U.S. patent application number 10/820202 was filed with the patent office on 2004-11-25 for production of hydroxylated fatty acids in genetically modified plants.
This patent application is currently assigned to The Carnegie Institution of Washington. Invention is credited to Boddupalli, Sekhar S., Broun, Pierre, Somerville, Chris, van de Loo, Frank.
Application Number | 20040237139 10/820202 |
Document ID | / |
Family ID | 24390991 |
Filed Date | 2004-11-25 |
United States Patent
Application |
20040237139 |
Kind Code |
A1 |
Broun, Pierre ; et
al. |
November 25, 2004 |
Production of hydroxylated fatty acids in genetically modified
plants
Abstract
This invention relates to plant fatty acid hydroxylases. Methods
to use conserved amino acid or nucleotide sequences to obtain plant
fatty acid hydroxylases are described. As described is the use of
cDNA clones encoding a plant hydroxylase to produce a family of
hydroxylated fatty acids in transgenic plants. In addition, the use
of genes encoding fatty acid hydroxylases or desaturases to alter
the level of lipid fatty acid unsaturation in transgenic plants is
described.
Inventors: |
Broun, Pierre; (Burlingame,
CA) ; van de Loo, Frank; (Lyons, AU) ;
Boddupalli, Sekhar S.; (Manchester, MO) ; Somerville,
Chris; (Portola Valley, CA) |
Correspondence
Address: |
MORGAN LEWIS & BOCKIUS LLP
1111 PENNSYLVANIA AVENUE NW
WASHINGTON
DC
20004
US
|
Assignee: |
The Carnegie Institution of
Washington
Monsanto Company, Inc.
|
Family ID: |
24390991 |
Appl. No.: |
10/820202 |
Filed: |
April 8, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10820202 |
Apr 8, 2004 |
|
|
|
09117921 |
Mar 4, 1999 |
|
|
|
09117921 |
Mar 4, 1999 |
|
|
|
PCT/US97/02187 |
Feb 6, 1997 |
|
|
|
09117921 |
Mar 4, 1999 |
|
|
|
08597313 |
Feb 6, 1996 |
|
|
|
6310194 |
|
|
|
|
Current U.S.
Class: |
800/281 |
Current CPC
Class: |
C12N 9/0071 20130101;
C12N 9/0073 20130101; C12N 15/8247 20130101; C12N 15/8222 20130101;
C12N 9/0083 20130101 |
Class at
Publication: |
800/281 |
International
Class: |
A01H 001/00; C12N
015/82 |
Claims
What is claimed is:
1. A method of altering an amount of an unsaturated fatty acid in a
seed of a plant comprising: decreasing a fatty acid desaturase
activity in the seed by genetic manipulation of at least one of
fatty acid desaturase or fatty acid hydroxylase.
2. The method of claim 1, wherein an endogenous gene for said fatty
acid hydroxylase is mutated and thereby decreases fatty acid
hydroxylase activity in the seed.
3. The method of claim 1, wherein said plant is transformed with a
nucleic acid containing a sequence which encodes a fatty acid
hydroxylase or derivative thereof.
4. The method of claim 3, wherein said derivative is a dominant
negative mutant which thereby alters the amount of the unsaturated
fatty acid in the seed.
5. The method of claim 3, wherein said derivative is a mutant fatty
acid hydroxylase in which one or more essential histidine residues
have been mutated which thereby alters the amount of the
unsaturated fatty acid in the seed.
6. The method of claim 1, wherein an endogenous gene for said fatty
acid desaturase is mutated and thereby decreases fatty acid
desaturase activity in the seed.
7. The method of claim 1, wherein said plant is transformed with a
nucleic acid containing a sequence which encodes a fatty acid
desaturase or derivative thereof.
8. The method of claim 7, wherein said derivative is a dominant
negative mutant which thereby alters the amount of the unsaturated
fatty acid in the seed.
9. The method of claim 7, wherein said derivative is a mutant fatty
acid desaturase in which one or more essential histidine residues
have been mutated which thereby alters the amount of the
unsaturated fatty acid in the seed.
10. The method of claim 1, wherein said plant is selected from the
group consisting of rapeseed, Crambe, Brassica juncea, canola,
flax, sunflower, safflower, cotton, cuphea, soybean, peanut,
coconut, oil palm and corn.
11. A method of altering an amount of a unsaturated fatty acid
comprising: (a) transforming a plant cell with a nucleic acid
containing a sequence which encodes a fatty acid hydroxylase or a
dominant negative mutant of fatty acid hydroxylase or a dominant
negative mutant of fatty acid desaturase, (b) growing a
seed-bearing plant from the transformed plant cell of step (a), and
(c) identifying a seed from the plant of step (b) with the altered
amount of the unsaturated fatty acid in the seed.
12. The method of claim 11, wherein said nucleic acid contains a
sequence which encodes the dominant negative mutant of fatty acid
hydroxylase in which one or more essential histidine residues have
been mutated.
13. The method of claim 11, wherein said nucleic acid contains a
sequence which encodes the dominant negative mutant of fatty acid
hydroxylase which thereby alters the amount of the unsaturated
fatty acid in the seed.
14. The method of claim 11, wherein said nucleic acid contains a
sequence which encodes the dominant negative mutant of fatty acid
desaturase in which one or more essential histidine residues have
been mutated.
15. The method of claim 11, wherein said nucleic acid contains a
sequence which encodes the dominant negative mutant of fatty acid
desaturase which thereby alters the amount of the unsaturated fatty
acid in the seed.
16. The method of claim 11, wherein said plant is selected from the
group consisting of rapeseed, Crambe, Brassica juncea, canola,
flax, sunflower, safflower, cotton, cuphea, soybean, peanut,
coconut, oil palm and corn.
17. A recombinant nucleic acid suitable for use in claim 1, wherein
said nucleic acid contains a sequence encoding a fatty acid
hydroxylase with an amino acid identity of 60% or greater to SEQ ID
NO:4.
18. The recombinant nucleic acid of claim 17, wherein the amino
acid identity is 90% or greater to SEQ ID NO:4.
19. The recombinant nucleic acid of claim 17, wherein the amino
acid identity is 100% of SEQ ID NO:4.
20. The recombinant nucleic acid of claim 17, wherein said nucleic
acid contains a sequence having a nucleotide identity of 90% or
greater to SEQ ID NO:1, 2 or 3.
21. The recombinant nucleic acid of claim 17, wherein said nucleic
acid contains SEQ ID NO:1, 2 or 3.
22. The recombinant nucleic acid of claim 17, wherein said sequence
is obtainable from a plant species producing a hydroxylated fatty
acid.
23. A recombinant nucleic acid suitable for use in claim 1, wherein
said nucleic acid contains a sequence encoding at least one of
fatty acid desaturase or fatty acid hydroxylase.
24. The recombinant nucleic acid of claim 23, wherein said sequence
is obtainable from Ricinus communis (L.) (castor).
25. The recombinant nucleic acid of claim 23, wherein said sequence
is obtainable from Lesquerella fendleri.
26. The recombinant nucleic acid of claim 23, wherein said nucleic
acid contains a sequence encoding at least one of fatty acid
desaturase or fatty acid hydroxylase in which one or more essential
histidine residues have been mutated.
27. The method of claim 1 further comprising: processing the seed
containing the altered amount of the unsaturated fatty acid to
obtain oil and/or seed meal.
28. Oil obtained by the method of claim 27.
29. Seed meal obtained by the method of claim 27.
30. Plant obtained by the method of claim 1.
31. The method of claim 11 further comprising: processing the seed
containing the altered amount of the unsaturated fatty acid to
obtain oil and/or seed meal.
32. Oil obtained by the method of claim 31.
33. Seed meal obtained by the method of claim 31.
34. Plant obtained by the method of claim 11.
Description
TECHNICAL FIELD
[0001] The present invention concerns the identification of nucleic
acid sequences and constructs, and methods related thereto, and the
use of these sequences and constructs to produce genetically
modified plants for the purpose of altering the fatty acid
composition of plant oils, waxes and related compounds.
[0002] Definitions
[0003] The subject of this invention is a class of enzymes that
introduce a hydroxyl group into several different fatty acids
resulting in the production of several different kinds of
hydroxylated fatty acids. In particular, these enzymes catalyze
hydroxylation of oleic acid to 12-hydroxy oleic acid and icosenoic
acid to 14-hydroxy icosenoic acid. Other fatty acids such as
palmitoleic and erucic acids may also be substrates. Since it is
not possible to refer to the enzyme by reference to a unique
substrate or product, the enzyme is referred throughout as kappa
hydroxylase to indicate that the enzyme introduces the hydroxyl
three carbons distal (i.e., away from the carboxylcarbon of the
acyl chain) from a double bond located near the center of the acyl
chain.
[0004] The following fatty acids are also the subject of this
invention: ricinoleic acid, 12-hydroxyoctadec-cis-9-enoic acid
(120H-18:1.sup.cis.DELTA.9); lesquerolic acid,
14-hydroxy-cis-11-icosenoi- c acid (140H-20:1.sup.cis.DELTA.11);
densipolic acid, 12-hydroxyoctadec-cis-9,15-dienoic acid
(120H-18:2.sup.cis.DELTA.9,15); auricolic acid,
14-hydroxy-cis-11,17-icosadienoic acid
(14OH-20:2.sup.cis.DELTA.11,17); hydroxyerucic,
16-hydroxydocos-cis-13-en- oic acid (16OH-22:1.sup.cis.DELTA.13);
hydroxypalmitoleic, 12-hydroxyhexadec-cis-9-enoic
(12OH-16:1.sup.cis.DELTA.9); icosenoic acid
(20:1.sup.cis.DELTA.11). It will be noted that icosenoic acid is
spelled eicosenoic acid in some countries.
BACKGROUND
[0005] Extensive surveys of the fatty acid composition of seed oils
from different species of higher plants have resulted in the
identification of at least 33 structurally distinct
monohydroxylated plant fatty acids, and 12 different
polyhydroxylated fatty acids that are accumulated by one or more
plant species (reviewed by van de Loo et al., 1993). Ricinoleic
acid, the principal constituent of the seed oil from the castor
plant Ricinus communis (L.), is of commercial importance. The
present inventors have cloned a gene from this species that encodes
a fatty acid hydroxylase, and have used this gene to produce
ricinoleic acid in transgenic plants of other species. Some of this
scientific evidence has been published by the present inventors
(van de Loo et al., 1995).
[0006] The use of the castor hydroxylase gene to also produce other
hydroxylated fatty acids such as lesquerolic acid, densipolic acid,
hydroxypalmitoleic, hydroxyerucic and auricolic acid in transgenic
plants is the subject of this invention. In addition, the
identification of a gene encoding a homologous hydroxylase from
Lesquerella fendleri, and the use of this gene to produce these
hydroxylated fatty acids in transgenic plants is the subject of
this invention.
[0007] Castor is aminor oilseed crop. Approximately 50% of the seed
weight is oil (triacylglycerol) in which 85-90% of total fatty
acids are the hydroxylated fatty acid, ricinoleic acid. Oil pressed
or extracted from castor seeds has many industrial uses based upon
the properties endowed by the hydroxylated fatty acid. The most
important uses are production of paints and varnishes, nylon-type
synthetic polymers, resins, lubricants, and cosmetics (Atsmon,
1989).
[0008] In addition to oil, the castor seed contains the extremely
toxic protein ricin, allergenic proteins, and the alkaloid
ricinine. These constituents preclude the use of the untreated seed
meal (following oil extraction) as a livestock feed, normally an
important economic aspect of oilseed utilization. Furthermore, with
the variable nature of castor plants and a lack of investment in
breeding, castor has few favorable agronomic characteristics.
[0009] For a combination of these reasons, castor is no longer
grown in the United States and the development of an alternative
domestic source of hydroxylated fatty acids would be attractive.
The production of ricinoleic acid, the important constituent of
castor oil, in an established oilseed crop through genetic
engineering would be a particularly effective means of creating a
domestic source.
[0010] Because there is no practical source of lesquerolic,
densipolic and auricolic acids from plants that are adapted to
modern agricultural practices, there is currently no large-scale
use of these fatty acids by industry. However, the fatty acids
would have uses similar to those of ricinoleic acid if they could
be produced in large quantities at comparable cost to other
plant-derived fatty acids (Smith, 1985).
[0011] Plant species, such as certain species in the genus
Lesquerella, that accumulate a high proportion of these fatty
acids, have not been domesticated and are not currently considered
a practical source of fatty acids (Hirsinger, 1989). This invention
represents a useful step toward the eventual production of these
and other hydroxylated fatty acids in transgenic plants of
agricultural importance.
[0012] The taxonomic relationships between plants having similar or
identical kinds of unusual fatty acids have been examined (van de
Loo et al., 1993). In some cases, particular fatty acids occur
mostly or solely in related taxa. In other cases there does not
appear to be a direct link between taxonomic relationships and the
occurrence of unusual fatty acids. In this respect, ricinoleic acid
has now been identified in 12 genera from 10 families (reviewed in
van de Loo et al., 1993). Thus, it appears that the ability to
synthesize hydroxylated fatty acids has evolved several times
independently during the radiation of the angiosperms. This
suggested to us that the enzymes which introduce hydroxyl groups
into fatty acids arose by minor modifications of a related
enzyme.
[0013] Indeed, as shown herein, the sequence similarity between
.DELTA.12 fatty acid desaturases and the kappa hydroxylase from
castor is so high that it is not possible to unambiguously
determine whether a particular enzyme is a desaturase or a
hydroxylase on the basis of evidence in the scientific literature.
Similarly, a patent application (PCT WO 94/11516) that purports to
teach the isolation and use of .DELTA.12 fatty acid desaturases
does not teach how to distinguish a hydroxylase from a desaturase.
In view of the importance of being able to distinguish between
these activities for the purpose of genetic engineering of plant
oils, the utility of that application is limited to the several
instances where direct experimental evidence (e.g., altered fatty
acid composition in transgenic plants) was presented to support the
assignment of function. A method for distinguishing between fatty
acid desaturases and fatty acid hydroxylases on the basis of amino
acid sequence of the enzyme is also a subject of this
invention.
[0014] A feature of hydroxylated or other unusual fatty acids is
that they are generally confined to seed triacylglycerols, being
largely excluded from the polar lipids by unknown mechanisms
(Battey and Ohlrogge 1989; Prasad et al., 1987). This is
particularly intriguing since diacylglycerol is a precursor of both
triacylglycerol and polar lipid. With castor microsomes, there is
some evidence that the pool of ricinoleoyl-containing polar lipid
is minimized by a preference of diacylglycerol acyltransferase for
ricinoleate-containing diacylglycerols (Bafor et al., 1991).
Analyses of vegetative tissues have generated few reports of
unusual fatty acids, other than those occurring in the cuticle. The
cuticle contains various hydroxylated fatty acids which are
interesterified to produce a high molecular weight polyester which
serves a structural role. A small number of other exceptions exist
in which unusual fatty acids are found in tissues other than the
seed.
[0015] The biosynthesis of ricinoleic acid from oleic acid in the
developing endosperm of castor (Ricinus communis) has been studied
by a variety of methods. Morris (1967) established in
double-labeling studies that hydroxylation occurs directly by
hydroxyl substitution rather than via an unsaturated-, keto- or
epoxy-intermediate. Hydroxylation using oleoyl-CoA as precursor can
be demonstrated in crude preparations or microsomes, but activity
in microsomes is unstable and variable, and isolation of the
microsomes involved a considerable, or sometimes complete loss of
activity (Galliard and Stumpf, 1966; Moreau and Stumpf, 1981).
Oleic acid can replace oleoyl-CoA as a precursor, but only in the
presence of CoA, Mg.sup.2+ and ATP (Galliard and Stumpf, 1966)
indicating that activation to the acyl-CoA is necessary. However,
no radioactivity could be detected in ricinoleoyl-CoA (Moreau and
Stumpf, 1981). These and more recent observations (Bafor et al.,
1991) have been interpreted as evidence that the substrate for the
castor oleate hydroxylase is oleic acid esterified to
phosphatidylcholine or another phospholipid.
[0016] The hydroxylase is sensitive to cyanide and azide, and
dialysis against metal chelators reduces activity, which could be
restored by addition of FeSO.sub.4, suggesting iron involvement in
enzyme activity (Galliard and Stumpf, 1966). Ricinoleic acid
synthesis requires molecular oxygen (Galliard and Stumpf, 1966;
Moreau and Stumpf 1981) and requires NAD(P)H to reduce cytochrome
b5 which is thought to be the intermediate electron donor for the
hydroxylase reaction (Smith et al., 1992). Carbon monoxide does not
inhibit hydroxylation, indicating that a cytochrome P450 is not
involved (Galliard and Stumpf, 1966; Moreau and Stumpf 1981). Data
from a study of the substrate specificity of the hydroxylase show
that all substrate parameters (i.e., chain length and double bond
position with respect to both ends) are important; deviations in
these parameters caused reduced activity relative to oleic acid
(Howling et al., 1972). The position at which the hydroxyl was
introduced, however, was determined by the position of the double
bond, always being three carbons distal. Thus, the castor acyl
hydroxylase enzyme can produce a family of different hydroxylated
fatty acids depending on the availability of substrates. Thus, as a
matter of convenience, the enzyme is referred throughout this
specification as a kappa hydroxylase (rather than an oleate
hydroxylase) to indicate the broad substrate specificity.
[0017] The castor kappa hydroxylase has many superficial
similarities to the microsomal fatty acyl desaturases (Browse and
Somerville, 1991). In particular, plants have a microsomal oleate
desaturase active at the .DELTA.12 position. The substrate of this
enzyme (Schmidt et al., 1993) and of the hydroxylase (Bafor et al.,
1991) appears to be a fatty acid esterified to the sn-2 position of
phosphatidylcholine. When oleate is the substrate, the modification
occurs at the same position (.DELTA.12) in the carbon chain, and
requires the same cofactors, namely electrons from NADH via
cytochrome b.sub.5 and molecular oxygen. Neither enzyme is
inhibited by carbon monoxide (Moreau and Stumpf, 1981), the
characteristic inhibitor of cytochrome P450 enzymes.
[0018] There do not appear to have been any published biochemical
studies of the properties of the hydroxylase enzyme(s) in
Lesquerella.
[0019] Conceptual Basis of the Invention
[0020] The present inventors have described the use of a cDNA clone
from castor for the production of ricinoleic acid in transgenic
plants. As noted above, biochemical studies had suggested that the
castor hydroxylase may not have strict specificity for oleic acid
but would also catalyze hydroxylation of other fatty acids such as
icosenoic acid (20:1.sup.cis.DELTA.11) (Howling et al., 1972).
Based on these studies, expression of kappa hydroxylase in
transgenic plants of species such as Brassica napus and Arabidopsis
thaliana that accumulate fatty acids such as icosenoic acid
(20:1.sup.cis.DELTA.11) and erucic acid (13-docosenoic acid;
22:1.sup.cis.DELTA.13) may cause the accumulation of hydroxylated
derivatives of these fatty acids due to the activity of the
hydroxylase on these fatty acids. Direct evidence is presented in
Example 1 that hydroxlyated derivatives of ricinoleic, lesquerolic,
densipolic and auricolic fatty acids are produced in transgenic
Arabidopsis plants.
[0021] Example 2 shows the isolation of a novel kappa hydroxylase
gene from Lesquerella fendleri.
[0022] In view of the high degree of sequence similarity between
.DELTA.12 fatty acid desaturases and the castor hydroxylase (van de
Loo et al., 1995), the validity of claims (e.g., PCT WO 94/11516)
for using a limited set of desaturase or hydroxylase genes or
sequences derived therefrom to identify genes of identical function
from other species must be viewed with skepticism. In this
application, the present inventors teach a method by which
hydroxylase genes can be distinguished from desaturases. The
present inventors describe a mechanistic basis for the similar
reaction mechanisms of desaturases and hydroxylases. Briefly, the
available evidence suggests that fatty acid desaturases have a
similar reaction mechanism to the bacterial enzyme methane
monooxygenase which catalyses a reaction involving oxygen-atom
transfer (CH.sub.4 .fwdarw.CH.sub.3OH) (van de Loo et al., 1993).
The cofactor in the hydroxylase component of methane monooxygenase
is termed a .mu.-oxo bridged diiron cluster (FeOFe). The two iron
atoms of the FeOFe cluster are liganded by protein-derived nitrogen
or oxygen atoms, and are tightly redox-coupled by the
covalently-bridging oxygen atom. The FeOFe cluster accepts two
electrons, reducing it to the diferrous state, before oxygen
binding. Upon oxygen binding, it is likely that heterolytic
cleavage also occurs, leading to a high valent oxoiron reactive
species that is stabilized by resonance rearrangements possible
within the tightly coupled FeOFe cluster. The stabilized
high-valent oxoiron state of methane monooxygenase is capable of
proton extraction from methane, followed by oxygen transfer, giving
methanol. The FeOFe cofactor has been shown to be directly relevant
to plant fatty acid modifications by the demonstration that castor
stearoyl-ACP desaturase contains this type of cofactor (Fox et al.,
1993).
[0023] On the basis of the foregoing considerations, the present
inventors suggest that the castor oleate hydroxylase might be a
structurally modified fatty acyl desaturase, based upon three
arguments. The first argument involves the taxonomic distribution
of plants containing ricinoleic acid. Ricinoleic acid has been
found in 12 genera of 10 families of higher plants (reviewed in van
de Loo et al., 1993). Thus, plants in which ricinoleic acid occurs
are found throughout the plant kingdom, yet close relatives of
these plants do not contain the unusual fatty acid. This pattern
suggests that the ability to synthesize ricinoleic acid has arisen
(and been lost) several times independently, and is therefore is
has recently diverged. In other words, the ability to synthesize
ricinoleic acid has evolved rapidly, suggesting that a relatively
minor genetic change in the structure of the ancestral enzyme was
necessary to accomplish it.
[0024] The second argument is that many biochemical properties of
castor kappa hydroxylase are similar to those of the microsomal
desaturases, as discussed above (e.g., both preferentially act on
fatty acids esterified to the sn-2 position of phosphatidylcholine,
both use cytochrome b5 as an intermediate electron donor, both are
inhibited by cyanide, both require molecular oxygen as a substrate,
both are thought to be located in the endoplasmic reticulum).
[0025] The third argument stems from the discussion of oxygenase
cofactors above, in which it is suggested that the plant membrane
bound fatty acid desaturases may have a .mu.-oxo bridged diiron
cluster-type cofactor, and that such cofactors are capable of
catalyzing both fatty acid desaturations and hydroxylations,
depending upon the electronic and structural properties of the
protein active site.
[0026] Taking these three arguments together, the present inventors
suggest that kappa hydroxylase of castor endosperm is homologous to
the microsomal oleate .DELTA.12 desaturase found in all plants. A
number of genes encoding microsomal .DELTA.12 desaturases from
various species have recently been cloned (Okuley et al., 1994) and
substantial information about the structure of these enzymes is now
known (Shanklin et al., 1994). Hence, in the following invention,
the present inventors teach how to use structural information to
isolate and identify kappa hydroxylase genes. This example teaches
the method by which any carbon-monoxide insensitive plant fatty
acyl hydroxylase gene can be identified by one skilled in the
art.
[0027] An unpredicted outcome of our studies on the castor
hydroxylase gene in transgenic Arabidopsis plants was the discovery
that expression of the hydroxylase leads to increased accumulation
of oleic acid in seed lipids. Because of the low nucleotide
sequence homology between the castor hydroxylase and the
.DELTA.12-desaturase (about 67%), it is unlikely that this effect
is due to silencing (also called sense-suppression or
cosuppression) of the expression of the desaturase gene by the
hydroxylase gene. Whatever the basis for the effect, this invention
teaches the use of hydroxylase genes to alter the level of fatty
acid unsaturation in tranagenic plants. This invention also teaches
the use of genetically modified hydroxylase and desaturase genes to
achieve directed modification of fatty acid unsaturation
levels.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIGS. 1A-D show the mass spectra of hydroxy fatty acids
standards (FIG. 1A, O-TMS-methylricinoleate; FIG. 1B, O-TMS-methyl
densipoleate; FIG. 1C, O-TMS-methyl-lesqueroleate; and FIG. 1D,
O-TMS-methylauricoleate- ).
[0029] FIG. 2 shows the fragmentation pattern of trimethylsilylated
methyl esters of hydroxy fatty acids.
[0030] FIG. 3A shows the gas chromatogram of fatty acids extracted
from seeds of wild type Arabidopsis plants. FIG. 3B shows the gas
chromatogram of fatty acids extracted from seeds of transgenic
Arabidopsis plants containing the fah12 hydroxylase gene. The
numbers indicate the following fatty acids: [1] 16:0; [2] 18:0; [3]
18:1.sup.cis.DELTA.9; [4] 18:2.sup.cis.DELTA.9,12; [5] 20:0; [6]
20:1.sup.cis.DELTA.11; [7] 18:3.sup.cis.DELTA.9,12,15; [8]
20:2.sup.cis.DELTA.11,14; [9] 22:1.sup.cis.DELTA.13; [10]
ricinoleic acid; [11]densipolic acid; [12] lesquerolic acid; and
[13] auricolic acid.
[0031] FIGS. 4A-D show the mass spectra of novel fatty acids found
in seeds of transgenic plants. FIG. 4A shows the mass spectrum of
peak 10 from FIG. 3B. FIG. 4B shows the mass spectrum of peak 11
from FIG. 3B. FIG. 4C shows the mass spectrum of peak 12 from FIG.
3B. FIG. 4D shows the mass spectrum of peak 13 from FIG. 3B.
[0032] FIG. 5 shows the nucleotide sequence of pLesq2 (SEQ ID
NO:1).
[0033] FIG. 6 shows the nucleotide sequence of pLesq3 (SEQ ID
NO:2).
[0034] FIG. 7 shows a Northern blot of total RNA from seeds of L.
fendleri probed with pLesq2 or pLesq3. S, indicates RNA is from
seeds; L, indicates RNA is from leaves.
[0035] FIGS. 8A-B show the nucleotide sequence of genomic clone
encoding pLesq-HYD (SEQ ID NO:3), and the deduced amino acid
sequence of hydroxylase enzyme encoded by the gene (SEQ ID
NO:4).
[0036] FIGS. 9A-B show multiple sequence alignment of deduced amino
acid sequences for kappa hydroxylases and microsomal .DELTA.12
desaturases. Abbreviations are: Rcfah12, fah12 hydroxylase gene
from R. communis (van de Loo et al., 1995); Lffah12, kappa
hydroxylase gene from L. fendleri; Atfad2, fad2 desaturase from
Arabidopsis thaliana (Okuley et al., 1994); Gmfad2-1, fad2
desaturase from Glycine max (GenBank accession number L43920);
Gmfad2-2, fad2 desaturase from Glycine max (Genbank accession
number L43921); Zmfad2, fad2 desaturase from Zea mays (PCT WO
94/11516); Rcfad2, fragment of fad2 desaturase from R. communis
(PCT WO 94/11516); Bnfad2, fad2 desaturase from Brassica napus (PCT
WO 94/11516); LFFAH12.AMI, SEQ ID NO:4; FAH12.AMI, SEQ ID NO:5;
ATFAD2.AMI, SEQ ID NO:6; BNFAD2.AMI, SEQ ID NO:7; GMFAD2-1.AMI, SEQ
ID NO:8; GMFAD2-2.AMI, SEQ ID NO:9; ZMFAD2.AMI, SEQ ID NO:10; and
RCFAD2.AMI, SEQ ID NO:11.
[0037] FIG. 10 shows a Southern blot of genomic DNA from L.
fendleri probed with pLesq-HYD. E=EcORI, H=HindIII, X=XbaI.
[0038] FIG. 11 shows a map of binary Ti plasmid pSLJ44024.
[0039] FIG. 12 shows a map of plasmid pYES2.0
[0040] FIG. 13 shows part of a gas chromatogram of derivatized
fatty acids from yeast cells that contain plasmid pLesqYes in which
expression of the hydroxylase gene was induced by addition of
galactose to the growth medium. The arrow points to a peak that is
not present in uninduced cells. The lower part of the figure is the
mass spectrum of the peak indicated by the arrow.
SUMMARY OF THE INVENTION
[0041] This invention relates to plant fatty acyl hydroxylases.
Methods to use conserved amino acid or nucleotide sequences to
obtain plant fatty acyl hydroxylases are described. Also described
is the use of cDNA clones encoding a plant hydroxylase to produce a
family of hydroxylated fatty acids in transgenic plants.
[0042] In a first embodiment, this invention is directed to
recombinant DNA constructs which can provide for the transcription,
or transcription and translation (expression) of the plant kappa
hydroxylase sequence. In particular, constructs which are capable
of transcription, or transcription and translation in plant host
cells are preferred. Such constructs may contain a variety of
regulatory regions including transcriptional initiation regions
obtained from genes preferentially expressed in plant seed tissue.
In a second aspect, this invention relates to the presence of such
constructs in host cells, especially plant host cells which have an
expressed plant kappa hydroxylase therein.
[0043] In yet another aspect, this invention relates to a method
for producing a plant kappa hydroxylase in a host cell or progeny
thereof via the expression of a construct in the cell. Cells
containing a plant kappa hydroxylase as a result of the production
of the plant kappa hydroxylase encoding sequence are also
contemplated herein.
[0044] In another embodiment, this invention relates to methods of
using a DNA sequence encoding a plant kappa hydroxylase for the
modification of the proportion of hydroxylated fatty acids produced
within a cell, especially plant cells. Plant cells having such a
modified hydroxylated fatty acid composition are also contemplated
herein.
[0045] In a further aspect of this invention, plant kappa
hydroxylase proteins and sequences which are related thereto,
including amino acid and nucleic acid sequences, are contemplated.
Plant kappa hydroxylase exemplified herein includes a Lesquerella
fendleri fatty acid hydroxylase. This exemplified fatty acid
hydroxylase may be used to obtain other plant fatty acid
hydroxylases of this invention.
[0046] In a further aspect of this invention, a nucleic acid
sequence which directs the seed specific expression of an
associated polypeptide coding sequence is described. The use of
this nucleic acid sequence or fragments derived therefrom, to
obtain seed-specific expression in higher plants of any coding
sequence is contemplated herein.
[0047] In a further aspect of this invention, the use of genes
encoding fatty acyl hydroxylases of this invention are used to
alter the amount of fatty acid unsaturation of seed lipids. The
present invention further discloses the use of genetically modified
hydroxylase and desaturase genes to achieve directed modification
of fatty acid unsaturation levels.
DETAILED DESCRIPTION OF THE INVENTION
[0048] A genetically transformed plant of the present invention
which accumulates hydroxylated fatty acids can be obtained by
expressing the double-stranded DNA molecules described in this
application.
[0049] A plant fatty acid hydroxylase of this invention includes
any sequence of amino acids, such as a protein, polypeptide or
peptide fragment, or nucleic acid sequences encoding such
polypeptides, obtainable from a plant source which demonstrates the
ability to catalyze the production of ricinoleic, lesquerolic,
hydroxyerucic (16-hydroxydocos-cis-13-enoic acid) or
hydroxypalmitoleic (12-hydroxyhexadec-cis-9-enoic) from CoA, ACP or
lipid-linked monoenoic fatty acid substrates under plant enzyme
reactive conditions. By "enzyme reactive conditions" is meant that
any necessary conditions are available in an environment (i.e.,
such factors as temperature, pH, lack of inhibiting substances)
which will permit the enzyme to function.
[0050] Preferential activity of a plant fatty acid hydroxylase
toward a particular fatty acyl substrate is determined upon
comparison of hydroxylated fatty acid product amounts obtained per
different fatty acyl substrates. For example, by "oleate
preferring" is meant that the hydroxylase activity of the enzyme
preparation demonstrates a preference for oleate-containing
substrates over other substrates. Although the precise substrate of
the castor fatty acid hydroxylase is not known, it is thought to be
a monounsaturated fatty acid moiety which is esterified to a
phospholipid such as phosphatidylcholine. However, it is also
possible that monounsaturated fatty acids esterified to
phosphatidylethanolamine, phosphatidic acid or a neutral lipid such
as diacylglycerol or a Coenzyme-A thioester may also be
substrates.
[0051] As noted above, significant activity has been observed in
radioactive labelling studies using fatty acyl substrates other
than oleate (Howling et al., 1972) indicating that the substrate
specificity is for a family of related fatty acyl compounds.
Because the castor hydroxylase introduces hydroxy groups three
carbons from a double bond, proximal to the methyl carbon of the
fatty acid, the enzyme is termed a kappa hydroxylase for
convenience. Of particular interest, the present invention
discloses that the castor kappa hydroxylase may be used for
production of 12-hydroxy-9-octadecenoic acid (ricinoleate),
12-hydroxy-9-hexadecenoic acid, 14-hydroxy-11-eicosenoic acid,
16-hydroxy-13-docosenoic acid, 9-hydroxy-6-octadecenoic acid by
expression in plants species which produce the non-hydroxylated
precursors. The present invention also discloses production of
additionally modified fatty acids such as
12-hydroxy-9,15-octadecadienoic acid that result from desaturation
of hydroxylated fatty acids (e.g., 12-hydroxy-9-octadecenoic acid
in this example).
[0052] The present invention also discloses that future advances in
the genetic engineering of plants will lead to production of
substrate fatty acids, such as icosenoic acid esters, and
palmitoleic acid esters in plants that do not normally accumulate
such fatty acids. The invention described herein may be used in
conjunction with such future improvements to produce hydroxylated
fatty acids of this invention in any plant species that is amenable
to directed genetic modification. Thus, the applicability of this
invention is not limited in our conception only to those species
that currently accumulate suitable substrates.
[0053] As noted above, a plant kappa hydroxylase of this invention
will display activity towards various fatty acyl substrates. During
biosynthesis of lipids in a plant cell, fatty acids are typically
covalently bound to acyl carrier protein (ACP), coenzyme A (COA) or
various cellular lipids. Plant kappa hydroxylases which display
preferential activity toward lipid-linked acyl substrate are
especially preferred because they are likely to be closely
associated with normal pathway of storage lipid synthesis in
immature embryos. However, activity toward acyl-CoA substrates or
other synthetic substrates, for example, is also contemplated
herein.
[0054] Other plant kappa hydroxylases are obtainable from the
specific exemplified sequences provided herein. Furthermore, it
will be apparent that one can obtain natural and synthetic plant
kappa hydroxylases including modified amino acid sequences and
starting materials for synthetic-protein modeling from the
exemplified plant kappa hydroxylase and from plant kappa
hydroxylases which are obtained through the use of such exemplified
sequences. Modified amino acid sequences include sequences which
have been mutated, truncated, elongated or the like, whether such
sequences were partially or wholly synthesized. Sequences which are
actually purified from plant preparations or are identical or
encode identical proteins thereto, regardless of the method used to
obtain the protein or sequence, are equally considered naturally
derived.
[0055] Thus, one skilled in the art will readily recognize that
antibody preparations, nucleic acid probes (DNA and RNA) or the
like may be prepared and used to screen and recover "homologous" or
"related" kappa hydroxylases from a variety of plant sources.
Typically, nucleic acid probes are labeled to allow detection,
preferably with radioactivity although enzymes or other methods may
also be used. For immunological screening methods, antibody
preparations either monoclonal or polyclonal are utilized.
Polyclonal antibodies, although less specific, typically are more
useful in gene isolation. For detection, the antibody is labeled
using radioactivity or any one of a variety of second
antibody/enzyme conjugate systems that are commercially
available.
[0056] Homologous sequences are found when there is an identity of
sequence and may be determined upon comparison of sequence
information, nucleic acid or amino acid, or through hybridization
reactions between a known kappa hydroxylase and a candidate source.
Conservative changes, such as Glu/Asp, Val/Ile, Ser/Thr, Arg/Lys
and Gln/Asn may also be considered in determining sequence
homology. Typically, a lengthy nucleic acid sequence may show as
little as 50-60% sequence identity, and more preferably at least
about 70% sequence identity, between the target sequence and the
given plant kappa hydroxylase of interest excluding any deletions
which may be present, and still be considered related. Amino acid
sequences are considered homologous by as little as 25% sequence
identity between the two complete mature proteins. (see generally,
Doolittle, R. F., OF URFS and ORFS, University Science Books, CA,
1986.)
[0057] A genomic or other appropriate library prepared from the
candidate plant source of interest may be probed with conserved
sequences from the plant kappa hydroxylase to identify homologously
related sequences. Use of an entire cDNA or other sequence may be
employed if shorter probe sequences are not identified. Positive
clones are then analyzed by restriction enzyme digestion and/or
sequencing. When a genomic library is used, one or more sequences
may be identified providing both the coding region, as well as the
transcriptional regulatory elements of the kappa hydroxylase gene
from such plant source. Probes can also be considerably shorter
than the entire sequence. Oligonucleotides may be used, for
example, but should be at least about 10, preferably at least about
15, more preferably at least 20 nucleotides in length. When shorter
length regions are used for comparison, a higher degree of sequence
identity is required than for longer sequences. Shorter probes are
often particularly useful for polymerase chain reactions (PCR),
especially when highly conserved sequences can be identified (see
Gould et al., 1989 for examples of the use of PCR to isolate
homologous genes from taxonomically diverse species).
[0058] When longer nucleic acid fragments are employed (>100 bp)
as probes, especially when using complete or large cDNA sequences,
one would screen with low stringencies (for example, 40-50.degree.
C. below the melting temperature of the probe) in order to obtain
signal from the target sample with 20-50% deviation, i.e.,
homologous sequences (Beltz et al., 1983).
[0059] In a preferred embodiment, a plant kappa hydroxylase of this
invention will have at least 60% overall amino acid sequence
similarity with the exemplified plant kappa hydroxylase. In
particular, kappa hydroxylases which are obtainable from an amino
acid or nucleic acid sequence of a castor or Lesquerella kappa
hydroxylase are especially preferred. The plant kappa hydroxylases
may have preferential activity toward longer or shorter chain fatty
acyl substrates. Plant fatty acyl hydroxylases having
oleate-12-hydroxylase activity and eicosenoate-14-hydroxylase
activity are both considered homologously related proteins because
of in vitro evidence (Howling et al., 1972), and evidence disclosed
herein, that the castor kappa hydroxylase will act on both
substrates. Hydroxylated fatty acids may be subject to further
enzymatic modification by other enzymes which are normally present
or are introduced by genetic engineering methods. For example,
14-hydroxy-11,17-eicosadienoic acid, which is present in some
Lesquerella species (Smith, 1985), is thought to be produced by
desaturation of 14-hydroxy-11-eicosenoic acid.
[0060] Again, not only can gene clones and materials derived
therefrom be used to identify homologous plant fatty acyl
hydroxylases, but the resulting sequences obtained therefrom may
also provide a further method to obtain plant fatty acyl
hydroxylases from other plant sources. In particular, PCR may be a
useful technique to obtain related plant fatty acyl hydroxylases
from sequence data provided herein. One skilled in the art will be
able to design oligonucleotide probes based upon sequence
comparisons or regions of typically highly conserved sequence. Of
special interest are polymerase chain reaction primers based on the
conserved regions of amino acid sequence between the castor kappa
hydroxylase and the L. fendleri hydroxylase (SEQ ID NO:4). Details
relating to the design and methods for a PCR reaction using these
probes are described more fully in the examples.
[0061] It should also be noted that the fatty acyl hydroxylases of
a variety of sources can be used to investigate fatty acid
hydroxylation events in a wide variety of plant and in vivo
applications. Because all plants synthesize fatty acids via a
common metabolic pathway, the study and/or application of one plant
fatty acid hydroxylase to a heterologous plant host may be readily
achieved in a variety of species.
[0062] Once the nucleic acid sequence is obtained, the
transcription, or transcription and translation (expression), of
the plant fatty acyl hydroxylases in a host cell is desired to
produce a ready source of the enzyme and/or modify the composition
of fatty acids found therein in the form of free fatty acids,
esters (particularly esterified to glycerolipids or as components
of wax esters), estolides, or ethers. Other useful applications may
be found when the host cell is a plant host cell, in vitro and in
vivo. For example, by increasing the amount of an kappa hydroxylase
available to the plant, an increased percentage of ricinoleate or
lesqueroleate (14-hydroxy-11-eicosenoic acid) may be provided.
[0063] Kappa Hydroxylase
[0064] By this invention, a mechanism for the biosynthesis of
ricinoleic acid in plants is demonstrated. Namely, that a specific
plant kappa hydroxylase having preferential activity toward fatty
acyl substrates is involved in the accumulation of hydroxylated
fatty acids in at least some plant species. The use of the terms
ricinoleate or ricinoleic acid (or lesqueroleate or lesquerolic
acid, densipoleate etc.) is intended to include the free acids, the
ACP and CoA esters, the salts of these acids, the glycerolipid
esters (particularly the triacylglycerol esters), the wax esters,
the estolides and the ether derivatives of these acids.
[0065] The determination that plant fatty acyl hydroxylases are
active in the in vivo production of hydroxylated fatty acids
suggests several possibilities for plant enzyme sources. In fact,
hydroxylated fatty acids are found in some natural plant species in
abundance. For example, three hydroxy fatty acids related to
ricinoleate occur in major amounts in seed oils from various
Lesquerella species. Of particular interest, lesquerolic acid is a
20 carbon homolog of ricinoleate with two additional carbons at the
carboxyl end of the chain (Smith, 1985). Other natural plant
sources of hydroxylated fatty acids include but are not limited to
seeds of the Linum genus, seeds of Wrightia species, Lycopodium
species, Strophanthus species, Convolvulaces species, Calendula
species and many others (van de Loo et al., 1993).
[0066] Plants having significant presence of ricinoleate or
lesqueroleate or desaturated other or modified derivatives of these
fatty acids are preferred candidates to obtain naturally-derived
kappa hydroxylases. For example, Lesquerella densipila contains a
diunsaturated 18 carbon fatty acid with a hydroxyl group (van de
Loo et al., 1993) that is thought to be produced by an enzyme that
is closely related to the castor kappa hydroxylase, according to
the theory on which this invention is based. In addition, a
comparison between kappa hydroxylases and between plant fatty acyl
hydroxylases which introduce hydroxyl groups at positions other
than the 12-carbon of oleate or the 14-carbon of lesqueroleate or
on substrates other than oleic acid and icosenoic acid may yield
insights for gene identification, protein modeling or other
modifications as discussed above.
[0067] Especially of interest are fatty acyl hydroxylases which
demonstrate activity toward fatty acyl substrates other than
oleate, or which introduce the hydroxyl group at a location other
than the C12 carbon. As described above, other plant sources may
also provide sources for these enzymes through the use of protein
purification, nucleic acid probes, antibody preparations, protein
modeling, or sequence comparisons, for example, and of special
interest are the respective amino acid and nucleic acid sequences
corresponding to such plant fatty acyl hydroxylases. Also, as
previously described, once a nucleic acid sequence is obtained for
the given plant hydroxylase, further plant sequences may be
compared and/or probed to obtain homologously related DNA sequences
thereto and so on.
[0068] Genetic Engineering Applications
[0069] As is well known in the art, once a cDNA clone encoding a
plant kappa hydroxylase is obtained, it may be used to obtain its
corresponding genomic nucleic acid sequences thereto.
[0070] The nucleic acid sequences which encode plant kappa
hydroxylases may be used in various constructs, for example, as
probes to obtain further sequences from the same or other species.
Alternatively, these sequences may be used in conjunction with
appropriate regulatory sequences to increase levels of the
respective hydroxylase of interest in a host cell for the
production of hydroxylated fatty acids or study of the enzyme in
vitro or in vivo or to decrease or increase levels of the
respective hydroxylase of interest for some applications when the
host cell is a plant entity, including plant cells, plant parts
(including but not limited to seeds, cuttings or tissues) and
plants.
[0071] A nucleic acid sequence encoding a plant kappa hydroxylase
of this invention may include genomic, cDNA or mRNA sequence. By
"encoding" is meant that the sequence corresponds to a particular
amino acid sequence either in a sense or anti-sense orientation. By
"recombinant" is meant that the sequence contains a genetically
engineered modification through manipulation via mutagenesis,
restriction enzymes, or the like. A cDNA sequence may or may not
encode pre-processing sequences, such as transit or signal peptide
sequences. Transit or signal peptide sequences facilitate the
delivery of the protein to a given organelle and are frequently
cleaved from the polypeptide upon entry into the organelle,
releasing the "mature" sequence. The use of the precursor DNA
sequence is preferred in plant cell expression cassettes.
[0072] Furthermore, as discussed above the complete genomic
sequence of the plant kappa hydroxylase may be obtained by the
screening of a genomic library with a probe, such as a cDNA probe,
and isolating those sequences which regulate expression in seed
tissue.
[0073] Once the desired plant kappa hydroxylase nucleic acid
sequence is obtained, it may be manipulated in a variety of ways.
Where the sequence involves non-coding flanking regions, the
flanking regions may be subjected to resection, mutagenesis, etc.
Thus, transitions, transversions, deletions, and insertions may be
performed on the naturally occurring sequence. In addition, all or
part of the sequence may be synthesized. In the structural gene,
one or more codons may be modified to provide for a modified amino
acid sequence, or one or more codon mutations may be introduced to
provide for a convenient restriction site or other purpose involved
with construction or expression. The structural gene may be further
modified by employing synthetic adapters, linkers to introduce one
or more convenient restriction sites, or the like.
[0074] The nucleic acid or amino acid sequences encoding a plant
kappa hydroxylase of this invention may be combined with other
non-native, or "heterologous", sequences in a variety of ways. By
"heterologous" sequences is meant any sequence which is not
naturally found joined to the plant kappa hydroxylase, including,
for example, combination of nucleic acid sequences from the same
plant which are not naturally found joined together.
[0075] The DNA sequence encoding a plant kappa hydroxylase of this
invention may be employed in conjunction with all or part of the
gene sequences normally associated with the kappa hydroxylase. In
its component parts, a DNA sequence encoding kappa hydroxylase is
combined in a DNA construct having, in the 5' to 3' direction of
transcription, a transcription initiation control region capable of
promoting transcription and/or translation in a host cell, the DNA
sequence encoding plant kappa hydroxylase and a transcription
and/or translation termination region.
[0076] Potential host cells include both prokaryotic and eukaryotic
cells. A host cell may be unicellular or found in a multicellular
differentiated or undifferentiated organism depending upon the
intended use. Cells of this invention may be distinguished by
having a plant kappa hydroxylase foreign to the wild-type cell
present therein, for example, by having a recombinant nucleic acid
construct encoding a plant kappa hydroxylase therein.
[0077] Depending upon the host, the regulatory regions will vary,
including regions from viral, plasmid or chromosomal genes, or the
like. For expression in prokaryotic or eukaryotic microorganisms,
particularly unicellular hosts, a wide variety of constitutive or
regulatable promoters may be employed. Expression in a
microorganism can provide a ready source of the plant enzyme. Among
transcriptional initiation regions which have been described are
regions from bacterial and yeast hosts, such as E. coli, B.
subtilis, Saccharomyces cerevisiae, including genes such as
beta-galactosidase, T7 polymerase, trpE or the like.
[0078] For the most part, the constructs will involve regulatory
regions functional in plants which provide for modified production
of plant kappa hydroxylase with resulting modification of the fatty
acid composition. The open reading frame, coding for the plant
kappa hydroxylase or functional fragment thereof will be joined at
its 5' end to a transcription initiation regulatory region.
Numerous transcription initiation regions are available which
provide for a wide variety of constitutive or regulatable, e.g.,
inducible, transcription of the structural gene functions.
[0079] Among transcriptional initiation regions used for plants are
such regions associated with the structural genes such as for
nopaline and mannopine synthases, or with napin, soybean
.beta.-conglycinin, oleosin, 12S storage protein, the cauliflower
mosaic virus 35S promoters or the like. The
transcription/translation initiation regions corresponding to such
structural genes are found immediately 5' upstream to the
respective start codons.
[0080] In embodiments wherein the expression of the kappa
hydroxylase protein is desired in a plant host, the use of all or
part of the complete plant kappa hydroxylase gene is desired. If a
different promoter is desired, such as a promoter native to the
plant host of interest or a modified promoter, i.e., having
transcription initiation regions derived from one gene source and
translation initiation regions derived from a different gene source
or enhanced promoters, such as double 35S CaMV promoters, the
sequences may be joined together using standard techniques.
[0081] For such applications when 5' upstream non-coding regions
are obtained from other genes regulated during seed maturation,
those preferentially expressed in plant embryo tissue, such as
transcription initiation control regions from the B. napus napin
gene, or the Arabidopsis 12S storage protein, or soybean
.beta.-conglycinin (Bray et al., 1987) are desired. Transcription
initiation regions which are preferentially expressed in seed
tissue, i.e., which are undetectable in other plant parts, are
considered desirable for fatty acid modifications in order to
minimize any disruptive or adverse effects of the gene product.
[0082] Regulatory transcript termination regions may be provided in
DNA constructs of this invention as well. Transcript termination
regions may be provided by the DNA sequence encoding the plant
kappa hydroxylase or a convenient transcription termination region
derived from a different gene source, for example, the transcript
termination region which is naturally associated with the
transcript initiation region. Where the transcript termination
region is from a different gene source, it will contain at least
about 0.5 kb, preferably about 1-3 kb of sequence 3' to the
structural gene from which the termination region is derived.
[0083] Plant expression or transcription constructs having a plant
kappa hydroxylase as the DNA sequence of interest for increased or
decreased expression thereof may be employed with a wide variety of
plant life, particularly, plant life involved in the production of
vegetable oils for edible and industrial uses. Most especially
preferred are temperate oilseed crops. Plants of interest include,
but are not limited to rapeseed (canola and high erucic acid
varieties), Crambe, Brassica juncea, Brassica nigra, meadowfoam,
flax, sunflower, safflower, cotton, Cuphea, soybean, peanut,
coconut and oil palms and corn. An important criterion in the
selection of suitable plants for the introduction on the kappa
hydroxylase is the presence in the host plant of a suitable
substrate for the hydroxylase. Thus, for example, production of
ricinoleic acid will be best accomplished in plants that normally
have high levels of oleic acid in seed lipids. Similarly,
production of lesquerolic acid will best be accomplished in plants
that have high levels of icosenoic acid in seed lipids.
[0084] Depending on the method for introducing the recombinant
constructs into the host cell, other DNA sequences may be required.
Importantly, this invention is applicable to dicotyledons and
monocotyledons species alike and will be readily applicable to new
and/or improved transformation and regulation techniques. The
method of transformation is not critical to the current invention;
various methods of plant transformation are currently available. As
newer methods are available to transform crops, they may be
directly applied hereunder. For example, many plant species
naturally susceptible to Agrobacterium infection may be
successfully transformed via tripartite or binary vector methods of
Agrobacterium mediated transformation. In addition, techniques of
microinjection, DNA particle bombardment, electroporation have been
developed which allow for the transformation of various monocot and
dicot plant species.
[0085] In developing the DNA construct, the various components of
the construct or fragments thereof will normally be inserted into a
convenient cloning vector which is capable of replication in a
bacterial host, e.g., E. coli. Numerous vectors exist that have
been described in the literature. After each cloning, the plasmid
may be isolated and subjected to further manipulation, such as
restriction, insertion of new fragments, ligation, deletion,
insertion, resection, etc., so as to tailor the components of the
desired sequence. Once the construct has been completed, it may
then be transferred to an appropriate vector for further
manipulation in accordance with the manner of transformation of the
host cell.
[0086] Normally, included with the DNA construct will be a
structural gene having the necessary regulatory regions for
expression in a host and providing for selection of transformant
cells. The gene may provide for resistance to a cytotoxic agent,
e.g., antibiotic, heavy metal, toxin, etc., complementation
providing prototropy to an auxotrophic host, viral immunity or the
like. Depending upon the number of different host species the
expression construct or components thereof are introduced, one or
more markers may be employed, where different conditions for
selection are used for the different hosts.
[0087] It is noted that the degeneracy of the DNA code provides
that some codon substitutions are permissible of DNA sequences
without any corresponding modification of the amino acid
sequence.
[0088] As mentioned above, the manner in which the DNA construct is
introduced into the plant host is not critical to this invention.
Any method which provides for efficient transformation may be
employed. Various methods for plant cell transformation include the
use of Ti- or Ri-plasmids, microinjection, electroporation,
infiltration, imbibition, DNA particle bombardment, liposome
fusion, DNA bombardment or the like. In many instances, it will be
desirable to have the construct bordered on one or both sides of
the T-DNA, particularly having the left and right borders, more
particularly the right border. This is particularly useful when the
construct uses A. tumefaciens or A. rhizogenes as a mode for
transformation, although the T-DNA borders may find use with other
modes of transformation.
[0089] Where Agrobacterium is used for plant cell transformation, a
vector may be used which may be introduced into the Agrobacterium
host for homologous recombination with T-DNA or the Ti- or
Ri-plasmid present in the Agrobacterium host. The Ti- or Ri-plasmid
containing the T-DNA for recombination may be armed (capable of
causing gall formation) or disarmed (incapable of causing gall),
the latter being permissible, so long as the vir genes are present
in the transformed Agrobacterium host. The armed plasmid can give a
mixture of normal plant cells and gall.
[0090] In some instances where Agrobacterium is used as the vehicle
for transforming plant cells, the expression construct bordered by
the T-DNA border(s) will be inserted into a broad host spectrum
vector, there being broad host spectrum vectors described in the
literature. Commonly used is pRK2 or derivatives thereof. See, for
example, Ditta et al. (1980), which is incorporated herein by
reference. Included with the expression construct and the T-DNA
will be one or more markers, which allow for selection of
transformed Agrobacterium and transformed plant cells. A number of
markers have been developed for use with plant cells, such as
resistance to kanamycin, the aminoglycoside G418, hygromycin, or
the like. The particular marker employed is not essential to this
invention, one or another marker being preferred depending on the
particular host and the manner of construction.
[0091] For transformation of plant cells using Agrobacterium,
explants may be combined and incubated with the transformed
Agrobacterium for sufficient time for transformation, the bacteria
killed, and the plant cells cultured in an appropriate selective
medium. Once callus forms, shoot formation can be encouraged by
employing the appropriate plant hormones in accordance with known
methods and the shoots transferred to rooting medium for
regeneration of plants. The plants may then be grown to seed and
the seed used to establish repetitive generations and for isolation
of vegetable oils.
[0092] Using Hydroxylase Genes to Alter the Activity of Fatty Acid
Desaturases
[0093] A widely acknowledged goal of current efforts to improve the
nutritional quality of edible plant oils, or to facilitate
industrial applications of plant oils, is to alter the level of
desaturation of plant storage lipids (Topfer et al., 1995). In
particular, in many crop species it is considered desirable to
reduce the level of polyunsaturation of storage lipids and to
increase the level of oleic acid. The precise amount of the various
fatty acids in a particular plant oil varies with the intended
application. Thus, it is desirable to have a robust method that
will permit genetic manipulation of the level of unsaturation to
any desired level.
[0094] Substantial progress has recently been made in the isolation
of genes encoding plant fatty acid desaturases (reviewed in Topfer
et al., 1995). These genes have been introduced into various plant
species and used to alter the level of fatty acid unsaturation in
one of three ways. First, the genes can be placed under
transcriptional control of a strong promoter so that the amount of
the corresponding enzyme is increased. In some cases this leads to
an increase in the amount of the fatty acid that is the product of
the reaction catalyzed by the enzyme. For example, Arondel et al.
(1992) increased the amount of linolenic acid (18:3) in tissues of
transgenic Arabidopsis plants by placing the endoplasmic
reticulum-localized fad3 gene under transcriptional control of the
strong constitutive cauliflower mosaic virus 35S promoter.
[0095] A second method of using cloned genes to alter the level of
fatty acid unsaturation is to cause transcription of all or part of
a gene in transgenic tissues so that the transcripts have an
antisense orientation relative to the normal mode of transcription.
This has been used by a number of laboratories to reduce the level
of expression of one or more desaturase genes that have significant
nucleotide sequence homology to the gene used in the construction
of the antisense gene (reviewed in Topfer et al.). For instance,
antisense repression of the oleate .DELTA.12-desaturase in
transgenic rapeseed resulted in a strong increase in oleic acid
content (cf., Topfer et al., 1995).
[0096] A third method for using cloned genes to alter fatty acid
desaturation is to exploit the phenomenon of cosuppression or
"gene-silencing" (Matzke et al., 1995). Although the mechanisms
responsible for gene silencing are not known in any detail, it has
frequently been observed that in transgenic plants, expression of
an introduced gene leads to inactivation of homologous endogenous
genes.
[0097] For example, high-level sense expression of the Arabidopsis
fad8 gene, which encodes a chloroplast-localized
.DELTA.15-desaturase, in transgenic Arabidopsis plants caused
suppression of the endogenous copy of the fad8 gene and the
homologous fad7 gene (which encodes an isozyme of the fad8 gene)
(Gibson et al., 1994). The fad7 and fad8 genes are only 76%
identical at the nucleotide level. At the time of publication, this
example represented the most divergent pair of plant genes for
which cosuppression had been observed.
[0098] In view of previous evidence concerning the relatively high
level of nucleotide sequence homology required to obtain
cosuppression, it is not obvious to one skilled in the art that
sense expression in transgenic plants of the castor fatty acyl
hydroxylase of this invention would significantly alter the amount
of unsaturation of storage lipids.
[0099] However, the present inventors establish that fatty acyl
hydroxylase genes can be used for this purpose as taught in Example
4 of this specification. Of particular importance, this invention
teaches the use of fatty acyl hydroxylase genes to increase the
proportion of oleic acid in transgenic plant tissues. The mechanism
by which expression of the gene exerts this effect is not known but
may be due to one of several possibilities which are elaborated
upon in Example 4.
[0100] The invention now being generally described, it will be more
readily understood by reference to the following examples which are
included for purposes of illustration only and are not intended to
limit the present invention.
EXAMPLES
[0101] In the experimental disclosure which follows, all
temperatures are given in degrees centigrade (.degree. C.), weights
are given in grams (g), milligram (mg) or micrograms (.mu.g),
concentrations are given as molar (M), millimolar (mM) or
micromolar (.mu.M) and all volumes are given in liters (l),
microliters (.mu.l) or milliliters (ml), unless otherwise
indicated.
Example 1
Production of Novel Hydroxylated Fatty Acids in Arabidopsis
Thaliana
[0102] Overview
[0103] The kappa hydroxylase encoded by the fah12 gene from castor
was used to produce ricinoleic acid, lesquerolic acid, densipolic
acid and auricolic acid in transgenic Arabidopsis plants.
[0104] Production of Transgenic Plants
[0105] A variety of methods have been developed to insert a DNA
sequence of interest into the genome of a plant host to obtain the
transcription and translation of the sequence to effect phenotypic
changes. The following methods represent only one of many
equivalent means of producing transgenic plants and causing
expression of the hydroxylase gene.
[0106] Arabidopsis plants were transformed, by
Agrobacterium-mediated transformation, with the kappa hydroxylase
encoded by the castor fah12 gene on binary Ti plasmid pB6. This
plasmid has also been used to transform Nicotiana tabacum for the
production of ricinoleic acid.
[0107] Inoculums of Agrobacterium tumefaciens strain GV3101
containing binary Ti plasmid pB6 were plated on L-broth plates
containing 50 .mu.g/ml kanamycin and incubated for 2 days at
30.degree. C. Single colonies were used to inoculate large liquid
cultures (L-broth medium with 50 mg/l rifampicin, 110 mg/l
gentamycin and 200 mg/l kanamycin) to be used for the
transformation of Arabidopsis plants.
[0108] Arabidopsis plants were transformed by the in planta
transformation procedure essentially as described by Bechtold et
al. (1993). Cells of A. cumetaciens GV3101(pB6) were harvested from
liquid cultures by centrifugation, then resuspended in infiltration
medium at OD.sub.600=0.8. Infiltration medium was Murashige and
Skoog macro and micronutrient medium (Sigma Chemical Co., St.
Louis, Mo.) containing 10 mg/l 6-benzylaminopurine and 5% glucose.
Batches of 12-15 plants were grown for 3 to 4 weeks in natural
light at a mean daily temperature of approximately 25.degree. C. in
3.5 inch pots containing soil. The intact plants were immersed in
the bacterial suspension then transferred to a vacuum chamber and
placed under 600 mm of vacuum produced by a laboratory vacuum pump
until tissues appeared uniformly water-soaked (approximately 10
min). The plants were grown at 25.degree. C. under continuous light
(100 .mu.mol m.sup.-2 s.sup.-1 irradiation in the 400 to 700 nm
range) for four weeks. The seeds obtained from all the plants in a
pot were harvested as one batch. The seeds were sterilized by
sequential treatment for 2 min with ethanol followed by 10 min in a
mixture of household bleach (Chlorox), water and Tween-80 (50%,
50%, 0.05%) then rinsed thoroughly with sterile water. The seeds
were plated at high density (2000 to 4000 per plate) onto
agar-solidified medium in 100 mm petri plates containing 1/2.times.
Murashige and Skoog salts medium enriched with B5 vitamins (Sigma
Chemical Co., St. Louis, Mo.) and containing kanamycin at 50 mg/l.
After incubation for 48 h at 4.degree. C. to stimulate germination,
seedlings were grown for a period of seven days until transformants
were clearly identifiable as healthy green seedlings against a
background of chlorotic kanamycin-sensitive seedlings. The
transformants were transferred to soil for two weeks before leaf
tissue could be used for DNA and lipid analysis. More than 20
transformants were obtained.
[0109] DNA was extracted from young leaves from transformants to
verify the presence of an intact fah12 gene. The presence of the
transgene in a number of the putative transgenic lines was verified
by using the polymerase chain reaction to amplify the insert from
pB6. The primers used were HF2=GCTCTTTTGTGCGCTCATTC (SEQ ID NO:12)
and HR1=CGGTACCAGAAAACGCCTTG (SEQ ID NO:13), which were designed to
allow the amplification of a 700 bp fragment. Approximately 100 ng
of genomic DNA was added to a solution containing 25 pmol of each
primer, 1.5 U Taq polymerase (Boehringer Manheim), 200 uM of dNTPs,
50 mM KCl, 10 mM Tris.Cl (pH 9), 0.1% (v/v) Triton X-100, 1.5 mM
MgCl.sub.2, 3% (v/v) formamide, to a final volume of 50 .mu.l.
Amplifications conditions were: 4 min denaturation step at
94.degree. C., followed by 30 cycles of 92.degree. C. for 1 min,
55.degree. C. for 1 min, 72.degree. C. for 2 min. A final extension
step closed the program at 72.degree. C. for 5 min. Transformants
could be positively identified after visualization of a
characteristic 1 kb amplified fragment on an ethidium bromide
stained agarose gel. All transgenic lines tested gave a PCR product
of a size consistent with the expected genotype, confirming that
the lines were, indeed, transgenic. All further experiments were
done with three representative transgenic lines of the wild type
designated as 1-3, 4D, 7-4 and one transgenic line of the fad2
mutant line JB12. The transgenic JB12 line was included in order to
test whether the increased accumulation of oleic acid in this
mutant would have an effect on the amount of ricinoleic acid that
accumulated in the transgenic plants.
[0110] Analysis of Transgenic Plants
[0111] Leaves and seeds from fah12 transgenic Arabidopsis plants
were analyzed for the presence of hydroxylated fatty acids using
gas chromatography. Lipids were extracted from 100-200 mg leaf
tissue or 50 seeds. Fatty acid methyl esters (FAMES) were prepared
by placing tissue in 1.5 ml of 1.0 M methanolic HCl (Supelco Co.)
in a 13.times.100 mm glass screw-cap tube capped with a
teflon-lined cap and heated to 80.degree. C. for 2 hours. Upon
cooling, 1 ml petroleum ether was added and the FAMES removed by
aspirating off the ether phase which was then dried under a
nitrogen stream in a glass tube. One hundred .mu.l of
N,O-bis(Trimethylsilyl) trifluoroacetamide (BSTFA; Pierce Chemical
Co) and 200 .mu.l acetonitrile was added to derivatize the hydroxyl
groups. The reaction was carried out at 70.degree. C. for 15 min.
The products were dried under nitrogen, redissolved in 100 .mu.l
chloroform and transferred to a gas chromatograph vial. Two .mu.l
of each sample were analyzed on a SP2340 fused silica capillary
column (30 m, 0.75 mm ID, 0.20 mm film, Supelco), using a
Hewlett-Packard 5890 II series Gas Chromatograph. The samples were
not split, the temperature program was 195.degree. C. for 18 min,
increased to 230.degree. C. at 25.degree. C./min, held at
230.degree. C. for 5 min then down to 195.degree. C. at 25.degree.
C./min., and flame ionization detectors were used.
[0112] The chromatographic elution time of methyl esters and O-TMS
derivatives of ricinoleic acid, lesquerolic acid and auricolic acid
was established by GC-MS of lipid samples from seeds of L. fendleri
and comparison to published chromatograms of fatty acids from this
species (Carlson et al., 1990). A O-TMS-methyl-ricinoleate standard
was prepared from ricinoleic acid obtained from Sigma Chemical Co
(St, Louis, Mo.). O-TMS-methyl-lesqueroleate and
O-TMS-methyl-auricoleate standards were prepared from
triacylglycerols purified from seeds of L. fendleri. The mass
spectrum of O-TMS-methyl-ricinoleate, O-TMS-methyl-densipoleate,
O-TMS-methyl-lesqueroleate, and O-TMS-methyl-auricoleate are shown
in FIGS. 1A-D, respectively. The structures of the characteristic
ions produced during mass spectrometry of these derivatives are
shown in FIG. 2.
[0113] Lipid extracted from transgenic tissues were analyzed by gas
chromatography and mass spectrometry for the presence of
hydroxylated fatty acids. As a matter of reference, the average
fatty acid composition of leaves in Arabidopsis wild type and fad2
mutant lines was reported by Miquel and Browse (1992). Gas
chromatograms of methylated and silylated fatty acids from seeds of
wild type and a fah12 transgenic wild type plant are shown in FIGS.
3A and 3B, respectively. The profiles are very similar except for
the presence of three small but distinct peaks at 14.3, 15.9 and
18.9 minutes. A very small peak at 20.15 min was also evident. The
elution time of the peaks at 14.3 and 18.9 min corresponded
precisely to that of comparably prepared ricinoleic and lesquerolic
standards, respectively. No significant differences were observed
in lipid extracts from leaves or roots of the wild type and the
fah12 transgenic wild type lines (Table 1).
[0114] Thus, in spite of the fact that the fah12 gene is expressed
throughout the plant, effects on fatty acid composition was
observed only in seed tissue. The present inventors have made a
similar observation for transgenic fah12 tobacco.
[0115] Table 1. Fatty acid composition of lipids from transgenic
and wild type Arabidopsis. The values are the means obtained from
analysis of samples from three independent transgenic lines, or
three independent samples of wild type and fad2 lines.
1 TABLE 1 Seed Leaf Root Fatty FAH12 FAH12 FAH12 FAH12 acid WT WT
fad2 JB12 WT WT WT WT 16:0 8.5 8.2 6.4 6.1 16.5 17.5 23.9 24.9 16:3
0 0 0 0 10.1 9.8 0 0 18:0 3.2 3.5 2.9 3.5 1.3 1.2 2.0 1.9 18:1 15.4
26.3 43.4 47.8 2.4 3.4 5.4 3.2 18:2 27.0 21.4 10.2 7.2 15.1 14.0
32.2 29.4 18:3 22.0 16.6 -- 9.7 36.7 36.0 26.7 30.6 20:1 14.0 14.3
-- 13.1 0 0 0 0 18:1- 0 0.4 0.3 0 0 0 0 0 OH 18:2- 0 0.4 0.3 0 0 0
0 0 OH 20:1- 0 0.2 0.1 0 0 0 0 0 OH 20:2- 0 0.1 0.1 0 0 0 0 0
OH
[0116] In order to confirm that the observed new peaks in the
transgenic lines corresponded to derivatives of ricinoleic,
lesquerolic, densipolic and auricolic acids, mass spectrometry was
used. The fatty acid derivatives were resolved by gas
chromatography as described above except that a Hewlett-Packard
5971 series mass selective detector was used in place of the flame
ionization detector used in the previous experiment. The spectra of
the four new peaks in FIG. 3B (peak numbers 10, 11, 12 and 13) are
shown in FIGS. 4A-D, respectively. Comparison of the spectrum
obtained for the standards with that obtained for the four peaks
from the transgenic lines confirms the identity of the four new
peaks. On the basis of the three characteristic peaks at M/Z 187,
270 and 299, peak 10 is unambiguously identified as
O-TMS-methylricinoleate. On the basis of the three characteristic
peaks at M/Z 185, 270 and 299, peak 11 is unambiguously identified
as O-TMS-methyldensipoleate. On the basis of the three
characteristic peaks at M/Z 187, 298 and 327, peak 12 is
unambiguously identified as O-TMS-methyllesqueroleate. On the basis
of the three characteristic peaks at M/Z 185, 298 and 327, peak 13
is unambiguously identified as O-TMS-methylauricoleate.
[0117] These results unequivocally demonstrate the identity of the
fah12 cDNA as encoding a hydroxylase that hydroxylates both oleic
acid to produce ricinoleic acid and also hydroxylates icosenoic
acid to produce lesquerolic acid. These results also provide
additional evidence that the hydroxylase can be functionally
expressed in a heterologous plant species in such a way that the
enzyme is catalytically functional. These results also demonstrate
that expression of this hydroxylase gene leads to accumulation of
ricinoleic, lesquerolic, densipolic and auricolic acids in a plant
species that does not normally accumulate hydroxylated fatty acids
in extractable lipids.
[0118] The present inventors expected to find lesquerolic acid in
the transgenic plants based on the biochemical evidence suggesting
broad substrate specificity of the kappa hydroxylase. By contrast,
the accumulation of densipolic and auricolic acids was less
predictable. Since Arabidopsis does not normally contain
significant quantities of the non-hydroxylated precursors of these
fatty acids which could serve as substrates for the hydroxylase, it
appears that one or more of the three n-3 fatty acid desaturases
known in Arabidopsis (e.g., fad3, fad7, fad8; reviewed in Gibson et
al., 1995) are capable of desaturating the hydroxylated compounds
at the n-3 position. That is, densipolic acid is produced by the
action of an n-3 desaturase on ricinoleic acid. Auricolic acid is
produced by the action of an n-3 desaturase on lesquerolic acid.
Because it is located in the endoplasmic reticulum, the fad3
desaturase is almost certainly responsible. This can be tested in
the future by producing fah12-containing transgenic plants of the
fad3-deficient mutant of Arabidopsis (similar experiments can be
done with fad7 and fad8). It is also formally possible that the
enzymes that normally elongate 18:1.sup.cis.DELTA.9 to
20:1.sup.cis.DELTA.11 may elongate 12OH-18:1.sup.cis.DELTA.9 to
14OH-20:1.sup.cis.DELTA.11, and 12OH-18:2.sup.cis.DELTA.9,15 to
14OH-20:2.sup.cis.DELTA.11,17.
[0119] The amount of the various fatty acids in seed, leaf and root
lipids of the control and transgenic plants is also presented in
Table 1. Although the amount of hydroxylated fatty acids produced
in this example is less than desired for production of ricinoleate
and other hydroxylated fatty acids from plants, numerous
improvements may be envisioned that will increase the level of
accumulation of hydroxylated fatty acids in plants that express the
fah12 or related hydroxylase genes. Improvements in the level and
tissue specificity of expression of the hydroxylase gene are
envisioned. Methods to accomplish this by the use of strong,
seed-specific promoters such as the B. napus napin promoter will be
obvious to one skilled in the art. Additional improvements are
envisioned that involve modification of the enzymes which cleave
hydroxylated fatty acids from phosphatidylcholine, reduction in the
activities of enzymes which degrade hydroxylated fatty acids and
replacement of acyltransferases which transfer hydroxylated fatty
acids to the sn-1, sn-2 and sn-3 positions of glycerolipids.
Although genes for these enzymes have not been described in the
scientific literature, their utility in improving the level of
production of hydroxylated fatty acids can be readily appreciated
based on the results of biochemical investigations of ricinoleate
synthesis.
[0120] Although Arabidopsis is not an economically important plant
species, it is widely accepted by plant biologists as a model for
higher plants. Therefore, the inclusion of this example is intended
to demonstrate the general utility of the invention described here
to the modification of oil composition in higher plants. One
advantage of studying the expression of this novel gene in
Arabidopsis is the existence in this system of a large body of
knowledge on lipid metabolism, as well as the availability of a
collection of mutants which can be used to provide useful
information on the biochemistry of fatty acid hydroxylation in
plant species. Another advantage is the ease of transposing any of
the information obtained on metabolism of ricinoleate in
Arabidopsis to closely related species such as the crop plants
Brassica napus, Brassica juncea or Crambe abyssinica in order to
mass produce ricinoleate, lesqueroleate or other hydroxylated fatty
acids for industrial use. The kappa hydroxylase is useful for the
production of ricinoleate or lesqueroleate in any plant species
that accumulates significant levels of the precursors, oleic acid
and icosenoic acid. Of particular interest are genetically modified
varieties that accumulate high levels of oleic acid. Such varieties
are currently available for sunflower and canola. Production of
lesquerolic acid and related hydroxy fatty acids can be achieved in
species that accumulate high levels of icosenoic acid or other long
chain monoenoic acids. Such plants may in the future be produced by
genetic engineering of plants that do not normally make such
precursors. Thus, the use of the kappa hydroxylase will be of
general utility.
Example 2
Isolation of Lesquerella Kappa Hydroxylase Genomic Clone
[0121] Overview
[0122] Regions of nucleotide sequence that were conserved in both
the castor kappa hydroxylase and the Arabidopsis fad2 .DELTA.12
fatty acid desaturase were used to design oligonucleotide primers.
These were used with genomic DNA from Lesquerella fendleri to
amplify fragments of several homologous genes. These amplified
fragments were then used as hybridization probes to identify full
length genomic clones from a genomic library of L. fendleri.
[0123] Hydroxylated fatty acids are specific to the seed tissue of
Lesquerella sp., and are not found to any appreciable extent in
vegetative tissues. One of the two genes identified by this method
was expressed in both leaves and developing seeds and is therefore
thought to correspond to the .DELTA.12 fatty acid desaturase. The
other gene was expressed at high levels in developing seeds but was
not expressed or was expressed at very low levels in leaves and is
the kappa hydroxylase from this species. The identity of the gene
as a fatty acyl hydroxylase was established by functional
expression of the gene in yeast.
[0124] The identity of this gene will also be established by
introducing the gene into transgenic Arabidopsis plants and showing
that it causes the accumulation of ricinoleic acid, lesquerolic
acid, densipolic acid and auricolic acid in seed lipids.
[0125] The various steps involved in this process are described in
detail below. Unless otherwise indicated, routine methods for
manipulating nucleic acids, bacteria and phage were as described by
Sambrook et al. (1989).
[0126] Isolation of a fragment of the Lesquerella Kappa Hydroxylase
Gene
[0127] Oligonucleotide primers for the amplification of the L.
fendleri kappa hydroxylase were designed by choosing regions of
high deduced amino acid sequence homology between the castor kappa
hydroxylase and the Arabidopsis .DELTA.12 desaturase (fad2).
Because most amino acids are encoded by several different codons,
these oligonucleotides were designed to encode all possible codons
that could encode the corresponding amino acids.
[0128] The sequence of these mixed oligonucleotides was Oligo 1:
TAYWSNCAYMGNMGNCAYCA (SEQ ID NO:14) and Oligo 2:
RTGRTGNGCNACRTGNGTRTC (SEQ ID NO:15) where Y=C+T, W=A+T, S=G+C,
N=A+G+C+T, M=A+C, and R=A+G.
[0129] These oligonucleotides were used to amplify a fragment of
DNA from L. fendleri genomic DNA by the polymerase chain reaction
(PCR) using the following conditions: Approximately 100 ng of
genomic DNA was added to a solution containing 25 pmol of each
primer, 1.5 U Taq polymerase (Boehringer Manheim), 200 uM of dNTPs,
50 mM KCl, 10 mM Tris.Cl (pH 9), 0.1% (v/v) Triton X-100, 1.5 mM
MgCl.sub.2, 3% (v/v) formamide, to a final volume of 50 .mu.l.
Amplifications conditions were: 4 min denaturation step at
94.degree. C., followed by 30 cycles of 92.degree. C. for 1 min,
55.degree. C. for 1 min, 72.degree. C. for 2 min. A final extension
step closed the program at 72.degree. C. for 5 min.
[0130] PCR products of approximately 540 bp were observed following
electrophoretic separation of the products of the PCR reaction in
agarose gels. Two of these fragments were cloned into pBluescript
(Stratagene) to give rise to plasmids pLesq2 and pLesq3. The
sequence of the inserts in these two plasmids was determined by the
chain termination method. The sequence of the insert in pLesq2 is
presented as FIG. 5 (SEQ ID NO:1) and the sequence of the insert in
pLesq3 is presented as FIG. 6 (SEQ ID NO:2). The high degree of
sequence identity between the two clones indicated that they were
both potential candidates to be either a .DELTA.12 desaturase or a
kappa hydroxylase.
[0131] Northern Analysis
[0132] In L. fendleri, hydroxylated fatty acids are found in large
amounts in seed oils but are not found in appreciable amounts in
leaves. An important criterion in discriminating between a fatty
acyl desaturase and kappa hydroxylase is that the kappa hydroxylase
gene is expected to be expressed more highly in tissues which have
high level of hydroxylated fatty acids than in other tissues. In
contrast, all plant tissues should contain mRNA for an .omega.6
fatty acyl desaturase since diunsaturated fatty acids are found in
the lipids of all tissues in most or all plants.
[0133] Therefore, it was of great interest to determine whether the
gene corresponding to pLesq2 was also expressed only in seeds, or
is also expressed in other tissues. This question was addressed by
testing for hybridization of pLesq2 to RNA purified from developing
seeds and from leaves.
[0134] Total RNA was purified from developing seeds and young
leaves of L. fendleri using an Rneasy RNA extraction kit (Qiagen),
according to the manufacturer's instructions. RNA concentrations
were quantified by UV spectrophotometry at .lambda.=260 and 280 nm.
In order to ensure even loading of the gel to be used for Northern
blotting, RNA concentrations were further adjusted after recording
fluorescence under UV light of RNA samples stained with ethidium
bromide and run on a test denaturing gel.
[0135] Total RNA prepared as described above from leaves and
developing seeds was electrophoresed through an agarose gel
containing formaldehyde (Iba et al., 1993). An equal quantity (10
.mu.g) of RNA was loaded in both lanes, and RNA standards
(0.16-1.77 kb ladder, Gibco-BRL) were loaded in a third lane.
Following electrophoresis, RNA was transferred from the gel to a
nylon membrane (Hybond N+, Amersham) and fixed to the filter by
exposure to UV light.
[0136] A .sup.32P-labelled probe was prepared from insert DNA of
clone pLesq2 by random priming and hybridized to the membrane
overnight at 52.degree. C., after it had been prehybridized for 2
h. The prehybridization solution contained 5.times.SSC, 10.times.
Denhardt's solution, 0.1% SDS, 0.1M KPO.sub.4 pH 6.8, 100 .mu.g/ml
salmon sperm DNA. The hybridization solution had the same basic
composition, but no SDS, and it contained 10% dextran sulfate and
30% formamide. The blot was washed once in 2.times.SSC, 0.5% SDS at
65.degree. C. then in 1.times.SSC at the same temperature.
[0137] Brief (30 min) exposure of the blot to X-ray film revealed
that the probe pLesq2 hybridized to a single band only in the seed
RNA lane (FIG. 7). The blot was re-probed with the insert from
pLesq3 gene, which gave bands of similar intensity in the seed and
leaf lanes (FIG. 7).
[0138] These results show that the gene corresponding to the clone
pLesq2 is highly and specifically expressed in seed of L. fendleri.
In conjunction with knowledge of the nucleotide and deduced amino
acid sequence, strong seed-specific expression of the gene
corresponding to the insert in pLesq2 is a convincing indicator of
the role of the enzyme in synthesis of hydroxylated fatty acids in
the seed oil.
[0139] Characterization of a Genomic Clone of the Kappa
Hydroxylase
[0140] Genomic DNA was prepared from young leaves of L. fendleri as
described by Murray and Thompson (1980). A Sau3AI-partial digest
genomic library constructed in the vector .lambda.DashII
(Stratagene, 11011 North Torrey Pines Road, La Jolla Calif. 92037)
was prepared by partially digesting 500 .mu.g of DNA,
size-selecting the DNA on a sucrose gradient (Sambrook et al.,
1989), and ligating the DNA (12 kb average size) to the
BamHI-digested arms of .lambda.DashII. The entire ligation was
packaged according to the manufacturer's conditions and plated on
E. coli strain XL1-Blue MRA-P2 (Stratagene). This yielded
5.times.10.sup.5 primary recombinant clones. The library was then
amplified according to the manufacturer's conditions. A fraction of
the genomic library was plated on E. coli XL1-Blue and resulting
plaques (150,000) were lifted to charged nylon membranes (Hybond
N+, Amersham), according to the manufacturer's conditions. DNA was
crosslinked to the filters under UV in a Stratalinker
(Stratagene).
[0141] Several clones carrying genomic sequences corresponding to
the L. fendleri hydroxylase were isolated by probing the membranes
with the insert from pLesq2 that was PCR-amplified with internal
primers and labelled with .sup.32P by random priming. The filters
were prehybridized for 2 hours at 65.degree. C. in 7% SDS, 1 mM
EDTA, 0.25 M Na.sub.2HPO.sub.4 (pH 7.2), 1% BSA and hybridized to
the probe for 16 hours in the same solution. The filters were
sequentially washed at 65.degree. C. in solutions containing
2.times.SSC, 1.times.SSC, 0.5.times.SSC in addition to 0.1% SDS. A
2.6 kb XbaI fragment containing the complete coding sequence for
the kappa hydroxylase and approximately 1 kb of the 5' upstream
region was subcloned into the corresponding site of pBluescript KS
to produce plasmid pLesq-Hyd and the sequence determined completely
using an automatic sequencer by the dideoxy chain termination
method. Sequence data was analyzed using the program DNASIS
(Hitachi Company).
[0142] The sequence of the insert in clone. pLesq-Hyd is shown in
FIGS. 8A-B. The sequence entails 1855 bp of contiguous DNA sequence
(SEQ ID NO:3). The clone encodes a 401 bp 5' untranslated region
(i.e., nucleotides preceding the first ATG codon), an 1152 bp open
reading frame, and a 302 bp 3' untranslated region. The open
reading frame encodes a 384 amino acid protein with a predicted
molecular weight of 44,370 (SEQ ID NO:4). The amino terminus lacks
features of a typical signal peptide (von Heijne, 1985).
[0143] The exact translation-initiation methionine has not been
experimentally determined, but on the basis of deduced amino acid
sequence homology to the castor kappa hydroxylase (noted below) is
thought to be the methionine encoded by the first ATG codon at
nucleotide 402.
[0144] Comparison of the pLesq-Hyd deduced amino acid sequence with
sequences of membrane-bound desaturases and the castor hydroxylase
(FIGS. 9A-B) indicates that pLesq-Hyd is homologous to these genes.
This figure shows an alignment of the L. fendleri hydroxylase (SEQ
ID NO:4) with the castor hydroxylase (van de Loo et al., 1995), the
Arabidopsis fad2 cDNA which encodes an endoplasmic
reticulum-localized .DELTA.12 desaturase (called fad2) (Okuley et
al., 1994), two soybean fad2 desaturase clones, a Brassica napus
fad2 clone, a Zea mays fad2 clone and partial sequence of a R.
communis fad2 clone.
[0145] The high degree of sequence homology indicates that the gene
products are of similar function. For instance, the overall
homology between the Lesquerella hydroxylase and the Arabidopsis
fad2 desaturase was 92.2% similarity and 84.8% identity and the two
sequences differed in length by only one amino acid.
[0146] Southern Hybridization
[0147] Southern analysis was used to examine the copy number of the
genes in the L. fendleri genome corresponding to the clone
pLesq-Hyd. Genomic DNA (5 Ag) was digested with EcORI, HindIII and
XbaI and separated on a 0.9% agarose gel. DNA was alkali-blotted to
a charged nylon membrane (Hybond N+, Amersham), according to the
manufacturer's protocol. The blot was prehybridized for 2 hours at
65.degree. C. in 7% SDS, 1 mM EDTA, 0.25 M Na.sub.2HPO.sub.4 (pH
7.2), 1% BSA and hybridized to the probe for 16 hours in the same
solution with pLesq-Hyd insert PCR-amplified with internal primers
and labelled with .sup.32P by random priming. The filters were
sequentially washed at 65.degree. C. in solutions containing
2.times.SSC, 1.times.SSC, 0.5.times.SSC in addition to 0.1% SDS,
then exposed to X-ray film.
[0148] The probe hybridized with a single band in each digest of L.
fendleri DNA (FIG. 10), indicating that the gene from which
pLesq-Hyd was transcribed is present in a single copy in the L.
fendleri genome.
[0149] Expression of pLesq-Hyd in Transgenic Plants
[0150] There are a wide variety of plant promoter sequences which
may be used to cause tissue-specific expression of cloned genes in
transgenic plants. For instance, the napin promoter and the acyl
carrier protein promoters have previously been used in the
modification of seed oil composition by expression of an antisense
form of a desaturase (Knutson et al., 1992). Similarly, the
promoter for the .beta.-subunit of soybean .beta.-conglycinin has
been shown to be highly active and to result in tissue-specific
expression in transgenic plants of species other than soybean (Bray
et al., 1987). Thus, other promoters which lead to seed-specific
expression may also be employed for the production of modified seed
oil composition. Such modifications of the invention described here
will be obvious to one skilled in the art.
[0151] Constructs for expression of L. fendleri kappa hydroxylase
in plant cells are prepared as follows: A 13 kb SalI fragment
containing the pLesq-Hyg gene was ligated into the XhoI site of
binary Ti plasmid vector pSLJ44026 (Jones et al., 1992) (FIG. 11)
to produce plasmid pTi-Hyd and transformed into Agrobacterium
tumefaciens strains GV3101 by electroporation. Strain GV3101 (Koncz
and Schell, 1986) contains a disarmed Ti plasmid. Cells for
electroporation were prepared as follows. GV3101 was grown in LB
medium with reduced NaCl (5 g/l). A 250 ml culture was grown to
OD.sub.600=0.6, then centrifuged at 4000 rpm (Sorvall GS-A rotor)
for 15 min. The supernatant was aspirated immediately from the
loose pellet, which was gently resuspended in 500 ml ice-cold
water. The cells were centrifuged as before, resuspended in 30 ml
ice-cold water, transferred to a 30 ml tube and centrifuged at 5000
rpm (Sorvall SS-34 rotor) for 5 min. This was repeated three times,
resuspending the cells consecutively in 30 ml ice-cold water, 30 ml
ice-cold 10% glycerol, and finally in 0.75 ml ice-cold 10%
glycerol. These cells were aliquoted, frozen in liquid nitrogen,
and stored at -80.degree. C.
[0152] Electroporations employed a Biorad Gene Pulser instrument
using cold 2 mm-gap cuvettes containing 40 .mu.l cells and 1 .mu.l
of DNA in water, at a voltage of 2.5 KV, and 200 Ohms resistance.
The electroporated cells were diluted with 1 ml SOC medium
(Sambrook et al., 1989, page A2) and incubated at 28.degree. C. for
2-4 h before plating on medium containing kanamycin (50 mg/l).
[0153] Arabidopsis thaliana can be transformed with the
Agrobacterium cells containing pTi-Hyd as described in Example 1
above. Similarly, the presence of hydroxylated fatty acids in the
transgeneic Arabidopsis plants can be demonstrated by the methods
described in Example 1 above.
[0154] Constitutive Expression of the L. fendleri Hydroxylase in
Transgenic Plants
[0155] A 1.5 kb EcORI fragment from pLesq-Hyg comprising the entire
coding region of the hydroxylase was gel purified, then cloned into
the corresponding site of pBluescript KS (Stratagene). Plasmid DNA
from a number of recombinant clones was then restricted with PstI,
which should cut only once in the insert and once in the vector
polylinker sequence. Release of a 920 bp fragment with PstI
indicated the right orientation of the insert for further
manipulations. DNA from one such clone was further restricted with
SalI, the 5' overhangs filled-in with the Klenow fragment of DNA
polymerase I, then cut with SacI. The insert fragment was gel
purified, and cloned between the SmaI and SacI sites of pBI121
(Clontech) behind the cauliflower mosaic virus 35S promoter. After
checking that the sequence of the junction between insert and
vector DNA was appropriate, plasmid DNA from a recombinant clone
was used to transform A. tumefaciens (GV3101). Kanamycin resistant
colonies were then used for in planta transformation of A. thaliana
as previously described.
[0156] DNA was extracted from kanamycin resistant seedlings and
used to PCR-amplify selected fragments from the hydroxylase using
nested primers. When fragments of the expected size could be
amplified, corresponding plants were grown in the greenhouse or on
agar plates, and fatty acids extracted from fully expanded leaves,
roots and dry seeds. GC-MS analysis was then performed as
previously described to characterize the different fatty acid
species and detect accumulation of hydroxy fatty acids in
transgenic tissues.
[0157] Expression of the Lesquerella Hydroxylase in Yeast
[0158] In order to demonstrate that the cloned L. fendleri gene
encoded a kappa hydroxylase, the gene was expressed in yeast cells
under transcriptional control of an inducible promoter and the
yeast cells were examined for the presence of hydroxylated fatty
acids by GC-MS.
[0159] In a first step, a lambda genomic clone containing the L.
fendleri hydroxylase gene was cut with EcORI, and a resulting 1400
bp fragment containing the coding sequence of the hydroxylase gene
was subcloned in the EcORI site of the pBluescript KS vector
(Stratagene). This subclone, pLesqcod, contains the coding region
of the Lesquerella hydroxylase plus some additional 3'
sequence.
[0160] In a second step, pLesqcod was cut with HindIII and XbaI,
and the insert fragment was cloned into the corresponding sites of
the yeast expression vector pYes2 (Invitrogen; FIG. 12). This
subclone, pLesqYes, contains the L. fendleri hydroxylase in the
sense orientation relative to the 3' side of the Gall promoter.
This promoter is inducible by the addition of galactose to the
growth medium, and is repressed upon addition of glucose. In
addition, the vector carries origins of replication allowing the
propagation of pLesqYes in both yeast and E. coli.
[0161] Transformation of S. cerevisiae Host Strain CGY2557
[0162] Yeast strain CGY2557 (MAT.alpha., GAL.sup.+, ura3-52,
leu2-3, trp1, ade2-1, lys2-1, his5, can1-100) was grown overnight
at 28.degree. C. in YPD liquid medium (10 g yeast extract, 20 g
bacto-peptone, 20 g dextrose per liter), and an aliquot of the
culture was inoculated into 100 ml fresh YPD medium and grown until
the OD.sub.600 of the culture was 1. Cells were then collected by
centrifugation and resuspended in about 200 .mu.l of supernatant.
40 .mu.l aliquots of the cell suspension were then mixed with 1-2
.mu.g DNA and electroporated in 2 mm-gap cuvettes using a Biorad
Gene Pulser instrument set at 600 V, 200 .OMEGA., 25 .mu.F, 160
.mu.l YPD was added and the cells were plated on selective medium
containing glucose. Selective medium consisted of 6.7 g yeast
nitrogen base (Difco), 0.4 g casamino acids (Difco), 0.02 g adenine
sulfate, 0.03 g L-leucine, 0.02 g L-tryptophan, 0.03 g
L-lysine-HCl, 0.03 g L-histidine-HCl, 2% glucose, water to 1 liter.
Plates were solidified using 1.5% Difco Bacto-agar. Transformant
colonies appeared after 3 to 4 days incubation at 28.degree. C.
[0163] Expression of the L. fendleri Hydroxylase in Yeast
[0164] Independent transformant colonies from the previous
experiment were used to inoculate 5 ml of selective medium
containing either 2% glucose (gene repressed) or 2% galactose (gene
induced) as the sole carbon source. Independent colonies of CGY2557
transformed with DYES2 containing no insert were used as
controls.
[0165] After 2 days of growth at 28.degree. C., an aliquot of the
cultures was used to inoculate 5 ml of fresh selective medium. The
new culture was placed at 16.degree. C. and grown for 9 days.
[0166] Fatty Acid Analysis of Yeast Expressing the L. fendleri
Hydroxylase
[0167] Cells from 2.5 ml of culture were pelleted at 1800 g, and
the supernatant was aspirated as completely as possible. Pellets
were then dispersed in 1 ml of 1 N methanolic HCl (Supelco,
Bellafonte, Pa.). Transmethylation and derivatization of hydroxy
fatty acids were performed as described above. After drying under
nitrogen, samples were redissolved in 50 .mu.l chloroform before
being analyzed by GC-MS. Samples were injected into an SP2330
fused-silica capillary column (30 m.times.0.25 mm ID, 0.25 .mu.m
film thickness, Supelco). The temperature profile was
100-160.degree. C., 25.degree. C./min, 160-230.degree. C.,
10.degree. C./min, 230.degree. C., 3 min, 230-100.degree. C.,
25.degree. C./min. Flow rate was 0.9 ml/min. Fatty acids were
analyzed using a Hewlett-Packard 5971 series Msdetector.
[0168] Gas chromatograms of derivatized fatty acid methyl esters
from induced cultures of yeast containing pLesqYes contained a
novel peak that eluted at 7.6 min (FIG. 13). O-TMS methyl
ricinoleate eluted at exactly the same position on control
chromatograms. This peak was not present in cultures lacking
pLesqYes or in cultures containing pLesqYes grown on glucose
(repressing conditions) rather than galactose (inducing
conditions). Mass spectrometry of the peak (FIG. 13) revealed that
the peak has the same spectrum as O-TMS methyl ricinoleate. Thus,
on the basis of chromatographic retention time and mass spectrum,
it was concluded that the peak corresponded to O-TMS methyl
ricinoleate. The presence of ricinoleate in the transgenic yeast
cultures confirms the identity of the gene as a kappa hydroxylase
of this invention.
Example 3
Obtaining Other Plant Fatty Acyl Hydroxylases
[0169] The castor fah12 sequence could be used to identify other
kappa hydroxylases by methods such as PCR and heterologous
hybridization. However, because of the high degree of sequence
similarity between .DELTA.12 desaturases and kappa hydroxylases,
the prior art does not teach how to distinguish between the two
kinds of enzymes without a functional test such as demonstrating
activity in transgenic plants or another suitable host (e.g.,
transgenic microbial or animal cells). The identification of the L.
fendleri hydroxylase provided for the development of criteria by
which a hydroxylase and a desaturase may be distinguished solely on
the basis of deduced amino acid sequence information.
[0170] FIGS. 9A-B show a sequence alignment of the castor and L.
fendleri hydroxylase sequences with the castor hydroxylase sequence
and all publicly available sequences for all plant microsomal
.DELTA.12 fatty acid desaturases. Of the 384 amino acid residues in
the castor hydroxylase sequence, more than 95% are identical to the
corresponding residue in at least one of the desaturase sequences.
Therefore, none of these residues are responsible for the catalytic
differences between the hydroxylase and the desaturases. Of the
remaining 16 residues in the castor hydroxylase and 14 residues in
the Lesquerella hydroxylase, all but seven represent instances
where the hydroxylase sequence has a conservative substitution
compared with one or more of the desaturase sequences, or there is
wide variability in the amino acid at that position in the various
desaturases. By conservative, it is meant that the following amino
acids are functionally equivalent: Ser/Thr, Ile/Leu/val/Met,
Asp/Glu. Thus, these structural differences also cannot account for
the catalytic differences between the desaturases and hydroxylases.
This leaves just seven amino acid residues where both the castor
hydroxylase and the Lesquerella hydroxylase differ from all of the
known desaturases and where all of the known microsomal .DELTA.12
desaturases have the identical amino acid residue. These residues
occur at positions 69, 111, 155, 226, 304, 331 and 333 of the
alignment in FIG. 9. Therefore, these seven sites distinguish
hydroxylases from desaturases. Based on this analysis, the present
inventors believe that any enzyme with greater than 60% sequence
identity to one of the enzymes listed in FIG. 9 can be classified
as a hydroxylase if it differs from the sequence of the desaturases
at these seven positions. Because of slight differences in the
number of residues in a particular protein, the numbering may vary
from protein to protein but the intent of the number system will be
evident if the protein in question is aligned with the castor
hydroxylase using the numbering system shown herein. Thus, in
conjunction with the methods for using the Lesquerella hydroxylase
gene to isolate homologous genes, the structural criterion
disclosed here teaches how to isolate and identify plant kappa
hydroxylase genes for the purpose of genetically modifying fatty
acid composition as disclosed herein.
Example 4
Using Hydroxylases To Alter the Level of Fatty Acid
Unsaturation
[0171] Evidence that kappa hydroxylases of this invention can be
used to alter the level of fatty acid unsaturation was obtained
from the analysis of transgenic plants that expressed the castor
hydroxylase under control of the cauliflower mosaic virus promoter.
The construction of the plasmids and the production of transgenic
Arabidopsis plants was described in Example 1 (above). The fatty
acid composition of seed lipids from wild type and six transgenic
lines (1-2/a, 1-2/b, 1-3/b, 4F, 7E, 7F) is shown in Table 2.
[0172] Table 2. Fatty acid composition of lipids from Arabidopsis
seeds. The asterisk (*) indicates that for some of these samples,
the 18:3 and 20:1 peaks overlapped on the gas chromatograph and,
therefore, the total amount of these two fatty acids is
reported.
2TABLE 2 Fatty acid WT 1-2/a 1-2/b 1-3/b 4F 7E 7F 16:0 10.3 8.6 9.5
8.4 8.1 8.4 9 18:0 3.5 3.8 3.9 3.3 3.5 3.8 4.2 18:1 14.7 33 34.5
25.5 27.5 30.5 28.5 18:2 32.4 16.9 21 27.5 21.1 20.1 19.8 18:3 13.8
-- 14.4 14.8 -- -- -- 20:0 1.3 1.6 1 1.1 2.4 1.8 2 20:1 22.5 --
14.1 17.5 -- -- -- 18:3 -- 31.2 -- -- 32.1 30.8 30.6 20:1*
Ricinoleic 0 0.6 0 0.1 0.2 0.7 0.9 Densipolic 0 0.6 0 0.1 0.2 0.5
0.6 Lesquerolic 0 0.2 0 0 0.2 0.2 0.6 Auricolic 0 0.1 0 0 0 0.1
0.1
[0173] The results in Table 2 show that expression of the castor
hydroxylase in transgenic Arabidopsis plants caused a substantial
increase in the amount of oleic acid (18:1) in the seed lipids and
an approximately corresponding decrease in the amount of linoleic
acid (18:2). The average amount of oleic acid in the six transgenic
lines was 29.9% versus 14.7% in the wild type.
[0174] The precise mechanism by which expression of the castor
hydroxylase gene causes increased accumulation of oleic acid is not
known. However, an understanding of the mechanism is not required
in order to exploit this invention for the directed alteration of
plant lipid fatty acid composition. Furthermore, it will be
recognized by one skilled in the art that many improvements of this
invention may be envisioned. Of particular interest will be the use
of other promoters which have high levels of seed-specific
expression.
[0175] Since hydroxylated fatty acids were not detected in the seed
lipids of transgenic line 1-2b, it seems likely that it is not the
presence of hydroxylated fatty acids per se that causes the effect
of the castor hydroxylase gene on desaturase activity.
Protein-protein interaction between the hydroxylase and the
.DELTA.12-oleate desaturase or another protein may be required for
the overall reaction (e.g., cytochrome b5) or for the regulation of
desaturase activity. For example, interaction between the
hydroxylase and this other protein may suppress the activity of the
desaturase. In particular, the quaternary structure of the
membrane-bound desaturases has not been established. It is possible
that these enzymes are active as dimers or as multimeric complexes
containing more than two subunits. Thus, if dimers or multimers
form between the desaturase and the hydroxylase, the presence of
the hydroxylase in the complex may disrupt the activity of the
desaturase.
[0176] Transgenic plants may be produced in which the hydroxylase
enzyme has been rendered inactive by the elimination of one or more
of the histidine residues that have been proposed to bind iron
molecules required for catalysis. Several of these histidine
residues have been shown to be essential for desaturase activity by
site directed mutagenesis (Shanklin et al., 1994). Codons encoding
histidine residues in the castor hydroxylase gene will be changed
to alanine residues as described by Shanklin et al. (1994). The
modified genes will be introduced into transgenic plants of
Arabidopsis, and possibly other species such as tobacco, by the
methods described in Example 1 of this application.
[0177] In order to examine the effect on all tissues, the strong
constitutive cauliflower mosaic virus promoter may be used to cause
transcription of the modified genes. However, it will be recognized
that in order to specifically examine the effect of expression of
the mutant gene on seed lipids, a seed-specific promoter such as
the B. napus napin promoter may be used. An expected outcome is
that expression of the inactive hydroxylase protein in transgenic
plants will inhibit the activity of the endoplasmic
reticulum-localized .DELTA.12-desaturase. Maximum inhibition will
be obtained by expressing high levels of the mutant protein.
[0178] In a further embodiment of this invention, mutations that
inactivate other hydroxylases such as the Lesquerella hydroxylase
of this invention, may also be useful for decreasing the amount of
endoplasmic reticulum-localized .DELTA.12-desaturase activity in
the same way as the castor gene. In a further embodiment of this
invention, similar mutations of desaturase genes may also be used
to inactivate endogenous desaturases. Thus, expression of
catalytically inactive fad2 gene from Arabidopsis in transgenic
Arabidopsis may inhibit the activity of the endogenous fad2 gene
product.
[0179] Similarly, expression of the catalytically inactive forms of
.DELTA.12-desaturase from Arabidopsis or other plants in transgenic
soybean, rapeseed, Crambe, Brassica juncea, canola, flax,
sunflower, safflower, cotton, cuphea, soybean, peanut, coconut, oil
palm or corn may lead to inactivation of endogenous
.DELTA.12-desaturase activity in these plants. In a further
embodiment of this invention, expression of catalytically inactive
forms of other desaturases such as the .DELTA.15-desaturases may
lead to inactivation of the corresponding desaturases.
[0180] An example of a class of mutants useful in the present
invention are "dominant negative" mutants that block the function
of a gene at the protein level (Herskowitz, 1987). A cloned gene is
altered so that it encodes a mutant product capable of inhibiting
the wild type gene product in a cell, thus causing the cell to be
deficient in the function of that gene product. Inhibitory variants
of a wild type product can be designed because proteins have
multiple functional domains that can be mutated independently,
e.g., oligomerization, substrate binding, catalysis, membrane
association domains or the like. In general, dominant negative
proteins retain an intact, functional subset of the domains of the
parent, wild type protein, but have the complement of that subset
either missing or altered so as to be nonfunctional.
[0181] Whatever the precise basis for the inhibitory effect of the
castor hydroxylase on desaturation, because the castor hydroxylase
has very low nucleotide sequence homology (i.e., about 67%) to the
Arabidopsis fad2 gene (encoding the endoplasmic reticulum-localized
.DELTA.12-desaturase), the inhibitory effect of this gene, which is
provisionally called "protein-mediated inhibition" ("protibition"),
may have broad utility because it does not depend on a high degree
of nucleotide sequence homology between the transgene and the
endogenous target gene. In particular, the castor hydroxylase may
be used to inhibit the endoplasmic reticulum-localized
.DELTA.12-desaturase activity of all higher plants. Of particular
relevance are those species used for oil production. These include
but are not limited to rapeseed, Crambe, Brassica juncea, canola,
flax, sunflower, safflower, cotton, cuphea, soybean, peanut,
coconut, oil palm and corn.
[0182] Concluding Remarks
[0183] By the above examples, demonstration of critical factors in
the production of novel hydroxylated fatty acids by expression of a
kappa hydroxylase gene from castor in transgenic plants is
described. In addition, a complete cDNA sequence of the Lesquerella
fendleri kappa hydroxylase is also provided. A full sequence of the
castor hydroxylase is also given with various constructs for use in
host cells. Through this invention, one can obtain the amino acid
and nucleic acid sequences which encode plant fatty acyl
hydroxylases from a variety of sources and for a variety of
applications. Also revealed is a novel method by which the level of
fatty acid desaturation can be altered in a directed way through
the use of genetically altered hydroxylase or desaturase genes.
[0184] All publications mentioned in this specification are
indicative of the level of skill of those skilled in the art to
which this invention pertains. All publications are herein
incorporated by reference to the same extent as if each individual
publication was specifically and individually indicated to be
incorporated by reference.
[0185] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
REFERENCES
[0186] Arondel, V., B. Lemieux, I. Hwang, S. Gibson, H. Goodman, C.
R. Somerville. Map-based cloning of a gene controlling omega-3
fatty acid desaturation in Arabidopsis. Science 258, 1353-1355
(1992).
[0187] Atsmon, D. (1989) Castor, in Oil Crops of the World,
Robbelen, G., Downey, K. R., and Ashri, A., Eds., McGraw-Hill, New
York, pp. 438-447.
[0188] Bechtold, N., Ellis, J. and Pelletier, G. (1993) In Planta
Agrobacterium mediated gene transfer by infiltration of adult
Arabidopsis thaliana plants. C. R. Acad. Sci. Paris 316,
1194-1199.
[0189] Beltz, G. A., Jacobs, K. A., Eickbuch, T. H., Cherbas, P.
T., Kafatos, F. C. (1983) Isolation of multigene families and
determination of homologies by filter hybridization methods.
Methods in Enzymology 100, 266-285.
[0190] Bray, E. A., Naito, S., Pan, N. S., Anderson, E., Dube, P.,
Beachy, R. N. (1987) Expression of the .beta.-subunit of
.beta.-conglycinin in seeds of transgenic plants. Planta 172,
364-370.
[0191] Carlson, K. D., Chaudhry, A., Bagby, M. O (1990) Analysis of
oil and meal from lesquerella fendleri seed. J. Am. Oil Chem. Soc.
67, 438-442.
[0192] Ditta, G., Stanfield, S., Corbin, D., Helinski, D. R. (1980)
Broad host range DNA cloning system for gram-negative bacteria:
Construction of a gene bank of Rhizobium meliloti. Proc. Natl.
Acad. Sci. USA 77, 7347-7351.
[0193] Gibson, S., Arondel, V., Iba, K., Somerville, C. R. (1994)
Temperature Regulated Expression of a Gene Encoding a Chloroplast
omega-3 Desaturase from Arabidopsis thaliana. Plant Physiol. 106,
1615-1621.
[0194] Gould, S. J., Subramani, S., Scheffler, I. E. (1989) Use of
the DNA polymerase chain reaction for homology probing. Proc. Natl.
Acad. Sci. USA 86, 1934-1938.
[0195] Herskowitz, I. (1987) Functional inactivation of genes by
dominant negative mutations. Nature 329, 219-222.
[0196] Hirsinger, F. (1989) New oil crops, in Oil Crops of the
World, Robbelen, G., Downey, K. R., and Ashri, A., Eds.,
McGraw-Hill, New York, pp. 518-533.
[0197] Howling, D., Morris, L. J., Gurr, M. I., James, A. T. (1972)
The specificity of fatty acid desaturases and hydroxylases. The
dehydrogenation and hydroxylation of monoenoic acids, Biochim.
Biophys. Acta 260, 10.
[0198] Huyuh, T. V., Young, R. A., Davis, R. W. (1985) Constructing
and screening cDNA libraries in .lambda.gt10 and .lambda.gt11. In
DNA Cloning, Vol. 1: A Practical Approach, (ed) D. M. Glover. IRL
Press, Washington D.C. pp 49-77.
[0199] Iba, K., Gibson, S., Nishiuchi, T., Fuse, T., Nishimura, M.,
Arondel, V., Hugly, S., and Somerville, C. (1993) A gene encoding a
chloroplast omega-3 fatty acid desaturase complements alterations
in fatty acid desaturation and chloroplast copy number of the fad7
mutant of Arabidopsis thaliana. J. Biol. Chem. 268,
24099-24105.
[0200] Jones, J. D. G., Shlumukov, L., Carland, F., English, J.,
Scofield, S., Bishop, G. J., Harrison, K. (1992) Effective vectors
for transformation, expression of heterologous genes, and assaying
transposon excision in transgenic plants. Transgenic Res. 1,
285-297.
[0201] Knutson, D. S., Thompson, G. A., Radke, S. E., Johnson, W.
B., Knauf, V. C., Kridl, J. C. (1992) Proc. Natl. Acad. Sci. USA
89, 2624-2628.
[0202] Koncz, C., Schell, J. (1986) The promoter of TL-DNA gene 5
controls the tissue-specific expression of chimeric genes carried
by a novel type of Agrobacterium binary vector. Mol. Gen. Genet.
204, 383-396.
[0203] Matzke, M., Matzke, A. J. M. (1995) How and why do plants
inactivate homologous (Trans)genes? Plant Physiol. 107,
679-685.
[0204] Miquel, M. Browse, J. (1992) Arabidopsis mutants deficient
in polyunsaturated fatty acid synthesis. J. Biol. Chem. 267,
1502-1509.
[0205] Murray, M. G., Thompson, W. F. (1980) Rapid isolation of
high molecular weight plant DNA. Nucl. Acid Res. 8, 4321-4325.
[0206] Okuley, J., Lightner, J., Feldman, K., Yadav, N., Lark, E.,
Browse, J. (1994) Arabidopsis FAD2 gene encodes the enzyme that is
essential for polyunsaturated lipid. Plant Cell 6, 147-158.
[0207] Sambrook, J., Fritsch, E. F., and Maniatis, T., Molecular
Cloning: a Laboratory Manual, 2nd ed., Cold Spring Harbor
Laboratory Press, 1989.
[0208] Shanklin, J., Whittle, E., Fox, B. G. (1994) Eight histidine
residues are catalytically essential in a membrane-associated iron
enzyme, stearoyl-CoA desaturase, and are conserved in alkane
hydroxylase and xylene monoxygenase. Biochemistry 33,
12787-12794.
[0209] Smith, C. R., Jr. (1985) Unusual seed oils and their fatty
acids, in Fatty Acids, Pryde E. H., Ed., American Oil Chemists'
Society, Champaign, Second edition, pp 29-47.
[0210] Topfer, R., Martini, N., Schell, J. (1995) Modification of
plant lipid synthesis. Science 268, 681-686.
[0211] van de Loo, F. J., Fox, B. G., Somerville, C. (1993) Unusual
fatty acids, in Lipid Metabolism in Plants, T. S. Moore Jr., Ed.,
CRC Press, Boca Raton, pp 91-126.
[0212] van de Loo, F. N., Turner, S., Somerville, C. R. (1995) An
oleate 12-hydroxylase from castor (Ricinus communis L.) is a fatty
acyl desaturase homolog. Proc. Natl. Acad. Sci. USA 92,
6743-6747.
[0213] von Heijne, G. (1985) Signal sequences. J. Mol. Biol. 184,
99-105.
Sequence CWU 1
1
15 1 543 DNA Artificial sequence Nucleotide sequence of pLesq2 1
tattggcacc ggcggcacca ttccaacaat ggatccctag aaaaagatga agtctttgtc
60 ccacctaaga aagctgcagt canatggtat gtcaaatacc tcaacaaccc
tcttggacgc 120 attctggtgt taacagttca gtttatcctc gggtggcctt
tgtatctagc ctttaatgta 180 tcaggtagac cttatgatgg tttcgcttca
catttcttcc ctcatgcacc tatctttaag 240 gaccgtgaac gtctccagat
atacatctca gatgctggta ttctagctgt ctgttatggt 300 ctttaccgtt
acgctgcttc acaaggattg actgctatga tctgcgtcta cggagtaccg 360
cttttgatag tgaacttttt ccttgtcttg gtcactttct tgcagcacac tcatccttca
420 ttacctcact atgattcaac cgagtgggaa tggattagag gagctttggt
tacggtagac 480 agagactatg gaatcttgaa caaggtgttt cacaacataa
cagacaccca cgtagcacac 540 cac 543 2 544 DNA Artificial sequence
Nucleotide sequence of pLesq3 2 tataggcacc ggaggcacca ttccaacaca
ggatccctcg aaagagatga agtatttgtc 60 ccaaagcaga aatccgcaat
caagtggtac ggcgaatacc tcaacaaccc tcctggtcgc 120 atcatgatgt
taactgtcca gttcgtcctc ggatggccct tgtacttagc cttcaacgtt 180
tctggcagac cctacaatgg tttcgcttcc catttcttcc ccaatgctcc tatctacaac
240 gaccgtgaac gcctccagat ttacatctct gatgctggta ttctagccgt
ctgttatggt 300 ctttaccgtt acgctgttgc acaaggacta gcctcaatga
tctgtctaaa cggagttccg 360 cttctgatag ttaacttttt cctcgtcttg
atcacttact tacaacacac tcaccctgcg 420 ttgcctcact atgattcatc
agagtgggat tggcttagag gagctttagc tactgtagac 480 agagactatg
gaatcttgaa caaggtgttc cataacatca cagacaccca cgtcgcacac 540 cact 544
3 1855 DNA Artificial sequence Nucleotide sequence of genomic clone
encoding pLesq-HYD 3 atgaagcttt ataagaagtt agttttctct ggtgacagag
aaattntgtc aattggtagt 60 gacagttgaa gcaacaggaa caacaaggat
ggttggtgnt gatgctgatg tggtgatgtg 120 ttattcatca aatactaaat
actacattac ttgttgctgc ctacttctcc tatttcctcc 180 gccacccatt
ttggacccac ganccttcca tttaaaccct ctctcgtgct attcaccaga 240
agagaagcca agagagagag agagagaatg ttctgaggat cattgtcttc ttcatcgtta
300 ttaacgtaag ttttttttga ccactcatat ctaaaatcta gtacatgcaa
tagattaatg 360 actgttcctt cttttgatat tttcagcttc ttgaattcaa
gatgggtgct ggtggaagaa 420 taatggttac cccctcttcc aagaaatcag
aaactgaagc cctaaaacgt ggaccatgtg 480 agaaaccacc attcactgtt
aaagatctga agaaagcaat cccacagcat tgtttcaagc 540 gctctatccc
tcgttctttc tcctaccttc tcacagatat cactttagtt tcttgcttct 600
actacgttgc cacaaattac ttctctcttc ttcctcagcc tctctctact tacctagctt
660 ggcctctcta ttgggtatgt caaggctgtg tcttaaccgg tatctgggtc
attggccatg 720 aatgtggtca ccatgcattc agtgactatc aatgggtaga
tgacactgtt ggttttatct 780 tccattcctt ccttctcgtc ccttacttct
cctggaaata cagtcatcgt cgtcaccatt 840 ccaacaatgg atctctcgag
aaagatgaag tctttgtccc accgaagaaa gctgcagtca 900 aatggtatgt
taaatacctc aacaaccctc ttggacgcat tctggtgtta acagttcagt 960
ttatcctcgg gtggcctttg tatctagcct ttaatgtatc aggtagacct tatgatggtt
1020 tcgcttcaca tttcttccct catgcaccta tctttaaaga ccgagaacgc
ctccagatat 1080 acatctcaga tgctggtatt ctagctgtct gttatggtct
ttaccgttac gctgcttcac 1140 aaggattgac tgctatgatc tgcgtctatg
gagtaccgct tttgatagtg aactttttcc 1200 ttgtcttggt aactttcttg
cagcacactc atccttcgtt acctcattat gattcaaccg 1260 agtgggaatg
gattagagga gctttggtta cggtagacag agactatgga atattgaaca 1320
aggtgttcca taacataaca gacacacatg tggctcatca tctctttgca actataccgc
1380 attataacgc aatggaagct acagaggcga taaagccaat acttggtgat
tactaccact 1440 tcgatggaac accgtggtat gtggccatgt atagggaagc
aaaggagtgt ctctatgtag 1500 aaccggatac ggaacgtggg aagaaaggtg
tctactatta caacaataag ttatgaggct 1560 gatagggcga gagaagtgca
attatcaatc ttcatttcca tgttttaggt gtcttgttta 1620 agaagctatg
ctttgtttca atastctcag agtccatnta gttgtgttct ggtgcatttt 1680
gcctagttat gtggtgtcgg aagttagtgt tcaaactgct tcctgctgtg ctgcccagtg
1740 aagaacaagt ttacgtgttt aaaatactcg gaacgaattg accacaanat
atccaaaacc 1800 ggctatccga attccatatc cgaaaaccgg atatccaaat
ttccagagta cttag 1855 4 384 PRT Lesquerella fendleri 4 Met Gly Ala
Gly Gly Arg Ile Met Val Thr Pro Ser Ser Lys Lys Ser 1 5 10 15 Glu
Thr Glu Ala Leu Lys Arg Gly Pro Cys Glu Lys Pro Pro Phe Thr 20 25
30 Val Lys Asp Leu Lys Lys Ala Ile Pro Gln His Cys Phe Lys Arg Ser
35 40 45 Ile Pro Arg Ser Phe Ser Tyr Leu Leu Thr Asp Ile Thr Leu
Val Ser 50 55 60 Cys Phe Tyr Tyr Val Ala Thr Asn Tyr Phe Ser Leu
Leu Pro Gln Pro 65 70 75 80 Leu Ser Thr Tyr Leu Ala Trp Pro Leu Tyr
Trp Val Cys Gln Gly Cys 85 90 95 Val Leu Thr Gly Ile Trp Val Ile
Gly His Glu Cys Gly His His Ala 100 105 110 Phe Ser Asp Tyr Gln Trp
Val Asp Asp Thr Val Gly Phe Ile Phe His 115 120 125 Ser Phe Leu Leu
Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg 130 135 140 His His
Ser Asn Asn Gly Ser Leu Glu Lys Asp Glu Val Phe Val Pro 145 150 155
160 Pro Lys Lys Ala Ala Val Lys Trp Tyr Val Lys Tyr Leu Asn Asn Pro
165 170 175 Leu Gly Arg Ile Leu Val Leu Thr Val Gln Phe Ile Leu Gly
Trp Pro 180 185 190 Leu Tyr Leu Ala Phe Asn Val Ser Gly Arg Pro Tyr
Asp Gly Phe Ala 195 200 205 Ser His Phe Phe Pro His Ala Pro Ile Phe
Lys Asp Arg Glu Arg Leu 210 215 220 Gln Ile Tyr Ile Ser Asp Ala Gly
Ile Leu Ala Val Cys Tyr Gly Leu 225 230 235 240 Tyr Arg Tyr Ala Ala
Ser Gln Gly Leu Thr Ala Met Ile Cys Val Tyr 245 250 255 Gly Val Pro
Leu Leu Ile Val Asn Phe Phe Leu Val Leu Val Thr Phe 260 265 270 Leu
Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Thr Glu Trp 275 280
285 Glu Trp Ile Arg Gly Ala Leu Val Thr Val Asp Arg Asp Tyr Gly Ile
290 295 300 Leu Asn Lys Val Phe His Asn Ile Thr Asp Thr His Val Ala
His His 305 310 315 320 Leu Phe Ala Thr Ile Pro His Tyr Asn Ala Met
Glu Ala Thr Glu Ala 325 330 335 Ile Lys Pro Ile Leu Gly Asp Tyr Tyr
His Phe Asp Gly Thr Pro Trp 340 345 350 Tyr Val Ala Met Tyr Arg Glu
Ala Lys Glu Cys Leu Tyr Val Glu Pro 355 360 365 Asp Thr Glu Arg Gly
Lys Lys Gly Val Tyr Tyr Tyr Asn Asn Lys Leu 370 375 380 5 387 PRT
Ricinus communis 5 Met Gly Gly Gly Gly Arg Met Ser Thr Val Ile Thr
Ser Asn Asn Ser 1 5 10 15 Glu Lys Lys Gly Gly Ser Ser His Leu Lys
Arg Ala Pro His Thr Lys 20 25 30 Pro Pro Phe Thr Leu Gly Asp Leu
Lys Arg Ala Ile Pro Pro His Cys 35 40 45 Phe Glu Arg Ser Phe Val
Arg Ser Phe Ser Tyr Val Ala Tyr Asp Val 50 55 60 Cys Leu Ser Phe
Leu Phe Tyr Ser Ile Ala Thr Asn Phe Phe Pro Tyr 65 70 75 80 Ile Ser
Ser Pro Leu Ser Tyr Val Ala Trp Leu Val Tyr Trp Leu Phe 85 90 95
Gln Gly Cys Ile Leu Thr Gly Leu Trp Val Ile Gly His Glu Cys Gly 100
105 110 His His Ala Phe Ser Glu Tyr Gln Leu Ala Asp Asp Ile Val Gly
Leu 115 120 125 Ile Val His Ser Ala Leu Leu Val Pro Tyr Phe Ser Trp
Lys Tyr Ser 130 135 140 His Arg Arg His His Ser Asn Ile Gly Ser Leu
Glu Arg Asp Glu Val 145 150 155 160 Phe Val Pro Lys Ser Lys Ser Lys
Ile Ser Trp Tyr Ser Lys Tyr Ser 165 170 175 Asn Asn Pro Pro Gly Arg
Val Leu Thr Leu Ala Ala Thr Leu Leu Leu 180 185 190 Gly Trp Pro Leu
Tyr Leu Ala Phe Asn Val Ser Gly Arg Pro Tyr Asp 195 200 205 Arg Phe
Ala Cys His Tyr Asp Pro Tyr Gly Pro Ile Phe Ser Glu Arg 210 215 220
Glu Arg Leu Gln Ile Tyr Ile Ala Asp Leu Gly Ile Phe Ala Thr Thr 225
230 235 240 Phe Val Leu Tyr Gln Ala Thr Met Ala Lys Gly Leu Ala Trp
Val Met 245 250 255 Arg Ile Tyr Gly Val Pro Leu Leu Ile Val Asn Cys
Phe Leu Val Met 260 265 270 Ile Thr Tyr Leu Gln His Thr His Pro Ala
Ile Pro Arg Tyr Gly Ser 275 280 285 Ser Glu Trp Asp Trp Leu Arg Gly
Ala Met Val Thr Val Asp Arg Asp 290 295 300 Tyr Gly Val Leu Asn Lys
Val Phe His Asn Ile Ala Asp Thr His Val 305 310 315 320 Ala His His
Leu Phe Ala Thr Val Pro His Tyr His Ala Met Glu Ala 325 330 335 Thr
Lys Ala Ile Lys Pro Ile Met Gly Glu Tyr Tyr Arg Tyr Asp Gly 340 345
350 Thr Pro Phe Tyr Lys Ala Leu Trp Arg Glu Ala Lys Glu Cys Leu Phe
355 360 365 Val Glu Pro Asp Glu Gly Ala Pro Thr Gln Gly Val Phe Trp
Tyr Arg 370 375 380 Asn Lys Tyr 385 6 383 PRT Arabidopsis thaliana
6 Met Gly Ala Gly Gly Arg Met Pro Val Pro Thr Ser Ser Lys Lys Ser 1
5 10 15 Glu Thr Asp Thr Thr Lys Arg Val Pro Cys Glu Lys Pro Pro Phe
Ser 20 25 30 Val Gly Asp Leu Lys Lys Ala Ile Pro Pro His Cys Phe
Lys Arg Ser 35 40 45 Ile Pro Arg Ser Phe Ser Tyr Leu Ile Ser Asp
Ile Ile Ile Ala Ser 50 55 60 Cys Phe Tyr Tyr Val Ala Thr Asn Tyr
Phe Ser Leu Leu Pro Gln Pro 65 70 75 80 Leu Ser Tyr Leu Ala Trp Pro
Leu Tyr Trp Ala Cys Gln Gly Cys Val 85 90 95 Leu Thr Gly Ile Trp
Val Ile Ala His Glu Cys Gly His His Ala Phe 100 105 110 Ser Asp Tyr
Gln Trp Leu Asp Asp Thr Val Gly Leu Ile Phe His Ser 115 120 125 Phe
Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser His Arg Arg His 130 135
140 His Ser Asn Thr Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro Lys
145 150 155 160 Gln Lys Ser Ala Ile Lys Trp Tyr Gly Lys Tyr Leu Asn
Asn Pro Leu 165 170 175 Gly Arg Ile Met Met Leu Thr Val Gln Phe Val
Leu Gly Trp Pro Leu 180 185 190 Tyr Leu Ala Phe Asn Val Ser Gly Arg
Pro Tyr Asp Gly Phe Ala Cys 195 200 205 His Phe Phe Pro Asn Ala Pro
Ile Tyr Asn Asp Arg Glu Arg Leu Gln 210 215 220 Ile Tyr Leu Ser Asp
Ala Gly Ile Leu Ala Val Cys Phe Gly Leu Tyr 225 230 235 240 Arg Tyr
Ala Ala Ala Gln Gly Met Ala Ser Met Ile Cys Leu Tyr Gly 245 250 255
Val Pro Leu Leu Ile Val Asn Ala Phe Leu Val Leu Ile Thr Tyr Leu 260
265 270 Gln His Thr His Pro Ser Leu Pro His Tyr Asp Ser Ser Glu Trp
Asp 275 280 285 Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr
Gly Ile Leu 290 295 300 Asn Lys Val Phe His Asn Ile Thr Asp Thr His
Val Ala His His Leu 305 310 315 320 Phe Ser Thr Met Pro His Tyr Asn
Ala Met Glu Ala Thr Lys Ala Ile 325 330 335 Lys Pro Ile Leu Gly Asp
Tyr Tyr Gln Phe Asp Gly Thr Pro Trp Tyr 340 345 350 Val Ala Met Tyr
Arg Glu Ala Lys Glu Cys Ile Tyr Val Glu Pro Asp 355 360 365 Arg Glu
Gly Asp Lys Lys Gly Val Tyr Trp Tyr Asn Asn Lys Leu 370 375 380 7
384 PRT Brassica napus misc_feature (384)..(384) Xaa can be any
naturally occurring amino acid 7 Met Gly Ala Gly Gly Arg Met Gln
Val Ser Pro Pro Ser Lys Lys Ser 1 5 10 15 Glu Thr Asp Asn Ile Lys
Arg Val Pro Cys Glu Thr Pro Pro Phe Thr 20 25 30 Val Gly Glu Leu
Lys Lys Ala Ile Pro Pro His Cys Phe Lys Arg Ser 35 40 45 Ile Pro
Arg Ser Phe Ser His Leu Ile Trp Asp Ile Ile Ile Ala Ser 50 55 60
Cys Phe Tyr Tyr Val Ala Thr Thr Tyr Phe Pro Leu Leu Pro Asn Pro 65
70 75 80 Leu Ser Tyr Phe Ala Trp Pro Leu Tyr Trp Ala Cys Gln Gly
Cys Val 85 90 95 Leu Thr Gly Val Trp Val Ile Ala His Glu Cys Gly
His Ala Ala Phe 100 105 110 Ser Asp Tyr Gln Trp Leu Asp Asp Thr Val
Gly Leu Ile Phe His Ser 115 120 125 Phe Leu Leu Val Pro Tyr Phe Ser
Trp Lys Tyr Ser His Arg Arg His 130 135 140 His Ser Asn Thr Gly Ser
Leu Glu Arg Asp Glu Val Phe Val Pro Arg 145 150 155 160 Arg Ser Gln
Thr Ser Ser Gly Thr Ala Ser Thr Ser Thr Thr Phe Gly 165 170 175 Arg
Thr Val Met Leu Thr Val Gln Phe Thr Leu Gly Trp Pro Leu Tyr 180 185
190 Leu Ala Phe Asn Val Ser Gly Arg Pro Tyr Asp Gly Gly Phe Ala Cys
195 200 205 His Phe His Pro Asn Ala Pro Ile Tyr Asn Asp Arg Glu Arg
Leu Gln 210 215 220 Ile Tyr Ile Ser Asp Ala Gly Ile Leu Ala Val Cys
Tyr Gly Leu Leu 225 230 235 240 Pro Tyr Ala Ala Val Gln Gly Val Ala
Ser Met Val Cys Phe Leu Arg 245 250 255 Val Pro Leu Leu Ile Val Asn
Gly Phe Leu Val Leu Ile Thr Tyr Leu 260 265 270 Gln His Thr His Pro
Ser Leu Pro His Tyr Asp Ser Ser Glu Trp Asp 275 280 285 Trp Leu Arg
Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly Ile Leu 290 295 300 Asn
Gln Gly Phe His Asn Ile Thr Asp Thr His Glu Ala His His Leu 305 310
315 320 Phe Ser Thr Met Pro His Tyr His Ala Met Glu Ala Thr Lys Ala
Ile 325 330 335 Lys Pro Ile Leu Gly Glu Tyr Tyr Gln Phe Asp Gly Thr
Pro Val Val 340 345 350 Lys Ala Met Trp Arg Glu Ala Lys Glu Cys Ile
Tyr Val Glu Pro Asp 355 360 365 Arg Gln Gly Glu Lys Lys Gly Val Phe
Trp Tyr Asn Asn Lys Leu Xaa 370 375 380 8 309 PRT Glycine max 8 Ser
Leu Leu Thr Ser Phe Ser Tyr Val Val Tyr Asp Leu Ser Phe Ala 1 5 10
15 Phe Ile Phe Tyr Ile Ala Thr Thr Tyr Phe His Leu Leu Pro Gln Pro
20 25 30 Phe Ser Leu Ile Ala Trp Pro Ile Tyr Trp Val Leu Gln Gly
Cys Leu 35 40 45 Leu Thr Arg Val Cys Gly His His Ala Phe Ser Lys
Tyr Gln Trp Val 50 55 60 Asp Asp Val Val Gly Leu Thr Leu His Ser
Thr Leu Leu Val Pro Tyr 65 70 75 80 Phe Ser Trp Lys Ile Ser His Arg
Arg His His Ser Asn Thr Gly Ser 85 90 95 Leu Asp Arg Asp Glu Arg
Val Lys Val Ala Trp Phe Ser Lys Tyr Leu 100 105 110 Asn Asn Pro Leu
Gly Arg Ala Val Ser Leu Leu Val Thr Leu Thr Ile 115 120 125 Gly Trp
Pro Met Tyr Leu Ala Phe Asn Val Ser Gly Arg Pro Tyr Asp 130 135 140
Ser Phe Ala Ser His Tyr His Pro Tyr Arg Val Arg Leu Leu Ile Tyr 145
150 155 160 Val Ser Asp Val Ala Leu Phe Ser Val Thr Tyr Ser Leu Tyr
Arg Val 165 170 175 Ala Thr Leu Lys Gly Leu Val Trp Leu Leu Cys Val
Tyr Gly Val Pro 180 185 190 Leu Leu Ile Val Asn Gly Phe Leu Val Thr
Ile Thr Tyr Leu Arg Val 195 200 205 His Tyr Asp Ser Ser Glu Trp Asp
Trp Leu Lys Gly Ala Leu Ala Thr 210 215 220 Met Asp Arg Asp Tyr Gly
Ile Leu Asn Lys Val Phe His His Ile Thr 225 230 235 240 Asp Thr His
Val Ala His His Leu Phe Ser Thr Met Pro His Tyr His 245 250 255 Leu
Arg Val Lys Pro Ile Leu Gly Glu Tyr Tyr Gln Phe Asp Asp Thr 260 265
270 Pro Phe Tyr Lys Ala Leu Trp Arg Glu Ala Arg Glu Cys Leu Tyr Val
275 280 285 Glu Pro Asp Glu Gly Thr Ser Glu Lys Gly Val Tyr Trp Tyr
Arg Asn 290 295 300 Lys Tyr Leu Arg Val 305 9 302 PRT Glycine max 9
Phe Ser Tyr Val Val Tyr Asp Leu Thr Ile Ala Phe Cys Leu Tyr Tyr 1 5
10 15 Val Ala Thr His Tyr Phe His Leu Leu Pro Gly Pro Leu Ser Phe
Arg 20 25 30 Gly Met Ala Ile Tyr Trp Ala Val Gln Gly Cys Ile Leu
Thr Gly Val 35 40 45 Trp
Val Val Ala Phe Ser Asp Tyr Gln Leu Leu Asp Asp Ile Val Gly 50 55
60 Leu Ile Leu His Ser Ala Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr
65 70 75 80 Ser His Arg Arg His His Ser Asn Thr Gly Ser Leu Glu Arg
Asp Glu 85 90 95 Val Phe Val Pro Lys Val Ser Lys Tyr Leu Asn Asn
Pro Pro Gly Arg 100 105 110 Val Leu Thr Leu Ala Val Thr Leu Thr Leu
Gly Trp Pro Leu Tyr Leu 115 120 125 Ala Leu Asn Val Ser Gly Arg Pro
Tyr Asp Arg Phe Ala Cys His Tyr 130 135 140 Asp Pro Tyr Gly Pro Ile
Tyr Ser Val Ile Ser Asp Ala Gly Val Leu 145 150 155 160 Ala Val Val
Tyr Gly Leu Phe Arg Leu Ala Met Ala Lys Gly Leu Ala 165 170 175 Trp
Val Val Cys Val Tyr Gly Val Pro Leu Leu Val Val Asn Gly Phe 180 185
190 Leu Val Leu Ile Thr Phe Leu Gln His Thr His Val Ser Glu Trp Asp
195 200 205 Trp Leu Arg Gly Ala Leu Ala Thr Val Asp Arg Asp Tyr Gly
Ile Leu 210 215 220 Asn Lys Val Phe His Asn Ile Thr Asp Thr His Val
Ala His His Leu 225 230 235 240 Phe Ser Thr Met Pro His Tyr His Ala
Met Glu Ala Thr Val Glu Tyr 245 250 255 Tyr Arg Phe Asp Glu Thr Pro
Phe Val Lys Ala Met Trp Arg Glu Ala 260 265 270 Arg Glu Cys Ile Tyr
Val Glu Pro Asp Gln Ser Thr Glu Ser Lys Gly 275 280 285 Val Phe Trp
Tyr Asn Asn Lys Leu Ala Met Glu Ala Thr Val 290 295 300 10 372 PRT
Zea mays misc_feature (372)..(372) Xaa can be any naturally
occurring amino acid 10 Met Gly Ala Gly Gly Arg Met Thr Glu Lys Glu
Arg Glu Lys Gln Glu 1 5 10 15 Gln Leu Ala Arg Ala Thr Gly Gly Ala
Ala Met Gln Arg Ser Pro Val 20 25 30 Glu Lys Pro Pro Phe Thr Leu
Gly Gln Ile Lys Lys Ala Ile Pro Pro 35 40 45 His Cys Phe Glu Arg
Ser Val Leu Lys Ser Phe Ser Tyr Val Val His 50 55 60 Asp Leu Val
Ile Ala Ala Ala Leu Leu Tyr Phe Ala Leu Ala Ile Ile 65 70 75 80 Pro
Ala Leu Pro Ser Pro Leu Arg Tyr Ala Ala Trp Pro Leu Tyr Trp 85 90
95 Ile Ala Gln Gly Ala Phe Ser Asp Tyr Ser Leu Leu Asp Asp Val Val
100 105 110 Gly Leu Val Leu His Ser Ser Leu Met Val Pro Tyr Phe Ser
Trp Lys 115 120 125 Tyr Ser His Arg Arg His His Ser Asn Thr Gly Ser
Leu Glu Arg Asp 130 135 140 Glu Val Phe Val Pro Lys Lys Lys Glu Ala
Leu Pro Trp Tyr Thr Pro 145 150 155 160 Tyr Val Tyr Asn Asn Pro Val
Gly Arg Val Val His Ile Val Val Gln 165 170 175 Leu Thr Leu Gly Trp
Pro Leu Tyr Leu Ala Thr Asn Ala Ser Gly Arg 180 185 190 Pro Tyr Pro
Arg Phe Ala Cys His Phe Asp Pro Tyr Gly Pro Ile Tyr 195 200 205 Asn
Asp Arg Glu Arg Ala Gln Ile Phe Val Ser Asp Ala Gly Val Val 210 215
220 Ala Val Ala Phe Gly Leu Tyr Lys Leu Ala Ala Ala Phe Gly Val Trp
225 230 235 240 Trp Val Val Arg Val Tyr Ala Val Pro Leu Leu Ile Val
Asn Ala Trp 245 250 255 Leu Val Leu Ile Thr Tyr Leu Gln His Thr His
Pro Ser Leu Pro His 260 265 270 Tyr Asp Ser Ser Glu Trp Asp Trp Leu
Arg Gly Ala Leu Ala Thr Met 275 280 285 Asp Arg Asp Tyr Gly Ile Leu
Asn Arg Val Phe His Asn Ile Thr Asp 290 295 300 Thr His Val Ala His
His Leu Phe Ser Thr Met Pro His Tyr His Ala 305 310 315 320 Met Glu
Ala Thr Lys Ala Ile Arg Pro Ile Leu Gly Asp Tyr Tyr His 325 330 335
Phe Asp Pro Thr Pro Val Ala Lys Ala Thr Trp Arg Glu Ala Gly Glu 340
345 350 Cys Ile Tyr Val Glu Pro Glu Asp Arg Lys Gly Val Phe Trp Tyr
Asn 355 360 365 Lys Lys Phe Xaa 370 11 224 PRT Ricinus communis 11
Trp Val Met Ala His Asp Cys Gly His His Ala Phe Ser Asp Tyr Gln 1 5
10 15 Leu Leu Asp Asp Val Val Gly Leu Ile Leu His Ser Cys Leu Leu
Val 20 25 30 Pro Tyr Phe Ser Trp Lys His Ser His Arg Arg His His
Ser Asn Thr 35 40 45 Gly Ser Leu Glu Arg Asp Glu Val Phe Val Pro
Lys Lys Lys Ser Ser 50 55 60 Ile Arg Trp Tyr Ser Lys Tyr Leu Asn
Asn Pro Pro Gly Arg Ile Met 65 70 75 80 Thr Ile Ala Val Thr Leu Ser
Leu Gly Trp Pro Leu Tyr Leu Ala Phe 85 90 95 Asn Val Ser Gly Arg
Pro Tyr Asp Arg Phe Ala Cys His Tyr Asp Pro 100 105 110 Tyr Gly Pro
Ile Tyr Asn Asp Arg Glu Arg Ile Glu Ile Phe Ile Ser 115 120 125 Asp
Ala Gly Val Leu Ala Val Thr Phe Gly Leu Tyr Gln Leu Ala Ile 130 135
140 Ala Lys Gly Leu Ala Trp Val Val Cys Val Tyr Gly Val Pro Leu Leu
145 150 155 160 Val Val Asn Ser Phe Leu Val Leu Ile Thr Phe Leu Gln
His Thr His 165 170 175 Pro Ala Leu Pro His Tyr Asp Ser Ser Glu Trp
Asp Trp Leu Arg Gly 180 185 190 Ala Leu Ala Thr Val Asp Arg Asp Tyr
Gly Ile Leu Asn Lys Val Phe 195 200 205 His Asn Ile Thr Asp Thr Gln
Val Ala His His Leu Phe Thr Met Pro 210 215 220 12 20 DNA
Artificial sequence Primer 12 gctcttttgt gcgctcattc 20 13 20 DNA
Artificial sequence Primer 13 cggtaccaga aaacgccttg 20 14 20 DNA
Artificial sequence Primer 14 taywsncaym gnmgncayca 20 15 21 DNA
Artificial sequence Primer 15 rtgrtgngcn acrtgngtrt c 21
* * * * *