the
replaced endogenous gene may be monitored. The vector pGN is an
example of this type of construction.
[0042] In accordance with another embodiment of the invention, the
inserted DNA may contain a foreign regulatory sequence. The
insertion site and, consequently, the flanking sequences are
selected as a function of the desired purpose, namely either the
insertion of the foreign regulatory sequence in order to give a
"double promoter" effect with the endogenous regulatory sequence,
or the replacement of an endogenous promoter by the foreign
promoter. The coding sequence which is situated under the control
of the regulatory sequence may be endogenous.
[0043] Another possibility would be the targetted insertion of a
foreign DNA which contains both a regulatory sequence and a coding
sequence. It is possible that the regulatory sequence is that which
is naturally associated with the coding sequence.
[0044] The procedure of the invention makes use of a vector
containing two "flanking" sequences, one on either side of the
foreign gene. These flanking sequence have at least 150 base pairs
and are preferably shorter than the length of the recipient gene.
It is essential that the two flanking sequences be homologous with
the two genomic sequences which are adjacent to the desired
insertion site. The flanking sequence of the vector which is
situated upstream from the foreign gene to be introduced is
normally homologous to the genomic sequence which is situated on
the 5' side of the insertion site. Similarly, the flanking sequence
of the vector which is situated downstream from the foreign gene is
normally homologous to the genomic sequence which is situated on
the 3' side of the insertion site.
[0045] It is possible to introduce "intercalating"
sequences-between one or other of the flanking sequences and the
foreign gene, for example sequences making possible the selection
of the transformants, markers, sequences making possible the
cloning of the vector, etc . . .
[0046] The position of these intercalating sequences with respect
to the foreign gene must, however, be selected so as not to prevent
the expression of the foreign gene, in particular of the foreign
coding DNA sequence under the control of the endogenous promoter
or, inversely, the endogenous DNA coding sequence under the control
of foreign regulatory elements supplied by the inserted
sequence.
[0047] In spite of the presence of the flanking sequences, which
promote homologous recombination, it is possible that a certain
number of integrations occur at random. In order to verify that the
targetted insertion has indeed occurred at the targetted site and
not at another site, the technique of the "Polymerase Chain
Reaction" (P.C.R.) (see Ref. 10) is used in order to amplify the
DNA sequence of the locus at which the insertion should be made. In
this manner, only the clones transformed following homologous
recombination are selected.
[0048] The flanking sequences of the vector are quite obviously
selected as a function of the desired insertion site so that the
homologous recombination may take place. Where appropriate, the
flanking sequences may contain replica sequences of the endogenous
promoter and/or modifications to the sequences which precede the
initiation codon in order to improve the level of translation
(sequences upstream) and replica sequences of the termination
sequences, in particular poly-adenylation sites (sequences
downstream).
[0049] The insertion gene may be any gene of interest. Mention
should be made, as non-limiting examples, of the lac.Z gene (as in
the model described below), the genes coding for interlinking or
interferon, the gene for the retinoic acid or 3-beta adrenergic or
H.I.V. receptor, for example, and genes known to be associated with
certain diseases, for example myopathy, etc . . .
[0050] In accordance with a preferred variant of the invention, the
eucaryotic cells are embryonic stem cells (see Ref. 14 and 15).
[0051] In fact, a mutated E.S. cell may be injected into an
immature embryo which, after reimplantation, will be born i-n a
chimeric form. If the germ line is colonized by the mutated cell,
the chimeric animal will transmit the mutation to its progeny.
Subsequently, it will be possible to observe the effects of this
mutation in the homozygous state in some individuals, on their
development, their behaviour, their metabolism, their pathology,
etc . . .
[0052] FIG. 1 shows the plasmid pGN.
[0053] FIGS. 2a and b show the molecules pGMA and pGMD,
respectively, constructed from the plasmid pGN with respect to the
Hox-3.1 gene. These plasmids are plasmids of nutagenesis. The two
parts of the coding phase of the Hox-3.1 gene are represented on
chromosome 15 by the black box "homeo". The corresponding sequences
of Hox-3.1 were cloned in the plasmid pGN. (A : polyadenylation
signal; Enh/Pro: enhancer-promoter).
[0054] 07 and 08 illustrate the two oligonuclueotides used in the
PCR.
[0055] FIGS. 3 to 6 show the plasmids used in the construction of
the pGN.
[0056] FIG. 7 illustrates the detection of homologous recombination
with the Polymerase Chain Reaction (P.C.R) technique on transfected
E.S. cells.
[0057] FIG. 8(a) and (b) shows Southern analyses of individual
positive clones (L5 and F2) and E.S. cells (C.C.E.).
[0058] The procedure of the invention is of very wide industrial
application and may vary according to the nature of the foreign
gene introduced.
[0059] The genetics of mammals will be able to make considerable
progress as a result of the recent possibility of. mutagenizing
specifically any gene, thus making it possible to better define its
role. By means of this technology which involves homologous
recombinations and E.S. cells, valuable information will be
provided concerning oncogenes, growth factors, transcription
factors, etc . . . genes which concern very topical subjects in
fundamental research or applied research. An important prospect for
medical research is the possibility of reproducing a human disease
whose genetic analysis is known (certain human diseases with
pathology, such as Duchesne myopathy) in order to study its
mechanisms better and to discover a treatment.
[0060] By applying the process of the invention, a gene known to be
responsible for a certain disease is inserted in a targetted manner
into the genome of a E.S. cell. The transgenic animal which is
subsequently produced provides a useful model of this disease.
[0061] If necessary, and as described above, the normal genetic
functions may be approximately maintained, in spite of the
insertion of the foreign gene.
[0062] Another application of the process of the invention consists
of inserting an insertion gene which is easily detectable e.g. the
lac.Z gene and which can thus play the role of cell marker. In this
manner, studies of lineage e.g. in animals entered in competitions
are facilitated, and the pedigree may be monitored.
[0063] The insertion of the lac.Z gene as insertion gene also makes
possible studies of the promoter. Owing to the possibility of
detecting the .beta.-galactosidase activity, the activity and
specificity of various endogenous promoters may be studied by
targeting different sites in the same or different types of cells.
It will be possible to carry out the same studies on a whole
organism during development, or in the adult state by using the
techniques of chimeric or transgenic animals.
[0064] The inventors have made the surprising observation that the
frequency of homologous recombination is not effected by the
insertion of fragments of large size, for example the Lac. Z. This
observation suggested to the inventors that the technique of
homologous recombination would be well adapted to the insertion of
other heterologous genes which are of large size.
[0065] Owing to the possibility of being able to modify the genome
of an animal, the process of the invention may also be used as
"gene therapy". The most obvious uses would consist of inactivating
the genes of receptors for infectious (viruses or bacteria) or
toxic agents. If such mutagenesis were to prove lethal, it would be
necessary to reestablish the lost function without reestablishing
the sensitivity to the noxious agents. A modified gene coding for
such a receptor could be reintroduced into the mutated cell
provided that the modification could be brought about by homologous
recombination. This modification of the genetic inheritance would
confer on the animal an immunity against the disease under
consideration.
[0066] This protocol may also be implemented in the context of
auto-transplantation. Diseased or healthy cells taken from a
patient could be treated and immunized, then reimplanted into the
same individual.
[0067] The technique of the invention also lends itself to studies
of the activity of pharmaceutical products presumed to have an
activity towards the products of expression of a pathological gene
associated with a disease. In this case, the inserted gene is
constituted by the pathological gene and the pharmaceutical product
is administered to the transgenic animal for the purpose of
evaluating its activity on the disease.
[0068] The invention will be illustrated by making reference to the
plasmid pGN and its use in the targetted insertion of a foreign
gene (lac.Z, coding for the enzyme .beta.-galactosidase of E. coli)
into the genome of a E.S. cell of mice. The lac.Z gene was selected
on account of the fact that its expression may be easily detected
and is simply used for purposes of illustration.
[0069] The coding phase of the .beta.-galactosidase enzyme of E.
coli (lac.Z; 1-3057), fused with a genomic sequence (7292-3) of the
mouse gene Hox. 3-1. (Ref. 1), starts with the initiation codon for
this gene. In fact, the sequence which precedes the initiation
codon of Hox-3.1 is identical with the consensus sequence observed
in vertebrates (ref. 2), thus making possible an improved level of
translation of .beta.-galactosidase in the cells of vertebrates.
The lac. Z gene is followed by a polyadenylation signal of, for
example the SV 40 virus, like most of the eucaryotic genes, in
order to stabilize the messenger RNAs.
[0070] The activity of the .beta.-galactosidase of E. coli, which
is functional in the eucaryotic cells, may be detected in different
ways. Cells expressing the lac.Z gene take on a blue colour, after
fixation in the presence of X-Gal, which is a substrate for
.beta.-galactosidase (Ref. 3). A new substrate, the FDG
(fluoroscein di-.beta.-galactopyranosi- de) makes it possible to
detect and determine the .beta.-gal. activity while keeping the
cells alive (Ref 4). The cells expressing lac.Z accumulate a
fluorescent product and can be isolated with the aid of a cell
sorter or FACS (fluorescence-activated cell sorter).
[0071] The transcription unit of the gene for resistance to
neomycin is derived, in large part, from the plasmid pRSV neo (Ref.
5). The LTR (long terminal repeat) of the Rous sarcoma virus
provides very powerful promoter and enhancer sequences in many
eucaryotic cells (Ref. 6). From the bacterial transposon Tn5 are
derived an active promoter in E. coli and the coding phase of the
enzyme phosphotransferase (Ref. 7), which is followed by the
polyadenylation signal of the SV40 virus. The same gene under the
double control of the RSV and Tn5 promoters can confer resistance
to neomycin or kanamycin on bacteria and resistance to G418 on
eucaryotic cells.
[0072] As a result of the effect of a simple point mutation, the B
unit of the enhancer sequences of the PyEC F9.1 strain of the
polyoma virus became much more active in different types of cells,
and in particular in embryo carcinoma (EC) cells (Ref. 8). Two
copies of this enhancer Py F9.1 were inserted in tandem into the
plasmid pGN, upstream from the LTR-RSV, and in the "late promoter"
orientation of the regulatory region of polyoma.
[0073] In order to improve the level of translation of the
phosphotransferase, the sequence preceding the initiation codon was
modified during oligonucleotide mutagenesis. Thus the sequence T T
C G C A U G became G C A C C A U G, corresponding much better to
the consensus initiation sequence for translation in vertebrates
(Ref. 2).
[0074] It was possible to evaluate the improvements introduced into
the transcription unit of the gene for resistance to neomycin by
transfecting embryonic stem cells (ES) of the mouse. At equal
molarity of plasmid, a construction with the Py. F9.1 enhancers
produced 7.5.times. more resistant clones to G418 than the pRSV neo
and 2 to 3.times. more than the pMCl Neo described by Capecchi et
al (ref. 13). Again, the number of clones was increased
60.times.,-that is 450.times.compared to the PRSV neo, by modifying
the initiation sequence of translation. Homologous recombination
may be a quite rare event, depending on the experimental conditions
used (p. ex 1/1000 for HPRT, ref. 13). A vector possessing a high
efficacy of selection is thus very useful, all the more so since
the conditions of electroporation mainly give rise to the
integration of a single copy.
[0075] The pGN plasmid, contains, in addition, a bacterial origin
of replication of the type colEl, pBR322, which makes the clonings
and preparations in E. coli possible.
[0076] Finally, a multiple cloning site (M.C.S.), synthesized in
vitro, which only contains unique sites of cleavage in pGN, was
inserted upstream from lac.Z., in order to facilitate the uses of
this plasmid.
[0077] The plasmid "flanking" sequences which produce homologous
recombination are added to the extremities of the pGN plasmid after
linearization of the plasmid upstream from lac.Z through a site of
the MCS (see FIG. 2). In this case, the flanking sequences selected
are homologous with the chromosomal sequences derived from Hox-3.1
subsequently required to engage in homologous recombination.
[0078] FIG. 2 places the molecule constructed from the plasmid pGN
with respect to the Hox-3.1 gene. In this case, recombination
between the plasmid and chromosomal sequences of Hox-3.1 would
result in an insertion at the start of the coding phase of this
gene, hence in its total inactivation.
[0079] The pGN plasmid brings together several advantages for this
methodology which is applicable to any gene. Since the event of
homologous recombination may be quite rare (of the order of 1 for
1000 non-homologous integrations), it is necessary to be able to
analyse a large number of clones whose resistance to G418 is
sufficiently high as to be expressed in any part of the genome. The
modifications introduced into the transcription unit of the
phosphotransferase completely solve these problems. The method of
mutagenesis by homologous recombination corresponds to inactivating
a gene by an insertion or a substitution, but the plasmid pGN
offers the additional advantage of being able to substitute the
expression of .beta.-galactosidase for that of the mutated gene.
Finally, the MCS facilitates the clonings of genomic fragments.
EXAMPLES
I--Construction of the Plasmid pGN
[0080] The intermediate plasmids are numbered according to their
step.
[0081] 1.degree. Step:
[0082] Insertion of a Xho I Site into the Bpl I Site of pRSV
Neo
[0083] Insertion of a Xho I linker into the Bgl I site of pRSV neo,
filled in by means of the Klenow fragment of the DNA polymerase of
E.coli.
[0084] 2.degree. Step:
[0085] Insertion of a Cla I Site into the Nde I Site of the Plasmid
p1
[0086] Insertion of a Cla I linker into the Nde I site of pl,
filled in by means of the Klenow polymerase.
[0087] 3.degree. Step:
[0088] Insertion of the Enhancer Py F9.1 into the Cla I Site of the
Plasmid p2
[0089] Insertion of the enhancer Py F9.1 Pvu II-Pvu II isolated
through a unique site, Acc I, into the Cla I site of p2. Selection
of a clone containing two enhancers oriented in the "late promoter"
sense.
[0090] 4.degree. Step:
[0091] Sma I-Hpa I Deletion from the Plasmid p3
[0092] The two enzymes give extremities with "blunt ends" which may
be ligated directly. This deletion removes the intron of the t
antigen of SV 40, which is not very useful and appreciably uses the
size of the transcription unit of the phosphotransferase.
[0093] 5.degree. Step:
[0094] Insertion of a Xho I Site into the Bam HI Site of pCH110
[0095] Insertion of a Xho I linker into the Bam HI site of the
plasmid. pCH 110 (Pharmacia), filled in by the Klenow
polymerase.
[0096] 6.degree. Step:
[0097] Insertion of the 3' Lac.Z-polyA SV 40 into the Plasmid
P4
[0098] The 3' part of the coding phase of .beta.-galactosidase,
followed by the polyadenylation signal of the SV 40 virus is
isolated from the plasmid p5 through the sites Xho I-Aat II and
cloned in the plasmid p4 through the same sites.
[0099] 7.degree. Step:
[0100] Insertion of the 5' Lac.Z into the Vector KS-
[0101] The 5' part of the coding phase of .beta.-galactosidase is
isolated from the plasmid pMC 1871 (Pharmacia) through the sites
Pst I-Sac I and cloned in the vector KS-(Stratagene) through the
sane sites.
[0102] 8.degree. Step:
[0103] Fusion of a Hox-3.1 Genomic Sequence with the 5' Lac.Z
[0104] A genomic sequence of the gene Hox-3.1, cloned in the vector
KS-, is purified by successive digestions by the Sac I enzyme, then
by the Mung bean nuclease and finally by the enzyme Apa I. This
insert is fused with the 5' part of the coding phase of
.beta.-galactosidase by cloning in the plasmid p7 digested by means
of Apa I-Sma I. The protein thus fused contains the initiation
codon for the translation of the Hox-3.1 gene followed by the
coding phase for .beta.-galactosidase (subsequently verified by
sequencing).
1 Met Ser Ser Ile Pro Gly Asp Pro CCAGC ATG AGC TCC ATT CCC GGG GAT
CCC GGTCG TAC TCG AGG TAA GGG CCC CTA GGG Sac I CCAGC ATG AGC T Sma
I GGTCG TAC Mung bean nuclease CCAGC ATG GGG GAT CCC GGTCG TAC CCC
CTG GGG Met Gly Asp Pro CCAGC ATG GGG GAT CCC GGTCG TAC CCC CTA
GGG
[0105] 9.degree. Step:
[0106] Insertion of Hox-3.1-5' Lac.Z into the Plasmid p6
[0107] The fusion Hox-3.1-5' lac.Z is isolated from the plasmid p8
through the sites Apa I-Sac I and cloned in the plasmid p6 through
the same sites. This cloning has the effect of reconstituting the
coding phase of .beta.-galactosidase in its entirety.
[0108] 10.degree. Step:
[0109] Insertion of the Neo.sub.RGene into the Vector KS+
[0110] The gene for resistance to neomycin (bacterial promoter and
coding phase of the phosphotransferase) is isolated from the pRSV
neo through the Hind III-Eco RI sites and cloned in the vector KS+
(Stratagene).
[0111] 11.degree. Step:
[0112] Mutagenesis of the Initiation Sequence of Neo.sup.Rin
p10
[0113] The initiation sequence of the translation of the
phosphotransferase is modified in order to be identical with the
consensus sequence observed in the vertebrates and thus makes
possible a higher level of initiation of the translation, hence
enhanced resistance to G418 in the case of mammalian cells. The
modification also creates a Apa LI site which enables the
effectiveness of the mutagenesis to be controlled.
2 Apa LI GTTTCGCATG GTGCACCATG
[0114] An oligonucleotide (CTTGTTCAATCATGGTGCACGATCCTCA) comprising
a region of mismatching with the sequence of the pSRV neo
(underlined) is synthesized (Gene Assembler, Pharmacia), then
phosphorylated by the polynucleotide kinase of the bacteriophage
T4. A single-stranded matrix of the plasmid p10 is prepared as a
result of the f1 origin of the plasmid KS+ and hybridized with the
oligonucleotide of mutagenesis. The second strand is synthesized
and repaired by the Klenow polymerase and the DNA ligase of the
bacteriophage T4. After transformation of bacteria, the mutated
clones are screened with the aid of the oligonucleotide labelled
with .sup.32P. The mutagenesis was verified by digesting with Apa
LI as well as by sequencing.
[0115] 12.degree. Step:
[0116] Replacement of the Initiation Sequence in the Plasmid p9
[0117] A fragment containing the modified initiation sequence for
the translation of the gene for resistance to neomycin is isolated
from the plasmid p11 by means of the enzymes Hind III-Bag I and
cloned in the plasmid p9 through the same sites.
[0118] 13.degree. step;
[0119] Insertion of the Multiple Cloning Site into the Plasmid
p12
[0120] Two complementary oligonucleotides are synthesized (Gene
Assembler, Pharmacia), then phosphorylated. After matching, the MCS
is cloned into the Apa I-Sac II sites of the plasmid p12 through
its cohesive ends.
3 Xma I Asp 718 Xmn I Apa I Sma I Kpn I Xba I Nsi I Sac II 5'
CCCCGGGGGTACCTCTAGAATGCATTCCGC 3' 3'
CCGGGGGGCCCCCATGGAGATCTTACGTAAGG 5'
[0121] The multiple cloning site was also verified by
sequencing.
II--Addition of the "Flanking" Sequences to the Extremities of the
Linearised Plasmid pGN Upstream from Lac.Z' Through a Site of the
M.C.S.
[0122] The flanking sequences used were selected as a function of
the desired insertion site (for example, Hox-3.1. , see FIG. 2a and
b pGMA and pGMD).
[0123] In the construction of the plasmid of mutagenesis pGMD, two
arms of DNA homologous to the Hox-3.1 locus were cloned at the Apa
I-Nsi I and Nsi I-Sac II sites of the vector pGN. The 5' arm starts
at the Sac II site (CCGCGG) at the nucleotide 219 of the cDNA c21
of Hox-3.1. This fragment extends for 6.8 kb at the 5' up to the
first BamHI site. The 3' arm starts at the Apa 1 site (GGGCCC) at
the nucleotide 885 of the cDNA c21. This fragment extends for 1.5
kb at the 3' up to the first PstI site. A NsiI linker was inserted
into the BamHI site of the 5' fragment and into the PstI site of
the 3' fragment. The 5' and 3' arms were cloned in the vector pGN
in the Nsi I-Sac II and the Apa I-Nsi I sites, respectively. The
sequence of the cDNA of Hox-3.1 c21 has been published (ref.
1).
[0124] The plasmid of mutagenesis is linearised by digestion with
Nsi I before electroporation of the E.S. cells. Its extremities are
formed of two genomic arms cloned at the Apa I-Nsi I and the Nsi
I-Sac II sites of the vector pGN.
[0125] The plasmid pGMD does not possess a polyadenylation signal
after the resistance gene but, on the contrary, does possess a
region rich in AU responsible for the selective degradation of
mRNA, inserted into the sequence of the intron of the Hox-3.1 of
the plasmid.
[0126] Another plasmid of mutagenesis, pGiA, possesses the same
structure as pGMD but contains the signals for polyadenylation and
termination of transcription of the SV40 and does not possess the
AU sequence for the degradation of mRNA downstream from the
Neo.sup.r gene. The purpose of these modifications is to reduce the
level of transcripts of the Neo.sup.r in the clones derived from
random integration. On the other hand, clones derived from
homologous recombination events between pCKD and a Hox-3.1 locus
should have inaltered growth durng the selection with G418, the AT
sequence for the degradation of mRNA being removed by the
recombination procedure itself or spliced with the intron
Hox-3.1.
[0127] In the experimental steps which follow, the protocol
described by Thompson et al., 1989 was followed for the production
of chimeric animals.
III--Transfection of Mouse Embryonic Cells.
[0128] The method described by Thompson et al. 1989, was used in
order to transfect mouse embryonic cells. The use of the technique
of electroporation ensures the introduction of a single copy of the
foreign gene (lac.Z) per cell. After transfection, several clones
expressing .beta.-galactosidase were isolated.
[0129] The plasmids of mutagenesis pGMD and pGMA were linearised
and introduced by electroporation into E.S. cells in order to
promote the insertion of one copy only into the genome (ref.
11).
[0130] The initial transfections were carried out in order to
compare the efficiency of screening of the Hox-3.1 of the plasmids
pDIA and pGMD (see table I).
4TABLE I Homologous recombination in the Hox-3.1. gene Plasmid
N.degree. of No. of clones of the set forming the No. of positive
Exp. mutagenes analysed set P.C.R. results I pGMA 3 600 0(2) II
pGMD 5 250 3(5) III pGMD 84 2-3 5(5)
[0131] The E.S. cell line "C.C.E." (ref.16) was maintained
continuously on fibroblast nurse cell layers (ref. 17). For the
experiments I and II, 1.5.times.10.sup.7 E.S. cells in 1.5 ml of
HeBS were electroporated (ref. 11) at 200 V with 40 mg of
linearised plasmid, then spread on four culture dishes (diameter
100 mm). For experiment III, the shock was administered under the
same conditions but a quarter of the cells were spread on four
plates with 24 wells. The next day, 250 .mu.g ml .sup.-1 M.sup.-1
G418 were added. Each transfection gave rise to about 2400 clones
with pGMA and about 1000 clones with pGMD.
[0132] The mean number of clones of E.S. cells resistant to G418 in
each set is indicated in table I, as well as the number of sets
giving a positive result with the P.C.R. technique. A positive
result means that it was possible to observe a band of 1.6 kb on an
agarose gel stained with ethidium bromide (see FIG. 7). The number
of sets giving a positive signal after a Southern analysis of the
P.C.R. mixture and hybridization with a specific probe which did
not contain the sequences of the primers is indicated in
parentheses (FIG. 8).
[0133] Detection of Homologous Recombination with the P.C.R.
[0134] P.C.R. was carried out on 10.sup.5 cells of a set of 250
clones of the transfection II (see lane D of FIG. 7). In the other
lanes, four sets of the transfection III were analysed together by
mixing about 4.times.5000 cells. The primers 07 and 08 used in the
P.C.R. surround the sequence 3' Hox-3.1 of the plasmid of
mutagenesis (FIG. 2). The 1.6 kb fragment covering this 3' sequence
can only be amplified in the case of homologous recombination. The
lanes 2, 3 and D illustrate positive results.
[0135] The DNA of the E.S. clones was prepared at the time of the
replica on a filter using the method "boiling-proteinase K
digestion boiling" (ref. 18). 40 cycles of amplification (40
seconds at 94.degree. C., 1 minute at 60.degree. C., 7 minutes at
72.degree. C.) were performed in a reaction mixture of 100 .mu.l,
containing 67 mM Tris-HCL (pH 8.6), 16.7 mM
(NH.sub.4).sub.2SO.sub.4, 6.7 mm MgCl.sub.2, 10 mm
2mercaptoethanoI, 0.01% (wt/v) gelatin, 200 .mu.M dATP, dTTP and
dCTP, 100 .mu.M dGTP, 100 .mu.M 7-deaza-dGT, 600 ng of each primer
(07: AACTCCCTCCTCTGCTATTC and 08: CAGCAGAAACATACAAGCTG) and 3U Taq
polymerase (Perkin Elmer Cetus), covered with 100 .mu.l of
paraffin.
[0136] Half of the reaction mixture was applied to a 0.7% agarose
gel stained with ethidium bromide. The size marker is a Eco RI+Hind
III digest of lambda DNA.
[0137] Southern Analyses
[0138] Three independent clones of E.S. cells containing the
mutated Hox-3.1 (identified by P.C.R.) were isolated from the
positive sets by using pipettes. Their DNA was examined by means of
Southern analysis after digestion with the restriction enzymes
indicated in FIG. 8 in order to confirm the specific screening and
to distinguish between the recombined and wild-type loci. Two
different probes were used in the analysis of the 3' end of the
Hox-3.1 loci in the mutated clones and in the non-mutated E.S.
cells serving as controls (FIG. 8c). The first probe "a" was
contained in the Hox-3.1 sequences of the plasmid of mutagenesis
and demonstrated the number of integrations of vector and their
physical linkages. One of the three recombined clones contained, in
addition, a copy of the plasmid integrated at random (FIG. 8a,
clone F2). The second probe "b" which was not contained in the
vector of mutagenesis distinguished between the recombined and
wild-type Hox-3.1 alleles (FIG. 8b). The recombined Hox-3.1 locus
showed with both probes the pattern of hybridization expected from
the restriction maps of the vector of mutagenesis and the intact
locus. Furthermore, the existence of two recombination domains in
the 3' arm of the vector was confirmed by the presence or absence
of the AT sequence in the recombined Hox-3.1 locus (for example
FIG. 8, clone L5). The 5' end of the Hox-3.1 locus was also
analysed for the homologous recombination event. Restriction
enzymes not possessing sites in the 5' Hox-3.1 sequence of 6.8 kb
of the vector of mutagenesis were used in the digestion of the DNAs
of the recombined clones. These DNAs were then subjected to
electrophoresis in a pulsed field in order to distinguish the
fragments of high molecular weight. A Southern analysis of this gel
also showed the recombined alleles correctly and the wild-type
Hox-3.1 alleles by using a probe possessing a sequence upstream
from the plasmid of mutagenesis.
[0139] The Southern analyses demonstrated that an allele of the
Hox-3.1 gene had recombined as expected. The homologous
recombination was equivalent to a double "crossing-over" between
the genomic arms of the plasmid of mutagenesis and the homologous
chronosomal sequences (FIG. 2).
[0140] In the recombinant clones, the lac Z gene has been placed
under the control of the promoter and regulatory sequences of the
Hox-3.1 upstream from the AUG codon, but the 3' maturation signals
of the mRNA were derived from the SV40. In these recombined clones,
the expression of lac.Z was not detectable by staining with
.beta.-Gel which is consistent with the absence of transcription of
Hox-3.1 in E.S. cells determined by RNase protection analysis. The
activity of .beta.-Gel could be induced in some cells after 3 or 4
days of culture in the presence of 5.10.sup.-7M retinoic acid,
known conditions for inducing the transcription of Hox-3.1 (ref.
19).
[0141] By using the vector of mutagenesis pGMA, which possesses a
total homology of 8.3 kb DNA with the Hox-3.1 locus, a fragment of
120 bp was replaced by an insertion of 7.2 kb. The frequency of
this targetted replacement (1/900) is comparable to that obtained
recently (1/1000) with HPRT (ref. 13) or with En-2 (1/260) (ref.
20), the heterologous fragment inserted being, however, much
smaller (1.1 and 1.5 kb, respectively) in these latter cases.
Surprisingly, it was observed that a very high frequency of
homologous recombination (1/40) could be obtained with the vector
pGMD. The removal of the 3' maturation signals for mRNA and the
addition of the sequence for the degradation of mRNA to the gene
for the resistance to neomycin had the effect of reducing the total
number of clones resistant to G418 by 2.4 (table I). The specific
screening ratio was almost 10 times higher (900/40). Even the
mechanism of homologous recombination must have been affected in
the experiments with pGMD. A possible explanation of these results
would be that a AT sequence of 51 bp could provide, in vivo, an
open loop in the plasmid of mutagenesis owing to its lower melting
temperature. If the neighbouring Hox-3.1 sequences of the pGMD can
be influenced by this opening, on each side of the AT region, they
could react more effectively in the single-stranded state with the
Hox-3.1 chromosomal locus. The model of mitotic recombination in
yeast suggests that it is initiated by such an exchange of strands,
whereas the mechanism of homologous recombination remains unknown
in the more complex eucaryotes.
[0142] FIG. 8 shows the results of the Southern analysis performed
on positive individual clones (L5 and F2) and on E.S. cells
(C.C.E.).
[0143] The probes used hybridize only with Hox-3.1 sequences
included in the vector (a) or excluded from the vector of
mutagenesis (b). The pattern of hybridization of the recombined
Hox-3.1 locus (open triangles) is clearly distinguished from the
wild-type locus (black triangles). The stars indicate the
hybridization bands of a copy of the plasmid which has been
integrated at random. The size marker is a Eco RI+ Hind III digest
of lambda DNA.
[0144] The FIG. 8(c) shows the restriction maps of the recombined
(rec.) and wild-type (wt) Hox-3.1 alleles. The parts of the vector
of mutagenesis and of the Hox-3.1 locus are indicated with the same
symbols as those used in FIG. 2. In this case, the AT sequence has
been integrated by homologous recombination. The vertical arrow
indicates the 3' end of the plasmid of mutagenesis. The location of
the "a" and "b" probes used in the Southern analysis is also
indicated. The abbreviations used in FIG. 8 are the following: B,
Bam HI; D, Dra I, E, Eco RI; H, Hind III; S, Sal I; X, Xho I.
IV--Production of Chimeric Embryos
[0145] A microinjection into blastocysts was carried out with two
recombinant E.S. clones containing an intact Hox-3.1 allele and a
recombined allele, these clones did not contain any other copy of
the plasmid of mutagenesis. The karyotypes of the cells were
normal.
[0146] Ten to fifteen mutated cells were microinjected per
blastocyst. After reimplantation in surrogate mothers, the embryos
were collected at 9.5, 10.5 and 12.5 days p.c. and analysed for the
expression of lac.Z. The range of transcription of Hox-3.1 at these
stages had been determined beforehand by in situ hybridization
analysis (ref. 1). The Hox-3.1 transcripts are detectable for the
first time at the stage of late gastrulation and are distributed in
all of the tissues of the posterior part of the animal. Later, the
distribution becomes progressively limited in space and specific
with respect to tissue. At the stage of 12.5 days p.c.,
transcription is localized in the cervical region of the neural
tube, at the level of the heart. During the course of
embryogenesis, the distribution of the transcription of Hox-3.1
thus undergoes modifications. The 10.5 days p.c. stage seems to be
a period of transition, transcription taking place both in the two
posterior regions and in the cervical neural tube.
[0147] In chimeric embryos at 9.5 and 10.5 days p.c., the caudal
part of the posterior bud exhibited intense .beta.-Gal activity,
whereas the marker was never detected in the anterior thoracic
region or the head (FIG. 9a). In the posterior region, cells
stained by .beta.-Gal were observed in all of the tissues and all
of the embryonic strata. Between the two buds which give rise to
the limbs, stained cells were distributed in restricted zones, in
the superficial ectoderm (FIG. 9b) as in the posterior regions
(FIG. 9c) and, in the form of narrow lines or stripes, in the
neural tube (FIG. 9b). These stripes showed an irregular and
asymmetric distribution in the wall of the neural tube. The
transcription of Hox-3.1 was not detected in the thin layer of
cells towards the closure of the neural tube. These cells did not
perhaps withstand the treatments used during the in situ
hybridization. It has been observed that the cells of the neural
ectoderm very early form part of different parts of the nervous
system and migrate in a radial direction, following restricted
lateral movements (ref. 21). These results are thus consistent with
that observation.
[0148] The expression of Lac.Z has thus correctly illustrated the
first part of the transcription of the homeogene Hox-3.1, i.e. in
all of the tissues of the caudal regions of the embryos at 9.5 and
10.5 days p.c., and has provided novel information concerning the
mode of transcription of Hox-3.1.
[0149] On the other hand, the expression of Lac.Z has not been
observed in the cervical regions of the neural tube of chimeric
embryos at 12.5 days, nor in the anterior region of embryos at 10.5
days; this was not the result expected from the studies of in situ
hybridization. The subsequent phase of transcription of Hox-3.1
observed from day 10.5 in the very localized zones of the neural
tube was not characterized by the activity of .beta.-Gel. One
possible explanation for this result would be that, whereas the
expression of lac.Z is under the control of the Hox-3.1 promoter,
the 3' sequences of the Hox-3.1 are absent from the reporter gene.
It is possible that 3' sequences of the initiation codon AUG of the
Hox-3.1 have an influence on the late expression of Hox-3.1 in the
anterior domain. An effect of "gene dosage" could also explain this
result. The autoactivation of several homeogenes in Drosophila has
been demonstrated genetically or suggested by the formation of
complexes between the DNA and the proteins of the homeobox.
[0150] If the late component of the transcription of Hox-3.1 in the
neural tube is maintained by a similar mechanism, the inactivation
of an allele would have a dominant effect in the cells of the
neural ectoderm. Since one allele only would produce the Hox-3.1
protein, the activation signal would be diluted on the two
promoters. The reduction of autoinactivation in the two loci would
thus be able to bring the initiation of transcription to a complete
stop. This would explain why no expression of Lac.Z was detected in
the cervical region of the neural tube of embryos at 10.5 and 12.5
days.
V--Passage of the Modification into the Germ Cell Line: Production
of Transgenic Animals
[0151] The effects in F.sub.1 and F.sub.2 of the modification
introduced by the targetted insertion were observed after
reproduction of the chimeras. The passage of the modification into
the germ cell line was noted.
Bibliography
[0152] 1. Le Mouellic, H., Condamine, H. et Brlet, P. (1988). Genes
& Development. 2, 125-135.
[0153] 2. Cavenir, D. R. (1987). Nucleic Acids Res. 15,
1353-1361.
[0154] 3. Sanes, J. R. Rubenstein, J. L. R. et Nicolas, J. F.
(1986) EMBO J. 5, 3133-3142.
[0155] 4. Nolan, G. P., Fiering, S., Nicolas, J. F. et Herzenberg,
L. A. (1988) Proc. Natl. Acad. Sci. USA 85, 2603-2607.
[0156] 5. Gorman, C., Padmanabhan, R. et Howard, B. H. (1983).
Science. 221, 661-553.
[0157] 6. Gormann, C. M., Merlino, G. T. Willingham, M. C. Pastan,
I. et Howard, B. H. (1982) Proc. Natl. Acad. Sci. USA 79,
6777-6781.
[0158] 7. Southern, P. J. et Berg, P. (1982) J. Mol. Appl. Genet 1,
327-341. S. Herbomel, P., Bourachot, B. et Yaniv, M. (1984). Cell.
39, 653-662.
[0159] 9. Robertson, E. J. (1987). Teratocarcinomas and embruyonic
stem cells: A practical approach. IRL Press, Oxford.
[0160] 10. Kahn, A. (1988). M{dot over (e)}decine/Sciences 4,
515-518.
[0161] 11.G. Chu, Hayakawa H., Berg. P. (1987) Nucleic Acid
Research 15, Nr. 3, 1311-1326.
[0162] 12. Thompson, S., Clarke, A. R., Pow, A. M., Hooper, M. L.,
Melton, D. W., (1989) Cell, 56, 313-321.
[0163] 13. Thomas, K. R.,Capecchi, M. R., (1987) Cell, 51
503-512.
[0164] 14. Evans, M. J., Kaufmann, M. H. (1981) Nature, 292,
154-155,
[0165] 15. Robertson, E. J., (1986) Trends in Genetics, 9-13 16.
Robertson, E., Bradley, A., Kuehn, M. & Evans, M. Nature 323,
445-448 (1986).
[0166] 17. Robertson, E. J. in Teratocarcinomas and Embryonic Stem
Cells (ed. Robertson, E. J.) 71-112 (IRL, Oxford, 1987).
[0167] 18. Kim, H. S. & Smithies, O. Nucleic Acids Res. 16,
8887-8903 (1988).
[0168] 19. Breier, G., Bucan, M., Francke, U., Colberg-Poley, A. M.
& Gruss, P. EMBO J.5, 2209-2215 (1986).
[0169] 20. Joyner, A. L., Skarnes, W. C. & Rossant, J. Nature
338, 153-156 (1989).
[0170] 21. McKay, R. D. G. Cell 56, 815-821 (1989).
Sequence CWU 1
1
17 1 14 DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 1 ccagcatgag ctcc 14 2 5 PRT Artificial
Sequence Description of Artificial Sequence Synthetic peptide 2 Ile
Pro Gly Asp Pro 1 5 3 15 DNA Artificial Sequence Description of
Artificial Sequence Synthetic oligonucleotide 3 attcccgggg atccc 15
4 12 DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 4 ccagcatgag ct 12 5 4 PRT Artificial
Sequence Description of Artificial Sequence Synthetic peptide 5 Met
Gly Asp Pro 1 6 17 DNA Artificial Sequence Description of
Artificial Sequence Synthetic oligonucleotide 6 ccagcatggg ggatccc
17 7 10 DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 7 gtttcgcatg 10 8 10 DNA Artificial
Sequence Description of Artificial Sequence Synthetic
oligonucleotide 8 gtgcaccatg 10 9 28 DNA Artificial Sequence
Description of Artificial Sequence Synthetic oligonucleotide 9
cttgttcaat catggtgcac gatcctca 28 10 30 DNA Artificial Sequence
Description of Artificial Sequence Synthetic oligonucleotide 10
ccccgggggt acctctagaa tgcattccgc 30 11 32 DNA Artificial Sequence
Description of Artificial Sequence Synthetic oligonucleotide 11
ggaatgcatt ctagaggtac ccccgggggg cc 32 12 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic
oligonucleotide 12 aacttccctc tctgctattc 20 13 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic
oligonucleotide 13 cagcagaaac atacaagctg 20 14 29 DNA Artificial
Sequence Description of Artificial Sequence Synthetic
oligonucleotide 14 ctgcaggtcg acggatccgg ggaattccc 29 15 12 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
oligonucleotide 15 ggggatcccg tc 12 16 18 DNA Artificial Sequence
Description of Artificial Sequence Synthetic oligonucleotide 16
aaataataat aaccgggc 18 17 23 DNA Artificial Sequence Description of
Artificial Sequence Synthetic oligonucleotide 17 aggggggatc
cgtcgacctg cag 23
* * * * *