U.S. patent application number 09/881012 was filed with the patent office on 2004-12-09 for susceptability and resistance genes for bipolar affective disorder.
Invention is credited to Egeland, Janice A., Ginns, Edward I., Paul, Steven M..
Application Number | 20040248086 09/881012 |
Document ID | / |
Family ID | 33519901 |
Filed Date | 2004-12-09 |
United States Patent
Application |
20040248086 |
Kind Code |
A9 |
Ginns, Edward I. ; et
al. |
December 9, 2004 |
SUSCEPTABILITY AND RESISTANCE GENES FOR BIPOLAR AFFECTIVE
DISORDER
Abstract
Chromosomal regions comprising loci associated with
susceptibility and resistance to bipolar affective disorder have
been identified. Methods and compositions are provided for
determining the contribution of these chromosomal regions to
bipolar affective disorder in an affected family, for determining
in an affected family a genotype associated with increased or
decreased susceptibility or resistance to bipolar illness, and for
assessing an increased or decreased risk of developing bipolar
illness for a tested individual from an affected family.
Inventors: |
Ginns, Edward I.; (Bethesda,
MD) ; Egeland, Janice A.; (Hershey, PA) ;
Paul, Steven M.; (Carmel, IN) |
Correspondence
Address: |
VENABLE, BAETJER, HOWARD & CIVILETTI, LLP
1201 NEW YORK AVE, N.W.
SUITE 1000
WASHINGTON
DC
20005
US
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 0192655 A1 |
December 19, 2002 |
|
|
Family ID: |
33519901 |
Appl. No.: |
09/881012 |
Filed: |
June 13, 2001 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09881012 |
Jun 13, 2001 |
|
|
|
09175158 |
Oct 19, 1998 |
|
|
|
09881012 |
Jun 13, 2001 |
|
|
|
08827568 |
Mar 28, 1997 |
|
|
|
60062924 |
Oct 20, 1997 |
|
|
|
60014334 |
Mar 29, 1996 |
|
|
|
60014334 |
Mar 29, 1996 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
536/24.3 |
Current CPC
Class: |
C12Q 2600/172 20130101;
C12Q 1/6883 20130101; C12Q 2600/16 20130101; C12Q 2600/156
20130101 |
Class at
Publication: |
435/006 ;
536/024.3 |
International
Class: |
C12Q 001/68; C07H
021/04 |
Claims
What is claimed is:
1. A method for determining a genotype associated with increased or
decreased resistance to familial bipolar affective disorder in a
family affected by bipolar affective disorder, comprising:
determining the genotype of at least one family member, wherein the
genotype is determined with at least one marker for at least one
chromosomal region linked to a locus associated with resistance to
bipolar affective disorder, wherein the chromosomal regions are
inclusive of and localized between D4S402 and D4S424; inclusive of
and localized between D4S431 and D4S404; or inclusive and localized
between D11S394 and D11S29; determining, after the age of onset,
the bipolar affective disorder disease status in the family member;
comparing the genotype with the bipolar affective disorder disease
status; and determining therefrom the genotype associated with
increased or decreased resistance to bipolar affective
disorder.
2. The method of claim 1, wherein the genotype is determined with
markers for at least two of the chromosomal regions.
3. The method of claim 2, wherein the genotype is determined with
markers for three of the chromosomal regions.
4. The method of claim 1, wherein the chromosomal region is
inclusive of and localized between markers D4S422 and D4S1625.
5. The method of claim 4, wherein the marker is D4S175, D4S422,
D4S1576, D4S2294, D4S1579, D4S397, D4S3089, D4S2965, D4S192,
D4S420, D4S1644, D4S3334, or combinations thereof.
6. The method of claim 1, wherein the chromosomal region is
inclusive of and localized between markers D4S3007 and D4S419.
7. The method of claim 6, wherein the marker is D4S3007, D4S394,
D4S2983, D4S2923, D4S615, AFM.sub..alpha.184za9, D4S2928, D4S1065,
D4S1582, D4S107, D4S3009, D4S2906, D4S2949, AFM087zg5, D4S2944,
D4S403, D4S2942, D4S2984, D4S1602, D4S1511, D4S2311, D4S3048, or
combinations thereof.
8. The method of claim 7, wherein the marker is D4S3009, D4S2906,
D4S2949, AFM087zg5, D4S2944, D4S403, D4S2942, D4S2984, D4S1602,
D4S1511, D4S2311, or combinations thereof.
9. The method of claim 1, wherein the chromosomal region is
inclusive of and localized between markers D11S133 and D11S29.
10. The method of claim 9, wherein the marker is D11S133, D11S147,
CD3D, D11S285, D11S29, or combinations thereof.
11. The method of claim 1, wherein the genotype at a single
chromosomal region is determined with at least three markers.
12. The method of claim 1, wherein the marker is for a restriction
fragment length polymorphism or microsatellite polymorphism.
13. A kit for determining a genotype associated with increased or
decreased resistance to familial bipolar affective disorder,
wherein the kit comprises markers for two or more of the
chromosomal regions: inclusive of and localized between D4S402 and
D4S424; inclusive of and localized between D4S431 and D4S404; and
inclusive and localized between D11S394 and D11S29.
14. The kit of claim 13, wherein the markers are selected from the
group consisting of: D4S175, D4S422, D4S1576, D4S2294, D4S1579,
D4S397, D4S3089, D4S2965, D4S192, D4S420, D4S1644, D4S3334;
D4S3007, D4S394, D4S2983, D4S2923, D4S615, AFM.sub..alpha.184za9,
D4S2928, D4S1065, D4S1582, D4S107, D4S3009, D4S2906, D4S2949,
AFM087zg5, D4S2944, D4S403, D4S2942, D4S2984, D4S1602, D4S1511,
D4S2311, D4S3048; and D11S133, D11S147, CD3D, D11S285, D11S29.
15. The method of claim 1, wherein the marker is amplified.
16. The method of claim 15, wherein the marker is amplified by the
polymerase chain reaction.
17. The method of claim 1, wherein the presence or absence of an
allele associated with increased resistance to bipolar affective
disorder is determined.
18. The method of claim 1, wherein the genotype of an affected
family member is determined.
19. The method of claim 1, wherein the genotype of a non-affected
family member is determined.
20. The method of claim 1, further comprising: determining the
genotype of at least one family member, wherein the genotype is
determined with at least one marker for at least one chromosomal
region linked to a locus associated with susceptibility to bipolar
affective disorder, wherein the chromosomal regions are inclusive
of and localized between D6S344 and D6S89; inclusive of and
localized between D13S171 and D13S218; or at about D15S148.
21. The method of claim 1, further comprising: determining the
genotype of a tested individual from the affected family, wherein
the genotype is determined with at least one marker for at least
one chromosomal region linked to a locus associated with resistance
to bipolar affective disorder, wherein the chromosomal regions are
inclusive of and localized between D4S402 and D4S424; inclusive of
and localized between D4S431 and D4S404; or inclusive and localized
between D11S133 and D11S29; comparing the genotype of the tested
individual to the genotype associated with increased or decreased
resistance to bipolar affective disorder; and determining therefrom
the increased or decreased risk of the tested individual developing
familial bipolar affective disorder.
22. The method of claim 21, wherein the genotype of the tested
individual is compared to the genotype of an affected family
member.
23. A method for determining the contribution of a chromosomal
region to the presence or absence of resistance to bipolar
affective disorder in a family affected by bipolar affective
disorder, comprising: determining the corresponding genotype of at
least two family members, wherein the genotype is determined with
at least one marker for at least one tested chromosomal region
linked to a locus associated with resistance to bipolar affective
disorder, wherein the tested chromosomal regions are inclusive of
and localized between D4S402 and D4S424; inclusive of and localized
between D4S431 and D4S404; or inclusive and localized between
D11S133 and D11S29; determining, after the age of onset, the
bipolar affective disorder disease status in the family members;
comparing the genotypes of the family members; and determining
therefrom the contribution of the chromosomal region to the
presence or absence of resistance to bipolar affective disorder in
the family.
24. A method for determining a genotype associated with increased
or decreased resistance to familial bipolar affective disorder in a
family affected by bipolar affective disorder, comprising:
determining the genotype of at least one family member, wherein the
genotype is determined with at least one marker for at least one
chromosomal region linked to a locus associated with resistance to
bipolar affective disorder, wherein the chromosomal regions are
inclusive of and localized between D4S402 and D4S424; inclusive of
and localized between D4S431 and D4S404; or inclusive and localized
between D11S133 and D11S29; determining the genotype of at least
one family member, wherein the genotype is determined with at least
one marker for at least one chromosomal region linked to a locus
associated with susceptibility to bipolar affective disorder,
wherein the chromosomal regions are inclusive of and localized
between D6S344 and D6S89; inclusive of and localized between
D13S171 and D13S218; or at about D15S148; determining, after the
age of onset, the bipolar affective disorder disease status in the
family member; comparing the genotype with the bipolar affective
disorder disease status; and determining therefrom the genotype
associated with increased or decreased resistance to bipolar
affective disorder.
25. The method of claim 24, wherein the marker associated with
susceptibility is D6S7, D13S1, D15S45, or combinations thereof.
26. The method of claim 24, further comprising: determining the
genotype of a tested individual from the affected family, wherein
the genotype is determined with at least one marker for at least
one chromosomal region linked to a locus associated with resistance
to bipolar affective disorder, wherein the chromosomal regions are
inclusive of and localized between D4S402 and D4S424; inclusive of
and localized between D4S431 and D4S404; or inclusive and localized
between D11S133 and D11S29; comparing the genotype of the tested
individual to the genotype associated with increased or decreased
resistance to bipolar affective disorder; and determining therefrom
the increased or decreased risk of the tested individual developing
familial bipolar affective disorder.
27. A kit comprising markers D6S7, D13S1, or D15S45 for performing
the method of claim 24.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional
Application Ser. No. 60/062,924, filed Oct. 20, 1997. This
application is related to Ser. No. 08/827,568, filed Mar. 28, 1997,
and 60/014,334, filed Mar. 29, 1996. These disclosures are
incorporated herein by reference for all purposes.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] This invention relates to the field of diagnosis and
treatment of bipolar affective disorders.
[0004] 2. Background
[0005] The most characteristic features of bipolar affective
disorder (manic-depressive illness) are episodes of mania (bipolar
I, BPI) or hypomania (bipolar II, BPII) that are interspersed with
periods of depression. If untreated, manic-depressive illness is
associated with an approximately 20% risk of suicide. Even with
treatment, this disorder constitutes a major public health problem,
afflicting approximately one percent of the population. Goodwin et
al., Manic-Depressive Illness (Oxford University Press, New York,
1990).
[0006] Although little is known about the etiology or
pathophysiology of bipolar affective disorder, genetic and
environmental factors contribute to its pathogenesis, especially in
families with multiple affected members. Considerable genetic and
epidemiologic data derived from twin, family and adoption studies
provide compelling evidence for a genetic etiology of this
disorder, but the mode(s) of inheritance has not been identified.
Craddock et al., Ann. Med. 25:317-322 (1993). Nonetheless, to date,
the majority of genetic linkage studies of bipolar affective
disorder have assumed that it exhibits classical Mendelian
inheritance attributable to a single major gene. Segregation
analyses have yielded inconsistent results with most studies
rejecting a single dominant or recessive locus inheritance model.
However, if only BPI is considered, the best single gene model is
dominant inheritance. Pauls et al., Neuropsy. Genet., 60:290-297
(1995).
[0007] Due to the complexities inherent in linkage studies of
psychiatric disorders, one study has focused on the identification
of a gene for bipolar illness in a large Old Order Amish pedigree
in southeastern Pennsylvania. Egeland et al., Nature, 325:783-787
(1987). The Old Order Amish are a religious sect numbering
approximately 15,000 who descend from some 30 pioneer couples and
who have remained genetically isolated, thereby minimizing the
introduction of multiple genes responsible for inherited disorders.
Amish families have large sibships and multiple living generations,
making them ideal for genetic studies. Further, alcohol and drug
abuse, which often complicate psychiatric diagnoses, are rare among
the Amish. Bipolar affective disorder, however, occurs amongst the
Old Order Amish with a prevalence rate, characteristic symptom
pattern and clinical course that are similar to those in the
general North American population. The identification and
characterization of these pedigrees led to the initiation of early
genetic linkage studies but no evidence for linkage between various
polymorphic serum proteins or blood group antigen loci and
affective disorder was found.
[0008] More recently, using a molecular genetic approach, Egeland
and colleagues reported evidence supporting the localization of a
gene conferring a strong predisposition to bipolar affective
disorder linked to two loci located on the short arm of chromosome
11, the Harvey-ras-1 oncogene locus (HRAS) and the insulin (INS)
locus. Id. However, reanalysis of the Old Order Amish pedigree to
include several new individuals, two changes in clinical status,
and a large lateral extension of the original pedigree markedly
reduced the probability of linkage between bipolar affective
disorder and the HRAS and INS loci. Kelsoe et al., Nature,
342:238-243 (1989).
[0009] Attempts to replicate linkage findings for bipolar affective
disorder have proven problematic and have been plagued by
diagnostic uncertainties, genetic heterogeneity, phenocopies,
genotyping errors, and the complexities of performing and
interpreting statistical analyses (Egeland et al. (1987) Nature
325, 783-787; Pekkarinen et al. (1995) Genome Res. 5: 105-115;
Ginns et al. (1996) Nature Genet. 12, 431-435; NIMH Genetics
Initiative Bipolar Group (1997) Am. J. of Med. Genetics
(Neuropsych. Genetics) 74, 227-269; Blackwood et al. (1996) Nature
Genet. 12,427-430; Freimer et al. (1996) Nature Genet. 12,
436-441). Reported linkages of bipolar affective disorder to DNA
markers on chromosomes 18, 21 and X have been difficult to
replicate and several proposed linkages have been refuted upon
reanalysis. Kelsoe et al., Nature, 342:238-243 (1989), Berrettini
et al., Proc. Natl. Acad. Sci. USA, 91:5918-5921 (1994), Straub et
al., Nature Gen. 8:291-296 (1994), Baron et al., Nat. Genet.,
3:49-55 (1993), Pauls et al., Am. J. Hum. Genet., 57:636-643
(1995).
[0010] Moreover, since the inheritance of BPAD is probably
multifactorial, the possible involvement of multiple genetic
components of small effect and/or the occurrence of major allelic
effects only in epistasis must be considered. In addition to
susceptibility alleles, there could be alleles that reduce the risk
of developing BPAD in a manner similar to that reported for other
complex genetic disorders (Philibert et al. (1997) J. Affective
Disorders 43, 1-3). If model-based linkage analyses are used, a
"false negative" linkage finding could result when individuals
inherit disease susceptibility alleles but do not manifest the
phenotype due to the presence of "protective" alleles. The
inclusion of individuals who inherit susceptibility alleles but do
not manifest disease because of "protective" alleles, or of
individuals who inherit "protective" alleles but nevertheless
manifest the disease, will also reduce the power of model-free
(allele-sharing) analyses. Thus, regardless of whether model-based
or model-free analyses are used, "wellness" or "protective" alleles
could have a significant impact on linkage analyses.
[0011] Given the magnitude of the public health problem associated
with bipolar illness and the availability of treatments for this
disorder, what is needed in the art is a means to determine the
risk to an individual, who comes from an affected family, of
developing bipolar affective disorder. Given that risk can depend
both on susceptibility and protective alleles, it is desirable to
have means to determine the presence or absence of both types of
alleles associated with bipolar affective disorder. Quite
surprisingly, the present invention provides these and other
advantages.
SUMMARY OF THE INVENTION
[0012] Regions of chromosomes 6, 13, and 15 have been determined to
comprise loci which are associated with susceptibility to bipolar
affective disorder (BPAD), while regions of chromosome 4 and
chromosome 11 are associated with resistance to BPAD. Compositions
and methods to determine the various forms of these loci are useful
for a variety of diagnostic procedures.
[0013] In one aspect, the present invention provides genetically
based methods and kits for determining a genotype associated with
an increased or decreased susceptibility to familial bipolar
affective disorder in a family affected by bipolar affective
disorder. The method comprises determining the genotype of at least
one family member, wherein the genotype is determined with at least
one marker for at least one chromosomal region linked to a locus
associated with susceptibility to bipolar affective disorder. The
chromosomal regions are inclusive of and localized between markers
D6S344 and D6S89 on chromosome 6, markers D13S171 and D13S218 on
chromosome 13, or markers D15S153 and D15S117 on chromosome 15,
such as at about marker D15S148 on chromosome 15. The bipolar
affective disorder disease status is determined for the family
member after the age of onset. The genotype and disease status of
the family member are compared to determine the genotype associated
with increased or decreased susceptibility to bipolar affective
disorder. In one embodiment, the genotype is determined with
markers to at least two chromosomal regions linked to a locus
associated with susceptibility to bipolar affective disorder.
Preferably, the genotype is determined with markers D6S7, D13S1, or
D15S45, or combinations thereof. In another embodiment, the
genotype of an affected family member is determined. In a further
embodiment, the markers are restriction fragment length
polymorphisms or microsatellite markers. In yet another embodiment,
the genotype which indicates either the presence or absence of a
bipolar illness allele is determined.
[0014] In another aspect, the present invention provides methods
and compositions for determining the increased or decreased risk of
a tested individual developing familial bipolar affective disorder
by comparing the disease genotype of the tested individual to the
genotype of a family member which is associated with increased or
decreased susceptibility to bipolar affective disorder. The disease
genotype is determined with at least one marker for at least one
chromosomal region linked to a locus associated with susceptibility
to bipolar affective disorder. The chromosomal regions are
inclusive of and localized between markers D6S344 and D6S89 on
chromosome 6, markers D13S171 and D13S218 on chromosome 13, or
markers D15S153 and D15S117 on chromosome 15 such as, for example,
at about marker D15S148 on chromosome 15. In one embodiment, the
genotype of the tested individual is compared to the genotype of an
affected family member. In another embodiment, the genotype of the
tested individual is determined with markers D6S7, D13S1, or
D15S45, or combinations thereof. In yet another embodiment, the
genotype of the tested individual and family member are determined
at all three chromosomal regions of the present invention.
[0015] The invention also provides genetically based methods and
kits for determining a genotype associated with an increased or
decreased susceptibility to familial bipolar affective disorder in
which markers associated with resistance to bipolar affective
disorder are detected. The methods involve determining the genotype
of at least one family member, wherein the genotype is determined
with at least one marker for at least one chromosomal region linked
to a locus associated with resistance to bipolar affective
disorder. The chromosomal regions are on chromosome 4, inclusive of
and localized between markers D4S402 and D4S424 and markers D4S431
and D4S404, and on chromosome 11, inclusive and localized between
D11S394 and D11S29. The bipolar affective disorder disease status
is determined for the family member after the age of onset. The
genotype and disease status of the family member are compared to
determine the genotype associated with increased or decreased
susceptibility to bipolar affective disorder. In one embodiment,
the genotype is determined with markers to at least two chromosomal
regions linked to a locus associated with resistance to bipolar
affective disorder. Preferred markers for determining the genotype
on chromosome 4q include, for example, D4S175, D4S422, D4S1576,
D4S2294, D4S1579, D4S397, D4S3089, D4S2965, D4S192, D4S420,
D4S1644, D4S3334, or combinations thereof. Preferred markers for
determining resistance alleles on chromosome 4p include, for
example, D4S3007, D4S394, D4S2983, D4S2923, D4S615,
AFM.sub..alpha.184za9, D4S2928, D4S1065, D4S1582, D4S107, D4S3009,
D4S2906, D4S2949, AFM087zg5, D4S2944, D4S403, D4S2942, D4S2984,
D4S1602, D4S1511, D4S2311, D4S3048or combinations thereof. On
chromosome 11, preferred markers include, for example, D11S133,
D11S147, CD3D, D11S285, D11S29, or combinations thereof
[0016] In some embodiments of the invention, the genotype of an
affected family member is determined. In a further embodiment, the
markers are restriction fragment length polymorphisms or
microsatellite markers. In yet another embodiment, the genotype
which indicates either the presence or absence of a bipolar illness
allele is determined.
[0017] In another aspect, the present invention provides methods
and compositions for determining the increased or decreased risk of
a tested individual developing familial bipolar affective disorder
by comparing the disease genotype of the tested individual to the
genotype of a family member which is associated with increased or
decreased susceptibility to bipolar affective disorder. The disease
genotype is determined with at least one marker for at least one
chromosomal region linked to a locus associated with resistance to
bipolar affective disorder. The chromosomal regions are on
chromosome 4, inclusive of and localized between markers D4S402 and
D4S424 and markers D4S431 and D4S404, and on chromosome 11,
inclusive and localized between D11S394 and D11S29. In one
embodiment, the genotype of the tested individual is compared to
the genotype of an affected family member. In yet another
embodiment, the genotype of the tested individual and family member
are determined at all three chromosomal regions of the present
invention.
[0018] Another embodiment of the invention provides compositions,
methods and kits for determining the presence of a genotype
associated with resistance to bipolar affective disorder in a
family affected by BPAD. These methods involve determining the
genotype of at least one family member, wherein the genotype is
determined with at least one marker for at least one chromosomal
region linked to a locus associated with resistance to bipolar
affective disorder. The chromosomal regions are on chromosome 4,
inclusive of and localized between markers D4S402 and D4S424 and
markers D4S431 and D4S404, and on chromosome 11, inclusive and
localized between D11S394 and D11S29. In one embodiment, the
genotype is determined with markers to at least two chromosomal
regions linked to a locus associated with resistance to bipolar
affective disorder.
[0019] In yet another aspect, the invention provides methods and
kits for determining the contribution of a chromosomal region to
the presence or absence of bipolar affective disorder, or
resistance to BPAD, in a family affected by bipolar affective
disorder. The method comprises determining the corresponding
genotype of at least two family members, wherein the genotype is
determined with at least one marker for at least one tested
chromosomal region linked to a locus associated with susceptibility
or resistance to bipolar affective disorder. The tested chromosomal
regions for susceptibility are inclusive of and localized between
D6S344 and D6S89, D13S171 and D13S218, or at about D15S148; for
resistance the tested chromosomal regions are inclusive of and
localized between either or D4S402 and D4S424 and markers D4S431
and D4S404, and on chromosome 11, inclusive and localized between
D11S394 and D11S29. The bipolar affective disease status in the
family members is determined after the age of onset and compared to
the genotypes of the family members. As a result of this
comparison, the contribution of the chromosomal region to the
presence or absence of bipolar affective disorder in the family is
determined. In one embodiment, corresponding genotype of at least
two family members affected by bipolar illness is determined. In
another embodiment, at least one of the markers D6S7, D13S1, or
D15S45 is used to determine susceptibility, and D4S2949, D4S175,
and D4S397 to determine resistance.
BRIEF DESCRIPTION OF THE FIGURES
[0020] FIG. 1 summarizes each pedigree in "block" form illustrating
that all of the BPI pedigrees trace along pathways leading to a
common progenitor, one of some 30 couples that founded the present
Lancaster County, Old Order Amish group.
[0021] FIG. 2 shows the maximum lod scores, using BPI as affected
diagnosis, for two scenarios: (N1)--nuclear families, homogeneity,
dominant inheritance, and affecteds only; and (N2)--sixteen
combinations of analyses for each marker including: dominant vs.
recessive inheritance, five pedigrees vs. nuclear families,
homogeneity vs. heterogeneity, and affecteds only vs affecteds and
unaffecteds. N1 and N2 represent the number of markers furnishing
maximum lod scores within given class boundaries for scenarios 1
and 2, respectively.
[0022] FIG. 3 shows the locations of markers on human chromosome 6
that are associated with susceptibility to BPAD. The statistical
significance of the genetic linkage between markers based on
sib-pair analysis is shown at left, and map distances between
markers (in centimorgans) are indicated in the rightmost two
columns.
[0023] FIG. 4 shows the locations of markers on human chromosome 13
that are associated with susceptibility to BPAD. The statistical
significance of the genetic linkage between markers based on
sib-pair analysis is shown at left, and map distances between
markers (in centimorgans) are indicated in the rightmost two
columns.
[0024] FIG. 5 shows the locations of markers on human chromosome 15
that are associated with susceptibility to BPAD. The statistical
significance of the genetic linkage between markers based on
sib-pair analysis is shown at left, and map distances between
markers (in centimorgans) are indicated in the rightmost two
columns.
[0025] FIG. 6 shows the locations of markers on human chromosome 4p
that are associated with resistance to BPAD. The statistical
significance of the genetic linkage between markers based on
sib-pair analysis is shown at left, and map distances between
markers (in centimorgans) are indicated in the rightmost two
columns.
[0026] FIG. 7 shows the locations of markers on human chromosome 4q
that are associated with resistance to BPAD. The statistical
significance of the genetic linkage between markers based on
sib-pair analysis is shown at left, and map distances between
markers (in centimorgans) are indicated in the rightmost two
columns.
[0027] FIG. 8 shows an analysis of the non-parametric LOD among
markers on human chromosome 4q that are associated with resistance
to BPAD.
[0028] FIG. 9A shows the location of the mouse Clock gene on a
genetic map chromosome 5 (King et al., Cell 89: 641-653 (1997)).
FIG. 9B shows an physical map of the mouse chromosome 5 region
immediately surrounding Clock. Shown in FIG. 9C is the
transcription unit map of the Clock locus. The locations of the
homologous region in human, which is found on chromosome 4, are
indicated.
[0029] FIG. 10 shows a summary of the ancestral trace for Amish
study bipolar pedigrees in "schematic" representation. The LEFT
extension coupled with the CORE Pedigree 110 provided the resource
used to initially report linkage findings (Egeland et al. (1987)
Nature 325, 783-787). Further genetic analyses were reported in
1989 after addition of a RIGHT extension to Pedigree 110 (Kelsoe et
al. (1989) Nature 342, 238-243). Pedigree 210 and partial Pedigree
310 (NIGMS Family 1075) became an additional large lateral
extension, that along with the earlier subjects, was used in the
genome-wide linkage analyses reported in 1996 (Ginns et al. (1996)
Nature Genet. 12, 431-435). The study reported in Example IV
utilized all of these earlier subjects plus additional expansions,
especially in Pedigree 410, so that the overall Study contained 346
samples, including those from 50 BPI individuals.
[0030] FIG. 11 shows a plot of t-statistics obtained from the
pair-wise linkage results. The figure insert depicts a cumulative
plot of p-values whose linearity would reflect uniformity in
p-values associated with multiple linkage results whose null
hypotheses were all true (see text). The outlying t-statistics and
p-values (denoted by arrows) were associated with markers, D4S107
(t=6.24), D4S2949 (t=7.79), D4S2928 (t=5.03), D11S133 (t=6.09), and
D11S29 (t=6.32).
[0031] FIGS. 12A and 12B present a model-free linkage analysis of
"wellness" using GENEHUNTER-PLUS -log.sub.10p. Map position is in
Kosambi centimorgans. The -log.sub.10 p was calculated using p
values generated by GENEHUNTER-PLUS (including individuals>age
45 yrs in all pedigrees) on the assumption that the NPL score is
standard normally distributed. A -log.sub.10p of 4.0 corresponds
asymptotically to a LOD score of 3.0. Only mentally healthy
individuals 45 years of age or older were classified as being
`well` (see, Example IV). FIG. 12A: -log.sub.10p for markers on
chromosome 4p: -----, Pedigree 110 only; and-----, Pedigrees 110,
210, 310 and 410; FIG. 12B: -log.sub.10p for markers on chromosome
4q: -----, Pedigree 110 only; and -----, Pedigrees 110, 210, 310
and 410.
DESCRIPTION OF THE PREFERRED EMBODIMENT
[0032] Introduction
[0033] In the present invention, regions of chromosome 6, 13, and
15 have been identified that comprise loci that are associated with
susceptibility to a familial form of bipolar affective disorder
(BPAD). Ginns et al. (1996) Nature Genet. 12, 431435. Additional
chromosome regions on chromosome 4 and chromosome 11 are associated
with resistance to BPAD. Genotypic identification of the loci
associated with either the presence or absence of familial bipolar
affective disorder provides a means to assess the risk of a tested
individual from an affected family having or developing the
disease. Moreover, the present invention also provides the means to
assess whether these loci are implicated in the presence or absence
of bipolar illness in an individual.
[0034] Accordingly, the methods and compositions of the present
invention provide a means to alert clinicians to a genetic
predisposition towards, or resistance to, bipolar affective
disorder. The methods of the invention are useful in genetic
counseling of individuals from families affected with bipolar
illness, and aid in the differential diagnosis of bipolar illness
from other psychiatric pathologies.
[0035] Definitions
[0036] As used herein, "bipolar illness," or "bipolar affective
disorder," or "manic depression" refer to bipolar I (BPI), bipolar
II (BPII), or major depressive disorder (MDD). See, "Research
Diagnostic Criteria," Spitzer et al., Arch Gen. Psychiat.,
35:773-782 (1978), incorporated herein by reference. The term
"familial" as applied to the defined terms denotes a genetic
contribution to the development of bipolar affective disorder as
opposed to a strictly environmental etiology.
[0037] As used herein "allele associated with increased
susceptibility to bipolar illness" or "bipolar illness allele" or
"disease allele" refers to a form of a locus on a chromosome which,
when present in an individual, directly or indirectly causes or
increases the risk of developing bipolar illness. Similarly,
"allele associated with increased resistance to bipolar illness"
refers to a form of a locus on a chromosome which, when present in
an individual, directly or indirectly increases the resistance of
that individual to bipolar illness. The locus may be any DNA
sequence, e.g., a gene or genes or fragments thereof or a
regulatory element.
[0038] As used herein "locus associated with susceptibility to
bipolar illness" refers to a locus on a chromosome which in at
least one form is an "allele associated with increased
susceptibility to bipolar illness." A "locus associated with
resistance to bipolar illness" refers to a locus on a chromosome
which in at least one form is an "allele associated with increased
resistance to bipolar illness."
[0039] As used herein, "marker" or "polymorphic marker" refers to a
polymorphic locus that serves to identify a unique locus on a
chromosome. An "informative marker" appears in different forms on
each homologous pair of chromosomes such that inheritance of the
individual chromosomes can be followed. An informative marker may
be comprised of two or more markers that individually are not
informative.
[0040] As used herein, "family member" refers to an individual's
consanguineous grandparent, parent, child, or sibling although a
more distant blood-relative may be used. The family member may be
alive or deceased.
[0041] As used herein, "family" refers to two or more
consanguineous individuals. A family may consist of individuals
from the same generation or from 2, 3, 4, 5, 6, 7, 8, 9, or 10-15
generations. Thus, a family may consist of ethnic groups or
subgroups thereof or a geographically secluded interbreeding
population having a common ancestor.
[0042] As used herein, "linked" refers to the greater association
in inheritance of two or more non-allelic loci than is to be
expected from independent assortment. Loci are linked because they
reside on the same chromosome. Generally, linked loci are separated
by less than 50 centimorgans, preferably less than 30 or 40
centimorgans, and most preferably less than 20 or 10
centimorgans.
[0043] As used herein, "chromosomal region" refers to a length of
chromosome which may be measured by reference to the linear segment
of DNA which it comprises. The 5' and/or 3' termini of the
chromosomal region can be defined by reference to a unique DNA
sequence, i.e., a marker. The chromosomal region may be inclusive
or exclusive of the defining 5' or 3' terminal DNA sequences.
Alternatively or additionally, the 5' and/or 3' termini of a
chromosomal region can be defined by reference to a length of DNA
extending from a unique DNA sequence. Typically the length
extending from a unique DNA sequence is about 10 centimorgans (or
million basepairs) or less, and may be 9, 8, 7, 6, 5, 4, 3, 2 or 1
centimorgans (or million basepairs) or fractional values thereof
wherein the distance in centimorgans is the sex-averaged value.
[0044] As used herein, "age of onset" refers to the age at which
those who develop bipolar affective disorder first exhibit its
clinically defined symptoms. The age of onset may occur at 15 years
of age, usually at between 15-20, or 21-25 years of age, and may
occur at 26-30 or 31-35 years of age.
[0045] As used herein, "genotype associated with increased
susceptibility to bipolar affective disorder" refers to a genotype
which has a higher probability of occurrence in bipolar affective
disorder affected family member(s) than in family members who are
past the age of onset but not affected by bipolar affective
disorder.
[0046] As used herein, "genotype associated with increased
resistance to bipolar affective disorder" refers to a genotype
which has a higher probability of occurrence in individuals who are
wholly or partially resistant to BPAD.
[0047] As used herein, a "genotype" may be defined by use of a
single or a plurality of markers.
[0048] As used herein, "genotype associated with decreased
susceptibility to bipolar affective disorder" refers to a genotype
which has a lower probability of occurrence in bipolar affective
disorder affected family member(s) than in family members who are
past the age of onset but not affected by bipolar affective
disorder.
[0049] As used herein, "genotype associated with increased or
decreased susceptibility to bipolar affective disorder" refers to a
"genotype associated with increased susceptibility to bipolar
affective disorder" or a "genotype associated with decreased
susceptibility to bipolar affective disorder."
[0050] As used herein, "increased" means greater than 50%.
[0051] As used herein, "decreased" means less than 50%.
[0052] As used herein, "determining" the "risk of the tested
individual developing familial bipolar affective disorder" means
ascertaining the probability of the tested individual developing
bipolar affective disorder after the individual reaches the age of
onset. The determination of risk may be a quantitatively assessed
or may be assessed qualitatively as higher, lower, or equivalent to
a family member whose corresponding genotype is determined at one
or more chromosomal regions linked to a locus associated with
susceptibility to bipolar affective disorder.
[0053] As used herein, "corresponding genotype" refers to a
genotype obtained using at least one marker from within the same
chromosomal region used to genotype another family member such that
a basis of comparison at that same chromosomal region is provided.
A corresponding genotype may conveniently be determined using at
least one of the same markers.
[0054] As used herein, "tested individual" refers to an individual,
pre- or post-partum, whose genotype is determined and includes a
proband. The tested individual is a family member from the same
family as the family member whose genotype the tested individual's
is compared to.
[0055] As used herein, "bipolar illness genotype" refers to a
genotype determined with at least one marker for at least one
chromosomal region linked to a locus associated with susceptibility
to bipolar affective disorder, wherein the tested chromosomal
regions are inclusive of and localized between D6S344 and D6S89,
D13S171 and D13S218, or at about D15S148.
[0056] As used herein, "bipolar illness resistance genotype" refers
to a genotype determined with at least one marker for at least one
chromosomal region linked to a locus associated with resistance to
bipolar affective disorder, wherein the tested chromosomal regions
are inclusive of and localized between markers D4S402 and D4S1625
and markers D4S431 and D4S404.
[0057] In the form of bipolar affective disorder addressed herein,
one or more of the loci associated with susceptibility to bipolar
affective disorder have a higher probability of occurring as a
disease allele in a bipolar illness affected family member than in
a non-affected family member. Conversely, in non-affected family
members, one or more of the loci which are associated with
susceptibility to bipolar affective disorder have an increased
probability of occurring in a form not found in bipolar illness
affected family members. This statistical correlation provides the
means of determining whether a particular genotype is associated
with increased or decreased susceptibility to bipolar affective
disorder. Further, this correlation allows one to determine whether
and which of the one, two, or three chromosomal regions of the
present invention contribute to bipolar illness in the affected
family. And, since susceptibility to bipolar illness increases with
the number of bipolar illness alleles of an individual, the methods
and compositions provide means of determining a tested individual's
increased or decreased risk of developing bipolar illness.
[0058] Similarly, one or more of the loci associated with
resistance to BPAD have a higher probability of occurring as a
resistance allele in a family member that is not affected with BPAD
than in an affected family member. The statistical correlation
provides a means for determining whether a particular genotype is
associated with increased or decreased resistance to BPAD.
[0059] The methods of the present invention generally comprise
determining the genotype of at least one family member from a
family affected by bipolar affective disorder. The affected family
will have at least one member with bipolar affective disorder,
preferably, two, three, four, or more members with bipolar
affective disorder. As will be clear to those of skill in the art,
the family affected by bipolar illness will preferably have at
least one prior or successive generation of family members such
that the loci associated with susceptibility to bipolar illness are
transmitted between at least two generations. Accordingly,
genotyping of two, three, four, or more family members for the
bipolar illness genotype is preferred. Even more preferably, these
family members will be from two or more different generations; even
more preferably three or more generations.
[0060] Methods of genotyping are well known to those of skill in
the art. Briefly, the methods of determining the bipolar illness
genotype typically comprise use of at least one marker for at least
one chromosomal region linked to a locus associated with bipolar
illness. Typically, nucleic acid probes to a marker within these
chromosomal region(s) are used for genotyping. The markers to the
chromosomal regions are sufficiently close to the loci which are
associated with susceptibility or, depending on the particular
chromosomal region tested, resistance to bipolar illness such that
following inheritance of the markers allows for following
inheritance of a locus or loci associated with increased or
decreased susceptibility or resistance to bipolar affective
disorder. Each marker is specific to a chromosomal region and DNA
sequence variability in markers typically allows a chromosome to be
distinguished from its homolog. However, sufficient conservation in
DNA sequence by each marker generally allows transmission of the
chromosomal region to be traced from generation to generation. A
statistically significant correlation between the presence or
absence of a chromosomal marker with the presence or absence of
bipolar illness in a family member after the age of onset allows
for the determination of the genotype(s) associated with increased
or decreased susceptibility or resistance to familial bipolar
affective disorder. The chromosomal regions of the present
invention that display linkage to loci associated with
susceptibility to bipolar illness are inclusive of and localized
between the markers D6S344 and D6S89 on chromosome 6, D13S171 and
D13S218 on chromosome 13, or at about D15S148 on chromosome 15,
generally about 10 centimorgans or 10 million basepairs flanking
either side of D15S148; preferably localized by, and inclusive of
at least, marker D15S117.
[0061] Conversely, chromosomal regions of the invention that are
linked to loci associated with increased resistance to BPAD are
found on human chromosome 4, more particularly on chromosome arm 4p
the regions are inclusive of and localized between markers D4S431
and D4S404 (FIG. 6 and FIG. 12A) and on chromosome arm 4q the
regions are inclusive of and localized between markers D4S402 and
D4S1625 (FIG. 7 and FIG. 12B). The chromosomal regions on arm 4p
are generally about 10 centimorgans or 10 million base pairs
flanking either side of D4S2949, more preferably about 5
centimorgans flanking either side of d4S2949. Examples of suitable
markers include, for example, D4S3007, D4S394, D4S2983, D4S2923,
D4S615, AFM.sub..alpha.184za9, D4S2928, D4S1065, D4S1582, D4S107,
D4S3009, D4S2906, D4S2949, AFM087zg5, D4S2944, D4S403, D4S2942,
D4S2984, D4S1602, D4S1511, D4S2311, D4S3048, or combinations
thereof. Particularly preferred markers include D4S3009, D4S2906,
D4S2949, AFM087zg5, D4S2944, D4S403, D4S2942, D4S2984, D4S1602,
D4S1511, D4S2311, or combinations thereof.
[0062] On arm 4q, the chromosomal regions that are linked to loci
associated with increased resistance to BPAD are typically within
about 10 centimorgans on either side of D4S397, more preferably
within about 5 centimorgans on either side of D4S397. Suitable
markers include, for example, D4S175, D4S422, D4S1576, D4S2294,
D4S1579, D4S397, D4S3089, D4S2965, D4S192, D4S420, D4S1644,
D4S3334, or combinations thereof.
[0063] An additional chromosomal region that is associated with
resistance to BPAD is found on human chromosome 11. This
chromosomal region is inclusive of and localized between markers
D11S133 and D11S29. Preferred markers for this region include, for
example, D11S133, D11S147, CD3D, D11S285, D11S29, or combinations
thereof.
[0064] The genotype or genotypes associated with increased or
decreased susceptibility or resistance to familial bipolar illness
is generally determined upon comparison (i.e., correlation) of the
genotype of the family member with that family member's bipolar
illness disease status after the age of onset. Comparison of the
family member's genotype with the family member's disease status
allows one to determine the genotype associated with increased or
decreased susceptibility or resistance to bipolar affective
disorder by the use of statistical methods well known to those of
skill in the art. Thus, for example, if the genotype of an affected
parent and the genotype of an affected child have only one form of
an informative marker in common, comparison of their disease status
with their genotypes implicates the particular chromosomal region
identified by that common marker as associated with an increased
risk of developing bipolar illness, or with an increased resistance
to genetic and/or environmentally induced BPAD. Accordingly, the
methods of the present invention also allow for the formation of
pedigrees of sufficient detail such that determination of an
allele(s) associated with increased susceptibility or resistance to
bipolar affective disorder may be determined.
[0065] Due to the increased probability of meiotic crossover events
between markers of the present invention and bipolar illness
alleles, determining a bipolar illness genotype is preferably
achieved using closer rather than more distantly related relatives.
For similar reasons, markers more proximal to the loci associated
with increased or decreased susceptibility to bipolar affective
disorder are employed, such as D6S7, D13S1, or D15S45, to minimize
the chance of crossover events. More preferably, two, three, or
more additional markers flanking D6S7, D13S1, or D15S45 are
employed to aid in the detection of a recombination event between a
marker and the bipolar illness disease allele. Typically, the
markers are separated by 1, 2, 3, 4, or 5 centimorgans. Preferably,
the markers are informative.
[0066] Similarly, for identification of a BPAD-resistant genotype,
closer rather than more distantly related relatives are preferred,
as are markers more proximal to the loci associated with increased
resistance to BPAD. Such markers on chromosome arm 4p include, for
example, D4S2366, D4S394a, D4S3007, D4S394, D4S2949, D4S1605,
D4S1582, D4S107m, and D4S403 as shown on FIG. 6. On chromosome arm
4q, preferred markers include, for example, D4S422, D4S2423,
D4S422a, D4S175, D4S397, D4S3334, and D4S1644 as shown in FIG. 7.
On chromosome 11, the preferred markers are in the chromosomal
region inclusive of and localized between markers D11S133 and
D11S29; these include D11S133, D11S147, CD3D, D11S285, D11S29, or
combinations thereof. In each case, the markers are typically
separated by 1, 2, 3, 4, or 5 centimorgans. Preferably, the markers
are informative.
[0067] The present invention also provides methods and compositions
for determining a tested individual's increased or decreased risk
of inheriting a disease allele. The method comprises determining
the bipolar illness genotype of a tested individual from the
affected family according to methods described for determining the
genotype of a family member. Thus, the genotype is determined with
at least one marker for at least one chromosomal region which is
linked to a locus associated with resistance to bipolar illness.
The chromosomal regions include chromosome arm 4p, where the
regions are inclusive of and localized between markers D4S431 and
D4S404 (FIG. 6 and FIG. 12A) and chromosome arm 4q, where the
regions are inclusive of and localized between markers D4S402 and
D4S1625 (FIG. 7 and FIG. 12B). An additional region associated with
resistance is found on chromosome 11 inclusive of and localized
between markers D11S133 and D11S29. Typically, the markers are
separated by 1, 2, 3, 4, or 5 centimorgans.
[0068] After determining the tested individual's bipolar illness
genotype it is compared to the genotype associated with increased
or decreased susceptibility to bipolar affective disorder of the
affected family. A corresponding genotype is tested such that at
least one equivalent chromosomal region of the present invention is
utilized during comparison of the tested individual's genotype with
that of the genotype associated with increased or decreased
susceptibility to bipolar affective disorder; sometimes two
equivalent chromosomal regions are compared, often all three
chromosomal regions of the tested individual are compared.
Conveniently, at least one identical marker is used for each
equivalent chromosomal region compared.
[0069] The described comparison provides for a determination of an
increased or decreased risk of the tested individual developing
familial bipolar affective disorder by assessing the similarities
and differences between the compared genotypes. The absence in the
tested individual of the form of a susceptibility marker found in
the chromosome complements of affected family members signals a
reduced risk inheriting a bipolar illness allele and thus, of
developing bipolar illness. Conversely, inheritance by the tested
individual of a form of the susceptibility marker found in affected
family members indicates a correspondingly increased risk of
inheriting the bipolar illness allele. Thus, for example, if the
same three forms of a marker are inherited by an affected parent
and affected child, the absence of any one of these forms of
markers in a tested sibling indicates a decreased risk of
inheriting the disease allele. In contrast, inheritance by the
tested sibling of an increasing number of the bipolar illness
genotypes found in the affected family members indicates an
increasing risk of inheriting one or more disease alleles. A
similar analysis applies to testing for increased or decreased risk
of BPAD because of the absence or presence, respectively, of a
chromosomal region that is associated with an allele that is
involved in resistance to BPAD.
[0070] The methods and compositions of the present invention
further provide for determining whether a chromosomal region of the
present invention is, in fact, contributing to the presence or
absence of familial bipolar affective disorder in a family with at
least one member affected by bipolar affective disorder. The method
comprises determining the corresponding genotype of at least two
family members using methods described for determining a genotype
associated with increased or decreased susceptibility or resistance
to familial bipolar affective disorder. Thus, each genotype is
determined with at least one marker for at least one chromosomal
region which is linked to a locus associated with susceptibility or
resistance to bipolar illness. The chromosomal regions associated
with susceptibility are inclusive of and localized between D6S34
and D6S89, D13S171 and D13S218, or at about D15S148, generally
inclusive of a chromosomal region localized by at least D15S117.
Preferably, the markers comprise D6S7, D13S1, or D15S45. More
preferably, markers flanking D6S7, D13S1, or D15S45 are also
employed. Typically, the markers are separated by 1, 2, 3, 4, or 5
centimorgans. Chromosomal regions associated with resistance to
BPAD are generally are inclusive of and localized between D4S402
and D4S424 (FIG. 12B); inclusive of and localized between D4S431
and D4S404 (FIG. 12A); or inclusive and localized between D11S394
and D11S29. Preferred markers include, for example, D4S2366,
D4S394a, D4S3007, D4S394, D4S2949, D4S1605, D4S1582, D4S107m, and
D4S403 as shown on FIG. 6, and D4S422, D4S2423, D4S422a, D4S175,
D4S397, D4S3334, and D4S1644 as shown in FIG. 7. Other preferred
markers for resistance include D4S175, D4S422, D4S1576, D4S2294,
D4S1579, D4S397, D4S3089, D4S2965, D4S192, D4S420, D4S1644,
D4S3334, D4S3007, D4S394, D4S2983, D4S2923, D4S615,
AFM.sub..alpha.184za9, D4S2928, D4S1065, D4S1582, D4S107, D4S3009,
D4S2906, D4S2949, AFM087zg5, D4S2944, D4S403, D4S2942, D4S2984,
D4S1602, D4S1511, D4S2311, D4S3048, D11S133, D11S147, CD3D,
D11S285, and D11S29. The markers are typically separated by 1, 2,
3, 4, or 5 centimorgans.
[0071] The bipolar affective disorder disease status of the family
members may be affected or unaffected, or both. The bipolar
affective disease status is assessed for the family members after
the age of onset. Corresponding genotypes are determined so that at
least one marker from within the same chromosomal region is used
such that a basis of comparison at that chromosomal region is
provided. Generally, markers from within two or three different
chromosomal regions of the present invention are used so that the
contribution of these same chromosomal regions can be determined.
Using statistical methods well known to the skilled artisan, the
genotypes of the family members are compared to determine if the
chromosomal region is associated with the presence or absence of
familial bipolar affective disorder. A lack of a statistically
significant correlation between a form of a marker and a particular
disease status may indicate that the particular chromosomal region
identified by that marker does not contribute to the presence or
absence of the disease. The method thereby allows one to exclude
one, two, or all three chromosomal regions of the present invention
from contributing to bipolar affective disorder in an affected
family. The method may be applied effectively to family members
from families where bipolar affective disorder is in part genetic,
or wholly environmental.
[0072] The methods of the present invention may be performed on a
wide variety of human cells including somatic cell hybrids,
purified nuclei, chromosomal preparations or nucleic acid sequences
comprising a marker to a chromosomal region of the present
invention. The cells may be somatic or germline and from any time
in gestation including fertilized embryo or preimplantation
blastocysts. Preferably, somatic cells are employed to avoid the
possibility of meiotic recombination events between a marker and
locus associated with susceptibility to bipolar illness and to more
readily allow determination of the genotype for a homologous
chromosome pair.
[0073] The methods of the present invention may conveniently be
practiced with informative markers which differ as to sequence or
length such as RFLPs (restriction fragment length polymorphisms)
and microsatellite markers such as STRPs (short tandem repeat
polymorphisms) or VNTRs (variable number tandem repeats). However,
other means to distinguish between the bipolar illness genotypes
may be used, such as but not limited to, antigenicity, specificity,
or activity of encoded proteins or fragments.
[0074] Isolation of nucleic acids from biological samples for use
in the present invention may be carried out by a variety of means
well known in the art. For example, see those described in Rothbart
et al., 1989, in PCR Technology (Erlich ed., Stockton Press, New
York) and Han et al., 1987, Biochemistry, 26:1617-1625. Kits are
also commercially available for the extraction of high-molecular
weight DNA for PCR. These kits include Genomic Isolation Kit
A.S.A.P. (Boehringer Mannheim, Indianapolis, Ind.), Genomic DNA
Isolation System (GIBCO BRL, Gaithersburg, Md.), Elu-Quik DNA
Purification Kit (Schleicher & Schuell, Keene, N.H.), DNA
Extraction Kit (Stratagene, La Jolla, Calif.), TurboGen Isolation
Kit (Invitrogen, San Diego, Calif.), and the like. Use of these
kits according to the manufacturers instructions is generally
acceptable for purification of DNA prior to practicing the methods
of the present invention. Prior to determining a bipolar illness
genotype, the marker or marker which defines it may be amplified
using such well known amplification means as the polymerase chain
reaction (PCR) as described in U.S. Pat. Nos. 4,683,195; 4,683,202;
and 4,965,188. In some case, the informative marker may be
transcribed into RNA by the cells. In this instance, RNA may be
used for amplification or for comparison between the tested
individual and affected family member.
[0075] Of particular use in the present invention as applied to
loci associated with susceptibility to BPAD are the following:
[0076] The primers 5'-CTCCAGCCTGGGTCACTA-3' (SEQ ID NO:1) and
5'-CTAATGCATGACAATAATATTTCCA-3' (SEQ ID NO:2) which amplify marker
D6S344.
[0077] The clone p7H4 comprising a probe which, with the
restriction enzyme EcoRV, can define a polymorphism of marker D6S7.
Clone p7H4 may be obtained from the American Type Culture
Collection (ATCC) as purified DNA with the accession number 57429,
or as a plasmid in E. coli or phage lysate with the accession
number 57428.
[0078] The primers 5'-ACCTAAGCGACTGCCTAAAC-3' (SEQ ID NO:3) and
5'-CTTGTTCATCTGCCTTGTGC-3' (SEQ ID NO:4) which amplify chromosome
marker D6S89.
[0079] Also, primers 5'-AGTCTCATGTGACACAAGGCAG-3' (SEQ ID NO:5) and
5'-TGTAACCTGGAAGTAAGGCATG-3' (SEQ ID NO:6) which also amplify
marker D6S89.
[0080] The primers 5'-TAGGGCCATCCATTCT-3' (SEQ ID NO:7) and
5'-CCTACCATTGACACTCTCAG-3' (SEQ ID NO:8) which amplify marker
D13S171.
[0081] The clone p7F12 comprising a probe which identifies
chromosome marker D13S1. Probe p7F12 is available from the ATCC as
purified DNA using accession number 57007, or in plasmid in E. coli
or phage lysate using accession number 57006. Polymorphisms can be
defined using restriction enzymes MspI, TaqI, or BclI in
conjunction with probe p7F12. A region spanning the marker can be
amplified with the primers 7F12-Ia 5'-TGTAACTATTGGGAGGAAAGA-3' (SEQ
ID NO:9) and 7F12-IIa 5'-TTGTGTAGGACTCTCTAGTTT-3' (SEQ ID
NO:10).
[0082] The primers 5'-GATTTGAAAATGAGCAGTCC-3' (SEQ ID NO:11) and
5'-GTCGGGCACTACGTTTATCT-3' (SEQ ID NO:12) which amplify chromosome
marker D13S218.
[0083] The probe inserted into clone pEFZ33 which defines an RFLP
for chromosome marker D15S45 and is available from the ATCC in E.
coli or a phage lysate using accession number 61006, or as purified
DNA using accession number 61007.
[0084] The primers 5'-GCACCAACAACTTATCCCAA-3' (SEQ ID NO:13) and
5'-CCCTAAGGGGTCTCTGAAGA-3' (SEQ ID NO:14) which amplify chromosome
marker D15S117.
[0085] Other probes and primers useful in the present invention are
presented in Table I. See, e.g., Gyapay et al., "The 1993-1994
Genethon Human Genetic Linkage Map," Nature Genet.
7:246-249(1994).
1 TABLE 1 Distance to Next Marker (Centimorgans) Genethon ID No.
Sex-Averaged Female Male D-Number EMBL GenBank No. Primers
5'-3'(SEQ ID NO:) AFMa350zc9 1.4 2.5 0.1 D6S1600 Z52999
AGCTTGTGCATGTGTGCA (15) CAAAGTCCCAGCAGGTTC (16) AFM092xb7 5.0 1.3
8.8 D6S344 Z17332 CTCCAGCCTGGGTCACTA (1) CTAATGCATGACAATAATATTTCCA
(2) AFM205yel 0.0 0.0 0.0 D15S123 Z16923 AGCTGAACCCAATGGACT (17)
TTTCATGCCACCAACAAA (18) AFMa246wb5 0.0 0.0 0.0 D15S982 Z52695
ATGTTTAAATTAATAACGTGACAGT (19) GACTTCATCTGGATTCACAA (20) AFM150xf4
0.0 0.0 0.0 D15S119 Z16673 AACAGAAAATCCGTAACATAACATA (21)
ACTTTTGTGCCATTTAGAGATT (22) AFM326vd9 0.0 0.0 0.0 D15S1032 Z51395
AGCTTTAACTTCCATGAGTTTC (23) CTAATCTCTGGTGCATAGTGA (24) AFM31Owel
0.0 0.0 0.0 D15S208 Z24290 TCTTAGCAGTAATTGTCACTCCTT (25)
ACATACCATCCCATGGTTAT (26) AFM261xb9 0.0 0.0 0.0 D15S161 Z23852
TCTGTGATTTTGCCATTATGAG (27) TAAACTGGAATTTTTGACTATGAGC (28)
AFM016ygl 0.0 0.0 0.0 D15S143 Z23284 CTAAGGAGGCAACAGCAAAG (29)
ATGTAAAGACTGGTATCTGTAGCAC (30) AFMb33Oxd5 0.0 0.0 0.0 D15S1017
Z53648 TCAAGTAAGGCNATTATTATACAGA (31) CCACAAGCTGGACTGAGAAT (32)
AFMa337zel 0.0 0.0 0.0 D15S990 Z52918 CTGAACAGGTTGAAGTGTCC (33)
CTTGGAATGCCTGAGGAC (34) AFMb351yhl 0.0 0.0 0.0 D15S1024 Z53819
CTAAGTCCTCCACACTAGCC (35) CTAAAATGGGAACAGGGC (36) AFM3S9tf9 0.0 0.0
0.0 D15S1039 Z51531 TGCCGGTAGTAACATCTG (37) CCAAGGATAAAGTATTTGTGTC
(38) AFMa345xh9 0.0 0.0 0.0 D15S992 Z52967 AGCTGAGAAATGCCTTCTATAAAT
(39) GAGGGCCACCTTGATAGT (40) AFMa23lwbS 0.0 0.0 0.0 D15S978 Z52624
AGCTTCATACACTGAAATTGTTG (41) CACCGGGAAACCTTGAT (42) AFM218yf12 1.6
3.2 0.0 D15S126 Z16994 GTGAGCCAAGATGGCACTAC (43)
GCCAGCAATAATGGGAAGTT (44) AFMb076wc9 0.0 0.1 0.0 D15S1003 Z53278
TGGTAGTACCCCTGGATACCTG (45) AATCTTTGTGGATATGGCTCTGCT (46) AFMI89ycl
0.0 0.0 0.0 D15S121 Z16814 TTGTATCAGGGATTTGGTTA (47)
TGTTGTCGCTTCAGTACATA (48) AFMb324yh9 0.5 1.1 0.0 Dl551016 Z53609
GATCCGTCACATAATGGC (49) ACACCTCAGCTTTCCTGG (50) AFM312wd1 0.0 0.0
0.0 Dl5S209 Z24319 AAACATAGTGCTCTGGAGGC (51) GGGCTAACAACAGTGTCTGC
(52) AFMa085wg1 0.0 0.0 0.0 D15S1049 Z51963 CACTCCAGCCTAAGGAACAC
(53) TGTCAAAGATGGCTTTTATTACC (54) AFM296wg5 0.0 0.1 0.0 D15S1029
Z51303 AAGAGTAAAACTCCGTCACAAACAC (55) AGATTTGAGTCTCTGCACAGTAAG (56)
AFMa106xg1 2.6 4.0 1.1 Dl5S962 Z52043 AATTCTGCTCATTGGGG (57)
GGATATTTTGGAACTGCACT (58) AFMbO34yg5 0.6 0.0 0.0 Dl5S998 Z53169
AAGCATCAAAGTGTAACTCAGACC (59) TTGGAGCCTGTGTATGTGTG (60) AFMb293ze9
0.0 1.4 0.0 D15S1008 Z53386 GGTGCTGCCTCCTAACA (61)
CGAGCCCTTCTGAAACA (62) AFM165xc7 0.0 0.0 0.0 D15S150 Z51073
CTGTATGGCCTCAGTCTCGG (63) AGCTCTGTGCGGAAGTCCCT (64) AFMO98ygl 0.0
0.0 0.0 Dl55117 Z16568 GCACCAACAACTTATCCCAA (13)
CCCTAAGGGGTCTCTGAAGA (14)
[0086] Of particular use in the present invention as applied to
loci found on human chromosome 4p that are associated with
resistance to BPAD are the following:
[0087] The primers 5'-AGGCATACTAGGCCGTATT-3' and
5'-TTCCCATCAGCGTCTTC-3', which amplify chromosome markers D4S431
and D4S2366;
[0088] The primers 5'-GCTCACAGAAGTGCCCAATA-3' and
5'-CCCTGGGTGAAGTTTAATCTC- -3', which amplify chromosome marker
D4S2935;
[0089] The primers 5'-ATTTTTGCTACATTGGTGACATA-3' and
5'-CTTCAGGTTCTACTAGTTCATGG-3', which amplify chromosome marker
D4S3007;
[0090] The primers 5'-CCCTTGAGCATCCTGACTTC-3' and
5'-GAGTGAGCCCCTGTACTCCA-- 3', which amplify chromosome marker
D4S394;
[0091] The primers 5'-ATCAGGGTTCTCCACACAAA-3' and
5'-TTGGTTGAAACTTGTGGATAT- AAA-3', which amplify chromosome marker
D4S1582;
[0092] The primers 5'-CATTCTAGTAGTTATTGGCTTATCC-3' and
5'-CAGTTGCTTGATACCTATATTTTTC-3', which amplify chromosome marker
D4S1605;
[0093] The primers 5'-CCTTACGGATAGGGGCAG-3' and
5'-CTAATGTCCAGGTCTACGGC-3'- , which amplify chromosome marker
D4S2949; and
[0094] The primers 5'-AGGTGGCCCTGAGTAGGAGT-3' and
5'-TTTGAGGGAATGATTTGGGT-- 3', which amplify chromosome marker
D4S403. These and additional markers are shown in Table 2.
[0095] Of particular use for detecting markers that are associated
with resistance to BPAD and are found on chromosome arm 4q are the
following:
[0096] The primers 5'-AATGCTTATCTACCAATGAGTG-3' and
5'-GTGGCTGGGTAGTATTCATGG-3', which amplify chromosome marker
D4S2423;
[0097] The primers 5'-GGCAAGANTCCGTCTCAA-3' and
5'-TGAAGTAAATTTGGGAGATTGT-- 3', which amplify chromosome marker
D4S422;
[0098] The primers 5'-AGGGAGGTCATCAGTTCATT-3' and
5'-TGTTGCAAACTTTGCTTTTC-- 3', which amplify chromosome marker
D4S397;
[0099] The primers 5'-TTCTTTGATTCTTCGGGG-3' and
5'-TTTCTCAGCAACATTCCTCT-3'- , which amplify chromosome marker
D4S420;
[0100] The primers 5'-TAACATTGACCGCTCCTCTC-3' and
5'-CATCCTTCCTGGTCCCTAGT-- 3', which amplify chromosome marker
D4S1644;
[0101] The primers 5'-TAAAACTTCTGAATGAAAAG-3' and
5'-GTAGGGAGGAATAGTTAG-3'- , which amplify chromosome marker
UT2147;
[0102] The primers 5'-TGCAAACTGTCACTCAAAAG-3' and
5'-GCCAAGGCTGATCCTC-3', which amplify chromosome marker
D4S1565;
[0103] The primers 5'-GCGCTCTTGGTATATGGTACAG-3' and
5'-TGTGGGCAACGTCACTC-3', which amplify chromosome marker D4S424;
and
[0104] The primers 5'-GACTCCAAATCACATGAGCC-3' and
5'-GTCTCTGCATTTGCTGGTTT-- 3', which amplify chromosome marker
D4S1625. These and additional primers that are useful for
amplifying chromosomal markers that identify chromosomal regions
associated with increased resistance to BPAD are shown in Table
3.
[0105] Significantly, the chromosomal region of human chromosome 4q
which is associated with increased resistance to BPAD includes the
human homolog of the mouse Clock gene (FIG. 9A). Certain alleles of
this gene, which is involved in circadian rhythms, are implicated
by the findings reported herein as being involved in mediating
resistance to BPAD. Accordingly, the present invention provides
methods of determining a genotype associated with increased or
decreased resistance to familial bipolar affective disorder by
determining the genotype of an individual using at least one marker
for at least one chromosomal region linked to the human Clock gene.
The chromosomal regions are inclusive of and localized between
D4S402 and D4S1625. From the genotype, increased or decreased
resistance to bipolar affective disorder is determined.
[0106] The chromosome markers disclosed may be modified by
insertions, deletions, substitutions, or additions with the proviso
that modified sequence be sufficiently complementary to identify
the same chromosomal markers as the unmodified sequences. As will
be recognized by those of skill, the complementary sequences of the
probes and primers may likewise be employed or modified.
[0107] The primer pairs for chromosomal markers are also
conveniently used as probes for the markers. Additional target
regions may be identified by walking from known chromosome markers
as described above. Techniques for chromosome walking are well
known in the art as described in Sambrook et al., Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor Press, 1989.
Vectors which are optimized for chromosome walking are commercially
available (e.g., .lambda.DASH and .lambda.FIX (Stratagene Cloning
Systems, La Jolla, Calif.). New markers may result from physical
mapping of the interval defined by markers D6S34 and
2 date- combined female male allele forward primer.vertline.lpl
reverse primer.vertline.rpl locus name start
CTCAAGAGAAATAGAACCAATAAGAGACGGAAACCAAATGGA GATA145E01 1.3 2.7 0 7
actctqaaggctgagatggg ctgaaccgcagatcccc D4S432 0 0 0 3
tcagaaacccctacaggaaa tttgatgagttattcggagg D4S2925 4.1 2.2 6.2 7
acctcactggaaactaaatgg tgaacagcagcggtgt D4S3023 1.4 0 1.9 10
aggcatactaggcctalt ttcccatcagcgtcttc D4S431 Hamisha September 1996
D4S2366 Brian Apr. 7, 1997 0.1 1.6 1.6 6 gctcacagaagtgcccaala
ccctgggtgaagtttaatctc D4S2935 Melissa November 1996 2.2 2.2 0 3
atttttgctacattggtgac cttcaggttctactagttca D4S3007 Melissa November
ata tgg 1996 1.6 3.7 0 8 cccttgagcatcctgacttc gagtgagcccctgtactcca
D4S394 Sharon November 1996 0 0 0 4 gggcatcatgtctgcaa
aggttccctgaatgttcg D4S2923 5.8 8.3 3.3 13 tgtccagttggcaggg
ggtcgcattcattcgc D4S2983 optimized 0.1 0 0 9 atggcctgtgaatcaaccc
aatcctttgaagacggccc D4S3009 0 0 0 6 atcagggttctccacacaaa
ttggttgaaacttgtggalat D4S1582 Hamisha September aaa 1996 0 0 0 7
atagacgtgttcctggtgg ctcaggctatttatggggtg D4S2928 0 0 0 4
cattctagtagttatcggctta cagttgcttgatacctatattt D4S1605 TOSS tcc ttc
1.1 1.1 1.1 7 ccttaaaagtatccagtaaagc caaggttgtcctgtgtctgc D4S1599
Melissa November aca 1996 0 0 0 6 cagtctagattcaaaggaatta
aattagagatgcccgtgaaa D4S2906 gac 0 0 0 7 agcttcttgctgtgtcc
aagggtggggctctat D4S3036 1.2 1.1 1.1 6 ccttacggataggggcag
ctaatgtccaggtctacggc D4S2949 Hamisha September 1996 0.4 1.1 0 6
agattctggcctccttgc cctggtgaagtggtggg D4S2944 0.1 0 0 7
caaatgcccatcaatcaac gggtccagtctcatccac D4S2942 0.1 0 0 6
ccagatgggttccaaatga tgtggactgagtagagagtgcc D4S1602 0 0 0 5
ccccaaaggaatcagatg gatcttgaaattttcccatttt D4S2984 3.3 1.1 5.4 7
aggtggccctgagtaggagt tttgagggaatgatttgggt D4S403 agcccaggaggtgaag
gagatttctaggaaacattgag D4S1564 agagtagttbccatctttgtt
gggcaaggctcatcac D4S1611 ttc acatggagaatcttttagta
cttttgagatacccctatcagt D4S1573 gca ggacctccttgcttcg
ccccttaggttgcttgt D4S427 Cary Jun. 1, 1997 TTTAGTTGAATGGCTGAGTGG
TGAGCCAATTCCCCTAATAA GATA30B11 CCACAAAGACAGAATCAATAG
TCTCAACCTCCATAACTGTG UT7161 TTTGATTTCCTGCAGTrGGT
TCAACACAAAACCAATGTGG ATA26F08 ttacactgaagaatgtgaga
ggccttggaactactgatgg D4S2985 gcc ccttgggtcagccacatatc
cactcagaacagaaacttgggt D4S1615 ACTGGTATGTCCTAACCCCC
GATCTGCAGTTGGATTCTGG ATA26B08 GCTGCACCTTAGACTAGAT
TTAGTAGCTTCTCAGCAGC UT6123
CAGACATAAATGAAAGAAAAGGGCAGCAAACTATGGTATGTAA UT723
AAGtTAATCCATGTGCCGTG CTTCTTTCTCTTTTTTCCCTG UT1376. ggtgatccacctgcct
aagccactgaccttcact D4S429 0 0 0 8 gacagcctattgtagtaacttg
tagtcagggtgctctaggqg D4S3039 tgg 0 0 0 3 atgggtactttttgaatcaca
acactccagcctccctgac D4S1575 tcc 2.6 0 0 7 agcttccatggtcattaagagt
tagggtcctccaaagaacaga D4S2959 Maria Apr. 7, 1997
AATGCTTATCTACCAATGAGTGGCTGGG- TAGTATTCATGGTGG D4S2423 Cary Jun. 1,
1997 0.1 0.1 0 8 ggcaagantccgtctcaa tgaagtaaaatttgggagat D4S422
Hamisha Mar. 15, tgt 1997 5.2 7.1 3.3 7 attgtncatatatcatcacc
acagcataaactaaaatttg D4S1576 Sharon November tgg ggg 1996 0 0 0 7
agctactcaggnaggctg tttttaatatccaacctcactt D4S2972 Cary Jun. 1, gtg
1997 0 0 0 9 cccccaccttcctgac ctggagcatccgtgtg D4S1579 1.6 2.2 0 6
agggaggtcatcagttcatt tgttgcaaactttgcttttc D4S397
TCGATCTGCAGTTGCCCTA TGTACCCATTAAGCAGCCTG UT1264 0 0 1 10
tttcccacctggccttat ctcttgaagccctgaagttt D4S2939 Melissa November
1996 0.6 1.2 0 6 tttacagttttcaaaatttc ggttcttgaccctagctcc D4S2965
1.1 1.1 1.1 7 ttctttgattcttcgggg tttctcagcaacattcctct D4S420
Melissa November 1996 TAACATTGACCGCTCCTCTC CATCCTTCCTGGTCCCTAGT
D4S1644 Melissa Feb. 28, 1997 TAAAACTTCTGAATGAAAAG
GTAGGGAGGAATAGTTAG UT2147 Ashima Apr. 7, 1997 0.7 2.2 0 7
tgcaaatcgtcactcaaaag gccaaggctgatcctc D4S1565 Sharon November 1996
GGCCAACAGAGCAGGATC GCCAAGAGAGTGAGACTCCA GATA135E06 Melissa Feb. 28,
1997 1.5 0 2.2 8 gcgctcttggtatatggtacag tgtgggcaacgtcactc D4S424
optimized 0 0 0 7 ggttatttaattttagtaacgc gaacagaagtgctggagac
D4S2981 Ashima Apr. 7, atc 1997 GACTCCAAATCACATGAGCC
GTCTCTGCATTTGCTGGTTT D4S1625 Ashima Apr. 7, 1997 0 0 0 4
tcgtgcccagccaagt ttgctcacaggattgcttct D4S1604
attttcatgcattcgttagaat tctaggtgatggtgatgctg D4S1561 ttt
gcatgtaccattgccagg cccagagtgctgatgtgtg D4S1586 Cary Jun. 1, 1997
aaagttccaatctcccc tcttatgctgcaatcactg D4S1549 tgccataaacaaggtgaaac
ttacccaactgctacaccat D4S1548
TTCAATACTCCTGTATCACAAAGGGAGACACAATCTGAGCTATGC GATA72A08 Cary Jun.
1, 1997 TGGTTCTGCTTTTTCTCTCC TTTAACAGACAAATGACAAATG GATA8A05 1.4
2.5 0.1 8 agcttgtgcatgtgtgca caaagtcccagcaggttc D6S1600 5 1.3 8.8 9
ctccagcctgggtcacta ctaatgcatgacaataatattt D6S344 optimized cca 0
0.4 0.1 15 aatcactgttacccatagggtt aggccaagacctctgtgc D6S1713
optimized atc 2.2 1.8 2.2 15 tgcaaaacaggcaoacatac
ttaatcaattttctgcaaagat D6S1617 optimized aaa 0 0.1 0.1 9
gtatagccaactgcttccaa gggtnccatttattgagatt D6S1668 Melissa Feb. 28,
1997 0 0.1 0.1 7 tgtttcagcagcataggg agagcctgtttggtgtcatc D6S1591 0
0.1 0.1 6 gtttccaagggctggg gaaatcaaaataacacatcct D6S1677 ctg 0.1
0.1 0.1 3 tacactaatggctctcctgg gccagatttctctgctgtag D6S1685
optimized 2.7 4.3 1.1 12 aagaacttcccaaaccaat aaccatccaggacatcaa
D6S1574 Maria Apr. 7, 1997 0 0.1 0.1 4 tcaaggctttctgaggc
agcatggattctgttgtttg D6S1S98 0.7 1.1 0.1 7 agccaggcatgctaacat
ggattacaggcacccagta D6S1640 optimized 1.5 1.1 2.2 8
ccttgagcaccttaaattttt taactgacaaagcagaatagca D6S1547 optimized 0
0.1 0.1 11 ccttaaacaaacaataagacc cagcctagaaaacagagcca D6S1674 acc
13 GATA161F06 174-190 23 5 GAGGTTGCTTGAAATCCAG
GAATCTCATCTACCCTGTTTGG 13 GATA21F07 189-205 0.63
ATACTCCGAGCTATCTGTCTACC GGTGCAGATCATGACCTCTC 13 GATA51B02 148-168
0.77 CATGGATGCAGAATTCACAG TCATCTCCCTGTTTGGTAGC 13 GATA53C06 178-210
0.87 GGTTTGCTGGCATCTGTATT TGTCTGGAGGCTTTTCAGTC 13 GGAA29H03 223-243
0.8 ACCTGTTGTATGGCAGCAGT GGTTGACTCTTTCCCCAACT 13 GGAT12E07 177-193
0.75 GTCTGTCCATCCATTCATCC CCTCTTCTCCATGAGGACCT 13 UT1213 213 6
ACTTAAATGTCCATCAATAAAT TGATTGGCTTTTTTTACTTAC 13 UT1585 213 7
TGAACTCCGGCCTGGGTGA TTTTGGAGCTGGGGATGTC 4 ATA26B08 235-259 0.81
ACTGGTATGTCCTAACCCCC GATCTGCAGTTGGATTCTGG 4 ATA26F08 222-234 0.87
TTTGATTTCCTGCAGTTGGT TCAACACAAAACCAATGTGG 4 D4S1548 245-271 9
tgccataaacaaggtgaaac ttacccaactgctacaccat 4 D4S1549 203-217 6
aaagttccaatctcccc tcttatgctgcaatcactg 4 D4S1561 294-306 7
attttcatgcattcgttagaatttt tctaggtgatggtgatgctg 4 D4S1564 220-242 12
agcccaggaggtgaag gagatttctaggaaacattgag 4 D4S1573 101-113 5
acatggagaatcttttagtagca cttttgagatacccctatcagt 4 D4S1S86 103-117 7
gcatgtaccattgccagg cccagagtgctgatgtgtg 4 D4S1602 222-233 6
ccagatgggttccaaatga tgtggactgagtagagagtgcc 4 D4S1611 277-285 5
agagtagtttccatctttgttttc gggcaaggctcatcac 4 D4S1615 115-125 5
ccttgggtcagccacatatc cactcagaacagaaacttgggt 4 D4S2985 248-262 8
ttacactgaagaatgtgagagcc ggccttggaactactgatgg 4 D4S422 75-97 8
ggcaagantccgtctcaa tgaagtaaaatttgggagattgt 4 D4S424 178-192 8
gcgctcttggtatatggtacag tgtgggcaacgtcactc 4 D4S427 142-166 10
ggacctccttgcttcg ccccttaggttgcttgt 4 D4S429 193-207 8
ggtgatccacctgcct aagccactgaccttcact 4 GATA145E01 161-229 11
CTCAAGAGAAATAGAACCAATAA TAAGACGGAAACCAAATGGA 4 GATA30B11 289-305
0.8 TTTAGTTGAATGGCTGAGTGG TGAGCCAATTCCCCTAATAA 4 GATA72A088 202-218
5 TTCAATACTCCTGTATCACAAAG TGAGACACAATCTGAGCTATGG 4 GATA8A05 151
0.68 TGGTTCTGCTTTTTCTCTCC TTTAACAGACAAATGACAAATCTG 4 UT1508 249 10
CCTCAGTTTTCTCTCCTGC TGCTGCTATATGCTTTGCAG 4 UT2021 338 4
TGGGTGACAGAGCTAGTCC GAACCAGCCTCGCATACC 4 UT6123 291 7
GCTGCACCTTAGACTAGAT TTAGTAGCTTCTCAGCAGC 4 UT7161 <361 6
CCACAAAGACAGAATCAATAG TCTCAACCTCCATAACTGTG 4 UT7738 <314 5
TTGCAGTGAGAAGAGATTGT GCACAAGAATCAGATAAGGA 4 UT7739 206 6
ACCCTGTACTTGTCAAGGTT AATCATGTGAACCAGTTTCC 4 UT7953 290 7
TGGTGGGTCTGCGTGTGTG TGCTGGGATTCGGTGCA
[0108] D6S89, D13S171 and D13S218. Markers D6S7 and D13S1 could
serve as convenient focal points for mapping of the intervals.
Regions proximal to D15S45 may also be used to identify new
markers. Those of skill in the art will appreciate that a variety
of methods to identify new markers may be employed. For example,
the chromosomal regions of the present invention cloned into a
yeast artificial chromosome (YAC) library can be identified and
isolated by identifying the presence of sequences corresponding to
the marker sequences identified above. Cosmid subclones can be
created to provide more detailed physical maps; and AC repetitive
hybridization probes could identify additional microsatellite
sequences in the cloned regions. Other chromosome markers could be
used to extend the physical map beyond the boundaries of the
identified markers to yield other markers.
[0109] Generally, the markers of the present invention will yield
directly or indirectly (e.g., upon treatment of a RFLP with a
restriction enzyme) at least two distinct bipolar illness genotypes
since one bipolar illness genotype will have been inherited from
each parent. In some cases, however, only one genotype may result
if the tested individual received identical forms of the genotype
from both parents. In such cases, informative markers providing
distinct genotypes may be used. The sizes of the markers of the
tested individual are determined for comparison to the size of the
markers of the affected family member. Equivalence in size between
informative markers for the affected family member and tested
individual indicates the same genotype as defined by that marker.
Differences in size between informative markers for the affected
family member indicates different genotypes as defined by that
marker. As will be understood by the skilled artisan, construction
of the pedigree is performed using the methods of the present
invention to follow the transmission of genotypes associated or not
associated with bipolar illness as defined by psychological
diagnostic criteria.
[0110] Generally, the sizes will be determined by standard gel
electrophoresis techniques as described in Sambrook et al.,
Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press,
1989, and Polymeropoulos et al., Genomics, 12:492-496 (1992).
Polyacrylamide gel electrophoresis is particularly preferred
because of its capability of high discrimination. Generally,
autoradiography is employed to simultaneously visualize and
identify the markers. Amplification of markers is generally
performed with labelled nucleotide bases that provide a means for
identifying the markers following the procedure. Alternatively,
labelled nucleic acid primers may employed as labelling probes
which can hybridize to the amplified markers. Typical
autoradiographic labels include .sup.32P, .sup.14C, .sup.3H,
.sup.125I, .sup.35S, or the like. Alternatively, probes may be
labelled with visual labels such as photoluminescents, Texas red,
rhodamine and its derivatives, red leuco dye and
3,3'5,5'-tetramethylbenzidine (TMB), fluorescein and its
derivatives, dansyl, umbelliferone and the like or with horse
radish peroxidase, alkaline phosphatase, or the like.
[0111] Although the present invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
EXAMPLE I
[0112] This Example describes the collection of epidemiologic data
from pedigree members.
[0113] The genetic-epidemiologic study of bipolar affective
disorders among the Old Order Amish in southeastern Pennsylvania
has been previously described (Egeland et al., Am. J. Psychiat.,
140:56-61 (1983), Egeland, Genetic Studies in Affective Disorders,
eds. Papolos & Lachman, 70-90 (John Wiley & Sons, N.Y.
(1994)). FIG. 1 shows that the ancestral line encompasses the
earliest cases of recurrent, psychiatric illness and the first
confirmed cases of bipolar affective disorder. Bipolar I disorder
among descendants of other pioneers usually occurred after
intermarriage with the BP progenitor line. (Egeland, Genetic
Studies in Affective Disorders, eds. Papolos & Lachman, 70-90
(John Wiley & Sons, N.Y. (1994)). On the extreme left side of
the figure, one observes the LEFT extension coupled with the CORE
Pedigree 110 which provided the resource first used to report
genetic linkage data (Egeland et al., Nature 325:783-787 (1987)).
After follow-up and addition of a RIGHT extension to Pedigree 110,
further genetic analyses were reported in 1989 (Kelsoe et al.,
Nature, 342:238-243 (1989). Next, Pedigree 210 and partial Pedigree
310 (NIGMS Family 1075) (Egeland, NIGMS Human Genetic Mutant Cell
Repository, NIH Publication 94-2011, 408-428, 992-999 (1994))
became a second large lateral extension (Pauls et al., Genomics,
11:730-736 (1991)). The present report utilizes all of these
earlier subjects plus additional expansions, especially in Pedigree
310. The diagnoses for the 207 individuals in our current linkage
study are summarized in Table 2. These Old Order Amish kinships
continue to provide for lateral and lineal expansion and have
evolved into the IX-Xth generations of descendants at risk.
[0114] Case ascertainment for mental illness among the Amish began
with a community-wide network of informants and institutional
rosters reviewed with informed consent (Hostetter et al., Am. J.
Psychiat., 140:62-66 (1983)). Over 400 patient cases have been
ascertained. A psychiatric review board composed (since 1976) of
Drs. James N. Sussex, Abram M. Hostetter, John J. Schwab, David R.
Offord and Jean Endicott used both psychiatric interviews (Endicott
et al., Arch. Gen. Psychiat., 35:837-844 (1978)) and abstracted
medical records to perform diagnostic assessments based on strict
Research Diagnostic Criteria (RDC) (Spitzer et al., Arch. Gen.
Psychiat., 35:773-782 (1978)). Assessments by this review board
were made blind to pedigree membership, diagnostic opinions and
treatment information in the medical records, and genetic marker
status. As the Board's diagnostic procedures yielded confirmed
cases of BPI affective disorder, the immediate families of these
patients were evaluated for psychopathology. Pedigree 110 was
selected (1981) for initial genetic linkage study because of
relationships between nuclear families, based on BPI probands, and
illness spanning several generations (Egeland, Genetic Studies in
Affective Disorders, eds. Papolos & Lachman 70-90, John Wiley
& Sons, N.Y., (1994)). When one examines the relative risk for
individuals used in this linkage study, there is a very high
prevalence of affective disorder, with age-corrected morbid risk
rates for BPI, BPII, and MDD (major depressive disorder) of 17%,
4%, and 6%, respectively. This gives an overall rate of 27% for
major affective disorder in these pedigrees. The present sample,
which includes extensions to the original family (FIG. 1) totals
207 members, with 31 diagnosed BPI, 50 with other psychiatric
diagnoses (Dx), and 126 unaffected individuals (Table 4).
3TABLE 4 DIAGNOSES FOR THE SAMPLE OF 207 OLD ORDER AMISH SUBJECTS
STUDIED IN GENOME SCAN PED. 110 PED. 110 PED. 110 PED. 210 Present
Sample Left Ext. CORE 1st Rt. Ext 2nd Rt. Ext PED. 310 TOTAL BPI 3
11 4 2 11 31 BPII 0 3 1 1 3 8 MDD: recurrent 1 5 3 2 4 15 MDD:
single 1 5 1 1 1 9 Other Dx. 0 9 1 3 5 18 AFFECTED 5 33 10 9 24 81
UNAFFECTED 5 52 21 19 29 126 GRAND TOTAL 10 85 31 28 53 207
[0115] Over 125 medical records were abstracted and Board reviewed
to document the 31 BPI cases. The average age of onset for BPI
disorder was 22 years. Reliability of the bipolar diagnoses was
checked when 16 of the 31 cases (52%) were evaluated twice, with an
average five year interval between the blind assessments using
different clinical documentation and resulting in 100% concordance.
The high reliability obtained lessens the likelihood of
misdiagnoses or a false positive BPI in our linkage analyses
(Egeland et al., Psychiat. Genet., 1:5-18 (1990)).
[0116] Apart from RDC diagnoses, the project psychiatric panel also
recorded clinical opinions in a consensus "clinical diagnosis."
There was 100% concordance between these two types of diagnostic
conclusions (5 board members) for the 31 BPI cases and 13 of the 15
cases of recurrent major depressive disorder. Of particular
interest are the diagnostic results for the eight cases of BPII.
Four were designated BPII by both RDC and clinical opinion. The
other four were labelled BPI according to clinical opinion, and two
of these actually were classified as "probable BPI" by the strict
Research Diagnostic Criteria. This is important to note because it
shows that true BPII disorder occurs rarely in these pedigrees;
BPII appears more as a "BPI" waiting to happen.
[0117] This study of bipolar affective disorder in the Old Order
Amish represents a 19 year longitudinal study of an isolated
population in which there is a relatively narrow spectrum of
illness (not one case of schizophrenia occurs in the pedigrees used
for linkage analyses) with bipolar disorder being the predominant
diagnosis. The rigorous longitudinal assessment of these Amish
pedigrees combined with the systematic and blind psychiatric
evaluations and diagnoses should also greatly reduce the number of
misdiagnoses included in the linkage analyses. Moreover, the
restricted gene pool characteristic of this relatively closed
population should reduce the number of disease-causing alleles,
minimizing the problem of genetic heterogeneity.
EXAMPLE II
[0118] This Example describes the collection and analysis of
genotypic data.
[0119] Genotypic data were collected for 551 DNA markers (RFLP and
microsatellite) from 207 pedigree members, including 31 cases of
confirmed BPI disorder. Blood samples were collected with informed
consent and lymphoblastoid cell lines were established at the
Coriell Institute of Medical Research and/or the National Institute
of Mental Health. The NIGMS Human Genetic Mutant Cell Repository
catalog contains updated pedigree and diagnostic information
(Egeland, NIGMS Human Genetic Mutant Cell Repository, NIH
Publication 94-2011, 408-428, 992-999 (1994)). DNA was extracted
from peripheral blood samples and/or immortalized lymphoblastoid
cell lines (Neitzel, Hum. Genet., 73:320-326 (1986)). The RFLP and
microsatellite markers used resulted in a linkage map with an
average spacing of between 5 and 10 cM (Gyapay et al., Nature Gen.,
7:246-249 (1994), Donis-Keller et al., Cell, 51:319-337 (1987)).
Mapping panels were constructed to determine the best order of
markers typed on the bipolar pedigrees using genotypic data from
the CEPH version 7 database, using the MultiMap linkage analysis
program (Matise et al, "Automated construction of genetic linkage
maps using an expert system (MultiMap): a human genome linkage map"
Nature Genet. 6:384-390 (1994). Microsatellite markers were
genotyped individually by previously described methods (Pauls et
al., Am. J. Hum. Genet., 57:636-643 (1995), Sambrook, Molecular
Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press,
N.Y. (1989)) and by multiplex procedures adapted from Vignal et al.
"Nonradioactive multiplex procedure for genotyping of
microsatellite markers" in Methods in Molecular Genetics, (ed.
Adolph, K. W.) 221 221 (Academic Press, Orlando 1993). In the
multiplex genotyping procedures, a total of 25 microsatellite
markers were analyzed in each lane of the genotyping gels. To
accomplish this, five markers were coamplified in each PCR tube,
and five sets of five markers were pooled and precipitated prior to
gel loading. Sets of five microsatellite markers were amplified in
20 .mu.l reactions that included: 10 mM Tris-HCl, Ph 8.3, 50 Mm
KCl, 0.001% gelatin, 1.5 Mm MgCl.sub.2, 0.2 mM dNTPs, 0.5 units Taq
polymerase, 1 .mu.M of each primer (10 primers in total), and 50 ng
genomic DNA. Samples were denatured at 94.degree. C. for 1 minute,
followed by 30-35 cycles at 94.degree. C. for 15 seconds, 55C. for
15 seconds, and 72.degree. C. for 15 seconds. After the final
cycle, the reactions were incubated at 72.degree. C. for 3 minutes.
Following amplification, five sets of PCR amplifications were
pooled and isopropanol precipitated in 96 well microwell plates.
The pooled PCR products were resuspended in 10 .mu.l loading dye
containing formamide, denatured at 95.degree. C. for 5 minutes and
loaded onto 6.0% denaturing polyacrylamide gels. After
electrophoresis, the gel fractionated microsatellite markers were
transferred to nylon membranes by capillary transfer, and
visualized by hybridizing membranes with marker specific,
chemiluminescent probes. One of the oligonucleotides used to
amplify each marker was labelled with peroxidase using the ECL
detection kit (Amersham) and used as probe. Multiple probes
corresponding to markers of different sizes were hybridized to the
filters simultaneously. Chemiluminscent signals were detected by
autoradiography. Allele sizes for the microsatellite markers were
determined relative to a PUC18 sequence or SEQUAMARK marker ladder
(Research Genetics). To maintain allelic designations for the
purposes of allele frequency calculations, DNA samples from
replicate individuals were included within and between gels. Films
were scored either manually or using semi-automated allele calling
software (BioImage), and were independently analyzed by two
individuals blind to disease status. Data from manually scored
markers and from the automated scoring system were transferred into
the same file system for linkage analyses.
EXAMPLE III
[0120] This Example describes the statistical analysis of genotypic
data.
[0121] Since the exact mode of inheritance of bipolar affective
disorder is unknown, linkage analyses were carried out using
nonparametric (allele sharing, model-independent) methods [SAGE,
Sibpal program for Haseman-Elston sib pair tests; affected sibpair
analysis (ASP) with weighing of multiple affected in the same
sibship by number of meioses; affected pedigree member (APM); and
transmission disequilibrium test (TDT)], as well as lod score
analyses.
[0122] For nonparametric analyses, based on the asymptotic
(theoretical) distribution of the test statistic, the SIBPAL
program furnished formal (asymptotic) p-values in the test for an
excess proportion of alleles shared IBD (identical by descent) and
in the Haseman-Elston regression test (Haseman et al., Behav.
Genet., 2:3-19 (1972); Keats and Elston, Genet Epidemiol Supplement
1:147-152 (1986)). The "true" p-value (the empirical significance
level) is defined as the probability that the observed result or
one more extreme than it is obtained by chance alone. To estimate
empirical significance levels associated with these results rather
than relying on the formal p-value, we carried out computer
simulations (3000 replicates) for each marker with a formal p-value
of 0.01 or less. These simulations were extremely time consuming as
a complete analysis had to be carried out for each replicate.
Resulting empirical p-values (identified by * in Table 5) typically
were about ten times higher than the formal "p-values" issued by
the program. In addition, a computer program was written to carry
out sib pair analyses in which multiple pairs per sibship are
weighed by the number of meioses.
[0123] Analysis of allele frequencies for the markers D6S7, D 13S1,
and D15S45 was carried out on probands and their mates to test for
the existence of linkage disequilibrium. In no case was there a
significant difference at the 5% level. For these three marker
loci, as well as for the two markers that flanked each, we tested
for the presence of specific haplotypes. Again, no haplotypes were
significantly more frequent than expected by chance when tested at
the 5% level.
[0124] The existence of linkage disequilibrium is known to
influence certain types of identify-by-state affected sib pair
strategies. The basic reason for this is that allele sharing among
relatives in isolated populations may be exaggerated due large
regions of founder chromosomes that have not been broken up by
recombination. For this reason, we employed the TDT to test for
linkage, and applied IBD methods, which are unlikely to be
significantly influenced by disequilibrium.
[0125] A recent described approach, based on all markers of a
chromosome, for estimating the proportion of alleles shared IBD was
applied to the chromosomes carrying out our best three markers.
Lander et al., Nature Genetics, 11:241-247 (1995). For allele
sharing among all possible affected sib pairs, it resulted in
suggestive linkage for locus D6S7. The TDT did not provide p-values
suggestive of linkage when applied to the best three loci and BPI
affecteds.
[0126] For parametric analyses, two-point lod scores were
calculated with the LINKAGE programs (Lathrop et al., Proc. Natl.
Acad. Sci., USA, 81:3443-3446 (1984)). Each marker was analyzed
under 16 models (dominant versus recessive inheritance, large
pedigrees versus data broken into nuclear families, homogeneity
versus allowing for heterogeneity by the HOMOG program (Ott, J.,
"Analysis of Human Genetic Linkage" (Johns Hopkins University
Press, Baltimore, 1991)), and for affecteds only versus affected
and unaffected individuals considered). A penetrance ratio (genetic
versus nongenetic cases) of 500:1 and disease allele frequencies
adjusted to reflect a population prevalence of 1%. Individuals
without psychiatric illness under any diagnostic scheme were
considered unaffected, whereas those not categorized as affected
under one scheme but affected under one of the other diagnostic
categories were taken to be unknown. Sixteen models were tested in
the lod score analyses, and included: dominant versus recessive
inheritance; large pedigrees versus data broken into nuclear
families; homogeneity versus allowing for heterogeneity; and
analysis for affecteds only versus using affecteds and unaffecteds.
To evaluate the effect of analyzing the data under multiple models,
we compiled maximum lod scores for the 551 markers obtained under a
single model (case 1)(for dominant inheritance, nuclear families,
homogeneity, and affected only) and compared them with lod scores
obtained under multiple testing (case 2) (FIG. 3). Mean lod scores
were 0.18 versus 0.46, for cases 1 and 2, respectively. Thus,
multiple testing raised lod scores on the average by 0.28 units.
Also, no lod score exceeded 2.0 under the fixed model (case 1),
whereas 3 lod scores had values of at least 2.0 under multiple
testing (case 2).
[0127] Eleven percent of the markers (62 of 551) used in our
genome-wide search gave a maximum lod score of 1.0 or higher in at
least one of the 16 analysis models. Consequently, only regions
which yielded stronger evidence of linkage were considered further,
namely those with markers having a test statistic of p<0.001 in
any one analysis type, or maximum lod score of at least 2.0. Using
these criteria, six markers showed evidence for linkage D1S48,
D6S7, D7S67, D11S146, D13S1, and D15S45).
[0128] Marker D11S146 can be obtained from the ATCC using accession
Nos. 59230 for a bacterial/phage lysate, or 59231 for purified DNA.
Marker D1S48 (Genethon ID G00-000-488) is disclosed in Cartinhour
et al., Cytogenetics and Cell Genetics, 46:591 (1987). Marker D7S67
(Genethon ID G00-008-432) is disclosed in Donis-Keller et al., Cell
51:319-337 (1987).
[0129] Markers at three chromosomal loci gave highly significant
test statistic p-values under Sibpal (ASP) analyses: D6S7 at
chromosome 6pter-p24 with p<0.0001; D13S1 at chromosome 13q13
with p=0.0003; and D15S45 at chromosome 15q11-qter with p=0.0003.
Test statistics for these three markers, as well as for markers
flanking these regions, are shown in Table 5. These SIBPAL test
statistic p-values were estimated using computer simulations (3000
replicates) run under an assumption of no linkage. Therefore, they
are not flawed by analyses that would furnish spuriously small
formal p-values. In lod score analysis none of the markers reached
LOD=3 criterion. However, in some of the nonparametric analysis
methods, p-values of less than 0.001 (and even 0.0001, which is
asymptotically equivalent to Z.sub.max=3) are found. Together,
these results lend further support to the significance of these
intervals as candidate regions.
4TABLE 5 RESULTS OF LINKAGE ANALYSES Locus Map dist Zmax dom Zmax
rec SIBPAL p ASP p BPI D6S344 .000 .000 .8729 .2145 D6S70.0 2.342
1.456 .0003* .0513 D6S89 36.0 .097 .001 .5567 1.0000 D6S28 17.7
.000 .003 .6262 .7800 BPI + II1 D6S344 .000 .000 .9249 .2341 D6S7
0.0 2.469 1.609 .0000 .0293 D6S89 36.0 .167 .000 .7113 .3230 D6S28
17.7 .000 .000 .6272 .7867 BPI + II D6S344 .000 .000 .9249 .2036
D6S7 0.0 1.885 .984 .0003* .1561 D6S89 36.0 .732 .394 .5241 .2743
D6S28 17.7 .000 .000 .6874 .6892 BPI + II + MDD D6S344 .000 .000
.8977 .1055 D6S7 0.0 1.606 .795 .0001 .4195 D6S89 36.0 .732 .399
.7126 .1714 D6S28 17.7 .000 .000 .6877 .7918 BPI D13S221 .000 .012
1.0000 .9725 D13S171 15.3 .000 .102 .4905 .3736 D13S1 5.2 1.276
1.248 .0003* .0057 D13S218 5.1 .312 .664 .0171 .0641 D13S263 10.1
.056 .175 .0865 .3028 BPI + II1 D13S221 .000 .000 1.0000 .8902
D13S171 15.3 .000 .000 1.0000 .4876 D13S1 5.2 1.402 1.036 .0000
.0056 D13S218 5.1 .494 .423 .0175 .0766 D13S263 10.1 .004 .178
.1475 .3998 BPI + II D13S221 .000 .000 1.0000 .7344 D13S171 15.3
.000 .000 1.0000 .4665 D13S1 5.2 1.203 .676 .0090* .0162 D13S218
5.1 .307 .314 .1403 .1484 D13S263 10.1 .006 .194 .2384 .4033 BPI +
II + MDD D13S221 .000 .000 1.0000 .7672 D13S171 15.3 .000 .204
1.0000 .9429 D13S1 5.2 .000 .043 .0223 .0932 D13S218 5.1 .000 .025
.3007 .3202 D13S263 10.1 .000 .008 .2262 .3525 BPI D15S45 1.114
.798 .0003* .0163 D15S117 5.6 .130 .580 .0843 .1660 D15S148 1.2
.338 .610 .0217 .1000 D15S38 6.1 .000 .000 1.0000 .9853 D15S36 0.0
.355 .400 .0114 .0862 BPI + II1 D15S45 1.097 .446 .0018 .0456
D15S117 5.6 .332 .589 .1225 .2346 D15S148 1.2 .752 .613 .0219 .0976
D15S38 6.1 .067 .000 1.0000 .9904 D15S36 0.0 .646 .402 .0118 .0844
BPI + II D15S45 .857 .731 .0183 .0399 D15S117 5.6 .089 .726 .0910
.1825 D15S148 1.2 .461 .829 .0123 .0589 D15S38 6.1 .000 .000 1.0000
.8551 D15S36 0.0 .368 .292 .0131 .1172 BP + II + MDD D15S45 1.709
.473 .0032 .0150 D15S117 5.6 .000 .096 .2119 .3546 D15S148 1.2 .148
.192 .0360 .0998 D15S38 6.1 .000 .000 1.0000 .7914 D15S36 0.0 .000
.000 .1423 .3168
[0130] Map Dist: Map distance in centimorgan between markers;
[0131] Z.sub.max: Maximum lod score in analysis of nuclear
families, affected only, penetrance ratio (genetic versus
nongenetic cases) of 500:1, with allowance for heterogeneity
(exception: for D6S7, affecteds and unaffecteds);
[0132] Z.sub.maxdom or Z.sub.maxrec: Under dominant or recessive
inheritance;
[0133] SIBPAL p: p-values furnished by SIBAL program in t-test for
excess allele sharing in affected sib pairs (exception: results for
regression analysis given for D6S7). For some markers, an empirical
p-value, p', was estimated by computer simulation;
[0134] ASP p: p-values in t-test for excess of allele sharing in
affected sibs, multiple sib pairs, in same sibship weighed by
number of meiosis;
[0135] Clinical
[0136] Categories: MDD includes only recurrent major depressive
disorder; Number of affecteds in clinical hierarchies were: 31 BPI,
35 BPI+BPII, 39 BPI+BPII, and 49 BPI+BPII+MDD;
[0137] 1) Only those BP II cases that are borderline BP I are
included (such as clinical BP I and RDC manic).
[0138] As observed in Table 5, results are typically stronger for
BPI than for more liberal diagnostic categories; that is, extending
the pool of affected individuals to include additional psychiatric
illness (BPII and recurrent MDD) appears to add "noise" to the
analyses. Generally, equivalent results are obtained for lod score
analyses and our simple ASP analysis, whereas the Haseman-Elston
approach (SIBPAL program) typically provided stronger results. The
main differences between the programs SIBPAL and ASP consist in the
weighing of multiple sib pairs in a sibship (no weighing in
SIBPAL). Moreover, SIBPAL deduces ambiguous genotypes from close or
distant relatives while ASP does this based only on individuals in
the nuclear family. In addition, ASP does not carry out any
Haseman-Elston type regression analysis as was applied in the case
of marker D6S7. The fact that some markers flanking our strongly
significant markers also show positive linkage results provides
support for the presence of susceptibility loci near the candidate
loci.
[0139] The relationship between pointwise (locus-specific or
nominal) and genome-wide significance levels was recently
discussed. Lander et al., Nature Genetics, 11:241-247 (1995).
According to this report, for sib pair methods, pointwise P-values
of 0.00074 and 0.000022 correspond to suggestive and significant
linkage, respectively, with "significant" denoting a genome-wide
P-value of 0.05. For lod score analysis, the respective lod score
thresholds are 1.9 and 3.3. Thus, according to these criteria,
markers D6S7, D13S1, and D15S45 yield locus-specific P-values that
are suggestive of linkage.
[0140] Our study of bipolar affective disorder in the Old Order
Amish, however, represents a 19 year longitudinal study of an
isolated population in which there is a relatively narrow spectrum
of illness (not one case of schizophrenia occurs in the pedigrees
used for linkage analyses) with bipolar disorder being the
predominant diagnosis. The rigorous longitudinal assessment of
these Amish pedigrees combined with the systematic and blind
psychiatric evaluations and diagnoses should also greatly reduce
the number of misdiagnoses included in our linkage analyses.
Moreover, the restricted gene pool characteristic of this
relatively closed population should reduce the number of
disease-causing alleles, minimizing the problem of genetic
heterogeneity.
[0141] Similar to other common and complex diseases like diabetes,
hypertension and perhaps even schizophrenia, our data suggest that
genetic factors likely contribute to the pathogenesis of bipolar
affective disorder, where in the majority of these cases,
inheritance is multifactorial rather than simple Mendelian
transmission. Like the genetic variance observed for quantitative
traits, bipolar affective disorder (even in a relative genetic
isolate like the Old Order Amish) appears to be a polygenic
(complex) trait resulting from the variable effects of multiple
genes. The results of our genome wide scan suggest that genes on
chromosomes 6, 13, and 15, rather than just different mutant
alleles of a single gene, determine the susceptibility to and
phenotype of bipolar affective disorder in the Old Order Amish.
Additional sets of genes may underlie the susceptibility to develop
bipolar affective disorder in other populations.
EXAMPLE IV
[0142] This Example describes the ascertainment of psychiatric
disorders and health among several large multigenerational Old
Order Amish pedigrees covers a period of over twenty years.
Throughout this longitudinal study, procedures for assessing and
diagnosing subjects have remained constant (Egeland et al. (1990)
Psychiat. Genet. 1, 5-18). Moreover, the clinical documentation and
diagnostic evaluations have employed rigorous standards and been
subjected to a variety of reliability tests (Hostetter et al.
(1983) Am. J. Psychiat. 140, 62-66). For families in this linkage
study, the clinical documentation and diagnostic evaluations have
included a thorough evaluation of all available RDC (Spitzer et al.
(1978) Arch. Gen. Psychiat. 35, 773-782) bipolar I (BPI) probands
and their relatives. Morbid risk analyses have demonstrated a high
prevalence of affective disorder among first degree relatives of
bipolar probands in these families with the highest risk conferred
on the children of a BPAD parent (Pauls et al. (1992) Arch. Gen.
Psychiat. 49, 703-708). Importantly, because of the long-term,
longitudinal nature of the study, even the unaffected, mentally
healthy individuals (those without any psychiatric illness) in
these families have been closely followed, many for a period of
years past the age of risk for BPAD. Consequently, rather than
limit this genome-wide search to identifying susceptibility loci
for the disease phenotype (BPAD), we tested the hypothesis that
"protective" alleles may contribute to the absence of psychiatric
illness (i.e. mental health "wellness") in unaffected family
members in these "high risk" pedigrees. Since the mode of
inheritance of any gene(s) modifying the relative risk for
affective disorder was unknown (Craddock, N. & McGuffin, P.
(1993) Ann. Med. 25, 317-322) we relied exclusively on model-free
linkage analyses.
[0143] This Example reports strong evidence for linkage of DNA
markers on chromosome 4p to mental health "wellness" in relatives
at high risk for, but who did not develop, major affective disorder
in several large multigenerational Old Order Amish pedigrees with
an extremely high incidence of BPAD.
MATERIALS AND METHODS
Diagnostic Assessment
[0144] Our genetic-epidemiologic study of BPAD among the Old Order
Amish in southeastern Pennsylvania has been described in detail
(Egeland, J. A. (1994) in Genetic Studies in Affective Disorders,
eds Papolos, D. F. & Lachman, H. M., (John Wiley & Sons,
New York) pp. 70-90), including the methods for ascertainment and
diagnostic evaluation with informed consent (medical records and
SADS-L interviews)(Spitzer et al. (1978) Arch. Gen. Psychiat. 35:
773-782; Endicott, J. & Spitzer, R. (1978) Arch. Gen. Psychiat.
35: 837-844). Diagnoses were made, using strict research diagnostic
criteria (RDC)(Spitzer et al., supra.), by a five member
psychiatric review board whose members were blind to pedigree
membership, diagnostic opinions, treatment data from abstracted
medical records and genetic marker status. By the late 1970's,
several dozen BPI probands had been certified by the psychiatric
Board. Subsequently, interviewing began on all available first
degree relatives using the SADS-L instrument. In this initial
screening, over 300 first degree relatives were interviewed
directly with the SADS-L. These 25 nuclear families, containing one
or more cases of BPI, formed the structure of Pedigrees 110, 210
and 310 (FIG. 10).
[0145] The BPI probands in the nuclear families used in this
linkage study have on the average 11.6 first degree relatives. A
few siblings were unavailable, while either both parents (57%) or
one parent (23%) were available for interviews and blood samples.
Cell lines have been established on an average of eight members for
each nuclear family.
[0146] In this study, the "unaffected" individuals (mentally "well"
or "healthy") are those for whom all SADS-L interview responses
were negative (normal) and no contradictory reports were given by
family informants. Any individuals for whom some symptomatology was
identified, even though it did not meet criteria for which the
psychiatric Board could give a formal diagnosis by RDC, were
labeled as "unknowns" in our linkage analyses.
[0147] The method used for this longitudinal study is ethnographic
and hence culturally appropriate to the field setting. Each "well"
person is not seen annually, nor is every individual in a family
routinely re-interviewed with the SADS-L. Instead, several members
of each nuclear family with a BPI proband (BPI nuclear family) are
seen annually, and those diagnosed with BPI or other major
affective disorder undergo a yearly "course-of-illness" update.
Parents of each BPI patient are regularly visited and they have
proven to be accurate informants about the health of their children
and grandchildren. At least one "unaffected" sibling (control
sample) of the married BPI patients has been interviewed yearly
since 1990 in connection with a prospective study of
"children-at-risk" for bipolar disorder. In summary, at least three
members and occasionally all members of each BPI nuclear family
have been evaluated yearly.
[0148] Individuals are interviewed anew with the complete SADS-L
schedule whenever any abnormal mental or emotional symptoms are
identified by the follow-up mechanisms. Nearly 50% of those
subjects presently carrying a diagnosis of a major affective
disorder, including BPI, were "unaffected" at the time of the
initial SADS-L interview. The long-term, systematic follow-up of
the families in our study has demonstrated that onset of illness in
the Old Order Amish is usually reported by multiple informants. We
are confident that individuals designated as "healthy" are free of
any significant affective disorder.
Patient Samples
[0149] Blood samples were uniformly collected only after each first
degree relative (including parents, siblings and children older
than age 15) of the BPI probands had been interviewed with the
complete SADS-L schedule. Samples were obtained with written
informed consent and coded to maintain confidentiality. The
phlebotomist was kept blind to pedigree relationships and
diagnostic status. Lymphoblastoid cell lines were established at
the Coriell Institute for Medical Research, Camden, N.J. and/or the
Clinical Neuroscience Branch, IRP, National Institute of Mental
Health, Bethesda, Md. The NIGMS Human Genetic Mutant Cell
Repository catalogue (Egeland, J. A. Amish major affective
disorders pedigrees. (1994) In 1994-1995 Catalog of Cell Lines,
NIGMS Human Genetic Mutant Cell Repository, 408-428, 992-999 (NIH
Publication 94-2011) contains updated pedigree and diagnostic
information for several of the Amish pedigrees used in our
study.
Genotyping
[0150] Genomic DNA was obtained from peripheral blood samples
and/or immortalized lymphoblastoid cell lines as previously
described (Ginns et al. (1996) Nature Genet. 12, 431-435). The best
order of typed markers on our mapping panels was obtained from the
genetic location database (LDB) (Collins et al. (1996) Proc. Natl.
Acad. Sci. USA. 93, 14771-14775). The order of markers on
chromosome 4p is: D4S412-6.50cM-D4S431-0.24cM-D4S2366-
-0.2cM-D4S2935-1.3cM-D4S3007-1.3cM-D4S394-2.0cM-D4S2983-0.00cM-D4S2923-0.0-
0cM-D4S615-0.05cM-AFMa184za9-1.54cM-D4S2928-1.51cM-D4S1065-0.04cM-D4S1582--
0.65cM-D4S107-1,46cM-D4S3009-0.30cM-D4S2906-0.00cM-D4S2949-0.05cM-AFM087zg-
5-0.24cM-D4S2944-0.11cM-D4S403-0.4cM-D4S2942-0.00cM-D4S2984-0.00cM-D4S1602-
-1.11cM-D4S1511-1.49cM-D4S2311-2.15cM-D4S3048-3.62cM-D4S419-1.75cM-D4S404--
2.5cM-D4S391. The order of markers on chromosome 4q is:
D4S3043-27.91cM-D4S402-0.9cM-D4S427-1.64cM-D4S2303-2.49cM-D4S2985-0.63cM--
D4S2423-2.39cM-D4S2286-1.50cM-D4S2959-1.01cM-D4S175-0.40cM-D4S422-0.24cM-D-
4S1576-4.10cM-D4S2294-0.04cM-D4S1579-0.54cM-D4S397-0.01cM-D4S3089-0.10cM-D-
4S2965-0.03cM-D4S192-0.01cM-D4S420-0.05cM-D4S1644-0.02cM-D4S3344-0.02cM-D4-
S1565-1.27cM-D4S1625-0.12cM-D4S424-0.04cM-D4S1604-2.31cM-D4S1548.
[0151] The order of markers on chromosome 11q is:
D11S934-2.1cM-D11S133-8.-
7cM-D11S147-4.0cM-CD3D-0.2cM-D11S285-0.1cM-D11S29.
[0152] DNA panels for PCR were set up using a 96 microtiter plate
format, and the PCR master mix was aliquoted using a BioMek robot
(Beckman Instruments). PCR was performed using Perkin-Elmer model
9600 and 9700 thermocyclers. PCR products for a given DNA marker
were optimized by carrying out PCR amplification at 3 different
annealing temperatures on a test panel of genomic DNA samples, and
by determining the fluorescence signal amplitude and shape
following electrophoresis using the ABI 373 fluorescent
sequencing/genotyping instrument (Applied Biosystems Division,
Perkin-Elmer). DNA markers were usually processed in groups of six.
The genomic DNA samples were PCR amplified separately with each of
the DNA markers. The PCR products were then multiplexed, 6 markers
per lane, for electrophoresis on the ABI 373 instruments (Applied
Biosystems Division, Perkin-Elmer). The DNA from several
individuals was represented multiple times in the genotyping panels
so that within and between each electrophoresis gel there were
"identical" samples that could be used to evaluate the consistency
of genotypes across several gels. The fluorescent signals from
amplified fragments were tracked using Genescan (Applied Biosystems
Division, Perkin-Elmer), and genotypes were subsequently analyzed
with Genotyper (Applied Biosystems Division, Perkin-Elmer).
[0153] Genetic Analysis Software (G.A.S. package version 2.0, Alan
Young, Oxford University, 1993-1995) was used to identify
problematic marker data, and a utility written in SPSS (SPSS Inc.)
generated a list of samples that needed to be rerun because of
inheritance discrepancies or unreadable signals. Samples that had
to be rerun were repicked by a Microlab 2200 robot (Hamilton
Instruments), aliquoted, electrophoresed and analyzed. Because we
are studying large multigenerational pedigrees where individuals
are descendants of a few progenitors, we maximize the useful
information by repeating the genotyping/analysis cycles described
above until all possible DNA marker genotypes are obtained for the
individuals in the study.
[0154] Once genotyping for a marker was finished, the data were
reanalyzed with G.A.S., observed allelic mutations and other
non-inheritances were "zeroed out" in the data file, and the
problematic alleles were notated on pedigree drawings. Histograms
were generated indicating the marker allele size bins. FASTLINK
(Schaffer, A. A. (1996) Hum. Hered. 46, 226-235) was used to
reanalyze the data prior to further statistical analyses.
Linkage Analyses
[0155] Model-free linkage analyses were conducted using the
two-point affected sib pair analysis program S.A.G.E. SIBPAL
(S.A.G.E. Statistical Analysis for Genetic Epidemiology, Release
3.0. (1997) Computer package available from the Department of
Epidemiology and Biostatistics, Rammelkamp Center for Education and
Research, MetroHealth Campus, Case Western Reserve University,
Cleveland, Ohio) and the multipoint analysis program
GENEHUNTER-PLUS (Kruglyak, L. & Lander, E. S. (1995) Am. J.
Hum. Genet. 56, 1212-1223). Because there were a few sibships with
incomplete marker information, marker allele frequencies were
estimated from the entire Old Order Amish family data set using a
maximum likelihood method implemented in the program MENDEL/USERM13
(Lange et al. (1988) Genet. Epidem. 5,471-472; Boehnke, M. (1991)
Am. J. Hum. Genet. 48, 22-25). SIBPAL was used to identify markers
showing an excess of alleles shared identical by descent (IBD)
among unaffected, mentally healthy sib pairs. Under the null
hypothesis of no linkage between a trait and marker, sib pairs
would be expected to share on the average fifty percent of alleles
IBD, but when a trait and marker are linked, IBD sharing will be
increased in both affected and unaffected sibpairs. Because SIBPAL
assumes marker allele frequencies appropriate for random samples,
it underestimates the proportion of alleles shared IBD by
concordant sib pairs when there is linkage. Multipoint analyses
using the model-free linkage program GENEHUNTER-PLUS produced NPL
(non-parametric linkage) scores along points at the chromosomal
region of interest. Two scoring functions are available in
GENEHUNTER-PLUS: IBD sharing can be assessed among concordant
relative pairs (NPL.sub.pairs) or it may be assessed among larger
groups of concordant relatives (NPL.sub.all). Our analyses were
conducted using the .sub.NPLall statistics as Kruglyak and
colleagues have demonstrated that the NPL.sub.all statistic results
in a more powerful test than the NPL.sub.pairs statistic (Boehnke,
supra.).
RESULTS
[0156] First we analyzed our genome-wide scan dataset looking for
evidence of chromosome regions linked to mental health "wellness".
In these analyses only mental health "wellness" (the absence of any
psychiatric illness), in individuals who were over 45 years of age
and had a first degree BPI sibling in their family (Pedigrees 110,
210, 310 and 410), was the linkage phenotype of interest
(concordantly unaffected pairs) using SIBPAL. Of more than 980 DNA
markers, only six markers representing three chromosome regions had
t-statistics that were sufficiently outlying and that were likely
to represent significant linkage results. Of the markers on
chromosome 4p, D4S2949, which is located in the vicinity of the
BPAD susceptibility locus reported by Blackwood et al. ((1996)
Nature Genet. 12, 427-430), had an empirical SIBPAL p
value<5.times.10.sup.-5 (nominal p value<1.times.10.sup.-7).
The marker D4S397 on chromosome 4q had an empirical SIBPAL p
value=9.times.10.sup.-4 (nominal p value=3.times.10.sup.-7) On
chromosome 11q, two DNA markers (D11S133 and D11S29) located over
an approximately 20 cM region each had a nominal p
value<5.times.10.sup.-5 (SIBPAL; simulations were not
performed). To supplement standard criteria for assessing the
significance of our linkage analysis results, we employed graphical
techniques (FIG. 11) and the empirical assessment of p values
(Schweder, T. & Spjotvoll, E. (1982) Biometrika. 69, 493-502;
Witte et al. (1996) Nature Genet. 12, 355-358; Drigalenko, E. L.
& Elston, R. C. (1997) Genetic Epidem. 14, 779-784). If each
marker assessed in a pairwise linkage analysis is unlinked to the
trait, then the p values associated with those markers should be
uniformly distributed. In addition, the test-statistics used to
generate these p values (for instance t-tests in the case of
SIBPAL) should follow an appropriate distribution. A plot
(generated using Proc Chart, SAS, SAS Institute Inc.) of the
t-statistics obtained from each pairwise linkage analysis is shown
in FIG. 11. The plot in the inset depicts a line that should be
linear if all markers are unlinked. However, as seen in FIG. 11,
there are outlying t-statistic values that likely represent false
null hypotheses; that is, evidence for significant linkage results.
In addition, in the inset to FIG. 11, the small upturned portion of
the p value plot near values of 1-p=1 represent departures from
uniformity and hence most likely reflect false null hypotheses.
Because of the effort required to investigate the significance of
these findings and the prior evidence supporting a BPAD related
locus on chromosome 4 (Blackwood et al. (1996) Nature Genet. 12,
427-430), we chose to examine DNA markers on chromosome 4 first for
linkage to mental health "wellness".
[0157] To evaluate the findings on chromosome 4p and 4q in more
detail, we genotyped the subpedigrees and nuclear families
containing at least one sibling with BPI (Table 6) using additional
DNA markers in these interesting regions. Compared to our previous
report (Ginns et al. (1996) Nature Genet. 12, 431-435) a larger
number of individuals were included in these analyses (Table 6). In
this report, model-free linkage analyses using SIBPAL and
GENEHUNTER-PLUS (Krugylak et al. (1996) Am. J. Hum. Genet. 58,
134-1363) were performed using mental health "wellness" as the
linkage phenotype (Tables 7 and 8). In our analyses, individuals
having a psychiatric diagnosis other than BPI, as well as those
having psychiatric symptoms but no diagnosis, were classified as
"unknown category" for affected status. In the Amish Study sample
of BPI patients (n=59) the mean and median ages of onset (RDC) are
24 and 22 years, respectively. Hence, in all analyses we used a
conservative age cutoff of 45 years to define family members with
the unaffected "wellness" phenotype. We also examined the influence
of younger age cutoffs for defining "well" individuals, and the
contribution of different subpedigrees (families from pedigrees
110, 210, 310, and 410 versus only families from pedigree 110) on
the test statistics for linkage (Tables 9 and 10). "Well"
individuals younger than the specified age cutoff were considered
to have an "unknown" affected status in the analyses.
5TABLE 6 Old Order Amish subjects included in linkage analysis
Analysis Mentally Categories Healthy "Unknowns" Pedigrees 110, 210,
310, 410 .gtoreq.25 years old 138 85 .gtoreq.35 years old 109 114
.gtoreq.45 years old 74 149 .gtoreq.55 years old 52 171 Pedigree
110 only .gtoreq.25 years old 45 32 .gtoreq.35 years old 37 40
.gtoreq.45 years old 31 46 .gtoreq.55 years old 23 54
[0158] In Table 6, the category of "unknowns" includes individuals
of unknown phenotype, individuals with psychiatric diagnoses other
than BPI, and individuals who are mentally healthy but are younger
than the particular age cut-off used in analyses. BPI individuals
are not included in the unknown phenotype category. In pedigrees
110, 210, 310 and 410, 39 people were diagnosed with BPI, 8 with
BPII, 21 with recurrent depressive disorder, 2 with unipolar
depressive disorder and 15 with other psychiatric illness. In
pedigree 110 only, 18 people were diagnosed with BPI, 2 with BPII,
10 with major depressive disorder, and 5 with other psychiatric
illness. Note: the individuals used in these linkage analyses
represent only a subset of the entire Amish bipolar pedigrees since
only nuclear families and subpedigrees containing a sibling with
BPI were included.
6TABLE 7 Results of SIBPAL analysis of 4p markers Pedigree 110
Pedigrees 110, 210, 310, 410 p-value p-value Marker {circumflex
over (.PI.)} (s.e) nominal simulated {circumflex over (.PI.)}
(s.e.) nominal simulated D4S412 .4749(.0621) .6555 np .5116(.0539)
.4154 np D4S431 .5734(.0441) .0523 np .5921(.0388) .0110 np D4S2366
.6781(.0452) .0002 .0005 .6024(.0356) .0027 .0094 D4S2935
.5066(.0218) .3825 np .4998(.0198) .5043 np D4S3007 .6233(.0386)
.0014 .0023 .5632(.0337) .0330 .0496 D4S394 .6782(.0513) .0007
.0012 .5955(.0421) .0135 .0249 D4S2983 .7219(.0484) <1 .times.
10.sup.-4 np .6090(.0377) .0025 np D4S2923 .6661(.0446) .0003 np
.5902(.0307) .0022 np D4S615 .7161(.0393) <1 .times. 10.sup.-4
np .6223(.0324) .0002 np Afma184 .7396(.0446) <1 .times.
10.sup.-4 np .6220(.0370) .0008 np xa9 D4S2928 .7333(.0257) <5
.times. 10.sup.-5 np .6369(.0272) <5 .times. 10.sup.-5 np
D4S1605 .5453(.0258) .0440 .0472 .5795(.0244) .0011 0.0058 D4S1582
.6787(.0616) .0032 .0112 .6269(.0557) .0139 .0510 D4S107
.6557(.0246) <5 .times. 10.sup.-5 .0029 .6514(.0243) <5
.times. 10.sup.-5 .0088 D4S3009 .7325(.0552) .0001 np .6237(.0379)
.0008 np D4S2906 .6460(.0396) .0004 np .5853(.0327) .0055 np
D4S2949 .7077(.0202) <1 .times. 10.sup.-7 <3 .times.
10.sup.-5 .6888(.0243) <1 .times. 10.sup.-7 <3 .times.
10.sup.-5 Afm087z .5229(.0368) .2686 np .5114(.0246) .3218 np g5
D4S2944 .5647(.0263) .0093 np .5428(.0255) .0483 np D4S403
.6032(.0492) .0217 .0233 .5989(.0443) .0232 .0350 D4S2942
.7196(.0308) <1 .times. 10.sup.-4 np .6627(.0243) <1 .times.
10.sup.-4 np D4S2984 .5510(.0396) .1032 np .5493(.0297) .0505 np
D4S1602 .6001(.0561) .0412 np .5703(.0383) .0356 np D4S1511
.6242(.0489) .0077 np .5779(.0315) .0079 np D4S2311 .7429(.0279)
<5 .times. 10.sup.-5 np .6327(.0336) .0001 np D4S3048
.6628(.0573) .0036 np .5998(.0403) .0078 np D4S419 .5981(.0270)
.0004 .0010 .5772(.0319) .0100 .0201 D4S404 .6785(.0489) .0004
.0010 .6428(.0470) .0020 .0072 D4S391 .7008(.0487) .0001 .0003
.6585(.0470) .0008 .0035 {circumflex over (.PI.)} is the estimated
proportion of alleles shared identical by descent. np: simulations
not performed
[0159]
7TABLE 8 Results of SIBPAL analysis of 4q markers Pedigree 110
Pedigrees 110, 210, 310, 410 p-value p-value Marker {circumflex
over (.PI.)} (s.e) nominal Simulated {circumflex over (.PI.)}
(s.e.) nominal simulated D4S3043 .4490(.0531) .8286 np .5143(.0354)
.3442 np D4S402 .4649(.0525) .7460 np .4598(.0463) .8048 np D4S427
.4759(.0452) .7016 np .4564(.0345) .8944 np D4S2303 .4616(.0423)
.8145 np .4670(.0305) .8585 np D4S2985 .5754(.0255) .0027 np
.5403(.0139) .0025 np D4S2423 .5445(.0415) .1453 .1373 .5445(.0304)
.0743 .0846 D4S2286 .5533(.0522) .1570 np .5225(.0381) .2780 np
D4S2959 .5035(.0359) .4619 np .4906(.0268) .6370 np D4S175
.5960(.0558) .0471 .0636 .5995(.0484) .0231 .0348 D4S422
.6198(.0500) .0108 np .5685(.0386) .0403 np D4S1576 .5290(.0509)
.2861 np .5377(.0367) .1545 np D4S2294 .4960(.0446) .5351 np
.4867(.0381) .6358 np D4S1579 .6206(.0381) .0015 np .5740(.0298)
.0077 np D4S397 .7511(.0449) 3 .times. 10.sup.-7 .0009 .6586(.0376)
5 .times. 10.sup.-6 .0002 D4S3089 .4544(.0348) .9013 np
.4768(.0261) .8120 np D4S2965 .5296(.0581) .3068 np .5267(.0366)
.2340 np D4S192 .5135(.0408) .3715 np .5040(.0337) .4525 np D4S420
.5595(.0539) .1384 np .5462(.0389) .1200 np D4S1644 .5224(.0521)
.3351 .2870 .5503(.0362) .0845 .0925 D4S3334 .5491(.0254) .0304
.0497 .5258(.0287) .1858 .1769 D4S1565 .5091(.0373) .4042 np
.5040(.0271) .4420 np D4S1625 .5433(.0454) .1730 np .5533(.0339)
.0603 np D4S424 .5901(.0527) .0481 np .5950(.0461) .0226 np D4S1604
.5501(.0473) .1480 np .5095(.0345) .3919 np D4S1548 .5597(.0356)
.0511 np .5814(.0267) .0016 np {circumflex over (.PI.)} is the
estimated proportion of alleles shared identical by descent. np:
simulations not performed
[0160]
8TABLE 9 Results of SIBPAL analysis of selected 4p markers by age
Pedigree 110 Pedigrees 110, 210, 310, 410 Marker Age {circumflex
over (.PI.)} (s.e.) t-value p-value {circumflex over (.PI.)} (s.e.)
t-value p-value D4S2366 .gtoreq.25 .5906(.0415) 2.1813 .0163
.5268(.0220) 1.2195 .1121 .gtoreq.35 .6295(.0482) 2.6843 .0051
.5459(.0290) 1.5846 .0580 .gtoreq.45 .6781(.0452) 3.9389 .0002
.6024(.0356) 2.8783 .0027 D4S3007 .gtoreq.25 .5567(.0341) 1.6625
.0505 .5231(.0196) 1.1767 .1205 .gtoreq.35 .5767(.0423) 1.8139
.0383 .5263(.0276) 0.9529 .1716 .gtoreq.45 .6233(.0386) 3.1978
.0014 .5632(.0337) 1.8729 .0330 D4S394 .gtoreq.25 .5872(.0397)
2.1935 .0159 .5306(.0220) 1.3885 .0834 .gtoreq.35 .6242(.0524)
2.3713 .0111 .5560(.0331) 1.6911 .0471 .gtoreq.45 .6782(.0513)
3.4734 .0007 .5955(.0421) 2.2683 .0135 D4S1605 .gtoreq.25
.5287(.0259) 1.1076 .1361 .5367(.0227) 1.6194 .0541 .gtoreq.35
.5271(.0270) 1.0039 .1608 .5405(.0276) 1.4686 .0739 .gtoreq.45
.5453(.0258) 1.7551 .0440 .5795(.0244) 3.2623 .0011 D4S1582
.gtoreq.25 .5695(.0439) 1.5849 .0588 .5078(.0250) 0.3110 .3781
.gtoreq.35 .6025(.0586) 1.7505 .0436 .5268(.0358) 0.7487 .2280
.gtoreq.45 .6787(.0616) 2.9012 .0032 .6269(.0557) 2.2772 .0139
D4S2949 .gtoreq.25 .6035(.0305) 3.3967 .0006 .5499(.0205) 2.4289
.0081 .gtoreq.35 .6497(.0310) 4.8265 9 .times. 10.sup.-6
.6035(.0260) 3.9796 6.8 .times. 10.sup.-5 .gtoreq.45 .7077(.0202)
10.288 <1 .times. 10.sup.-7 .6888(.0243) 7.7856 <1 .times.
10.sup.-7 {circumflex over (.PI.)} is the estimated proportion of
alleles shared identical by descent.
[0161]
9TABLE 10 Results of SIBPAL analysis of selected 4q markers by age
Pedigree 110 Pedigrees 110, 210, 310, 410 Marker Age {circumflex
over (.PI.)} (s.e.) t-value p-value {circumflex over (.PI.)} (s.e.)
t-value p-value D4S175 .gtoreq.25 .5254(.0402) 0.6314 .2650
.5209(.0283) 0.7398 .2305 .gtoreq.35 .5730(.0524) 1.3932 .0857
.5557(.0420) 1.3258 .0952 .gtoreq.45 .5960(.0558) 1.7200 .0471
.5995(.0484) 2.0536 .0231 D4S397 .gtoreq.25 .6599(.0307) 5.2010 1
.times. 10.sup.-6 .6303(.0243) 5.3595 2 .times. 10.sup.-7
.gtoreq.35 .7455(.0427) 5.7485 6 .times. 10.sup.-7 .6622(.0383)
4.2358 4.5 .times. 10.sup.-5 .gtoreq.45 .7511(.0449) 5.5883 3
.times. 10.sup.-7 .6586(.0376) 4.2156 5 .times. 10.sup.-6 D4S3334
.gtoreq.25 .5571(.0265) 2.1548 .0174 .5369(.0187) 1.9786 .0246
.gtoreq.35 .5483(.0280) 1.7269 .0457 .5213(.0238) 0.8968 .1859
.gtoreq.45 .5491(.0254) 1.9346 .0304 .5258(.0287) 0.8996 .1858
[0162] {circumflex over (.PI.)} is the estimated proportion of
alleles shared identical by descent.
[0163] On chromosome 4p, the maximum multipoint NPL value
(GENEHUNTER-PLUS) was 4.05 (p=5.22.times.10.sup.-4; including
individuals>age 45 yrs in pedigree 110 only) and 4.05
(p=1.84.times.10.sup.-4; including individuals>age 45 yrs in all
pedigrees), respectively. The maximum multipoint NPL value
(GENEHUNTER-PLUS) for markers on chromosome 4q was 3.29
(p=2.57.times.10.sup.-3; including individuals>age 45 yrs in
pedigree 110 only) and 2.82 (p=4.43.times.10.sup.-3; including
individuals>age 45 yrs in all pedigrees), respectively. The
GENEHUNTER-PLUS -log.sub.10p value as a function of the map
position at these locations on chromosome 4 are shown in FIG. 12.
SIBPAL test statistics for markers on chromosomes 4p and 4q are
shown in Tables 7 and 8. On chromosome 4 the lowest (nominal) p
values obtained from the SIBPAL t-statistics were for markers
D4S2949 (4p; p<1.times.10.sup.-7) and D4S397 (4q;
p=3.times.10.sup.-7). The maximum multipoint NPL value
(GENEHUNTER-PLUS) for markers on chromosome 11q was 2.43 (including
individuals>age 45 yrs in pedigree 110 only) and 2.49 (including
individuals>age 45 yrs in all pedigrees), respectively.
[0164] To obtain empirical p-values, we simulated genotype data by
randomly assigning marker alleles to the founders and then
assigning alleles to their descendants following Mendelian
inheritance. Allowing for consanguineous matings, the entire family
structure (FIG. 10) was used in marker assignment, thus taking into
account all relationships between individuals in the dataset. For
each simulation, after marker assignment, the pedigrees were
trimmed down to that of the nuclear families used in the linkage
analysis. SIBPAL was then run on the trimmed dataset and
t-statistics for concordant and discordant sib pairs were obtained.
The true p value is simply estimated as the proportion of
replicates in which the simulated statistic is greater than or
equal to the observed statistic, i.e., the probability that the
observed result or something more extreme would be obtained by
chance alone. Simulations were conducted for markers on chromosomes
4p and 4q. For each marker, 100,000 replicates were obtained. The
empirical p values on chromosome 4p clearly meet the proposed
criteria of significance for linkage (Lander, E. S. & Kruglyak,
L. (1995) Nature Genet. 11, 241-247).
DISCUSSION
[0165] If alleles exist that are associated with mental health
"wellness", we reasoned that the identification of chromosome
regions containing these alleles would be enhanced by studying the
genetically at risk, mentally healthy members of large,
multigenerational pedigrees like our Old Order Amish families'.
However, in trying to identify "protective" or "wellness" alleles,
one must recognize that there are phenocopies that need to be
considered. Despite the extremely high risk for developing disease,
some individuals are undoubtedly "well" because they do not inherit
any (or all) of the requisite susceptibility alleles for BPAD. In
addition, since the age of greatest liability for onset of BPAD in
the Old Order Amish is from early teens through 24 years of age,
the misspecification of the "well" phenotype for individuals who
will eventually develop BPAD would be greatest through this age
period. In these Old Order Amish families susceptibility alleles
for BPAD probably occur in very high frequency. Accordingly, an
important step in our study which demonstrates that there are
"protective" alleles was to show that there are "mentally healthy"
individuals who share marker alleles that should increase the risk
of developing BPAD, and yet, in the presence of "protective"
alleles these individuals do not manifest BPAD. The effect of age
for inclusion for the "wellness" phenotype can be seen in Tables 9
and 10. For many of the markers, {circumflex over (.PI.)}, an
underestimate of the proportion of alleles shared identical by
descent (IBD) in "well" sibpairs, increases with increasing age,
i.e. a more stringent definition of the "well" phenotype. For
example, with respect to marker D4S2949 on 4p, {circumflex over
(.PI.)} is 0.60, 0.65 and 0.71 for age cutoff points of 25, 35, and
45 years, respectively. This suggests that increasing the age for
inclusion eliminates some age-related "well" phenocopies.
[0166] It is conceivable that virtually all cases of affective
disorder in these families are due to a common set of
susceptibility alleles. The "wellness" or "protective" loci that we
have tentatively identified could harbor alleles that prevent the
manifestation of a bipolar affective spectrum disorder phenotype,
which could also include major depressive disorder. In our analyses
the strongest evidence for "protective" alleles comes from pedigree
110, suggesting that such alleles may be more likely in this branch
of the family. However, highly significant test statistics and
multipoint lod scores (using GENEHUNTER-PLUS) are also observed
when pedigrees 110, 210, 310 and 410 are used for analyses (FIGS.
12A and 12B). The decreased sharing in proportion of alleles
identical by descent (IBD) for discordant pairs provides further
support for the existence of alleles associated with the absence of
affective disorder (mental health "wellness") in these families
(Table 11). In addition, epistatic interactions between alleles
could also prevent or delay an illness such as major depressive
disorder from developing into BPAD. Indeed, as we increase the "age
of risk" cutoff for defining the "well" phenotype from 25 to 45
years in our linkage analyses, the number of mentally healthy
members decreases as expected, yet the evidence for linkage
increases (Tables 9 and 10).
10TABLE 11 SIBPAL analysis for concordant and discordant pair
Number of Pedigree 110 Pedigrees 110, 210, 310, 410 Affected Sibs
P-value P-value Marker (# pairs in 110/all) {circumflex over
(.PI.)} (s.e.) nominal simulated {circumflex over (.PI.)} (s.e.)
nominal simulated CHROMOSOME 4p D4S2949 0 (37/60) .7077(.0202)
<1 .times. 10.sup.-7 <1 .times. 10.sup.-5 .6888(.0243) <1
.times. 10.sup.-7 <1 .times. 10.sup.-5 1 (30/52) .5094(.0360)
.6018 np .4177(.0337) .0089 .0145 2 (17/20) .4183(.0608) .9021 np
.4559(.0537) .7897 np CHROMOSOME 4q D4S175 0 (35/43) .5960(.0558)
.0471 .0636 .5995(.0484) .0231 .0348 1 (27/38) .4875(.0611) .4194
np .4969(.0513) .4762 np 2 (17/19) .4733(.0528) .6901 np
.4533(.0533) .8042 np D4S397 0 (35/43) .7511(.0449) 3 .times.
10.sup.-7 .0009 .6586(.0376) 5 .times. 10.sup.-6 .0002 1 (27/38)
.4536(.0460) .1599 np .5069(.0358) .5760 np 2 (17/19) .5000(.0404)
.5000 np .5116(.0419) .3926 np D4S3334 0 (37/66) .5491(.0254) .0304
.0497 .5258(.0287) .1858 .1769 1 (30/56) .4119(.0368) .0113 .0089
.4515(.0317) .0655 np 2 (17/20) .4457(.0595) .8133 np .4556(.0564)
.7805 np {circumflex over (.PI.)} is the estimated proportion of
alleles shared identical by decent. Number of affecteds: 0 =
mentally healthy (well) sib pairs (older than age 45 years) 1 =
discordant sib pairs 2 = BPI sib pairs np: not performed
[0167] There is some debate on the analysis of sibling pairs as to
whether the use of inbred sibling pairs results in an increased
number of false-positives if allele-sharing-based statistical
methods are used (Genin, E. & Clerget-Darpoux, F. (1996) Am. J.
Hum. Genet. 59, 1149-1162). However, the arguments that a) inbred
sibling pairs are likely to share more genes than non-inbred
sibling pairs (i.e., have a kinship factor greater than 0.5) and b)
that greater regions of the genome would show significant
deviations from the expected non-inbred sibling sharing value of
0.5, are incorrect when one is merely considering an analysis of
sibling pairs involving only the transmission of alleles from
parents to offspring. The transmission of alleles from parents to
offspring will follow Mendelian ratios, and thus the null values
for 0, 1, or 2 IBD sibling allele sharing in any population will be
0.25, 0.50, and 0.25, whenever only parental and sibling genotype
information is used. However, if the origin of the parental alleles
is taken into consideration, then there will be greater information
about alleles shared by sibling pairs from inbred populations. For
example, this increased informativeness has the potential to
resolve ambiguities in the sharing of alleles transmitted from
homozygous parents, since the two copies of the allele in an inbred
homozygous parent could be IBD. This information could also help
resolve alleles shared by siblings identical in state into alleles
shared IBD, showing that alleles transmitted to two offspring from
different parents may be copies of the same allele because of the
relatedness of the parents. If genealogy is taken into account,
then the increased ability to resolve ambiguities in allele sharing
would result in greater power in the analysis of inbred sibling
pairs (Genin, E. & Clerget-Darpoux, F., supra.).
[0168] Ultimately, if inbreeding exists in a population from which
sibling pairs have been gathered, but one ignores genealogical
information by merely studying the transmission of alleles from
parents to offspring, then no increase in false-positive linkage
results will occur. This is because Mendel's law applies to inbred
as well as outbred parent-offspring allele transmission studies. On
the contrary, a decrease in power may result from inbred sibling
pair analyses because spouses may manifest greater homozygosity and
therefore provide less informative genotypes for
parent-offspring-based linkage studies.
[0169] Genetic mapping of complex disorders with multifactorial
inheritance could be especially difficult if, in addition to
susceptibility alleles, individuals inherit "protective" alleles
that prevent or reduce the risk of manifesting the disease
phenotype. Even though model-based linkage analyses that do not
allow for a multifactorial component are of only limited usefulness
in these circumstances, they are still frequently employed. In
these instances, a false negative linkage finding (type 2 error)
could result when individuals inherit disease susceptibility
alleles but do not manifest the phenotype due to the simultaneous
presence of "protective" alleles. If model-based methods are used,
it is important to provide a reasonably low estimate of penetrance
and include a multifactorial component in the model.
[0170] In the initial stages of analyzing a disorder like BPAD
which most likely displays multifactorial inheritance, robust
model-free (allele sharing) methods are usually more useful than
model-based linkage analysis (Elston, R. C. (1995) Exp. Clin.
Immunogenet. 12, 129-140). Concordant individuals should
demonstrate excess allele sharing, even with the occurrence of
phenocopies, genetic heterogeneity, high frequency of
susceptibility alleles, and incomplete penetrance. Individuals who
inherit susceptibility alleles but do not manifest disease because
of "protective" alleles, and individuals who inherit "protective"
alleles but nevertheless manifest the disease will reduce the power
of these analyses. Thus, regardless of the type of linkage analysis
performed, the presence of "protective" alleles could have a major
impact on identifying susceptibility loci.
[0171] Although the idea that "protective" alleles could modify (or
even prevent) a behavioral phenotype like BPAD is relatively novel,
there are examples where such "protective" alleles can affect the
expression or inheritance of other Mendelian and multifactorial
disorders. The severity of sickle cell anemia is influenced by
genes that increase the amount of circulating fetal hemoglobin
(Perrine et al. (1972) Lancet 2, 1163-1167). Similarly, the
genotype of the chemokine receptor CCR5 dramatically influences the
kinetics of HIV-1 infection, where most individuals who are
homozygous for a 32 bp deletion in the CCR5 gene encoding the
coreceptor for macrophage-tropic HIV-1 are "protected" from virus
infection (Picchio et al. (1997) J. Virology 71, 7124-7127). In
Alzheimer's disease, ApoE2, in contrast to ApoE4, appears to reduce
the relative risk of developing the disease and may protect
individuals who inherit a disease-associated ApoE4 allele (Corder
et al. (1994) Nat. Genet. 7: 180-183). In an extended Italian
family, apolipoprotein A-I.sub.MILANO protects against the
development of both clinical and pathologic signs of
atherosclerosis, despite significantly elevated plasma
triglycerides and a markedly decreased level of HDL-cholesterol
(Franceschini et al. (1980) J. Clin. Invest. 66, 892-900). In the
non-obese diabetic (NOD) mouse model of human autoimmune
insulin-dependent diabetes mellitus, partial protection from
disease is provided by "resistance" alleles occurring singly at
either the Idd3 or Idd10 non-MHC loci, while epistatic interactions
between "resistance" alleles at these two loci produces nearly
complete protection from diabetes (Wicker et al. (1994) J. Exp.
Med. 180, 1705-1713).
[0172] There are several mechanisms by which "wellness" or
"protective" alleles could affect the clinical manifestations of
BPAD in the Old Order Amish. One possibility is that dominant
acting "protective" alleles, either singly or acting together in
epistasis, could prevent or modify the BPAD phenotype. The variable
penetrance of illness or its heterogeneous clinical manifestations
could result from "resistance" or "protective" alleles that alone
provide only partial protection, while together with other genes
produce epistatic interactions resulting in a greater degree of
modification of the phenotype. Alternatively, there also could be
cellular target molecules, e.g. mood "effectors", having forms that
are either resistant or susceptible to the genetic and/or
environmental susceptibility factors for BPAD. Individuals having
"resistant" mood effectors would be protected from the effects of
susceptibility alleles and/or environmental factors that result in
the BPAD phenotype. In contrast, individuals with "sensitive" forms
of these mood effectors would be vulnerable to developing the BPI
phenotype when requisite BPAD susceptibility alleles and/or
environmental factors are present.
[0173] If epistatic interactions are required for manifestation of
the effects of either susceptibility or "protective" alleles, the
existence of "resistant" and "sensitive" forms of cellular
effectors or "protective" alleles would be most apparent in
families (or populations) where there is a high density of affected
individuals such as the Old Order Amish in the present study.
Regardless of the mechanism, the presence of "wellness" or
"protective" alleles can have a significant impact on linkage
analyses as evidenced by preventing the appearance of the BPAD
phenotype (or its presentation as a forme fruste) in individuals
who are otherwise genetically predisposed to developing
illness.
[0174] Accordingly, a multilocus approach that considers both
additive and subtractive influences of alleles on the BPAD
phenotype is preferred in the identification of chromosomal loci
harboring genes that contribute to the clinical manifestations of
BPAD. The involvement of "protective" or "wellness" alleles in
determining the manifestation of the BPAD phenotype provides an
attractive explanation for at least some of the difficulty
encountered in searches for BPAD susceptibility alleles. The test
statistics from our analyses for alleles linked to the absence of
psychiatric illness in the Old Order Amish are at least as
significant as those reported for any susceptibility locus. The
identification and characterization of "protective" alleles and
their gene products can lead to the development of a more rational
and direct approach to effective therapy for affective
disorders.
[0175] All publications and patents mentioned in this specification
are incorporated herein by reference into the specification to the
same extent as if each individual publication or patent was
specifically and individually indicated to be incorporated herein
by reference.
Sequence CWU 1
1
240 1 18 DNA Artificial Sequence D6S344 forward primer 1 ctccagcctg
ggtcacta 18 2 25 DNA Artificial Sequence D6S344 reverse primer 2
ctaatgcatg acaataatat ttcca 25 3 20 DNA Artificial Sequence D6S89
primer 3 acctaagcga ctgcctaaac 20 4 20 DNA Artificial Sequence
D6S89 primer 4 cttgttcatc tgccttgtgc 20 5 22 DNA Artificial
Sequence D6S89 primer 5 agtctcatgt gacacaaggc ag 22 6 22 DNA
Artificial Sequence D6S89 primer 6 tgtaacctgg aagtaaggca tg 22 7 16
DNA Artificial Sequence D13S171 primer 7 tagggccatc cattct 16 8 20
DNA Artificial Sequence D13S171 primer 8 cctaccattg acactctcag 20 9
21 DNA Artificial Sequence 7F12-Ia primer 9 tgtaactatt gggaggaaag a
21 10 21 DNA Artificial Sequence 7F12-IIa primer 10 ttgtgtagga
ctctctagtt t 21 11 20 DNA Artificial Sequence D13S218 primer 11
gatttgaaaa tgagcagtcc 20 12 20 DNA Artificial Sequence D13S218
primer 12 gtcgggcact acgtttatct 20 13 20 DNA Artificial Sequence
D15S117 primer 13 gcaccaacaa cttatcccaa 20 14 20 DNA Artificial
Sequence D15S117 primer 14 ccctaagggg tctctgaaga 20 15 18 DNA
Artificial Sequence D6S1600 forward primer 15 agcttgtgca tgtgtgca
18 16 18 DNA Artificial Sequence D6S1600 reverse primer 16
caaagtccca gcaggttc 18 17 18 DNA Artificial Sequence D15S123 primer
17 agctgaaccc aatggact 18 18 18 DNA Artificial Sequence D15S123
primer 18 tttcatgcca ccaacaaa 18 19 25 DNA Artificial Sequence
D15S982 primer 19 atgtttaaat taataacgtg acagt 25 20 20 DNA
Artificial Sequence D15S982 primer 20 gacttcatct ggattcacaa 20 21
25 DNA Artificial Sequence D15S119 primer 21 aacagaaaat ccgtaacata
acata 25 22 22 DNA Artificial Sequence D15S119 primer 22 acttttgtgc
catttagaga tt 22 23 22 DNA Artificial Sequence D15S1032 primer 23
agctttaact tccatgagtt tc 22 24 21 DNA Artificial Sequence D15S1032
primer 24 ctaatctctg gtgcatagtg a 21 25 24 DNA Artificial Sequence
D15S208 primer 25 tcttagcagt aattgtcact cctt 24 26 20 DNA
Artificial Sequence D15S208 primer 26 acataccatc ccatggttat 20 27
22 DNA Artificial Sequence D15S161 primer 27 tctgtgattt tgccattatg
ag 22 28 25 DNA Artificial Sequence D15S161 primer 28 taaactggaa
tttttgacta tgagc 25 29 20 DNA Artificial Sequence D15S143 primer 29
ctaaggaggc aacagcaaag 20 30 25 DNA Artificial Sequence D15S143
primer 30 atgtaaagac tggtatctgt agcac 25 31 25 DNA Artificial
Sequence D15S1017 primer 31 tcaagtaagg cnattattat acaga 25 32 20
DNA Artificial Sequence D15S1017 primer 32 ccacaagctg gactgagaat 20
33 20 DNA Artificial Sequence D15S990 primer 33 ctgaacaggt
tgaagtgtcc 20 34 18 DNA Artificial Sequence D15S990 primer 34
cttggaatgc ctgaggac 18 35 20 DNA Artificial Sequence D15S1024
primer 35 ctaagtcctc cacactagcc 20 36 18 DNA Artificial Sequence
D15S1024 primer 36 ctaaaatggg aacagggc 18 37 18 DNA Artificial
Sequence D15S1039 primer 37 tgccggtagt aacatctg 18 38 22 DNA
Artificial Sequence D15S1039 primer 38 ccaaggataa agtatttgtg tc 22
39 24 DNA Artificial Sequence D15S992 primer 39 agctgagaaa
tgccttctat aaat 24 40 18 DNA Artificial Sequence D15S992 primer 40
gagggccacc ttgatagt 18 41 23 DNA Artificial Sequence D15S978 primer
41 agcttcatac actgaaattg ttg 23 42 17 DNA Artificial Sequence
D15S978 primer 42 caccgggaaa ccttgat 17 43 20 DNA Artificial
Sequence D15S126 primer 43 gtgagccaag atggcactac 20 44 20 DNA
Artificial Sequence D15S126 primer 44 gccagcaata atgggaagtt 20 45
22 DNA Artificial Sequence D15S1003 primer 45 tggtagtacc cctggatacc
tg 22 46 24 DNA Artificial Sequence D15S1003 primer 46 aatctttgtg
gatatggctc tgct 24 47 20 DNA Artificial Sequence D15S121 primer 47
ttgtatcagg gatttggtta 20 48 20 DNA Artificial Sequence D15S121
primer 48 tgttgtcgct tcagtacata 20 49 18 DNA Artificial Sequence
D15S1016 primer 49 gatccgtcac ataatggc 18 50 18 DNA Artificial
Sequence D15S1016 primer 50 acacctcagc tttcctgg 18 51 20 DNA
Artificial Sequence D15S209 primer 51 aaacatagtg ctctggaggc 20 52
20 DNA Artificial Sequence D15S209 primer 52 gggctaacaa cagtgtctgc
20 53 20 DNA Artificial Sequence D15S1049 primer 53 cactccagcc
taaggaacac 20 54 23 DNA Artificial Sequence D15S1049 primer 54
tgtcaaagat ggcttttatt acc 23 55 25 DNA Artificial Sequence D15S1029
primer 55 aagagtaaaa ctccgtcaca aacac 25 56 24 DNA Artificial
Sequence D15S1029 primer 56 agatttgagt ctctgcacag taag 24 57 17 DNA
Artificial Sequence D15S962 primer 57 aattctgctc attgggg 17 58 20
DNA Artificial Sequence D15S962 primer 58 ggatattttg gaactgcact 20
59 24 DNA Artificial Sequence D15S998 primer 59 aagcatcaaa
gtgtaactca gacc 24 60 20 DNA Artificial Sequence D15S998 primer 60
ttggagcctg tgtatgtgtg 20 61 17 DNA Artificial Sequence D15S1008
primer 61 ggtgctgcct cctaaca 17 62 17 DNA Artificial Sequence
D15S1008 primer 62 cgagcccttc tgaaaca 17 63 20 DNA Artificial
Sequence D15S150 primer 63 ctgtatggcc tcagtctcgg 20 64 20 DNA
Artificial Sequence D15S150 primer 64 agctctgtgc ggaagtccct 20 65
19 DNA Artificial Sequence D4S431 and D4S2366 forward primer 65
aggcatacta ggccgtatt 19 66 17 DNA Artificial Sequence D4S431 and
D4S2366 reverse primer 66 ttcccatcag cgtcttc 17 67 20 DNA
Artificial Sequence D4S2935 forward primer 67 gctcacagaa gtgcccaata
20 68 21 DNA Artificial Sequence D4S2935 reverse primer 68
ccctgggtga agtttaatct c 21 69 23 DNA Artificial Sequence D4S3007
forward primer 69 atttttgcta cattggtgac ata 23 70 23 DNA Artificial
Sequence D4S3007 reverse primer 70 cttcaggttc tactagttca tgg 23 71
20 DNA Artificial Sequence D4S394 forward primer 71 cccttgagca
tcctgacttc 20 72 20 DNA Artificial Sequence D4S394 reverse primer
72 gagtgagccc ctgtactcca 20 73 20 DNA Artificial Sequence D4S1582
forward primer 73 atcagggttc tccacacaaa 20 74 24 DNA Artificial
Sequence D4S1582 reverse primer 74 ttggttgaaa cttgtggata taaa 24 75
25 DNA Artificial Sequence D4S1605 forward primer 75 cattctagta
gttattggct tatcc 25 76 25 DNA Artificial Sequence D4S1605 reverse
primer 76 cagttgcttg atacctatat ttttc 25 77 18 DNA Artificial
Sequence D4S2949 forward primer 77 ccttacggat aggggcag 18 78 20 DNA
Artificial Sequence D4S2949 reverse primer 78 ctaatgtcca ggtctacggc
20 79 20 DNA Artificial Sequence D4S403 forward primer 79
aggtggccct gagtaggagt 20 80 20 DNA Artificial Sequence D4S403
reverse primer 80 tttgagggaa tgatttgggt 20 81 22 DNA Artificial
Sequence D4S2423 forward primer 81 aatgcttatc taccaatgag tg 22 82
21 DNA Artificial Sequence D4S2423 reverse primer 82 gtggctgggt
agtattcatg g 21 83 18 DNA Artificial Sequence D4S422 forward primer
83 ggcaagantc cgtctcaa 18 84 23 DNA Artificial Sequence D4S422
reverse primer 84 tgaagtaaaa tttgggagat tgt 23 85 20 DNA Artificial
Sequence D4S397 forward primer 85 agggaggtca tcagttcatt 20 86 20
DNA Artificial Sequence D4S397 reverse primer 86 tgttgcaaac
tttgcttttc 20 87 18 DNA Artificial Sequence D4S420 forward primer
87 ttctttgatt cttcgggg 18 88 20 DNA Artificial Sequence D4S420
reverse primer 88 tttctcagca acattcctct 20 89 20 DNA Artificial
Sequence D4S1644 forward primer 89 taacattgac cgctcctctc 20 90 20
DNA Artificial Sequence D4S1644 reverse primer 90 catccttcct
ggtccctagt 20 91 20 DNA Artificial Sequence UT2147 forward primer
91 taaaacttct gaatgaaaag 20 92 18 DNA Artificial Sequence UT2147
reverse primer 92 gtagggagga atagttag 18 93 20 DNA Artificial
Sequence D4S1565 forward primer 93 tgcaaactgt cactcaaaag 20 94 16
DNA Artificial Sequence D4S1565 reverse primer 94 gccaaggctg atcctc
16 95 22 DNA Artificial Sequence D4S424 forward primer 95
gcgctcttgg tatatggtac ag 22 96 17 DNA Artificial Sequence D4S424
reverse primer 96 tgtgggcaac gtcactc 17 97 20 DNA Artificial
Sequence D4S1625 forward primer 97 gactccaaat cacatgagcc 20 98 20
DNA Artificial Sequence D4S1625 reverse primer 98 gtctctgcat
ttgctggttt 20 99 23 DNA Artificial Sequence GATA145E01 forward
primer 99 ctcaagagaa atagaaccaa taa 23 100 20 DNA Artificial
Sequence GATA145E01 reverse primer 100 taagacggaa accaaatgga 20 101
20 DNA Artificial Sequence D4S432 forward primer 101 actctgaagg
ctgagatggg 20 102 17 DNA Artificial Sequence D4S432 reverse primer
102 ctgaaccgca gatcccc 17 103 20 DNA Artificial Sequence D4S2925
forward primer 103 tcagaaaccc ctacaggaaa 20 104 20 DNA Artificial
Sequence D4S2925 reverse primer 104 tttgatgagt tattcggagg 20 105 21
DNA Artificial Sequence D4S3023 forward primer 105 acctcactgg
aaactaaatg g 21 106 16 DNA Artificial Sequence D4S3023 reverse
primer 106 tgaacagcag cggtct 16 107 17 DNA Artificial Sequence
D4S2923 forward primer 107 gggcatcatg tctgcaa 17 108 18 DNA
Artificial Sequence D4S2923 reverse primer 108 aggttccctg aatgttcg
18 109 16 DNA Artificial Sequence D4S2983 forward primer 109
tgtccagttg gcaggg 16 110 16 DNA Artificial Sequence D4S2983 reverse
primer 110 ggtcgcattc attcgc 16 111 19 DNA Artificial Sequence
D4S3009 forward primer 111 atggcctgtg aatcaaccc 19 112 19 DNA
Artificial Sequence D4S3009 reverse primer 112 aatcctttga agacggccc
19 113 19 DNA Artificial Sequence D4S2928 forward primer 113
atagacgtgt tcctggtgg 19 114 20 DNA Artificial Sequence D4S2928
reverse primer 114 ctcaggctat ttatggggtg 20 115 25 DNA Artificial
Sequence D4S1599 forward primer 115 ccttaaaagt atccagtaaa gcaca 25
116 20 DNA Artificial Sequence D4S1599 reverse primer 116
caaggttgtc ctgtgtctgc 20 117 25 DNA Artificial Sequence D4S2906
forward primer 117 cagtctagat tcaaaggaat tagac 25 118 20 DNA
Artificial Sequence D4S2906 reverse primer 118 aattagagat
gcccgtgaaa 20 119 17 DNA Artificial Sequence D4S3036 forward primer
119 agcttcttgc tgtgtcc 17 120 16 DNA Artificial Sequence D4S3036
reverse primer 120 aagggtgggg ctctat 16 121 18 DNA Artificial
Sequence D4S2944 forward primer 121 agattctggc ctccttgc 18 122 17
DNA Artificial Sequence D4S2944 reverse primer 122 cctggtgaag
tggtggg 17 123 19 DNA Artificial Sequence D4S2942 forward primer
123 caaatgccca tcaatcaac 19 124 18 DNA Artificial Sequence D4S2942
reverse primer 124 gggtccagtc tcatccac 18 125 19 DNA Artificial
Sequence D4S1602 forward primer 125 ccagatgggt tccaaatga 19 126 22
DNA Artificial Sequence D4S1602 reverse primer 126 tgtggactga
gtagagagtg cc 22 127 18 DNA Artificial Sequence D4S2984 forward
primer 127 ccccaaagga atcagatg 18 128 22 DNA Artificial Sequence
D4S2984 reverse primer 128 gatcttgaaa ttttcccatt tt 22 129 16 DNA
Artificial Sequence D4S1564 forward primer 129 agcccaggag gtgaag 16
130 22 DNA Artificial Sequence D4S1564 reverse primer 130
gagatttcta ggaaacattg ag 22 131 24 DNA Artificial Sequence D4S1611
forward primer 131 agagtagttt ccatctttgt tttc 24 132 16 DNA
Artificial Sequence D4S1611 reverse primer 132 gggcaaggct catcac 16
133 23 DNA Artificial Sequence D4S1573 forward primer 133
acatggagaa tcttttagta gca 23 134 22 DNA Artificial Sequence D4S1573
reverse primer 134 cttttgagat acccctatca gt 22 135 16 DNA
Artificial Sequence D4S427 forward primer 135 ggacctcctt gcttcg 16
136 17 DNA Artificial Sequence D4S427 reverse primer 136 ccccttaggt
tgcttgt 17 137 21 DNA Artificial Sequence GATA30B11 forward primer
137 tttagttgaa tggctgagtg g 21 138 20 DNA Artificial Sequence
GATA30B11 reverse primer 138 tgagccaatt cccctaataa 20 139 21 DNA
Artificial Sequence UT7161 forward primer 139 ccacaaagac agaatcaata
g 21 140 20 DNA Artificial Sequence UT161 reverse primer 140
tctcaacctc cataactgtg 20 141 20 DNA Artificial Sequence ATA26F08
forward primer 141 tttgatttcc tgcagttggt 20 142 20 DNA Artificial
Sequence ATA26F08 reverse primer 142 tcaacacaaa accaatgtgg
20 143 23 DNA Artificial Sequence D4S2985 forward primer 143
ttacactgaa gaatgtgaga gcc 23 144 20 DNA Artificial Sequence D4S2985
reverse primer 144 ggccttggaa ctactgatgg 20 145 20 DNA Artificial
Sequence D4S1615 forward primer 145 ccttgggtca gccacatatc 20 146 22
DNA Artificial Sequence D4S1615 reverse primer 146 cactcagaac
agaaacttgg gt 22 147 20 DNA Artificial Sequence ATA26B08 forward
primer 147 actggtatgt cctaaccccc 20 148 20 DNA Artificial Sequence
ATA26B08 reverse primer 148 gatctgcagt tggattctgg 20 149 19 DNA
Artificial Sequence UT6123 forward primer 149 gctgcacctt agactagat
19 150 19 DNA Artificial Sequence UT6123 reverse primer 150
ttagtagctt ctcagcagc 19 151 21 DNA Artificial Sequence UT723
forward primer 151 cagacataaa tgaaagaaaa g 21 152 22 DNA Artificial
Sequence UT723 reverse primer 152 ggcagcaaac tatggtatgt aa 22 153
20 DNA Artificial Sequence UT1376 forward primer 153 aagttaatcc
atgtgccgtg 20 154 21 DNA Artificial Sequence UT1376 reverse primer
154 cttctttctc ttttttccct g 21 155 16 DNA Artificial Sequence
D4S429 forward primer 155 ggtgatccac ctgcct 16 156 18 DNA
Artificial Sequence D4S429 reverse primer 156 aagccactga ccttcact
18 157 25 DNA Artificial Sequence D4S3039 forward primer 157
gacagcctat tgtagtaact tgtgg 25 158 20 DNA Artificial Sequence
D4S3039 reverse primer 158 tagtcagggt gctctagggg 20 159 24 DNA
Artificial Sequence D4S1575 forward primer 159 atgggtactt
tttgaatcac atcc 24 160 19 DNA Artificial Sequence D4S1575 reverse
primer 160 acactccagc ctgggtgac 19 161 21 DNA Artificial Sequence
D4S2959 forward primer 161 agcttccatg gtcattagag t 21 162 22 DNA
Artificial Sequence D4S2959 reverse primer 162 taagggtcct
ccaaagaaca ga 22 163 23 DNA Artificial Sequence D4S1576 forward
primer 163 attgtncata tatcatcacc tgg 23 164 23 DNA Artificial
Sequence D4S1576 reverse primer 164 acagcataaa ctaaaatttg ggg 23
165 18 DNA Artificial Sequence D4S2972 forward primer 165
agctactcag gnaggctg 18 166 25 DNA Artificial Sequence D4S2972
reverse primer 166 tttttaatat ccaacctcac ttgtg 25 167 16 DNA
Artificial Sequence D4S1579 forward primer 167 cccccacctt cctgac 16
168 16 DNA Artificial Sequence D4S1579 reverse primer 168
ctggagcatc cgtgtg 16 169 19 DNA Artificial Sequence UT1264 forward
primer 169 tcgatctgca gttgcccta 19 170 20 DNA Artificial Sequence
UT1264 reverse primer 170 tgtacccatt aagcagcctg 20 171 18 DNA
Artificial Sequence D4S2939 forward primer 171 tttcccacct ggccttat
18 172 20 DNA Artificial Sequence D4S2939 reverse primer 172
ctcttgaagc cctgaagttt 20 173 23 DNA Artificial Sequence D4S2965
forward primer 173 tttacagttt tcaaaatggg ttc 23 174 19 DNA
Artificial Sequence D4S2965 reverse primer 174 ggttcttgac cctagctcc
19 175 18 DNA Artificial Sequence GATA135E06 forward primer 175
ggccaacaga gcaggatc 18 176 20 DNA Artificial Sequence GATA135E06
reverse primer 176 gccaagagag tgagactcca 20 177 25 DNA Artificial
Sequence D4S2981 forward primer 177 ggttatttaa ttttagtaac gcatc 25
178 19 DNA Artificial Sequence D4S2981 reverse primer 178
gaacagaagt gctggagac 19 179 16 DNA Artificial Sequence D4S1604
forward primer 179 tcgtgcccag ccaagt 16 180 20 DNA Artificial
Sequence D4S1604 reverse primer 180 ttgctcacag gattgcttct 20 181 25
DNA Artificial Sequence D4S1561 forward primer 181 attttcatgc
attcgttaga atttt 25 182 20 DNA Artificial Sequence D4S1561 reverse
primer 182 tctaggtgat ggtgatgctg 20 183 18 DNA Artificial Sequence
D4S1586 forward primer 183 gcatgtacca ttgccagg 18 184 19 DNA
Artificial Sequence D4S1586 reverse primer 184 cccagagtgc tgatgtgtg
19 185 17 DNA Artificial Sequence D4S1549 forward primer 185
aaagttccaa tctcccc 17 186 19 DNA Artificial Sequence D4S1549
reverse primer 186 tcttatgctg caatcactg 19 187 20 DNA Artificial
Sequence D4S1548 forward primer 187 tgccataaac aaggtgaaac 20 188 20
DNA Artificial Sequence D4S1548 reverse primer 188 ttacccaact
gctacaccat 20 189 23 DNA Artificial Sequence GATA72A08 forward
primer 189 ttcaatactc ctgtatcaca aag 23 190 22 DNA Artificial
Sequence GATA72A08 reverse primer 190 tgagacacaa tctgagctat gc 22
191 20 DNA Artificial Sequence GATA8A05 forward primer 191
tggttctgct ttttctctcc 20 192 24 DNA Artificial Sequence GATA8A05
reverse primer 192 tttaacagac aaatgacaaa tctg 24 193 25 DNA
Artificial Sequence D6S1713 forward primer 193 aatcactgtt
acccataggg ttatc 25 194 18 DNA Artificial Sequence D6S1713 reverse
primer 194 aggccaagac ctctgtgc 18 195 20 DNA Artificial Sequence
D6S1617 forward primer 195 tgcaaaacag gcacacatac 20 196 25 DNA
Artificial Sequence D6S1617 reverse primer 196 ttaatcaatt
ttctgcaaag ataaa 25 197 20 DNA Artificial Sequence D6S1668 forward
primer 197 gtatagccaa ctgcttccaa 20 198 20 DNA Artificial Sequence
D6S1668 reverse primer 198 gggtnccatt tattgagatt 20 199 18 DNA
Artificial Sequence D6S1591 forward primer 199 tgtttcagca gcataggg
18 200 20 DNA Artificial Sequence D6S1591 reverse primer 200
agagcctgtt tggtgtcatc 20 201 16 DNA Artificial Sequence D6S1677
forward primer 201 gtttccaagg gctggg 16 202 24 DNA Artificial
Sequence D6S1677 reverse primer 202 gaaatcaaaa taacacatcc tctg 24
203 20 DNA Artificial Sequence D6S1685 forward primer 203
tacactaatg gctctcctgg 20 204 20 DNA Artificial Sequence D6S1685
reverse primer 204 gccagatttc tctgctgtag 20 205 19 DNA Artificial
Sequence D6S1574 forward primer 205 aagaacttcc caaaccaat 19 206 18
DNA Artificial Sequence D6S1574 reverse primer 206 aaccatccag
gacatcaa 18 207 17 DNA Artificial Sequence D6S1598 forward primer
207 tcaaggcttt ctgaggc 17 208 20 DNA Artificial Sequence D6S1598
reverse primer 208 agcatggatt ctgttgtttg 20 209 18 DNA Artificial
Sequence D6S1640 forward primer 209 agccaggcat gctaacat 18 210 19
DNA Artificial Sequence D6S1640 reverse primer 210 ggattacagg
cacccagta 19 211 21 DNA Artificial Sequence D6S1547 forward primer
211 ccttgagcac cttaaatttt t 21 212 22 DNA Artificial Sequence
D6S1547 reverse primer 212 taactgacaa agcagaatag ca 22 213 24 DNA
Artificial Sequence D6S1674 forward primer 213 ccttaaacaa
acaataagac cacc 24 214 20 DNA Artificial Sequence D6S1674 reverse
primer 214 cagcctagaa aacagagcca 20 215 20 DNA Artificial Sequence
GATA161F06 primer 215 gaggttgctt gaaatccatg 20 216 22 DNA
Artificial Sequence GATA161F06 primer 216 gaatctcatc taccctgttt gg
22 217 23 DNA Artificial Sequence GATA21F07 primer 217 atactccgag
ctatctgtct acc 23 218 20 DNA Artificial Sequence GATA21F07 primer
218 ggtgcagatc atgacctctc 20 219 20 DNA Artificial Sequence
GATA51B02 primer 219 catggatgca gaattcacag 20 220 20 DNA Artificial
Sequence GATA51B02 primer 220 tcatctccct gtttggtagc 20 221 20 DNA
Artificial Sequence GATA53C06 primer 221 ggtttgctgg catctgtatt 20
222 20 DNA Artificial Sequence GATA53C06 primer 222 tgtctggagg
cttttcagtc 20 223 20 DNA Artificial Sequence GGAA29H03 primer 223
acctgttgta tggcagcagt 20 224 20 DNA Artificial Sequence GGAA29H03
primer 224 ggttgactct ttccccaact 20 225 20 DNA Artificial Sequence
GGAT12E07 primer 225 gtctgtccat ccattcatcc 20 226 20 DNA Artificial
Sequence GGAT12E07 primer 226 cctcttctcc atgaggacct 20 227 22 DNA
Artificial Sequence UT1213 primer 227 acttaaatgt ccatcaataa at 22
228 21 DNA Artificial Sequence UT1213 primer 228 tgattggctt
tttttactta c 21 229 19 DNA Artificial Sequence UT1585 primer 229
tgaactccgg cctgggtga 19 230 19 DNA Artificial Sequence UT1585
primer 230 ttttggagct ggggatgtc 19 231 19 DNA Artificial Sequence
UT1508 primer 231 cctcagtttt ctctcctgc 19 232 20 DNA Artificial
Sequence UT1508 primer 232 tgctgctata tgctttgcag 20 233 19 DNA
Artificial Sequence UT2021 primer 233 tgggtgacag agctagtcc 19 234
18 DNA Artificial Sequence UT2021 primer 234 gaaccagcct cgcatacc 18
235 20 DNA Artificial Sequence UT7738 primer 235 ttgcagtgag
aagagattgt 20 236 20 DNA Artificial Sequence UT7738 primer 236
gcacaagaat cagataagga 20 237 20 DNA Artificial Sequence UT7739
primer 237 accctgtact tgtcaaggtt 20 238 20 DNA Artificial Sequence
UT7739 primer 238 aatcatgtga accagtttcc 20 239 19 DNA Artificial
Sequence UT7953 primer 239 tggtgggtct gcgtgtgtg 19 240 19 DNA
Artificial Sequence UT7953 primer 240 ggtgctggga ttcggtgca 19
* * * * *