U.S. patent application number 10/485113 was filed with the patent office on 2004-12-02 for antisense modulation of apolipoprotein(a) expression.
Invention is credited to Crooke, Rosanne M, Graham, Mark J.
Application Number | 20040242516 10/485113 |
Document ID | / |
Family ID | 25448810 |
Filed Date | 2004-12-02 |
United States Patent
Application |
20040242516 |
Kind Code |
A1 |
Crooke, Rosanne M ; et
al. |
December 2, 2004 |
Antisense modulation of apolipoprotein(a) expression
Abstract
Antisense compounds, compositions and methods are provided for
modulating the expression of apolipoprotein(a). The compositions
comprise antisense compounds, particularly antisense
oligonucleotides, targeted to nucleic acids encoding
apolipoprotein(a). Methods of using these compounds for modulation
of apolipoprotein(a) expression and for treatment of diseases
associated with expression of apolipoprotein(a) are provided.
Inventors: |
Crooke, Rosanne M;
(Carlsbad, CA) ; Graham, Mark J; (San Clemente,
CA) |
Correspondence
Address: |
Mary E Bak
Howson and Howson
Spring House Corporate Center
Box 457
Spring House
PA
19477
US
|
Family ID: |
25448810 |
Appl. No.: |
10/485113 |
Filed: |
May 21, 2004 |
PCT Filed: |
August 5, 2002 |
PCT NO: |
PCT/US02/24920 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10485113 |
May 21, 2004 |
|
|
|
09923515 |
Aug 7, 2001 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/23.5 |
Current CPC
Class: |
A61K 38/00 20130101;
C12N 2310/3341 20130101; C12N 2310/315 20130101; A61P 3/06
20180101; A61P 9/10 20180101; A61P 9/00 20180101; Y02P 20/582
20151101; C12N 2310/341 20130101; C12N 2310/3525 20130101; C12N
2310/321 20130101; C12N 15/113 20130101; C12N 2310/321 20130101;
C12N 2310/346 20130101 |
Class at
Publication: |
514/044 ;
536/023.5 |
International
Class: |
A61K 048/00; C07H
021/04 |
Claims
1. A compound 8 to 50 nucleobases in length targeted to a nucleic
acid molecule encoding human apolipoprotein(a), wherein said
compound specifically hybridizes with a nucleic acid molecule
encoding human apolipoprotein(a) and inhibits the expression of
human apolipoprotein(a).
2. The compound of claim 1 which is an antisense
oligonucleotide.
3. (Canceled).
4. The compound of claim 2 wherein the antisense oligonucleotide
comprises at least one modified internucleoside linkage.
5. The compound of claim 4 wherein the modified internucleoside
linkage is a phosphorothioate linkage.
6. The compound of claim 2 wherein the antisense oligonucleotide
comprises at least one modified sugar moiety.
7. The compound of claim 6 wherein the modified sugar moiety is a
2'-O-methoxyethyl sugar moiety.
8. The compound of claim 2 wherein the antisense oligonucleotide
comprises at least one modified nucleobase.
9. The compound of claim 8 wherein the modified nucleobase is a
5-methylcytosine.
10. The compound of claim 2 wherein the antisense oligonucleotide
is a chimeric oligonucleotide.
11. A compound 8 to 50 nucleobases in length which specifically
hybridizes with at least an 8-nucleobase portion of an active site
on a nucleic acid molecule encoding human apolipoprotein(a).
12. A composition comprising the compound of claim 1 and a
pharmaceutically acceptable carrier or diluent.
13. The composition of claim 12 further comprising a colloidal
dispersion system.
14. The composition of claim 12 wherein the compound is an
antisense oligonucleotide.
15. A method of inhibiting the expression of human
apolipoprotein(a) in cells or tissues comprising contacting said
cells or tissues with the compound of claim 1 so that expression of
human apolipoprotein(a) is inhibited.
16. A method of treating a human having a disease or condition
associated with human apolipoprotein(a) comprising administering to
said human a therapeutically or prophylactically effective amount
of the compound of claim 1 so that expression of human
apolipoprotein(a) is inhibited.
17. The method of claim 16 wherein the condition involves abnormal
lipid metabolism.
18. The method of claim 16 wherein the condition involves abnormal
cholesterol metabolism.
19. The method of claim 16 wherein the condition is
atherosclerosis.
20. The method of claim 16 wherein the disease is cardiovascular
disease.
Description
FIELD OF THE INVENTION
[0001] The present invention provides compositions and methods for
modulating the expression of apolipoprotein(a). In particular, this
invention relates to compounds, particularly oligonucleotides,
specifically hybridizable with nucleic acids encoding
apolipoprotein(a). Such compounds have been shown to modulate the
expression of apolipoprotein(a).
BACKGROUND OF THE INVENTION
[0002] Lipoproteins are globular, micelle-like particles that
consist of a non-polar core of acylglycerols and cholesteryl
esters, surrounded by an amphiphilic coating consisting of protein,
phospholipid and cholesterol. Lipoproteins have been classified
into five broad categories on the basis of their functional and
physical properties: chylomicrons (which transport dietary lipids
from intestine to tissues), very low density lipoproteins (VLDL),
intermediate density lipoproteins (IDL), low density lipoproteins
(LDL), (all of which transport triacylglycerols and cholesterol
from the liver to tissues), and high density lipoproteins (HDL)
(which transport endogenous cholesterol from tissues to the
liver).
[0003] Lipoprotein particles undergo continuous metabolic
processing and have variable properties and compositions.
Lipoprotein densities increase without decreasing particle diameter
because the density of their outer coatings is less than that of
the inner core. The protein components of lipoproteins are known as
apolipoproteins. At least nine apolipoproteins are distributed in
significant amounts among the various human lipoproteins.
[0004] Lipoprotein(a) (also known as Lp(a)) is a cholesterol rich
particle of the pro-atherogenic LDL class. Because Lp(a) is found
only in Old World primates and European hedgehogs, it has been
suggested that it does not play an essential role in lipid and
lipoprotein metabolism. Most studies have shown that high
concentrations of Lp(a) are strongly associated with increased risk
of cardiovascular disease (Rainwater and Kammerer, J. Exp. Zool.,
1998, 282, 54-61). These observations have stimulated numerous
studies in humans and other primates to investigate the factors
that control Lp(a) concentrations and physiological properties
(Rainwater and Kammerer, J. Exp. Zool., 1998, 282, 54-61).
[0005] Lp(a) contains two disulfide-linked distinct proteins,
apolipoprotein(a) (or ApoA) and apolipoprotein B (or ApoB)
(Rainwater and Kammerer, J. Exp. Zool., 1998, 282, 54-61).
Apolipoprotein(a) is a unique apolipoprotein encoded by the LPA
gene which has been shown to exclusively control the physiological
concentrations of Lp(a) (Rainwater and Kammerer, J. Exp. Zool.,
1998, 282, 54-61). It varies in size due to interallelic
differences in the number of tandemly repeated Kringle 4-encoding
5.5 kb sequences in the LPA gene (Rainwater and Kammerer, J. Exp.
Zool., 1998, 282, 54-61).
[0006] Cloning of human apolipoprotein(a) in 1987 revealed homology
to human plasminogen (McLean et al., Nature, 1987, 330, 132-137).
The gene locus LPA encoding apolipoprotein(a) was localized to
chromosome 6q26-27, in close proximity to the homologous gene for
plasminogen (Frank et al., Hum. Genet., 1988, 79, 352-356).
[0007] Transgenic mice expressing human apolipoprotein(a) were
found to be more susceptible than control mice to the development
of lipid-staining lesions in the aorta and, consequently,
apolipoprotein(a) is co-localized with lipid deposition in the
artery walls (Lawn et al., Nature, 1992, 360, 670-672). As an
extension of these studies, it was established that the major in
vivo action of apolipoprotein(a) is inhibition of the conversion of
plasminogen to plasmin which causes decreased activation of latent
transforming growth factor-beta. Because transforming growth
factor-beta is a negative regulator of smooth muscle cell migration
and proliferation, inhibition of plasminogen activation indicates a
possible mechanism for apolipoprotein(a) induction of
atherosclerotic lesions (Grainger et al., Nature, 1994, 370,
460-462).
[0008] Elevated plasma levels of Lp(a), caused by increased
expression of apolipoprotein(a), are associated with increased risk
for atherosclerosis and its manifestations, which include
hypercholesterolemia (Seed et al., N. Engl. J. Med. 1990, 322,
1494-1499), myocardial infarction (Sandkamp et al., Clin. Chem.,
1990, 36, 20-23), and thrombosis (Nowak-Gottl et al., Pediatrics,
1997, 99, Ell).
[0009] Moreover, the plasma concentration of Lp(a) is strongly
influenced by heritable factors and is refractory to most drug and
dietary manipulation (Katan and Beynen, Am. J. Epidemiol., 1987,
125, 387-399; Vessby et al., Atherosclerosis, 1982, 44, 61-71).
Pharmacologic therapy of elevated Lp(a) levels has been only
modestly successful and apheresis remains the most effective
therapeutic modality (Hajjar and Nachman, Annu. Rev. Med., 1996,
47, 423-442).
[0010] Morishita et al. have reported the use of ribozyme
oligonucleotides against apolipoprotein(a) for inhibition of
apolipoprotein(a) expression in HepG2 cells (Morishita et al.,
Circulation, 1998, 98, 1898-1904).
[0011] Disclosed and claimed in U.S. Pat. No. 5,721,138 are
nucleotide sequences encoding the human apolipoprotein(a) gene
5'-regulatory region and isolated nucleotide sequences comprising
at least thirty consecutive complementary nucleotides from human
apolipoprotein(a) from nucleotide position -208 to -1448 (Lawn,
1998).
[0012] To date, investigative and therapeutic strategies aimed at
inhibiting apolipoprotein(a) function have involved the previously
cited use of Lp(a) apheresis and ribozyme oligonucleotides.
Consequently, there remains a long-felt need for additional agents
capable of effectively inhibiting apolipoprotein(a) function.
[0013] Antisense technology is emerging as an effective means of
reducing the expression of specific gene products and may therefore
prove to be uniquely useful in a number of therapeutic, diagnostic
and research applications involving modulation of
apolipoprotein(a)expression.
[0014] The present invention provides compositions and methods for
modulating apolipoprotein(a) expression.
SUMMARY OF THE INVENTION
[0015] The present invention is directed to compounds, particularly
antisense oligonucleotides, which are targeted to a nucleic acid
encoding apolipoprotein(a), and which modulate the expression of
apolipoprotein(a). Pharmaceutical and other compositions comprising
the compounds of the invention are also provided. Further provided
are methods of modulating the expression of apolipoprotein(a) in
cells or tissues comprising contacting said cells or tissues with
one or more of the antisense compounds or compositions of the
invention. Further provided are methods of treating an animal,
particularly a human, suspected of having or being prone to a
disease or condition associated with expression of
apolipoprotein(a), by administering a therapeutically or
prophylactically effective amount of one or more of the antisense
compounds or compositions of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0016] The present invention employs oligomeric compounds,
particularly antisense oligonucleotides, for use in modulating the
function of nucleic acid molecules encoding apolipoprotein(a),
ultimately modulating the amount of apolipoprotein(a) produced.
This is accomplished by providing antisense compounds which
specifically hybridize with one or more nucleic acids encoding
apolipoprotein(a). As used herein, the terms "target nucleic acid"
and "nucleic acid encoding apolipoprotein(a)" encompass DNA
encoding apolipoprotein(a), RNA (including pre-mRNA and mRNA)
transcribed from such DNA, and also cDNA derived from such RNA. The
specific hybridization of an oligomeric compound with its target
nucleic acid interferes with the normal function of the nucleic
acid. This modulation of function of a target nucleic acid by
compounds which specifically hybridize to it is generally referred
to as "antisense". The functions of DNA to be interfered with
include replication and transcription. The functions of RNA to be
interfered with include all vital functions such as, for example,
translocation of the RNA to the site of protein translation,
translation of protein from the RNA, splicing of the RNA to yield
one or more mRNA species, and catalytic activity which may be
engaged in or facilitated by the RNA. The overall effect of such
interference with target nucleic acid function is modulation of the
expression of apolipoprotein(a). In the context of the present
invention, "modulation" means either an increase (stimulation) or a
decrease (inhibition) in the expression of a gene. In the context
of the present invention, inhibition is the preferred form of
modulation of gene expression and mRNA is a preferred target.
[0017] It is preferred to target specific nucleic acids for
antisense. "Targeting" an antisense compound to a particular
nucleic acid, in the context of this invention, is a multi step
process. The process usually begins with the identification of a
nucleic acid sequence whose function is to be modulated. This may
be, for example, a cellular gene (or mRNA transcribed from the
gene) whose expression is associated with a particular disorder or
disease state, or a nucleic acid molecule from an infectious agent.
In the present invention, the target is a nucleic acid molecule
encoding apolipoprotein(a). The targeting process also includes
determination of a site or sites within this gene for the antisense
interaction to occur such that the desired effect, e.g., detection
or modulation of expression of the protein, will result. Within the
context of the present invention, a preferred intragenic site is
the region encompassing the translation initiation or termination
codon of the open reading frame (ORF) of the gene. Since, as is
known in the art, the translation initiation codon is typically
5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding
DNA molecule), the translation initiation codon is also referred to
as the "AUG codon," the "start codon" or the "AUG start codon". A
minority of genes have a translation initiation codon having the
RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and
5'-CUG have been shown to function in vivo. Thus, the terms
"translation initiation codon" and "start codon" can encompass many
codon sequences, even though the initiator amino acid in each
instance is typically methionine (in eukaryotes) or
formylmethionine (in prokaryotes). It is also known in the art that
eukaryotic and prokaryotic genes may have two or more alternative
start codons, any one of which may be preferentially utilized for
translation initiation in a particular cell type or tissue, or
under a particular set of conditions. In the context of the
invention, "start codon" and "translation initiation codon" refer
to the codon or codons that are used in vivo to initiate
translation of an mRNA molecule transcribed from a gene encoding
apolipoprotein(a), regardless of the sequence(s) of such
codons.
[0018] It is also known in the art that a translation termination
codon (or "stop codon") of a gene may have one of three sequences,
i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences
are 5'-TAA, 5'-TAG and 5'-TGA, respectively). The terms "start
codon region" and "translation initiation codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation initiation codon. Similarly, the terms "stop
codon region" and "translation termination codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation termination codon.
[0019] The open reading frame (ORF) or "coding region," which is
known in the art to refer to the region between the translation
initiation codon and the translation termination codon, is also a
region which may be targeted effectively. Other target regions
include the 5' untranslated region (5'UTR), known in the art to
refer to the portion of an mRNA in the 5' direction from the
translation initiation codon, and thus including nucleotides
between the 5' cap site and the translation initiation codon of an
mRNA or corresponding nucleotides on the gene, and the 3'
untranslated region (3'UTR), known in the art to refer to the
portion of an mRNA in the 3' direction from the translation
termination codon, and thus including nucleotides between the
translation termination codon and 3' end of an mRNA or
corresponding nucleotides on the gene. The 5' cap of an mRNA
comprises an N7-methylated guanosine residue joined to the 5'-most
residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap
region of an mRNA is considered to include the 5' cap structure
itself as well as the first 50 nucleotides adjacent to the cap. The
5' cap region may also be a preferred target region.
[0020] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns,"
which are excised from a transcript before it is translated. The
remaining (and therefore translated) regions are known as "exons"
and are spliced together to form a continuous mRNA sequence. mRNA
splice sites, i.e., intron-exon junctions, may also be preferred
target regions, and are particularly useful in situations where
aberrant splicing is implicated in disease, or where an
overproduction of a particular mRNA splice product is implicated in
disease. Aberrant fusion junctions due to rearrangements or
deletions are also preferred targets. It has also been found that
introns can also be effective, and therefore preferred, target
regions for antisense compounds targeted, for example, to DNA or
pre-mRNA.
[0021] Once one or more target sites have been identified,
oligonucleotides are chosen which are sufficiently complementary to
the target, i.e., hybridize sufficiently well and with sufficient
specificity, to give the desired effect.
[0022] In the context of this invention, "hybridization" means
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases. For example, adenine and thymine are
complementary nucleobases which pair through the formation of
hydrogen bonds. "Complementary," as used herein, refers to the
capacity for precise pairing between two nucleotides. For example,
if a nucleotide at a certain position of an oligonucleotide is
capable of hydrogen bonding with a nucleotide at the same position
of a DNA or RNA molecule, then the oligonucleotide and the DNA or
RNA are considered to be complementary to each other at that
position. The oligonucleotide and the DNA or RNA are complementary
to each other when a sufficient number of corresponding positions
in each molecule are occupied by nucleotides which can hydrogen
bond with each other. Thus, "specifically hybridizable" and
"complementary" are terms which are used to indicate a sufficient
degree of complementarity or precise pairing such that stable and
specific binding occurs between the oligonucleotide and the DNA or
RNA target. It is understood in the art that the sequence of an
antisense compound need not be 100% complementary to that of its
target nucleic acid to be specifically hybridizable. An antisense
compound is specifically hybridizable when binding of the compound
to the target DNA or RNA molecule interferes with the normal
function of the target DNA or RNA to cause a loss of utility, and
there is a sufficient degree of complementarity to avoid
non-specific binding of the antisense compound to non-target
sequences under conditions in which specific binding is desired,
i.e., under physiological conditions in the case of in vivo assays
or therapeutic treatment, and in the case of in vitro assays, under
conditions in which the assays are performed.
[0023] Antisense and other compounds of the invention which
hybridize to the target and inhibit expression of the target are
identified through experimentation, and the sequences of these
compounds are hereinbelow identified as preferred embodiments of
the invention. The target sites to which these preferred sequences
are complementary are hereinbelow referred to as "active sites" and
are therefore preferred sites for targeting. Therefore another
embodiment of the invention encompasses compounds which hybridize
to these active sites.
[0024] Antisense compounds are commonly used as research reagents
and diagnostics. For example, antisense oligonucleotides, which are
able to inhibit gene expression with exquisite specificity, are
often used by those of ordinary skill to elucidate the function of
particular genes. Antisense compounds are also used, for example,
to distinguish between functions of various members of a biological
pathway. Antisense modulation has, therefore, been harnessed for
research use.
[0025] For use in kits and diagnostics, the antisense compounds of
the present invention, either alone or in combination with other
antisense compounds or therapeutics, can be used as tools in
differential and/or combinatorial analyses to elucidate expression
patterns of a portion or the entire complement of genes expressed
within cells and tissues.
[0026] Expression patterns within cells or tissues treated with one
or more antisense compounds are compared to control cells or
tissues not treated with antisense compounds and the patterns
produced are analyzed for differential levels of gene expression as
they pertain, for example, to disease association, signaling
pathway, cellular localization, expression level, size, structure
or function of the genes examined. These analyses can be performed
on stimulated or unstimulated cells and in the presence or absence
of other compounds which affect expression patterns.
[0027] Examples of methods of gene expression analysis known in the
art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett.,
2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE
(serial analysis of gene expression) (Madden, et al., Drug Discov.
Today, 2000, 5, 415-425), READS (restriction enzyme amplification
of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999,
303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et
al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), protein
arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16;
Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed
sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000,
480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57),
subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal.
Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41,
203-208), subtractive cloning, differential display (DD) (Jurecic
and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative
genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl.,
1998, 31, 286-96), FISH (fluorescent in situ hybridization)
techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35,
1895-904) and mass spectrometry methods (reviewed in (To, Comb.
Chem. High Throughput Screen, 2000, 3, 235-41).
[0028] The specificity and sensitivity of antisense is also
harnessed by those of skill in the art for therapeutic uses.
Antisense oligonucleotides have been employed as therapeutic
moieties in the treatment of disease states in animals and man.
Antisense oligonucleotide drugs, including ribozymes, have been
safely and effectively administered to humans and numerous clinical
trials are presently underway. It is thus established that
oligonucleotides can be useful therapeutic modalities that can be
configured to be useful in treatment regimes for treatment of
cells, tissues and animals, especially humans.
[0029] In the context of this invention, the term "oligonucleotide"
refers to an oligomer or polymer of ribonucleic acid (RNA) or
deoxyribonucleic acid (DNA) or mimetics thereof. This term includes
oligonucleotides composed of naturally-occurring nucleobases,
sugars and covalent internucleoside (backbone) linkages as well as
oligonucleotides having non-naturally-occurring portions which
function similarly. Such modified or substituted oligonucleotides
are often preferred over native forms because of desirable
properties such as, for example, enhanced cellular uptake, enhanced
affinity for nucleic acid target and increased stability in the
presence of nucleases.
[0030] While antisense oligonucleotides are a preferred form of
antisense compound, the present invention comprehends other
oligomeric antisense compounds, including but not limited to
oligonucleotide mimetics such as are described below. The antisense
compounds in accordance with this invention preferably comprise
from about 8 to about 50 nucleobases (i.e. from about 8 to about 50
linked nucleosides). Particularly preferred antisense compounds are
antisense oligonucleotides, even more preferably those comprising
from about 12 to about 30 nucleobases. Antisense compounds include
ribozymes, external guide sequence (EGS) oligonucleotides
(oligozymes), and other short catalytic RNAs or catalytic
oligonucleotides which hybridize to the target nucleic acid and
modulate its expression.
[0031] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn the respective ends of this
linear polymeric structure can be further joined to form a circular
structure, however, open linear structures are generally preferred.
Within the oligonucleotide structure, the phosphate groups are
commonly referred to as forming the internucleoside backbone of the
oligonucleotide. The normal linkage or backbone of RNA and DNA is a
3' to 5' phosphodiester linkage.
[0032] Specific examples of preferred antisense compounds useful in
this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, oligonucleotides having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified oligonucleotides that do not have a phosphorus atom
in their internucleoside backbone can also be considered to be
oligonucleosides. Preferred modified oligonucleotide backbones
include, for example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonates, 5'-alkylene phosphonates and chiral phosphonates,
phosphinates, phosphoramidates including 3'-amino phosphoramidate
and aminoalkylphosphoramidates, thionophosphoramidates,
thiono-alkylphosphonates, thionoalkylphosphotriesters,
selenophosphates and boranophosphates having normal 3'-5' linkages,
2' -5' linked analogs of these, and those having inverted polarity
wherein one or more internucleotide linkages is a 3' to 3', 5' to
5' or 2' to 2' linkage. Preferred oligonucleotides having inverted
polarity comprise a single 3' to 3' linkage at the 3'-most
internucleotide linkage i.e. a single inverted nucleoside residue
which may be abasic (the nucleobase is missing or has a hydroxyl
group in place thereof). Various salts, mixed salts and free acid
forms are also included.
[0033] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555;
5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are
commonly owned with this application, and each of which is herein
incorporated by reference.
[0034] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; riboacetyl backbones; alkene containing backbones;
sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate and sulfonamide backbones; amide backbones;
and others having mixed N, O, S and CH.sub.2 component parts.
[0035] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, certain of which are commonly owned with
this application, and each of which is herein incorporated by
reference.
[0036] In other preferred oligonucleotide mimetics, both the sugar
and the internucleoside linkage, i.e., the backbone, of the
nucleotide units are replaced with novel groups. The base units are
maintained for hybridization with an appropriate nucleic acid
target compound. One such oligomeric compound, an oligonucleotide
mimetic that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA
compounds, the sugar-backbone of an oligonucleotide is replaced
with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative United States patents that
teach the preparation of PNA compounds include, but are not limited
to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of
which is herein incorporated by reference. Further teaching of PNA
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0037] Most preferred embodiments of the invention are
oligonucleotides with phosphorothioate backbones and
oligonucleosides with heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone], --CH.sub.2--O--N(CH.sub.3)
--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above referenced U.S. Pat. No. 5,602,240. Also
preferred are oligonucleotides having morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0038] Modified oligonucleotides may also contain one or more
substituted sugar moieties. Preferred oligonucleotides comprise one
of the following at the 2' position: OH; F; O--, S--, or N-alkyl;
O--, S--, or N-alkenyl; O--, S-- or N-alkynyl; or O-alkyl-O-alkyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or
unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10
alkenyl and alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.su- b.3)].sub.2, where n and
m are from 1 to about 10. Other preferred oligonucleotides comprise
one of the following at the 2' position: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl,
O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3,
OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2,
N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl,
aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving
group, a reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes 2'-methoxyethoxy
(2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta,
1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred
modification includes 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples hereinbelow, and
2'-dimethylamino-ethoxyethoxy (also known in the art as
2'-O-dimethylamino-ethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2, also described in
examples hereinbelow.
[0039] A further prefered modification includes Locked Nucleic
Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or
4' carbon atom of the sugar ring thereby forming a bicyclic sugar
moiety. The linkage is preferably a methelyne (--CH.sub.2--).sub.n
group bridging the 2' oxygen atom and the 4' carbon atom wherein n
is 1 or 2. LNAs and preparation thereof are described in WO
98/39352 and WO 99/14226.
[0040] Other preferred modifications include 2'-methoxy
(2'-O--CH.sub.3), 2'-aminopropoxy
(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), 2'-allyl
(2'-CH.sub.2--CH.dbd.CH.sub.2), 2'-O-allyl
(2'-O--CH.sub.2--CH.dbd.CH.sub- .2) and 2'-fluoro (2'-F). The
2'-modification may be in the arabino (up) position or ribo (down)
position. A preferred 2'-arabino modification is 2'-F. Similar
modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Oligonucleotides may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747;
and 5,700,920, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0041] Oligonucleotides may also include nucleobase (often referred
to in the art simply as "base") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include other synthetic and natural nucleobases such as
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cyto-sines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine. Further modified nucleobases include tricyclic
pyrimidines such as phenoxazine cytidine(1H-pyrimido
[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a
substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b- ][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2- -one), pyridoindole
cytidine (H-pyrido[3', 2':4,5]pyrrolo[2,3-d]pyrimidin-- 2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John
Wiley & Sons, 1990, those disclosed by Englisch et al.,
Angewandte Chemie, International Edition, 1991, 30, 613, and those
disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and
Applications, pages 289-302, Crooke, S. T. and Lebleu, B. ed., CRC
Press, 1993. Certain of these nucleobases are particularly useful
for increasing the binding affinity of the oligomeric compounds of
the invention. These include 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyl-adenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
276-278) and are presently preferred base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar
modifications.
[0042] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include, but are not limited to,
the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653;
5,763,588; 6,005,096; and 5,681,941, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference, and U.S. Pat. No. 5,750,692, which is
commonly owned with the instant application and also herein
incorporated by reference.
[0043] Another modification of the oligonucleotides of the
invention involves chemically linking to the oligonucleotide one or
more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the oligonucleotide. The
compounds of the invention can include conjugate groups covalently
bound to functional groups such as primary or secondary hydroxyl
groups. Conjugate groups of the invention include inter-calators,
reporter molecules, polyamines, polyamides, poly-ethylene glycols,
polyethers, groups that enhance the pharmacodynamic properties of
oligomers, and groups that enhance the pharmacokinetic properties
of oligomers. Typical conjugates groups include cholesterols,
lipids, phospholipids, biotin, phenazine, folate, phenanthridine,
anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and
dyes. Groups that enhance the pharmaco-dynamic properties, in the
context of this invention, include groups that improve oligomer
uptake, enhance oligomer resistance to degradation, and/or
strengthen sequence-specific hybridization with RNA. Groups that
enhance the pharmacokinetic properties, in the context of this
invention, include groups that improve oligomer uptake,
distribution, metabolism or excretion. Representative conjugate
groups are disclosed in International patent application
PCT/US92/09196, filed Oct. 23, 1992 the entire disclosure of which
is incorporated herein by reference. Conjugate moieties include but
are not limited to lipid moieties such as a cholesterol moiety
(Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86,
6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let.,
1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol
(Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309;
Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a
thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20,
533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues
(Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et
al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie,
1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol
or triethylammonium 1,2-di-O-hexadecyl-rac-glyc-
ero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36,
3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a
polyamine or a polyethylene glycol chain (Manoharan et al.,
Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane
acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36,
3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys.
Acta, 1995, 1264, 229-237), or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937). Oligonucleotides of the
invention may also be conjugated to active drug substances, for
example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen,
fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen,
dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid,
folinic acid, a benzothiadiazide, chlorothiazide, a diazepine,
indo-methicin, a barbiturate., a cephalosporin, a sulfa drug, an
antidiabetic, an antibacterial or an antibiotic.
Oligonucleotide-drug conjugates and their preparation are described
in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15,
1999) which is incorporated herein by reference in its
entirety.
[0044] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, certain of which are commonly owned with
the instant application, and each of which is herein incorporated
by reference.
[0045] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
compound or even at a single nucleoside within an oligonucleotide.
The present invention also includes antisense compounds which are
chimeric compounds. "Chimeric" antisense compounds or "chimeras,"
in the context of this invention, are antisense compounds,
particularly oligonucleotides, which contain two or more chemically
distinct regions, each made up of at least one monomer unit, i.e.,
a nucleotide in the case of an oligonucleotide compound. These
oligonucleotides typically contain at least one region wherein the
oligonucleotide is modified so as to confer upon the
oligonucleotide increased resistance to nuclease degradation,
increased cellular uptake, and/or increased binding affinity for
the target nucleic acid. An additional region of the
oligonucleotide may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby greatly enhancing the efficiency of
oligonucleotide inhibition of gene expression. Consequently,
comparable results can often be obtained with shorter
oligonucleotides when chimeric oligonucleotides are used, compared
to phosphorothioate deoxyoligonucleotides hybridizing to the same
target region. Cleavage of the RNA target can be routinely detected
by gel electrophoresis and, if necessary, associated nucleic acid
hybridization techniques known in the art.
[0046] Chimeric antisense compounds of the invention may be formed
as composite structures of two or more oligonucleotides, modified
oligonucleotides, oligonucleosides and/or oligonucleotide mimetics
as described above. Such compounds have also been referred to in
the art as hybrids or gapmers. Representative United States patents
that teach the preparation of such hybrid structures include, but
are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007;
5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference in its entirety.
[0047] The antisense compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0048] The antisense compounds of the invention are synthesized in
vitro and do not include antisense compositions of biological
origin, or genetic vector constructs designed to direct the in vivo
synthesis of antisense molecules.
[0049] The compounds of the invention may also be admixed,
encapsulated, conjugated or otherwise associated with other
molecules, molecule structures or mixtures of compounds, as for
example, liposomes, receptor targeted molecules, oral, rectal,
topical or other formulations, for assisting in uptake,
distribution and/or absorption. Representative United States
patents that teach the preparation of such uptake, distribution
and/or absorption assisting formulations include, but are not
limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016;
5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721;
4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170;
5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854;
5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948;
5,580,575; and 5,595,756, each of which is herein incorporated by
reference.
[0050] The antisense compounds of the invention encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof. Accordingly,
for example, the disclosure is also drawn to prodrugs and
pharmaceutically acceptable salts of the compounds of the
invention, pharmaceutically acceptable salts of such prodrugs, and
other bioequivalents.
[0051] The term "prodrug" indicates a therapeutic agent that is
prepared in an inactive form that is converted to an active form
(i.e., drug) within the body or cells thereof by the action of
endogenous enzymes or other chemicals and/or conditions. In
particular, prodrug versions of the oligonucleotides of the
invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate]
derivatives according to the methods disclosed in WO-93/24510 to
Gosselin et al., published Dec. 9, 1993 or in WO 94/26764 and U.S.
Pat. No. 5,770,713 to Imbach et al.
[0052] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the
compounds of the invention: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto.
[0053] Pharmaceutically acceptable base addition salts are formed
with metals or amines, such as alkali and alkaline earth metals or
organic amines. Examples of metals used as cations are sodium,
potassium, magnesium, calcium, and the like. Examples of suitable
amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline,
diethanolamine, dicyclohexylamine, ethylenediamine,
N-methylglucamine, and procaine (see, for example, Berge et al.,
"Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). The
base addition salts of said acidic compounds are prepared by
contacting the free acid form with a sufficient amount of the
desired base to produce the salt in the conventional manner. The
free acid form may be regenerated by contacting the salt form with
an acid and isolating the free acid in the conventional manner. The
free acid forms differ from their respective salt forms somewhat in
certain physical properties such as solubility in polar solvents,
but otherwise the salts are equivalent to their respective free
acid for purposes of the present invention. As used herein, a
"pharmaceutical addition salt" includes a pharmaceutically
acceptable salt of an acid form of one of the components of the
compositions of the invention. These include organic or inorganic
acid salts of the amines. Preferred acid salts are the
hydrochlorides, acetates, salicylates, nitrates and phosphates.
Other suitable pharmaceutically acceptable salts are well known to
those skilled in the art and include basic salts of a variety of
inorganic and organic acids, such as, for example, with inorganic
acids, such as for example hydrochloric acid, hydrobromic acid,
sulfuric acid or phosphoric acid; with organic carboxylic,
sulfonic, sulfo or phospho acids or N-substituted sulfamic acids,
for example acetic acid, propionic acid, glycolic acid, succinic
acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric
acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic
acid, glucaric acid, glucuronic acid, citric acid, benzoic acid,
cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic
acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid,
nicotinic acid or isonicotinic acid; and with amino acids, such as
the 20 alpha-amino acids involved in the synthesis of proteins in
nature, for example glutamic acid or aspartic acid, and also with
phenylacetic acid, methanesulfonic acid, ethanesulfonic acid,
2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid,
benzenesulfonic acid, 4-methylbenzenesulfoic acid,
naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or
3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid
(with the formation of cyclamates), or with other acid organic
compounds, such as ascorbic acid. Pharmaceutically acceptable salts
of compounds may also be prepared with a pharmaceutically
acceptable cation. Suitable pharmaceutically acceptable cations are
well known to those skilled in the art and include alkaline,
alkaline earth, ammonium and quaternary ammonium cations.
Carbonates or hydrogen carbonates are also possible.
[0054] For oligonucleotides, preferred examples of pharmaceutically
acceptable salts include but are not limited to (a) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (b) acid
addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (c) salts formed with organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid,
succinic acid, maleic acid, fumaric acid, gluconic acid, citric
acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
and (d) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0055] The antisense compounds of the present invention can be
utilized for diagnostics, therapeutics, prophylaxis and as research
reagents and kits. For therapeutics, an animal, preferably a human,
suspected of having a disease or disorder which can be treated by
modulating the expression of apolipoprotein(a) is treated by
administering antisense compounds in accordance with this
invention. The compounds of the invention can be utilized in
pharmaceutical compositions by adding an effective amount of an
antisense compound to a suitable pharmaceutically acceptable
diluent or carrier. Use of the antisense compounds and methods of
the invention may also be useful prophylactically, e.g., to prevent
or delay infection, inflammation or tumor formation, for
example.
[0056] The antisense compounds of the invention are useful for
research and diagnostics, because these compounds hybridize to
nucleic acids encoding apolipoprotein(a), enabling sandwich and
other assays to easily be constructed to exploit this fact.
Hybridization of the antisense oligonucleotides of the invention
with a nucleic acid encoding apolipoprotein(a) can be detected by
means known in the art. Such means may include conjugation of an
enzyme to the oligonucleotide, radiolabelling of the
oligonucleotide or any other suitable detection means. Kits using
such detection means for detecting the level of apolipoprotein(a)
in a sample may also be prepared.
[0057] The present invention also includes pharmaceutical
compositions and formulations which include the antisense compounds
of the invention. The pharmaceutical compositions of the present
invention may be administered in a number of ways depending upon
whether local or systemic treatment is desired and upon the area to
be treated. Administration may be topical (including ophthalmic and
to mucous membranes including vaginal and rectal delivery),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal), oral or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; or
intracranial, e.g., intrathecal or intraventricular,
administration. Oligonucleotides with at least one
2'-O-methoxyethyl modification are believed to be particularly
useful for oral administration.
[0058] Pharmaceutical compositions and formulations for topical
administration may include transdermal patches, ointments, lotions,
creams, gels, drops, suppositories, sprays, liquids and powders.
Conventional pharmaceutical carriers, aqueous, powder or oily
bases, thickeners and the like may be necessary or desirable.
Coated condoms, gloves and the like may also be useful. Preferred
topical formulations include those in which the oligonucleotides of
the invention are in admixture with a topical delivery agent such
as lipids, liposomes, fatty acids, fatty acid esters, steroids,
chelating agents and surfactants. Preferred lipids and liposomes
include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine,
dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl
choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and
cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and
dioleoylphosphatidyl ethanolamine DOTMA). Oligonucleotides of the
invention may be encapsulated within liposomes or may form
complexes thereto, in particular to cationic liposomes.
Alternatively, oligonucleotides may be complexed to lipids, in
particular to cationic lipids. Preferred fatty acids and esters
include but are not limited arachidonic acid, oleic acid,
eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic
acid, palmitic acid, stearic acid, linoleic acid, linolenic acid,
dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a C.sub.1-10 alkyl ester (e.g. isopropylmyristate IPM),
monoglyceride, diglyceride or pharmaceutically acceptable salt
thereof. Topical formulations are described in detail in U.S.
patent application Ser. No. 09/315,298 filed on May 20, 1999 which
is incorporated herein by reference in its entirety.
[0059] Compositions and formulations for oral administration
include powders or granules, microparticulates, nanoparticulates,
suspensions or solutions in water or non-aqueous media, capsules,
gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
may be desirable. Preferred oral formulations are those in which
oligonucleotides of the invention are administered in conjunction
with one or more penetration enhancers surfactants and chelators.
Preferred surfactants include fatty acids and/or esters or salts
thereof, bile acids and/or salts thereof. Prefered bile acids/salts
include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic
acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid,
glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic
acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusid- ate,
sodium glycodihydrofusidate. Prefered fatty acids include
arachidonic acid, undecanoic acid, oleic acid, lauric acid,
caprylic acid, capric acid, myristic acid, palmitic acid, stearic
acid, linoleic acid, linolenic acid, dicaprate, tricaprate,
monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a monoglyceride, a diglyceride or a pharmaceutically acceptable
salt thereof (e.g. sodium). Also prefered are combinations of
penetration enhancers, for example, fatty acids/salts in
combination with bile acids/salts. A particularly prefered
combination is the sodium salt of lauric acid, capric acid and
UDCA. Further penetration enhancers include
polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
Oligonucleotides of the invention may be delivered orally in
granular form including sprayed dried particles, or complexed to
form micro or nanoparticles. Oligonucleotide complexing agents
include poly-amino acids; polyimines; polyacrylates;
polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates;
cationized gelatins, albumins, starches, acrylates,
polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates;
DEAE-derivatized polyimines, pollulans, celluloses and starches.
Particularly preferred complexing agents include chitosan,
N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine,
polyspermines, protamine, polyvinylpyridine,
polythiodiethylamino-methylethylene P(TDAE), polyaminostyrene (e.g.
p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate),
poly(butylcyanoacrylate), poly(isobutylcyanoacrylate),
poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate,
DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate,
polyhexylacrylate, poly(D,L-lactic acid),
poly(DL-lactic-co-glycolic acid (PLGA), alginate, and
polyethyleneglycol (PEG). Oral formulations for oligonucleotides
and their preparation are described in detail in U.S. applications
Ser. No. 08/886,829 (filed Jul. 1, 1997), Ser. No. 09/108,673
(filed Jul. 1, 1998), Ser. No. 09/256,515 (filed Feb. 23, 1999),
Ser. No. 09/082,624 (filed May 21, 1998) and Ser. No. 09/315,298
(filed May 20, 1999) each of which is incorporated herein by
reference in their entirety.
[0060] Compositions and formulations for parenteral, intrathecal or
intraventricular administration may include sterile aqueous
solutions which may also contain buffers, diluents and other
suitable additives such as, but not limited to, penetration
enhancers, carrier compounds and other pharmaceutically acceptable
carriers or excipients.
[0061] Pharmaceutical compositions of the present invention
include, but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions may be
generated from a variety of components that include, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids.
[0062] The pharmaceutical formulations of the present invention,
which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general the
formulations ate prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0063] The compositions of the present invention may be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, gel capsules, liquid syrups, soft gels,
suppositories, and enemas. The compositions of the present
invention may also be formulated as suspensions in aqueous,
non-aqueous or mixed media. Aqueous suspensions may further contain
substances which increase the viscosity of the suspension
including, for example, sodium carboxymethylcellulose, sorbitol
and/or dextran. The suspension may also contain stabilizers.
[0064] In one embodiment of the present invention the
pharmaceutical compositions may be formulated and used as foams.
Pharmaceutical foams include formulations such as, but not limited
to, emulsions, microemulsions, creams, jellies and liposomes. While
basically similar in nature these formulations vary in the
components and the consistency of the final product. The
preparation of such compositions and formulations is generally
known to those skilled in the pharmaceutical and formulation arts
and may be applied to the formulation of the compositions of the
present invention.
[0065] Emulsions
[0066] The compositions of the present invention may be prepared
and formulated as emulsions. Emulsions are typically heterogenous
systems of one liquid dispersed in another in the form of droplets
usually exceeding 0.1 .mu.m in diameter. (Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p.
335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often
biphasic systems comprising of two immiscible liquid phases
intimately mixed and dispersed with each other. In general,
emulsions may be either water-in-oil (w/o) or of the oil-in-water
(o/w) variety. When an aqueous phase is finely divided into and
dispersed as minute droplets into a bulk oily phase the resulting
composition is called a water-in-oil (w/o) emulsion. Alternatively,
when an oily phase is finely divided into and dispersed as minute
droplets into a bulk aqueous phase the resulting composition is
called an oil-in-water (o/w) emulsion. Emulsions may contain
additional components in addition to the dispersed phases and the
active drug which may be present as a solution in either the
aqueous phase, oily phase or itself as a separate phase.
Pharmaceutical excipients such as emulsifiers, stabilizers, dyes,
and anti-oxidants may also be present in emulsions as needed.
Pharmaceutical emulsions may also be multiple emulsions that are
comprised of more than two phases such as, for example, in the case
of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w)
emulsions. Such complex formulations often provide certain
advantages that simple binary emulsions do not. Multiple emulsions
in which individual oil droplets of an o/w emulsion enclose small
water droplets constitute a w/o/w emulsion. Likewise a system of
oil droplets enclosed in globules of water stabilized in an oily
continuous provides an o/w/o emulsion.
[0067] Emulsions are characterized by little or no thermodynamic
stability. Often, the dispersed or discontinuous phase of the
emulsion is well dispersed into the external or continuous phase
and maintained in this form through the means of emulsifiers or the
viscosity of the formulation. Either of the phases of the emulsion
may be a semisolid or a solid, as is the case of emulsion-style
ointment bases and creams. Other means of stabilizing emulsions
entail the use of emulsifiers that may be incorporated into either
phase of the emulsion. Emulsifiers may broadly be classified into
four categories: synthetic surfactants, naturally occurring
emulsifiers, absorption bases, and finely dispersed solids (Idson,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
199).
[0068] Synthetic surfactants, also known as surface active agents,
have found wide applicability in the formulation of emulsions and
have been reviewed in the literature (Rieger, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199).
Surfactants are typically amphiphilic and comprise a hydrophilic
and a hydrophobic portion. The ratio of the hydrophilic to the
hydrophobic nature of the surfactant has been termed the
hydrophile/lipophile balance (HLB) and is a valuable tool in
categorizing and selecting surfactants in the preparation of
formulations. Surfactants may be classified into different classes
based on the nature of the hydrophilic group: nonionic, anionic,
cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 285).
[0069] Naturally occurring emulsifiers used in emulsion
formulations include lanolin, beeswax, phosphatides, lecithin and
acacia. Absorption bases possess hydrophilic properties such that
they can soak up water to form w/o emulsions yet retain their
semisolid consistencies, such as anhydrous lanolin and hydrophilic
petrolatum. Finely divided solids have also been used as good
emulsifiers especially in combination with surfactants and in
viscous preparations. These include polar inorganic solids, such as
heavy metal hydroxides, nonswelling clays such as bentonite,
attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum
silicate and colloidal magnesium aluminum silicate, pigments and
nonpolar solids such as carbon or glyceryl tristearate.
[0070] A large variety of non-emulsifying materials are also
included in emulsion formulations and contribute to the properties
of emulsions. These include fats, oils, waxes, fatty acids, fatty
alcohols, fatty esters, humectants, hydrophilic colloids,
preservatives and antioxidants (Block, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0071] Hydrophilic colloids or hydrocolloids include naturally
occurring gums and synthetic polymers such as polysaccharides (for
example, acacia, agar, alginic acid, carrageenan, guar gum, karaya
gum, and tragacanth), cellulose derivatives (for example,
carboxymethylcellulose and carboxypropylcellulose), and synthetic
polymers (for example, carbomers, cellulose ethers, and
carboxyvinyl polymers). These disperse or swell in water to form
colloidal solutions that stabilize emulsions by forming strong
interfacial films around the dispersed-phase droplets and by
increasing the viscosity of the external phase.
[0072] Since emulsions often contain a number of ingredients such
as carbohydrates, proteins, sterols and phosphatides that may
readily support the growth of microbes, these formulations often
incorporate preservatives. Commonly used preservatives included in
emulsion formulations include methyl paraben, propyl paraben,
quaternary ammonium salts, benzalkonium chloride, esters of
p-hydroxybenzoic acid, and boric acid. Antioxidants are also
commonly added to emulsion formulations to prevent deterioration of
the formulation. Antioxidants used may be free radical scavengers
such as tocopherols, alkyl gallates, butylated hydroxyanisole,
butylated hydroxytoluene, or reducing agents such as ascorbic acid
and sodium metabisulfite, and antioxidant synergists such as citric
acid, tartaric acid, and lecithin.
[0073] The application of emulsion formulations via dermatological,
oral and parenteral routes and methods for their manufacture have
been reviewed in the literature (Idson, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for
oral delivery have been very widely used because of reasons of ease
of formulation, efficacy from an absorption and bioavailability
standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman,
Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York,
N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 199). Mineral-oil base laxatives,
oil-soluble vitamins and high fat nutritive preparations are among
the materials that have commonly been administered orally as o/w
emulsions.
[0074] In one embodiment of the present invention, the compositions
of oligonucleotides and nucleic acids are formulated as
microemulsions. A microemulsion may be defined as a system of
water, oil and amphiphile which is a single optically isotropic and
thermodynamically stable liquid solution (Rosoff, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically
microemulsions are systems that are prepared by first dispersing an
oil in an aqueous surfactant solution and then adding a sufficient
amount of a fourth component, generally an intermediate
chain-length alcohol to form a transparent system. Therefore,
microemulsions have also been described as thermodynamically
stable, isotropically clear dispersions of two immiscible liquids
that are stabilized by interfacial films of surface-active
molecules (Leung and Shah, in: Controlled Release of Drugs:
Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH
Publishers, New York, pages 185-215). Microemulsions commonly are
prepared via a combination of three to five components that include
oil, water, surfactant, cosurfactant and electrolyte. Whether the
microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w)
type is dependent on the properties of the oil and surfactant used
and on the structure and geometric packing of the-polar heads and
hydrocarbon tails of the surfactant molecules (Schott, in
Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton,
Pa., 1985, p. 271).
[0075] The phenomenological approach utilizing phase diagrams has
been extensively studied and has yielded a comprehensive knowledge,
to one skilled in the art, of how to formulate microemulsions
(Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 335). Compared to conventional emulsions,
microemulsions offer the advantage of solubilizing water-insoluble
drugs in a formulation of thermodynamically stable droplets that
are formed spontaneously.
[0076] Surfactants used in the preparation of microemulsions
include, but are not limited to, ionic surfactants, non-ionic
surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol
fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol
monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol
pentaoleate (PO500), decaglycerol monocaprate (MCA750),
decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750),
decaglycerol decaoleate (DAO750), alone or in combination with
cosurfactants. The cosurfactant, usually a short-chain alcohol such
as ethanol, 1-propanol, and 1-butanol, serves to increase the
interfacial fluidity by penetrating into the surfactant film and
consequently creating a disordered film because of the void space
generated among surfactant molecules. Microemulsions may, however,
be prepared without the use of cosurfactants and alcohol-free
self-emulsifying microemulsion systems are known in the art. The
aqueous phase may typically be, but is not limited to, water, an
aqueous solution of the drug, glycerol, PEG300, PEG400,
polyglycerols, propylene glycols, and derivatives of ethylene
glycol. The oil phase may include, but is not limited to, materials
such as Captex 300, Captex 355, Capmul MCM, fatty acid esters,
medium chain (C8-C12) mono, di, and tri-glycerides,
polyoxyethylated glyceryl fatty acid esters, fatty alcohols,
polyglycolized glycerides, saturated polyglycolized C8-C10
glycerides, vegetable oils and silicone oil.
[0077] Microemulsions are particularly of interest from the
standpoint of drug solubilization and the enhanced absorption of
drugs. Lipid based microemulsions (both o/w and w/o) have been
proposed to enhance the oral bioavailability of drugs, including
peptides (Constantinides et al., Pharmaceutical Research, 1994, 11,
1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13,
205). Microemulsions afford advantages of improved drug
solubilization, protection of drug from enzymatic hydrolysis,
possible enhancement of drug absorption due to surfactant-induced
alterations in membrane fluidity and permeability, ease of
preparation, ease of oral administration over solid dosage forms,
improved clinical potency, and decreased toxicity (Constantinides
et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J.
Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form
spontaneously when their components are brought together at ambient
temperature. This may be particularly advantageous when formulating
thermolabile drugs, peptides or oligonucleotides. Microemulsions
have also been effective in the transdermal delivery of active
components in both cosmetic and pharmaceutical applications. It is
expected that the microemulsion compositions and formulations of
the present invention will facilitate the increased systemic
absorption of oligonucleotides and nucleic acids from the
gastrointestinal tract, as well as improve the local cellular
uptake of oligonucleotides and nucleic acids within the
gastrointestinal tract, vagina, buccal cavity and other areas of
administration.
[0078] Microemulsions of the present invention may also contain
additional components and additives such as sorbitan monostearate
(Grill 3), Labrasol, and penetration enhancers to improve the
properties of the formulation and to enhance the absorption of the
oligonucleotides and nucleic acids of the present invention.
Penetration enhancers used in the microemulsions of the present
invention may be classified as belonging to one of five broad
categories--surfactants, fatty acids, bile salts, chelating agents,
and non-chelating non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these
classes has been discussed above.
[0079] Liposomes
[0080] There are many organized surfactant structures besides
microemulsions that have been studied and used for the formulation
of drugs. These include monolayers, micelles, bilayers and
vesicles. Vesicles, such as liposomes, have attracted great
interest because of their specificity and the duration of action
they offer from the standpoint of drug delivery. As used in the
present invention, the term "liposome" means a vesicle composed of
amphiphilic lipids arranged in a spherical bilayer or bilayers.
[0081] Liposomes are unilamellar or multilamellar vesicles which
have a membrane formed from a lipophilic material and an aqueous
interior. The aqueous portion contains the composition to be
delivered. Cationic liposomes possess the advantage of being able
to fuse to the cell wall. Non-cationic liposomes, although not able
to fuse as efficiently with the cell wall, are taken up by
macrophages in vivo.
[0082] In order to cross intact mammalian skin, lipid vesicles must
pass through a series of fine pores, each with a diameter less than
50 nm, under the influence of a suitable transdermal gradient.
Therefore, it is desirable to use a liposome which is highly
deformable and able to pass through such fine pores.
[0083] Further advantages of liposomes include; liposomes obtained
from natural phospholipids are biocompatible and biodegradable;
liposomes can incorporate a wide range of water and lipid soluble
drugs; liposomes can protect encapsulated drugs in their internal
compartments from metabolism and degradation (Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
Important considerations in the preparation of liposome
formulations are the lipid surface charge, vesicle size and the
aqueous volume of the liposomes.
[0084] Liposomes are useful for the transfer and delivery of active
ingredients to the site of action. Because the liposomal membrane
is structurally similar to biological membranes, when liposomes are
applied to a tissue, the liposomes start to merge with the cellular
membranes. As the merging of the liposome and cell progresses, the
liposomal contents are emptied into the cell where the active agent
may act.
[0085] Liposomal formulations have been the focus of extensive
investigation as the mode of delivery for many drugs. There is
growing evidence that for topical administration, liposomes present
several advantages over other formulations. Such advantages include
reduced side-effects related to high systemic absorption of the
administered drug, increased accumulation of the administered drug
at the desired target, and the ability to administer a wide variety
of drugs, both hydrophilic and hydrophobic, into the skin.
[0086] Several reports have detailed the ability of liposomes to
deliver agents including high-molecular weight DNA into the skin.
Compounds including analgesics, antibodies, hormones and
high-molecular weight DNAs have been administered to the skin. The
majority of applications resulted in the targeting of the upper
epidermis.
[0087] Liposomes fall into two broad classes. Cationic liposomes
are positively charged liposomes which interact with the negatively
charged DNA molecules to form a stable complex. The positively
charged DNA/liposome complex binds to the negatively charged cell
surface and is internalized in an endosome. Due to the acidic pH
within the endosome, the liposomes are ruptured, releasing their
contents into the cell cytoplasm (Wang et al., Biochem. Biophys.
Res. Commun., 1987, 147, 980-985).
[0088] Liposomes which are pH-sensitive or negatively-charged,
entrap DNA rather than complex with it. Since both the DNA and the
lipid are similarly charged, repulsion rather than complex
formation occurs. Nevertheless, some DNA is entrapped within the
aqueous interior of these liposomes. pH-sensitive liposomes have
been used to deliver DNA encoding the thymidine kinase gene to cell
monolayers in culture. Expression of the exogenous gene was
detected in the target cells (Zhou et al., Journal of Controlled
Release, 1992, 19, 269-274).
[0089] One major type of liposomal composition includes
phospholipids other than naturally-derived phosphatidylcholine.
Neutral liposome compositions, for example, can be formed from
dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl
phosphatidylcholine (DPPC). Anionic liposome compositions generally
are formed from dimyristoyl phosphatidylglycerol, while anionic
fusogenic liposomes are formed primarily from dioleoyl
phosphatidylethanolamine (DOPE). Another type of liposomal
composition is formed from phosphatidylcholine (PC) such as, for
example, soybean PC, and egg PC. Another type is formed from
mixtures of phospholipid and/or phosphatidylcholine and/or
cholesterol.
[0090] Several studies have assessed the topical delivery of
liposomal drug formulations to the skin. Application of liposomes
containing interferon to guinea pig skin resulted in a reduction of
skin herpes sores while delivery of interferon via other means
(e.g. as a solution or as an emulsion) were ineffective (Weiner et
al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an
additional study tested the efficacy of interferon administered as
part of a liposomal formulation to the administration of interferon
using an aqueous system, and concluded that the liposomal
formulation was superior to aqueous administration (du Plessis et
al., Antiviral Research, 1992, 18, 259-265).
[0091] Non-ionic liposomal systems have also been examined to
determine their utility in the delivery of drugs to the skin, in
particular systems comprising non-ionic surfactant and cholesterol.
Non-ionic liposomal formulations comprising Novasome.TM. I
(glyceryl dilaurate/cholesterol/po- lyoxyethylene-10-stearyl ether)
and Novasome.TM. II (glyceryl
distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used
to deliver cyclosporin-A into the dermis of mouse skin. Results
indicated that such non-ionic liposomal systems were effective in
facilitating the deposition of cyclosporin-A into different layers
of the skin (Hu et al. S.T.P. Pharma. Sci., 1994, 4, 6, 466).
[0092] Liposomes also include "sterically stabilized" liposomes, a
term which, as used herein, refers to liposomes comprising one or
more specialized lipids that, when incorporated into liposomes,
result in enhanced circulation lifetimes relative to liposomes
lacking such specialized lipids. Examples of sterically stabilized
liposomes are those in which part of the vesicle-forming lipid
portion of the liposome (A) comprises one or more glycolipids, such
as monosialoganglioside G.sub.M1, or (B) is derivatized with one or
more hydrophilic polymers, such as a polyethylene glycol (PEG)
moiety. While not wishing to be bound by any particular theory, it
is thought in the art that, at least for sterically stabilized
liposomes containing gangliosides, sphingomyelin, or
PEG-derivatized lipids, the enhanced circulation half-life of these
sterically stabilized liposomes derives from a reduced uptake into
cells of the reticuloendothelial system (RES) (Allen et al., FEBS
Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53,
3765). Various liposomes comprising one or more glycolipids are
known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci.,
1987, 507, 64) reported the ability of monosialoganglioside
G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to
improve blood half-lives of liposomes. These findings were
expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A.,
1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to
Allen et al., disclose liposomes comprising (1) sphingomyelin and
(2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester.
U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes
comprising sphingomyelin. Liposomes comprising
1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499
(Lim et al.).
[0093] Many liposomes comprising lipids derivatized with one or
more hydrophilic polymers, and methods of preparation thereof, are
known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53,
2778) described liposomes comprising a nonionic detergent,
2C.sub.1215G, that contains a PEG moiety. Illum et al. (FEBS Lett.,
1984, 167, 79) noted that hydrophilic coating of polystyrene
particles with polymeric glycols results in significantly enhanced
blood half-lives. Synthetic phospholipids modified by the
attachment of carboxylic groups of polyalkylene glycols (e.g., PEG)
are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899).
Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments
demonstrating that liposomes comprising phosphatidylethanolamine
(PE) derivatized with PEG or PEG stearate have significant
increases in blood circulation half-lives. Blume et al. (Biochimica
et Biophysica Acta, 1990, 1029, 91) extended such observations to
other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from
the combination of distearoylphosphatidylethanolamine (DSPE) and
PEG. Liposomes having covalently bound PEG moieties on their
external surface are described in European Patent No. EP 0 445 131
B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20
mole percent of PE derivatized with PEG, and methods of use
thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556
and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and
European Patent No. EP 0 496 813 B1). Liposomes comprising a number
of other lipid-polymer conjugates are disclosed in WO 91/05545 and
U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073
(Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids
are described in WO 96/10391 (Choi et al.). U.S. Pat. No. 5,540,935
(Miyazaki et al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.)
describe PEG-containing liposomes that can be further derivatized
with functional moieties on their surfaces.
[0094] A limited number of liposomes comprising nucleic acids are
known in the art. WO 96/40062 to Thierry et al. discloses methods
for encapsulating high molecular weight nucleic acids in liposomes.
U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded
liposomes and asserts that the contents of such liposomes may
include an antisense RNA. U.S. Pat. No. 5,665,710 to Rahman et al.
describes certain methods of encapsulating oligodeoxynucleotides in
liposomes. WO 97/04787 to Love et al. discloses liposomes
comprising antisense oligonucleotides targeted to the raf gene.
[0095] Transfersomes are yet another type of liposomes, and are
highly deformable lipid aggregates which are attractive candidates
for drug delivery vehicles. Transfersomes may be described as lipid
droplets which are so highly deformable that they are easily able
to penetrate through pores which are smaller than the droplet.
Transfersomes are adaptable to the environment in which they are
used, e.g. they are self-optimizing (adaptive to the shape of pores
in the skin), self-repairing, frequently reach their targets
without fragmenting, and often self-loading. To make transfersomes
it is possible to add surface edge-activators, usually surfactants,
to a standard liposomal composition. Transfersomes have been used
to deliver serum albumin to the skin. The transfersome-mediated
delivery of serum albumin has been shown to be as effective as
subcutaneous injection of a solution containing serum albumin.
[0096] Surfactants find wide application in formulations such as
emulsions (including microemulsions) and liposomes. The most common
way of classifying and ranking the properties of the many different
types of surfactants, both natural and synthetic, is by the use of
the hydrophile/lipophile balance (HLB). The nature of the
hydrophilic group (also known as the "head") provides the most
useful means for categorizing the different surfactants used in
formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel
Dekker, Inc., New York, N.Y., 1988, p. 285).
[0097] If the surfactant molecule is not ionized, it is classified
as a nonionic surfactant. Nonionic surfactants find wide
application in pharmaceutical and cosmetic products and are usable
over a wide range of pH values. In general their HLB values range
from 2 to about 18 depending on their structure. Nonionic
surfactants include nonionic esters such as ethylene glycol esters,
propylene glycol esters, glyceryl esters, polyglyceryl esters,
sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic
alkanolamides and ethers such as fatty alcohol ethoxylates,
propoxylated alcohols, and ethoxylated/propoxylated block polymers
are also included in this class. The polyoxyethylene surfactants
are the most popular members of the nonionic surfactant class.
[0098] If the surfactant molecule carries a negative charge when it
is dissolved or dispersed in water, the surfactant is classified as
anionic. Anionic surfactants include carboxylates such as soaps,
acyl lactylates, acyl amides of amino acids, esters of sulfuric
acid such as alkyl sulfates and ethoxylated alkyl sulfates,
sulfonates such as alkyl benzene sulfonates, acyl isethionates,
acyl taurates and sulfosuccinates, and phosphates. The most
important members of the anionic surfactant class are the alkyl
sulfates and the soaps.
[0099] If the surfactant molecule carries a positive charge when it
is dissolved or dispersed in water, the surfactant is classified as
cationic. Cationic surfactants include quaternary ammonium salts
and ethoxylated amines. The quaternary ammonium salts are the most
used members of this class.
[0100] If the surfactant molecule has the ability to carry either a
positive or negative charge, the surfactant is classified as
amphoteric. Amphoteric surfactants include acrylic acid
derivatives, substituted alkylamides, N-alkylbetaines and
phosphatides.
[0101] The use of surfactants in drug products, formulations and in
emulsions has been reviewed (Rieger, in Pharmaceutical Dosage
Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0102] Penetration Enhancers
[0103] In one embodiment, the present invention employs various
penetration enhancers to effect the efficient delivery of nucleic
acids, particularly oligonucleotides, to the skin of animals. Most
drugs are present in solution in both ionized and nonionized forms.
However, usually only lipid soluble or lipophilic drugs readily
cross cell membranes. It has been discovered that even
non-lipophilic drugs may cross cell membranes if the membrane to be
crossed is treated with a penetration enhancer. In addition to
aiding the diffusion of non-lipophilic drugs across cell membranes,
penetration enhancers also enhance the permeability of lipophilic
drugs.
[0104] Penetration enhancers may be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants (Lee et
al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
p.92). Each of the above mentioned classes of penetration enhancers
are described below in greater detail.
[0105] Surfactants: In connection with the present invention,
surfactants (or "surface-active agents") are chemical entities
which, when dissolved in an aqueous solution, reduce the surface
tension of the solution or the interfacial tension between the
aqueous solution and another liquid, with the result that
absorption of oligonucleotides through the mucosa is enhanced. In
addition to bile salts and fatty acids, these penetration enhancers
include, for example, sodium lauryl sulfate,
polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p.92); and perfluorochemical emulsions, such as FC-43.
Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
[0106] Fatty acids: Various fatty acids and their derivatives which
act as penetration. enhancers include, for example, oleic acid,
lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic
acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin,
caprylic acid, arachidonic acid, glycerol 1-monocaprate,
1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines,
C.sub.1-10 alkyl esters thereof (e.g., methyl, isopropyl and
t-butyl), and mono- and di-glycerides thereof (i.e., oleate,
laurate, caprate, myristate, palmitate, stearate, linoleate, etc.)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier
Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol.,
1992, 44, 651-654).
[0107] Bile salts: The physiological role of bile includes the
facilitation of dispersion and absorption of lipids and fat-soluble
vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The
Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al.
Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural
bile salts, and their synthetic derivatives, act as penetration
enhancers. Thus the term "bile salts" includes any of the naturally
occurring components of bile as well as any of their synthetic
derivatives. The bile salts of the invention include, for example,
cholic acid (or its pharmaceutically acceptable sodium salt, sodium
cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic
acid (sodium deoxycholate), glucholic acid (sodium glucholate),
glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium
glycodeoxycholate), taurocholic acid (sodium-taurocholate),
taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic
acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA),
sodium tauro-24,25-dihydro-fusidate (STDHF), sodium
glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee
et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical
Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa.,
1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic
Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm.
Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990,
79, 579-583).
[0108] Chelating Agents: Chelating agents, as used in connection
with the present invention, can be defined as compounds that remove
metallic ions from solution by forming complexes therewith, with
the result that absorption of oligonucleotides through the mucosa
is enhanced. With regards to their use as penetration enhancers in
the present invention, chelating agents have the added advantage of
also serving as DNase inhibitors, as most characterized DNA
nucleases require a divalent metal ion for catalysis and are thus
inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618,
315-339). Chelating agents of the invention include but are not
limited to disodium ethylenediaminetetraacetate (EDTA), citric
acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and
homovanilate), N-acyl derivatives of collagen, laureth-9 and
N-amino acyl derivatives of beta-diketones (enamines) (Lee et al.,
Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page
92; Muranishi, Critical Reviews in Therapeutic Drug Carrier
Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14,
43-51).
[0109] Non-chelating non-surfactants: As used herein, non-chelating
non-surfactant penetration enhancing compounds can be defined as
compounds that demonstrate insignificant activity as chelating
agents or as surfactants but that nonetheless enhance absorption of
oligonucleotides through the alimentary mucosa (Muranishi, Critical
Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This
class of penetration enhancers include, for example, unsaturated
cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, page 92); and non-steroidal anti-inflammatory agents such as
diclofenac sodium, indomethacin and phenylbutazone (Yamashita et
al., J. Pharm. Pharmacol., 1987, 39, 621-626).
[0110] Agents that enhance uptake of oligonucleotides at the
cellular level may also be added to the pharmaceutical and other
compositions of the present invention. For example, cationic
lipids, such as lipofectin (Junichi et al, U.S. Pat. No.
5,705,188), cationic glycerol derivatives, and polycationic
molecules, such as polylysine (Lollo et al., PCT application WO
97/30731), are also known to enhance the cellular uptake of
oligonucleotides.
[0111] Other agents may be utilized to enhance the penetration of
the administered nucleic acids, including glycols such as ethylene
glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and
terpenes such as limonene and menthone.
[0112] Carriers
[0113] Certain compositions of the present invention also
incorporate carrier compounds in the formulation. As used herein,
"carrier compound" or "carrier" can refer to a nucleic acid, or
analog thereof, which is inert (i.e., does not possess biological
activity per se) but is recognized as a nucleic acid by in vivo
processes that reduce the bioavailability of a nucleic acid having
biological activity by, for example, degrading the biologically
active nucleic acid or promoting its removal from circulation. The
coadministration of a nucleic acid and a carrier compound,
typically with an excess of the latter substance, can result in a
substantial reduction of the amount of nucleic acid recovered in
the liver, kidney or other extracirculatory reservoirs, presumably
due to competition between the carrier compound and the nucleic
acid for a common receptor. For example, the recovery of a
partially phosphorothioate oligonucleotide in hepatic tissue can be
reduced when it is coadministered with polyinosinic acid, dextran
sulfate, polycytidic acid or 4-acetamido-4'
isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., Antisense
Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense & Nucl.
Acid Drug Dev., 1996, 6, 177-183).
[0114] Excipients
[0115] In contrast to a carrier compound, a "pharmaceutical
carrier" or "excipient" is a pharmaceutically acceptable solvent,
suspending agent or any other pharmacologically inert vehicle for
delivering one or more nucleic acids to an animal. The excipient
may be liquid or solid and is selected, with the planned manner of
administration in mind, so as to provide for the desired bulk,
consistency, etc., when combined with a nucleic acid and the other
components of a given pharmaceutical composition. Typical
pharmaceutical carriers include, but are not limited to, binding
agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or
hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and
other sugars, microcrystalline cellulose, pectin, gelatin, calcium
sulfate, ethyl cellulose, polyacrylates or calcium hydrogen
phosphate, etc.); lubricants (e.g., magnesium stearate, talc,
silica, colloidal silicon dioxide, stearic acid, metallic
stearates, hydrogenated vegetable oils, corn starch, polyethylene
glycols, sodium benzoate, sodium acetate, etc.); disintegrants
(e.g., starch, sodium starch glycolate, etc.); and wetting agents
(e.g., sodium lauryl sulphate, etc.).
[0116] Pharmaceutically acceptable organic or inorganic excipient
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can also be used to
formulate the compositions of the present invention. Suitable
pharmaceutically acceptable carriers include, but are not limited
to, water, salt solutions, alcohols, polyethylene glycols, gelatin,
lactose, amylose, magnesium stearate, talc, silicic acid, viscous
paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the
like.
[0117] Formulations for topical administration of nucleic acids may
include sterile and non-sterile aqueous solutions, non-aqueous
solutions in common solvents such as alcohols, or solutions of the
nucleic acids in liquid or solid oil bases. The solutions may also
contain buffers, diluents and other suitable additives.
Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can be used.
[0118] Suitable pharmaceutically acceptable excipients include, but
are not limited to, water, salt solutions, alcohol, polyethylene
glycols, gelatin, lactose, amylose, magnesium stearate, talc,
silicic acid, viscous paraffin, hydroxymethylcellulose,
polyvinylpyrrolidone and the like.
[0119] Other Components
[0120] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may contain additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the compositions of the present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the nucleic acid(s) of the
formulation.
[0121] Aqueous suspensions may contain substances which increase
the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension may
also contain stabilizers.
[0122] Certain embodiments of the invention provide pharmaceutical
compositions containing (a) one or more antisense compounds and (b)
one or more other chemotherapeutic agents which function by a
non-antisense mechanism. Examples of such chemotherapeutic agents
include but are not limited to daunorubicin, daunomycin,
dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin,
bleomycin, mafosfamide, ifosfamide, cytosine arabinoside,
bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D,
mithramycin, prednisone, hydroxyprogesterone, testosterone,
tamoxifen, dacarbazine, procarbazine, hexamethylmelamine,
pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil,
methylcyclohexylnitrosurea, nitrogen mustards, melphalan,
cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine,
5-azacytidine, hydroxyurea, deoxycoformycin,
4-hydroxyperoxycyclophosphor- amide, 5-fluorouracil (5-FU),
5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine,
taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate,
irinotecan, topotecan, gemcitabine, teniposide, cisplatin and
diethylstilbestrol (DES). See, generally, The Merck Manual of
Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al.,
eds., Rahway, N.J. When used with the compounds of the invention,
such chemotherapeutic agents may be used individually (e.g., 5-FU
and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide
for a period of time followed by MTX and oligonucleotide), or in
combination with one or more other such chemotherapeutic agents
(e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and
oligonucleotide). Anti-inflammatory drugs, including but not
limited to nonsteroidal anti-inflammatory drugs and
corticosteroids, and antiviral drugs, including but not limited to
ribivirin, vidarabine, acyclovir and ganciclovir, may also be
combined in compositions of the invention. See, generally, The
Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al.,
eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively).
Other non-antisense chemotherapeutic agents are also within the
scope of this invention. Two or more combined compounds may be used
together or sequentially.
[0123] In another related embodiment, compositions of the invention
may contain one or more antisense compounds, particularly
oligonucleotides, targeted to a first nucleic acid and one or more
additional antisense compounds targeted to a second nucleic acid
target. Numerous examples of antisense compounds are known in the
art. Two or more combined compounds may be used together or
sequentially.
[0124] The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill of
those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50s found to be
effective in in vitro and in vivo animal models. In general, dosage
is from 0.01 ug to 100 g per kg of body weight, and may be given
once or more daily, weekly, monthly or yearly, or even once every 2
to 20 years. Persons of ordinary skill in the art can easily
estimate repetition rates for dosing based on measured residence
times and concentrations of the drug in bodily fluids or tissues.
Following successful treatment, it may be desirable to have the
patient undergo maintenance therapy to prevent the recurrence of
the disease state, wherein the oligonucleotide is administered in
maintenance doses, ranging from 0.01 ug to 100 g per kg of body
weight, once or more daily, to once every 20 years.
[0125] While the present invention has been described with
specificity in accordance with certain of its preferred
embodiments, the following examples serve only to illustrate the
invention and are not intended to limit the same.
EXAMPLES
Example 1
Nucleoside Phosphoramidites for Oligonucleotide Synthesis Deoxy and
2'-alkoxy amidites
[0126] 2'-Deoxy and 2'-methoxy beta-cyanoethyldiisopropyl
phosphoramidites were purchased from commercial sources (e.g.
Chemgenes, Needham Mass. or Glen Research, Inc. Sterling Va.).
Other 2'-O-alkoxy substituted nucleoside amidites are prepared as
described in U.S. Pat. No. 5,506,351, herein incorporated by
reference. For oligonucleotides synthesized using 2'-alkoxy
amidites, the standard cycle for unmodified oligonucleotides was
utilized, except the wait step after pulse delivery of tetrazole
and base was increased to 360 seconds.
[0127] Oligonucleotides containing 5-methyl-2'-deoxycytidine
(5-Me-C) nucleotides were synthesized according to published
methods (Sanghvi, et. al., Nucleic Acids Research, 1993, 21,
3197-3203) using commercially available phosphoramidites (Glen
Research, Sterling Va. or ChemGenes, Needham Mass.).
2'-Fluoro amidites
2'-Fluorodeoxyadenosine amidites
[0128] 2'-fluoro oligonucleotides were synthesized as described
previously (Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841)
and U.S. Pat. No. 5,670,633, herein incorporated by reference.
Briefly, the protected nucleoside
N6-benzoyl-2'-deoxy-2'-fluoroadenosine was synthesized utilizing
commercially available 9-beta-D-arabinofuranosyladenine as starting
material and by modifying literature procedures whereby the
2'-alpha-fluoro atom is introduced by a S.sub.N2-displacement of a
2'-beta-trityl group. Thus
N6-benzoyl-9-beta-D-arabinofuranosyladenine was selectively
protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP)
intermediate. Deprotection of the THP and N6-benzoyl groups was
accomplished using standard methodologies and standard methods were
used to obtain the 5'-dimethoxytrityl-(DMT) and
5'-DMT-3'-phosphoramidite intermediates.
2'-Fluorodeoxyguanosine
[0129] The synthesis of 2'-deoxy-2'-fluoroguanosine was
accomplished using tetraisopropyldisiloxanyl (TPDS) protected
9-beta-D-arabinofuranosylguani- ne as starting material, and
conversion to the intermediate
diisobutyryl-arabinofuranosylguanosine. Deprotection of the TPDS
group was followed by protection of the hydroxyl group with THP to
give diisobutyryl di-THP protected arabinofuranosylguanine.
Selective O-deacylation and triflation was followed by treatment of
the crude product with fluoride, then deprotection of the THP
groups. Standard methodologies were used to obtain the 5'-DMT- and
5'-DMT-3'-phosphoramidi- tes.
2'-Fluorouridine
[0130] Synthesis of 2'-deoxy-2'-fluorouridine was accomplished by
the modification of a literature procedure in which
2,2'-anhydro-1-beta-D-ara- binofuranosyluracil was treated with 70%
hydrogen fluoride-pyridine. Standard procedures were used to obtain
the 5'-DMT and 5'-DMT-3'phosphoramidites.
2'-Fluorodeoxycytidine
[0131] 2'-deoxy-2'-fluorocytidine was synthesized via amination of
2'-deoxy-2'-fluorouridine, followed by selective protection to give
N4-benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures were
used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.
2'-O-(2-Methoxyethyl) modified amidites
[0132] 2'-O-Methoxyethyl-substituted nucleoside amidites are
prepared as follows, or alternatively, as per the methods of
Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504.
2,2'-Anhydro[1-(beta-D-arabinofuranosyl)-5-methyluridine]
[0133] 5-Methyluridine (ribosylthymine, commercially available
through Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenylcarbonate
(90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) were
added to DMF (300 mL). The mixture was heated to reflux, with
stirring, allowing the evolved carbon dioxide gas to be released in
a controlled manner. After 1 hour, the slightly darkened solution
was concentrated under reduced pressure. The resulting syrup was
poured into diethylether (2.5 L), with stirring. The product formed
a gum. The ether was decanted and the residue was dissolved in a
minimum amount of methanol (ca. 400 mL). The solution was poured
into fresh ether (2.5 L) to yield a stiff gum. The ether was
decanted and the gum was dried in a vacuum oven (60.degree. C. at 1
mm Hg for 24 h) to give a solid that was crushed to a light tan
powder (57 g, 85% crude yield). The NMR spectrum was consistent
with the structure, contaminated with phenol as its sodium salt
(ca. 5%). The material was used as is for further reactions (or it
can be purified further by column chromatography using a gradient
of methanol in ethyl acetate (10-25%) to give a white solid, mp
222-4.degree. C.)
2'-O-Methoxyethyl-5-methyluridine
[0134] 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M),
tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol
(1.2 L) were added to a 2 L stainless steel pressure vessel and
placed in a pre-heated oil bath at 160.degree. C. After heating for
48 hours at 155-160.degree. C., the vessel was opened and the
solution evaporated to dryness and triturated with MeOH (200 mL).
The residue was suspended in hot acetone (1 L). The insoluble salts
were filtered, washed with acetone (150 mL) and the filtrate
evaporated. The residue (280 g) was dissolved in CH.sub.3CN (600
mL) and evaporated. A silica gel column (3 kg) was packed in
CH.sub.2Cl.sub.2/acetone/MeOH (20:5:3) containing 0.5% Et.sub.3NH.
The residue was dissolved in CH.sub.2Cl.sub.2 (250 mL) and adsorbed
onto silica (150 g) prior to loading onto the column. The product
was eluted with the packing solvent to give 160 g (63%) of product.
Additional material was obtained by reworking impure fractions.
2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
[0135] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was
co-evaporated with pyridine (250 mL) and the dried residue
dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the mixture stirred at
room temperature for one hour. A second aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the reaction stirred for
an additional one hour. Methanol (170 mL) was then added to stop
the reaction. HPLC showed the presence of approximately 70%
product. The solvent was evaporated and triturated with CH.sub.3CN
(200 mL). The residue was dissolved in CHCl.sub.3 (1.5 L) and
extracted with 2.times.500 mL of saturated NaHCO.sub.3 and
2.times.500 mL of saturated NaCl. The organic phase was dried over
Na.sub.2SO.sub.4, filtered and evaporated. 275 g of residue was
obtained. The residue was purified on a 3.5 kg silica gel column,
packed and eluted with EtOAc/hexane/acetone (5:5:1) containing 0.5%
Et.sub.3NH. The pure fractions were evaporated to give 164 g of
product. Approximately 20 g additional was obtained from the impure
fractions to give a total yield of 183 g (57%).
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
[0136] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106
g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from
562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38
mL, 0.258 M) were combined and stirred at room temperature for 24
hours. The reaction was monitored by TLC by first quenching the TLC
sample with the addition of MeOH. Upon completion of the reaction,
as judged by TLC, MeOH (50 mL) was added and the mixture evaporated
at 35.degree. C. The residue was dissolved in CHCl.sub.3 (800 mL)
and extracted with 2.times.200 mL of saturated sodium bicarbonate
and 2.times.200 mL of saturated NaCl. The water layers were back
extracted with 200 mL of CHCl.sub.3. The combined organics were
dried with sodium sulfate and evaporated to give 122 g of residue
(approx. 90% product). The residue was purified on a 3.5 kg silica
gel column and eluted using EtOAc/hexane(4:1). Pure product
fractions were evaporated to yield 96 g (84%). An additional 1.5 g
was recovered from later fractions.
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazoleurid-
ine
[0137] A first solution was prepared by dissolving
3'-O-acetyl-2'-O-methox-
yethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in
CH.sub.3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M)
was added to a solution of triazole (90 g, 1.3 M) in CH.sub.3CN (1
L), cooled to -5.degree. C. and stirred for 0.5 h using an overhead
stirrer. POCl.sub.3 was added dropwise, over a 30 minute period, to
the stirred solution maintained at 0-10.degree. C., and the
resulting mixture stirred for an additional 2hours. The first
solution was added dropwise, over a 45 minute period, to the latter
solution. The resulting reaction mixture was stored overnight in a
cold room. Salts were filtered from the reaction mixture and the
solution was evaporated. The residue was dissolved in EtOAc (1 L)
and the insoluble solids were removed by filtration. The filtrate
was washed with 1.times.300 mL of NaHCO.sub.3 and 2.times.300 mL of
saturated NaCl, dried over sodium sulfate and evaporated. The
residue was triturated with EtOAc to give the title compound.
2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0138] A solution of
3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5--
methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and
NH.sub.4OH (30 mL) was stirred at room temperature for 2 hours. The
dioxane solution was evaporated and the residue azeotroped with
MeOH (2.times.200 mL). The residue was dissolved in MeOH (300 mL)
and transferred to a 2 liter stainless steel pressure vessel. MeOH
(400 mL) saturated with NH.sub.3 gas was added and the vessel
heated to 100.degree. C. for 2 hours (TLC showed complete
conversion). The vessel contents were evaporated to dryness and the
residue was dissolved in EtOAc (500 mL) and washed once with
saturated NaCl (200 mL). The organics were dried over sodium
sulfate and the solvent was evaporated to give 85 g (95%) of the
title compound.
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0139] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyl-cytidine (85
g, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride
(37.2 g, 0.165 M) was added with stirring. After stirring for 3
hours, TLC showed the reaction to be approximately 95% complete.
The solvent was evaporated and the residue azeotroped with MeOH
(200 mL). The residue was dissolved in CHCl.sub.3 (700 mL) and
extracted with saturated NaHCO.sub.3 (2.times.300 mL) and saturated
NaCl (2.times.300 mL), dried over MgSO.sub.4 and evaporated to give
a residue (96 g). The residue was chromatographed on a 1.5 kg
silica column using EtOAc/hexane (1:1) containing 0.5% Et.sub.3NH
as the eluting solvent. The pure product fractions were evaporated
to give 90 g (90%) of the title compound.
N4-Benzoyl-2'-N-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine-3'-am-
idite
[0140]
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
(74 g, 0.10 M) was dissolved in CH.sub.2Cl.sub.2 (1 L). Tetrazole
diisopropylamine (7.1 g) and
2-cyanoethoxy-tetra-(isopropyl)phosphite (40.5 mL, 0.123 M) were
added with stirring, under a nitrogen atmosphere. The resulting
mixture was stirred for 20 hours at room temperature (TLC showed
the reaction to be 95% complete). The reaction mixture was
extracted with saturated NaHCO.sub.3 (1.times.300 mL) and saturated
NaCl (3.times.300 mL). The aqueous washes were back-extracted with
CH.sub.2Cl.sub.2 (300 mL), and the extracts were combined, dried
over MgSO.sub.4 and concentrated. The residue obtained was
chromatographed on a 1.5 kg silica column using EtOAc/hexane (3:1)
as the eluting solvent. The pure fractions were combined to give
90.6 g (87%) of the title compound.
2'-O-(Aminooxyethyl) nucleoside amidites and
2'-O-(dimethylaminooxyethyl) nucleoside amidites
2'-(Dimethylaminooxyethoxy) nucleoside amidites
[0141] 2'-(Dimethylaminooxyethoxy) nucleoside amidites (also known
in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites) are
prepared as described in the following paragraphs. Adenosine,
cytidine and guanosine nucleoside amidites are prepared similarly
to the thymidine (5-methyluridine) except the exocyclic amines are
protected with a benzoyl moiety in the case of adenosine and
cytidine and with isobutyryl in the case of guanosine.
5-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
[0142] O.sup.2-2'-anhydro-5-methyluridine (Pro. Bio. Sint., Varese,
Italy, 100.0 g, 0.416 mmol), dimethylaminopyridine (0.66 g, 0.013
eq, 0.0054 mmol) were dissolved in dry pyridine (500 ml) at ambient
temperature under an argon atmosphere and with mechanical stirring.
tert-Butyldiphenylchlorosilane (125.8 g, 119.0 mL, 1.1 eq, 0.458
mmol) was added in one portion. The reaction was stirred for 16 h
at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicated a
complete reaction. The solution was concentrated under reduced
pressure to a thick oil. This was partitioned between
dichloromethane (1 L) and saturated sodium bicarbonate (2.times.1
L) and brine (1 L). The organic layer was dried over sodium sulfate
and concentrated under reduced pressure to a thick oil. The oil was
dissolved in a 1:1 mixture of ethyl acetate and ethyl ether (600
mL) and the solution was cooled to -10.degree. C. The resulting
crystalline product was collected by filtration, washed with ethyl
ether (3.times.200 mL) and dried (40.degree. C., 1 mm Hg, 24 h) to
149 g (74.8%) of white solid. TLC and NMR were consistent with pure
product.
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
[0143] In a 2 L stainless steel, unstirred pressure reactor was
added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the
fume hood and with manual stirring, ethylene glycol (350 mL,
excess) was added cautiously at first until the evolution of
hydrogen gas subsided.
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
(149 g, 0.311 mol) and sodium bicarbonate (0.074 g, 0.003 eq) were
added with manual stirring. The reactor was sealed and heated in an
oil bath until an internal temperature of 160.degree. C. was
reached and then maintained for 16 h (pressure<100 psig). The
reaction vessel was cooled to ambient and opened. TLC (Rf 0.67 for
desired product and Rf 0.82 for ara-T side product, ethyl acetate)
indicated about 70% conversion to the product. In order to avoid
additional side product formation, the reaction was stopped,
concentrated under reduced pressure (10 to 1 mm Hg) in a warm water
bath (40-100.degree. C.) with the more extreme conditions used to
remove the ethylene glycol. [Alternatively, once the low boiling
solvent is gone, the remaining solution can be partitioned between
ethyl acetate and water. The product will be in the organic phase.]
The residue was purified by column chromatography (2 kg silica gel,
ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate
fractions were combined, stripped and dried to product as a white
crisp foam (84 g, 50%), contaminated starting material (17.4 g) and
pure reusable starting material 20 g. The yield based on starting
material less pure recovered starting material was 58%. TLC and NMR
were consistent with 99% pure product.
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine
[0144]
5'-O-tert-Butyldiphenylsilyl-2-O-(2-hydroxyethyl)-5-methyluridine
(20 g, 36.98 mmol) was mixed with triphenylphosphine (11.63 g,
44.36 mmol) and N-hydroxyphthalimide (7.24 g, 44.36 mmol). It was
then dried over P.sub.2O.sub.5 under high vacuum for two days at
40.degree. C. The reaction mixture was flushed with argon and dry
THF (369.8 mL, Aldrich, sure seal bottle) was added to get a clear
solution. Diethyl-azodicarboxylate (6.98 mL, 44.36 mmol) was added
dropwise to the reaction mixture. The rate of addition is
maintained such that resulting deep red coloration is just
discharged before adding the next drop. After the addition was
complete, the reaction was stirred for 4 hrs. By that time TLC
showed the completion of the reaction (ethylacetate:hexane, 60:40).
The solvent was evaporated in vacuum. Residue obtained was placed
on a flash column and eluted with ethyl acetate:hexane (60:40), to
get
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine
as white foam (21.819 g, 86%).
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-methylurid-
ine
[0145]
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridi-
ne (3.1 g, 4.5 mmol) was dissolved in dry CH.sub.2Cl.sub.2 (4.5 mL)
and methylhydrazine (300 mL 4.64 mmol) was added dropwise at
-10.degree. C. to 0.degree. C. After 1 h the mixture was filtered,
the filtrate was washed with ice cold CH.sub.2Cl.sub.2 and the
combined organic phase was washed with water, brine and dried over
anhydrous Na.sub.2SO.sub.4. The solution was concentrated to get
2'-O-(aminooxyethyl) thymidine, which was then dissolved in MeOH
(67.5 mL). To this formaldehyde (20% aqueous solution, w/w, 1.1
eq.) was added and the resulting mixture was strirred for 1 h.
Solvent was removed under vacuum; residue chromatographed to get
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)
ethyl]-5-methyluridine as white foam: (1.95 g, 78%).
5'-O-tert-Butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5-methylurid-
ine
[0146]
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-met-
hyluridine (1.77 g, 3.12 mmol) was dissolved in a solution of 1M
pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6 mL). Sodium
cyanoborohydride (0.39 g, 6.13 mmol) was added to this solution at
10.degree. C. under inert atmosphere. The reaction mixture was
stirred for 10 minutes at 10.degree. C. After that the reaction
vessel was removed from the ice bath and stirred at room
temperature for 2 h, the reaction monitored by TLC (5% MeOH in
CH.sub.2Cl.sub.2). Aqueous NaHCO.sub.3 solution (5%, 10 mL) was
added and extracted with ethyl acetate (2.times.20 mL). Ethyl
acetate phase was dried over anhydrous Na.sub.2SO.sub.4, evaporated
to dryness. Residue was dissolved in a solution of 1M PPTS in MeOH
(30.6 mL). Formaldehyde (20% w/w, 30 mL, 3.37 mmol) was added and
the reaction mixture was stirred at room temperature for 10
minutes. Reaction mixture cooled to 10.degree. C. in an ice bath,
sodium cyanoborohydride (0.39 g, 6.13 mmol) was added and reaction
mixture stirred at 10.degree. C. for 10 minutes. After 10 minutes,
the reaction mixture was removed from the ice bath and stirred at
room temperature for 2 hrs. To the reaction mixture 5% NaHCO.sub.3
(25 mL) solution was added and extracted with ethyl acetate
(2.times.25 mL). Ethyl acetate layer was dried over anhydrous
Na.sub.2SO.sub.4 and evaporated to dryness . The residue obtained
was purified by flash column chromatography and eluted with 5% MeOH
in CH.sub.2Cl.sub.2 to get
5'-O-tert-butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5-methyluri-
dine as a white foam (14.6 g, 80%).
2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0147] Triethylamine trihydrofluoride (3.91 mL, 24.0 mmol) was
dissolved in dry THF and triethylamine (1.67 mL, 12 mmol, dry, kept
over KOH). This mixture of triethylamine-2HF was then added to
5'-O-tert-butyldiphenylsil-
yl-2'-O-[N,N-dimethylaminooxyethyll-]5-methyluridine (1.40 g, 2.4
mmol) and stirred at room temperature for 24 hrs. Reaction was
monitored by TLC (5% MeOH in CH.sub.2Cl.sub.2). Solvent was removed
under vacuum and the residue placed on a flash column and eluted
with 10% MeOH in CH.sub.2Cl.sub.2 to get
2'-O-(dimethylaminooxyethyl)-5-methyluridine (766 mg, 92.5%).
5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0148] 2'-O-(dimethylaminooxyethyl)-5-methyluridine (750 mg, 2.17
mmol) was dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. It was then co-evaporated with anhydrous pyridine (20
mL). The residue obtained was dissolved in pyridine (11 mL) under
argon atmosphere. 4-dimethylaminopyridine (26.5 mg, 2.60 mmol),
4,4'-dimethoxytrityl chloride (880 mg, 2.60 mmol) was added to the
mixture and the reaction mixture was stirred at room temperature
until all of the starting material disappeared. Pyridine was
removed under vacuum and the residue chromatographed and eluted
with 10% MeOH in CH.sub.2Cl.sub.2 (containing a few drops of
pyridine) to get 5'-O-DMT-2'-O-(dimethylamino-oxyethyl)-5--
methyluridine (1.13 g, 80%).
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoet-
hyl)-N,N-diisopropylphosphoramidite]
[0149] 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine (1.08
g, 1.67 mmol) was co-evaporated with toluene (20 mL). To the
residue N,N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) was
added and dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. Then the reaction mixture was dissolved in anhydrous
acetonitrile (8.4 mL) and
2-cyanoethyl-N,N,N.sup.1,N.sup.1-tetraisopropylphosphoramidite
(2.12 mL, 6.08 mmol) was added. The reaction mixture was stirred at
ambient temperature for 4 hrs under inert atmosphere. The progress
of the reaction was monitored by TLC (hexane:ethyl acetate 1:1).
The solvent was evaporated, then the residue was dissolved in ethyl
acetate (70 mL) and washed with 5% aqueous NaHCO.sub.3 (40 mL).
Ethyl acetate layer was dried over anhydrous Na.sub.2SO.sub.4 and
concentrated. Residue obtained was chromatographed (ethyl acetate
as eluent) to get 5'-O-DMT-2'-O-(2-N,N-dim-
ethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoethyl)-N,N-diisopropylphos-
phoramidite] as a foam (1.04 g, 74.9%).
2'-(Aminooxyethoxy) nucleoside amidites
[0150] 2'-(Aminooxyethoxy) nucleoside amidites (also known in the
art as 2'-O-(aminooxyethyl) nucleoside amidites) are prepared as
described in the following paragraphs. Adenosine, cytidine and
thymidine nucleoside amidites are prepared similarly.
N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimeth-
oxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite]
[0151] The 2'-O-aminooxyethyl guanosine analog may be obtained by
selective 2'-O-alkylation of diaminopurine riboside. Multigram
quantities of diaminopurine riboside may be purchased from Schering
AG (Berlin) to provide 2'-O-(2-ethylacetyl) diaminopurine riboside
along with a minor amount of the 3'-O-isomer. 2'-O-(2-ethylacetyl)
diaminopurine riboside may be resolved and converted to
2'-O-(2-ethylacetyl)guanosine by treatment with adenosine
deaminase. (McGee, D. P. C., Cook, P. D., Guinosso, C. J., WO
94/02501 A1 940203.) Standard protection procedures should afford
2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine and
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'--
dimethoxytrityl)guanosine which may be reduced to provide
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-hydroxyethyl)-5'-O-(4,4'-dim-
ethoxytrityl)guanosine. As before the hydroxyl group may be
displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the
protected nucleoside may phosphitylated as usual to yield
2-N-isobutyryl-6-O-diphen-
ylcarbamoyl-2'-O-([2-phthalmidoxy]ethyl)-5'-O-(4,4'-dimethoxytrityl)guanos-
ine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite].
2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites
[0152] 2'-dimethylaminoethoxyethoxy nucleoside amidites (also known
in the art as 2'-O-dimethylaminoethoxyethyl, i.e.,
2'-O--CH.sub.2--O--CH.sub.2--- N(CH.sub.2).sub.2, or 2'-DMAEOE
nucleoside amidites) are prepared as follows. Other nucleoside
amidites are prepared similarly.
2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine
[0153] 2[2-(Dimethylamino)ethoxy]ethanol (Aldrich, 6.66 g, 50 mmol)
is slowly added to a solution of borane in tetra-hydrofuran (1 M,
10 mL, 10 mmol) with stirring in a 100 mL bomb. Hydrogen gas
evolves as the solid dissolves. O.sup.2-,2'-anhydro-5-methyluridine
(1.2 g, 5 mmol), and sodium bicarbonate (2.5 mg) are added and the
bomb is sealed, placed in an oil bath and heated to 155.degree. C.
for 26 hours. The bomb is cooled to room temperature and opened.
The crude solution is concentrated and the residue partitioned
between water (200 mL) and hexanes (200 mL). The excess phenol is
extracted into the hexane layer. The aqueous layer is extracted
with ethyl acetate (3.times.200 mL) and the combined organic layers
are washed once with water, dried over anhydrous sodium sulfate and
concentrated. The residue is columned on silica gel using
methanol/methylene chloride 1:20 (which has 2% triethylamine) as
the eluent. As the column fractions are concentrated a colorless
solid forms which is collected to give the title compound as a
white solid.
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-methyl
uridine
[0154] To 0.5 g (1.3 mmol) of
2'-O-[2(2-N,N-dimethylamino-ethoxy)ethyl)]-5- -methyl uridine in
anhydrous pyridine (8 mL), triethylamine (0.36 mL) and
dimethoxytrityl chloride (DMT-Cl, 0.87 g, 2 eq.) are added and
stirred for 1 hour. The reaction mixture is poured into water (200
mL) and extracted with CH.sub.2Cl.sub.2 (2.times.200 mL). The
combined CH.sub.2Cl.sub.2 layers are washed with saturated
NaHCO.sub.3 solution, followed by saturated NaCl solution and dried
over anhydrous sodium sulfate. Evaporation of the solvent followed
by silica gel chromatography using MeOH:CH.sub.2Cl.sub.2:Et.sub.3N
(20:1, v/v, with 1% triethylamine) gives the title compound.
5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-methyl
uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite
[0155] Diisopropylaminotetrazolide (0.6 g) and
2-cyanoethoxy-N,N-diisoprop- yl phosphoramidite (1.1 mL, 2 eq.) are
added to a solution of
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-methylur-
idine (2.17 g, 3 mmol) dissolved in CH.sub.2Cl.sub.2 (20 mL) under
an atmosphere of argon. The reaction mixture is stirred overnight
and the solvent evaporated. The resulting residue is purified by
silica gel flash column chromatography with ethyl acetate as the
eluent to give the title compound.
Example 2
Oligonucleotide synthesis
[0156] Unsubstituted and substituted phosphodiester (P.dbd.O)
oligonucleotides are synthesized on an automated DNA synthesizer
(Applied Biosystems model 380B) using standard phosphoramidite
chemistry with oxidation by iodine.
[0157] Phosphorothioates (P.dbd.S) are synthesized as for the
phosphodiester oligonucleotides except the standard oxidation
bottle was replaced by 0.2 M solution of 3H-1,2-benzodithiole-3-one
1,1-dioxide in acetonitrile for the stepwise thiation of the
phosphite linkages. The thiation wait step was increased to 68 sec
and was followed by the capping step. After cleavage from the CPG
column and deblocking in concentrated ammonium hydroxide at
55.degree. C. (18 h), the oligonucleotides were purified by
precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl
solution. Phosphinate oligonucleotides are prepared as described in
U.S. Pat. No. 5,508,270, herein incorporated by reference.
[0158] Alkyl phosphonate oligonucleotides are prepared as described
in U.S. Pat. No. 4,469,863, herein incorporated by reference.
[0159] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are
prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050,
herein incorporated by reference.
[0160] Phosphoramidite oligonucleotides are prepared as described
in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878, herein
incorporated by reference.
[0161] Alkylphosphonothioate oligonucleotides are prepared as
described in published PCT applications PCT/US94/00902 and
PCT/US93/06976 (published as WO 94/17093 and WO 94/02499,
respectively), herein incorporated by reference.
[0162] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are
prepared as described in U.S. Pat. No. 5,476,925, herein
incorporated by reference.
[0163] Phosphotriester oligonucleotides are prepared as described
in U.S. Pat. No. 5,023,243, herein incorporated by reference.
[0164] Borano phosphate oligonucleotides are prepared as described
in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated
by reference.
Example 3
Oligonucleoside synthesis
[0165] Methylenemethylimino linked oligonucleosides, also
identified as MMI linked oligonucleosides,
methylenedi-methylhydrazo linked oligonucleosides, also identified
as MDH linked oligonucleosides, and methylenecarbonylamino linked
oligonucleosides, also identified as amide-3 linked
oligonucleosides, and methyleneaminocarbonyl linked
oligo-nucleosides, also identified as amide-4 linked
oligonucleo-sides, as well as mixed backbone compounds having, for
instance, alternating MMI and P.dbd.O or P.dbd.S linkages are
prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023,
5,489,677, 5,602,240 and 5,610,289, all of which are herein
incorporated by reference.
[0166] Formacetal and thioformacetal linked oligonucleosides are
prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564,
herein incorporated by reference.
[0167] Ethylene oxide linked oligonucleosides are prepared as
described in U.S. Pat. No. 5,223,618, herein incorporated by
reference.
Example 4
PNA Synthesis
[0168] Peptide nucleic acids (PNAs) are prepared in accordance with
any of the various procedures referred to in Peptide Nucleic Acids
(PNA): Synthesis, Properties and Potential Applications, Bioorganic
& Medicinal Chemistry, 1996, 4, 5-23. They may also be prepared
in accordance with U.S. Pat. Nos. 5,539,082, 5,700,922, and
5,719,262, herein incorporated by reference.
Example 5
Synthesis of Chimeric Oligonucleotides
[0169] Chimeric oligonucleotides, oligonucleosides or mixed
oligonucleotides/oligonucleosides of the invention can be of
several different types. These include a first type wherein the
"gap" segment of linked nucleosides is positioned between 5' and 3'
"wing" segments of linked nucleosides and a second "open end" type
wherein the "gap" segment is located at either the 3' or the 5'
terminus of the oligomeric compound. Oligonucleotides of the first
type are also known in the art as "gapmers" or gapped
oligonucleotides. Oligonucleotides of the second type are also
known in the art as "hemimers" or "wingmers".
[2'-O-Me]--[2'-deoxy--[2'-O-Me]Chimeric Phosphorothioate
Oligonucleotides
[0170] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate
and 2'-deoxy phosphorothioate oligo-nucleotide segments are
synthesized using an Applied Biosystems automated DNA synthesizer
Model 380B, as above. Oligonucleotides are synthesized using the
automated synthesizer and
2'-deoxy-5'-dimethoxytrityl-3-O-phosphor-amidite for the DNA
portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for
5' and 3' wings. The standard synthesis cycle is modified by
increasing the wait step after the delivery of tetrazole and base
to 600 s repeated four times for RNA and twice for 2'-O-methyl. The
fully protected oligonucleotide is cleaved from the support and the
phosphate group is deprotected in 3:1 ammonia/ethanol at room
temperature overnight then lyophilized to dryness. Treatment in
methanolic ammonia for 24 hrs at room temperature is then done to
deprotect all bases and sample was again lyophilized to dryness.
The pellet is resuspended in 1M TBAF in THF for 24 hrs at room
temperature to deprotect the 2' positions. The reaction is then
quenched with 1M TEAA and the sample is then reduced to 1/2 volume
by rotovac before being desalted on a G25 size exclusion column.
The oligo recovered is then analyzed spectrophotometrically for
yield and for purity by capillary electrophoresis and by mass
spectrometry.
[2'-O-(2-Methoxyethyl)]--[2'-deoxy]--[2'-O-(Methoxyethyl)]Chimeric
Phosphorothioate. Oligonucleotides
[0171]
[2'-O-(2-methoxyethyl)]--[2'-deoxy]--[-2'-O-(methoxy-ethyl)]chimeri-
c phosphorothioate oligonucleotides were prepared as per the
procedure above for the 2'-O-methyl chimeric oligonucleotide, with
the substitution of 2'-O-(methoxyethyl) amidites for the
2'-O-methyl amidites.
[2'-O-(2-Methoxyethyl)Phosphodiester]--[2'-deoxy
Phosphorothioate]--[2'-O-- (2-Methoxyethyl).
Phosphodiester]Chimeric Oligonucleotides
[0172] [2'-O-(2-methoxyethyl phosphodiester]--[2'-deoxy
phos-phorothioate]--[2'-O-(methoxyethyl)phosphodiester]chimeric
oligonucleotides are prepared as per the above procedure for the
2'-O-methyl chimeric oligonucleotide with the substitution of
2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites,
oxidization with iodine to generate the phosphodiester
internucleotide linkages within the wing portions of the chimeric
structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate
internucleotide linkages for the center gap.
[0173] Other chimeric oligonucleotides, chimeric oligonucleo-sides
and mixed chimeric oligonucleotides/oligonucleosides are
synthesized according to U.S. Pat. No. 5,623,065, herein
incorporated by reference.
Example 6
Oligonucleotide Isolation
[0174] After cleavage from the controlled pore glass column
(Applied Biosystems) and deblocking in concentrated ammonium
hydroxide at 55.degree. C. for 18 hours, the oligonucleotides or
oligonucleosides are purified by precipitation twice out of 0.5 M
NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides were
analyzed by polyacrylamide gel electrophoresis on denaturing gels
and judged to be at least 85% full length material. The relative
amounts of phosphorothioate and phosphodiester linkages obtained in
synthesis were periodically checked by .sup.31p nuclear magnetic
resonance spectroscopy, and for some studies oligonucleotides were
purified by HPLC, as described by Chiang et al., J. Biol. Chem.
1991, 266, 18162-18171. Results obtained with HPLC-purified
material were similar to those obtained with non-HPLC purified
material.
Example 7
Oligonucleotide Synthesis--96 Well Plate Format
[0175] Oligonucleotides were synthesized via solid phase P(III)
phosphoramidite chemistry on an automated synthesizer capable of
assembling 96 sequences simultaneously in a standard 96 well
format. Phosphodiester internucleotide linkages were afforded by
oxidation with aqueous iodine. Phosphorothioate internucleotide
linkages were generated by sulfurization utilizing 3,H-1,2
benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous
acetonitrile. Standard base-protected beta-cyanoethyldiisopropyl
phosphoramidites were purchased from commercial vendors (e.g.
PE-Applied Biosystems, Foster City, Calif., or Pharmacia,
Piscataway, N.J.). Non-standard nucleosides are synthesized as per
known literature or patented methods. They are utilized as base
protected beta-cyanoethyldiisopropyl phosphoramidites.
[0176] Oligonucleotides were cleaved from support and deprotected
with concentrated NH.sub.4OH at elevated temperature (55-60.degree.
C.) for 12-16 hours and the released product then dried in vacuo.
The dried product was then re-suspended in sterile water to afford
a master plate from which all analytical and test plate samples are
then diluted utilizing robotic pipettors.
Example 8
Oligonucleotide Analysis--96 Well Plate Format
[0177] The concentration of oligonucleotide in each well was
assessed by dilution of samples and UV absorption spectroscopy. The
full-length integrity of the individual products was evaluated by
capillary electrophoresis (CE) in either the 96 well format
(Beckman P/ACE.TM. MDQ) or, for individually prepared samples, on a
commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270).
Base and backbone composition was confirmed by mass analysis of the
compounds utilizing electrospray-mass spectroscopy. All assay test
plates were diluted from the master plate using single and
multi-channel robotic pipettors. Plates were judged to be
acceptable if at least 85% of the compounds on the plate were at
least 85% full length.
Example 9
Cell Culture and Oligonucleotide Treatment
[0178] The effect of antisense compounds on target nucleic acid
expression can be tested in any of a variety of cell types provided
that the target nucleic acid is present at measurable levels. This
can be routinely determined using, for example, PCR or Northern
blot analysis. The following 7 cell types are provided for
illustrative purposes, but other cell types can be routinely used,
provided that the target is expressed in the cell type chosen. This
can be readily determined by methods routine in the art, for
example Northern blot analysis, Ribonuclease protection assays, or
RT-PCR.
[0179] T-24 Cells:
[0180] The human transitional cell bladder carcinoma cell line T-24
was obtained from the American Type Culture Collection (ATCC)
(Manassas, Va.). T-24 cells were routinely cultured in complete
McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, Md.)
supplemented with 10% fetal calf serum (Gibco/Life Technologies,
Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin
100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.).
Cells were routinely passaged by trypsinization and dilution when
they reached 90% confluence. Cells were seeded into 96-well plates
(Falcon-Primaria #3872) at a density of 7000 cells/well for use in
RT-PCR analysis.
[0181] For Northern blotting or other analysis, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
[0182] A549 cells:
[0183] The human lung carcinoma cell line A549 was obtained from
the American Type Culture Collection (ATCC) (Manassas, Va.). A549
cells were routinely cultured in DMEM basal media (Gibco/Life
Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf
serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100
units per mL, and streptomycin 100 micrograms per mL (Gibco/Life
Technologies, Gaithersburg, Md.). Cells were routinely passaged by
trypsinization and dilution when they reached 90% confluence.
[0184] NHDF Cells:
[0185] Human neonatal dermal fibroblast (NHDF) were obtained from
the Clonetics Corporation (Walkersville Md.). NHDFs were routinely
maintained in Fibroblast Growth Medium (Clonetics Corporation,
Walkersville Md.) supplemented as recommended by the supplier.
Cells were maintained for up to 10 passages as recommended by the
supplier.
[0186] HEK Cells:
[0187] Human embryonic keratinocytes (HEK) were obtained from the
Clonetics Corporation (Walkersville, Md.). HEKs were routinely
maintained in Keratinocyte Growth Medium (Clonetics Corporation,
Walkersville Md.) formulated as recommended by the supplier. Cells
were routinely maintained for up to 10 passages as recommended by
the supplier.
[0188] HepG2 Cells:
[0189] The human hepatoblastoma cell line HepG2 was obtained from
the American Type Culture Collection (Manassas, Va.). HepG2 cells
were routinely cultured in Eagle's MEM supplemented with 10% fetal
calf serum, non-essential amino acids, and 1 mM sodium pyruvate
(Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely
passaged by trypsinization and dilution when they reached 90%
confluence. Cells were seeded into 96-well plates (Falcon-Primaria
#3872) at a density of 7000 cells/well for use in RT-PCR
analysis.
[0190] For Northern blotting or other analyses, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
[0191] AML12 Cells:
[0192] AML12 (alpha mouse liver 12) cell line was established from
hepatocytes from a mouse (CD1 strain, line MT42) transgenic for
human TGF alpha. Cells are cultured in a 1:1 mixture of Dulbecco's
modified Eagle's medium and Ham's F12 medium with 0.005 mg/ml
insulin, 0.005 mg/ml transferrin, 5 ng/ml selenium, and 40 ng/ml
dexamethasone, and 90%; 10% fetal bovine serum. For subculturing,
spent medium is removed and fresh media of 0.25% trypsin, 0.03%
EDTA solution is added. Fresh trypsin solution (1 to 2 ml) is added
and the culture is left to sit at room temperature until the cells
detach.
[0193] Cells were routinely passaged by trypsinization and dilution
when they reached 90% confluence. Cells were seeded into 96-well
plates (Falcon-Primaria #3872) at a density of 7000 cells/well for
use in RT-PCR analysis.
[0194] For Northern blotting or other analyses, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
Primary Mouse Hepatocytes:
[0195] Primary mouse hepatocytes were prepared from CD-1 mice
purchased from Charles River Labs (Wilmington, Mass.) and were
routinely cultured in Hepatoyte Attachment Media (Gibco)
supplemented with 10Fetal Bovine Serum (Gibco/Life Technologies,
Gaithersburg, Md.), 250 nM dexamethasone (Sigma), and 10 nM bovine
insulin (Sigma). Cells were seeded into 96-well plates
(Falcon-Primaria #3872) at a density of 10000 cells/well for use in
RT-PCR analysis.
[0196] For Northern blotting or other analyses, cells are plated
onto 100 mm or other standard tissue culture plates coated with rat
tail collagen (200 ug/mL) (Becton Dickinson) and treated similarly
using appropriate volumes of medium and oligonucleotide.
[0197] Treatment with Antisense Compounds:
[0198] When cells reach 80% confluency, they are treated with
oligonucleotide. For cells grown in 96-well plates, wells are
washed once with 200 .mu.L OPTI-MEM.TM.-1 reduced-serum medium
(Gibco BRL) and then treated with 130 .mu.L of OPTI-MEM.TM.-1
containing 3.75 .mu.g/mL LIPOFECTIN.TM. (Gibco BRL) and the desired
concentration of oligonucleotide. After 4-7 hours of treatment, the
medium is replaced with fresh medium. Cells are harvested 16-24
hours after oligonucleotide treatment.
[0199] The concentration of oligonucleotide used varies from cell
line to cell line. To determine the optimal oligonucleotide
concentration for a particular cell line, the: cells are treated
with a positive control oligonucleotide at a range of
concentrations. For human cells the positive control
oligonucleotide is ISIS 13920, TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1,
a 2'-O-methoxyethyl gapmer (2'-O-methoxyethyls shown in bold) with
a phosphorothioate backbone which is targeted to human H-ras. For
mouse or rat cells the positive control oligonucleotide is ISIS
15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 2, a 2'-O-methoxyethyl
gapmer (2'-O-methoxyethyls shown in bold) with a phosphorothioate
backbone which is targeted to both mouse and rat c-raf. The
concentration of positive control oligonucleotide that results in
80% inhibition of c-Ha-ras (for ISIS 13920) or c-raf (for ISIS
15770) mRNA is then utilized as the screening concentration for new
oligonucleotides in subsequent experiments for that cell line. If
80% inhibition is not achieved, the lowest concentration of
positive control oligonucleotide that results in 60% inhibition of
H-ras or c-raf mRNA is then utilized as the oligonucleotide
screening concentration in subsequent experiments for that cell
line. If 60% inhibition is not achieved, that particular cell line
is deemed as unsuitable for oligonucleotide transfection
experiments.
Example 10
Analysis of oligonucleotide Inhibition of apolipoprotein(a)
Expression
[0200] Antisense modulation of apolipoprotein(a) expression can be
assayed in a variety of ways known in the art. For example,
apolipoprotein(a) mRNA levels can be quantitated by, e.g., Northern
blot analysis, competitive polymerase chain reaction (PCR), or
real-time PCR (RT-PCR). Real-time quantitative PCR is presently
preferred. RNA analysis can be performed on total cellular RNA or
poly(A)+ mRNA. Methods of RNA isolation are taught in, for example,
Ausubel, F. M. et al., Current Protocols in Molecular Biology,
Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons,
Inc., 1993. Northern blot analysis is routine in the art and is
taught in, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley &
Sons, Inc., 1996. Real-time quantitative (PCR) can be conveniently
accomplished using the commercially available ABI PRISM.TM. 7700
Sequence Detection System, available from PE-Applied Biosystems,
Foster City, Calif. and used according to manufacturer's
instructions.
[0201] Protein levels of apolipoprotein(a) can be quantitated in a
variety of ways well known in the art, such as immunoprecipitation,
Western blot analysis (immunoblotting), ELISA or
fluorescence-activated cell sorting (FACS). Antibodies directed to
apolipoprotein(a) can be identified and obtained from a variety of
sources, such as the MSRS catalog of antibodies (Aerie Corporation,
Birmingham, Mich.), or can be prepared via conventional antibody
generation methods. Methods for preparation of polyclonal-antisera
are taught in, for example, Ausubel, F. M. et al., Current
Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John
Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies
is taught in, for example, Ausubel, F. M. et al., Current Protocols
in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley
& Sons, Inc., 1997.
[0202] Immunoprecipitation methods are standard in the art and can
be found at, for example, Ausubel, F. M. et al., Current Protocols
in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley
& Sons, Inc., 1998. Western blot (immunoblot) analysis is
standard in the art and can be found at, for example, Ausubel, F.
M. et al., Current Protocols in Molecular Biology, Volume 2, pp.
10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked
immunosorbent assays (ELISA) are standard in the art and can be
found at, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley &
Sons, Inc., 1991.
Example 11
Poly(A)+ mRNA isolation
[0203] Poly(A)+ mRNA can be isolated according to Miura et al.,
Clin. Chem., 1996, 42, 1758-1764. Other methods for poly(A)+ mRNA
isolation are taught in, for example, Ausubel, F. M. et al.,
Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3,
John Wiley & Sons, Inc., 1993. Briefly, for cells grown on
96-well plates, growth medium is removed from the cells and each
well is washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10
mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM
vanadyl-ribonucleoside complex) is added to each well, the plate is
gently agitated and then incubated at room temperature for five
minutes. 55 .mu.L of lysate is transferred to Oligo d(T) coated
96-well plates (AGCT Inc., Irvine Calif.). Plates are incubated for
60 minutes at room temperature, washed 3 times with 200 .mu.L of
wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After
the final wash, the plate is blotted on paper towels to remove
excess wash buffer and then air-dried for 5 minutes. 60 .mu.L of
elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70.degree. C.
is added to each well, the plate is incubated on a 90.degree. C.
hot plate for 5 minutes, and the eluate is then transferred to a
fresh 96-well plate.
[0204] Cells grown on 100 mm or other standard plates may be
treated similarly, using appropriate volumes of all solutions.
Example 12
Total RNA Isolation
[0205] Total RNA can be isolated using an RNEASY 96.TM. kit and
buffers purchased from Qiagen Inc. (Valencia Calif.) following the
manufacturer's recommended procedures. Briefly, for cells grown on
96-well plates, growth medium is removed from the cells and each
well is washed with 200 .mu.L cold PBS. 100 .mu.L Buffer RLT is
added to each well and the plate vigorously agitated for 20
seconds. 100 .mu.L of 70% ethanol is then added to each well and
the contents mixed by pipetting three times up and down. The
samples are then transferred to the RNEASY 96.TM. well plate
attached to a QIAVAC.TM. manifold fitted with a waste collection
tray and attached to a vacuum source. Vacuum is applied for 15
seconds. 1 mL of Buffer RW1 was added to each well of the RNEASY
96.TM. plate and the vacuum again applied for 15 seconds. 1 mL of
Buffer RPE is then added to each well of the RNEASY 96.TM. plate
and the vacuum applied for a period of 15 seconds. The Buffer RPE
wash was then repeated and the vacuum is applied for an additional
10 minutes. The plate is then removed from the QIAVAC.TM. manifold
and blotted dry on paper towels. The plate is then re-attached to
the QIAVAC.TM. manifold fitted with a collection tube rack
containing 1.2 mL collection tubes. RNA is then eluted by pipetting
60 .mu.L water into each well, incubating 1 minute, and then
applying the vacuum for 30 seconds. The elution step is repeated
with an additional 60 .mu.L water.
[0206] The repetitive pipetting and elution steps may be automated
using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.).
Essentially, after lysing of the cells on the culture plate, the
plate is transferred to the robot deck where the pipetting, DNase
treatment and elution steps are carried out.
Example 13
Real-Time Quantitative PCR Analysis of apolipoprotein(a) mRNA
Levels
[0207] Quantitation of apolipoprotein(a) mRNA levels can be
determined by real-time quantitative PCR using the ABI PRISM.TM.
7700 Sequence Detection System (PE-Applied Biosystems, Foster City,
Calif.) according to manufacturer's instructions. This is a
closed-tube, non-gel-based, fluorescence detection system which
allows high-throughput quantitation of polymerase chain reaction
(PCR) products in real-time. As opposed to standard PCR, in which
amplification products are quantitated after the PCR is completed,
products in real-time quantitative PCR are quantitated as they
accumulate. This is accomplished by including in the PCR reaction
an oligonucleotide probe that anneals specifically between the
forward and reverse PCR primers, and contains two fluorescent dyes.
A reporter dye (e.g., JOE, FAM, or VIC, obtained from either Operon
Technologies Inc., Alameda, Calif. or PE-Applied Biosystems, Foster
City, Calif.) is attached to the 5' end of the probe and a quencher
dye (e.g., TAMRA, obtained from either Operon Technologies Inc.,
Alameda, Calif. or PE-Applied Biosystems, Foster City, Calif.) is
attached to the 3' end of the probe. When the probe and dyes are
intact, reporter dye emission is quenched by the proximity of the
3' quencher dye. During amplification, annealing of the probe to
the target sequence creates a substrate that can be cleaved by the
5'-exonuclease activity of Taq polymerase. During the extension
phase of the PCR amplification cycle, cleavage of the probe by Taq
polymerase releases the reporter dye from the remainder of the
probe (and hence from the quencher moiety) and a sequence-specific
fluorescent signal is generated. With each cycle, additional
reporter dye molecules are cleaved from their respective probes,
and the fluorescence intensity is monitored at regular intervals by
laser optics built into the ABI PRISMS .TM. 7700 Sequence Detection
System. In each assay, a series of parallel reactions containing
serial dilutions of mRNA from untreated control samples generates a
standard curve that is used to quantitate the percent inhibition
after antisense oligonucleotide treatment of test samples.
[0208] Prior to quantitative PCR analysis, primer-probe sets
specific to the target gene being measured are evaluated for their
ability to be "multiplexed" with a GAPDH amplification reaction. In
multiplexing, both the target gene and the internal standard gene
GAPDH are amplified concurrently in a single sample. In this
analysis, mRNA isolated from untreated cells is serially diluted.
Each dilution is amplified in the presence of primer-probe sets
specific for GAPDH only, target gene only ("single-plexing"), or
both (multiplexing). Following PCR amplification, standard curves
of GAPDH and target mRNA signal as a function of dilution are
generated from both the single-plexed and multiplexed samples. If
both the slope and correlation coefficient of the GAPDH and target
signals generated from the multiplexed samples fall within 10% of
their corresponding values generated from the single-plexed
samples, the primer-probe set specific for that target is deemed
multiplexable. Other methods of PCR are also known in the art.
[0209] PCR reagents are obtained from PE-Applied Biosystems, Foster
City, Calif. RT-PCR reactions are carried out by adding 25 .mu.L
PCR cocktail (1.times.TAQMAN.TM. buffer A, 5.5 mM MgCl.sub.2, 300
.mu.M each of dATP, dCTP and dGTP, 600 .mu.M of dUTP, 100 nM each
of forward primer, reverse primer, and probe, 20 Units RNAse
inhibitor, 1.25 Units AMPLITAQ GOLD.TM., and 12.5 Units MuLV
reverse transcriptase) to 96 well plates containing 25 .mu.L total
RNA solution. The RT reaction is carried out by incubation for 30
minutes at 48.degree. C. Following a 10 minute incubation at
95.degree. C. to activate the AMPLITAQ GOLD.TM., 40 cycles of a
two-step PCR protocol are carried out: 95.degree. C. for 15 seconds
(denaturation) followed by 60.degree. C. for 1.5 minutes
(annealing/extension).
[0210] Gene target quantities obtained by real time RT-PCR can be
normalized using either the expression level of GAPDH, a gene whose
expression is constant, or by quantifying total RNA using
RiboGreen.TM. (Molecular Probes, Inc. Eugene, Oreg.). GAPDH
expression is quantified by real time RT-PCR, by being run
simultaneously with the target, multiplexing, or separately. Total
RNA is quantified using RiboGreen.TM. RNA quantification reagent
from Molecular Probes (Eugene, Oreg.). Methods of RNA
quantification by RiboGreen.TM. are taught in Jones, L. J., et al,
Analytical Biochemistry, 1998, 265, 368-374.
[0211] In this assay, 175 .mu.L of RiboGreen.TM. working reagent
(RiboGreen.TM. reagent diluted 1:2865 in 10 mM Tris-HCl, 1 mM EDTA,
pH 7.5) is pipetted into a 96-well plate containing 25 uL purified,
cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied
Biosystems) with excitation at 480 nm and emission at 520 nm.
[0212] Probes and primers to human apolipoprotein(a) are designed
to hybridize to a human apolipoprotein(a) sequence, using published
sequence information (GenBank accession number NM.sub.--005577,
incorporated herein as SEQ ID NO: 3).
[0213] For human GAPDH the standard PCR primers are: forward
primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 4) reverse primer:
GAAGATGGTGATGGGATTTC (SEQ ID NO: 5) and the PCR probe is: 5'
JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO: 6) where JOE
(PE-Applied Biosystems, Foster City, Calif.) is the fluorescent
reporter dye) and TAMRA (PE-Applied Biosystems, Foster City,
Calif.) is the quencher dye.
Example 14
Northern Blot Analysis of apolipoprotein(a) mRNA Levels
[0214] Eighteen hours after antisense treatment, cell monolayers
are washed twice with cold PBS and lysed in 1 mL RNAZOL.TM.
(TEL-TEST "B" Inc., Friendswood, Tex.). Total RNA is prepared
following manufacturer's recommended protocols. Twenty micrograms
of total RNA is fractionated by electrophoresis through 1.2%
agarose gels containing 1.1% formaldehyde using a MOPS buffer
system (AMRESCO, Inc. Solon, Ohio). RNA is transferred from the gel
to HYBOND.TM.-N+ nylon membranes (Amersham Pharmacia Biotech,
Piscataway, N.J.) by overnight capillary transfer using a
Northern/Southern Transfer buffer system (TEL-TEST "B" Inc.,
Friendswood, Tex.). RNA transfer is confirmed by UV visualization.
Membranes are fixed by UV cross-linking using a STRATALINKER.TM. UV
Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then
probed using QUICKHYB.TM. hybridization solution (Stratagene, La
Jolla, Calif.) using manufacturer's recommendations for stringent
conditions.
[0215] To detect human apolipoprotein(a), a human apolipoprotein(a)
specific probe is prepared by PCR using a forward and a reverse
primer. To normalize for variations in loading and transfer
efficiency, membranes are stripped and probed for human
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech,
Palo Alto, Calif.).
[0216] Hybridized membranes are visualized and quantitated using a
PHOSPHORIMAGER.TM. and IMAGEQUANT.TM. Software V3.3 (Molecular
Dynamics, Sunnyvale, Calif.). Data are normalized to GAPDH levels
in untreated controls.
Example 15
Chimeric phosphorothioate oligonucleotides having 2'-MOE wings and
a deoxy gap targeting human apolipoprotein(a)
[0217] In accordance with the present invention, a series of
oligonucleotides were designed to target different regions of the
human apolipoprotein(a) RNA, using published sequence (GenBank
accession number NM.sub.--005577, incorporated herein as SEQ ID NO:
3). The oligonucleotides are shown in Table 1. "Target site"
indicates the first (5'-most) nucleotide number on the particular
target sequence to which the oligonucleotide binds. All compounds
in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides
in length, composed of a central "gap" region consisting of ten
2'-deoxynucleotides, which is flanked on both sides (5' and
3'directions) by five-nucleotide "wings". The wings are composed of
2'-methoxyethyl (2'-MOE)nucleotides. The internucleoside (backbone)
linkages are phosphorothioate (P.dbd.S) throughout the
oligonucleotide. All cytidine residues are 5-methylcytidines.
1TABLE 1 Chimeric phosphorothioate oligonucleotides having 2'-MOE
wings and a deoxy gap targeting human apolipoprotein(a) TARGET SEQ
SEQ ID TARGET ID ISIS # REGION NO SITE SEQUENCE NO 144367 Coding 3
174 GGCAGGTCCTTCCTGTGACA 7 144368 Coding 3 352 TCTGCGTCTGAGCATTGCGT
8 144369 Coding 3 522 AAGCTTGGCAGGTTCTTCCT 9 144370 Coding 3 1743
TCGGAGGCGCGACGGCAGTC 10 144371 Coding 3 2768 CGGAGGCGCGACGGCAGTCC
11 144372 Coding 3 2910 GGCAGGTTCTTCCTGTGACA 12 144373 Coding 3
3371 ATAACAATAAGGAGCTGCCA 13 144374 Coding 3 4972
GACCAAGCTTGGCAGGTTCT 14 144375 Coding 3 5080 TAACAATAAGGAGCTGCCAC
15 144376 Coding 3 5315 TGACCAAGCTTGGCAGGTTC 16 144377 Coding 3
5825 TTCTGCGTCTGAGCATTGCG 17 144378 Coding 3 6447
AACAATAAGGAGCTGCCACA 18 144379 Coding 3 7155 ACCTGACACCGGGATCCCTC
19 144380 Coding 3 7185 CTGAGCATTGCGTCAGGTTG 20 144381 Coding 3
8463 AGTAGTTCATGATCAAGCCA 21 144382 Coding 3 8915
GACGGCAGTCCCTTCTGCGT 22 144383 Coding 3 9066 GGCAGGTTCTTCCAGTGACA
23 144384 Coding 3 10787 TGACCAAGCTTGGCAAGTTC 24 144385 Coding 3
11238 TATAACACCAAGGACTAATC 25 144386 Coding 3 11261
CCATCTGACATTGGGATCCA 26 144387 Coding 3 11461 TGTGGTGTCATAGAGGACCA
27 144388 Coding 3 11823 ATGGGATCCTCCGATGCCAA 28 144389 Coding 3
11894 ACACCAAGGGCGAATCTCAG 29 144390 Coding 3 11957
TTCTGTCACTGGACATCGTG 30 144391 Coding 3 12255 CACACGGATCGGTTGTGTAA
31 144392 Coding 3 12461 ACATGTCCTTCCTGTGACAG 32 144393 Coding 3
12699 CAGAAGGAGGCCCTAGGCTT 33 144394 Coding 3 13354
CTGGCGGTGACCATGTAGTC 34 144395 3'UTR 3 13711 TCTAAGTAGGTTGATGCTTC
35 144396 3'UTR 3 13731 TCCTTACCCACGTTTCAGCT 36 144397 3'UTR 3
13780 GGAACAGTGTCTTCGTTTGA 37 144398 3'UTR 3 13801
GTTTGGCATAGCTGGTAGCT 38 144399 3'UTR 3 13841 ACCTTAAAAGCTTATACACA
39 144400 3'UTR 3 13861 ATACAGAATTTGTCAGTCAG 40 144401 3'UTR 3
13881 GTCATAGCTATGACACCTTA 41
Example 16
Western Blot Analysis of apolipoprotein(a) Protein Levels
[0218] Western blot analysis (immunoblot analysis) is carried out
using standard methods. Cells are harvested 16-20 h after
oligonucleotide treatment, washed once with PBS, suspended in
Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a
16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and
transferred to membrane for western blotting. Appropriate primary
antibody directed to apolipoprotein(a) is used, with a
radiolabelled or fluorescently labeled secondary antibody directed
against the primary antibody species. Bands are visualized,using a
PHOSPHORIMAGER.TM. (Molecular Dynamics, Sunnyvale Calif.).
Sequence CWU 1
1
41 1 20 DNA Artificial Sequence Antisense Oligonucleotide 1
tccgtcatcg ctcctcaggg 20 2 20 DNA Artificial Sequence Antisense
Oligonucleotide 2 atgcattctg cccccaagga 20 3 13938 DNA Homo sapiens
CDS (46)...(13692) 3 ctgggattgg gacacacttt ctggacactg ctggccagtc
ccaaa atg gaa cat aag 57 Met Glu His Lys 1 gaa gtg gtt ctt cta ctt
ctt tta ttt ctg aaa tca gca gca cct gag 105 Glu Val Val Leu Leu Leu
Leu Leu Phe Leu Lys Ser Ala Ala Pro Glu 5 10 15 20 caa agc cat gtg
gtc cag gat tgc tac cat ggt gat gga cag agt tat 153 Gln Ser His Val
Val Gln Asp Cys Tyr His Gly Asp Gly Gln Ser Tyr 25 30 35 cga ggc
acg tac tcc acc act gtc aca gga agg acc tgc caa gct tgg 201 Arg Gly
Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp 40 45 50
tca tct atg aca cca cat caa cat aat agg acc aca gaa aac tac cca 249
Ser Ser Met Thr Pro His Gln His Asn Arg Thr Thr Glu Asn Tyr Pro 55
60 65 aat gct ggc ttg atc atg aac tac tgc agg aat cca gat gct gtg
gca 297 Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val
Ala 70 75 80 gct cct tat tgt tat acg agg gat ccc ggt gtc agg tgg
gag tac tgc 345 Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp
Glu Tyr Cys 85 90 95 100 aac ctg acg caa tgc tca gac gca gaa ggg
act gcc gtc gcg cct ccg 393 Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly
Thr Ala Val Ala Pro Pro 105 110 115 act gtt acc ccg gtt cca agc cta
gag gct cct tcc gaa caa gca ccg 441 Thr Val Thr Pro Val Pro Ser Leu
Glu Ala Pro Ser Glu Gln Ala Pro 120 125 130 act gag caa agg cct ggg
gtg cag gag tgc tac cat ggt aat gga cag 489 Thr Glu Gln Arg Pro Gly
Val Gln Glu Cys Tyr His Gly Asn Gly Gln 135 140 145 agt tat cga ggc
aca tac tcc acc act gtc aca gga aga acc tgc caa 537 Ser Tyr Arg Gly
Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln 150 155 160 gct tgg
tca tct atg aca cca cac tcg cat agt cgg acc cca gaa tac 585 Ala Trp
Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr 165 170 175
180 tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca gat gct
633 Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala
185 190 195 gtg gca gct cct tat tgt tat acg agg gat ccc ggt gtc agg
tgg gag 681 Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg
Trp Glu 200 205 210 tac tgc aac ctg acg caa tgc tca gac gca gaa ggg
act gcc gtc gcg 729 Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly
Thr Ala Val Ala 215 220 225 cct ccg act gtt acc ccg gtt cca agc cta
gag gct cct tcc gaa caa 777 Pro Pro Thr Val Thr Pro Val Pro Ser Leu
Glu Ala Pro Ser Glu Gln 230 235 240 gca ccg act gag caa agg cct ggg
gtg cag gag tgc tac cat ggt aat 825 Ala Pro Thr Glu Gln Arg Pro Gly
Val Gln Glu Cys Tyr His Gly Asn 245 250 255 260 gga cag agt tat cga
ggc aca tac tcc acc act gtc aca gga aga acc 873 Gly Gln Ser Tyr Arg
Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr 265 270 275 tgc caa gct
tgg tca tct atg aca cca cac tcg cat agt cgg acc cca 921 Cys Gln Ala
Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro 280 285 290 gaa
tac tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca 969 Glu
Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro 295 300
305 gat gct gtg gca gct cct tat tgt tat acg agg gat ccc ggt gtc agg
1017 Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp Pro Gly Val
Arg 310 315 320 tgg gag tac tgc aac ctg acg caa tgc tca gac gca gaa
ggg act gcc 1065 Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp Ala
Glu Gly Thr Ala 325 330 335 340 gtc gcg cct ccg act gtt acc ccg gtt
cca agc cta gag gct cct tcc 1113 Val Ala Pro Pro Thr Val Thr Pro
Val Pro Ser Leu Glu Ala Pro Ser 345 350 355 gaa caa gca ccg act gag
caa agg cct ggg gtg cag gag tgc tac cat 1161 Glu Gln Ala Pro Thr
Glu Gln Arg Pro Gly Val Gln Glu Cys Tyr His 360 365 370 ggt aat gga
cag agt tat cga ggc aca tac tcc acc act gtc aca gga 1209 Gly Asn
Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly 375 380 385
aga acc tgc caa gct tgg tca tct atg aca cca cac tcg cat agt cgg
1257 Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser
Arg 390 395 400 acc cca gaa tac tac cca aat gct ggc ttg atc atg aac
tac tgc agg 1305 Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met
Asn Tyr Cys Arg 405 410 415 420 aat cca gat gct gtg gca gct cct tat
tgt tat acg agg gat ccc ggt 1353 Asn Pro Asp Ala Val Ala Ala Pro
Tyr Cys Tyr Thr Arg Asp Pro Gly 425 430 435 gtc agg tgg gag tac tgc
aac ctg acg caa tgc tca gac gca gaa ggg 1401 Val Arg Trp Glu Tyr
Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly 440 445 450 act gcc gtc
gcg cct ccg act gtt acc ccg gtt cca agc cta gag gct 1449 Thr Ala
Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala 455 460 465
cct tcc gaa caa gca ccg act gag caa agg cct ggg gtg cag gag tgc
1497 Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu
Cys 470 475 480 tac cat ggt aat gga cag agt tat cga ggc aca tac tcc
acc act gtc 1545 Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr
Ser Thr Thr Val 485 490 495 500 aca gga aga acc tgc caa gct tgg tca
tct atg aca cca cac tcg cat 1593 Thr Gly Arg Thr Cys Gln Ala Trp
Ser Ser Met Thr Pro His Ser His 505 510 515 agt cgg acc cca gaa tac
tac cca aat gct ggc ttg atc atg aac tac 1641 Ser Arg Thr Pro Glu
Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr 520 525 530 tgc agg aat
cca gat gct gtg gca gct cct tat tgt tat acg agg gat 1689 Cys Arg
Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp 535 540 545
ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc tca gac gca
1737 Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln Cys Ser Asp
Ala 550 555 560 gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg gtt
cca agc cta 1785 Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr Pro
Val Pro Ser Leu 565 570 575 580 gag gct cct tcc gaa caa gca ccg act
gag caa agg cct ggg gtg cag 1833 Glu Ala Pro Ser Glu Gln Ala Pro
Thr Glu Gln Arg Pro Gly Val Gln 585 590 595 gag tgc tac cat ggt aat
gga cag agt tat cga ggc aca tac tcc acc 1881 Glu Cys Tyr His Gly
Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser Thr 600 605 610 act gtc aca
gga aga acc tgc caa gct tgg tca tct atg aca cca cac 1929 Thr Val
Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser Met Thr Pro His 615 620 625
tcg cat agt cgg acc cca gaa tac tac cca aat gct ggc ttg atc atg
1977 Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile
Met 630 635 640 aac tac tgc agg aat cca gat gct gtg gca gct cct tat
tgt tat acg 2025 Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro
Tyr Cys Tyr Thr 645 650 655 660 agg gat ccc ggt gtc agg tgg gag tac
tgc aac ctg acg caa tgc tca 2073 Arg Asp Pro Gly Val Arg Trp Glu
Tyr Cys Asn Leu Thr Gln Cys Ser 665 670 675 gac gca gaa ggg act gcc
gtc gcg cct ccg act gtt acc ccg gtt cca 2121 Asp Ala Glu Gly Thr
Ala Val Ala Pro Pro Thr Val Thr Pro Val Pro 680 685 690 agc cta gag
gct cct tcc gaa caa gca ccg act gag caa agg cct ggg 2169 Ser Leu
Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly 695 700 705
gtg cag gag tgc tac cat ggt aat gga cag agt tat cga ggc aca tac
2217 Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr
Tyr 710 715 720 tcc acc act gtc aca gga aga acc tgc caa gct tgg tca
tct atg aca 2265 Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp
Ser Ser Met Thr 725 730 735 740 cca cac tcg cat agt cgg acc cca gaa
tac tac cca aat gct ggc ttg 2313 Pro His Ser His Ser Arg Thr Pro
Glu Tyr Tyr Pro Asn Ala Gly Leu 745 750 755 atc atg aac tac tgc agg
aat cca gat gct gtg gca gct cct tat tgt 2361 Ile Met Asn Tyr Cys
Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys 760 765 770 tat acg agg
gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa 2409 Tyr Thr
Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln 775 780 785
tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg act gtt acc ccg
2457 Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro Thr Val Thr
Pro 790 795 800 gtt cca agc cta gag gct cct tcc gaa caa gca ccg act
gag caa agg 2505 Val Pro Ser Leu Glu Ala Pro Ser Glu Gln Ala Pro
Thr Glu Gln Arg 805 810 815 820 cct ggg gtg cag gag tgc tac cat ggt
aat gga cag agt tat cga ggc 2553 Pro Gly Val Gln Glu Cys Tyr His
Gly Asn Gly Gln Ser Tyr Arg Gly 825 830 835 aca tac tcc acc act gtc
aca gga aga acc tgc caa gct tgg tca tct 2601 Thr Tyr Ser Thr Thr
Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser 840 845 850 atg aca cca
cac tcg cat agt cgg acc cca gaa tac tac cca aat gct 2649 Met Thr
Pro His Ser His Ser Arg Thr Pro Glu Tyr Tyr Pro Asn Ala 855 860 865
ggc ttg atc atg aac tac tgc agg aat cca gat gct gtg gca gct cct
2697 Gly Leu Ile Met Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala
Pro 870 875 880 tat tgt tat acg agg gat ccc ggt gtc agg tgg gag tac
tgc aac ctg 2745 Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu
Tyr Cys Asn Leu 885 890 895 900 acg caa tgc tca gac gca gaa ggg act
gcc gtc gcg cct ccg act gtt 2793 Thr Gln Cys Ser Asp Ala Glu Gly
Thr Ala Val Ala Pro Pro Thr Val 905 910 915 acc ccg gtt cca agc cta
gag gct cct tcc gaa caa gca ccg act gag 2841 Thr Pro Val Pro Ser
Leu Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu 920 925 930 caa agg cct
ggg gtg cag gag tgc tac cat ggt aat gga cag agt tat 2889 Gln Arg
Pro Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr 935 940 945
cga ggc aca tac tcc acc act gtc aca gga aga acc tgc caa gct tgg
2937 Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala
Trp 950 955 960 tca tct atg aca cca cac tcg cat agt cgg acc cca gaa
tac tac cca 2985 Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro
Glu Tyr Tyr Pro 965 970 975 980 aat gct ggc ttg atc atg aac tac tgc
agg aat cca gat gct gtg gca 3033 Asn Ala Gly Leu Ile Met Asn Tyr
Cys Arg Asn Pro Asp Ala Val Ala 985 990 995 gct cct tat tgt tat acg
agg gat ccc ggt gtc agg tgg gag tac tgc 3081 Ala Pro Tyr Cys Tyr
Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys 1000 1005 1010 aac ctg
acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg 3129 Asn
Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro Pro 1015
1020 1025 act gtt acc ccg gtt cca agc cta gag gct cct tcc gaa caa
gca ccg 3177 Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu
Gln Ala Pro 1030 1035 1040 act gag caa agg cct ggg gtg cag gag tgc
tac cat ggt aat gga cag 3225 Thr Glu Gln Arg Pro Gly Val Gln Glu
Cys Tyr His Gly Asn Gly Gln 1045 1050 1055 1060 agt tat cga ggc aca
tac tcc acc act gtc aca gga aga acc tgc caa 3273 Ser Tyr Arg Gly
Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln 1065 1070 1075 gct
tgg tca tct atg aca cca cac tcg cat agt cgg acc cca gaa tac 3321
Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro Glu Tyr
1080 1085 1090 tac cca aat gct ggc ttg atc atg aac tac tgc agg aat
cca gat gct 3369 Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg
Asn Pro Asp Ala 1095 1100 1105 gtg gca gct cct tat tgt tat acg agg
gat ccc ggt gtc agg tgg gag 3417 Val Ala Ala Pro Tyr Cys Tyr Thr
Arg Asp Pro Gly Val Arg Trp Glu 1110 1115 1120 tac tgc aac ctg acg
caa tgc tca gac gca gaa ggg act gcc gtc gcg 3465 Tyr Cys Asn Leu
Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala 1125 1130 1135 1140
cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc gaa caa
3513 Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser Glu
Gln 1145 1150 1155 gca ccg act gag caa agg cct ggg gtg cag gag tgc
tac cat ggt aat 3561 Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu
Cys Tyr His Gly Asn 1160 1165 1170 gga cag agt tat cga ggc aca tac
tcc acc act gtc aca gga aga acc 3609 Gly Gln Ser Tyr Arg Gly Thr
Tyr Ser Thr Thr Val Thr Gly Arg Thr 1175 1180 1185 tgc caa gct tgg
tca tct atg aca cca cac tcg cat agt cgg acc cca 3657 Cys Gln Ala
Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro 1190 1195 1200
gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca
3705 Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn
Pro 1205 1210 1215 1220 gat gct gtg gca gct cct tat tgt tat acg agg
gat ccc ggt gtc agg 3753 Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr
Arg Asp Pro Gly Val Arg 1225 1230 1235 tgg gag tac tgc aac ctg acg
caa tgc tca gac gca gaa ggg act gcc 3801 Trp Glu Tyr Cys Asn Leu
Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala 1240 1245 1250 gtc gcg cct
ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc 3849 Val Ala
Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser 1255 1260
1265 gaa caa gca ccg act gag caa agg cct ggg gtg cag gag tgc tac
cat 3897 Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys
Tyr His 1270 1275 1280 ggt aat gga cag agt tat cga ggc aca tac tcc
acc act gtc aca gga 3945 Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr
Ser Thr Thr Val Thr Gly 1285 1290 1295 1300 aga acc tgc caa gct tgg
tca tct atg aca cca cac tcg cat agt cgg 3993 Arg Thr Cys Gln Ala
Trp Ser Ser Met Thr Pro His Ser His Ser Arg 1305 1310 1315 acc cca
gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc agg 4041 Thr
Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg 1320
1325 1330 aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat
ccc ggt 4089 Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg
Asp Pro Gly 1335 1340 1345 gtc agg tgg gag tac tgc aac ctg acg caa
tgc tca gac gca gaa ggg 4137 Val Arg Trp Glu Tyr Cys Asn Leu Thr
Gln Cys Ser Asp Ala Glu Gly 1350 1355 1360 act gcc gtc gcg cct ccg
act gtt acc ccg gtt cca agc cta gag gct 4185 Thr Ala Val Ala Pro
Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala 1365 1370 1375 1380 cct
tcc gaa caa gca ccg act gag caa agg cct ggg gtg cag gag tgc 4233
Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys
1385 1390 1395 tac cat ggt aat gga cag agt tat cga ggc aca tac tcc
acc act gtc 4281 Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr
Ser Thr Thr Val 1400 1405 1410 aca gga aga acc tgc caa gct tgg tca
tct atg aca cca cac tcg cat 4329 Thr Gly Arg Thr Cys Gln Ala Trp
Ser Ser Met Thr Pro His Ser His 1415 1420 1425 agt cgg acc cca gaa
tac tac cca aat gct ggc ttg atc atg aac tac 4377 Ser Arg Thr Pro
Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr 1430 1435 1440 tgc
agg aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat 4425
Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp
1445 1450 1455 1460 ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa
tgc tca gac gca 4473 Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr
Gln Cys Ser Asp Ala 1465 1470 1475 gaa ggg act gcc gtc
gcg cct ccg act gtt acc ccg gtt cca agc cta 4521 Glu Gly Thr Ala
Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu 1480 1485 1490 gag
gct cct tcc gaa caa gca ccg act gag caa agg cct ggg gtg cag 4569
Glu Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln
1495 1500 1505 gag tgc tac cat ggt aat gga cag agt tat cga ggc aca
tac tcc acc 4617 Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly
Thr Tyr Ser Thr 1510 1515 1520 act gtc aca gga aga acc tgc caa gct
tgg tca tct atg aca cca cac 4665 Thr Val Thr Gly Arg Thr Cys Gln
Ala Trp Ser Ser Met Thr Pro His 1525 1530 1535 1540 tcg cat agt cgg
acc cca gaa tac tac cca aat gct ggc ttg atc atg 4713 Ser His Ser
Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met 1545 1550 1555
aac tac tgc agg aat cca gat gct gtg gca gct cct tat tgt tat acg
4761 Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr
Thr 1560 1565 1570 agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg
acg caa tgc tca 4809 Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn
Leu Thr Gln Cys Ser 1575 1580 1585 gac gca gaa ggg act gcc gtc gcg
cct ccg act gtt acc ccg gtt cca 4857 Asp Ala Glu Gly Thr Ala Val
Ala Pro Pro Thr Val Thr Pro Val Pro 1590 1595 1600 agc cta gag gct
cct tcc gaa caa gca ccg act gag caa agg cct ggg 4905 Ser Leu Glu
Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly 1605 1610 1615
1620 gtg cag gag tgc tac cat ggt aat gga cag agt tat cga ggc aca
tac 4953 Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly
Thr Tyr 1625 1630 1635 tcc acc act gtc aca gga aga acc tgc caa gct
tgg tca tct atg aca 5001 Ser Thr Thr Val Thr Gly Arg Thr Cys Gln
Ala Trp Ser Ser Met Thr 1640 1645 1650 cca cac tcg cat agt cgg acc
cca gaa tac tac cca aat gct ggc ttg 5049 Pro His Ser His Ser Arg
Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu 1655 1660 1665 atc atg aac
tac tgc agg aat cca gat gct gtg gca gct cct tat tgt 5097 Ile Met
Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys 1670 1675
1680 tat acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg
caa 5145 Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu
Thr Gln 1685 1690 1695 1700 tgc tca gac gca gaa ggg act gcc gtc gcg
cct ccg act gtt acc ccg 5193 Cys Ser Asp Ala Glu Gly Thr Ala Val
Ala Pro Pro Thr Val Thr Pro 1705 1710 1715 gtt cca agc cta gag gct
cct tcc gaa caa gca ccg act gag caa agg 5241 Val Pro Ser Leu Glu
Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg 1720 1725 1730 cct ggg
gtg cag gag tgc tac cat ggt aat gga cag agt tat cga ggc 5289 Pro
Gly Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly 1735
1740 1745 aca tac tcc acc act gtc aca gga aga acc tgc caa gct tgg
tca tct 5337 Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala
Trp Ser Ser 1750 1755 1760 atg aca cca cac tcg cat agt cgg acc cca
gaa tac tac cca aat gct 5385 Met Thr Pro His Ser His Ser Arg Thr
Pro Glu Tyr Tyr Pro Asn Ala 1765 1770 1775 1780 ggc ttg atc atg aac
tac tgc agg aat cca gat gct gtg gca gct cct 5433 Gly Leu Ile Met
Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro 1785 1790 1795 tat
tgt tat acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg 5481
Tyr Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu
1800 1805 1810 acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct
ccg act gtt 5529 Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala
Pro Pro Thr Val 1815 1820 1825 acc ccg gtt cca agc cta gag gct cct
tcc gaa caa gca ccg act gag 5577 Thr Pro Val Pro Ser Leu Glu Ala
Pro Ser Glu Gln Ala Pro Thr Glu 1830 1835 1840 caa agg cct ggg gtg
cag gag tgc tac cat ggt aat gga cag agt tat 5625 Gln Arg Pro Gly
Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr 1845 1850 1855 1860
cga ggc aca tac tcc acc act gtc aca gga aga acc tgc caa gct tgg
5673 Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala
Trp 1865 1870 1875 tca tct atg aca cca cac tcg cat agt cgg acc cca
gaa tac tac cca 5721 Ser Ser Met Thr Pro His Ser His Ser Arg Thr
Pro Glu Tyr Tyr Pro 1880 1885 1890 aat gct ggc ttg atc atg aac tac
tgc agg aat cca gat gct gtg gca 5769 Asn Ala Gly Leu Ile Met Asn
Tyr Cys Arg Asn Pro Asp Ala Val Ala 1895 1900 1905 gct cct tat tgt
tat acg agg gat ccc ggt gtc agg tgg gag tac tgc 5817 Ala Pro Tyr
Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys 1910 1915 1920
aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg
5865 Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro
Pro 1925 1930 1935 1940 act gtt acc ccg gtt cca agc cta gag gct cct
tcc gaa caa gca ccg 5913 Thr Val Thr Pro Val Pro Ser Leu Glu Ala
Pro Ser Glu Gln Ala Pro 1945 1950 1955 act gag caa agg cct ggg gtg
cag gag tgc tac cat ggt aat gga cag 5961 Thr Glu Gln Arg Pro Gly
Val Gln Glu Cys Tyr His Gly Asn Gly Gln 1960 1965 1970 agt tat cga
ggc aca tac tcc acc act gtc aca gga aga acc tgc caa 6009 Ser Tyr
Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln 1975 1980
1985 gct tgg tca tct atg aca cca cac tcg cat agt cgg acc cca gaa
tac 6057 Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro
Glu Tyr 1990 1995 2000 tac cca aat gct ggc ttg atc atg aac tac tgc
agg aat cca gat gct 6105 Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr
Cys Arg Asn Pro Asp Ala 2005 2010 2015 2020 gtg gca gct cct tat tgt
tat acg agg gat ccc ggt gtc agg tgg gag 6153 Val Ala Ala Pro Tyr
Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu 2025 2030 2035 tac tgc
aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg 6201 Tyr
Cys Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala 2040
2045 2050 cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc
gaa caa 6249 Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro
Ser Glu Gln 2055 2060 2065 gca ccg act gag caa agg cct ggg gtg cag
gag tgc tac cat ggt aat 6297 Ala Pro Thr Glu Gln Arg Pro Gly Val
Gln Glu Cys Tyr His Gly Asn 2070 2075 2080 gga cag agt tat cga ggc
aca tac tcc acc act gtc aca gga aga acc 6345 Gly Gln Ser Tyr Arg
Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr 2085 2090 2095 2100 tgc
caa gct tgg tca tct atg aca cca cac tcg cat agt cgg acc cca 6393
Cys Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro
2105 2110 2115 gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc
agg aat cca 6441 Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr
Cys Arg Asn Pro 2120 2125 2130 gat gct gtg gca gct cct tat tgt tat
acg agg gat ccc ggt gtc agg 6489 Asp Ala Val Ala Ala Pro Tyr Cys
Tyr Thr Arg Asp Pro Gly Val Arg 2135 2140 2145 tgg gag tac tgc aac
ctg acg caa tgc tca gac gca gaa ggg act gcc 6537 Trp Glu Tyr Cys
Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala 2150 2155 2160 gtc
gcg cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc 6585
Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser
2165 2170 2175 2180 gaa caa gca ccg act gag caa agg cct ggg gtg cag
gag tgc tac cat 6633 Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val
Gln Glu Cys Tyr His 2185 2190 2195 ggt aat gga cag agt tat cga ggc
aca tac tcc acc act gtc aca gga 6681 Gly Asn Gly Gln Ser Tyr Arg
Gly Thr Tyr Ser Thr Thr Val Thr Gly 2200 2205 2210 aga acc tgc caa
gct tgg tca tct atg aca cca cac tcg cat agt cgg 6729 Arg Thr Cys
Gln Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg 2215 2220 2225
acc cca gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc agg
6777 Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys
Arg 2230 2235 2240 aat cca gat gct gtg gca gct cct tat tgt tat acg
agg gat ccc ggt 6825 Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr
Thr Arg Asp Pro Gly 2245 2250 2255 2260 gtc agg tgg gag tac tgc aac
ctg acg caa tgc tca gac gca gaa ggg 6873 Val Arg Trp Glu Tyr Cys
Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly 2265 2270 2275 act gcc gtc
gcg cct ccg act gtt acc ccg gtt cca agc cta gag gct 6921 Thr Ala
Val Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala 2280 2285
2290 cct tcc gaa caa gca ccg act gag caa agg cct ggg gtg cag gag
tgc 6969 Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln
Glu Cys 2295 2300 2305 tac cat ggt aat gga cag agt tat cga ggc aca
tac tcc acc act gtc 7017 Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly
Thr Tyr Ser Thr Thr Val 2310 2315 2320 aca gga aga acc tgc caa gct
tgg tca tct atg aca cca cac tcg cat 7065 Thr Gly Arg Thr Cys Gln
Ala Trp Ser Ser Met Thr Pro His Ser His 2325 2330 2335 2340 agt cgg
acc cca gaa tac tac cca aat gct ggc ttg atc atg aac tac 7113 Ser
Arg Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr 2345
2350 2355 tgc agg aat cca gat gct gtg gca gct cct tat tgt tat acg
agg gat 7161 Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr
Thr Arg Asp 2360 2365 2370 ccc ggt gtc agg tgg gag tac tgc aac ctg
acg caa tgc tca gac gca 7209 Pro Gly Val Arg Trp Glu Tyr Cys Asn
Leu Thr Gln Cys Ser Asp Ala 2375 2380 2385 gaa ggg act gcc gtc gcg
cct ccg act gtt acc ccg gtt cca agc cta 7257 Glu Gly Thr Ala Val
Ala Pro Pro Thr Val Thr Pro Val Pro Ser Leu 2390 2395 2400 gag gct
cct tcc gaa caa gca ccg act gag caa agg cct ggg gtg cag 7305 Glu
Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln 2405
2410 2415 2420 gag tgc tac cat ggt aat gga cag agt tat cga ggc aca
tac tcc acc 7353 Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly
Thr Tyr Ser Thr 2425 2430 2435 act gtc aca gga aga acc tgc caa gct
tgg tca tct atg aca cca cac 7401 Thr Val Thr Gly Arg Thr Cys Gln
Ala Trp Ser Ser Met Thr Pro His 2440 2445 2450 tcg cat agt cgg acc
cca gaa tac tac cca aat gct ggc ttg atc atg 7449 Ser His Ser Arg
Thr Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met 2455 2460 2465 aac
tac tgc agg aat cca gat gct gtg gca gct cct tat tgt tat acg 7497
Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr
2470 2475 2480 agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg
caa tgc tca 7545 Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu
Thr Gln Cys Ser 2485 2490 2495 2500 gac gca gaa ggg act gcc gtc gcg
cct ccg act gtt acc ccg gtt cca 7593 Asp Ala Glu Gly Thr Ala Val
Ala Pro Pro Thr Val Thr Pro Val Pro 2505 2510 2515 agc cta gag gct
cct tcc gaa caa gca ccg act gag caa agg cct ggg 7641 Ser Leu Glu
Ala Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly 2520 2525 2530
gtg cag gag tgc tac cat ggt aat gga cag agt tat cga ggc aca tac
7689 Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr
Tyr 2535 2540 2545 tcc acc act gtc aca gga aga acc tgc caa gct tgg
tca tct atg aca 7737 Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala
Trp Ser Ser Met Thr 2550 2555 2560 cca cac tcg cat agt cgg acc cca
gaa tac tac cca aat gct ggc ttg 7785 Pro His Ser His Ser Arg Thr
Pro Glu Tyr Tyr Pro Asn Ala Gly Leu 2565 2570 2575 2580 atc atg aac
tac tgc agg aat cca gat gct gtg gca gct cct tat tgt 7833 Ile Met
Asn Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys 2585 2590
2595 tat acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg acg
caa 7881 Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu
Thr Gln 2600 2605 2610 tgc tca gac gca gaa ggg act gcc gtc gcg cct
ccg act gtt acc ccg 7929 Cys Ser Asp Ala Glu Gly Thr Ala Val Ala
Pro Pro Thr Val Thr Pro 2615 2620 2625 gtt cca agc cta gag gct cct
tcc gaa caa gca ccg act gag cag agg 7977 Val Pro Ser Leu Glu Ala
Pro Ser Glu Gln Ala Pro Thr Glu Gln Arg 2630 2635 2640 cct ggg gtg
cag gag tgc tac cac ggt aat gga cag agt tat cga ggc 8025 Pro Gly
Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly 2645 2650
2655 2660 aca tac tcc acc act gtc act gga aga acc tgc caa gct tgg
tca tct 8073 Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala
Trp Ser Ser 2665 2670 2675 atg aca cca cac tcg cat agt cgg acc cca
gaa tac tac cca aat gct 8121 Met Thr Pro His Ser His Ser Arg Thr
Pro Glu Tyr Tyr Pro Asn Ala 2680 2685 2690 ggc ttg atc atg aac tac
tgc agg aat cca gat gct gtg gca gct cct 8169 Gly Leu Ile Met Asn
Tyr Cys Arg Asn Pro Asp Ala Val Ala Ala Pro 2695 2700 2705 tat tgt
tat acg agg gat ccc ggt gtc agg tgg gag tac tgc aac ctg 8217 Tyr
Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu 2710
2715 2720 acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg
act gtt 8265 Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro
Pro Thr Val 2725 2730 2735 2740 acc ccg gtt cca agc cta gag gct cct
tcc gaa caa gca ccg act gag 8313 Thr Pro Val Pro Ser Leu Glu Ala
Pro Ser Glu Gln Ala Pro Thr Glu 2745 2750 2755 caa agg cct ggg gtg
cag gag tgc tac cat ggt aat gga cag agt tat 8361 Gln Arg Pro Gly
Val Gln Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr 2760 2765 2770 cga
ggc aca tac tcc acc act gtc aca gga aga acc tgc caa gct tgg 8409
Arg Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp
2775 2780 2785 tca tct atg aca cca cac tcg cat agt cgg acc cca gaa
tac tac cca 8457 Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro
Glu Tyr Tyr Pro 2790 2795 2800 aat gct ggc ttg atc atg aac tac tgc
agg aat cca gat gct gtg gca 8505 Asn Ala Gly Leu Ile Met Asn Tyr
Cys Arg Asn Pro Asp Ala Val Ala 2805 2810 2815 2820 gct cct tat tgt
tat acg agg gat ccc ggt gtc agg tgg gag tac tgc 8553 Ala Pro Tyr
Cys Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu Tyr Cys 2825 2830 2835
aac ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg cct ccg
8601 Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala Pro
Pro 2840 2845 2850 act gtt acc ccg gtt cca agc cta gag gct cct tcc
gaa caa gca ccg 8649 Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro
Ser Glu Gln Ala Pro 2855 2860 2865 act gag caa agg cct ggg gtg cag
gag tgc tac cat ggt aat gga cag 8697 Thr Glu Gln Arg Pro Gly Val
Gln Glu Cys Tyr His Gly Asn Gly Gln 2870 2875 2880 agt tat cga ggc
aca tac tcc acc act gtc aca gga aga acc tgc caa 8745 Ser Tyr Arg
Gly Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln 2885 2890 2895
2900 gct tgg tca tct atg aca cca cac tcg cat agt cgg acc cca gaa
tac 8793 Ala Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro
Glu Tyr 2905 2910 2915 tac cca aat gct ggc ttg atc atg aac tac tgc
agg aat cca gat gct 8841 Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr
Cys Arg Asn Pro Asp Ala 2920 2925 2930 gtg gca gct cct tat tgt tat
acg agg gat ccc ggt gtc agg tgg gag 8889 Val Ala Ala Pro Tyr Cys
Tyr Thr Arg Asp Pro Gly Val Arg Trp Glu 2935 2940 2945 tac tgc aac
ctg acg caa tgc tca gac gca gaa ggg act gcc gtc gcg 8937 Tyr Cys
Asn Leu Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala Val Ala 2950 2955
2960 cct ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc gaa
caa 8985 Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser
Glu Gln 2965 2970 2975 2980 gca ccg act gag cag agg cct ggg gtg cag
gag tgc
tac cac ggt aat 9033 Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu
Cys Tyr His Gly Asn 2985 2990 2995 gga cag agt tat cga ggc aca tac
tcc acc act gtc act gga aga acc 9081 Gly Gln Ser Tyr Arg Gly Thr
Tyr Ser Thr Thr Val Thr Gly Arg Thr 3000 3005 3010 tgc caa gct tgg
tca tct atg aca cca cac tcg cat agt cgg acc cca 9129 Cys Gln Ala
Trp Ser Ser Met Thr Pro His Ser His Ser Arg Thr Pro 3015 3020 3025
gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc agg aat cca
9177 Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg Asn
Pro 3030 3035 3040 gat gct gtg gca gct cct tat tgt tat acg agg gat
ccc ggt gtc agg 9225 Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg
Asp Pro Gly Val Arg 3045 3050 3055 3060 tgg gag tac tgc aac ctg acg
caa tgc tca gac gca gaa ggg act gcc 9273 Trp Glu Tyr Cys Asn Leu
Thr Gln Cys Ser Asp Ala Glu Gly Thr Ala 3065 3070 3075 gtc gcg cct
ccg act gtt acc ccg gtt cca agc cta gag gct cct tcc 9321 Val Ala
Pro Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala Pro Ser 3080 3085
3090 gaa caa gca ccg act gag cag agg cct ggg gtg cag gag tgc tac
cac 9369 Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys
Tyr His 3095 3100 3105 ggt aat gga cag agt tat cga ggc aca tac tcc
acc act gtc act gga 9417 Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr
Ser Thr Thr Val Thr Gly 3110 3115 3120 aga acc tgc caa gct tgg tca
tct atg aca cca cac tcg cat agt cgg 9465 Arg Thr Cys Gln Ala Trp
Ser Ser Met Thr Pro His Ser His Ser Arg 3125 3130 3135 3140 acc cca
gaa tac tac cca aat gct ggc ttg atc atg aac tac tgc agg 9513 Thr
Pro Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr Cys Arg 3145
3150 3155 aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat
ccc ggt 9561 Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg
Asp Pro Gly 3160 3165 3170 gtc agg tgg gag tac tgc aac ctg acg caa
tgc tca gac gca gaa ggg 9609 Val Arg Trp Glu Tyr Cys Asn Leu Thr
Gln Cys Ser Asp Ala Glu Gly 3175 3180 3185 act gcc gtc gcg cct ccg
act gtt acc ccg gtt cca agc cta gag gct 9657 Thr Ala Val Ala Pro
Pro Thr Val Thr Pro Val Pro Ser Leu Glu Ala 3190 3195 3200 cct tcc
gaa caa gca ccg act gag cag agg cct ggg gtg cag gag tgc 9705 Pro
Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln Glu Cys 3205
3210 3215 3220 tac cac ggt aat gga cag agt tat cga ggc aca tac tcc
acc act gtc 9753 Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr
Ser Thr Thr Val 3225 3230 3235 act gga aga acc tgc caa gct tgg tca
tct atg aca cca cac tcg cat 9801 Thr Gly Arg Thr Cys Gln Ala Trp
Ser Ser Met Thr Pro His Ser His 3240 3245 3250 agt cgg acc cca gaa
tac tac cca aat gct ggc ttg atc atg aac tac 9849 Ser Arg Thr Pro
Glu Tyr Tyr Pro Asn Ala Gly Leu Ile Met Asn Tyr 3255 3260 3265 tgc
agg aat cca gat gct gtg gca gct cct tat tgt tat acg agg gat 9897
Cys Arg Asn Pro Asp Ala Val Ala Ala Pro Tyr Cys Tyr Thr Arg Asp
3270 3275 3280 ccc ggt gtc agg tgg gag tac tgc aac ctg acg caa tgc
tca gac gca 9945 Pro Gly Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln
Cys Ser Asp Ala 3285 3290 3295 3300 gaa ggg act gcc gtc gcg cct ccg
act gtt acc ccg gtt cca agc cta 9993 Glu Gly Thr Ala Val Ala Pro
Pro Thr Val Thr Pro Val Pro Ser Leu 3305 3310 3315 gag gct cct tcc
gaa caa gca ccg act gag cag agg cct ggg gtg cag 10041 Glu Ala Pro
Ser Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly Val Gln 3320 3325 3330
gag tgc tac cac ggt aat gga cag agt tat cga ggc aca tac tcc acc
10089 Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Arg Gly Thr Tyr Ser
Thr 3335 3340 3345 act gtc act gga aga acc tgc caa gct tgg tca tct
atg aca cca cac 10137 Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser
Ser Met Thr Pro His 3350 3355 3360 tcg cat agt cgg acc cca gaa tac
tac cca aat gct ggc ttg atc atg 10185 Ser His Ser Arg Thr Pro Glu
Tyr Tyr Pro Asn Ala Gly Leu Ile Met 3365 3370 3375 3380 aac tac tgc
agg aat cca gat cct gtg gca gcc cct tat tgt tat acg 10233 Asn Tyr
Cys Arg Asn Pro Asp Pro Val Ala Ala Pro Tyr Cys Tyr Thr 3385 3390
3395 agg gat ccc agt gtc agg tgg gag tac tgc aac ctg aca caa tgc
tca 10281 Arg Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu Thr Gln
Cys Ser 3400 3405 3410 gac gca gaa ggg act gcc gtc gcg cct cca act
att acc ccg att cca 10329 Asp Ala Glu Gly Thr Ala Val Ala Pro Pro
Thr Ile Thr Pro Ile Pro 3415 3420 3425 agc cta gag gct cct tct gaa
caa gca cca act gag caa agg cct ggg 10377 Ser Leu Glu Ala Pro Ser
Glu Gln Ala Pro Thr Glu Gln Arg Pro Gly 3430 3435 3440 gtg cag gag
tgc tac cac gga aat gga cag agt tat caa ggc aca tac 10425 Val Gln
Glu Cys Tyr His Gly Asn Gly Gln Ser Tyr Gln Gly Thr Tyr 3445 3450
3455 3460 ttc att act gtc aca gga aga acc tgc caa gct tgg tca tct
atg aca 10473 Phe Ile Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser
Ser Met Thr 3465 3470 3475 cca cac tcg cat agt cgg acc cca gca tac
tac cca aat gct ggc ttg 10521 Pro His Ser His Ser Arg Thr Pro Ala
Tyr Tyr Pro Asn Ala Gly Leu 3480 3485 3490 atc aag aac tac tgc cga
aat cca gat cct gtg gca gcc cct tgg tgt 10569 Ile Lys Asn Tyr Cys
Arg Asn Pro Asp Pro Val Ala Ala Pro Trp Cys 3495 3500 3505 tat aca
aca gat ccc agt gtc agg tgg gag tac tgc aac ctg aca cga 10617 Tyr
Thr Thr Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu Thr Arg 3510
3515 3520 tgc tca gat gca gaa tgg act gcc ttc gtc cct ccg aat gtt
att ctg 10665 Cys Ser Asp Ala Glu Trp Thr Ala Phe Val Pro Pro Asn
Val Ile Leu 3525 3530 3535 3540 gct cca agc cta gag gct ttt ttt gaa
caa gca ctg act gag gaa acc 10713 Ala Pro Ser Leu Glu Ala Phe Phe
Glu Gln Ala Leu Thr Glu Glu Thr 3545 3550 3555 ccc ggg gta cag gac
tgc tac tac cat tat gga cag agt tac cga ggc 10761 Pro Gly Val Gln
Asp Cys Tyr Tyr His Tyr Gly Gln Ser Tyr Arg Gly 3560 3565 3570 aca
tac tcc acc act gtc aca gga aga act tgc caa gct tgg tca tct 10809
Thr Tyr Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ala Trp Ser Ser
3575 3580 3585 atg aca cca cac cag cat agt cgg acc cca gaa aac tac
cca aat gct 10857 Met Thr Pro His Gln His Ser Arg Thr Pro Glu Asn
Tyr Pro Asn Ala 3590 3595 3600 ggc ctg acc agg aac tac tgc agg aat
cca gat gct gag att cgc cct 10905 Gly Leu Thr Arg Asn Tyr Cys Arg
Asn Pro Asp Ala Glu Ile Arg Pro 3605 3610 3615 3620 tgg tgt tac acc
atg gat ccc agt gtc agg tgg gag tac tgc aac ctg 10953 Trp Cys Tyr
Thr Met Asp Pro Ser Val Arg Trp Glu Tyr Cys Asn Leu 3625 3630 3635
aca caa tgc ctg gtg aca gaa tca agt gtc ctt gca act ctc acg gtg
11001 Thr Gln Cys Leu Val Thr Glu Ser Ser Val Leu Ala Thr Leu Thr
Val 3640 3645 3650 gtc cca gat cca agc aca gag gct tct tct gaa gaa
gca cca acg gag 11049 Val Pro Asp Pro Ser Thr Glu Ala Ser Ser Glu
Glu Ala Pro Thr Glu 3655 3660 3665 caa agc ccc ggg gtc cag gat tgc
tac cat ggt gat gga cag agt tat 11097 Gln Ser Pro Gly Val Gln Asp
Cys Tyr His Gly Asp Gly Gln Ser Tyr 3670 3675 3680 cga ggc tca ttc
tct acc act gtc aca gga agg aca tgt cag tct tgg 11145 Arg Gly Ser
Phe Ser Thr Thr Val Thr Gly Arg Thr Cys Gln Ser Trp 3685 3690 3695
3700 tcc tct atg aca cca cac tgg cat cag agg aca aca gaa tat tat
cca 11193 Ser Ser Met Thr Pro His Trp His Gln Arg Thr Thr Glu Tyr
Tyr Pro 3705 3710 3715 aat ggt ggc ctg acc agg aac tac tgc agg aat
cca gat gct gag att 11241 Asn Gly Gly Leu Thr Arg Asn Tyr Cys Arg
Asn Pro Asp Ala Glu Ile 3720 3725 3730 agt cct tgg tgt tat acc atg
gat ccc aat gtc aga tgg gag tac tgc 11289 Ser Pro Trp Cys Tyr Thr
Met Asp Pro Asn Val Arg Trp Glu Tyr Cys 3735 3740 3745 aac ctg aca
caa tgt cca gtg aca gaa tca agt gtc ctt gcg acg tcc 11337 Asn Leu
Thr Gln Cys Pro Val Thr Glu Ser Ser Val Leu Ala Thr Ser 3750 3755
3760 acg gct gtt tct gaa caa gca cca acg gag caa agc ccc aca gtc
cag 11385 Thr Ala Val Ser Glu Gln Ala Pro Thr Glu Gln Ser Pro Thr
Val Gln 3765 3770 3775 3780 gac tgc tac cat ggt gat gga cag agt tat
cga ggc tca ttc tcc acc 11433 Asp Cys Tyr His Gly Asp Gly Gln Ser
Tyr Arg Gly Ser Phe Ser Thr 3785 3790 3795 act gtt aca gga agg aca
tgt cag tct tgg tcc tct atg aca cca cac 11481 Thr Val Thr Gly Arg
Thr Cys Gln Ser Trp Ser Ser Met Thr Pro His 3800 3805 3810 tgg cat
cag aga acc aca gaa tac tac cca aat ggt ggc ctg acc agg 11529 Trp
His Gln Arg Thr Thr Glu Tyr Tyr Pro Asn Gly Gly Leu Thr Arg 3815
3820 3825 aac tac tgc agg aat cca gat gct gag att cgc cct tgg tgt
tat acc 11577 Asn Tyr Cys Arg Asn Pro Asp Ala Glu Ile Arg Pro Trp
Cys Tyr Thr 3830 3835 3840 atg gat ccc agt gtc aga tgg gag tac tgc
aac ctg acg caa tgt cca 11625 Met Asp Pro Ser Val Arg Trp Glu Tyr
Cys Asn Leu Thr Gln Cys Pro 3845 3850 3855 3860 gtg atg gaa tca act
ctc ctc aca act ccc acg gtg gtc cca gtt cca 11673 Val Met Glu Ser
Thr Leu Leu Thr Thr Pro Thr Val Val Pro Val Pro 3865 3870 3875 agc
aca gag ctt cct tct gaa gaa gca cca act gaa aac agc act ggg 11721
Ser Thr Glu Leu Pro Ser Glu Glu Ala Pro Thr Glu Asn Ser Thr Gly
3880 3885 3890 gtc cag gac tgc tac cga ggt gat gga cag agt tat cga
ggc aca ctc 11769 Val Gln Asp Cys Tyr Arg Gly Asp Gly Gln Ser Tyr
Arg Gly Thr Leu 3895 3900 3905 tcc acc act atc aca gga aga aca tgt
cag tct tgg tcg tct atg aca 11817 Ser Thr Thr Ile Thr Gly Arg Thr
Cys Gln Ser Trp Ser Ser Met Thr 3910 3915 3920 cca cat tgg cat cgg
agg atc cca tta tac tat cca aat gct ggc ctg 11865 Pro His Trp His
Arg Arg Ile Pro Leu Tyr Tyr Pro Asn Ala Gly Leu 3925 3930 3935 3940
acc agg aac tac tgc agg aat cca gat gct gag att cgc cct tgg tgt
11913 Thr Arg Asn Tyr Cys Arg Asn Pro Asp Ala Glu Ile Arg Pro Trp
Cys 3945 3950 3955 tac acc atg gat ccc agt gtc agg tgg gag tac tgc
aac ctg aca cga 11961 Tyr Thr Met Asp Pro Ser Val Arg Trp Glu Tyr
Cys Asn Leu Thr Arg 3960 3965 3970 tgt cca gtg aca gaa tcg agt gtc
ctc aca act ccc aca gtg gcc ccg 12009 Cys Pro Val Thr Glu Ser Ser
Val Leu Thr Thr Pro Thr Val Ala Pro 3975 3980 3985 gtt cca agc aca
gag gct cct tct gaa caa gca cca cct gag aaa agc 12057 Val Pro Ser
Thr Glu Ala Pro Ser Glu Gln Ala Pro Pro Glu Lys Ser 3990 3995 4000
cct gtg gtc cag gat tgc tac cat ggt gat gga cgg agt tat cga ggc
12105 Pro Val Val Gln Asp Cys Tyr His Gly Asp Gly Arg Ser Tyr Arg
Gly 4005 4010 4015 4020 ata tcc tcc acc act gtc aca gga agg acc tgt
caa tct tgg tca tct 12153 Ile Ser Ser Thr Thr Val Thr Gly Arg Thr
Cys Gln Ser Trp Ser Ser 4025 4030 4035 atg ata cca cac tgg cat cag
agg acc cca gaa aac tac cca aat gct 12201 Met Ile Pro His Trp His
Gln Arg Thr Pro Glu Asn Tyr Pro Asn Ala 4040 4045 4050 ggc ctg acc
gag aac tac tgc agg aat cca gat tct ggg aaa caa ccc 12249 Gly Leu
Thr Glu Asn Tyr Cys Arg Asn Pro Asp Ser Gly Lys Gln Pro 4055 4060
4065 tgg tgt tac aca acc gat ccg tgt gtg agg tgg gag tac tgc aat
ctg 12297 Trp Cys Tyr Thr Thr Asp Pro Cys Val Arg Trp Glu Tyr Cys
Asn Leu 4070 4075 4080 aca caa tgc tca gaa aca gaa tca ggt gtc cta
gag act ccc act gtt 12345 Thr Gln Cys Ser Glu Thr Glu Ser Gly Val
Leu Glu Thr Pro Thr Val 4085 4090 4095 4100 gtt cca gtt cca agc atg
gag gct cat tct gaa gca gca cca act gag 12393 Val Pro Val Pro Ser
Met Glu Ala His Ser Glu Ala Ala Pro Thr Glu 4105 4110 4115 caa acc
cct gtg gtc cgg cag tgc tac cat ggt aat ggc cag agt tat 12441 Gln
Thr Pro Val Val Arg Gln Cys Tyr His Gly Asn Gly Gln Ser Tyr 4120
4125 4130 cga ggc aca ttc tcc acc act gtc aca gga agg aca tgt caa
tct tgg 12489 Arg Gly Thr Phe Ser Thr Thr Val Thr Gly Arg Thr Cys
Gln Ser Trp 4135 4140 4145 tca tcc atg aca cca cac cgg cat cag agg
acc cca gaa aac tac cca 12537 Ser Ser Met Thr Pro His Arg His Gln
Arg Thr Pro Glu Asn Tyr Pro 4150 4155 4160 aat gat ggc ctg aca atg
aac tac tgc agg aat cca gat gcc gat aca 12585 Asn Asp Gly Leu Thr
Met Asn Tyr Cys Arg Asn Pro Asp Ala Asp Thr 4165 4170 4175 4180 ggc
cct tgg tgt ttt acc atg gac ccc agc atc agg tgg gag tac tgc 12633
Gly Pro Trp Cys Phe Thr Met Asp Pro Ser Ile Arg Trp Glu Tyr Cys
4185 4190 4195 aac ctg acg cga tgc tca gac aca gaa ggg act gtg gtc
gct cct ccg 12681 Asn Leu Thr Arg Cys Ser Asp Thr Glu Gly Thr Val
Val Ala Pro Pro 4200 4205 4210 act gtc atc cag gtt cca agc cta ggg
cct cct tct gaa caa gac tgt 12729 Thr Val Ile Gln Val Pro Ser Leu
Gly Pro Pro Ser Glu Gln Asp Cys 4215 4220 4225 atg ttt ggg aat ggg
aaa gga tac cgg ggc aag aag gca acc act gtt 12777 Met Phe Gly Asn
Gly Lys Gly Tyr Arg Gly Lys Lys Ala Thr Thr Val 4230 4235 4240 act
ggg acg cca tgc cag gaa tgg gct gcc cag gag ccc cat aga cac 12825
Thr Gly Thr Pro Cys Gln Glu Trp Ala Ala Gln Glu Pro His Arg His
4245 4250 4255 4260 agc acg ttc att cca ggg aca aat aaa tgg gca ggt
ctg gaa aaa aat 12873 Ser Thr Phe Ile Pro Gly Thr Asn Lys Trp Ala
Gly Leu Glu Lys Asn 4265 4270 4275 tac tgc cgt aac cct gat ggt gac
atc aat ggt ccc tgg tgc tac aca 12921 Tyr Cys Arg Asn Pro Asp Gly
Asp Ile Asn Gly Pro Trp Cys Tyr Thr 4280 4285 4290 atg aat cca aga
aaa ctt ttt gac tac tgt gat atc cct ctc tgt gca 12969 Met Asn Pro
Arg Lys Leu Phe Asp Tyr Cys Asp Ile Pro Leu Cys Ala 4295 4300 4305
tcc tct tca ttt gat tgt ggg aag cct caa gtg gag ccg aag aaa tgt
13017 Ser Ser Ser Phe Asp Cys Gly Lys Pro Gln Val Glu Pro Lys Lys
Cys 4310 4315 4320 cct gga agc att gta ggg ggg tgt gtg gcc cac cca
cat tcc tgg ccc 13065 Pro Gly Ser Ile Val Gly Gly Cys Val Ala His
Pro His Ser Trp Pro 4325 4330 4335 4340 tgg caa gtc agt ctc aga aca
agg ttt gga aag cac ttc tgt gga ggc 13113 Trp Gln Val Ser Leu Arg
Thr Arg Phe Gly Lys His Phe Cys Gly Gly 4345 4350 4355 acc tta ata
tcc cca gag tgg gtg ctg act gct gct cac tgc ttg aag 13161 Thr Leu
Ile Ser Pro Glu Trp Val Leu Thr Ala Ala His Cys Leu Lys 4360 4365
4370 aag tcc tca agg cct tca tcc tac aag gtc atc ctg ggt gca cac
caa 13209 Lys Ser Ser Arg Pro Ser Ser Tyr Lys Val Ile Leu Gly Ala
His Gln 4375 4380 4385 gaa gtg aac ctc gaa tct cat gtt cag gaa ata
gaa gtg tct agg ctg 13257 Glu Val Asn Leu Glu Ser His Val Gln Glu
Ile Glu Val Ser Arg Leu 4390 4395 4400 ttc ttg gag ccc aca caa gca
gat att gcc ttg cta aag cta agc agg 13305 Phe Leu Glu Pro Thr Gln
Ala Asp Ile Ala Leu Leu Lys Leu Ser Arg 4405 4410 4415 4420 cct gcc
gtc atc act gac aaa gta atg cca gct tgt ctg cca tcc cca 13353 Pro
Ala Val Ile Thr Asp Lys Val Met Pro Ala Cys Leu Pro Ser Pro 4425
4430 4435 gac tac atg gtc acc gcc agg act gaa tgt tac atc act ggc
tgg gga 13401 Asp Tyr Met Val Thr Ala Arg Thr Glu Cys Tyr Ile Thr
Gly Trp Gly 4440 4445 4450 gaa acc caa ggt acc ttt ggg act ggc ctt
ctc aag gaa gcc cag ctc 13449 Glu Thr Gln Gly Thr Phe Gly Thr Gly
Leu Leu Lys Glu Ala Gln Leu 4455 4460 4465 ctt gtt att gag aat gaa
gtg tgc aat cac tat aag tat att tgt gct 13497 Leu Val Ile Glu Asn
Glu Val Cys Asn His Tyr Lys Tyr Ile Cys Ala 4470 4475 4480 gag cat
ttg gcc aga ggc act gac agt tgc cag ggt gac agt gga ggg 13545 Glu
His
Leu Ala Arg Gly Thr Asp Ser Cys Gln Gly Asp Ser Gly Gly 4485 4490
4495 4500 cct ctg gtt tgc ttc gag aag gac aaa tac att tta caa gga
gtc act 13593 Pro Leu Val Cys Phe Glu Lys Asp Lys Tyr Ile Leu Gln
Gly Val Thr 4505 4510 4515 tct tgg ggt ctt ggc tgt gca cgc ccc aat
aag cct ggt gtc tat gct 13641 Ser Trp Gly Leu Gly Cys Ala Arg Pro
Asn Lys Pro Gly Val Tyr Ala 4520 4525 4530 cgt gtt tca agg ttt gtt
act tgg att gag gga atg atg aga aat aat 13689 Arg Val Ser Arg Phe
Val Thr Trp Ile Glu Gly Met Met Arg Asn Asn 4535 4540 4545 taa
ttggacggga gacagagtga agcatcaacc tacttagaag ctgaaacgtg 13742
ggtaaggatt tagcatgctg gaaataatag acagcaatca aacgaagaca ctgttcccag
13802 ctaccagcta tgccaaacct tggcattttt ggtatttttg tgtataagct
tttaaggtct 13862 gactgacaaa ttctgtatta aggtgtcata gctatgacat
ttgttaaaaa taaactctgc 13922 acttattttg atttga 13938 4 19 DNA
Artificial Sequence PCR Primer 4 gaaggtgaag gtcggagtc 19 5 20 DNA
Artificial Sequence PCR Primer 5 gaagatggtg atgggatttc 20 6 20 DNA
Artificial Sequence PCR Probe 6 caagcttccc gttctcagcc 20 7 20 DNA
Artificial Sequence Antisense Oligonucleotide 7 ggcaggtcct
tcctgtgaca 20 8 20 DNA Artificial Sequence Antisense
Oligonucleotide 8 tctgcgtctg agcattgcgt 20 9 20 DNA Artificial
Sequence Antisense Oligonucleotide 9 aagcttggca ggttcttcct 20 10 20
DNA Artificial Sequence Antisense Oligonucleotide 10 tcggaggcgc
gacggcagtc 20 11 20 DNA Artificial Sequence Antisense
Oligonucleotide 11 cggaggcgcg acggcagtcc 20 12 20 DNA Artificial
Sequence Antisense Oligonucleotide 12 ggcaggttct tcctgtgaca 20 13
20 DNA Artificial Sequence Antisense Oligonucleotide 13 ataacaataa
ggagctgcca 20 14 20 DNA Artificial Sequence Antisense
Oligonucleotide 14 gaccaagctt ggcaggttct 20 15 20 DNA Artificial
Sequence Antisense Oligonucleotide 15 taacaataag gagctgccac 20 16
20 DNA Artificial Sequence Antisense Oligonucleotide 16 tgaccaagct
tggcaggttc 20 17 20 DNA Artificial Sequence Antisense
Oligonucleotide 17 ttctgcgtct gagcattgcg 20 18 20 DNA Artificial
Sequence Antisense Oligonucleotide 18 aacaataagg agctgccaca 20 19
20 DNA Artificial Sequence Antisense Oligonucleotide 19 acctgacacc
gggatccctc 20 20 20 DNA Artificial Sequence Antisense
Oligonucleotide 20 ctgagcattg cgtcaggttg 20 21 20 DNA Artificial
Sequence Antisense Oligonucleotide 21 agtagttcat gatcaagcca 20 22
20 DNA Artificial Sequence Antisense Oligonucleotide 22 gacggcagtc
ccttctgcgt 20 23 20 DNA Artificial Sequence Antisense
Oligonucleotide 23 ggcaggttct tccagtgaca 20 24 20 DNA Artificial
Sequence Antisense Oligonucleotide 24 tgaccaagct tggcaagttc 20 25
20 DNA Artificial Sequence Antisense Oligonucleotide 25 tataacacca
aggactaatc 20 26 20 DNA Artificial Sequence Antisense
Oligonucleotide 26 ccatctgaca ttgggatcca 20 27 20 DNA Artificial
Sequence Antisense Oligonucleotide 27 tgtggtgtca tagaggacca 20 28
20 DNA Artificial Sequence Antisense Oligonucleotide 28 atgggatcct
ccgatgccaa 20 29 20 DNA Artificial Sequence Antisense
Oligonucleotide 29 acaccaaggg cgaatctcag 20 30 20 DNA Artificial
Sequence Antisense Oligonucleotide 30 ttctgtcact ggacatcgtg 20 31
20 DNA Artificial Sequence Antisense Oligonucleotide 31 cacacggatc
ggttgtgtaa 20 32 20 DNA Artificial Sequence Antisense
Oligonucleotide 32 acatgtcctt cctgtgacag 20 33 20 DNA Artificial
Sequence Antisense Oligonucleotide 33 cagaaggagg ccctaggctt 20 34
20 DNA Artificial Sequence Antisense Oligonucleotide 34 ctggcggtga
ccatgtagtc 20 35 20 DNA Artificial Sequence Antisense
Oligonucleotide 35 tctaagtagg ttgatgcttc 20 36 20 DNA Artificial
Sequence Antisense Oligonucleotide 36 tccttaccca cgtttcagct 20 37
20 DNA Artificial Sequence Antisense Oligonucleotide 37 ggaacagtgt
cttcgtttga 20 38 20 DNA Artificial Sequence Antisense
Oligonucleotide 38 gtttggcata gctggtagct 20 39 20 DNA Artificial
Sequence Antisense Oligonucleotide 39 accttaaaag cttatacaca 20 40
20 DNA Artificial Sequence Antisense Oligonucleotide 40 atacagaatt
tgtcagtcag 20 41 20 DNA Artificial Sequence Antisense
Oligonucleotide 41 gtcatagcta tgacacctta 20
* * * * *