U.S. patent application number 10/844403 was filed with the patent office on 2004-11-25 for sorbitol dehydrogenase, gene encoding the same and use thereof.
This patent application is currently assigned to Fujisawa Pharmaceutical Co. Ltd.. Invention is credited to Ichikawa, Chiyo, Matsuura, Mitsutaka, Noguchi, Yuji, Saito, Yoshimasa, Shibata, Takashi, Takata, Yoko, Yamashita, Michio.
Application Number | 20040235105 10/844403 |
Document ID | / |
Family ID | 26413947 |
Filed Date | 2004-11-25 |
United States Patent
Application |
20040235105 |
Kind Code |
A1 |
Shibata, Takashi ; et
al. |
November 25, 2004 |
Sorbitol dehydrogenase, gene encoding the same and use thereof
Abstract
The present invention provide a gene encoding D-sorbitol
dehydrogenase (SLDH), a method for producing SLDH by culture of a
host cell transformed with a vector expressing this gene and a
method for producing L-sorbose or 2-keto-L-gulonic acid (2KLGA)
using the culture. 2KLGA is an important intermediate for the
production of L-ascorbic acid. Therefore, the present invention
also provides a method for producing L-ascorbic acid from the 2KLGA
obtained by the above-mentioned method.
Inventors: |
Shibata, Takashi;
(Tsukuba-shi, JP) ; Ichikawa, Chiyo; (Nagoya-shi,
JP) ; Matsuura, Mitsutaka; (Ichinomiya-shi, JP)
; Noguchi, Yuji; (Ama-gun, JP) ; Saito,
Yoshimasa; (Mitaka-shi, JP) ; Yamashita, Michio;
(Tsukuba-shi, JP) ; Takata, Yoko; (Osaka-shi,
JP) |
Correspondence
Address: |
OBLON, SPIVAK, MCCLELLAND, MAIER & NEUSTADT, P.C.
1940 DUKE STREET
ALEXANDRIA
VA
22314
US
|
Assignee: |
Fujisawa Pharmaceutical Co.
Ltd.
Osaka-shi
JP
|
Family ID: |
26413947 |
Appl. No.: |
10/844403 |
Filed: |
May 13, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10844403 |
May 13, 2004 |
|
|
|
09926163 |
Dec 21, 2001 |
|
|
|
09926163 |
Dec 21, 2001 |
|
|
|
PCT/JP00/01608 |
Mar 16, 2000 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/105; 435/189; 435/252.3; 435/320.1; 536/23.2 |
Current CPC
Class: |
C12N 9/0006 20130101;
C12P 7/60 20130101; C12P 19/02 20130101 |
Class at
Publication: |
435/069.1 ;
435/189; 435/252.3; 435/105; 435/320.1; 536/023.2 |
International
Class: |
C07H 021/04; C12P
019/02; C12N 009/02; C12N 009/04 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 17, 1999 |
JP |
11/72810 |
Aug 6, 1999 |
JP |
11/224679 |
Claims
1-22. (Cancelled)
23. A host cell comprising one or more expression vector(s)
comprising separately or collectively DNA encoding sorbitol
dehydrogenase (SLDH), a DNA encoding sorbose dehydrogenase (SLDH),
a DNA encoding sorbosone dehydrogenase (SNDH).
24. The host cell of claim 23, which contains an expression vector
which comprises a DNA encoding SLDH, and an expression vector
comprising a DNA encoding SDH and SNDH.
25. The host cell of claim 23, which contains an expression vector
comprising a DNA encoding SLDH, SDH and SNDH.
26. The host cell of claim 23, wherein said host cell is
Escherichia.
27. The host cell of claim 23, wherein said host cell is
Pseudomonas.
28. The host cell of claim 23, wherein said host cell is
Pseudogluconobacter.
29. The host cell of claim 23, wherein said host cell is
Gluconobacter.
30. The host cell of claim 23, wherein said host cell is
Acetobacter.
31. A method for producing 2-keto-L-gluconic acid, comprising: (a)
culturing in a suitable medium a transformant comprising at least
one expression vector comprising separately or collectively all of
a DNA encoding sorbitol dehydrogenase (SLDH), a DNA encoding
sorbose dehydrogenase (SLDH), a DNA encoding sorbosone
dehydrogenase (SNDH); and (b) bringing D-sorbitol into contact with
the obtained culture or a treated product thereof.
32. The method of claim 31, wherein said transformant comprises an
expression vector which comprises a DNA encoding SLDH, and an
expression vector comprising a DNA encoding SDH and SNDH.
33. The method of claim 31, wherein said transformant comprises an
expression vector comprising a DNA encoding SLDH, SDH and SNDH.
34. The method of claim 31, wherein said transformant is derived
from a host cell belonging to Pseudomonas.
35. The method of claim 31, wherein said SLDH is derived from
Gluconobacter.
36. The method of claim 31, wherein said SLDH is dependent on
NAD(P).sup.+.
37. The method of claim 31, wherein said host cell is
Escherichia.
38. The method of claim 31, wherein said host cell is
Pseudomonas.
39. The method of claim 31, wherein said host cell is
Pseudogluconobacter.
40. The method of claim 31, wherein said host cell is
Gluconobacter.
41. The method of claim 31, wherein said host cell is
Acetobacter.
42. The method of claim 31, which is carried out in the presence of
glycerol.
Description
TECHNICAL FIELD
[0001] This invention relates to a novel sorbitol dehydrogenase (in
the present invention, sorbitol dehydrogenase means an enzyme
capable of catalyzing a reaction for converting D-sorbitol to
L-sorbose by oxidation; hereinafter to be referred to as SLDH), a
gene encoding the same, a method for producing L-sorbose and
2-keto-L-gulonic acid (hereinafter to be referred to as 2KLGA) by
gene manipulation using said gene, and an expression system
involved in the production thereof. The present invention further
relates to a method for producing L-ascorbic acid or a salt thereof
utilizing the 2KLGA obtained by the above-mentioned method.
BACKGROUND ART
[0002] L-sorbose is an important intermediate for the synthesis of
L-ascorbic acid (vitamin C) by the Reichstein method (see FIG. 1).
When D-sorbitol is chemically oxidized, approximately a half of the
product becomes D-sorbose, whereas when D-sorbitol is brought into
contact with a microorganism having an SLDH activity, only an
L-enantiomer is obtained in a yield of about 95%. Therefore, a
fermentation method has been conventionally used for converting
D-sorbitol to L-sorbose.
[0003] On the other hand, 2KLGA is industrially synthesized by
chemically oxidizing L-sorbose. There are known microorganisms that
convert L-sorbose into 2KLGA by a two-step enzymatic oxidation
reaction by L-sorbose dehydrogenase (SDH) and L-sorbosone
dehydrogenase (SNDH), but the production amount of 2KLGA is low by
these methods.
[0004] As a method by which to produce 2KLGA more efficiently than
before by a fermentation method, there is mentioned a method
comprising isolating an SLDH gene, introducing the gene into a
microorganism having an SDH or SNDH activity to give a recombinant
microorganism capable of synthesizing 2KLGA from D-sorbitol, and
bringing the microorganism into contact with D-sorbitol.
[0005] Several types of SLDHs have been isolated [Agric. Biol.
Chem., 46(1), 135-141 (1982); Biokhimiia, 43(6), 1067-1078 (1978);
J. Biol. Chem., 224, 323 (1957); J. Biol. Chem., 226, 301 (1957);
J. Bacteriol., 71, 737 (1956)]. The present inventors have already
isolated, from a strain belonging to Gluconobacter oxydans, a gene
encoding SLDH which is of a membrane-bound type, consists of two
large and small subunits and which binds with cytochrome c-like
polypeptide and acts (international patent publication No.
WO99/20763). However, there is no report on the cloning of a
different type of SLDH gene.
[0006] It is therefore an object of the present invention to
provide a novel SLDH gene useful for the fermentative production of
2KLGA, and to provide a host microorganism transformed with said
gene, particularly a transformant obtained by introducing said gene
into a host already having SDH and SNDH activity, or a transformant
obtained by introducing said gene together with SDH gene and SNDH
gene. Another object of the present invention is to provide a
method for producing L-sorbose or 2KLGA from D-sorbitol using said
microorganism, and to provide a method for producing L-ascorbic
acid from 2KLGA obtained by this method. It is yet another object
of the present invention to provide a method for producing a
recombinant SLDH by culture of a host microorganism transformed
with said SLDH gene and a method for producing L-sorbose by an
enzyme method using said SLDH.
DISCLOSURE OF THE INVENTION
[0007] The present inventors have conducted intensive studies in an
attempt to solve the above-mentioned problems and succeeded in
cloning a DNA containing a coding region of SLDH from a chromosomal
DNA library of a strain belonging to the genus Gluconobacter having
said enzyme activity. As a result of the sequencing, the DNA was
confirmed to contain a novel SLDH gene completely different from
the SLDH gene previously isolated by the present inventors.
Moreover, the present inventors transformed Pseudomonas with an
expression vector containing the DNA and succeeded in purifying a
recombinant SLDH from the culture of said recombinant Pseudomonas.
They have also transformed Pseudomonas transformed with an
expression vector containing said DNA, with an expression vector
containing an SDH gene and an SNDH gene and efficiently converting
D-sorbitol to 2KLGA using the culture of this transformant, which
resulted in the completion of the present invention.
[0008] Accordingly, the present invention provides the
following.
[0009] (1) An SLDH having the following physicochemical
properties:
[0010] (a) action: catalyzes the reaction converting D-sorbitol to
L-sorbose
[0011] (b) molecular weight: about 54 kDa
[0012] (c) coenzyme: NAD(P).sup.+ dependent
[0013] (d) substrate specificity: specifically oxidizes sorbitol,
mannitol and arabitol, but does not act on xylitol, ribitol,
inositol and glycerol.
[0014] (2) The SLDH of the above-mentioned (1), which is derived
from the strain Gluconobacter oxydans G624.
[0015] (3) An SLDH which is originated from the same gene as is the
SLDH of the above-mentioned (2) in its molecular evolution.
[0016] (4) The SLDH of the above-mentioned (3), which is derived
from a bacteria belonging to the genus Gluconobacter.
[0017] (5) An SLDH which is the following protein (a) or (b):
[0018] (a) a protein consisting of an amino acid sequence depicted
in Sequence Listing SEQ ID NO:1
[0019] (b) a protein consisting of the same amino acid sequence as
(a) above, except that one to several amino acids are deleted,
substituted, inserted, added or modified, which catalyzes a
reaction converting D-sorbitol to L-sorbose.
[0020] (6) A DNA encoding the SLDH of any of the above-mentioned
(1) to (5).
[0021] (7) The DNA of the above-mentioned (6), which is (a) or (b)
of the following:
[0022] (a) a DNA having a base sequence of base numbers 537-1991 of
the base sequence depicted in Sequence Listing SEQ ID NO:2
[0023] (b) a DNA capable of hybridizing to the base sequence of the
above-mentioned (a) under stringent conditions.
[0024] (8) The DNA of the above-mentioned (6) or (7), which is
derived from bacteria belonging to the genus Gluconobacter.
[0025] (9) A gene encoding a protein having an SLDH activity, which
is a DNA capable of hybridizing a DNA having a base sequence of
base numbers 537-1991 of the base sequence depicted in Sequence
Listing SEQ ID NO:2 and a partial DNA thereof.
[0026] (10) A protein derived from the genus Gluconobacter, which
is encoded by the gene of the above-mentioned (9) and which has an
SLDH activity.
[0027] (11) A promoter gene comprising the DNA of the following (a)
or (b):
[0028] (a) a DNA having a base sequence of base numbers 1-536 of
the base sequence depicted in Sequence Listing SEQ ID NO:2
[0029] (b) a DNA having a base sequence of the above-mentioned (a)
wherein one to several bases is(are) deleted, substituted,
inserted, added or modified, which DNA shows a promoter activity at
least in one microorganism.
[0030] (12) A recombinant vector comprising a DNA of any of the
above-mentioned (6) to (9).
[0031] (13) An expression vector comprising a DNA of any of the
above-mentioned (6) to (9).
[0032] (14) The expression vector of the above-mentioned (13),
further comprising a DNA encoding an SDH and/or a DNA encoding an
SNDH.
[0033] (15) A transformant obtained by transforming a host cell
with an expression vector of the above-mentioned (13) or (14).
[0034] (16) The transformant of the above-mentioned (15), which
belongs to a genus selected from the group consisting of
Escherichia coli, the genus Pseudomonas, the genus Gluconobacter,
the genus Acetobacter and the genus Pseudogluconobacter.
[0035] (17) The transformant of the above-mentioned (15) or (16),
which is capable of converting D-sorbitol to 2-KLGA.
[0036] (18) A method for producing a protein having an SLDH
activity, which method comprises culturing a host cell transformed
with an expression vector of the above-mentioned (13) in a medium
and harvesting the SLDH of any of the above-mentioned (1) to (5) or
the protein of (10) from the obtained culture.
[0037] (19) A method for producing an L-sorbose, which method
comprises culturing a host cell transformed with an expression
vector of the above-mentioned (13) in a medium and bringing
D-sorbitol into contact with the obtained culture or a treated
product thereof.
[0038] (20) A method for producing 2-KLGA, which method comprises
culturing a host cell transformed with an expression vector
containing a DNA encoding an SDH and a DNA encoding an SNDH in a
medium and bringing the L-sorbose obtained according to the method
of the above-mentioned (19) into contact with the obtained culture
or a treated product thereof.
[0039] (21) A method for producing 2-KLGA, which method comprises
culturing the transformant of the above-mentioned (17) in a medium
and bringing D-sorbitol into contact with the obtained culture or a
treated product thereof.
[0040] (22) A method for producing L-ascorbic acid or an alkali
metal salt thereof or an alkaline earth metal salt thereof, which
method comprises converting 2-KLGA obtained by the method of the
above-mentioned (20) or (21) to L-ascorbic acid or an alkali metal
salt thereof or an alkaline earth metal salt thereof.
[0041] The recombinant cell that expresses the SLDH gene of the
present invention can be a useful means for the fermentative
production of L-sorbose and 2KLGA. Therefore, the present invention
is extremely useful for facilitated and large-scale production of
L-ascorbic acid.
BRIEF DESCRIPTION OF THE DRAWINGS
[0042] FIG. 1 shows a reaction scheme of the synthesis of
L-ascorbic acid, wherein R is alkyl group.
[0043] FIG. 2 shows a restriction enzyme map of DNA insert portion
of plasmids pUCP19-B7SX2 and pUCP19-HC, and a sequencing strategy
of the DNA insert portion of pUCP19-HC.
[0044] FIG. 3 shows a gene map of plasmid pUCP19-SLDH.
[0045] FIG. 4 shows a gene map of expression vector
pSDH-tufB1-Eco-d9U.
[0046] FIG. 5 shows a gene map of expression vector
pBBR(Km)-SDH.cndot. SNDH.
[0047] FIG. 6 shows a gene map of expression vector
pBBR(Tc)-SDH.cndot. SNDH.
[0048] FIG. 7 shows a gene map of expression vector
pUCP19-SDH.cndot. SNDH.
BEST MODE FOR CARRYING OUT THE INVENTION
[0049] The SLDH of the present invention is a protein having a
molecular weight of about 54 kDa, which catalyzes a reaction to
convert D-sorbitol to L-sorbose, and characteristically requires
NADP.sup.+ or NAD.sup.+ as a coenzyme. This enzyme can specifically
oxidize mannitol and arabitol besides sorbitol, but does not act on
xylitol, ribitol, inositol or glycerol.
[0050] The SLDH of the present invention is not particularly
limited as regards the derivation as long as it shows the
above-mentioned characteristics. It may be derived from a naturally
occurring organism, a spontaneous or artificial mutant, or a
transformant which is obtained by introducing a heterologous (i.e.
foreign) SLDH gene. Preferably, SLDH derived from acetic acid
bacteria, particularly bacteria. belonging to the genus
Gluconobacter, more preferably Gluconobacter oxydans, particularly
the strain Gluconobacter oxydans G624 (FERM BP-4415; International
Patent Publication No. WO95/23220) are exemplified. In another
preferable mode, the SLDH of the present invention is an SLDH
derived from the same gene as is the SLDH derived from the strain
G. oxydans G624 in its molecular evolution. As used herein, by the
"derived from the same gene . . . in its molecular evolution" is
meant an SLDH reasonably concluded to have evolved from the same
gene as has an SLDH derived from strain G. oxydans G624 in its
molecular evolution, as a result of the analyses of DNA sequence,
physiological role and the like, and their DNA sequences show high
homology. These SLDHs preferably have not less than 60%, most
preferably not less than 80%, homology in the DNA sequence with an
SLDH derived from the strain G. oxydans G624. These genes can be
cloned based on the DNA sequence depicted in Sequence Listing SEQ
ID NO:2 and using a suitable primer according to the PCR method or
using a suitable probe according to the hybridization method, as
detailed later.
[0051] In a more preferable mode, the SLDH of the present invention
is a protein having an amino acid sequence depicted in Sequence
Listing SEQ ID NO:1, or a protein having an amino acid sequence
having the amino acid sequence comprising one to several amino
acids deleted, substituted, inserted, added or modified, as long as
the SLDH activity is not impaired.
[0052] The SLDH of the present invention can be obtained by
appropriately using (1) a method comprising isolating and purifying
it from a culture of a cell or tissue as a starting material that
produces the enzyme, (2) a method comprising chemical synthesis,
(3) a method comprising purifying it from a cell manipulated by
gene recombinant technique to express SLDH and the like.
[0053] The isolation and purification of SLDH from a naturally
occurring SLDH producing cell includes, for example, the following
steps. The cell is cultured in a suitable liquid medium, and a
fraction having an SLDH activity is separated and recovered from
the obtained culture. For example, when the enzyme is localized in
cytosol (the SLDH of the present invention being NAD(P).sup.+
dependent, localization in cytosol is expected), the culture is
centrifuged and/or filtrated to recover the cell, and the cell is
ruptured by ultrasonication, lysozyme treatment, osmotic pressure
shock and the like and centrifuged at about 10,000-40,000 rpm to
recover a supernatant (soluble fraction). The objective SLDH can be
purified from the obtained soluble fraction by appropriately
combining separation techniques conventionally used for separation
and purification of enzyme proteins. Such separation techniques
include, for example, methods utilizing difference in solubility
such as salting out, solvent precipitation method and the like,
methods utilizing difference in molecular weight such as dialysis,
ultrafiltration, gel filtration, non-denatured polyacrylamide gel
electrophoresis (PAGE), SDS-PAGE and the like, methods utilizing
charge such as ion exchange chromatography, hydroxyl apatite
chromatography and the like, methods utilizing specific affinity
such as affinity chromatography and the like, methods utilizing
hydrophobicity such as reverse-phase high performance liquid
chromatography and the like, and methods utilizing difference in
isoelectric point such as isoelectric focusing and the like.
[0054] Production of the SLDH of the present invention by chemical
synthesis includes the steps of, for example, synthesizing, based
on the amino acid sequence depicted in Sequence Listing SEQ ID
NO:1, the entirety or a part of each sequence using peptide
synthesizer, and renaturating the obtained polypeptide under
suitable renaturation conditions.
[0055] The SLDH derived from G. oxydans G624, which is one mode of
the present invention, is an extremely unstable enzyme in
non-physiological conditions, and may be deactivated during
purification by the above-mentioned method. Such enzyme can be
quickly purified by affinity chromatography utilizing an
added/modified sequence having affinity for a specific substance,
according to the histidine tag method, GST method and the like.
Therefore, a particularly preferable method for obtaining the SLDH
of the present invention includes the steps of, as detailed in the
following, cloning a DNA encoding the enzyme from the DNA of a cell
having this enzyme, and adding, to this DNA by gene manipulation, a
nucleotide sequence encoding an amino acid sequence capable of
adsorbing to a metal ion chelate.
[0056] An enzyme gene can be generally cloned by the following
method. A desired enzyme is purified completely or partially from a
cell or tissue that produces the enzyme by the above-mentioned
method, and the N terminal amino acid sequence is determined by the
Edman method. The enzyme is partially digested by a
sequence-specific protease and the amino acid sequence of the
obtained oligopeptide is also determined by the Edman method
oligonucleotides having base sequences corresponding to the amino
acid sequences thus determined are synthesized, and using these as
primers or probes, a DNA encoding this enzyme is cloned from RNA or
DNA prepared from a cell or tissue capable of producing the enzyme,
by the PCR method or colony (or plaque) hybridization method.
[0057] Alternatively, an antibody against the enzyme is prepared
using the entirety or a part of a completely or partially purified
enzyme as an antigen by a conventional method, and a DNA encoding
the enzyme can be cloned from a cDNA or genomic DNA library
prepared from a cell or tissue capable of producing the enzyme, by
immunoscreening.
[0058] However, in the case of an enzyme that is unstable and whose
purification is difficult, such as the above-mentioned SLDH derived
from G. oxydans G624, the gene of the enzyme can be screened using
its enzyme activity as a marker, as a fragment containing its
promoter sequence from the genomic DNA library. Inasmuch as SLDH
converts D-sorbitol to L-sorbose, a clone having an SLDH activity
can be selected by detecting the generated L-sorbose. Note that the
application of this method often accompanies technical
difficulty.
[0059] To be specific, a chromosomal DNA is isolated from a cell or
tissue having an SLDH activity by a conventional method, and
digested by a suitable restriction enzyme, preferably partially
digested by a restriction enzyme having many restriction sites in a
chromosomal DNA, and the obtained fragment is inserted in a
suitable cloning vector. As the cloning vector, exemplified are
plasmid vector, phage vector and the like. Because of the
capability of accommodating a large DNA insert and recovering as a
colony, a cosmid vector and a charomid vector are preferable. When
a phage vector, a cosmid vector and the like are used, in vitro
packaging is further applied to obtain a genomic DNA library.
[0060] When a cosmid library is used, a suitable indicating
bacteria, preferably Escherichia coli competent cell having high
transformation capability, after infection with a packaging
solution obtained as above, is plated on a solid medium and
cultured. The resulting respective colonies are individually
inoculated to a liquid medium containing D-sorbitol and cultured.
After the completion of the culture, a culture supernatant is
recovered and candidate clones having an SLDH activity are selected
using, for example, a color identification reaction with
ketohexose, such as a resorcin-hydrochloric acid reaction (Cohen,
J. Biol. Chem., 201, 71, 1953), a resorcin-ferric salt-hydrochloric
acid reaction (Kulka, Biochem. J., 63, 542, 1956) and the like.
[0061] The presence of SLDH activity (conversion of D-sorbitol to
L-sorbose) in the obtained clone is confirmed by the detection of
sorbose in the culture supernatant by, for example, HPLC and the
like.
[0062] Because the DNA insert of cosmid clone is considerably large
(35-45 kb), a part of a non-SLDH gene region of the insert DNA is
desirably removed for downsizing for facilitated subcloning to
plasmid. For downsizing of the DNA insert, for example, subcloning
to a charomid vector and the like is employed. Since a charomid
vector has a spacer DNA of various lengths, DNA having various
lengths smaller than a cosmid vector can be cloned. In the present
invention, for example, a charomid vector capable of accommodating
an about 10-20 kb DNA insert is preferably used. The charomid clone
having an SLDH activity can be selected according to the method
mentioned above.
[0063] The subcloning to a plasmid vector can be done by, for
example, applying plural charomid clones obtained as mentioned
above to restriction enzyme mapping, downsizing a DNA insert using
a restriction enzyme found to have no restriction site in the SLDH
gene, and ligating with a plasmid vector that underwent a
restriction enzyme treatment.
[0064] Apart from the above-mentioned strategy, moreover, a DNA
encoding the SLDH of the present invention can be directly cloned
using the PCR method. That is, PCR is conducted according to a
conventional method, using a genomic DNA or cDNA (or mRNA) derived
from a cell or tissue having the enzyme activity as a template, and
using a pair of oligonucleotides, where an amplification fragment
suitably covers the coding region of SLDH, as a primer to amplify a
DNA fragment containing the coding region of SLDH. This method is
particularly useful for cloning of an SLDH gene having the same
origin in the molecular evolution with an SLDH having a known
sequence. For example, when an SLDH gene derived from a bacteria,
which is speculated to have the same origin in the molecular
evolution with an SLDH derived from the strain G. oxydans G624, is
to be cloned, sense and antisense primers capable of amplifying a
DNA fragment having high homology with a DNA fragment containing a
base sequence of base number 537-1991 from the sequence is
constructed based on the DNA sequence depicted in Sequence Listing
SEQ ID NO:2 and the PCR method is performed. When the DNA sequence
of SLDH having high homology with the objective SLDH is unknown,
for example, PCR is performed using some sequences conserved
relatively well in the 5' upstream region as sense primers, and
some complementary strand sequences conserved relatively well in
the 3' downstream region as antisense primers to clone the SLDH
gene. When the upstream and downstream sequences of SLDH are
unknown, the annealing temperature needs to be set lower, so that a
template DNA and a primer to be used containing some mismatches can
still be bound. Therefore, the PCR product may be a mixture of a
fragment containing the objective SLDH gene and a non-specific
amplification fragment. In this case, the obtained amplification
fragment is cloned to a suitable cloning vector (for example,
plasmid vector for TA cloning and the like). When the objective
amplification fragment does not contain a promoter region, the
obtained amplification fragment is cloned to an expression vector,
with which a competent cell, such as Escherichia coli, is
transformed, and the transformant having an SLDH activity is
screened by the aforementioned method.
[0065] As a different strategy for the cloning of an SLDH gene
having the same origin in the molecular evolution with an SLDH
having a known sequence, direct cloning by hybridization method
such as Southern method and the like may be employed, wherein a
genomic DNA or cDNA (or mRNA) derived from a cell or tissue having
an SLDH activity is used as a template and the entirety or a part
of a known DNA sequence is used as a probe. The conditions of the
hybridization may be an appropriately altered stringency depending
on the origin of the DNA. For example, the conditions may be
changed based on the degree of closeness in the relation of the
microorganism to be cloned and the like, such as those under which,
of the base sequence, only a sequence having about not less than
60% homology forms a hybrid, only a sequence having about not less
than 80% homology forms a hybrid, and the like.
[0066] The base sequence of the DNA insert obtained in the
above-mentioned manner can be identified by a known sequencing
technique, such as Maxam-Gilbert method, dideoxy termination method
and the like.
[0067] A DNA encoding the SLDH of the present invention preferably
encodes an amino acid sequence depicted in Sequence Listing SEQ ID
NO:1, or an amino acid sequence wherein, in the above-mentioned
amino acid sequence, 1 to several amino acids are deleted,
substituted, inserted or added (provided that a protein consisting
of the mutated amino acid sequence can catalyze the reaction to
convert D-sorbitol to L-sorbose). More preferably, a DNA encoding
the SLDH of the present invention is a DNA substantially consisting
of a base sequence having a base number 537-1991 of the base
sequence depicted in Sequence Listing SEQ ID NO:2. As used herein,
by the "DNA substantially consisting of" is meant a DNA consisting
of this specific base sequence and a DNA consisting of a base
sequence capable of hybridizing to the DNA consisting of this
specific base sequence under stringent conditions, and encoding a
protein having similar physicochemical properties as the protein
encoded by the DNA consisting of this specific base sequence. The
"stringent conditions" here mean those under which a DNA having
about not less than 60% homology of base sequence can hybridize.
The stringency can be controlled by appropriately changing the
temperature, salt concentration and the like of hybridization
reaction and washing.
[0068] Another DNA of the present invention also encompasses a gene
consisting of a base sequence capable of hybridizing to a base
sequence having a base number 537-1991 from the base sequence
depicted in Sequence Listing SEQ ID NO:2 and a partial DNA thereof,
and encoding a protein having an SLDH activity. Therefore, a
protein having an SLDH activity, which is encoded by this gene,
particularly a protein derived from the genus Gluconobacter, is
also within the scope of the present invention.
[0069] The DNA of the present invention may be a DNA obtained from
a genomic DNA as mentioned above, or a cDNA obtained from mRNA, or
DNA chemically synthesized based on a base sequence having a base
number 537-1991 from the base sequence depicted in Sequence Listing
SEQ ID NO:2.
[0070] The DNA encoding SLDH, which is obtained from a genomic DNA
with the SLDH activity as an index as mentioned above, contains a
promoter gene sequence in the 5' upstream region. This promoter
gene preferably has a base sequence having a base number 1-536 from
the base sequence depicted in Sequence Listing SEQ ID NO:2, or said
base sequence wherein one to several amino acids are deleted,
substituted, inserted, added or modified, which is a DNA having a
promoter activity in at least one microorganism. As the
"microorganism" here, there are preferably exemplified prokaryotes
such as bacteria (e.g., Escherichia coli, Bacillus subtilis,
Pseudomonas, Gluconobacter, Pseudogluconobacter, Acetobacter and
the like) and actinomyces, and certain eucaryotes such as yeast and
the like.
[0071] The present invention provides a recombinant vector
containing a DNA encoding the SLDH of the present invention. The
recombinant vector of the present invention is not particularly
limited as long as it can replicate/maintain or autonomously
proliferate in various host cells of procaryotic and/or eucaryotic
cells, and encompasses a plasmid vector, a phage vector and the
like. The recombinant vector can be conveniently prepared by
inserting a DNA encoding SLDH into a cloning vector or expression
vector available in the pertinent field, by the use of a suitable
restriction enzyme site.
[0072] Particularly, the recombinant vector of the present
invention is an expression vector wherein a DNA encoding SLDH is
disposed under the control of a promoter functional in a certain
host cell. Usable vector is not particularly restricted as long as
it contains a promoter region functional in various host cells such
as procaryotic and/or eucaryotic cells and is capable of
controlling the transcription of a gene disposed in the downstream
thereof, and a transcription termination signal of said gene,
namely, a terminator region, wherein said promoter region and the
terminator region are ligated via a sequence containing at least
one restriction enzyme recognition site, preferably a unique
restriction site. It is preferable that it further contain a
selection marker gene for the selection of a transformant. Where
desired, this expression vector may contain an initiation codon and
a stop codon in the downstream of the promoter region and the
upstream of the terminator region, respectively.
[0073] When bacteria is used as a host cell, an expression vector
generally needs to contain, in addition to the above-mentioned
promoter region and terminator region, a replicable unit capable of
autonomous replication in a host cell. The promoter region includes
a promoter, an operator and a Shine-Dalgarno (SD) sequence. For
example, when the host is Escherichia coli, trp promoter, lac
promoter, recA promoter, lpp promoter, tac promoter and the like
are exemplified as the promoter region, and when the host is
Bacillus subtilis, the promoter region includes SPO1 promoter, SPO2
promoter, penP promoter and the like. As the terminator region, a
naturally occurring or synthetic terminator, which is typically
used, can be used. As the selection marker gene, resistant genes
against various drugs, such as tetracyclin, ampicillin, kanamycin
and the like, can be used. As the initiation codon, ATG is
generally used. In some cases, GTG can be also used. As the stop
codon, conventional TGA, TAA and TAG can be used.
[0074] When a DNA encoding the SLDH of the present invention is
prepared from a genomic DNA derived from a cell or tissue that
produces the enzyme, and obtained in a form containing inherent
promoter and terminator regions, and the expression vector of the
present invention can be prepared by inserting the DNA into a
suitable site of a known cloning vector that can replicate/maintain
or autonomously proliferate in a host cell to be transformed. The
usable cloning vector in the case where the host is bacteria is
exemplified by pBR vector, pUC vector and the like derived from
Escherichia coli, pUB110, pTP5 and pC194, derived from Bacillus
subtilis, and the like.
[0075] When an expression vector containing a DNA encoding the SLDH
of the present invention is used for the production of a
recombinant SLDH, particularly when the SLDH is extremely unstable
and typical purification method may cause deactivation of the
enzyme on the way of purification, the use of an expression vector
containing a modified SLDH coding sequence, as in the following, is
particularly preferable. The modified SLDH coding sequence
comprises, a sequence wherein a base sequence encoding a specific
amino acid sequence capable of accelerating the purification of
SLDH is added to the terminus of the SLDH coding sequence to allow
expression of SLDH in which the specific amino acid sequence has
been added to the terminus of the original SLDH amino acid
sequence. The specific amino acid sequence capable of accelerating
the purification of SLDH is exemplified by amino acid sequence
capable of adsorbing to a metal ion chelate, preferably a sequence
consisting of basic amino acids such as histidine, lysine, arginine
and the like, more preferably a sequence consisting of histidine.
Such sequence can be added to the terminus of amino or carboxyl of
SLDH, with preference given to addition to the carboxyl terminus.
Such modified SLDH coding sequence can be constructed by
synthesizing an oligonucleotide wherein a base sequence encoding
the amino acid sequence to be added is added to a base sequence
consistent with a terminus sequence of the inherent SLDH coding
sequence, and, using this as one of the primers and SLDH DNA as a
template, performing PCR. The resulting recombinant SLDH can be
quickly isolated and purified using a carrier on which a metal ion
chelate capable of adsorbing the added amino acid sequence has been
immobilized, as detailed in the following.
[0076] When an expression vector containing a DNA encoding the SLDH
of the present invention is used for the production of 2KLGA, an
expression vector containing, in addition to the DNA, a DNA
encoding SDH and/or SNDH in a form permitting expression in the
host cell may be used. The DNA encoding SLDH, a DNA encoding SDH
and a DNA encoding SNDH may be placed under control of different
promoters, or two of which or more may be placed in tandem under
the control of the same promoter.
[0077] The transformant of the present invention can be prepared by
transforming a host cell with a recombinant vector containing a DNA
encoding the SLDH of the present invention. The host cell is not
particularly limited as long as it can be adapted to the
recombinant vector to be used and can be transformed, and various
cells conventionally used in this field, such as a naturally
occurring cell or an artificially produced mutant cell or a
recombinant cell, can be utilized. Preferably, bacteria,
particularly Escherichia coli (e.g., DH5 , HB101 and the like),
Bacillus subtilis, the genus Pseudomonas bacteria (e.g.,
Pseudomonas fluorescence and the like), the genus Gluconobacter
bacteria (e.g., Gluconobacter oxydans and the like), the genus
Pseudogluconobacter bacteria, the genus Acetobacter bacteria and
the like are used.
[0078] A recombinant vector can be introduced into a host cell by a
method conventionally known. For example, when the host is bacteria
such as Escherichia coli, Bacillus subtilis and the like, the
method of Cohen et al. [Proc. Natl. Acad. Sci. USA, 69: 2110
(1972)], protoplast method [Mol. Gen. Genet., 168: 111 (1979)],
competent method [J. Mol. Biol., 56: 209 (1971)], electroporation
method and the like can be used.
[0079] Particularly, the transformant of the present invention is a
host cell transformed with an expression vector containing a DNA
encoding the SLDH of the present invention. When the transformant
is prepared with the aim of producing 2KLGA from D-sorbitol, the
host cell needs to have an ability to convert L-sorbose to 2KLGA.
Preferably, the host cell produces SDH and SNDH activity. Such
naturally occurring cell is, for example, bacteria belonging to the
genus Gluconobacter, the genus Acetobacter, the genus
Pseudogluconobacter and the like, specifically Gluconobacter
oxydans T-100 (FERM BP-4415; International Patent Publication No.
WO95/23220) and the like. Such artificially prepared cell is, for
example, a cell transformed with an expression vector functionally
containing a DNA encoding SDH and SNDH isolated from the
above-mentioned naturally occurring bacteria and the like,
preferably Escherichia coli, the genus Pseudomonas bacteria, the
genus Gluconobacter bacteria, the genus Pseudogluconobacter
bacteria, the genus Acetobacter bacteria and the like.
Specifically, E. coli JM109-pUC19SD5 (International Patent
Publication No. WO94/20609), Gluconobacter oxydans
NB6939-pSDH-tufB1, Gluconobacter oxydans NB6939-pSDH-trp6,
Gluconobacter oxydans NB6939-pSDH-PL1, Gluconobacter oxydans
NB6939-pSDH-tac8 (all from International Patent Publication No.
WO95/23220) and the like are exemplified.
[0080] The transformant of the present invention can be also
obtained by transforming a host cell with an expression vector
containing, in addition to the above-mentioned DNA encoding SLDH, a
DNA encoding SDH and/or a DNA encoding SNDH in a form permitting
expression in the host cell. When the expression vector lacks one
of the DNA encoding SDH and the DNA encoding SNDH, the host cell
may be co-transformed along with a different expression vector
containing said DNA.
[0081] The recombinant SLDH of the present invention can be
produced by culturing a transformant containing an expression
vector containing a DNA encoding the above-mentioned SLDH in a
suitable medium and harvesting SLDH from the obtained culture.
[0082] The nutrient medium to be used contains, as a carbon source,
saccharides such as glucose and fructose, glycerol, preferably
L-sorbose and D-sorbitol. It may contain an inorganic or organic
nitrogen source (e.g., ammonium sulfate, ammonium chloride,
hydrolysate of casein, yeast extract, polypeptone, bactotrypton,
beef extract and the like). When desired, other nutrient sources
[e.g., inorganic salt (e.g., sodium diphosphate or potassium
diphosphate, potassium hydrogenphosphate, magnesium chloride,
magnesium sulfate, calcium chloride), vitamins (e.g., vitamin B1),
antibiotics (e.g., ampicillin, kanamycin) etc.] may be added to the
medium. Preferably, the medium contains D-sorbitol, yeast extract,
CaCO.sub.3 and glycerol as ingredients. The medium has a sugar
(D-sorbitol) concentration of generally 1-50%, preferably
2-40%.
[0083] A transformant is cultured at generally pH 5.5-8.5,
preferably pH 6-8, at generally 18-40.degree. C., preferably
20-35.degree. C. for 5-150 h.
[0084] SLDH can be purified by appropriately combining various
separation techniques typically used according to the fraction
having an SLDH activity. Since the SLDH of the present invention is
NAD(P).sup.+ dependent, it highly likely localizes in a soluble
fraction of the transformant. In this case, after the completion of
the culture, the culture is filtrated or centrifuged to recover the
cell, which is then ruptured by ultrasonication, lysozyme
treatment, osmotic pressure shock and the like to give a cell
extract for use.
[0085] When the recombinant SLDH is produced in the aforementioned
form wherein a specific amino acid sequence is added to the
terminus, the SLDH can be quickly and easily purified by a
treatment including chromatography using a carrier, on which a
metal ion chelate capable of adsorbing the specific amino acid
sequence is immobilized (immobilized metal affinity chromatography;
IMAC). The metal ion chelate adsorber to be used can be prepared by
bringing a solution containing a transition metal (e.g., divalent
ion such as cobalt, copper, nickel and iron, trivalent ion such as
iron, aluminum and the like, preferably divalent ion of cobalt)
into contact with a matrix to which a ligand, for example,
iminodiacetate group, nitrilotriacetate group,
tris(carboxymethyl)ethylen- ediamine group and the like, has been
attached to allow binding with the ligand. The matrix portion of
the chelate adsorbent is not particularly limited as long as it is
a typical insoluble carrier.
[0086] According to the production method of L-sorbose of the
present invention, any transformant containing an expression vector
containing the above-mentioned DNA encoding SLDH is cultured in a
suitable medium, and D-sorbitol is brought into contact with the
obtained culture, or, when the SLDH activity is present in an
intracellular fraction of the transformant, with a cell extract
thereof, to give L-sorbose. The method for bringing D-sorbitol into
contact with the culture includes culture of the transformant in a
medium containing D-sorbitol.
[0087] The present invention also provides a production method of
2KLGA, which utilizes L-sorbose obtained by the above-mentioned
method. That is, a host cell capable of converting L-sorbose to
2KLGA, preferably a host cell transformed with an expression vector
containing a DNA encoding SDH and a DNA encoding SNDH, is cultured
in a suitable medium, and L-sorbose obtained by the above-mentioned
method is brought into contact with the obtained culture, or, when
the SDH and SLDH activity is present in an intracellular fraction
of the host cell, with a cell extract thereof, to give 2KLGA. The
method for bringing L-sorbose into contact with the culture
includes culture of the host cell in a medium containing
L-sorbose.
[0088] According to a different production method of 2KLGA of the
present invention, a host cell capable of converting L-sorbose to
2KLGA, which is transformed with an expression vector containing a
DNA encoding the above-mentioned SLDH, is cultured in a suitable
medium, and D-sorbitol is brought into contact with the obtained
culture, or, when the SLDH, SDH and SLDH activity is present in an
intracellular fraction of the host cell, with a cell extract
thereof, to give 2KLGA. The method for bringing D-sorbitol into
contact with the culture includes culture of the host cell in a
medium containing D-sorbitol.
[0089] The medium and culture conditions to be used for the
production method of L-sorbose and the production method of 2KLGA
of the present invention may be the same as or partially different
from those used for the above-mentioned production method of
SLDH.
[0090] When D-sorbitol or L-sorbose is brought into contact with a
cell extract, the culture after the completion of culture is
centrifuged or filtrated to recover the cell, which is suspended in
a suitable buffer, such as acetate buffer, and the cell is ruptured
by ultrasonication and the like and subjected to a centrifugation
treatment to give a supernatant which can be used as a cell
extract.
[0091] The L-sorbose or 2KLGA thus produced can be purified from a
reaction mixture (when the transformant is cultured in a medium
containing D-sorbitol or L-sorbose, a culture supernatant) by a
purification method generally used (for example, dialysis, gel
filtration, column chromatography on a suitable adsorbent, high
performance liquid chromatography and the like).
[0092] The purified 2KLGA can be converted to L-ascorbic acid or a
salt thereof (for example, salt with an alkali metal or alkaline
earth metal) by a method conventionally known. Such method is not
particularly limited and exemplified by a method including heating
2KLGA by adding a strong acid such as hydrochloric acid.
[0093] The present invention is explained in detail in the
following by referring to Examples. These examples are merely
exemplifications and do not limit the scope of the present
invention in any way.
EXAMPLE 1
Cloning of SLDH
[0094] (1) Preparation of Chromosomal DNA
[0095] A single colony of the strain G. oxydans G624 (FERM BP-4415;
International Patent Publication No. WO95/23220) was cultured in a
medium (pH 6.0) containing 2.5% mannitol, 0.3% polypeptone and 0.5%
yeast extract at 37.degree. C. for 48 hours. The cells were
collected by centrifugation (6,000 rpm, 10 minutes) and suspended
in sterilized water (1 ml). The suspension was diluted with STE
buffer [1 ml, 20% sucrose--50 mM Tris-HCl (pH 8.0)--1 mM EDTA] and
lysozyme (2 mg) was added. The mixture was stood at 37.degree. C.
for 30 minutes. Thereto were added a sarcosyl solution [2.5 ml, 1%
lauroylsarcosylate 100 mM EDTA (pH 8.5)] and proteinase K (final
concentration 100 .mu.g/ml), and the mixture was stood at
50.degree. C. for 2 hours. Thereto were added caesium chloride (5.5
g) and 5 mg/ml ethidium bromide (0.3 ml) and the mixture was
ultracentrifuged at 20.degree. C., 50,000 rpm for 16 hours. The
part containing a chromosomal DNA was isolated, dissolved in TE
buffer [30 ml, 10 mM Tris-HCl (pH 8.0)--1 mM EDTA] and dialyzed
twice against 5 L of 1 mM EDTA. The dialyzate was washed 4 times
with isobutanol, twice with phenol and 3 times with chloroform, and
purified by ethanol precipitation. This was dissolved in TE buffer
(10 ml) to give a 180 .mu.g/ml chromosomal DNA solution.
[0096] (2) Preparation of Cosmid Library
[0097] A single colony of Escherichia coli DH1/pcos6EMBL (ATCC
37571; purchased from ATCC through Sumitomo Pharma International
Co. Ltd.) was cultured in a 50 .mu.g/ml kanamycin-containing LB
medium [3 ml, 1% polypeptone, 0.5% yeast extract, 1% sodium
chloride (pH 7.4)] at 37.degree. C. for 16 hours, and 0.5 ml
thereof was inoculated to 50 .mu.g/ml kanamycin-containing LB
medium (50 ml) in a 500 ml Erlenmeyer flask. The medium was
cultured at 37.degree. C. for 8 hours and the cells were harvested
by centrifugation (6,000 rpm, 10 minutes). The cosmid pcos6EMBL was
purified with QIAGEN Plasmid Midi Kit (QIAGEN). The pcos6EMBL (25
.mu.g) was digested with 50 U BamHI at 37.degree. C. for 2 hours,
and purified by ethanol precipitation. This was subjected to
dephosphorylation with 3 U calf intestine-derived alkaline
phosphatase (CIAP) at 37.degree. C. for 1 hour and purified by
ethanol precipitation. Separately, the chromosomal DNA (100 .mu.g)
of the strain G. oxydans G624 obtained in the above-mentioned (1)
was partially digested with 5 U Sau3AI at 37.degree. C. for 1
minute, and purified by ethanol precipitation. The partial digest
(ca. 1.5 .mu.g) and BamHI digest of pcos6EMBL (ca. 3 .mu.g) were
ligated with 3 U T4 DNA ligase at 4.degree. C. for 16 hours. A
portion (3 .mu.l) thereof was subjected to in vitro packaging using
GIGAPACK II Gold Packaging Extract (STRATAGENE). This packaging
solution was diluted 50-fold with SM buffer [50 mM Tris-HCl (pH
7.5)--100 mM NaCl--8 mM MgSO.sub.4--0.1% gelatin] and 25 .mu.l of
the indicating bacteria (Escherichia coli XL1-Blue MRA) was
infected with 25 .mu.l thereof, sown on a 50 .mu.g/ml
kanamycin-containing LB plate and stood at 37.degree. C overnight.
About 400 colonies were obtained, which means a cosmid library of
about 400000 clones was obtained.
[0098] (3) Screening of Clone having SLDH Activity
[0099] In a 96 well plate rounded bottom (Nalge) containing a
0.9-fold diluted LB medium containing 5% sorbitol and 50 .mu.g/ml
kanamycin by 150 .mu.l per well, 368 cosmid clones were cultured
with gentle shaking at 30.degree. C. for 3 days. After
centrifugation (2,000 rpm, 10 minutes), 0.5 mg/ml resorcin-ethanol
solution (30 .mu.l) and 0.216 mg/ml ferric sulfate (III)
ammonium-hydrochloric acid solution (30 .mu.l) were added to the
culture supernatant (20 .mu.l), and the mixture was heated at
80.degree. C. for 1 hour. Using a medium alone similarly reacted as
a control, 3 clones of 1A4, 1A5, 4A9 which showed deeper brown
color than did the control were selected as the clones having a
conversion capability to sorbose (fructose). The culture
supernatants thereof were analyzed by HPLC [column: Polyspher OA KC
(E. Merck), 7.8.times.300 mm; temperature: room temperature;
migration phase: 0.01N H.sub.2 SO.sub.4 ; flow amount: 0.4
ml/minute; detection: RI] and sorbose was detected for each clone.
Thus, these 3 clones were considered to have an SLDH activity. The
length of the insert part of these cosmid clones was about 40 kb
for all of them.
[0100] (4) Subcloning to Charomid Vector (Downsizing of Insert)
[0101] The cosmid clone 1A4 (300 ng) having an SLDH activity was
partially digested with 20 mU Sau3AI at 37.degree. C. for 1 hour.
The charomid 9-28 (1 .mu.g, Nippon Gene) was digested with 4 U
BamHI at 37.degree. C. for 1 hour. These two solutions were mixed,
purified by ethanol precipitation, dissolved in 2-fold diluted TE
buffer (5 .mu.l) and ligated with 1 U. T4 DNA ligase at 4.degree.
C. for 16 hours. One(1) .mu.l thereof was subjected to in vitro
packaging using GIGAPACK II XL Packaging Extract (STRATAGENE). The
packaging solution (75 .mu.l) and SM buffer (75 .mu.l) were mixed
and used for infecting 150 .mu.l of indicating bacteria
(Escherichia coli DH-1), which was sown on a 50 .mu.g/ml
ampicillin-containing LB plate and incubated at 37.degree. C. for 1
day. Of the colonies appeared, 95 colonies were cultured with
gentle shaking at 30.degree. C. for 3 days in a 96 well plate
rounded bottom (Nalge) containing a 0.9-fold diluted LB medium
containing 5% sorbitol and 50 .mu.g/ml kanamycin by 150 .mu.l per
well. After centrifugation (2,000 rpm, 10 minutes), 0.5 mg/ml
resorcin-ethanol solution (30 .mu.l) and 0.216 mg/ml ferric sulfate
(III) ammonium-hydrochloric acid solution (30 .mu.l) were added to
the culture supernatant (20 .mu.l), and the mixture was heated at
80.degree. C. for 1 hour. Using a medium alone similarly reacted as
a control, 6 clones of G1, C2, A4, B7, H10, B12 which showed deeper
brown color than did the control were selected as the clones having
a conversion capability to sorbose. The length of the insert part
of these charomid clones was about 15 kb for all of them.
[0102] (5) Subcloning of SLDH Gene to Plasmid Vector
[0103] From the restriction enzyme map of the clones obtained so
far, it was found that SLDH gene did not have a SacI site or a XbaI
site. Thus, 1 .mu.g of charomid B7 was digested with 10 U of SacI
and 10 U of XbaI to give about 6 kb (B7SX3) and about 9 kb (B7SX2)
SacI-XbaI fragments. These two fragments were respectively ligated
with Escherichia coli-Pseudomonas shuttle vector pUCP19 [1.8 kb
PstI fragment derived from. pRO1614 was inserted into NarI site of
pUC19 and purified from Escherichia coli DH5 .alpha.F' (ATCC
87110)] and transformed with Pseudomonas (this strain was later
named Pseudomonas sp. F-1, hereinafter to be referred to by this
designation) by the electroporation method to give Ps./pUCP19-B7SX3
and Ps./pUCP19-B7SX2. The preparation of competent cell and
conditions of transformation followed those of Escherichia coli.
These two clones were cultured in a medium containing sorbitol. As
a result, sorbose conversion capability was found in
Ps./pUCP19-B7SX2. Therefore, Ps./pUCP19-B7SX2 was cultured in a
medium (pH 7.4) containing 5% sorbitol, 1% bactotrypton, 0.5% yeast
extract, 1% sodium chloride and 50 .mu.g/ml ampicillin at
30.degree. C. for 4 days to give 2.4 mg/ml of sorbose (conversion
efficiency: 5%). This sorbose was separated by HPLC and the
coincidence of retention time with the standard product was
confirmed. HPLC was performed under the same conditions as in the
above-mentioned (3). Using GC/MS [column:DB-5 (J & W
Scientific), 0.32 mm.times.30 m (film 0.25 .mu.m); temperature:
injection=230.degree. C., column=100.degree. C. (5
minutes).fwdarw.heating at 10.degree. C./minute for 10
minute.fwdarw.200.degree. C. (5 minutes).fwdarw.heating at
30.degree. C./minute for 1 minute.fwdarw.230.degree. C. (4
minutes), detect=230.degree. C.; flow amount: pressure control 20
kPa(He)], the coincidence of mass pattern with the standard product
was confirmed.
[0104] (6) Determination of Base Sequence of SLDH Gene
[0105] The restriction enzyme map of the insert part of plasmid
pUCP19-B7SX2 of transformant of Pseudomonas, Ps./pUCP19-B7SX2, that
expresses an SLDH activity was assumed as shown in FIG. 2. By
digestion of 1 .mu.g of pUCP19-B7SX2 with 10 U of Hind III at
37.degree. C. for 1 hour, about 4 kb Hind III-Hind III fragment was
obtained. This Hind III-Hind III fragment was ligated with vector
pUCP19 and plasmid pUCP19-HC was constructed. Pseudomonas was
transformed with this plasmid to give Ps./pUCP19-HC. This
transformant was cultured in a medium containing sorbitol. As a
result, expression of SLDH activity was acknowledged. Thus, this
Hind III-Hind III fragment was found to contain full length SLDH
gene. The base sequence of this about 4 kb Hind III-Hind III
fragment was determined. First, the insert part of pUCP19-HC was
divided into about 1.1 kb SphI-SphI fragment (Si), about 0.8 kb
EcoRI-SphI fragment (ES) and about 1.3 kb EcoRI-EcoRI (E1) fragment
(FIG. 2), and each was subcloned to pUC18 to give pUC18-S1,
pUC18-ES and pUC18-E1.
[0106] Using plasmids pUCP19-HC, pUC18-S1, pUC18-ES and pUC18-E1 as
templates and using universal primer and reverse primer (New
England Labs.), which were M13 sequencing primers, first sequencing
was performed. The sample was fluorescent labeled with BigDye
Terminator Cycle Sequencing kit (Applied Biosystems) and analyzed
with ABI PRISM 310 Genetic Analyzer (Applied Biosystems). The
following 11 kinds of primers were synthesized and using pUCP19-HC
as a template sequencing was performed, whereby the base sequence
of about 4 kb Hind III-Hind III fragment was determined (Sequence
Listing SEQ ID NO:2).
1 SLDH gene sequencing primer SL1 GCTGCTGAGTGATCCG (Sequence
Listing SEQ ID NO: 3) SL2 GACTGCTACTTCGATCC (Sequence Listing SEQ
ID NO: 4) SL3 CCTACACCTAGCCTGC (Sequence Listing SEQ ID NO: 5) SL4
CAGTGCCGTCATGAGG (Sequence Listing SEQ ID NO: 6) SL5
TCCTGATCTCGGTGCG (Sequence Listing SEQ ID NO: 7) SL6
GATGCTTCAGCACGGC (Sequence Listing SEQ ID NO: 8) SL7
GACGATCACGGAAGGC (Sequence Listing SEQ ID NO: 9) SL8
GGTTACGTGGTCGAGG (Sequence Listing SEQ ID NO: 10) SL9
CTATACGTGACAGGTCC (Sequence Listing SEQ ID NO: 11) SL10
GCGCGATCTGGATACG (Sequence Listing SEQ ID NO: 12) SL11
CGAGGATCTCGAACGG (Sequence Listing SEQ ID NO: 13)
[0107] From the analysis of the base sequence, 1455 bp ORF was
found (base number 537-1991). Therefore, SLDH was assumed to
consist of 485 amino acids and has a molecular weight of about 54
kDa. As a result of the homology search, it showed 42% homology
with mannitol dehydrogenase of Pseudomonas fluorescence.
EXAMPLE 2
Production of Recombinant SLDH
[0108] (1) Construction of Plasmid Expressing SLDH having
Histidine-Tag (hereinafter to be Referred to as His-Tagged
SLDH)
[0109] For purification of the recombinant protein, a tag system
utilizing 6.times.histidine was an extremely easy method. That is,
a protein having 6 histidine tag is expressed, and utilizing
interaction of a metal (e.g., cobalt, nickel) and histidine
residue, the protein is separated by IMAC. For insertion of
6.times.His into the C terminus side of SLDH, the following two
pairs of primers were respectively used and using pUCP19-HC (5 ng)
as a template, PCR was performed with pfu DNA polymerase (2.5 U)
(94.degree. C., 30 seconds.fwdarw.55.degree. C. 2
minutes.fwdarw.72.degre- e. C., 2 minutes, 25 cycles). The primer
(each 20 pmol) was heated to 99.degree. C. for 4 minutes and
rapidly cooled before use.
[0110] PCR 1
[0111] Primer 1 (sense) [sequence that coincides with sequence near
NheI site (underlined) in SLDH coding sequence]
2 CGGATTGCTAGCGATGGC (Sequence Listing SEQ ID NO: 14)
[0112] Primer 2 (antisense) [containing sequence that coincides
with 3' terminus of SLDH coding sequence, 6.times.His (H), stop is
codon (*) and BamHI site (underlined part)]
3 ATCGAGGATCC TCA ATGATGATGATGATGATG GGCCGGGATGGCGGC * H H H H H H
(Sequence Listing SEQ ID NO: 15)
[0113] PCR 2
[0114] Primer 3 (sense) [including BamHI site (underlined) and
sequence that coincides with sequence immediately after stop codon
of SLDH gene]
4 (Sequence Listing SEQ ID NO: 16)
ATCGAGGATCCATTCGGCTTTTAGGGTAGC
[0115] Primer 4 (antisense) [including sequence that coincides with
sequence near BglII site in 3' non-coding region of SLDH gene and
SacI site (underlined)]
5 (Sequence Listing SEQ ID NO: 17) TAGCTGAGCTCATGGGACAGATCTGAGC
[0116] The about 360 bp fragment specifically amplified in PCR 1
was digested with NheI and BamHI, and the about 100 bp fragment
specifically amplified in PCR 2 was digested with BamHI and SacI.
Separately, the about 2 kb fragment obtained by digesting pUCP19-HC
with BglII and PstI was inserted into BamHI-PstI fragment of pUCP19
to give plasmid pUCP19-SLDH (FIG. 3) wherein the downstream of
BglII site of the insert was removed. This was digested with NheI
and SacI, and the obtained about 6.2 kb fragment was ligated with
the above-mentioned two PCR amplification fragments with T4 DNA
ligase to construct pUCP19-SLDH-His. Pseudomonas was transformed
with this plasmid to give Ps./pUCP19-SLDH-His.
[0117] (2) Purification of His-Tagged SLDH
[0118] One loopful of cryopreservation stock of transformant
Ps./pUCP19-SLDH-His was inoculated to LB medium (2 ml) containing
50 .mu.g/ml ampicillin in a 15 ml centrifuge tube (Corning) and
cultured at 30.degree. C. for 16 hours. The 1.5 ml thereof was
inoculated to LB medium. (50 ml) containing 5% sorbitol and 50
.mu.g/ml ampicillin in a 500 ml Erlenmeyer flask and cultured at
25.degree. C. for 3 days. The cells were harvested by
centrifugation (6,000 rpm, 4.degree. C. for 5 minutes), and
suspended in 10 ml of 100 mM NaCl-containing 20 mM Tris-HCl (pH
8.0). The suspension was treated with an ultrasonication
homogenizer (Tomy UD-201) for 5 minutes (50% interval), centrifuged
(15,000 rpm, 4.degree. C. for 10 minutes) and a supernatant was
recovered to give a cell-free extract. TARON resin (2 ml, CLONTECH)
was placed in a 15 ml centrifuge tube (Corning), and washed twice
with 10 ml of 100 mM NaCl-containing 20 mM Tris-HCl (pH 8.0) for
equilibration. The above-mentioned cell-free extract (5 ml) was
added and the mixture was shaken at room temperature for 20 minutes
to adsorb His-tagged SLDH, followed by washing 3 times with 100 mM
NaCl-containing 20 mM Tris-HCl (10 ml, pH 8.0) over 10 minutes. 100
mM NaCl-containing 20 mM Tris-HCl buffers (2 ml, pH 8.0)
respectively containing 10 mM, 30 mM, 50 mM and 100 mM imidazole
were added successively, and shaken at room temperature for 2
minutes to elute His-tagged SLDH. As a result, SLDH activity eluted
in a 30 mM-50 mM imidazole fraction. This fraction was applied to
SDS-PAGE analyze to detect nearly single band.
[0119] (3) Analysis of N Terminus Amino Acid Sequence
[0120] The His-tagged SLDH purified in the above-mentioned (2) was
electrophoresed using a multigel (Daiichi Pure Chemicals) having a
gel concentration of 12.5% with 40 mA current over 1 hour, and
using Horiz-Blot (Atto), transferred onto a PVDF membrane
(Immobilon PSQ; Millipore). The membrane was stained with coomasie
brilliant blue G-250, and a band seemingly an about 55 kDa SLDH was
cut out with a pair of scissors. This PVDF membrane was subjected
to amino acid sequence analysis using protein sequencer G100A
(Hewlett-Packard) and PTH analyzer 1090 (Hewlett-Packard). As a
result, a sequence (MITRETLKSL; Sequence Listing SEQ ID NO:18)
consistent with N terminus amino acid sequence expected from ORF of
SLDH gene was obtained.
[0121] (4) Confirmation of SLDH Activity
[0122] In the same manner as in the above-mentioned (2) except that
the cell-free extract to be applied was by 10 ml, the resin after
His-tagged SLDH adsorption was washed 6 times, and His-tagged SLDH
was eluted with 50 mM imidazole and 100 mM NaCl-containing 20 mM
Tris-HCl (5 ml, pH 8.0), His-tagged SLDH was purified. The obtained
His-tagged SLDH was reacted with sorbitol and the resulting product
was analyzed. The composition of the reaction solution (2 ml) was
10 mM (1.82 mg/ml) sorbitol, 0.1 M glycine/NaOH buffer (pH 10.1), 5
mM NADP.sup.+ and His-tagged SLDH 0.2 ml (41.4 .mu.g protein) and
the reaction was carried out at 25.degree. C. for 24 hours. As a
result, 1.12 mg/ml sorbose was generated (sorbitol remaining in
0.70 mg/ml; conversion efficiency: 62%). Thus, His-tagged SLDH
purified by cobalt type IMAC was confirmed to be sorbitol
dehydrogenase that oxidizes sorbitol and generates sorbose.
EXAMPLE 3
Characterization of SLDH
[0123] (1) Coenzyme Dependency and Active pH Range
[0124] To a solution containing 0.1 ml of 50 mM NAD.sup.+ (or
NADP.sup.+), 0.2 ml of 500 mM buffer, 10 .mu.l of His-tagged SLDH
solution (2.1 .mu.g protein) prepared in Example 2(4) and distilled
water (0.29 ml) was added to 500 mM sorbitol (0.4 ml) to start the
reaction (25.degree. C.), and increase in NADH (or NADPH) was
measured by a spectrophotometer (UV-2200; Shimadzu) based on
absorbance at 340 nm as an index. For the reaction solutions having
pH 10.1 and pH 9.0, glycine/NaOH buffer was used, and for reaction
solutions having pH 8.0 and pH 7.0, potassium phosphate buffer was
used. The enzyme activity (1 unit) was defined to be an amount to
generate 1 .mu.mol of NADH (or NADPH) per minute. The molecular
extinction coefficient of NAD(P)H was 6.3 mM.sup.-1 cm.sup.-1. The
protein amount was measured with bovine serum albumin (BSA) as a
standard by the Lowry method. As a result, SLDH could utilize both
NAD.sup.+ and NADP.sup.+ as coenzymes, and NADP.sup.+ showed higher
specificity. The activity of this enzyme was higher in the alkaline
pH (Table 1).
6 TABLE 1 Activity (U/mg Coenzyme pH protein) NADP.sup.+ 10.1 130.2
9.0 30.0 8.0 22.9 7.0 4.2 NAD.sup.+ 10.1 8.1 9.0 3.4 8.0 1.2 7.0
0.1
[0125] (2) Substrate Specificity
[0126] In the same manner as in the above-mentioned (1) except that
the reaction solution contained various substrates to replace
sorbitol, the buffer was glycine/NaOH buffer (pH 10.1), and
coenzyme was NADP.sup.+, the SLDH activity was measured. As a
result, this enzyme could utilize, besides sorbitol, mannitol and
arabitol as a substrate, but showed no action on xylitol, ribitol,
inositol or glycerol (Table 2).
7 TABLE 2 Substrate Activity (U/mg protein) sorbitol 130.2 mannitol
85.7 arabitol 88.1 xylitol 0 ribitol 0 inositol 0 glycerol 0
[0127] (3) Michaelis Constant
[0128] Using sorbitol as a substrate, SLDH activity was measured
according to the method of the above-mentioned (2). As a result,
the Km value for sorbitol was 132 mM (25.degree. C.).
EXAMPLE 4
Preparation of Pseudomonas Transformant having SNDH/SDH Expression
Vector and Study of 2KLGA Productivity by this Transformant
[0129] Of the pBBR plasmids that are broad host range plasmids
[Gene, 166, 175 (1995)] supplied by Dr. Kovach at Louisiana State
University, Medical Center, SNDH/SDH gene was introduced into the
genus Pseudomonas strain using pBBR1MCS-2 (kanamycin resistant) and
pBBR1MCS-3 (tetracycline resistant) as vectors, and fermentative
production of 2KLGA from L-sorbose by the obtained transformant was
studied.
[0130] (1) Construction of SNDH/SDH Expressing Broad Host Range
Plasmid
[0131] Plasmid pSDH-tufB1-Eco-d9U (FIG. 4) (5 .mu.g) containing
SNDH/SDH gene and using tufB as a promoter was digested with EcoRI
(50 U, Behringer-Mannheim) at 37.degree. C. for 1 hour, and
electrophoresed on 0.8% agarose gel, which was followed by
separation of a 3.7 kb EcoRI/EcoRI fragment containing SNDH/SDH
gene. This fragment was inserted into the EcoRI site of pBBR1MCS-2.
The plasmid inserted in the same direction as the
.beta.-galactosidase gene was taken as pBBR (Km)-SDH.cndot. SNDH
(FIG. 5).
[0132] Plasmid pSDH-tufB1 (10 .mu.g, construction method is
described in European Patent Publication EP 0758679 A1) containing
an SNDH/SDH gene and using tufB as a promoter was digested with
EcoRI (50 U, Behringer-Mannheim) at 37.degree. C. for 1 hour and
the termini were blunted by a treatment using Klenow fragment
(Nippon Gene) at room temperature for 30 minutes. Using a T4 DNA
ligase (TOYOBO), PstI linker (GCTGCAGC, TOYOBO) was ligated with
the termini and digested with PstI (50 U, Behringer Mannheim) at
37.degree. C. for 1 hour. This digest was electrophoresed with 0.8%
agarose gel and a 3.7 kb PstI/PstI fragment containing an SNDH/SDH
gene was separated. This fragment was inserted in the PstI site of
pBBR1MCS-3. The plasmid inserted in the same direction as the
.beta.-galactosidase gene was taken as pBBR(Tc) SDH.cndot. SNDH
(FIG. 6).
[0133] (2) Preparation of Competent Cell of Pseudomonas
[0134] The glycerol cryopreservation stock of Pseudomonas sp.F-1
was inoculated to L medium (3 ml, pH 7.4) containing 1%
bactotrypton (Difco), 0.5% yeast extract (Difco) and 1% sodium
chloride in a 16.5.times.165 mm test tube and cultured at
30.degree. C. overnight. The entire amount of the culture solution
was inoculated to L medium (50 ml) in a 500 ml Erlenmeyer flask,
and cultured at 25.degree. C. for 6 hours. The culture solution was
centrifuged to harvest the cells and the cells were washed twice
with cold 10% aqueous glycerol solution (30 ml). The washed cells
were suspended in a small amount of cold 10% aqueous glycerol
solution, dispensed by 60 .mu.l and instantaneously frozen with
liquid nitrogen.
[0135] (3) Transformation of Pseudomonas
[0136] The competent cells of Pseudomonas cryopreserved in liquid
nitrogen sp.F-1 were thawed in ice water, and solutions of an
SNDH/SDH expressing broad host range plasmid constructed in the
above-mentioned (1), pBBR(Km)-SDH.cndot. SNDH and
pBBR(Tc)-SDH.cndot. SNDH, were added by 1 .mu.l (ca. 1 .mu.g) each,
and stood at 4.degree. C. for 30 minutes. This was transformed
using a Gene Pulser gene transfer device (Bio-Rad) in a cuvette
having a distance of 0.1 cm between electrodes under the conditions
of 200.OMEGA., 1.8 kV, 25 .mu.F, and suspended in L medium
containing 0.4% glucose, which was followed by shaking at
30.degree. C. for 1 hour. They were sown on an L agar plate
containing 50 .mu.g/ml kanamycin and an L agar plate containing 20
.mu.g/ml tetracycline, cultured at 30.degree. C. for 2 days to give
transformant Ps./pBBR(Km)-SDH.cndot. SNDH and
Ps./pBBR(Tc)-SDH.cndot. SNDH.
[0137] (4) Fermentative Production of 2KLGA from Sorbose by the
Transformant
[0138] A single colony of transformants Ps./pBBR(Km)-SDH.cndot.
SNDH and Ps./pBBR (Tc)-SDH.cndot. SNDH obtained in the
above-mentioned (3) was each inoculated to 5 ml of L medium in a
16.5.times.165 mm test tube and cultured at 30.degree. C. for 2
days. The culture solution (0.5 ml) was inoculated to a medium (10
ml, pH 7.4) for 2KLGA production containing 5% sorbose, 0.1%
glucose, 0.9% bactotrypton (Difco), 0.45% yeast extract (Difco),
0.9% sodium chloride and 2% calcium carbonate in a 100 ml
Erlenmeyer flask, and cultured at 30.degree. C. for 5 days. The
culture solution was separated by centrifugation and sorbose,
sorbosone, 2KLGA and L-idonic acid in the culture supernatant were
quantitatively determined. The sorbose, sorbosone, 2KLGA and
L-idonic acid were each quantitatively determined by HPLC under the
following conditions.
[0139] [Sorbose]
[0140] column: Polyspher OA KC (7.8 mm inner diameter.times.300 mm;
Cica-MERCK)
[0141] migration phase: 0.01N H.sub.2SO.sub.4
[0142] column temperature: room temperature
[0143] flow rate: 0.4 ml/minute
[0144] detection: differential refractometer
[0145] [Sorbosone (Post-Column Labeling Method)]
[0146] column: Polyspher OA KC (7.8 mm inner diameter.times.300 mm;
Cica-MERCK)
[0147] migration phase (labeling agent): 0.04M benzamidine
hydrochloride
[0148] 0.25M potassium sulfite
[0149] 2 mM boric acid/0.1N potassium hydroxide
[0150] flow rate: 0.3 ml/minute
[0151] detection: fluorescent detector (excitation wavelength: 315
nm, detection wavelength: 405 nm)
[0152] [2KLGA and L-Idonic Acid]
[0153] column: Capcell pak NH2 (4.6 mm inner diameter.times.250 mm;
Shiseido)
[0154] migration phase: 30% acetonitrile, 20 mM calcium phosphate
(pH 3.0)
[0155] flow rate: 1.2 ml/minute
[0156] detection: UV-210 nm
[0157] As a result, the conversion efficiency from sorbose to 2KLGA
by Ps./pBBR (Km)-SDH.cndot. SNDH was about 18%, and about 37%
combined with the conversion efficiency to L-idonic acid. The
conversion efficiency from sorbose to 2KLGA by Ps./pBBR
(Tc)-SDH.cndot. SNDH was about 26%, and about 47% combined with the
conversion efficiency to L-idonic acid (Table 3).
8TABLE 3 culture results by transformant (mg/ml) transformant
sorbose sorbosone 2KLGA L-idonic acid Ps./pBBR (Km) - 12.5 (25.0)
0.3 (0.6) 8.9 (17.8) 9.6 (19.6) SDH SNDH Ps./pBBR (Tc) - 15.6
(31.2) 0.15 (0.3) 13 (26.0) 10.3 (20.6) SDH SNDH
[0158] The figures in parentheses are conversion efficiency (% of
product concentration to initial sorbose concentration).
[0159] For comparison, production of 2KLGA and L-idonic acid by a
non-transformant Pseudomonas sp. F-1 was also investigated. The
glycerol cryopreserved cells of Pseudomonas sp. F-1 were inoculated
to 5 ml of L medium in a 16.5.times.165 mm test tube and cultured
at 30.degree. C. for 1 day. The culture solution (1 ml) was
inoculated to a medium (10 ml, pH 7.4) containing 5% sorbose, 0.9%
bactotrypton (Difco), 0.45% yeast extract (Difco) and 0.9% sodium
chloride in a 100 ml Erlenmeyer flask, and cultured at 30.degree.
C. for 3 days. The culture solution was centrifuged and sorbose,
sorbosone, 2KLGA and L-idonic acid in the culture supernatant were
similarly determined quantitatively. As a result, sorbose was
consumed (5.7 mg/ml) but sorbosone, 2KLGA and L-idonic acid were
not detected.
[0160] From the above, by the introduction of SNDH/SDH gene into
2KLGA and L-idonic acid non-producing Pseudomonas sp. F-1, a
transformant that highly produces 2KLGA and L-idonic acid from
sorbose could be obtained.
EXAMPLE 5
Preparation of Pseudomonas Transformant Containing SNDH/SDH
Expression Vector and Consideration of 2KLGA Productivity of the
Transformant--(2)
[0161] In the same manner as in Example 4 and using a different
strain [strain Pseudomonas IFO3309; supplied by the Institute for
Fermentation, Osaka (17-85, Juso-honmachi 2-chome, Yodogawa-ku,
Osaka)] belonging to the genus Pseudomonas as a host, a
transformant was prepared, into which the SNDH/SDH gene was
introduced, and the 2KLGA and L-idonic acid productivity of this
transformant was investigated.
[0162] (1) Introduction of SNDH/SDH Gene into Strain Pseudomonas
IFO3309
[0163] Glycerol cryopreserved cells of the strain Pseudomonas
IFO3309 were treated in the same manner as in Example 4(2) to
prepare cryopreserved cells of competent cells. The competent cells
cryopreserverd in liquid nitrogen were thawed in ice water, and a
solution 1 .mu.l (ca. 1 .mu.g) of Ps./pBBR(Km)-SDH.cndot.
SNDH.cndot. which was an SNDH/SDH expressing broad host range
plasmid, was added and the mixture was stood at 4.degree. C. for 30
minutes. This was transformed using a Gene Pulser gene transfer
device (Bio-Rad) under the same conditions as in Example 4(3) to
give transformant Ps. IFO3309/pBBR(Km)-SDH.cndot. SNDH.
[0164] (2) Fermentative Production of 2KLGA by the Transformant
[0165] One loopful of the Ps.IFO3309/pBBR(Km)-SDH.cndot. SNDH
obtained in the above (1) was inoculated to a medium (5 ml, pH 7.0)
containing 2% sorbitol and 0.5% yeast extract (Difco) in a
16.5.times.165 mm test tube, and cultured at 28.degree. C. for 1
day. The culture solution (1 ml) was inoculated to a medium (10 ml,
pH 7.0) containing 5% sorbitol, 0.5% yeast extract (Difco), 0.2%
polypeptone (Wako Pure Chemical Industries), 0.1% K.sub.2
HPO.sub.4, 0.5% MgSO.sub.4.7H.sub.2O and 2% CaCO.sub.3 in a 100 ml
Erlenmeyer flask and cultured at 28.degree. C. for 7 days. The
culture solution was centrifuged and in the same manner as in
Example 4(4), sorbitol, sorbose, sorbosone, 2KLGA and L-idonic acid
in the culture supernatant were quantitatively determined. For
comparison, non-transformant the strain Pseudomonas IFO3309 was
cultured under the same conditions and sorbitol, sorbose,
sorbosone, 2KLGA and L-idonic acid in the culture supernatant were
quantitatively determined.
[0166] As a result, by the non-transformant, sorbitol was consumed
(0.4 mg/ml), sorbose was produced (3.9 mg/ml) but sorbosone, 2KLGA
and L-idonic acid were not detected. On the other hand, 2KLGA (1.2
mg/ml) and L-idonic acid (0.5 mg/ml) were produced by the
transformant Ps. IFO3309/pBBR(Km)-SDH .cndot. SNDH (Table 4). In
other words, it was confirmed that, is by the introduction of
SNDH/SDH gene into this host, the ability to produce 2KLGA and
L-idonic acid from sorbitol was imparted even under the conditions
where Pseudomonas IFO3309 cannot produce 2KLGA or L-idonic
acid.
9TABLE 4 culture results by transformant (mg/ml) transformant
sorbose sorbosone 2KLGA L-idonic acid Ps.3309/pBBR (Km) - 0.41 1.8
1.2 0.5 SDH SNDH
EXAMPLE 6
Production of 2KLGA by Pseudomonas Transformant into which SLDH
Expression Vector and SNDH/SDH Expression Vector were
Introduced
[0167] (1) Preparation of Pseudomonas Transformant having SLDH
Expression Vector and SNDH/SDH Expression Vector
[0168] As mentioned above, an expression vector pBBR(Km)-SDH.cndot.
SNDH (FIG. 5) was constructed by incorporating an SNDH/SDH gene
derived from G. oxydans T-100 (FERM BP-4188; European Patent
Publication EP 0758679 A1) into pBBR1MCS-2. pBBR.(Km)-SDH.cndot.
SNDH was introduced into recombinant Pseudomonas Ps./pUCP19-B7SX2
obtained in Example 1(5) by the electroporation method to give
Ps./pUCP19-B7SX2+pBBR(Km)-SDH.cndot. SNDH.
[0169] (2) Production of 2KLGA by Pseudomonas Transformant
[0170] Ps./pUCP19-B7SX2+pBBR(Km)-SDH.cndot. SNDH was cultured in a
medium (pH 7.4) containing 5% sorbitol, 1% bactotrypton (Difco),
0.5% yeast extract (Difco), 1% sodium chloride, 50 .mu.g/ml
ampicillin, 50 .mu.g/ml kanamycin and 2% light calcium carbonate at
30.degree. C. for 4 days to give 1.1 mg/ml of 2KLGA and 1.7 mg/ml
of idonic acid. The 2KLGA was separated by HPLC and coincidence
with a standard product in the retention time was confirmed. Using
GC/MS, coincidence with a standard product in the mass pattern was
confirmed. HPLC and GC/MS were performed under the same conditions
as in Example 1(3) and (5).
EXAMPLE 7
Preparation of Various Pseudomonas Transformants
[0171] (1) Ps./pUCP19-SLDH+pBBR(Km)-SDH.cndot. SNDH
[0172] Pseudomonas sp.F-1 was transformed with pUCP19-SLDH
constructed in Example 2(1) to give Ps./pUCP19-SLDH.
pBBR(Km)-SDH.cndot. SNDH was further introduced into this
recombinant Pseudomonas to give Ps./pUCP19-SLDH+pBBR(Km)-SDH.cndot.
SNDH.
[0173] (2) Ps./pUCP19-SLDH-tufB+pBBR(Km)-SDH.cndot. SNDH
[0174] To introduce SspI site into the upstream of initiation codon
of SLDH gene, PCR was performed using pUCP19-SLDH (5 .mu.g) as a
template in the presence of the following primers (20 pmol each)
using pfu DNA polymerase (2.5 U) (94.degree. C., 30
seconds.fwdarw.55.degree. C., 2 minutes.fwdarw.72.degree. C., 2
minutes, 25 cycles). sense primer [including SspI site (underlined)
and sequence identical with 5' terminus of SLDH coding
sequence]
10 (Sequence Listing SEQ ID NO: 19)
TAGGAATATTTCTCATGATTACGCGCGAAACCC
[0175] antisense primer [sequence identical with sequence
downstream of EagI site in SLDH coding sequence]
11 GATGCTTCAGCACGGC (Sequence Listing SEQ ID NO: 20)
[0176] The about 360 bp fragment specifically amplified by PCR was
digested with SspI and EagI. pUCP19-SLDH was digested with PstI and
EagI to give about 5.7 kb fragment. These two fragments and
PstI-SspI fragment (Sequence Listing SEQ ID NO:21) containing tufB
promoter were ligated with T4 DNA ligase to construct
pUCP19-SLDH-tufB. Pseudomonas was transformed with this plasmid to
give Ps./pUCP19-SLDH-tufB. Furthermore, pBBR(Km)-SDH.cndot. SNDH
capable of expressing SNDH/SDH activity was introduced to give
Ps./pUCP19-SLDH-tufB+pBBR(Km)-SDH.cndot. SNDH.
[0177] (3) Ps./pUCP19-3DH
[0178] pUCP19-SLDH-tufB (5 .mu.g) was digested with 40 U KpnI and
40 U PstI at 37.degree. C. for 1 hour to give a 1.6 kb fragment.
pUCP19-SDH.cndot. SNDH (expression vector obtained by incorporating
SNDH/SDH gene derived from G. oxydans T-100 into pUCP19; FIG. 7) (1
.mu.g) was digested with 10 U KpnI and 10 U PstI at 37.degree. C.
for 1 hour to give a 8.2 kb fragment. These two fragments were
ligated with T4 DNA ligase to construct pUCP19-3DH. Pseudomonas was
transformed with this plasmid to give Ps./pUCP19-3DH.
EXAMPLE 8
Consideration of Productivity of 2KLGA
[0179] Since production of 2KLGA by recombinant Pseudomonas was
confirmed, the productivity of 2KLGA was studied in media having
various compositions by 4 transformants obtained in Examples 6 and
7.
[Culture 1]
[0180] One loopful of cryopreservation stock of
Ps./pUCP19-B7SX2+pBBR(Km)-- SDH.cndot. SNDH was inoculated to a
medium (2 ml, pH 7.4) containing 1% bactotrypton (Difco), 0.5%
yeast extract (Difco), 1% NaCl, 50 .mu.g/ml ampicillin and 50
.mu.g/ml kanamycin in a 15 ml tube (Falcon) and pre-cultured at
30.degree. C. for 24 hours. The pre-culture solution (0.5 ml) was
inoculated to a main culture medium (10 ml, pH 7.0) containing 5%
sorbitol, 5% yeast extract (Difco), 0.15% MgSO.sub.4.7H.sub.2O, 50
.mu.g/ml ampicillin, 50 .mu.g/ml kanamycin and 4% calcium carbonate
in a 100 ml Erlenmeyer flask and cultured at 30.degree. C. for 3
days.
[0181] [Culture 2]
[0182] The cells were cultured in the same manner as in [culture 1]
except that 5% yeast extract in the main culture medium was changed
to 5% casamino acid.
[0183] [Culture 3]
[0184] The cells were cultured in the same manner as in [culture 1]
except that 1% glycerol was further added to the main culture
medium.
[0185] [culture 4]
[0186] The cells were cultured in the same manner as in [culture 1]
except that Ps./pUCP19-SLDH+pBBR(Km)-SDH.cndot. SNDH was used as
the producing bacteria and 5% glycerol was further added to the
main culture medium.
[0187] [Culture 5]
[0188] The cells were cultured in the same manner as in [culture 1]
except that Ps./pUCP19-SLDH-tufB+pBBR(Km)-SDH.cndot. SNDH was used
as the producing bacteria and 5% glycerol was further added to the
main culture medium.
[Culture 6]
[0189] The cells were cultured in the same manner as in [culture 1]
except that Ps./pUCP19-3DH was used as the producing bacteria,
kanamycin was removed from the pre-culture medium and the main
culture medium and 5% glycerol was further added to the main
culture medium.
[0190] The sorbitol, sorbose, sorbosone and 2KLGA in each culture
were quantitatively determined. The results are shown in Table 5.
The propensity toward increased conversion efficiency to 2KLGA was
observed by the addition of glycerol to the medium.
[0191] [Culture 7]
[0192] The cells were cultured for 7 days in the same manner as in
[culture 1] except that the yeast extract concentration of the main
culture medium was set to 2% and 5% glycerol was further added to
the main culture medium. The sorbitol, sorbose, sorbosone and 2KLGA
at day 1, 3, 5 and 7 of culture were quantitatively determined. The
results are shown in Table 5.
12TABLE 5 culture days sorbitol sorbose sorbosone 2KLGA idonic acid
1 44.1 6.3 0.1 3.7 1.6 2 44.8 3.1 0 4.8 2.2 3 26.7 5.1 0 10.9 8.4 4
26.6 0 0 9.0 ND 5 26.6 0 0 10.7 ND 6 30.7 5.2 0 7.5 ND 7 1 41.1 0 0
4.2 ND 3 25.6 0 0 10.6 ND 5 14.2 0 0 16.3 ND 7 7.6 0 0 18.4 15.5
(unit: mg/ml) ND: Not determined
EXAMPLE 9
Fermentative Production of Sorbose or 2KLGA by Pseudomonas putida
Transformant into which SLDH Expression Vector and/or SNDH/SDH
Expression Vector were Introduced
[0193] In the following test, the preparation and transformation of
competent cells of the strain Pseudomonas putida IFO3738 followed
the above-mentioned Pseudomonas sp.F-1. Because the strain
Pseudomonas putida IFO3738 is ampicillin resistant, when ampicillin
resistance is used as a selection marker, cells were sown on an L
agar plate containing 500 .mu.g/ml ampicillin (10-fold amount of
normal level) after electroporation, and cultured at 30.degree. C.
for 1 day to pick up large colonies for the selection of
transformant. (1) Fermentative production of sorbose from sorbitol
by transformant into which SLDH expression vector was
introduced
[0194] SLDH gene (pUCP19-SLDH) was introduced into the strain
Pseudomonas putida IFO3738. A single colony of the obtained
transformant Pseudomonas putida IFO3738/pUCP19-SLDH was inoculated
to a medium (10 ml, pH 7.4) for sorbose production, which contained
5% sorbitol, 0.9% bactotrypton (Difco), 0.45% yeast extract
(Difco), 0.9% sodium chloride and 500 .mu.g/ml ampicillin in a 100
ml Erlenmeyer flask and cultured at 30.degree. C. for 3 days. The
culture solution was centrifuged and sorbitol and sorbose in the
culture supernatant were quantitatively determined. As a result,
34.6 mg/ml of sorbitol remained and 7.6 mg/ml of sorbose was
generated.
[0195] (2) Fermentative Production of 2KLGA from Sorbose by
Transformant into which SNDH/SDH Expression Vector was
Introduced
[0196] SNDH/SDH gene (pBBR(Km)-SDH.cndot. SNDH) was introduced into
Pseudomonas putida IFO3738. A single colony of the obtained
transformant Pseudomonas putida IFO3738/pBBR (Km)-SDH.cndot. SNDH
was inoculated to a medium (10 ml, pH 7.4) for 2KLGA production,
which contained 5% sorbose, 0.9% bactotrypton (Difco), 0.45% yeast
extract (Difco), 0.9% sodium chloride, 2% calcium carbonate and 50
.mu.g/ml kanamycin in a 100 ml Erlenmeyer flask and cultured at
30.degree. C. for 7 days. The culture solution-was centrifuged and
sorbose, 2KLGA and idonic acid in the culture supernatant were
quantitatively determined. As a result, 34.3 mg/ml of sorbose
remained and 13.9 mg/ml of 2KLGA and 3.5 mg/ml of idonic acid were
generated.
[0197] (3) Fermentative Production of 2KLGA from Sorbitol by
Transformant into which SLDH Expression Vector and SNDH/SDH
Expression Vector were Introduced
[0198] SLDH and SNDH/SDH genes (pUCP19-SLDH and pBBR(Km)-SDH.cndot.
SNDH) were introduced into the strain Pseudomonas putida IFO3738. A
single colony of the obtained transformant Pseudomonas putida
IFO3738/pUCP19-SLDH+pBBR (Km)-SDH.cndot. SNDH was inoculated to a
medium (10 ml, pH 7.4) for 2KLGA production, which contained 5%
sorbitol, 0.9% bactotrypton (Difco), 0.45% yeast extract (Difco),
0.9% sodium chloride, 2% calcium carbonate, 500 .mu.g/ml ampicillin
and 50 .mu.g/ml kanamycin in a 100 ml Erlenmeyer flask and cultured
at 30.degree. C. for 7 days. The culture solution was centrifuged
and sorbitol, sorbose, 2KLGA and idonic acid in the culture
supernatant were quantitatively determined. As a result, 35.6 mg/ml
of sorbitol remained and 13.2 mg/ml of 2KLGA and 6.2 mg/ml of
idonic acid were generated. Sorbose was not detected.
[0199] Free Text of Sequence Listing
[0200] SEQ ID NO:3: Oligonucleotide designed to act as primer for
sequencing insert DNA of pUCP19-HC.
[0201] SEQ ID NO:4: Oligonucleotide designed to act as primer for
sequencing insert DNA of pUCP19-HC.
[0202] SEQ ID NO:5: Oligonucleotide designed to act as primer for
sequencing insert DNA of pUCP19-HC.
[0203] SEQ ID NO:6: Oligonucleotide designed to act as primer for
sequencing insert DNA of pUCP19-HC.
[0204] SEQ ID NO:7: Oligonucleotide designed to act as primer for
sequencing insert DNA of pUCP19-HC.
[0205] SEQ ID NO:8: Oligonucleotide designed to act as primer for
sequencing insert DNA of pUCP19-HC.
[0206] SEQ ID NO:9: Oligonucleotide designed to act as primer for
sequencing insert DNA of pUCP19-HC.
[0207] SEQ ID NO:10: Oligonucleotide designed to act as primer for
sequencing insert DNA of pUCP19-HC.
[0208] SEQ ID NO:11: Oligonucleotide designed to act as primer for
sequencing insert DNA of pUCP19-HC.
[0209] SEQ ID NO:12: Oligonucleotide designed to act as primer for
sequencing insert DNA of pUCP19-HC.
[0210] SEQ ID NO:13: Oligonucleotide designed to act as primer for
sequencing insert DNA of pUCP19-HC.
[0211] SEQ ID NO:14: Oligonucleotide designed to act as sense
primer for amplifying DNA sequence encoding His-tagged SLDH and
promoter.
[0212] SEQ ID NO:15: Oligonucleotide designed to act as antisense
primer for amplifying DNA sequence encoding His-tagged SLDH and
promoter.
[0213] SEQ ID NO:16: Oligonucleotide designed to act as sense
primer for amplifying DNA sequence of 3' non-coding region of SLDH
gene.
[0214] SEQ ID NO:17: Oligonucleotide designed to act as antisense
primer for amplifying DNA sequence of 3' non-coding region of SLDH
gene.
[0215] SEQ ID NO:18: N-terminal amino acid sequence of SLDH.
[0216] SEQ ID NO:19: Oligonucleotide designed to act as PCR primer
(sense) for introducing SspI restriction site into 5' upstream
region of SLDH coding sequence.
[0217] SEQ ID NO:20: Oligonucleotide designed to act as PCR primer
(antisense) for introducing SspI restriction site into 5' upstream
region of SLDH coding sequence.
[0218] This application is based on patent application Ser. Nos.
72810/1999 and 224679/1999 filed in Japan, the contents of which
are hereby incorporated by reference.
[0219] All of the references cited herein, including patents and
patent applications are hereby incorporated in their entireties by
reference.
Sequence CWU 1
1
20 1 4115 DNA Gluconobacter oxydans CDS (537)..(1994) 1 aagcttgcat
gcctgcaggt cgactctaga ggatccggtt ttggcagcgc tccctagatt 60
gatgcggcgt ctgttgaccg acatgatgct ggtggcacgt gccattgcga cggggcgtgc
120 gaccgggaac acaggcctgc tgcctttgta caaggggctg agtcatgcgc
tgcgtgggct 180 ggcacatagt tgcgaagagc agttgcgcgc aaagcagaac
cagcatgaac agcagtccga 240 agacgaggaa atcctcggcc tcctaccgcg
attggaagag cagacccgtc ctgagatgcg 300 ttttgtgatg tccctgttcc
gcgaggatct cgaacgggct gttggggtgc tcatgcgttc 360 tgatgcgagt
gccgcaaaag gtctctgaac aggacgtccc gcggagggca gtcagaggtc 420
gaaatggctc ctgttgaaac cgtcattcgg tttttacgtt gtttcggggc tatgatggca
480 catgcccggc cttgtcggtc cccgtcagcg accggcccga aaccacggag aattcc
atg 539 Met 1 att acg cgc gaa acc ctt aag tct ctt cct gcc aat gtc
cag gct ccc 587 Ile Thr Arg Glu Thr Leu Lys Ser Leu Pro Ala Asn Val
Gln Ala Pro 5 10 15 ccc tat gac atc gac ggg atc aag cct ggg atc gtg
cat ttc ggt gta 635 Pro Tyr Asp Ile Asp Gly Ile Lys Pro Gly Ile Val
His Phe Gly Val 20 25 30 ggt aac ttt ttt cga gcc cat gag gcg ttc
tac gtc gag cag att ctt 683 Gly Asn Phe Phe Arg Ala His Glu Ala Phe
Tyr Val Glu Gln Ile Leu 35 40 45 gaa cac gct ccg gac tgg gcg att
gtt ggt gtt ggc ctg acg ggc agt 731 Glu His Ala Pro Asp Trp Ala Ile
Val Gly Val Gly Leu Thr Gly Ser 50 55 60 65 gac cgt tca aag aaa aaa
gcc gag gaa ttc aag gcc cag gac tgc ctg 779 Asp Arg Ser Lys Lys Lys
Ala Glu Glu Phe Lys Ala Gln Asp Cys Leu 70 75 80 tat tcc ctg acc
gag acg gct ccg tcc ggc aag agc acg gtg cgc gtc 827 Tyr Ser Leu Thr
Glu Thr Ala Pro Ser Gly Lys Ser Thr Val Arg Val 85 90 95 atg ggc
gcg ctg cgt gac tat ctg ctt gcc ccg gcc gat ccg gaa gcc 875 Met Gly
Ala Leu Arg Asp Tyr Leu Leu Ala Pro Ala Asp Pro Glu Ala 100 105 110
gtg ctg aag cat ctt gtt gat ccg gcc atc cgc atc gtt tcc atg acg 923
Val Leu Lys His Leu Val Asp Pro Ala Ile Arg Ile Val Ser Met Thr 115
120 125 atc acg gaa ggc ggc tac aac atc aac gag acg acc ggt gcg ttc
gat 971 Ile Thr Glu Gly Gly Tyr Asn Ile Asn Glu Thr Thr Gly Ala Phe
Asp 130 135 140 145 ctg gag aat gcg gca gta aag gcc gac ctc aag aac
ccg gaa aag ccg 1019 Leu Glu Asn Ala Ala Val Lys Ala Asp Leu Lys
Asn Pro Glu Lys Pro 150 155 160 tct acc gtt ttc ggt tac gtg gtc gag
gcc ctg cgt cgt cgt tgg gat 1067 Ser Thr Val Phe Gly Tyr Val Val
Glu Ala Leu Arg Arg Arg Trp Asp 165 170 175 gcc ggt ggt aag gca ttt
acg gtc atg tcc tgt gat aac ctg cgt cat 1115 Ala Gly Gly Lys Ala
Phe Thr Val Met Ser Cys Asp Asn Leu Arg His 180 185 190 aac ggc aat
gtc gcc cgc aag gcc ttc ctc ggc tat gcg aag gcg cgc 1163 Asn Gly
Asn Val Ala Arg Lys Ala Phe Leu Gly Tyr Ala Lys Ala Arg 195 200 205
gat ccg gag ttg gcg aag tgg att gag gaa aac gcg acc ttc ccg aac
1211 Asp Pro Glu Leu Ala Lys Trp Ile Glu Glu Asn Ala Thr Phe Pro
Asn 210 215 220 225 gga atg gtt gat cgc atc acc ccg acc gtt tcg gcg
gaa atc gcc aag 1259 Gly Met Val Asp Arg Ile Thr Pro Thr Val Ser
Ala Glu Ile Ala Lys 230 235 240 aag ctc aac gcg gcc agt ggg ctg gat
gac gac ctg ccg ctg gtg gcc 1307 Lys Leu Asn Ala Ala Ser Gly Leu
Asp Asp Asp Leu Pro Leu Val Ala 245 250 255 gag gat ttc cat cag tgg
gtg ctg gaa gac cag ttt gcg gat ggc cgt 1355 Glu Asp Phe His Gln
Trp Val Leu Glu Asp Gln Phe Ala Asp Gly Arg 260 265 270 ccg ccg ctt
gaa aaa gcc ggc gtg cag atg gtc ggg gac gtg acg gac 1403 Pro Pro
Leu Glu Lys Ala Gly Val Gln Met Val Gly Asp Val Thr Asp 275 280 285
tgg gag tac gtc aag atc cga atg ctc aat gca ggg cat gtc atg ctc
1451 Trp Glu Tyr Val Lys Ile Arg Met Leu Asn Ala Gly His Val Met
Leu 290 295 300 305 tgc ttc cca ggc att ctg gtc ggc tat gag aat gtg
gat gac gcc att 1499 Cys Phe Pro Gly Ile Leu Val Gly Tyr Glu Asn
Val Asp Asp Ala Ile 310 315 320 gaa gac agc gaa ctc ctt ggc aat ctg
aag aac tat ctc aac aag gat 1547 Glu Asp Ser Glu Leu Leu Gly Asn
Leu Lys Asn Tyr Leu Asn Lys Asp 325 330 335 gtc atc ccg acc ctg aag
gcg cct tca ggc atg acg ctc gaa ggc tat 1595 Val Ile Pro Thr Leu
Lys Ala Pro Ser Gly Met Thr Leu Glu Gly Tyr 340 345 350 cgg gac agc
gtc atc agc cgt ttc tcc aac aag gcg atg tcg gac cag 1643 Arg Asp
Ser Val Ile Ser Arg Phe Ser Asn Lys Ala Met Ser Asp Gln 355 360 365
acg ctc cgg att gct agc gat ggc tgt tcc aag gtt cag gtg ttc tgg
1691 Thr Leu Arg Ile Ala Ser Asp Gly Cys Ser Lys Val Gln Val Phe
Trp 370 375 380 385 acg gaa acc gtg cgt cgg gcg atc gaa gac aag cgg
gac ctg tca cgt 1739 Thr Glu Thr Val Arg Arg Ala Ile Glu Asp Lys
Arg Asp Leu Ser Arg 390 395 400 ata gcg ttc gga att gca tcc tat ctc
gaa atg ctg cgt ggt cgc gac 1787 Ile Ala Phe Gly Ile Ala Ser Tyr
Leu Glu Met Leu Arg Gly Arg Asp 405 410 415 gag aag ggc ggg acg tat
gaa tcg tcc gag ccg act tat ggc gac gcc 1835 Glu Lys Gly Gly Thr
Tyr Glu Ser Ser Glu Pro Thr Tyr Gly Asp Ala 420 425 430 gaa tgg aag
ttg gcc aag gcg gac gac ttc gaa agc tct ctg aag ctc 1883 Glu Trp
Lys Leu Ala Lys Ala Asp Asp Phe Glu Ser Ser Leu Lys Leu 435 440 445
ccg gcg ttc gat ggg tgg cgc gat ctg gat acg tcc gaa ctg gat caa
1931 Pro Ala Phe Asp Gly Trp Arg Asp Leu Asp Thr Ser Glu Leu Asp
Gln 450 455 460 465 aag gtc atc gtg ctg cgg aag atc atc cgc gaa aag
ggc gta aaa gcc 1979 Lys Val Ile Val Leu Arg Lys Ile Ile Arg Glu
Lys Gly Val Lys Ala 470 475 480 gcc atc ccg gcc tga attcggcttt
tagggtagcg actgaaacag aaaaccgcgc 2034 Ala Ile Pro Ala 485
tctggaagga gcgcggtttt ttttatgctc agatctgtcc catcaggaca aggatcacga
2094 cgaccacgat caggacaagt ccgctggagg gggagcccca tttcgaactg
tacggccatg 2154 acggcagcgc accgagatca ggattacaag aaggatcagt
cccatggcac atctctcttg 2214 ccggttgaga ctggtctgtg ttccgggtgt
ctaaaaagtt tccgtagggg cgcgaaagat 2274 caaagctgtc ggtcgcgctt
aatccggtcc caagccgcat tgatgcgggc cacccggtcc 2334 tgtgcgcgtt
tgcgctctgt ctctgacata ggtttctggg ccagcacgtc cggatgatgt 2394
tcgcggatca gggtgcgcca gcgcacgcgg atttctgtgt cagttgcgct gcgggtgatg
2454 ccgagaatac gataggcatc cggctcgttt ccgctggcgg cgcgattgtt
gccgctttcg 2514 gcccggtccc atgctcctgg cggcaggcca aatgccccgt
gaacgcgctg cagaaaatcg 2574 atttccttcg ggtgaagctc gcggctgggg
ccggcatcgg cacgggcgat acggaacagt 2634 gccgtcatga ggttctcaag
cggcgccgta ttatcggcat aggccttgcc catttcgcgg 2694 gcatacatct
cgaaatcgtc cgtccggtcg cgggcgcgat cgaacagcat gccgacttcc 2754
ttggtgttat cgggggggaa ctggaagcag gtcttgaaag cgttgatttc gtgtcggttc
2814 accggcccgt cgatcttcgc cagcttcgcg cacagggcaa caaggccgat
ggcgtaaagc 2874 tgatctcgtt tgcccagggc cgcagcaatc ttggcagcgc
cgaaaaaggc cgcgctgttg 2934 ggatcgggac ggccattcgc gggaaagcgc
tcactccagc cgcccgttga gggcttgagt 2994 agcgaaccgt tatcggcggc
atgccccagc gctgcgccca tcagtgctcc gaaaggacca 3054 ccaaccgcga
agcccgcgac accaccgaac atcttgcccc agatagccat gtcatcaacc 3114
tagcacgccc gctcacagcg gcaaatgaca gatcgcaggc taggtgtagg tgctgatgcg
3174 ccaaccgccc gggcttgcgg tgtggtagaa gctaggagtt acgaacttat
cgctgtctca 3234 tgcttttgag gcgcaggttc ttctgttcgt ttcatgacgg
atatttttat gcccaccttg 3294 atccagactg ctacttcgat ccctttccgc
tctgatgacg aactgatgga tcttttgatc 3354 aagcgtctgc caatgtggct
gcagaaagtg ctgaactggt tgcgggaagc ggatcataaa 3414 tgggttcgga
ttccggcggg cgtgctgttc atgctgggcg gcgttctgtc catcctgcct 3474
gttctgggtc tgtggatgct gccggtcggc gtgatgttgc ttgcgcagga tattccgttc
3534 ttccgtcgcc ttcagggccg cctcttgcgc tggatcgaac gtcaacatcc
ggattggctg 3594 ggccttccgg cgaaaagcgg cagaagctaa ccgttcgtct
ggacgtgttt ctgaagatgt 3654 gtcagtgctg caacccgcag ggctgaagcc
agtgggcgct ctggtggtcg cgcggcatcg 3714 agagaagcca ccagagacgc
aaagctctgc tggcggactg cggccatcgc gtccagtata 3774 gcccagaact
cgggttccag tgccacggac gtccggtgtc ctgacagaga caggctgcgt 3834
ttgacgagat cactcattcc ggttgtttct caaggcgctt caaagcccat tgtgcggttt
3894 cggaaacatc agggtccgga tcactcagca gctcccgcgc agaagatata
agcgacggat 3954 cggccgagtt gccgatcgcg atcaggacag ttacgtacga
accggttgcg tccaatccgt 4014 ttgaccggag agccagaaaa aaacgtccgg
aatgtcgcat tatccagccg caccagttcg 4074 tcgagttttg gtgcaatcag
ctccgggcgg gcctgaagct t 4115 2 485 PRT Gluconobacter oxydans 2 Met
Ile Thr Arg Glu Thr Leu Lys Ser Leu Pro Ala Asn Val Gln Ala 1 5 10
15 Pro Pro Tyr Asp Ile Asp Gly Ile Lys Pro Gly Ile Val His Phe Gly
20 25 30 Val Gly Asn Phe Phe Arg Ala His Glu Ala Phe Tyr Val Glu
Gln Ile 35 40 45 Leu Glu His Ala Pro Asp Trp Ala Ile Val Gly Val
Gly Leu Thr Gly 50 55 60 Ser Asp Arg Ser Lys Lys Lys Ala Glu Glu
Phe Lys Ala Gln Asp Cys 65 70 75 80 Leu Tyr Ser Leu Thr Glu Thr Ala
Pro Ser Gly Lys Ser Thr Val Arg 85 90 95 Val Met Gly Ala Leu Arg
Asp Tyr Leu Leu Ala Pro Ala Asp Pro Glu 100 105 110 Ala Val Leu Lys
His Leu Val Asp Pro Ala Ile Arg Ile Val Ser Met 115 120 125 Thr Ile
Thr Glu Gly Gly Tyr Asn Ile Asn Glu Thr Thr Gly Ala Phe 130 135 140
Asp Leu Glu Asn Ala Ala Val Lys Ala Asp Leu Lys Asn Pro Glu Lys 145
150 155 160 Pro Ser Thr Val Phe Gly Tyr Val Val Glu Ala Leu Arg Arg
Arg Trp 165 170 175 Asp Ala Gly Gly Lys Ala Phe Thr Val Met Ser Cys
Asp Asn Leu Arg 180 185 190 His Asn Gly Asn Val Ala Arg Lys Ala Phe
Leu Gly Tyr Ala Lys Ala 195 200 205 Arg Asp Pro Glu Leu Ala Lys Trp
Ile Glu Glu Asn Ala Thr Phe Pro 210 215 220 Asn Gly Met Val Asp Arg
Ile Thr Pro Thr Val Ser Ala Glu Ile Ala 225 230 235 240 Lys Lys Leu
Asn Ala Ala Ser Gly Leu Asp Asp Asp Leu Pro Leu Val 245 250 255 Ala
Glu Asp Phe His Gln Trp Val Leu Glu Asp Gln Phe Ala Asp Gly 260 265
270 Arg Pro Pro Leu Glu Lys Ala Gly Val Gln Met Val Gly Asp Val Thr
275 280 285 Asp Trp Glu Tyr Val Lys Ile Arg Met Leu Asn Ala Gly His
Val Met 290 295 300 Leu Cys Phe Pro Gly Ile Leu Val Gly Tyr Glu Asn
Val Asp Asp Ala 305 310 315 320 Ile Glu Asp Ser Glu Leu Leu Gly Asn
Leu Lys Asn Tyr Leu Asn Lys 325 330 335 Asp Val Ile Pro Thr Leu Lys
Ala Pro Ser Gly Met Thr Leu Glu Gly 340 345 350 Tyr Arg Asp Ser Val
Ile Ser Arg Phe Ser Asn Lys Ala Met Ser Asp 355 360 365 Gln Thr Leu
Arg Ile Ala Ser Asp Gly Cys Ser Lys Val Gln Val Phe 370 375 380 Trp
Thr Glu Thr Val Arg Arg Ala Ile Glu Asp Lys Arg Asp Leu Ser 385 390
395 400 Arg Ile Ala Phe Gly Ile Ala Ser Tyr Leu Glu Met Leu Arg Gly
Arg 405 410 415 Asp Glu Lys Gly Gly Thr Tyr Glu Ser Ser Glu Pro Thr
Tyr Gly Asp 420 425 430 Ala Glu Trp Lys Leu Ala Lys Ala Asp Asp Phe
Glu Ser Ser Leu Lys 435 440 445 Leu Pro Ala Phe Asp Gly Trp Arg Asp
Leu Asp Thr Ser Glu Leu Asp 450 455 460 Gln Lys Val Ile Val Leu Arg
Lys Ile Ile Arg Glu Lys Gly Val Lys 465 470 475 480 Ala Ala Ile Pro
Ala 485 3 16 DNA Artificial Sequence synthetic DNA 3 gctgctgagt
gatccg 16 4 17 DNA Artificial Sequence synthetic DNA 4 gactgctact
tcgatcc 17 5 16 DNA Artificial Sequence synthetic DNA 5 cctacaccta
gcctgc 16 6 16 DNA Artificial Sequence synthetic DNA 6 cagtgccgtc
atgagg 16 7 16 DNA Artificial Sequence synthetic DNA 7 tcctgatctc
ggtgcg 16 8 16 DNA Artificial Sequence synthetic DNA 8 gatgcttcag
cacggc 16 9 16 DNA Artificial Sequence synthetic DNA 9 gacgatcacg
gaaggc 16 10 16 DNA Artificial Sequence synthetic DNA 10 ggttacgtgg
tcgacg 16 11 17 DNA Artificial Sequence synthetic DNA 11 ctatacctga
caggtcc 17 12 16 DNA Artificial Sequence synthetic DNA 12
gcgcgatctg gatacg 16 13 16 DNA Artificial Sequence synthetic DNA 13
cgaggatctc gaacgg 16 14 18 DNA Artificial Sequence synthetic DNA 14
cggattgcta gcgatggc 18 15 47 DNA Artificial Sequence synthetic DNA
15 atcgaggatc ctcaatgatg atgatgatga tgggccggga tggcggc 47 16 30 DNA
Artificial Sequence synthetic DNA 16 atcgaggatc cattcggctt
ttagggtagc 30 17 28 DNA Artificial Sequence synthetic DNA 17
tagctgagct catgggacag atctgagc 28 18 10 PRT Gluconobacter oxydans
18 Met Ile Thr Arg Glu Thr Leu Lys Ser Leu 1 5 10 19 33 DNA
Artificial Sequence synthetic DNA 19 taggaatatt tctcatgatt
acgcgcgaaa ccc 33 20 16 DNA Artificial Sequence synthetic DNA 20
gatgcttcag cacggc 16
* * * * *