U.S. patent application number 10/872706 was filed with the patent office on 2004-11-25 for manipulation of negative stranded rna viruses by rearrangement of their genes and uses thereof.
This patent application is currently assigned to Research Development Foundation. Invention is credited to Ball, Andrew L., Wertz, Gail W..
Application Number | 20040235135 10/872706 |
Document ID | / |
Family ID | 24410755 |
Filed Date | 2004-11-25 |
United States Patent
Application |
20040235135 |
Kind Code |
A1 |
Wertz, Gail W. ; et
al. |
November 25, 2004 |
Manipulation of negative stranded RNA viruses by rearrangement of
their genes and uses thereof
Abstract
The present invention provides a method of increasing expression
of a promoter distal gene in a virus of the order Mononegavirales,
and a recombinant virus constructed by such method. Also provided
is a method of attenuating a virus of the order Mononegavirales,
and of constructing an attenuated virus useful for a vaccine.
Inventors: |
Wertz, Gail W.; (Birmingham,
AL) ; Ball, Andrew L.; (Birmingham, AL) |
Correspondence
Address: |
Dr. Benjamin Adler
Adler & Associates
8011 Candle Lane
Houston
TX
77071
US
|
Assignee: |
Research Development
Foundation
|
Family ID: |
24410755 |
Appl. No.: |
10/872706 |
Filed: |
June 21, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10872706 |
Jun 21, 2004 |
|
|
|
10198371 |
Jul 18, 2002 |
|
|
|
6777220 |
|
|
|
|
10198371 |
Jul 18, 2002 |
|
|
|
09602288 |
Jun 23, 2000 |
|
|
|
6596529 |
|
|
|
|
09602288 |
Jun 23, 2000 |
|
|
|
09071606 |
May 1, 1998 |
|
|
|
6136585 |
|
|
|
|
60045471 |
May 2, 1997 |
|
|
|
Current U.S.
Class: |
435/235.1 ;
435/456 |
Current CPC
Class: |
A61K 2039/5254 20130101;
A61K 39/12 20130101; A61P 37/02 20180101; A61K 39/00 20130101; C12N
2760/20243 20130101; C12N 15/86 20130101; C07K 14/005 20130101;
C12N 2760/20222 20130101; C12N 7/00 20130101; A61K 2039/543
20130101; C12N 2760/20261 20130101; A61K 39/155 20130101; C12N
2760/20234 20130101; C12N 2760/20161 20130101; A61K 39/205
20130101 |
Class at
Publication: |
435/235.1 ;
435/456 |
International
Class: |
C12N 007/00; C12N
015/86 |
Claims
What is claimed is:
1. A method of constructing an attenuated virus useful for a
vaccine, comprising the steps of: rearranging gene order of said
virus by moving a gene away from its wild-type 3' promoter proximal
position site, wherein said gene is an essential limiting factor
for genome replication; and placing a gene coding for an immune
response-inducing antigen in the position closest to the 3' end of
the gene order of said virus, therefore, an attenuated virus is
constructed for vaccine use.
2. The method of claim 1, wherein the essential limiting factor
gene is the nucleocapsid (N) gene.
3. The method of claim 1, wherein the essential limiting factor
gene is placed in the next to last position in the gene order of
said virus.
4. The method of claim 1, wherein the gene coding for an immune
response-inducing antigen is selected from the group consisting of
the attachment glycoprotein (G) gene, a fusion gene or the
hemagglutinin/neuraminidase gene.
5. A virus attenuated according to the method of claim 1.
6. The method of claim 1, wherein said virus of the order
Mononegavirales is a Rhabdovirus.
7. The method of claim 6, wherein said Rhabdovirus is rabies virus
or vesicular stomatitis virus.
8. The method of claim 1, wherein said virus of the order
Mononegavirales is a Paramyxovirus.
9. The method of claim 8, wherein said Paramyxovirus is measles,
mumps, parainfluenza virus or a respiratory syncytial virus.
10. The method of claim 9, wherein said respiratory syncytial virus
is a human respiratory syncytial virus or a bovine respiratory
syncytial virus.
11. The method of claim 1, wherein said virus of the order
Mononegavirales is a Filovirus.
12. The method of claim 11, wherein said Filovirus is Ebola virus
or Marburg virus.
13. The method of claim 1, wherein said attenuated virus useful for
a vaccine is attenuated such that the lethal dose and the
protective dose of the virus differ by about 1000 fold.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a divisional of U.S. Ser. No.
10/198,371, filed on Jul. 18, 2002, which is a divisional of U.S.
Ser. No. 09/602,288, filed Jun. 23, 2000, issued on Jul. 22, 2003,
as U.S. Pat. No. 6,596,529, which is a continuation-in-part
application and claims the benefit of priority under 35 USC
.sctn.120 of U.S. Ser. No. 09/071,606, filed May 1, 1998, issued on
Oct. 24, 2000, as U.S. Pat. No. 6,136,585.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates generally to the fields of
molecular virology and vaccinology. More specifically, the present
invention relates to the attenuation of negative stranded RNA
viruses by rearrangement of their genes and uses thereof.
[0004] 2. Description of the Related Art
[0005] The order Mononegavirales is composed of four families, the
Rhabdoviridae, the Paramyxoviridae, the Filoviridae and the
Bornaviridae. The viruses in these families contain a single strand
of non-segmented negative-sense RNA and are responsible for a wide
range of significant diseases in fish, plants, and animals (Wagner,
1996). The expression of the genes encoded by these viruses is
controlled at the level of transcription by the order of the genes
on the genome relative to the single 3' promoter. Gene order
throughout the Mononegavirales is highly conserved: genes encoding
products required in stoichiometric amounts for replication are
always at or near the 3' end of the genome while those whose
products are needed in catalytic amounts are more promoter distal
(Pringle and Easton, 1997).
[0006] Vesicular stomatitis virus (VSV) is the prototypic virus of
the Rhabdoviridae. Its 11 kilobase genome has 5 genes which encode
the 5 structural proteins of the virus; the nucleocapsid protein,
N, which is required in stoichiometric amounts for encapsidation of
the replicated RNA; the phosphoprotein, P, which is a cofactor of
the RNA-dependent RNA polymerase, L; the matrix protein, M; and the
attachment glycoprotein, G. The order of genes in the genome is
3'-N-P-M-G-L-5' and previous studies have shown that expression is
obligatorily sequential from a single 3' promoter (Ball and White,
1976). Due to attenuation at each gene junction the 3'-most genes
are transcribed more abundantly than those that are more promoter
distal (Iverson and Rose, 1981).
[0007] In nature, VSV infects a wide range of animals of which
horses, cattle, and domestic swine are the most economically
important. Infection results in the appearance of lesions around
the mouth, hooves, and udder teats and while seldom fatal it leads
to a loss in meat and milk production along with the expense of
quarantine and vaccination. There are two main VSV serotypes,
Indiana (Ind) and New Jersey (NJ) and while these viruses are
endemic in Central and South American countries, outbreaks do occur
within the United States. A recent outbreak in the U.S. occurred in
1997 in horses, and was of the Ind serotype while previous cases
identified in 1995 and 1982-1983 were of the NJ serotype. The ease
with which these viruses are transmitted, and the similarity of
their symptoms to those caused by foot-and-mouth disease virus in
cattle and domestic swine, makes VSV a pathogen of concern to the
agriculture industry.
[0008] Live attenuated viruses capable of replicating to generate
protective humoral as well as cell mediated immune responses
without producing disease manifestations have proven effective
vaccines against viruses such as smallpox, yellow fever and
poliomyelitis. The strategy for attenuation, however, has been
empirical in most cases and not reproducible for general use. An
additional consideration in the case of RNA viruses is that the
high error rate of RNA dependent RNA polymerases, their, lack of
proof reading and the quasi-species nature of RNA virus populations
(Domingo et al, 1996), make the use of live attenuated viruses for
this large group of medically significant pathogens problematic.
This is especially true if the vaccine virus is based on a limited
number of single base changes as reversion to virulence is a
potential problem. For example, only a few back mutations can
restore virulence to the Sabin poliovirus type 3 vaccine strain
(Wimmer et al., 1993).
[0009] The non-segmented negative strand RNA viruses of the family
Mononegavirales possess an elegantly simple means of controlling
the expression of their genes. The linear, single-stranded RNA
genomes of this family encode five to ten genes, the order of which
is highly conserved among all members. The prototype virus of this
family is the Rhabdovirus, vesicular stomatitis virus (VSV).
Transcription of the viral genome is carried out by the
virus-encoded RNA dependent RNA polymerase. There is a single entry
site on the linear genome for the RNA polymerase, yet the mRNAs of
the virus are not produced in equimolar amounts.
[0010] Available evidence indicates that the linear order of the
genes on the genome controls the levels of expression of individual
genes. Transcription initiates at the single polymerase entry site
a t the 3' terminus of the genome and is obligatorily processive
(Ball and White, 1976). The level of expression of the individual
genes as monocistronic mRNAs is controlled by the dissociation,
approximately 30% of the time, of the polymerase at each intergenic
junction, as it traverses the genome in the 3' to 5' direction
(Iverson and Rose, 1981). This mechanism of transcription results
in sequentially decreasing amounts of the transcripts of each gene
as a function of the distance of the gene from the 3' terminus of
the genome. Correspondingly, gene products needed in stoichiometric
amounts to support replication, such as the nucleocapsid (N)
protein, are encoded at or near the 3' terminus in all cases and
expressed in the highest molar amounts (Villarreal et al., 1976,
Ball and White, 1976). Gene products needed in enzymatic amounts,
such as the RNA polymerase are encoded most distal from the 3' end.
In all of the Mononegavirales, the polymerase gene is the 5'-most
gene, and it is expressed in the lowest amount. Precise molar
ratios of the proteins are required for optimal replication. For
successful replication, proteins must be expressed in molar ratios
that approximate those expressed normally from the genome (Pattnaik
and Wertz, 1990).
[0011] Viruses of the family Mononegavirales do not undergo
homologous genetic recombination (Pringle, 1987). Thus, other than
defective interfering particles, which lack portions of the genome,
variants of these viruses having the entire complement of genes in
a rearranged format have not been observed in nature.
[0012] The prior art is deficient in the lack of effective means of
increasing expression of a promoter distal gene in a virus of the
order Mononegavirales and uses of such viruses. The present
invention fulfills this long-standing need and desire in the
art.
SUMMARY OF THE INVENTION
[0013] The non-segmented negative-strand RNA viruses (order
Mononegavirales) comprise several important human pathogens. The
order of their genes, which is highly conserved, is the major
determinant of the relative levels of gene expression, since genes
that are close to the single promoter site on the viral genome are
transcribed at higher levels than those that occupy more distal
positions. An infectious cDNA clone of the prototypic vesicular
stomatitis virus (VSV) was manipulated to rearrange the order of
four of the five viral genes, while leaving all other aspects of
the viral nucleotide sequence unaltered. In one set of cDNA clones,
the middle three genes (which encode the phosphoprotein P, the
matrix protein M, and the glycoprotein G) were rearranged into all
six possible orders. In another set, the gene for the nucleocapsid
protein N was moved away from its wild-type promoter-proximal
position and placed second, third or fourth. In a final
rearrangement, the G protein gene, which encodes the major surface
antigen and the target for neutralizing antibodies, was put next to
the promoter, in the position for maximum expression. Infectious
viruses were recovered from each of these rearranged cDNAs and
examined for their levels of gene expression and growth potential
in cell culture, and their immunogenicity and virulence in mice.
Rearrangement changed the expression levels of the encoded proteins
and attenuated the viruses to different extents both in cultured
cells and in mice. Increasing the expression of the G protein
enhanced and accelerated the immune response in inoculated mice.
Since the Mononegavirales do not undergo homologous recombination,
gene rearrangement should be irreversible and thus provides a
rational method for developing securely attenuated live vaccines
against this type of virus.
[0014] In one embodiment of the present invention, there is
provided a method of increasing expression of a promoter distal
gene in a virus of the order Mononegavirales, comprising the step
of rearranging gene order of the virus by moving the promoter
distal gene toward a wild-type 3' promoter proximal position
site.
[0015] In another embodiment of the present invention, there is
provided a recombinant virus of the order Mononegavirales having a
rearranged genome, wherein the genome is rearranged by moving a
promoter distal gene of the virus toward a wild type 3' promoter
proximal position site. Such recombinant virus can be used for
accelerating and enhancing a protective immune response.
[0016] In still another embodiment of the present invention, there
is provided a method of attenuating a virus of the order
Mononegavirales by rearranging gene order of the virus by moving a
gene away from its wild type position, or by rearranging gene order
of the virus by moving an essential limiting factor gene away from
its wild type 3' promoter proximal position site.
[0017] In yet another embodiment of the present invention, there is
provided a method of constructing an attenuated virus useful for a
vaccine, comprising the steps of: rearranging the gene order of the
virus by moving a gene away from its wild-type 3' promoter proximal
position site, wherein the gene is an essential limiting factor for
genome replication; and placing a gene coding for an immune
response inducing antigen in the position closest to the 3' end of
the gene order of the virus.
[0018] Other and further aspects, features, and advantages of the
present invention will be apparent from the following description
of the presently preferred embodiments of the invention given for
the purpose of disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] So that the matter in which the above-recited features,
advantages and objects of the invention, as well as others which
will become clear, are attained and can be understood in detail,
more particular descriptions of the invention briefly summarized
above may be had by reference to certain embodiments thereof which
are illustrated in the appended drawings. These drawings form a
part of the specification. It is to be noted, however, that the
appended drawings illustrate preferred embodiments of the invention
and therefore are not to be considered limiting in their scope.
[0020] FIG. 1 shows the gene orders of the rearranged VSV
genomes.
[0021] FIG. 2 shows the stepwise procedure for generation of
rearranged VSV genomic cDNAs.
[0022] FIG. 3A shows the cleavage specificity of restriction
enzymes used to generate cDNA modules for gene order rearrangement.
Using PCR, either a BspMI or BsaI site is positioned at each end of
the P, M and G genes of VSV, and at the 3' end of the N gene and
the 5' end of the L gene, such that the sticky ends correspond to 4
of the conserved nucleotides at the intercistronic junctions. FIG.
3B shows fragments of VSV genome cloned for gene order
rearrangement.
[0023] FIG. 4 shows the strategy for construction of rearranged
genomes N2, N3, N4 and G1N2.
[0024] FIG. 5A shows the schematic diagram of the VSV genome
showing positions of PCR primers that annealed to the N or L genes,
respectively (shown by the arrows) and restriction enzyme cleavage
sites and predicted fragment sizes. FIG. 5B shows the products
after digestion with indicated enzymes of the cDNAs of viral RNA
from viruses GMP, MGP, PGM, PMG, GPM and MPG (lanes 1-6,
respectively). Fragments were analyzed by electrophoresis on a 1%
agarose gel in the presence of ethidium bromide. Lane M=marker DNA
fragments with sizes as indicated.
[0025] FIG. 6 shows viral RNAs synthesized in BHK-21 cells that
were infected with the wild-type and variant viruses. Viral RNAs
were labeled with [.sup.3H]uridine, resolved by electrophoresis on
an agarose-urea gel, and detected by fluorography. The infecting
viruses are shown above the lanes, and the viral RNAs are
identified on the left.
[0026] FIG. 7 shows viral proteins synthesized in BHK-21 cells that
were infected with the wild-type and variant viruses. Viral
proteins were labeled with [.sup.35S]methionine, resolved by
electrophoresis on an SDS-polyacrylamide gel, and detected by
autoradiography. The infecting viruses are shown above the lanes,
and the viral proteins are identified on the left. Uninf,
uninfected cells.
[0027] FIGS. 8A-8B show the molar ratios of proteins synthesized in
BHK-21 cells that were infected with the wild type and variant
viruses. Proteins were labeled, resolved on SDS-polyacrylamide gels
as shown in FIG. 7, and quantitated by phosphorimaging. Molar
ratios were calculated after normalizing for the methionine
contents of the individual proteins: N-14, P-5, M-11, G-10 and
L-60.
[0028] FIG. 9 shows the single step growth curves of wild type VSV
and the rearranged variants in BSC-1 cells. Viral titers were
measured in duplicate at each time point during three independent
single-step growth experiments at 37.degree. C., and the results
were averaged.
[0029] FIG. 10 shows pathogenesis of wild-type (wt) and variant
viruses following intranasal inoculation into mice. The time course
of morbidity (gray bars) and mortality (black bars) in animals that
received intranasal inoculation of 100 PFU of each of the variant
viruses is shown. No further changes occurred after the time
periods shown.
[0030] FIG. 11 shows the viral specific RNA synthesized in BHK-21
cells infected with rearranged viruses N1 (wt), N2, N3 and N4.
Conditions of infection, labeling and analysis were as described in
FIG. 6.
[0031] FIG. 12 shows the molar ratios of the VSV specific proteins
synthesized in BHK-21 cells following infection with rearranged
viruses N1 (wt), N2, N3 and N4. Proteins were analyzed as described
in FIG. 7 and molar ratios calculated as described in FIGS.
8A-8B.
[0032] FIG. 13 shows replication of viruses with N gene
translocations by single step growth in BHK cells.
[0033] FIG. 14 shows relative lethality of viruses N1 (wt), N2, N3
and N4 for mice.
[0034] FIG. 15 shows a comparison of antibody production and
ability to protect against lethal challenge for viruses N1 (wt),
N2, N3 and N4.
[0035] FIG. 16 shows the viral specific RNA synthesized in BHK-21
cells infected with viruses containing a foreign gene (I) inserted
at each VSV intergenic junction. Conditions of infection, labeling
and analysis are as described in FIG. 6 except the labeling time
was from 2 to 4.5 hours postinfection.
[0036] FIG. 17 shows the gene order of the variant viruses: N1G4
(wild type), G1N2, G3N4, and G1N4.
[0037] FIG. 18 shows synthesis of viral proteins in BHK-21 cells
infected with the variant viruses. In FIG. 18A, BHK-21 cells were
infected at a MOI of 50 and incubated at 37.degree. C. for 5 hr in
the presence of actinomycin D (5 .mu.g/ml) for the final 2 hr.
Infected cells were then starved for methionine for 30 min and
exposed to medium containing [.sup.35S]methionine (30 .mu.Ci/ml)
for 1 hr. Total infected cell proteins were analyzed by SDS-PAGE.
In FIG. 18B, virions were isolated from supernatant fluids of
BHK-21 cells infected at a MOI of 5 and exposed to
[.sup.35S]methionine (50 .mu.Ci/ml) from 2.5 to 12 hr
post-infection. Virus particles were purified by centrifugation
through 10% sucrose and their protein contents determined by
SDS-PAGE. Viral proteins shown in FIG. 18A and FIG. 18B were
quantitated by phosphorimaging and expressed as molar percentages
of each viral protein in infected BHK-21 cells in FIG. 18C or molar
percentages of each protein in purified virions in FIG. 18D. Data
shown average two independent experiments. Lanes: 1, N1G4 (wt); 2,
G1N2; 3, G3N4; 4, G1N4; 5, uninfected cells.
[0038] FIG. 19 shows single-step growth analysis. Viruses were
assayed for their ability to replicate by single-step growth in
BHK-21 cells at 37.degree. C. Cells were infected at a multiplicity
of infection of 3 and samples of the supernatant medium harvested
at the indicated time points. Samples were titrated in duplicate by
plaque assay on Vero-76 cells. Average virus yields per cell were
determined at 24 hr post-infection (inset).
[0039] FIG. 20 shows pathogenesis in mice. The viruses shown were
administered intranasally to groups of 6 mice at a dose of 1,000
PFU per mouse, and the animals were monitored daily for signs of
morbidity and mortality. No further changes occurred after day
12.
[0040] FIG. 21 shows average weight of mice inoculated with the
rearranged viruses. Groups of 6 mice were inoculated intranasally
with serial 10-fold dilutions of N1G4 (wt), G1N2, G3N4, or G1N4
ranging from 10,000 to 1 pfu/animal. Control mice received
inoculation medium alone. The vertical dotted line indicates day of
challenge with 5.4.times.10.sup.6 pfu/mouse of wild-type virus. For
each group, all living animals were weighed together and the
average weight determined. , 10,000 pfu; {circumflex over (1)},
1,000 pfu; , 100 pfu; , 10 pfu; .Arrow-up bold., 1 pfu; +,
medium.
[0041] FIG. 22 shows kinetics of antibody production in response to
inoculation with the rearranged and wild-type viruses. Groups of 6
mice were inoculated intranasally with serial 10-fold dilutions of
N1G4 (wt), G1N2, G3N4, or G1N4 ranging from 10,000 to 1 pfu/animal.
Control mice received inoculation medium only. The vertical dotted
line indicates the day of challenge with 5.4.times.10.sup.6
pfu/mouse of wild type virus. Serum was collected by tail bleeds
from 2-4 animals at weekly intervals, the serum pooled and the
level of antibody raised against VSV determined by titration on
detergent-lysed VSV-infected cell antigen in an ELISA. Antibody
levels are expressed as log.sub.10 titers. , 10,000 pfu;
{circumflex over (4)}, 1,000 pfu; , 100 pfu; , 10 pfu; .Arrow-up
bold., 1 pfu; +, medium.
[0042] FIG. 23 shows that groups of 6 mice were inoculated
intranasally with serial 10-fold dilutions of N1G4 (wt), G1N2,
G3N4, or G1N4 ranging from 10,000 to 1 pfu/animal. Control mice
received inoculation medium only. Mice were assessed for
neutralizing antibody levels as measured in serum samples on the
day of challenge by plaque reduction assay (FIG. 23A). Neutralizing
antibody levels are expressed as the reciprocal of the highest
dilution giving a 50% reduction in wild-type virus plaques on
Vero-76 cells. *sera from animals given 1 PFU or 10 PFU of N1G4 or
G1N2 virus had background levels of neutralizing antibody. Mice
were also assayed for ability to survive intranasal challenge by
5.4.times.10.sup.6 PFU of N1G4 virus (FIG. 23B). The dotted line
shows the lethality of this dose (83%) in unvaccinated,
age-matched, control animals 21 days after challenge.
DETAILED DESCRIPTION OF THE INVENTION
[0043] The present invention illustrates that introduction of
specific changes into the genome of a negative strand RNA virus
allowed translocation of the gene for the nucleocapsid (N) protein
to successive positions on the genome and demonstrated directly
that the position of a gene relative to the promoter determined the
level of expression. Levels of N protein synthesis control the
level of RNA replication. Consistent with this, the present
invention demonstrates that as the level of N mRNA and protein
synthesis in cells infected with viruses N2, N3 and N4 was reduced,
the level of genomic RNA replication was also reduced.
Correspondingly, the production of infectious virus in cell culture
was reduced in increments up to four orders of magnitude with virus
N4. Finally, concomitant with reduced replication potential, the
lethality of viruses N2, N3, and N4 for mice following IN
inoculation was reduced by approximately one, two or three orders
of magnitude, respectively, compared to the wild-type virus.
[0044] These data demonstrate that translocating a single gene
essential for replication to successive positions down the viral
genome lowered the growth potential in cell culture and the
lethality of the viruses for mice in a stepwise manner. However,
the ability of the viruses to elicit a protective immune response
in mice was not altered in correspondence with the reduction in
virulence. Therefore, since the viruses all contained the wild-type
complement of genes and all were competent to replicate, albeit at
reduced levels, the level of replication was sufficient to induce a
protective host response. Thus, for some rearranged viruses, the
protective dose and the lethal dose were 1,000 fold different, in
contrast to the situation with wild-type virus where the lethal
dose and protective dose overlap. Taken together, these data
suggest a means of attenuating non-segmented negative strand RNA
viruses in a predictable, incremental manner that would allow one
to determine an optimal level of attenuation to avoid disease
production without loss of replication potential to induce a
sufficient immune response.
[0045] Since the Mononegavirales have not been observed to undergo
homologous recombination, gene rearrangement is predicted to be
irreversible, and therefore, the present invention provides a
rational, alternative method for developing stably attenuated live
vaccines against the non-segmented negative strand RNA viruses.
Furthermore, based on the close similarity of genome organization
and control of gene expression, this approach to generating
attenuated viruses should be applicable to the entire family of
Mononegavirales, which includes the Rhabdoviridae, such as rabies,
the Paramyxoviridae, such as measles, mumps, respiratory syncytial
virus, and parainfluenza viruses I-IV, and the Filoviridae such as
Ebola and Marburg viruses. These represent some of the most
problematic viral pathogens extent.
[0046] In one embodiment of the present invention, there is
provided a method of increasing expression of a promoter distal
gene in a virus of the order Mononegavirales, comprising the step
of rearranging gene order of the virus by moving the promoter
distal gene toward a wild-type 3' promoter proximal position site.
Preferably, the distal gene encodes a surface glycoprotein. For
vesicular stomatitis virus, one distal gene that encodes a surface
glycoprotein is the gene for the attachment glycoprotein G. For
respiratory syncytial virus, one distal gene that encodes a surface
glycoprotein is referred to as the attachment glycoprotein (G)
gene; another distal gene that encodes a surface glycoprotein is
the respiratory syncytial virus fusion (F) protein gene. For the
measles virus, the distal gene that encodes a surface glycoprotein
is referred to as the H (hemagglutinin) gene. For the mumps and
parainfluenza viruses, the distal gene that encodes a surface
glycoprotein is referred to as the HN (hemagglutinin/neuraminidase)
gene. A person having ordinary skill in this art would readily
recognize, for each specific virus of the order Mononegavirales,
which distal gene that encodes a surface glycoprotein would be
manipulated in order to perform the methods of the present
invention.
[0047] In another embodiment of the present invention, there is
provided a recombinant virus of the order Mononegavirales having a
rearranged genome, wherein the genome is rearranged by moving a
promoter distal gene of the virus toward a wild type 3' promoter
proximal position site. Such recombinant virus can be used for
accelerating and enhancing a protective immune response.
[0048] In still another embodiment of the present invention, there
is provided a method of attenuating a virus of the order
Mononegavirales by rearranging gene order of the virus by moving a
gene away from its wild type position, or by rearranging gene order
of the virus by moving an essential limiting factor gene away from
its wild type 3' promoter proximal position site. Preferably, the
gene is placed in the next to last position in the gene order of
the virus. Furthermore, it is preferable that the gene which is an
essential limiting factor for genome replication is the
nucleocapsid (N) gene. Representative examples of viruses of the
order Mononegavirales are a Rhabdovirus, such as rabies virus or
vesicular stomatitis virus, a Paramyxovirus, such as measles,
mumps, parainfluenza virus or respiratory syncytial virus (human
and bovine), or a Filovirus, such as Ebola virus or Marburg virus.
The present invention also includes a virus attenuated according to
this method.
[0049] In yet another embodiment of the present invention, there is
provided a method of constructing an attenuated virus useful for a
vaccine, comprising the steps of rearranging gene order of the
virus by moving a gene away from its wild-type 3' promoter proximal
position site, wherein the gene is an essential limiting factor for
genome replication; and placing a gene coding for an immune
response inducing antigen in the position closest to the 3' end of
the gene order of the virus. Preferably, the essential limiting
factor gene is the nucleocapsid (N) gene and the gene is placed in
the next to last position in the gene order of the virus. Still
preferably, the gene coding for an immune response inducing antigen
may be the attachment glycoprotein (G) gene, a fusion gene or the
hemagglutinin/neuraminidase gene. A person having ordinary skill in
this art would be able to readily substitute suitable immune
response-inducing antigens. The present invention also includes a
virus attenuated according to this method.
[0050] In accordance with the present invention, there may be
employed conventional molecular biology, microbiology, and
recombinant DNA techniques within the skill of the art. Such
techniques are explained fully in the literature. See, e.g.,
Maniatis, Fritsch & Sambrook, "Molecular Cloning: A Laboratory
Manual (1982); "DNA Cloning: A Practical Approach," Volumes I and
II (D. N. Glover ed. 1985); "Oligonucleotide Synthesis" (M. J. Gait
ed. 1984); "Nucleic Acid Hybridization" [B. D. Hames & S. J.
Higgins eds. (1985)]; "Transcription and Translation" [B. D. Hames
& S. J. Higgins eds. (1984)]; "Animal Cell Culture" [R. I.
Freshney, ed. (1986)]; "Immobilized Cells And Enzymes" [IRL Press,
(1986)]; B. Perbal, "A Practical Guide To Molecular Cloning"
(1984). Therefore, if appearing herein, the following terms shall
have the definitions set out below.
[0051] A "DNA molecule" refers to the polymeric form of
deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in
its either single stranded form, or a double-stranded helix. This
term refers only to the primary and secondary structure of the
molecule, and does not limit it to any particular tertiary forms.
Thus, this term includes double-stranded DNA found, inter alia, in
linear DNA molecules (e.g., restriction fragments), viruses,
plasmids, and chromosomes. In discussing the structure herein
according to the normal convention of giving only the sequence in
the 5' to 3' direction along the non-transcribed strand of DNA
(i.e., the strand having a sequence homologous to the mRNA).
[0052] A "vector" is a replicon, such as plasmid, phage or cosmid,
to which another DNA segment may be attached so as to bring about
the replication of the attached segment. A "replicon" is any
genetic element (e.g., plasmid, chromosome, virus) that functions
as a n autonomous unit of DNA replication in vivo; i.e., capable of
replication under its own control. An "origin of replication"
refers to those DNA sequences that participate in DNA synthesis. An
"expression control sequence" is a DNA sequence that controls and
regulates the transcription and translation of another DNA
sequence. A coding sequence is "operably linked" and "under the
control" of transcriptional and translational control sequences in
a cell when RNA polymerase transcribes the coding sequence into
mRNA, which is then translated into the protein encoded by the
coding sequence.
[0053] In general, expression vectors containing promoter sequences
which facilitate the efficient transcription and translation of the
inserted DNA fragment are used in connection with the host. The
expression vector typically contains an origin of replication,
promoter(s), terminator(s), as well as specific genes which are
capable of providing phenotypic selection in transformed cells. The
transformed hosts can be fermented and cultured according to means
known in the art to achieve optimal cell growth.
[0054] A DNA "coding sequence" is a double-stranded DNA sequence
which is transcribed and translated into a polypeptide in vivo when
placed under the control of appropriate regulatory sequences. The
boundaries of the coding sequence are determined by a start codon
at the 5' (amino) terminus and a translation stop codon at the 3'
(carboxyl) terminus. A coding sequence can include, but is not
limited to, prokaryotic sequences, cDNA from eukaryotic mRNA,
genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and
even synthetic DNA sequences. A polyadenylation signal and
transcription termination sequence will usually be located 3' to
the coding sequence. A "cDNA" is defined as copy-DNA or
complementary-DNA, and is a product of a reverse transcription
reaction from an mRNA molecule. An "exon" is an expressed sequence
transcribed from the gene locus, whereas an "intron" is a
non-expressed sequence that is from the gene locus.
[0055] Transcriptional and translational control sequences are DNA
regulatory sequences, such as promoters, enhancers, polyadenylation
signals, terminators, and the like, that provide for the expression
of a coding sequence in a host cell. A "cis-element" is a
nucleotide sequence, also termed a "consensus sequence" or "motif",
that interacts with other proteins which can upregulate or
downregulate expression of a specific gene locus. A "signal
sequence" can also be included with the coding sequence. This
sequence encodes a signal peptide, N-terminal to the polypeptide,
that communicates to the host cell and directs the polypeptide to
the appropriate cellular location. Signal sequences can be found
associated with a variety of proteins native to prokaryotes and
eukaryotes.
[0056] A "promoter sequence" is a DNA regulatory region capable of
binding RNA polymerase in a cell and initiating transcription of a
downstream (3' direction) coding sequence. For purposes of defining
the present invention, the promoter sequence is bounded at its 3'
terminus by the transcription initiation site and extends upstream
(5' direction) to include the minimum number of bases or elements
necessary to initiate transcription at levels detectable above
background. Within the promoter sequence will be found a
transcription initiation site, as well as protein binding domains
(consensus sequences) responsible for the binding of RNA
polymerase. Eukaryotic promoters often, but not always, contain
"TATA" boxes and "CAT" boxes. Prokaryotic promoters contain
Shine-Delgarno sequences in addition to the -10 and -35 consensus
sequences.
[0057] The term "oligonucleotide" is defined as a molecule
comprised of two or more deoxyribonucleotides, preferably more than
three. Its exact size will depend upon many factors which, in turn,
depend upon the ultimate function and use of the oligonucleotide.
The term "primer" as used herein refers to an oligonucleotide,
whether occurring naturally as in a purified restriction digest or
produced synthetically, which is capable of acting as a point of
initiation of synthesis when placed under conditions in which
synthesis of a primer extension product, which is complementary to
a nucleic acid strand, is induced, i.e., in the presence of
nucleotides and an inducing agent such as a DNA polymerase and at a
suitable temperature and pH. The primer may be either
single-stranded or double-stranded and must be sufficiently long to
prime the synthesis of the desired extension product in the
presence of the inducing agent. The exact length of the primer will
depend upon many factors, including temperature, source of primer
and use the method. For example, for diagnostic applications,
depending on the complexity of the target sequence, the
oligonucleotide primer typically contains 15-25 or more
nucleotides, although it may contain fewer nucleotides.
[0058] The primers herein are selected to be "substantially"
complementary to different strands of a particular target DNA
sequence. This means that the primers must be sufficiently
complementary to hybridize with their respective strands.
Therefore, the primer sequence need not reflect the exact sequence
of the template. For example, a non-complementary nucleotide
fragment may be attached to the 5' end of the primer, with the
remainder of the primer sequence being complementary to the strand.
Alternatively, non-complementary bases or longer sequences can be
interspersed into the primer, provided that the primer sequence has
sufficient complementarity with the sequence or hybridize therewith
and thereby form the template for the synthesis of the extension
product.
[0059] As used herein, the terms "restriction endonucleases" and
"restriction enzymes" refer to enzymes which cut double-stranded
DNA at or near a specific nucleotide sequence.
[0060] "Recombinant DNA technology" refers to techniques for
uniting two heterologous DNA molecules, usually as a result of in
vitro ligation of DNAs from different organisms. Recombinant DNA
molecules are commonly produced by experiments in genetic
engineering. Synonymous terms include "gene splicing", "molecular
cloning" and "genetic engineering". The product of these
manipulations results in a "recombinant" or "recombinant
molecule".
[0061] A cell has been "transformed" or "transfected" with
exogenous or heterologous DNA when such DNA has been introduced
inside the cell. The transforming DNA may or may not be integrated
(covalently linked) into the genome of the cell. In prokaryotes,
yeast, and mammalian cells for example, the transforming DNA may be
maintained on an episomal element such as a vector or plasmid. With
respect to eukaryotic cells, a stably transformed cell is one in
which the transforming DNA has become integrated into a chromosome
so that it is inherited by daughter cells through chromosome
replication. This stability is demonstrated by the ability of the
eukaryotic cell to establish cell lines or clones comprised of a
population of daughter cells containing the transforming DNA. A
"clone" is a population of cells derived from a single cell or
ancestor by mitosis. A "cell line" is a clone of a primary cell
that is capable of stable growth in vitro for many generations. An
organism, such as a plant or animal, that has been transformed with
exogenous DNA is termed "transgenic".
[0062] As used herein, the term "host" is meant to include not only
prokaryotes but also eukaryotes such as yeast, plant and animal
cells. A recombinant DNA or RNA molecule or gene of the present
invention can be used to transform a host using any of the
techniques commonly known to those of ordinary skill in the art.
One preferred embodiment is the use of a vectors containing coding
sequences for the RNA molecules or cDNA molecules of the present
invention for purposes of transformation. Prokaryotic hosts may
include E. coli, S. typhimurium, Serratia marcescens and Bacillus
subtilis. Eukaryotic hosts include yeasts such as Pichia pastoris,
mammalian cells and insect cells, and more preferentially, plant
cells, such as Arabidopsis thaliana and Tobaccum nicotiana.
[0063] Two DNA sequences are "substantially homologous" when at
least about 75% (preferably at least about 80%, and most preferably
at least about 90% or 95%) of the nucleotides match over the
defined length of the DNA sequences. Sequences that are
substantially homologous can be identified by comparing the
sequences using standard software available in sequence data banks,
or in a Southern hybridization experiment under, for example,
stringent conditions as defined for that particular system.
Defining appropriate hybridization conditions is within the skill
of the art. See, e.g., Maniatis et al., supra; DNA Cloning, Vols. I
& II, supra; Nucleic Acid Hybridization, supra.
[0064] A "heterologous" region of the DNA construct is an
identifiable segment of DNA within a larger DNA molecule that is
not found in association with the larger molecule in nature. Thus,
when the heterologous region encodes a mammalian gene, the gene
will usually be flanked by DNA that does not flank the mammalian
genomic DNA in the genome of the source organism. In another
example, the coding sequence is a construct where the coding
sequence itself is not found in nature (e.g., a cDNA where the
genomic coding sequence contains introns, or synthetic sequences
having codons different than the native gene). Allelic variations
or naturally-occurring mutational events do not give rise to a
heterologous region of DNA as defined herein.
[0065] A standard Northern blot assay can be used to ascertain the
relative amounts of mRNA in a cell or tissue obtained from plant or
other transgenic tissue, in accordance with conventional Northern
hybridization techniques known to those persons of ordinary skill
in the art. Alternatively, a standard Southern blot assay may be
used to confirm the presence and the copy number of the gene in
transgenic systems, in accordance with conventional Southern
hybridization techniques known to those of ordinary skill in the
art. Both the Northern blot and Southern blot use a hybridization
probe, e.g. radiolabeled cDNA, either containing the full-length,
single stranded DNA or a fragment of that DNA sequence at least 20
(preferably at least 30, more preferably at least 50, and most
preferably at least 100 consecutive nucleotides in length). The DNA
hybridization probe can be labeled by any of the many different
methods known to those skilled in this art. Alternatively, the
label may be incorporated directly into the RNA or protein molecule
by many different methods known to those of skill in this art.
[0066] The labels most commonly employed for these studies are
radioactive elements, enzymes, chemicals which fluoresce when
exposed to ultraviolet light, and others. A number of fluorescent
materials are known and can be utilized as labels. These include,
for example, fluorescein, rhodamine, auramine, Texas Red, AMCA blue
and Lucifer Yellow. A particular detecting material is anti-rabbit
antibody prepared in goats and conjugated with fluorescein through
an isothiocyanate. Proteins can also be labeled with a radioactive
element or with an enzyme. The radioactive label can be detected by
any of the currently available counting procedures. The preferred
isotope may be selected from .sup.3H, 14C, .sup.32P, .sup.35S,
.sup.36Cl, .sup.51Cr, .sup.57Co, .sup.58CO, .sup.59Fe, .sup.90Y,
.sup.125I, .sup.131I, and .sup.186Re.
[0067] Enzyme labels are likewise useful, and can be detected by
any of the presently utilized colorimetric, spectrophotometric,
fluorospectrophotometric, amperometric or gasometric techniques.
The enzyme is conjugated to the selected particle by reaction with
bridging molecules such as carbodiimides, diisocyanates,
glutaraldehyde and the like. Many enzymes which can be used in
these procedures are known and can be utilized. The preferred are
peroxidase, .beta.-glucuronidase, .beta.-D-glucosidase,
.beta.-D-galactosidase, urease, glucose oxidase plus peroxidase and
alkaline phosphatase. U.S. Pat. Nos. 3,654,090, 3,850,752, and
4,016,043 are referred to by way of example for their disclosure of
alternate labeling material and methods.
[0068] As used herein, the term "attenuation" is defined as either
a genetic mechanism involving premature termination of
transcription used to regulate expression of a gene, or
immunologically, the process whereby a pathogenic microorganism
loses its virulence.
[0069] As used herein, the term "lethal dose" is defined as the
amount of virus inoculum required to confer lethality on the
host.
[0070] As used herein, the term "protective dose" is defined as the
amount of virus inoculum that produces a sufficient immune response
towards the virus without resulting in lethality.
[0071] As used herein, the term "rearrangement" is defined as the
reordering of the genes within the viral genome, such that the gene
and the intergenic regions remain wild-type and only the order with
respect to the 3' terminus is altered.
[0072] As used herein, the term "negative strand RNA virus" is
defined as a classification of RNA viruses in which the genome
comprises the negative strand of an RNA molecule.
[0073] The present invention also demonstrates that it is possible
to increase the expression of a promoter distal gene, e.g., the G
gene, which encodes the attachment glycoprotein, by moving it to a
promoter proximal site. To show that an increase in the production
of the G protein during infection could elicit a greater protective
immune response, changes were engineered into an infectious cDNA
clone of the VSV genome and two novel viruses were recovered in
which the glycoprotein gene was moved from its normal fourth
position to the first position in the gene order. One virus had the
gene order 3'-G-N-P-M-L-5' (G1N2) and the second 3'-G-P-M-N-L-5'
(G1N4). The in vitro and in vivo characteristics of these viruses
were assessed and compared to those of viruses having the gene
orders 3'-P-M-G-N-L-5' (G3N4) and 3'-N-P-M-G-L-5' (N1G4), the
latter being the wild-type gene order. Differences were observed in
the replication of these viruses in cell culture, lethality in
mice, kinetics and levels of antibody production, and their ability
to protect against challenge with a lethal dose of VSV.
[0074] The following examples are given for the purpose of
illustrating various embodiments of the invention and are not meant
to limit the present invention in any fashion.
EXAMPLE 1
[0075] Viruses and Cells
[0076] The San Juan isolate of the Indiana serotype of VSV provided
the original template for most of the cDNA clones used herein.
However, the gene encoding the G protein was originally derived
from the Orsay isolate of VSV Indiana (Whelan et al., 1995). Baby
hamster kidney (BHK-21) cells were used to recover viruses from
cDNAs and for single step growth experiments and radioisotopic
labeling of RNAs and proteins. African green monkey kidney (BSC-1
and BSC-40) cells were used for plaque assays.
EXAMPLE 2
[0077] Plasmid Construction and Recovery of Infectious Viruses
[0078] Each of the five genes of VSV is flanked by a common
sequence of eighteen nucleotides. Thus, it was possible to
construct individual molecular clones from which DNA fragments
precisely encompassing each gene could be released by digestion
with a n appropriate restriction endonuclease. Restriction
endonucleases that cut at sites remote from their recognition
sequences were used to create gene segments having cohesive ends
that corresponded to the same four nucleotides (ACAG) of the
conserved intercistronic regions. In this way, the DNA segments
that encompassed each of the five genes could be reassembled in any
desired order to create a family of DNA plasmids whose nucleotide
sequences corresponded precisely to that of wild-type VSV, except
for the fact that their genes were rearranged. A diagram of the
steps involved in the construction of the rearranged virus genomes
N1 (wt), GMP, MGP, PGM, GPM, MPG, N2, N3, N4, G1N2 and G1N4 is
shown in FIGS. 2, 3 and 4.
[0079] Infectious viruses were recovered from these DNA plasmids by
methods described (Whelan et al., 1995). Briefly, BHK cells were
infected with the vaccinia virus recombinant that expresses T7 RNA
polymerase, VTF7-3, (Fuerst et al., 1986) and cotransfected with
one of the rearranged cDNA plasmids and the three support plasmids
that express the N, P and L proteins required for RNA encapsidation
and replication. Infectious viruses were recovered from the
supernatant of transfected cells, amplified by low-multiplicity
passage on BHK-21 cells, and filtered through 0.2 mm filters to
remove contaminating VTF7-3. The gene orders of the recovered
viruses were verified by amplifying the rearranged portions of the
viral genomes using reverse transcription and polymerase chain
reaction (PCR) followed by restriction enzyme analysis with a set
of enzymes which distinguished the rearranged gene orders (FIG.
5).
EXAMPLE 3
[0080] Single-Cycle Virus Replication
[0081] Monolayer cultures of 10.sup.6 BHK-21, BSC-40 or BSC-1 cells
were infected with individual viruses at an input multiplicity of
3. Following a one hour adsorption period, the inoculum was
removed, cultures were washed twice, fresh media was added and
cultures were incubated at 31.degree. C. or 37.degree. C. Samples
were harvested at the indicated intervals over a 36 hour period and
viral replication quantitated by plaque assay on confluent
monolayers of BSC-40 cells.
EXAMPLE 4
[0082] Analysis of Viral RNA and Protein Synthesis
[0083] Confluent monolayer cultures of BHK-21 cells were infected
with individual viruses at an input multiplicity of 5 PFU per cell
and given a one hour adsorption period. For analysis of viral RNA
synthesis, cultures were treated with actinomycin D (5 .mu.g/ml) a
t 1.5 hours post-infection for 30 minutes prior to addition of
[.sup.3H]-uridine (30 .mu.Ci/ml) for a 2 or 4 hour labeling period.
Cells were harvested, cytoplasmic extracts prepared and RNA
analyzed on 1.75% agarose-urea gels as described (Pattnaik and
Wertz, 1990). Protein synthesis was analyzed at four hours
post-infection by addition of [.sup.35S]-methionine (40 .mu.Ci/ml)
for a 30 minute labeling period following a 30 minute incubation in
methionine free media. Cytoplasmic extracts were prepared and
proteins analyzed on 10% polyacrylamide gels as described
previously (Pattnaik and Wertz, 1990). Individual RNAs or proteins
were quantitated by densitometric analysis of autoradiographs using
a Howteck Scanmaster 3 with Pdi Quantity One software and molar
ratios were subsequently calculated.
EXAMPLE 5
[0084] Virulence in Mice
[0085] The lethality of individual viruses was measured in male
Swiss-Webster mice, 3-4 weeks old, obtained from Taconic Farms.
Groups of 5-6 lightly anesthetized (Ketamine/Xylazine) animals were
inoculated with diluent (PBS) or with serial ten-fold dilutions of
individual viruses by either the intracranial route in a volume of
30 .mu.l or by the intranasal route in a volume of 15 .mu.l.
Animals were observed daily and the 50% lethal dose (LD.sub.50) for
each virus was calculated by the method of Reed and Muench
(1938).
EXAMPLE 6
[0086] Protection of Mice
[0087] Groups of control mice inoculated with diluent or inoculated
intranasally with non-lethal doses of individual viruses were
monitored by tail bleeds for neutralizing serum antibody
production. On day 14 post-inoculation, mice were challenged with
1.3.times.10.sup.6 PFU of wild-type virus (designated N1)
administered intranasally in 15 .mu.l while under light anesthesia
as above. Challenged animals were observed for 21 days.
EXAMPLE 7
[0088] A General Approach to Rearranging the Genes of the
Mononegavirales
[0089] To rearrange the genes of VSV without introducing any other
changes into the viral genome, the polymerase chain reaction (PCR)
was used to construct individual cDNA clones of the N, P, M, and G
genes flanked by sites for restriction enzymes that cut outside
their recognition sequences. To flank the P, M, and G genes, BspM1
sites were used, whereas to flank the N gene, Bsa 1 sites were used
(N contains an internal BspM1 site). PCR primers were designed to
position these restriction sites so that the four-base cohesive
ends left after endonuclease digestion corresponded to the ACAG
sequence of the conserved 5' AACAG . . . 3' that occurs at the
start of each VSV mRNA (see also FIG. 3A). For example: 5' . . .
ACCTGCACT AACAG . . . AAAAAAACTAACAGAGATGCAGGT . . . 3.degree. (SEQ
ID No. 1), where the VSV sequence, written in the positive sense,
is in italics, the BspM1 recognition sites are in bold letters, and
the four-base cohesive ends left by BspM1 digestion are underlined.
In this way, the four genes, together with their respective
intergenic junctions, were recovered on individual DNA fragments
that had compatible cohesive termini (FIGS. 3A and 3B). The only
deliberate departure from the wild-type sequence was that the
untranscribed intergenic dinucleotide was made 5'-CT-3' at all
junctions, including that following the P gene where the wild-type
sequence is 5'-GT-3'. This mutation is apparently silent (Barr et
al., 1997). To circumvent the effect of spurious mutations arising
during PCR, the termini of the cloned genes were sequenced and
their interiors were replaced with corresponding DNA fragments from
the infectious clone.
[0090] Two other starting plasmids were required to reconstruct the
rearranged full-length clones: one contained a bacteriophage T7
promoter followed by the VSV leader sequence, with a unique BspM1
site positioned to cut within the 5' (A)ACAG at the start of the N
gene: 5' . . . GAAACTTTAACAGTAATGCAGGT . . . 3' (SEQ ID No. 2). The
other plasmid contained the first 420 nucleotides of the L gene and
had a unique BspM1 site positioned to cut within the same sequence
at the start of L: 5' . . . ACCTGCACTAAC AGCAATCATG . . . 3' (SEQ
ID No. 3). The N, P, M and G gene fragments were ligated
unidirectionally into the unique BspM1 sites of these plasmids to
rebuild the viral genome in a stepwise manner from either the 3' or
the 5' end. Insertion of each gene recreated a wild-type intergenic
junction and left a unique BspM1 site to receive the next gene.
[0091] The final step of plasmid construction was to add a DNA
fragment from the infectious clone that encompassed the remaining 6
kb of the L gene, the 5' end of the viral genome, and the ribozyme
and T7 terminator that are needed for the intracellular synthesis
of replication-competent transcripts (Pattnaik et al., 1992). This
approach can be applied to any of the Mononegavirales which have
conserved sequences at their intergenic junctions. The rearranged
gene orders that were created in this manner are shown in FIG. 1.
To validate this cloning strategy and to verify that the individual
genes encoded functional proteins, a plasmid that contained the
wild-type genome was created in parallel with the rearranged cDNA
clones. Virus recovered from this plasmid was used as the wild-type
(N1, see FIG. 1). In all cases, the conserved 23 nucleotide
intergenic region was maintained between genes.
EXAMPLE 8
[0092] Generation of Viruses with Rearranged Genomes
[0093] Initial rearrangements of the cDNA of the genome of VSV were
conservative, in light of the highly conserved nature of the
genomes of all viruses in the family Mononegavirales, and the
knowledge that precise molar ratios of the VSV nucleocapsid (N)
protein, phosphoprotein (P) and RNA polymerase (L) protein are
required for replication. The 3' most gene, N, and the 5' most
gene, L, were originally maintained in their natural positions and
the three central genes of VSV, the P, M and G genes, were
rearranged in all possible combinations to generate the 6 genome
orders (N1 (wt), GMP, MGP, PGM, GPM and MPG) as shown in FIG. 1.
The wild-type gene order, N1, was generated as described above to
serve as a test that all of the cDNA elements were functional. Each
of the cDNAs was constructed in a specialized T7 expression plasmid
designed to generate RNAs having precise 5' and 3' termini
(Pattnaik et al., 1992).
[0094] The ability of the rearranged cDNAs to generate a functional
RNA genome was demonstrated by transfecting each of the six
rearranged cDNAs into BHK cells infected with vaccinia virus
expressing the T7 polymerase (Fuerst et al., 1986) concomitantly
with cDNA clones encoding the VSV N, P, and L proteins to
encapsidate the RNA transcribed from the cDNA clones and to form
functional ribonucleocapsids as described (Whelan et al., 1995).
Virus was recovered with varying efficiency from all six of the
cDNA constructs and amplified in the presence of cytosine
arabinoside (25 .mu.g/ml) following filtration through 0.2 .mu.m
filters to remove the recombinant vaccinia virus used to express
the T7 polymerase required for transcription of the cDNAs to yield
RNA virus.
EXAMPLE 9
[0095] The Gene Order of the Recovered RNA Viruses Reflects that of
the cDNA from which they were Generated
[0096] The gene orders of the recovered viruses were determined
after three passages in cell culture by amplifying a 4.1-kb
fragment encompassing the rearranged portions of the viral genomes
by reverse transcription and PCR, followed by restriction enzyme
analysis of the PCR products. PCR was carried out with primers
located in the N and L genes. After cleavage with restriction
endonuclease AccI, BglI, or PstI, which cleave uniquely in the P,
M, or G gene, respectively, the observed sizes of the digestion
products were found to be exactly as predicted (FIGS. 5A and 5B).
The data showed that the gene orders of the recovered viruses
corresponded to the cDNA clones from which there were recovered.
There was no evidence for the reappearance of the wild-type gene
order among the variants.
EXAMPLE 10
[0097] Synthesis of Viral RNAs and Proteins
[0098] The recovered viruses were next examined for their levels of
gene expression. Synthesis of viral RNAs and proteins by the
variant viruses was examined by metabolic incorporation of
[.sup.3H]uridine or [.sup.35S]methionine into infected cells, and
analysis of the radiolabeled products by gel electrophoresis. The
same species of viral RNAs were made in cells infected with the
wild-type virus and with each of the variants: the 11.16-kb genomic
RNA and mRNAs representing the L, G, N, P, and M genes (FIG. 6).
The latter two mRNAs are similar in size and comigrated during
electrophoresis. No novel or aberrant RNA species were found in
cells infected with the variant viruses, showing that the virus
preparations were free of DI particles (FIG. 6). Moreover, the
similarities among the RNA patterns reinforced the idea that the
behavior of the viral polymerase during transcription across the
intergenic junctions was determined exclusively by local sequence
elements at these positions, with no detectable long-range
influences. In accordance with the RNA patterns, the viral proteins
made by the variant viruses also resembled qualitatively those made
during wild-type infection (FIG. 7).
[0099] Although the RNA and protein profiles of cells infected with
the wild-type and variant viruses were qualitatively similar,
measurement of the relative levels of the different RNAs and
proteins showed that the variant viruses expressed their genes in
molar ratios that differed from both the wild type and one another
(FIGS. 8A-8B). Normalizing the expression of each protein to that
of the promoter-proximal N gene for each variant virus showed that
the relative expression level of a gene depended primarily on its
location in the genome and thus on its distance from the promoter,
just as predicted by the model of progressive transcriptional
attenuation. This is clearly exemplified by comparison of the molar
rations of proteins expressed by the wild-type (PMG) with variant
GMP in which the order of the internal genes is reversed (FIGS.
8A-8B). A similar quantitative analysis of the mRNA profiles was
complicated by the lack of resolution of the M and P mRNAs (FIG.
6), but measurement of the L, G, and N mRNA levels reinforced the
conclusion that the proximity of a gene to 3' end of the viral
genome was the major determinant of its level of transcription. For
example, the differences in the relative abundance of G mRNA
reflected the position of the G gene (FIG. 6). The RNA profiles
also showed that the level of RNA replication, as measured by the
abundance of the 11.1-kb genomic and antigenomic RNAs, differed
substantially among the variants (FIG. 6).
EXAMPLE 11
[0100] Replication of Viruses with Rearranged Genomes
[0101] The variant viruses were compared for their ability to
replicate under the conditions of plaque formation and single-cycle
growth. Although some of the viruses such as MGP and MPG were
indistinguishable from the N1 wild type virus (PMG) in these
assays, others such as GMP, GPM, and PGM formed significantly
smaller plaques than the wild type on monolayers of BSC-1 cells
(Table 1). Moreover, GMP plaques ceased to grow after 24 h when
those of the wild type virus and the other variants were still
increasing in size (Table 1). The impaired replication of GMP, GPM,
and PGM was also demonstrated during single-cycle growth on BSC-1
cells (FIG. 9). At 17 h post-infection, the incremental yields of
the variants averaged over three independent growths and expressed
as percentages of the wild type were as follows: for MGP, 107%; for
MPG, 51%; for GMP, 23%; for PGM, 21%; and for GPM, 1.6% (Table
2).
1TABLE 1 Plaque diameter (mean .+-. standard error).sup.a Virus 24
h 30 h PMG (wild type) 4.02 .+-. 0.12 4.81 .+-. 0.19 GMP 3.08 .+-.
0.17 3.10 .+-. 0.18 MGP 3.96 .+-. 0.19 4.97 .+-. 0.18 PGM 3.36 .+-.
0.12 3.86 .+-. 0.14 GPM 2.26 .+-. 0.09 3.16 .+-. 0.13 MPG 3.85 .+-.
0.18 5.43 .+-. 0.17 .sup.aPlaque diameters were measured from
photographs taken at approximately two-fold magnification of groups
of 50 (24 h) or 70 (30 h) viral plaques formed at 37.degree. C. on
monolayers of BSC-1 cells.
EXAMPLE 12
[0102] Virulence in Mice
[0103] Intracerebral or intranasal inoculation of wild-type VSV
into mice causes fatal encephalitis. Since 1938, when Sabin and
Olitsky first described the neuropathology and comparative
susceptibility of mice to VSV encephalitis as a function of age and
route of inoculation, young mice have served as a convenient and
sensitive small animal model for comparing the lethality of VSV and
its mutants (Sabin and Olitsky, 1938; Wagner, 1974). The
pathogenesis of the variant viruses in mice was therefore
examined.
[0104] Intranasal inoculation of wild-type VSV into 3-4 week old
mice causes encephalitis, paralysis and death after 7-11 days
(Sabin and Olitsky, 1938), with the LD.sub.50 dose being about 10
PFU. The virulence of the variant viruses was compared by
inoculating groups of mice intranasally with serial 10-fold
dilutions ranging from 0.1 to 1,000 PFU per dose and observing them
twice daily. Viral gene orders were verified on viruses recovered
shortly after death from the brains of inoculated mice by using the
methodology shown in FIGS. 5A and 5B. In each case, the gene order
of the recovered virus corresponded to that of the inoculum (data
not shown).
[0105] The LD.sub.50 doses for the variant viruses were similar to
that of the wild type, with viruses GPM, GMP, and MGP requiring
slightly higher (1.5- to 2-fold) dose (Table 2). These experiments
were repeated three times, and the results of a representative
experiment show the time of appearance of illness and death at a
dose of 100 PFU per mouse (FIG. 10). The wild-type infected animals
first appeared sick at 6 days post-inoculation, rapidly became
paralyzed, and died within two weeks. Recombinants GMP and MGP
elicited reproducibly faster pathogenesis, with symptoms developing
24-36 h earlier than in wild-type infected animals, whereas the
onset of death from infection with MPG and GPM occurred 24 to 36 h
later (FIG. 10). In general, the paralysis that is typical of
infection with wild-type VSV was less apparent with the variant
viruses, but there was no evidence of persistent nervous system
disease such as that produced by some M protein mutants (Barr et
al., 1997).
[0106] Virulence in mice could not be predicted from the cell
culture phenotypes of the variant viruses (Table 2). Of the three
recombinants whose replication in cell culture was most compromised
(GMP, PGM, and GPM), one (GPM) required 2 fold more virus for an
LD.sub.50 than the wild-type and showed slightly delayed killing in
mice, whereas GMP induced faster onset of symptoms and death, and
PGM was indistinguishable from wild-type. This lack of correlation
between the behavior of viruses in cell culture and their
properties in animals is a familiar observation among different
animal viruses, but is interesting in this context where the only
differences between the viruses were the relative levels of
wild-type proteins that they expressed.
2TABLE 2 Summary of properties of variant viruses Gene Relative
Relative LD.sub.50 Onset of order plaque size.sup.a burst
size.sup.b value.sup.c symptoms.sup.d PMG (wt) 1.00 1.00 14 6.0 GMP
0.64 0.23 21 4.5 MGP 1.03 1.07 21 5.5 PGM 0.80 0.21 12 5.5 GPM 0.66
0.016 30 5.5 MPG 1.13 0.51 11 5.5 .sup.aMeasured at 30 h
post-infection (see Table 1). .sup.bMeasured at 17 h post-infection
(see FIG. 9). .sup.cCPFU per mouse inoculated intranasally.
.sup.dDays after intranasal inoculation of 100 PFU per mouse (see
FIG. 10).
EXAMPLE 13
[0107] Effect of Severe Rearrangements on Recovery of Viable
Virus
[0108] Encouraged by the relative tolerance that VSV exhibited for
rearrangement of the three internal genes based on recovery of
infectious virus, further rearrangements were made that altered the
position of the gene for the nucleocapsid protein, N. The N protein
is required in stoichiometric quantities to support encapsidation
of nascent genomic RNA during RNA replication (Patton et al.,
1984). RNA replication is dependent on constant synthesis of the N
protein, and inhibition of N protein synthesis results in cessation
of replication. If the level of N protein synthesis were lowered by
moving the N gene progressively away from its promoter proximal
site (and thus lowering the level of N gene expression), it would
therefore result in lowered levels of genomic replication. As such,
the genome of VSV was altered at the cDNA level by moving the N
gene from the 3' most position, which results in synthesis of the
largest amount of N mRNA, to each sequential internal position as
shown in FIG. 1 to create N2 (PNMGL), N3 (PMNGL), and N4 (PMGNL).
N1 corresponds to the wild-type arrangement. A fourth and fifth
variation, in which the G gene was moved from next to last in the
order and placed in front of the N gene, were also generated (FIG.
1). This results in G1N2 (GNPML), as well as G1N4 (GPMNL), where
the position of the G and N genes were exchanged.
[0109] The cDNAs for N1-N4 and G1N2 and G1N4 were transfected into
cells as described above and analyzed for the ability to generate
viable virus. Virus was recovered with comparative ease from N2, N3
and G1N2. Virus was not recovered from N4 and G1N4, even with
repeated trials using standard transfection conditions a t
37.degree. C. Virus corresponding to N4 and G1N4 was recovered by
lowering the temperature of the transfections and subsequent
passages to 31.degree. C.
EXAMPLE 14
[0110] RNA Synthesis by Viruses with N Gene Rearrangements
[0111] Moving the N gene sequentially down the genome had a marked
effect on the level of replication and N mRNA synthesis (FIG. 11).
The level of N mRNA synthesis decreased substantially from
wild-type levels as the N gene was moved successively away from the
promoter in viruses N2, N3 and N4 (36%, 6% and 3% of wild-type,
respectively; FIG. 11). Consistent with this, an increase in the
amount of G mRNA was observed with virus N4, in which the G gene
was moved one position closer to the promoter as the N gene
replaced it as next to last in the gene order (FIG. 11). The amount
of genomic RNA replication of N2, N3 and N4 declined relative to
wild-type (50%, 28% and 4%, respectively; FIG. 11), concomitant
with the lowered expression of the N gene, as predicted if N
protein synthesis was limiting for replication. The overall level
of transcription was reduced also as the N gene was moved
progressively promoter distal, presumably as a secondary effect due
to the lowered number of genomic templates.
EXAMPLE 15
[0112] Protein Synthesis of Viruses with the N Gene Rearranged
[0113] All five of the VSV proteins were expressed in cells
infected with the rearranged viruses and they all co-migrated with
those of the wild-type virus. However, N protein synthesis declined
as its gene was moved away from the 3' position. The data presented
in FIG. 12 show how the molar amounts of the proteins decrease as a
function of their distance from the 3' terminus in the wild-type
virus N1. When the N gene was translocated, the data in FIG. 12
show that the molar ratios of the N protein relative to the
phosphoprotein P decreased progressively as the N gene was moved
from first to second, third, or fourth in the gene order. These
results confirm the predictions from previous analysis of gene
expression in VSV and the sequential nature of transcription.
Moreover, these data demonstrate directly that the position of a
gene determines its level of expression. Examination of the levels
of proteins in isolated, mature N1-N4 virions showed that the
relative molar ratios of the proteins in mature virus particles
remained essentially the same as that of the wild-type virus.
However, less overall virus was produced from infections of N2-4,
correlating with the lowered level of genomic RNA replication.
EXAMPLE 16
[0114] Replication Ability in Cell Culture
[0115] Viruses with the N gene rearrangements replicated
progressively less well as the N gene was moved downstream of its
normal promoter proximal position. Growth potential was analyzed by
single step growth curves. N2 and G1N2 were reduced in viral yields
by approximately 15-fold at 37.degree. C.; N3 was reduced by 50
fold and N4 was reduced by 20,000 fold in replication ability as
compared to the wild-type virus (FIG. 13). Comparison of virus
growth at 31.degree. C. showed a similar progressive decline,
however, the effect was less pronounced than at 37.degree. C., and
overall, this temperature was more permissive for growth (FIG. 13,
inset). At 31.degree. C., N4 replication was reduced approximately
100 fold compared to wild-type. The burst size in PFU per cell for
each of the viruses at 31.degree. C. and 37.degree. C., shows that
the yield per cell declined in a stepwise manner as the N gene was
moved to each successive position down the genome (FIG. 13). The
relative plaque sizes of the viruses also varied; plaques of N4 are
compared to that of wild-type (<0.5 mm compared to 3 mm in
diameter at 42 hours post infection). These data indicate that
although the genes of N2, N3 and N4 were wild type, rearrangement
of the genes and the subsequent alterations of the protein molar
ratios rendered some step of the viral replication process
partially temperature sensitive.
EXAMPLE 17
[0116] Lethality in Mice
[0117] Growth of VSV in mice, neuropathology and susceptibility to
encephalitis by intracerebral or intranasal inoculation of
wild-type, temperature sensitive or plaque size variant viruses has
been described in detail (Sabin and Olitsky, 1937; Shechmeister et
al., 1967; Wagner, 1974; Youngner and Wertz, 1968). The lethality
of viruses N2, N3 and N4 for mice was examined in comparison with
the wild-type virus N1 for both the intracerebral and intranasal
routes of inoculation. The amounts of virus required for a lethal
dose (LD.sub.50) by each route is shown in Table 3. By
intercerebral inoculation, the LD.sub.50 dose for each of the
viruses was 1 to 5 pfu, although the average time to death was
about twice as long with the N4 virus. These data show that when
injected directly into the brain, thereby circumventing the
majority of host defenses, the rearranged viruses eventually could
cause fatal encephalitis.
[0118] Intranasal inoculation, by contrast, showed striking
differences in the amount of virus required for a lethal dose
(Table 3). Whereas the LD.sub.50 dose for the wild-type virus by IN
administration was approximately 10 pfu, the values for N2, N3 and
N4 viruses were progressively greater. N2 required 20 fold more
virus, N3, 500 fold more virus, and N4 required 3000 fold more
virus than wild-type, i.e. 30,000 PFU for the LD.sub.50. The time
to onset of sickness (ruffled fur, lethargy, hind limb paralysis)
and extent of death increased progressively compared to wild-type
following infection with viruses N2, N3 and N4 (FIG. 14) and the
extent of mortality was a function of dose (Table 3). These data
show that when administered by a peripheral route, the progressive
reduction in virus replication observed in cell culture correlated
with a reduced lethality in mice.
3TABLE 3 Lethality of wild-type or Rearranged VSV Viruses for Mice
LD.sub.50 Data* pfu/mouse (Average days to death) Intracranial
Intranasal N1 NPMGL (WT) 1 (3-6) 11 (5-10) N2 PNMGL 5 (3-7) 250#
(9-12) N3 PMNGL 5 (3-8) 5,400# (7-9) N4 PMGNL 1 (4-11) 30,000
(10-12) *The LD.sub.50 for each route of inoculation was calculated
from mortality among groups of 5 to 7 mice inoculated either IC or
IN with five serial10-fold dilutions of virus. Data from a single
internally controlled experiment are shown; the duplicate
experiments carried out for each route of administration were
similar. #Mortality data for this virus yielded a bell shaped death
curve; the LD.sub.50 dose was calculated from the lower part of the
curve. Days to death are shown in parentheses.
EXAMPLE 18
[0119] Ability of Rearranged Viruses to Protect Against Wild-Type
Challenge
[0120] The observation that all of the viruses were lethal when
inoculated IC indicated that even the most attenuated viruses were
able to replicate in mice. This, coupled with the attenuation
observed following intranasal administration, raised the
possibility that the attenuated viruses might nevertheless be able
to elicit a protective immune response. To test this possibility,
mice were immunized by IN inoculation with serial ten-fold
dilutions of the wild-type N1 or with variant viruses N2, N3 or N4.
The surviving animals were challenged 14 days later by IN
inoculation with 1.3.times.10.sup.6 PFU of wild-type virus. The
percentage of animals surviving the challenge was a function of the
immunizing dose in agreement with previous studies (Wagner, 1974).
For viruses N2, N3 and N4, 300 PFU per mouse was the lowest dose
giving 100% survival; 30 PFU yielded 80-90% survival; 3-6 PFU gave
45-85% survival; and doses below 3-6 PFU per mouse gave results
that were not significantly different from those of age matched
unimmunized controls (FIG. 15, dotted line in panel A). With the
wild-type virus, the lethal dose and the protective dose were
close, but in general, 80-85% of animals that survived
administration of 3-6 PFU of virus were protected.
[0121] Measurement of serum antibody prior to challenge on day 14
showed that despite attenuation for virulence in mice, the level of
neutralizing antibody present in the serum of animals immunized
with viruses N2, N3 and N4 was higher than that observed in the
animals surviving inoculation of 3-6 PFU of wild-type virus and
generally increased in a dose dependent manner (FIG. 15B). The
lethality of the wild-type virus prevented direct comparison of
antibody titers at higher doses, however, the neutralizing antibody
titers in animals both vaccinated with viruses N1-N4 and then
challenged with 1.times.10.sup.6 PFU of wild-type virus ranged from
1:625 to 1:3125. These data show that despite their attenuation for
replication and lethality in animals, the N-rearranged viruses
elicited a protective response that was undiminished compared with
that of the wild-type virus.
EXAMPLE 19
[0122] Organization of Genes to Develop an Optimum Vaccine
Virus
[0123] The present invention illustrates that gene order in the
Mononegavirales determines the level of gene expression.
Furthermore, these data show that moving the important Nucleocapsid
(N) gene away from its normal 3' promoter proximal position
provides a means of generating sequentially more attenuated
viruses. The maximal level of attenuation occurs when the N gene is
placed next to last in the gene order. The highest level of
expression occurs from the 3'-most gene. Therefore, in constructing
a vaccine vector that is both attenuated and expresses high levels
of the antigen involved in protection, the ideal arrangement is a
combination of N4 (3'-PMGNL-5') or G1N2 (3'-GNPML-5') or G1N4
(3'-GPMNL-5'). In these constructs, N4 is maximally attenuated and
G1N2 yields the greatest levels of the attachment glycoprotein,
important for an immune response. Based upon this criteria, G1N4
(3'-GPMNL-5') should be maximally attenuated and yield the highest
levels of G protein.
EXAMPLE 20
[0124] A Vaccine Vector Capable of Expressing Additional Foreign
Genes so that the Level of the Foreign Gene is Regulated by
Position
[0125] The genome of VSV can accommodate and express additional
foreign genes if inserted at intergenic regions and if the
conserved gene start, gene end and intergenic regions are
maintained (FIG. 16) (Schnell et al., 1996). Additionally, the
level of expression of a foreign gene inserted in the VSV genome
can be controlled by the position in the genome at which the gene
is inserted. A 660 nucleotide sequence of the bacteriophage Phi
X174 genome surrounded by the conserved VSV gene start and gene end
sequences was inserted into each sequential gene junction of the
full length cDNA of the VSV genome in such a manner so as to
maintain the conserved intergenic sequences. The gene order of
these constructs was respectively: NIP (3'-NIPMGL-5'), PIM
(3'-NPIMGL-5'), MIG (3'-NPMIGL-5'), or GIL (3'-NPMGIL-5') where I
represents the (I)nserted foreign gene. Virus was recovered from
each of the above-mentioned cDNAs by transfection as described
above.
[0126] The viruses with the foreign gene sequence inserted a t each
position in the genome were each used to infect BHK-21 cells and
synthesis of RNAs was analyzed by metabolic labeling with
[.sup.3H]-uridine in the presence of actinomycin D. VSV genomic RNA
and the VSV specific mRNAs were expressed from all of the recovered
viruses (FIG. 16). In addition, in all four cases, the synthesis of
an mRNA of the size expected from the inserted foreign genetic
material was also observed. The level of expression of the foreign
gene varied as its position of insertion from the 3' end of the
genome. The highest level of expression was from NIP, followed by
PIM, MIG and GIL (FIG. 16). Thus, these data show that foreign
genes may be inserted into the genome of VSV and that the foreign
gene will be expressed if surrounded by the conserved VSV gene
start and stop signals. Most importantly, this data shows that the
level of expression of the foreign gene is controlled by the
position at which the gene is inserted into the genome.
[0127] Analysis of the growth potential of each of the viruses
expressing a foreign gene showed that the position of the insertion
of the foreign gene determined whether or not there was an effect
on viral growth. NIP was reduced by 10-fold in viral yields
compared to wild-type virus, whereas PIM, MIG and GIL all
replicated to levels equivalent to that of wild-type virus. Thus,
these data show that insertion of a foreign gene is possible, that
it is not lethal to the virus, and that it may, depending on the
position of insertion, serve to attenuate replication.
EXAMPLE 21
[0128] Viruses and Cells
[0129] The San Juan isolate of the Indiana serotype of VSV provided
the template for all of the cDNA clone of the VSV genome except the
G protein gene which was derived from the Orsay isolate of
VSV-Indiana. All viruses were recovered from cDNAs in baby hamster
kidney (BHK-21) cells. BHK-21 cells were also used for single-step
growth assays and radioisotopic labeling of viral RNAs and
proteins. Plaque assays were performed on the African green monkey
cell line Vero-76.
EXAMPLE 22
[0130] Plasmid Construction and Recovery of Infectious Virus
[0131] The construction of a full-length cDNA clone of the VSV
genome and its use for the recovery of infectious virus has been
described. This infectious clone was manipulated using methods
which allowed the genome to be assembled with the genes in
different orders. No other changes were made in the genome except
for a single nucleotide in the intergenic region downstream of the
P gene. This change, from 3'-CA-5' to 3'-GA-5', has little effect
on transcription.
[0132] To recover infectious viruses from the rearranged cDNA
clones, BHK-21 cells were infected with a recombinant vaccinia
virus expressing the T7 RNA polymerase (vTF7-3) (Fuerst, et al.,
1986). One hour later the cells were transfected with the
rearranged VSV cDNA along with three plasmids, which expressed the
N, P, and L proteins required for encapsidation and replication of
the anti-genomic RNA (Whelan et al., 1995). Infectious viruses were
harvested from the supernatant medium and amplified in BHK-21 cells
at low multiplicity of infection (MOI) to avoid formation of DI
particles and in the presence of cytosine arabinoside (25 .mu.g/ml)
to suppress the replication of vaccinia virus. Supernatant medium
was filtered through 0.2 .mu.M filters and the virus was banded on
15 to 45% sucrose velocity gradients to separate it from any
remaining vTF7-3 vaccinia virus. The gene orders of the recovered
viruses were confirmed by amplifying the rearranged portions of the
genomes using reverse transcription and PCR followed by restriction
enzyme analysis.
EXAMPLE 23
[0133] Analysis of Viral Protein Synthesis
[0134] Viral protein synthesis directed by each of the variant
viruses was measured in BHK-21 cells infected at a MOI of 50 with
actinomycin D (5 .mu.g/ml) added at 3 hours post-infection. At 5
hours post-infection the cells were washed and incubated in
methionine-free medium for 30 min. Cells were exposed to
[.sup.35S]methionine (30 .mu.Ci/ml, sp act 10.2 mCi/ml) for 1 hour.
Cell monolayers were harvested directly into gel loading buffer and
after normalizing for equal counts per minute (cpm) the viral
proteins were separated on 10% polyacrylamide gels using a low bis
to acrylamide ratio to separate the P and N proteins. Viral
proteins were quantitated using a phosphorimager and the molar
ratios calculated.
EXAMPLE 24
[0135] Analysis of Virion Proteins
[0136] To assess the quantity of each of the proteins in the mature
virions, BHK-21 cells were infected at a MOI of 5. After 2 hours
the cells were washed and incubated in methionine-free medium for
30 min. Cells were labeled with [.sup.35S]methionine (50 .mu.Ci/ml,
sp act 10.2 mCi/ml) overnight with cold methionine added to 10% of
normal medium level. Supernatant fluid was collected, cell debris
was removed by centrifugation, and virus was collected by
centrifugation through 10% sucrose. After normalizing the cpm, the
viral pellet was resuspended in gel loading buffer and virion
proteins separated on a 10% polyacrylamide gel. Virion proteins
were quantitated using a phosphorimager and the molar ratios
determined.
EXAMPLE 25
[0137] Single Cycle Virus Replication
[0138] BHK-21 cells were infected at a multiplicity of infection
(MOI) of 3. After 1-hour adsorption the inoculum was removed and
the monolayer washed twice. Fresh medium was added and the cells
incubated at 37.degree. C. Supernatant fluids were harvested at
indicated intervals over a 30-hour period and viral yields
determined by plaque assay on Vero 76 cells.
EXAMPLE 26
[0139] Lethality in Mice
[0140] Male Swiss-Webster mice, 3-4 weeks old, were purchased from
Taconic Farms German-town, NY, and housed under BL2 containment
conditions. Groups of 6 mice were lightly anesthetized with
ketamine/xylazine and inoculated intranasally with 10-.mu.l
aliquots of serial ten-fold viral dilutions of the individual
viruses in Dulbecco modified Eagle medium (DMEM). Control animals
were given a similar volume of DMEM. Animals were observed and each
group was weighed daily. The 50% lethal dose (LD.sub.50) for each
of the viruses was calculated using the method of Reed and Muench
(1938).
EXAMPLE 27
[0141] Determination of Serum Antibody Levels and Neutralization
Titers
[0142] After virus inoculation blood was collected at weekly
intervals from groups of 2-4 animals. Serum was pooled and heated
to 57.degree. C. for 40 min to inactivate complement. Cell
monolayers infected with VSV wild-type (N1G4) and uninfected BHK-21
cells were lysed in detergent buffer (1% NP40, 0.4% sodium
deoxycholate, 66 mM EDTA, 10 mM Tris-HCl pH 7.4) and used as
antigen in a direct enzyme-linked-immunosorbant-assay (ELISA).
Samples were serially diluted and detected using goat .alpha.-mouse
Ig conjugated to horseradish peroxidase. The optical density (OD)
was read at 450 nm and the antibody titers calculated by linear
regression analysis of a plot of optical density versus serum
dilution. The endpoint titers (log.sub.10) were deduced at an OD
1.5 times the pre-immune samples. Serum neutralizing antibody
titers on day of challenge were determined by a standard plaque
reduction assay on Vero 76 cells and the titer expressed as the
reciprocal of the dilution giving 50% neutralization.
EXAMPLE 28
[0143] Protection of Mice from Wild-Type Challenge
[0144] Mice were immunized intranasally with doses of each virus
ranging from 1-10,000 plaque-forming units (pfu) in DMEM.
Twenty-one days post-inoculation groups of mice that received
non-lethal doses of each of the variant viruses were challenged
intranasally with 5.4.times.10.sup.6 PFU of N1G4 wild-type virus.
Challenged animals and controls were monitored for a further
twenty-one days. At weekly intervals blood was collected by tail
bleeds for serum antibody titrations.
EXAMPLE 29
[0145] Generation and Recovery of Rearranged Viruses
[0146] In the present work, cDNA clones were generated in which the
G gene was moved from its normal position of fourth in the gene
order, to the first, most promoter proximal position to increase
its expression. Two new gene rearrangements were generated: one in
which the G gene was moved to first in the gene order and the
remaining four genes were left undisturbed to generate the order
3'-GNPML-5' (G1N2), and the second in which the positions of the G
and the N genes were exchanged to generate the order 3'-GPMNL-5'
(G1N4), (FIG. 17). These cDNAs were transfected into cells and
virus was recovered in both cases. The recovered viruses were
designated G1N2 and G1N4 respectively, according to the positions
of the N and G genes in the rearranged gene order. The properties
of these viruses were examined in comparison to a virus derived
from a cDNA clone created using the same gene rearrangement process
to regenerate the wild-type gene order (N1G4), and a virus with the
gene order 3'-P-M-G-N-L-5' (G3N4).
EXAMPLE 30
[0147] Effect of Gene Rearrangement on Viral Protein Expression
[0148] BHK-21 cells were infected with viruses with rearranged
genomes and the relative levels of viral protein synthesis were
examined by labeling for 1 hr with [.sup.35S]methionine at 5 hr
post-infection. Total cellular proteins were resolved by SDS-PAGE
and visualized by autoradiography. A typical gel is shown in FIG.
18A. Infection with wild-type VSV and the rearranged variants
resulted in rapid inhibition of host protein synthesis which
allowed the viral N, P, M, G, and L proteins to be detected
directly. Synthesis of G protein was significantly increased
relative to the other viral proteins in cells infected with G1N2
and G1N4 viruses (FIG. 18, lanes 2 and 4) as compared to the rate
in wild-type (N1G4) infected cells (FIG. 18, lane 1).
[0149] Proteins were quantitated by phosphorimaging. The molar
percentage of G protein synthesized during a 1 hr labeling period
was 2.3-fold higher in G1N2 infected cells and 1.7-fold higher in
G1N4 infected cells than in cells infected with wild-type virus.
Similarly, translocation of the N gene from its promoter proximal
position to a more distal position in viruses G1N2, G3N4, and G1N4
decreased the rate of N protein synthesis (FIG. 18C). As a
consequence of these changes in the relative rates of synthesis,
the molar ratios of the viral proteins differed in cells infected
with the variant viruses, in particular the ratio of N to P which
is known to be critical for optimal RNA replication (Pattnaik and
Wertz, 1990) (FIG. 18C).
[0150] The protein contents of purified virus particles were also
examined to determine if changes in protein synthesis in cells
affected protein assembly into virions. BHK-21 cells were infected
with each of the viruses, labeled with [.sup.35S]methionine
overnight, and virions harvested from supernatant fluids and
separated from cell debris by centrifugation through 10% sucrose.
Analysis of the virion proteins by SDS-PAGE (FIG. 18B) showed no
gross differences in the relative protein contents. Phosphorimager
quantitation confirmed that despite the altered relative levels of
protein synthesis in infected cells the amounts of proteins in
virions were similar to that of wild-type virus, with the exception
of virus G1N2 in which the level of G was 1.6-fold higher than in
wild-type or the other rearranged viruses (FIG. 18D).
EXAMPLE 31
[0151] Virus Replication in Cell Culture
[0152] Replication of the rearranged viruses under single-step
growth conditions was examined in cultured BHK-21 cells infected at
a MOI of 3 followed by incubation at 37.degree. C. Supernatant
fluids were harvested at various times and the virus yields
measured by plaque assay. Translocation of the N gene away from the
promoter proximal position resulted in stepwise reduction of
replication as the gene was moved further from the first position.
Movement of N to the second position (G1N2) decreased replication
by 3-fold, whereas moving N to the fourth position (G3N4) reduced
replication by as much as 1,000-fold (FIG. 19). However the two
viruses with N in the fourth position (G3N4 and G1N4) replicated to
very different levels under single-step growth conditions possibly
because the molar ratio of N:P critical for optimal replication was
less perturbed in G1N4 than G3N4. Measurement of the intracellular
rates of protein synthesis 5 hours after infection showed a molar
ratio for N:P of 1:1.6 in cells infected with G1N4 (3'-GPMNL-5')
compared to a N:P ratio of 1:1.8 in G3N4 (3'-PMGNL-5') infected
cells (FIG. 18C). A molar ratio for N:P of between 1:0.5 and 1:1 is
optimal for replication as shown by the N:P ratios of 1:0.7 in
wild-type-infected cells (N1G4) and 1:0.8 for cells infected with
G1N2. Both the wild-type virus and G1N2 have N directly followed by
P in the gene order (FIG. 17). Too much or too little P relative to
N decreases replication significantly; thus, in cells infected with
virus G3N4, not only is N limiting, but also the molar ratio of N:P
is more than twice the optimal value. The kinetics of replication
of G3N4 and G1N4 were delayed in comparison to wild-type and G1N2.
Single-step growth of G3N4 and G1N4 was not complete until 24 hr.
post-infection compared to 12 hr for N1G4 and G1N2. It is unlikely
that the over abundance of G in the infected cell was responsible
for this delay in replication since G1N2 showed no delay in
replication relative to wild-type virus.
EXAMPLE 32
[0153] Lethality in Mice
[0154] Young mice provide a sensitive animal model for the study of
neuropathology caused by VSV and its mutants, (Sabin and Olitsky,
1938; Wagner, 1974) and inoculation of mice with wild-type VSV via
the intranasal route results in fatal encephalitis. The
pathogenesis of the rearranged variant viruses was compared to that
of wild-type virus after intranasal inoculation in 3-4 week old
Swiss-Webster mice. The doses that constitute an LD.sub.50 for each
of the viruses are shown in Table 4.
4TABLE 4 LD.sub.50 dose for mice of viruses with rearranged gene
orders Virus pfu N1G4 (wt) 100 G1N2 50 G3N4 >100,000 G1N4 19,000
*The LD.sub.50 values were calculated from the observed mortality
among groups of 6 mice inoculated intranasally with a series of
10-fold dilutions of the rearranged viruses. Virus titers were
determined by plaque assay on Vero-76 cells. Data from a single,
internally controlled experiment is shown.
[0155] All the viruses were lethal for mice if given in
sufficiently high doses, although the doses of G3N4 administered in
these experiments did not reach the LD.sub.50 seen previously. In
general the position of the N gene, the N:P ratio, and the
resulting level of virus replication were major determinants of
lethality. Viruses in which the N gene was moved away from the
promoter required greatly increased doses to constitute an
LD.sub.50. These results confirmed previous observations with
viruses N1-N4 in which the N gene was moved sequentially. However,
the results presented here show that for viruses with N in the
fourth position (G3N4 and G1N4), both the replication ability and
the LD.sub.50 values were affected also by the position of the G
gene.
[0156] The LD.sub.50 values reported here are expressed in terms of
the viral titers on Vero-76 cells which are about 10-fold higher
than the titers on BSC-40 cells. Cell lines were changed because
rearranging the gene order of VSV could affect the interactions of
the variant viruses with the interferon system. BSC-40 cells are
competent to produce interferon after infection while Vero cells
are not. Therefore changing to Vero cells circumvented possible
differences in interferon induction or sensitivity.
[0157] The first symptoms of sickness (a hunched posture and
hind-limb paralysis) appeared 5 days post-inoculation with both
N1G4 and G1N2 viruses although the first deaths occurred earlier in
animals inoculated with N1G4 (FIG. 20). The viruses with N in the
fourth position induced symptoms more slowly and at a dose of 1,000
PFU per mouse, G3N4 induced neither morbidity nor mortality, as
observed before. In an attempt to detect sub-clinical signs of
sickness the groups of mice were weighed daily throughout the study
period (FIG. 21). However, whereas the mice that showed symptoms
invariably lost weight and died, those that showed no symptoms
showed no weight differences from uninoculated control animals
(FIG. 21). Similar results were observed after challenge of the
inoculated mice with wild-type virus: all animals that developed
symptoms subsequently died and those that did not develop symptoms
also showed no weight loss.
EXAMPLE 33
[0158] Serum Antibody
[0159] To assess the effect of inoculation of viruses with
rearranged G genes on the humoral immune response, mice were
inoculated intranasally with a serial 10-fold dilutions of each of
the variant viruses. Blood was collected at weekly intervals by
tail bleed and the level of serum antibody determined by ELISA.
Since survival of the inoculation was a prerequisite for this
experiment, only doses at or below the LD.sub.50 were used.
Translocation of the G gene changed the kinetics and magnitude of
the antibody response (FIG. 22). Mice inoculated with wild-type
virus made barely detectable levels of antibody within 21 days,
whereas animals that received 100 PFU of G1N2 had significant
titers by 14 days and those given G1N4 had significant titers by 7
days post-inoculation. This accelerated and enhanced response can
be seen most clearly by comparing the mice that received 100 PFU
(FIG. 22). The results demonstrate that translocation of the G gene
from the fourth to the first position enhances the humoral immune
response to VSV. Mice given G1N4 synthesized antibody earlier and
at higher levels than those given G3N4. This further confirms the
observation that putting the G gene first in the gene order
increased the immunogenicity of vsv.
[0160] Twenty-one days post-inoculation, the mice were challenged
with 5.4.times.10.sup.6 PFU of wild-type VSV. A rapid increase in
antibody titer was observed in animals given either N1G4 or G1N2,
although there was no further rise in the already high titers that
had been achieved prior to challenge in mice inoculated with G3N4
or G1N4.
EXAMPLE 34
[0161] Neutralizing Antibody Titer After Inoculation
[0162] The level of neutralizing antibody in the serum at the time
of challenge was measured. In mice and cattle, neutralizing
antibodies are an important element in protection against VSV
infection. On the day of challenge mice were bled and serum samples
were assayed for their ability to neutralize wild-type VSV in a
standard plaque-reduction assay on Vero-76 cells. The reciprocal of
the highest dilution that gave a 50% reduction of plaque numbers
was calculated to determine the neutralizing titers of the
sera.
[0163] All the viruses with rearranged genomes elicited serum
neutralizing antibody in mice (FIG. 23A). Neutralizing antibody was
not detected at doses of 1 or 10 pfu/mouse of either N1G4 or G1N2,
but both viruses elicited detectable titers at doses of 100 pfu,
the response to G1N2 being 10-fold higher than that to wild-type
virus. Thus for N1G4 and G1N2 the level of neutralizing antibody
did not correlate with virus replication in cell culture, where the
wild-type virus replicated 2-3 fold more abundantly than G1N2 (FIG.
19). This conclusion was reinforced by the response to G3N4 and
G1N4, which elicited approximately 10-fold higher titers than the
wild-type virus despite greatly reduced replication potential.
[0164] In summary, viruses with over-expressed G and
under-expressed N in infected cells yielded increased levels of
neutralizing antibody compared to wild-type virus (N1G4) following
intranasal inoculation. The combination of over-expressing G and
under-expressing N combined this enhanced immunogenicity with virus
attenuation which allowed the administration of higher doses that
elicited correspondingly higher titers of neutralizing antibodies.
Moreover, because of the lower lethality of these viruses, 100
times more virus could be administered without detriment, and under
these conditions they elicited up to 100-fold more neutralizing
antibody than could be attained in response to wild-type virus.
EXAMPLE 35
[0165] Protection of Mice from Challenge
[0166] These results establish that non-pathogenic doses of the
viruses that over-expressed G protein could elicit significant
humoral immune responses in mice. To see whether immunization with
the rearranged viruses could confer protection against VSV disease
animals that survived inoculated with each of the rearranged
viruses were challenged after 21 days with 5.4.times.10.sup.6 PFU
of wild-type virus. This dose was sufficient to kill 83% of the
uninoculated, age-matched, control group of animals.
[0167] All the viruses with rearranged genomes conferred
protection, the level of which varied with the dose of inoculum
(FIG. 23B). The levels of protection elicited by N1G4 and G1N2 were
alike, reflecting the comparable levels of replication and
lethality of these viruses described previously (FIG. 19 and Table
4). Similarly, the protection conferred by G1N4 resembled that of
G3N4. By 21 days post-inoculation, both viruses elicited solid
immunity at doses of 1,000 PFU per mouse. Importantly, these fully
protective doses were 20-100-fold less than the corresponding
LD.sub.50 values. This emphasizes the conclusion that gene
rearrangement is an effective method to systematically change the
phenotype of VSV to optimize the properties required of a live
attenuated vaccine.
[0168] Discussion
[0169] The present invention demonstrates that the order of genes
in negative strand RNA viruses determines the level of gene
expression. The gene order can be rearranged and the levels of
expression of the rearranged viral genes reflects their position
relative to the 3' promoter of transcription. By rearranging a
single gene essential for replication, such as the N (nucleocapsid)
gene, to successive positions down the viral genome, it is possible
to affect the growth potential in cell culture and the lethality of
the virus for mice in a stepwise manner. Thus, these data
demonstrate a means of attenuating these viruses in a stepwise
manner. Attenuated viruses, such as N4 (3'-PMGNL-5'), are such that
the lethal dose and the protective dose of the virus differ by over
1000-fold, an attribute desirable for an attenuated vaccine
candidate.
[0170] In addition, the present invention demonstrates that one may
insert foreign genes into the genome of the negative strand virus,
and recover infectious virus which expresses the foreign gene. The
level of expression of the foreign gene can be controlled by the
position in the genome relative to the 3' end at which the gene is
inserted. The ability of these viruses to accommodate foreign
material is most likely due to the fact that they possess helical
ribonucleocapsids, such that the nucleocapsid and the virus both
become larger as the size of the genome is increased. No limit on
the amount of foreign material that may be inserted has been
reached.
[0171] The methodology of the present invention can be used to
develop attenuated viruses for vaccines, and such methodology is
applicable to all members of the family Mononegavirales based upon
the close similarity of the genome organization and mechanism for
control of gene expression for the members of the family. The
Mononegavirales include the Rhabdoviruses, such as rabies, the
Paramyxoviruses, such as measles, parainfluenzaviruses, and
respiratory syncytial virus, and the Filoviruses such as Ebola and
Marburg.
[0172] The recovery of infectious viruses from cDNA clones of the
Mononegavirales permits experimental manipulation of the viral
genome. Gene expression in these viruses is controlled at the
transcriptional level by the order of the genes relative to the
single promoter at the 3' end of the viral genome. A method to
rearrange the order of the genes without introducing other changes
into the genome was developed. Gene rearrangement altered the
relative levels of synthesis of the viral proteins as expected, and
produced infectious viruses having a variety of different
phenotypes. The present studies examined the consequences of moving
the G protein gene, which encodes the major neutralizing epitopes
of the virus, from its promoter-distal position to first in the
gene order. Expression of G protein in infected cells was
significantly increased when its gene was moved from the fourth to
the first position. However, the protein content of the purified
virus particles was largely unaffected by changes in the viral gene
order.
[0173] The over-expression of G protein by these viruses allowed
examination of whether they elicited an altered humoral immune
response in animals. The data in FIG. 22 show that at an inoculum
dose of 100 pfu, antibody was produced more quickly and at higher
levels in animals infected with the viruses with G moved to a
promoter proximal position as compared to the wild-type virus.
Doses higher than 100 PFU could not be assayed for the N1G4
wild-type and G1N2 viruses because of their lethality. When
compared a t the dose of 100 pfu, viruses G1N2, G3N4, and G1N4 all
elicited higher antibody titers more rapidly than wild-type virus.
The reduced lethality of the G1N4 and G3N4 viruses allowed higher
doses to be administered and in these cases antibody levels
increased more rapidly than at lower doses.
[0174] The observation that all three viruses which had G move to a
promoter proximal position elicited an enhanced humoral immune
response in mice has implications for the understanding of
protective immunity in this system. Although the relative levels of
replication of the variant inocula in the cells that are most
relevant for induction of the immune response are unknown, it seems
likely that they mirror, at least qualitatively, the relative
levels of replication seen in cell culture. If this is the case,
G1N2, G3N4, and G1N4 express higher levels of G protein per
inoculated mouse only during the first round of replication. After
that, the more robust replication of the wild-type virus should
have more than compensated for its weaker G protein synthesis. Yet
at the same inoculated dose of 100 PFU per mouse, the variant
viruses elicited a n enhanced and accelerated humoral immune
response compared to the wild-type inoculated animals. It is
remarkable that a modest increase in the rate of G protein
synthesis in infected cells should exert such a marked effect on
the immune response, even in the face of substantial attenuation of
viral replication.
[0175] These results suggest that the kinetics and magnitude of the
humoral immune response becomes established very early in
infection. Either there is a short temporal window during which the
scale of the immune response becomes established irrevocably, or
the immune response to VSV infection is somehow determined by the
level of G protein synthesis per infected cell rather than by the
aggregate immunogenic load. A similar conclusion is suggested by
the efficacy of vaccines using recombinant canarypox vectors under
conditions where they are unable to replicate. Robust synthesis of
antigen by a highly attenuated vector appears to be an effective
vaccine strategy that warrants further exploration.
[0176] The position of the N gene and the level of N protein
expression correlated with efficiency of replication as the N
protein is required in stoichiometric amounts for genomic RNA
replication. The wild-type virus N1G4 replicated to the highest
titers, followed by virus G1N2 and viruses G1N4 and G3N4, which
replicated least well. Virus G1N4 however, replicated significantly
better than virus G3N4 although they both have the N gene in the
fourth position. Both of these viruses showed delayed replication
kinetics as might be expected if the formation of progeny virus was
limited by the supply of N protein.
[0177] It is known that the relative levels of the N and P
proteins, in addition to the absolute amount of N protein, are
critical for efficient replication. One function of the P protein
is to maintain the N protein in a soluble state such that it is
able to support encapsidation of newly replicated RNA. Consistent
with this, virus G1N2, while having reduced N protein expression
(FIGS. 18A and 18C) has the N and P genes in the same relative
order as the wild-type virus N1G4 (FIG. 17). Accordingly, G1N2
expressed the N and P proteins at about the same relative rates as
wild-type virus, 1:0.8 and 1:0.7 respectively. In agreement with
this, virus G1N2 replicated only slightly less than the wild-type
virus. Further to this point, although viruses G1N4 and G3N4 both
have N in the fourth position, G1N4 replicates substantially better
than G3N4 (FIG. 19). The ratio between the rates of synthesis of
the N and P proteins is disparate from the wild-type in both of
these viruses. However, virus G3N4 which has P in the first
position has an N to P ratio in infected cells of 1:1.8 whereas the
N:P ratio in cells infected with G1N4, where P is in the second
position, is 1:1.6, closer to that of wild-type virus. There is
also a difference between these two viruses in the rates of G
protein expression and it is possible that the increased levels of
G protein provide an advantage for replication of virus G1N4.
[0178] The reduced lethality of the viruses with gene
rearrangements is also consistent with the showing that attenuation
of lethality in mice correlated with reduced replication capacity.
Reduced replication, in turn, was related to the overall expression
levels of N protein and the N to P ratios as discussed above.
Obviously any gene rearrangement which brings the G gene to the
first position will displace the N gene from its wild-type position
and therefore decrease N protein expression. It will also alter the
molar ratios of proteins whose gene positions relative to one
another are changed by the rearrangement in question. Both types of
change would be expected to alter replication efficiency and
lethality. The data in Table 4 show that the viruses which
replicate best, wild-type and G1N2, required only 50 to 100 PFU to
constitute an LD.sub.50 dose, whereas 200 to 1,000 times more G1N4
and G3N4 virus, respectively, were required for a lethal dose.
[0179] The data presented here show that rearrangement of genes
allowed the manipulation of two important aspects of the viral
phenotype: lethality and the stimulation of neutralizing antibody.
By reducing N protein expression, and altering the N:P ratio, it
was possible to decrease replication potential and lethality for
animals; by increasing G protein expression it was possible to
alter the kinetics and level of antibody synthesis.
[0180] These results demonstrate that gene rearrangement can be
used to generate viruses with novel, beneficial phenotypes. This
approach provides the ability to alter the phenotype in a stepwise
manner to achieve a desired level of attenuation or to alter the
expression of a particular gene. It allows the level of attenuation
and immunogenicity to be modulated independently and
systematically, exactly what is needed to generate and manipulate
live attenuated vaccine candidates. This approach should be
applicable to other members of the Mononegavirales, all of which
have a common mechanism for the control of gene expression via
obligatorily sequential transcription originating from a single 3'
promoter. Furthermore, viruses of the Mononegavirales have not been
found to undergo homologous recombination, therefore changes made
to the gene order should be irreversible by natural processes.
Several foreign genes have been expressed from VSV and in one study
mice were protected against the corresponding pathogen. These
properties of VSV make it an excellent candidate in which to
generate future vaccines directed against VSV itself or against
other pathogens. Studies designed to evaluate the pathogenesis and
immunogenicity of the G1N2, G3N4, and G1N4 viruses in a natural
host are underway.
[0181] The following references were cited herein:
[0182] Ball, L. A. 1992. J. Virol. 66, 2335-2345.
[0183] Ball, L. and C. White. 1976. Proc. Natl. Acad. Sci. USA 73,
442-446.
[0184] Barr, J. N. et al., 1997. J. Virol. 71, 1797-1801.
[0185] Domingo, E. et al., 1996. The FASEB Journal 10, 859-864.
[0186] Ferran, M. and J. M. Lucas-Lenard. 1997. J. Virol. 71,
371-377.
[0187] Fuerst, T. et al., 1986. Proc. Natl. Acad. Sci. USA 83,
8122-8126.
[0188] Iverson, L. and J. Rose. 1981. Cell 23, 477-484.
[0189] Lyles, D. S. et al., 1996. Virology 217, 76-87.
[0190] Pattnaik, A. K. and G. W. Wertz. 1990. J. Virol. 64,
2948-2957.
[0191] Pattnaik, A. K. et al., 1992. Cell 69, 1011-1020.
[0192] Patton, J. P. et al., 1984. J. Virol. 49, 303-309.
[0193] Peluso, R. W., and S. A. Moyer. 1988. Virology 162,
369-376.
[0194] Pringle, C. R. et al., 1981. J. Virol. 39, 377-389.
[0195] Pringle, C. R., and A. J. Easton, 1997. Semin. Virol. 8,
49-57.
[0196] Reed, E. J. and H. Muench. 1938. Am. J. Hyg. 27,
493-497.
[0197] Sabin, A. and P. Olitsky. 1938. J. Exp. Med. 67,
201-227.
[0198] Schnell, M. J. et al., 1996. J. Virol. 70, 2318-2323.
[0199] Shechmeister, et al., 1967. Arch. Ges. Virusforsch. 21,
127-132.
[0200] Villareal, L. P. et al., 1976. Biochem. 15, 1663.
[0201] Wagner, R. 1974. Infection and Immunity 10, 309-315.
[0202] Wagner, R. 1996. In Fields Virology (Fields, B. N. and D. M.
Knipe eds.) 3.sup.rd edition; Lippincott-Raven Press.
[0203] Whelan, S. P. J. et al., 1995. Proc. Natl. Acad. Sci. USA
92, 8388-8392.
[0204] Wimmer, E. et al., 1993. Ann. Rev. Genetics. 27,
353-436.
[0205] Youngner, J. S. and G. Wertz. 1968. J. Virol. 2,
1360-1361.
[0206] Any patents or publications mentioned in this specification
are indicative of the levels of those skilled in the art to which
the invention pertains. These patents and publications are herein
incorporated by reference to the same extent as if each individual
publication was specifically and individually indicated to be
incorporated by reference.
[0207] One skilled in the art will readily appreciate that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those inherent
therein. The present examples along with the methods, procedures,
treatments, molecules, and/or specific compounds described herein
are presently representative of preferred embodiments, are
exemplary, and are not intended as limitations on the scope of the
invention. Changes therein and other uses will occur to those
skilled in the art which are encompassed within the spirit of the
invention as defined by the scope of the claims.
Sequence CWU 1
1
12 1 38 DNA Artificial sequence PCR primer used to construct
individual cDNA clones of VSV genes 1 acctgcacta acagaaaaaa
actaacagag atgcaggt 38 2 23 DNA Artificial sequence Starting
plasmid to reconstruct the rearranged full-length clones of N gene,
containing a bacteriophage T7 promoter followed by the VSV leader
sequence 2 gaaactttaa cagtaatgca ggt 23 3 22 DNA Artificial
sequence starting plasmid to reconstruct the rearranged full-length
clones of L gene, containing the first 420 nucleotides of the L
gene 3 acctgcacta acagcaatca tg 22 4 14 DNA Artificial sequence 1,
2, 3, 4, 5, 6, 7, 8 Nucleotide sequence of the BspM1 site
positioned at the ends of the P, M and S genes, the 3' end of N
gene and the 5' end of the L gene in VSV; n = a or g or c or t 4
nnnnnnnngc aggt 14 5 11 DNA Artificial sequence 1, 2, 3, 4, 5
Nucleotide sequence of the Bsa site positioned at the ends of the
P, M and S genes, the 3' end of N gene and the 5' end of the L gene
in VSV; n = a or g or c or t 5 nnnnngagac c 11 6 30 DNA Artificial
sequence primer_bind 24, 25, 28, 29, 30 Upstream primer; n = a or g
or c or t 6 gggaagctta cctgcactaa cagnnatnnn 30 7 25 DNA Artificial
sequence 19, 20, 23, 24, 25 Nucleotide sequence of the VSV
intercistronic junction; n = a or g or c or t 7 tatgaaaaaa
actaacagnn atnnn 25 8 34 DNA Artificial sequence primer_bind 16, 17
Downstream primer; n = a or g or c or t 8 ctttttttga ttgtcnntac
gtccagggcc cacg 34 9 34 DNA Artificial sequence primer_bind P gene
downstream primer sequence 9 gcacccggga cctgcatatc tgttactttt tttc
34 10 34 DNA Artificial sequence primer_bind M gene downstream
primer sequence 10 gcacccggga cctgcatctc tgttagtttt tttc 34 11 34
DNA Artificial sequence primer_bind G gene downstream primer
sequence 11 gcacccggga cctgcattgc tgttagtttt tttc 34 12 34 DNA
Artificial sequence primer_bind Downstream consensus sequence for
P, M, and G primers 12 gcacccggga cctgcatatc tgttagtttt tttc 34
* * * * *