U.S. patent application number 10/874827 was filed with the patent office on 2004-11-25 for novel recombinant and mutant adenoviruses.
Invention is credited to Chiang, Christina H., Cochran, Mark D..
Application Number | 20040234549 10/874827 |
Document ID | / |
Family ID | 26826927 |
Filed Date | 2004-11-25 |
United States Patent
Application |
20040234549 |
Kind Code |
A1 |
Chiang, Christina H. ; et
al. |
November 25, 2004 |
Novel recombinant and mutant adenoviruses
Abstract
The present invention provides novel viral vectors. In one
embodiment, the present invention provides mutant and recombinant
bovine adenoviruses having a deletion and/or insertion of DNA in
the early gene region 4 (E4). In another embodiment, the present
invention provides mutant and recombinant bovine adenovirus 1
viruses having a deletion and/or insertion of DNA in the early gene
region 3 (E3). The present invention also contemplates the use of
the viral vectors for vaccination, gene therapy or other
applications as suitable.
Inventors: |
Chiang, Christina H.; (San
Diego, CA) ; Cochran, Mark D.; (Carlsbad,
CA) |
Correspondence
Address: |
SCHERING-PLOUGH CORPORATION
PATENT DEPARTMENT (K-6-1, 1990)
2000 GALLOPING HILL ROAD
KENILWORTH
NJ
07033-0530
US
|
Family ID: |
26826927 |
Appl. No.: |
10/874827 |
Filed: |
June 23, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10874827 |
Jun 23, 2004 |
|
|
|
10199520 |
Jul 19, 2002 |
|
|
|
10199520 |
Jul 19, 2002 |
|
|
|
09545481 |
Apr 7, 2000 |
|
|
|
6451319 |
|
|
|
|
60128766 |
Apr 9, 1999 |
|
|
|
Current U.S.
Class: |
424/199.1 ;
435/235.1 |
Current CPC
Class: |
C12N 2710/10343
20130101; C12N 15/86 20130101; A61P 31/12 20180101 |
Class at
Publication: |
424/199.1 ;
435/235.1 |
International
Class: |
A61K 039/12; C12N
007/00 |
Claims
1-7. (canceled)
8. A mutant virus comprising a deletion of at least a portion of
the E4 gene region of a bovine adenovirus.
9. The mutant virus of claim 8 which also has a foreign DNA
sequence inserted into the E4 gene region.
10. The mutant virus of claim 8, wherein at least one open reading
frame of said E4 gene region of said bovine adenovirus is
completely deleted.
11. A recombinant virus comprising a foreign DNA sequence inserted
into the E3 gene region of a bovine adenovirus 1.
12. The mutant virus of claim 11, wherein said foreign DNA encodes
a polypeptide from a virus or bacteria selected from the group
consisting of bovine rotavirus, bovine coronavirus, bovine herpes
virus type 1, bovine respiratory syncytial virus, bovine para
influenza virus type 3 (BPI-3), bovine diarrhea virus, bovine
rhinotracheitis virus, bovine parainfluenza type 3 virus,
Pasteurella haemolytica, Pasteurella multocida and/or Haemophilus
somnus.
13. The mutant virus of claim 12, wherein said polypeptide
comprises more than ten amino acids.
14. The mutant virus of claim 12, wherein said polypeptide is
antigenic.
15. The mutant virus of claim 12, wherein said foreign DNA sequence
is under control of a promoter located upstream of said foreign DNA
sequence.
16. A mutant virus comprising a deletion of at least a portion of
the E3 gene region of a bovine adenovirus 1.
17. The mutant virus of claim 16 which also has a foreign DNA
sequence inserted into the E3 gene region.
18. The mutant virus of claim 16, wherein at least one open reading
frame of said E3 gene region of said bovine adenovirus 1 is
completely deleted.
19. A vaccine comprising the mutant virus of claim 9.
20. A method of inducing an immunological response in an animal,
comprising introducing the vaccine of claim 19 to said animal.
21. A vaccine comprising the mutant virus of claim 10.
22. A method of inducing an immunological response in an animal
comprising introducing the vaccine of claim 21 to said animal.
23. A vaccine comprising the mutant virus of claim 14.
24. A method of inducing an immunological response in an animal
comprising introducing the vaccine of claim 23 to said animal.
Description
[0001] The benefit of the Apr. 9, 1999 filing date of Provisional
Application No. 60/128,766 is claimed.
FIELD OF THE INVENTION
[0002] The present invention relates to viral vectors for
vaccination of animals. In particular, the present invention
pertains to viral vectors having insertion sites for the
introduction of foreign DNA.
BACKGROUND OF THE INVENTION
[0003] The adenoviruses cause enteric or respiratory infection in
humans as well as in domestic and laboratory animals.
[0004] Inserting genes into adenoviruses has been accomplished. In
the human adenovirus (HuAd) genome there are two important regions:
E1 and E3 in which foreign genes can be inserted to generate
recombinant adenoviruses.
[0005] This application of genetic engineering has resulted in
several attempts to prepare adenovirus expression systems for
obtaining vaccines. Examples of such research include the
disclosure of U.S. Pat. No. 4,510,245 of an adenovirus major late
promoter for expression in a yeast host; U.S. Pat. No. 4,920,209 of
a live recombinant adenovirus type 7 with a gene coding for
hepatitis-B surface antigen; European patent No. 389,286 of a
non-defective human adenovirus 5 recombinant expression system in
human cells; and published International application No. WO
91/11525 of live non-pathogenic immunogenic viable canine
adenovirus in a cell.
[0006] However, because they are more suitable for entering a host
cell, an indigenous adenovirus vector would be better suited for
use as a live recombinant virus vaccine in different animal species
compared to an adenovirus of human origin. For example, bovine
adenovirus-based expression vectors have been reported for bovine
adenovirus 3 (BAV-3) (see U.S. Pat. No. 5,820,868).
[0007] Bovine adenoviruses (BAVs) comprise at least nine serotypes
divided into two subgroups. These subgroups have been characterized
based on enzyme-linked immunoassays (ELISA), serologic studies with
immunofluorescence assays, virus-neutralization tests,
immunoelectron microscopy and by their host specificity and
clinical syndromes. Subgroup 1 viruses include BAV 1, 2, 3 and 9
and grow relatively well in established bovine cells compared to
subgroup 2 viruses which include BAV 4, 5, 6, 7 and 8.
[0008] BAV-3 was first isolated in 1965 and is the best
characterized of the BAV genotypes and contains a genome of
approximately 35 kilobases. The locations of hexon and proteinase
genes in the BAV-3 genome have been identified and sequenced.
[0009] Genes of the bovine adenovirus 1 (BAV-1) genome have also
been identified and sequenced. However, the location and sequences
of other genes such as certain early gene regions in the BAV genome
have not been reported.
[0010] The continued identification of suitable viruses and gene
insertion sites are valuable for the development of new vaccines.
The selection of (i) a suitable virus and (ii) the particular
portion of the genome to use as an insertion site for creating a
vector for foreign gene expression, however, pose a significant
challenge. In particular, the insertion site must be non-essential
for the viable replication of the virus, as well as its operation
in tissue culture and in vivo. Moreover, the insertion site must be
capable of accepting new genetic material, while ensuring that the
virus continues to replicate.
[0011] What is needed is the identification of novel viruses and
gene insertion sites for the creation of new viral vectors.
SUMMARY OF THE INVENTION
[0012] In one embodiment, the present invention provides
recombinant viruses. While not limited to a particular use, these
recombinant viruses can be used to generate vaccines.
[0013] While not limited to a particular virus, in one embodiment
the present invention provides a recombinant virus comprising a
foreign DNA sequence inserted into the E4 gene region of a bovine
adenovirus. In a preferred embodiment, the insertion is to a
non-essential site. In another embodiment, the present invention
provides a recombinant virus comprising a foreign DNA sequence
inserted into the E3 gene region of a bovine adenovirus 1. In a
preferred embodiment, the insertion is to a non-essential site.
[0014] While not limited to its ability to replicate, in a
preferred embodiment, the recombinant virus is replication
competent. Likewise, while not limited to the foreign DNA to be
inserted, in a preferred embodiment, the foreign DNA encodes a
polypeptide and is from a virus or bacteria selected from the group
consisting of bovine rotavirus, bovine coronavirus, bovine herpes
virus type 1, bovine respiratory syncytial virus, bovine para
influenza virus type 3 (BPI-3), bovine diarrhea virus, bovine
rhinotracheitis virus, bovine parainfluenza type 3 virus,
Pasteurella haemolytica, Pasteurella multocida and/or Haemophilus
somnus. In another preferred embodiment, the foreign DNA encodes a
cytokine. In a further preferred embodiment, the polypeptide
comprises more than ten amino acids and is antigenic. Finally, in a
particularly preferred embodiment, the foreign DNA sequence is
under the control of a promoter located upstream of the foreign DNA
sequence.
[0015] The present invention also contemplates mutant viruses.
While not limited to a particular mutant virus, in one embodiment,
the mutant virus comprises a deletion of at least a portion of the
E4 gene region of a bovine adenovirus. In a preferred embodiment,
the deletion is of a non-essential site. In another embodiment, the
virus comprises a deletion of at least a portion of the E3 gene
region of a bovine adenovirus 1. In a preferred embodiment, the
mutant virus is replication competent. In a further preferred
embodiment, at least one open reading frame of the relevant gene
region of the bovine adenovirus is completely deleted.
[0016] In yet another embodiment, the present invention provides a
method for preparing a recombinant virus comprising inserting at
least one foreign gene or gene fragment that encodes at least one
antigen into the genome of a virus wherein said gene or gene
fragment has been inserted into the early gene region 4 of a bovine
adenovirus or inserted into the early gene region 3 of bovine
adenovirus 1. In a preferred embodiment, the method includes the
insertion of at least a part of the genome of a virus into a
bacterial plasmid, transforming said bacteria with said plasmid,
and incubating said bacteria at approximately 25.degree. C.
[0017] In another embodiment, the present invention provides
vaccines. While not limited to a particular vaccine, in one
embodiment, the vaccines comprise the recombinant viruses described
above.
[0018] The present invention also contemplates methods of
vaccination, including, but not limited to, the introduction of the
above-described vaccines to an animal.
[0019] Definitions
[0020] The term, "animal" refers to organisms in the animal
kingdom. Thus, this term includes humans, as well as other
organisms. Preferably, the term refers to vertebrates. More
preferably, the term refers to bovine animals.
[0021] A "vector" is a replicon, such as a plasmid, phage, cosmid
or virus, to which another DNA sequence may be attached so as to
bring about the expression of the attached DNA sequence.
[0022] For purposes of this invention, a "host cell" is a cell used
to propagate a vector and its insert. Infecting the cell can be
accomplished by methods well known to those skilled in the art, for
example, as set forth in Transfection of BAV-1 DNA below.
[0023] A DNA "coding sequence" is a DNA sequence which is
transcribed and translated into a polypeptide in vivo when placed
under the control of appropriate regulatory sequences. The
boundaries of the coding sequence are determined by a start codon
at the 5' (amino) terminus and a translation stop codon at the 3'
(carboxy) terminus. A coding sequence can include, but is not
limited to, procaryotic sequences, cDNA from eucaryotic mRNA,
genomic DNA sequences from eucaryotic (e.g., mammalian) DNA, viral
DNA, and even synthetic DNA sequences. A polyadenylation signal and
transcription termination sequence can be located 3' to the coding
sequence.
[0024] A "promoter sequence" is a DNA regulatory region capable of
binding RNA polymerase or an auxiliary protein and initiating
transcription of a downstream (3' direction) coding sequence. For
purposes of defining the present invention, the promoter sequence
is in close proximity to the 5' terminus by the translation start
codon (ATG) of a coding sequence and extends upstream (5'
direction) to include the minimum number of bases or elements
necessary to facilitate transcription at levels detectable above
background. Within the promoter sequence will be found a
transcription initiation site, as well as protein binding domains
(consensus sequences) responsible for the binding of RNA
polymerase. Eucaryotic promoters will often, but not always,
contain "TATA" boxes and "CAAT" boxes, conserved sequences found in
the promoter region of many eucaryotic organisms.
[0025] A coding sequence is "operably linked to" or "under the
control of" promoter or control sequences in a cell when RNA
polymerase will interact with the promoter sequence directly or
indirectly and result in transcription of the coding sequence into
mRNA, which is then translated into the polypeptide encoded by the
coding sequence.
[0026] A "double-stranded DNA molecule" refers to the polymeric
form of deoxyribonucleotides (adenine, guanine, thymine, or
cytosine) in its normal, double-stranded helix. This term refers
only to the primary and secondary structure of the molecule, and
does not limit it to any particular tertiary forms. Thus, this term
includes, for example, double-stranded DNA found in linear DNA
molecules (e.g., restriction fragments of DNA from viruses,
plasmids, and chromosomes), as well as circular and concatamerized
forms of DNA.
[0027] A "foreign DNA sequence" is a segment of DNA that has been
or will be attached to another DNA molecule using recombinant
techniques wherein that particular DNA segment is not found in
association with the other DNA molecule in nature. The source of
such foreign DNA may or may not be from a separate organism than
that into which it is placed. The foreign DNA may also be a
synthetic sequence having codons different from the native gene.
Examples of recombinant techniques include, but are not limited to,
the use of restriction enzymes and ligases to splice DNA.
[0028] An "insertion site" is a restriction site in a DNA molecule
into which foreign DNA can be inserted.
[0029] For purposes of this invention, a "homology vector" is a
plasmid constructed to insert foreign DNA sequence in a specific
site on the genome of an adenovirus.
[0030] The term "open reading frame" or "ORF" is defined as a
genetic coding region for a particular gene that, when expressed,
can produce a complete and specific polypeptide chain protein.
[0031] A cell has been "transformed" with exogenous DNA when such
exogenous DNA has been introduced inside the cell membrane.
Exogenous DNA may or may not be integrated (covalently linked) to
chromosomal DNA making up the genome of the cell. In procaryotes
and yeasts, for example, the exogenous DNA may be maintained on an
episomal element, such as a plasmid. A stably transformed cell is
one in which the exogenous DNA has become integrated into the
chromosome so that it is inherited by daughter cells through
chromosome replication. For mammalian cells, this stability is
demonstrated by the ability of the cell to establish cell lines or
clones comprised of a population of daughter cells containing the
exogenous DNA.
[0032] A "replication competent virus" is a virus whose genetic
material contains all of the DNA or RNA sequences necessary for
viral replication as are found in a wild-type of the organism.
Thus, a replication competent virus does not require a second virus
or a cell line to supply something defective in or missing from the
virus in order to replicate. A "non-essential site in the
adenovirus genome" means a region in the adenovirus genome, the
polypeptide product or regulatroy sequence of which is not
necessary for viral infection or replication.
[0033] Two polypeptide sequences are "substantially homologous"
when at least about 80% (preferably at least about 90%, and most
preferably at least about 95%) of the amino acids match over a
defined length of the molecule.
[0034] Two DNA sequences are "substantially homologous" when they
are identical to or not differing in more that 40% of the
nucleotides, more preferably about 20% of the nucleotides, and most
preferably about 10% of the nucleotides.
[0035] A virus that has had a foreign DNA sequence inserted into
its genome is a "recombinant virus," while a virus that has had a
portion of its genome removed by intentional deletion (e.g., by
genetic engineering) is a "mutant virus."
[0036] The term "polypeptide" is used in its broadest sense, i.e.,
any polymer of amino acids (dipeptide or greater) linked through
peptide bonds. Thus, the term "polypeptide" includes proteins,
oligopeptides, protein fragments, analogs, muteins, fusion
proteins, etc.
[0037] "Antigenic" refers to the ability of a molecule containing
one or more epitopes to stimulate an animal or human immune system
to make a humoral and/or cellular antigen-specific response. An
"antigen" is an antigenic polypeptide.
[0038] An "immunological response" to a composition or vaccine is
the development in the host of a cellular and/or antibody-mediated
immune response to the composition or vaccine of interest. Usually,
such a response consists of the subject producing antibodies, B
cells, helper T cells, suppressor T cells, and/or cytotoxic T cells
directed specifically to an antigen or antigens included in the
composition or vaccine of interest.
[0039] The terms "immunogenic polypeptide" and "immunogenic amino
acid sequence" refer to a polypeptide or amino acid sequence,
respectively, which elicit antibodies that neutralize viral
infectivity, and/or mediate antibody-complement or antibody
dependent cell cytotoxicity to provide protection of an immunized
host. An "immunogenic polypeptide" as used herein, includes the
full length (or near full length) sequence of the desired protein
or an immunogenic fragment thereof.
[0040] By "immunogenic fragment" is meant a fragment of a
polypeptide which includes one or more epitopes and thus elicits
antibodies that neutralize viral infectivity, and/or mediates
antibody-complement or antibody dependent cell cytotoxicity to
provide protection of an immunized host. Such fragments will
usually be at least about 5 amino acids in length, and preferably
at least about 10 to 15 amino acids in length. There is no critical
upper limit to the length of the fragment, which could comprise
nearly the full length of the protein sequence, or even a fusion
protein comprising fragments of two or more of the antigens.
[0041] By "infectious" is meant having the capacity to deliver the
viral genome into cells.
[0042] A "substantially pure" protein will be free of other
proteins, preferably at least 10% homogeneous, more preferably 60%
homogeneous, and most preferably 95% homogeneous.
BRIEF DESCRIPTION OF THE DRAWING FIGURE
[0043] FIG. 1 is a diagram of BAV-1 genomic DNA showing the
relative size of various regions in kilobase pairs. Fragments are
lettered in order of decreasing size.
DETAILED DESCRIPTION OF THE INVENTION
[0044] Throughout this disclosure, various publications, patents
and patent applications are referenced. The disclosures of these
publications, patents and patent applications are herein
incorporated by reference.
[0045] The methods and compositions of the present invention
involve modifying DNA sequences from various prokaryotic and
eucaryotic sources and by gene insertions, gene deletions, single
or multiple base changes, and subsequent insertions of these
modified sequences into the genome of an adenovirus. One example
includes inserting parts of an adenovirus DNA into plasmids in
bacteria, reconstructing the virus DNA while in this state so that
the DNA contains deletions of certain sequences, and/or furthermore
adding foreign DNA sequences either in place of the deletions or at
sites removed by the deletions.
[0046] Generally, the foreign gene construct is cloned into an
adenovirus nucleotide sequence which represents only a part of the
entire adenovirus genome, which may have one or more appropriate
deletions. This chimeric DNA sequence is usually present in a
plasmid which allows successful cloning to produce many copies of
the sequence. The cloned foreign gene construct can then be
included in the complete viral genome, for example, by in vivo
recombination following a DNA-mediated cotransfection technique.
Multiple copies of a coding sequence or more than one coding
sequences can be inserted into the viral genome so that the
recombinant virus can express more than one foreign protein or
multiple copies of the same protein. The foreign gene can have
additions, deletions or substitutions to enhance expression and/or
immunological effects of the expressed protein.
[0047] In order for successful expression of the gene to occur, it
can be inserted into an expression vector together with a suitable
promoter including enhancer elements and polyadenylation sequences.
A number of eucaryotic promoter and polyadenylation sequences which
provide successful expression of foreign genes in mammalian cells
and how to construct expression cassettes, are known in the art,
for example in U.S. Pat. No. 5,151,267. The promoter is selected to
give optimal expression of immunogenic protein which in turn
satisfactorily leads to humoral, cell mediated and mucosal immune
responses according to known criteria.
[0048] The polypeptide encoded by the foreign DNA sequence is
produced by expression in vivo in a recombinant virus-infected
cell. The polypeptide may be immunogenic. More than one foreign
gene can be inserted into the viral-genome to obtain successful
production of more than one effective protein.
[0049] Therefore, one utility of the use of a mutant adenovirus or
the addition of a foreign DNA sequence into the genome of an
adenovirus is to vaccinate an animal. For example, a mutant virus
could be introduced into an animal to elicit an immune response to
the mutant virus.
[0050] Alternatively, a recombinant adenovirus having a foreign DNA
sequence inserted into its genome that encodes a polypeptide may
also serve to elicit an immune response in an animal to the foreign
DNA sequence, the polypeptide encoded by the foreign DNA sequence
and/or the adenovirus itself. Such a virus may also be used to
introduce foreign DNA and its products into the host animal to
alleviate a defective genomic condition in the host animal or to
enhance the genomic condition of the host animal.
[0051] While the present invention is not limited to the use of
particular viral vectors, in preferred embodiments the present
invention utilizes bovine adenovirus expression vector systems. In
particularly preferred embodiments, the present invention comprises
a bovine adenovirus in which part or all of the E4 gene region is
deleted and/or into which foreign DNA is introduced. Alternatively,
the system comprises a bovine adenovirus 1 (BAV-1) in which part or
all of the E3 and/or E4 gene regions are deleted and/or into which
foreign DNA is introduced.
[0052] The present invention is not limited by the foreign genes or
coding sequences (viral, prokaryotic, and eukaryotic) that are
inserted into a bovine adenovirus nucleotide sequence in accordance
with the present invention. Typically the foreign DNA sequence of
interest will be derived from pathogens that in bovine cause
diseases that have an economic impact on the cattle or dairy
industry. The genes may be derived from organisms for which there
are existing vaccines, and because of the novel advantages of the
vectoring technology, the adenovirus derived vaccines will be
superior. Also, the gene of interest may be derived from pathogens
for which there is currently no vaccine but where there is a
requirement for control of the disease. Typically, the gene of
interest encodes immunogenic polypeptides of the pathogen and may
represent surface proteins, secreted proteins and structural
proteins.
[0053] The present invention is not limited by the particular
organisms from which a foreign DNA sequence is obtained for gene
insertion into a bovine adenovirus genome. In preferred
embodiments, the foreign DNA is from bovine rotavirus, bovine
coronavirus, bovine herpes virus type 1, bovine respiratory
syncytial virus, bovine para influenza virus type 3 (BPI-3), bovine
diarrhea virus, bovine rhinotracheitis virus, bovine parainfluenza
type 3 virus, Pasteurella haemolytica, Pasteurella multocida and/or
Haemophilus somnus. In another preferred embodiment, the foreign
DNA encodes a cytokine.
[0054] The present invention is also not limited to the use of a
particular DNA sequence from such an organism. Often selection of
the foreign DNA sequence to be inserted into an adenovirus genome
is based upon the protein it encodes. Preferably, the foreign DNA
sequence encodes an immunogenic polypeptide.
[0055] The preferred immunogenic polypeptide to be expressed by the
virus systems of the present invention contain full-length (or near
full-length) sequences encoding antigens. Alternatively, shorter
sequences that are immunogenic (i.e., encode one or more epitopes)
can be used. The shorter sequence can encode a neutralizing
epitope, which is defined as an epitope capable of eliciting
antibodies that neutralize virus infectivity in an in vitro assay.
Preferably the peptide should encode a protective epitope that is
capable of raising in the host an protective immune response; i.e.,
an antibody-mediated and/or a cell-mediated immune response that
protects an immunized host from infection. In some cases the gene
for a particular antigen can contain a large number of introns or
can be from an RNA virus. In these cases a complementary DNA copy
(cDNA) can be used.
[0056] It is also possible to use fragments of nucleotide sequences
of genes rather than the complete sequence as found in the
wild-type organism. Where available, synthetic genes or fragments
thereof can also be used. However, the present invention can be
used with a wide variety of genes and/or fragment and is not
limited to those set out herein.
[0057] Thus, the antigens encoded by the foreign DNA sequences used
in the present invention can be either native or recombinant
immunogenic polypeptides or fragments. They can be partial
sequences, full-length sequences, or even fusions (e.g., having
appropriate leader sequences for the recombinant host and/or with
an additional antigen sequence for another pathogen).
[0058] The present invention is also not limited by the ability of
the resulting recombinant and mutant viruses to replicate. In a
preferred embodiment, the mutant and recombinant viruses of the
present invention are replication competent. In this manner, a
complimenting cell line is not necessary to produce adequate
supplies of virus.
[0059] As stated above, the present invention contemplates the
administration of the recombinant and mutant viruses of the present
invention to vaccinate an animal. The present invention is not
limited by the nature of administration to an animal. For example,
the antigens used in the present invention, particularly when
comprised of short oligopeptides, can be conjugated to a vaccine
carrier. Vaccine carriers are well known in the art: for example,
bovine serum albumin (BSA), human serum albumin (HSA) and keyhole
limpet hemocyanin (KLH). A preferred carrier protein, rotavirus
VP6, is disclosed in EPO Pub. No. 0259149.
[0060] The vaccines of the present invention carrying foreign genes
or fragments can also be orally administered in a suitable oral
carrier, such as in an enteric-coated dosage form. Oral
formulations include such normally-employed excipients as, for
example, pharmaceutical grades of mannitol, lactose, starch,
magnesium stearate, sodium saccharin cellulose, magnesium
carbonate, etc. Oral vaccine compositions may be taken in the form
of solutions (e.g., water), suspensions, tablets, pills, capsules,
sustained release formulations, or powders, containing from about
10% to about 95% of the active ingredient, preferably about 25% to
about 70%. An oral vaccine may be preferable to raise mucosal
immunity in combination with systemic immunity, which plays an
important role in protection against pathogens infecting the
gastrointestinal tract.
[0061] In addition, the vaccine can be formulated into a
suppository. For suppositories, the vaccine composition will
include traditional binders and carriers, such as polyalkaline
glycols or triglycerides. Such suppositories may be formed from
mixtures containing the active ingredient in the range of about
0.5% to about 10% (w/w), preferably about 1% to about 2%.
[0062] Protocols for administering the vaccine composition(s) of
the present invention to animals are within the skill of the art in
view of the present disclosure. Those skilled in the art will
select a concentration of the vaccine composition in a dose
effective to elicit an antibody and/or T-cell mediated immune
response to the antigenic fragment.
[0063] The timing of administration may also be important. For
example, a primary inoculation preferably may be followed by
subsequent booster inoculations if needed. It may also be
preferred, although optional, to administer a second, booster
immunization to the animal several weeks to several months after
the initial immunization. To insure sustained high levels of
protection against disease, it may be helpful to readminister a
booster immunization to the animals at regular intervals, for
example once every several years. Alternatively, an initial dose
may be administered orally followed by later inoculations, or vice
versa. Preferred vaccination protocols can be established through
routine vaccination protocol experiments.
[0064] The dosage for all routes of administration of an in vivo
recombinant virus vaccine depends on various factors, including the
size of the patient, the nature of the infection against which
protection is needed, the type of carrier and other factors, which
can readily be determined by those of skill in the art. By way of
non-limiting example, a dosage of between 10.sup.3 plaque forming
units (pfu) and 10.sup.8 pfu can be used.
[0065] The present invention also includes a method for providing
gene therapy to a mammal in need thereof to control a gene
deficiency. In one embodiment, the methods comprises administering
to said mammal a live recombinant bovine adenovirus containing a
foreign nucleotide sequence encoding a non-defective form of a
gene. The foreign nucleotide sequence is either incorporated into
the mammalian genome or is maintained independently to provide
expression of the required gene in the target organ or tissue.
These kinds of techniques have recently been used by those of skill
in the art to replace a defective gene or portion thereof. For
example, U.S. Pat. No. 5,399,346 to Anderson et al. describes
techniques for gene therapy. Moreover, examples of foreign genes
nucleotide sequences or portions thereof that can be incorporated
for use in a conventional gene therapy include, but are not limited
to, cystic fibrosis transmembrane conductance regulator gene, human
minidystrophin gene, alpha 1-antitrypsin gene and others.
[0066] Methods for constructing, selecting and purifying
recombinant adenovirus are detailed below in the materials, methods
and examples below. The following serve to illustrate certain
preferred embodiments and aspects of the present invention and are
not to be construed as limiting the scope thereof.
[0067] Preparation of Bovine Adenovirus (BAV-1) Stock
[0068] Bovine adenovirus stocks were prepared by infecting tissue
culture cells, Madin-Darby bovine kidney cells (MDBK), at a
multiplicity of infection of 0.01 PFU/cell in Dulbecco's Modified
Eagle Medium (DMEM) containing 2 mM glutamine, 100 units/ml
penicillin, 100 units/ml streptomycin (these components are
obtained from Sigma (St. Louis, Mo.) or an equivalent supplier, and
hereafter are referred to as complete DME medium) plus 1% fetal
bovine serum. After cytopathic effect was complete, the medium and
cells were harvested. After one or two cycles of freezing
(-70.degree. C.) and thawing (37.degree. C.), the infected cells
were aliquot as 1 ml stock and stored frozen at -70.degree. C.
[0069] Preparation of Bovine Adenovirus (BAV-1) DNA
[0070] All manipulations of bovine adenovirus were made using
strain 10 (ATCC VR-313). For the preparation of BAV-1 viral DNA
from the cytoplasm of infected cells, MDBK cells were infected at a
multiplicity of infection (MOI) sufficient to cause extensive
cytopathic effect before the cells overgrew. All incubations were
carried out at 37.degree. C. in a humidified incubator with 5% CO,
in air.
[0071] The best DNA yields were obtained by harvesting monolayers
which were maximally infected, but showing incomplete cell lysis
(typically 5-7 days). Infected cells were harvested by scraping the
cells into the medium using a cell scraper (Costar brand). The cell
suspension was centrifuged at 3000 rpm for 10 minutes at 5.degree.
C. in a GS-3 rotor (Sorvall Instruments, Newtown, Conn.). The
resultant pellet was resuspended in cold PBS (20 ml/Roller Bottle)
and subjected to another centrifugation for 10 minutes at 3000 rpm
in the cold.
[0072] After decanting the PBS, the cellular pellet was resuspended
in 5 ml/roller bottle of TE buffer (10 mM Tris pH 7.5 and 1 mM
EDTA) and swell on ice for 15 minutes. NP40 (Nonidet P-40.TM.;
Sigma, St. Louis, Mo.) was added to the sample to a final
concentration of 0.5% and keep on ice for another 15 minutes. The
sample was centrifuged for 10 minutes at 3000 rpm in the cold to
pellet the nuclei and remove cellular debris.
[0073] The supernatant fluid was carefully transferred to a 30 ml
Corex centrifuge tube. SDS (sodium dodecyl sulfate; stock 20%) were
added to the sample to final concentrations of 1%. 200 .mu.l of
proteinase-K at 10 mg/ml (Boehringer Mannheim, Indianapolis, Ind.)
was added per roller bottle of sample, mixed, and incubated at
45.degree. C. for 1-2 hours.
[0074] After this period, an equal volume of water-saturated phenol
was added to the sample and mixed by vortex. The sample was spun in
a clinical centrifuge for 5 minutes at 3000 rpm to separate the
phases. NaAc was added to the aqueous phase to a final
concentration of 0.3M (stock solution 3M pH 5.2), and the nucleic
acid precipitated at -70.degree. C. for 30 minutes after the
addition of 2.5 volumes of cold absolute ethanol. DNA in the sample
was pelleted by spinning for 20 minutes to 8000 rpm in an HB-4
rotor at 4.degree. C.
[0075] The supernatant was carefully removed and the DNA pellet
washed once with 25 ml of 80% ethanol. The DNA pellet was dried
briefly by vacuum (2-3 minutes), and resuspended in 2 ml/roller
bottle of infected cells of TE buffer (20 mM Tris pH 7.5, 1 mM
EDTA). 1011 of RNaseA at 10 mg/ml (Sigma, St. Louis, Mo.) was added
and incubate at 37.degree. C. for one hour. 0.5 ml of 5N NaCl and
0.75 ml of 30% PEG was added and precipitated at 4.degree. C.
overnight.
[0076] DNA in the sample was pelleted by spinning for 20 minutes to
8000 rpm in an HB-4 rotor at 4.degree. c. Resuspend pellet in 2 ml
TES buffer (20 mM Tris pH7.5, 1 mM EDTA and 0.2% SDS) and extracted
with an equal volume of water-saturated phenol. The sample was spun
in a clinical centrifuge for 5 minutes at 3000 rpm to separate the
phases. NaAc was added to the aqueous phase to a final
concentration of 0.3M (stock solution 3M pH 5.2), and the nucleic
acid precipitated at -70.degree. C. for 30 minutes after the
addition of 2.5 volumes of cold absolute ethanol.
[0077] DNA in the sample was pelleted by spinning for 20 minutes to
8000 rpm in an HB-4 rotor at 5.degree. C. The supernatant was
carefully removed and the DNA pellet washed once with 25 ml of 80%
ethanol. The DNA pellet was dried briefly by vacuum (2-3 minutes),
and resuspended in 200 .mu.l/roller bottle of infected cells of TE
buffer (10 mM Tris pH 7.5, 1 mM EDTA). All viral DNA was stored at
approximately 4.degree. C.
[0078] Molecular Biological Techniques.
[0079] Techniques for the manipulation of bacteria and DNA,
including such procedures as digestion with restriction
endonucleases, gel electrophoresis, extraction of DNA from gels,
ligation, phosphorylation with kinase, treatment with phosphatase,
growth of bacterial cultures, transformation of bacteria with DNA,
and other molecular biological methods are described by Maniatis et
al. (T. Maniatis, et al., Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor, N.Y. (1982)) and Sambrook et al. (J. Sambrook,
et al., Molecular Cloning: A Laboratory Manual Second Edition, Cold
Spring Harbor Press, Cold Spring Harbor, N.Y. (1989)). The
polymerase chain reaction (PCR) was used to introduce restriction
sites convenient for the manipulation of various DNAs. The
procedures used are described by Innis et al (M. A. Innis, et al.,
PCR Protocols: A Guide To Methods And Applications, pp. 84-91,
Academic Press, Inc., San Diego, Calif. (1990)).
[0080] In general, amplified fragments were less than 2000 base
pairs in size and critical regions of amplified fragments were
confirmed by DNA sequencing. Except as noted, these techniques were
used with minor variations.
[0081] DNA Sequencing
[0082] DNA sequencing was performed on the Applied Biosystems
Automated Sequencer Model 373A (with XL upgrade) per instructions
of the manufacturer. Subclones were made to facilitate sequencing.
Internal primers were synthesized on an ABI 392 DNA synthesizer or
obtained commercially (Genosys Biotechnologies, Inc., The
Woodlands, Tex.). Larger DNA sequences were built utilizing
consecutive overlapping primers. Sequence across the junctions of
large genomic subclones was determined directly using a full length
genomic clone as template Assembly, manipulation and comparison of
sequences was performed with DNAstar programs. Comparisons with
GenBank were performed using NCBI BLAST programs (Altschul, Stephen
F., Thomas L.-Madden, Alejandro A. Schffer, Jinghui Zhang, Zheng
Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs",
Nucleic Acids Res. 25:3389-3402.).
[0083] Construction of Recombinant BAV-1 Genomes in E. coli
[0084] Recombinant BAV-1 genomes are constructed by homologous
recombination according to the method of C. Chartier et al (1996)
J. of Virology 70:805-4810.
[0085] A small, easily manipulated plasmid was constructed
containing approximately 1000 base pairs each of the Left and Right
ends of the BAV-1 genome. Homologous recombination between this
vector and BAV-1 genomic DNA results in a plasmid containing the
entire BAV-1 genome (adenoviral backbone vector). This BAV-1
genomic plasmid may be used to generate recombinant genomes by
linearization of the plasmid and recombination with homology DNAs
engineered to contain foreign DNA flanked by DNA derived from the
desired BAV-1 insertion site. Note that in order to linearize the
adenoviral backbone vector, an infrequent cutting enzyme must be
located within the region analogous to the flanking BAV-1
sequences.
[0086] We have mapped the restriction sites of such an enzyme. PvuI
cuts the BAV-1 genome at two locations one in the BamH1 D fragment
and one in the BamH1 C fragment (see FIG. 1). The adenoviral
backbone vector contains a third PvuI site within the antibiotic
resistance gene of the plasmid. The PvuI site within the BamH1 C
fragment is suitable for gene insertion sites within both the E3
and E4 regions. Therefore a partial PvuI digestion of the
adenoviral backbone vector will yield a sub population of molecules
linearized at the PvuI site in the BamH1 C fragment. These
molecules may recombine with the homology DNA to generate a viable
plasmid. Molecules linearized at the other two sites will not be
able to recombine to generate viable plasmids.
[0087] The high competence of bacteria cells E. coli BJ5183 recBC
sbcBC (D. Hanahan (1983) J. Mol. Biol. 166:557-580) is desired to
achieve efficient recombination. Typically, 10 nanograms of a
restriction fragment containing foreign DNA flanked by the
appropriate BAV insertion sequences (homology DNA) is mixed with 1
nanogram of linearized adenoviral backbone vector in a total volume
of 10 .mu.l. Fifty microliters of competent BJ5183 cells were
added. After 15 min. on ice, 5 min. at 37.degree. C. and 15 min. on
ice, 200 .mu.l of LB was added and the cells plated on agar
containing LB+80 .mu.g/ml carbenicillin, after one hour at
37.degree. C.
[0088] Low temperature (25-27.degree. C.) for growing small scale
cultures (for screening carbenicillin resistant colonies) and
subsequent large scale cultures (for isolation of large quantities
of plasmid DNA) is essential. Carb.sup.R colonies were first grown
in 4-5 ml cultures at 25-27.degree. C. for two days. Small scale
DNAs were prepared using boiling method (J. Sambrook, et al.,
Molecular Cloning: A Laboratory Manual Second Edition, Cold Spring
Harbor Press, Cold Spring Harbor, N.Y. (1989)) and analyzed by DNA
restriction analysis. To purify the DNA away from vector DNA
concatemers the DNAs from correct clones were re-transform into
DH10B (Life Technologies) cells. Analysis of bacterial colonies by
DNA restriction analysis was repeated. Glycerol stocks were
prepared from the correct clones and stored at -70.degree. C. Large
quantities of plasmid DNA were prepared using Qiagen Plasmid Kit
(Qiagen Inc.) or scale-up of boiling method from 250 ml cultures
which were inoculated with glycerol stock and grown at 37.degree.
C. for one day.
[0089] Transfection of BAV-1 DNA
[0090] Approximately 1.5.times.10.sup.5 cells/ml (MDBK) were plated
in 6 cm plates 24 hr before transfection, by which time they
reached 50-70% confluency. For transfection the Lipofectin method
was used according to the manufacturer's instructions (Lipofectin,
Life Technologies, Rockville, Md.). A transfection mix was prepared
by adding several (4-15) .mu.g of BAV-1 viral DNA or linearized
genome plasmid DNA and 50 .mu.l of Lipofectin Reagent to 200 .mu.l
of serum-free medium according to the manufacturer's
instruction.
[0091] After incubation at room temperature for 15-30 min, the
transfection mix was added to the cells. After 4-6 hr at 37.degree.
C., the media containing the transfection mix was removed, and 5 ml
of growth medium was added. Cytopathic effect became apparent
within 7-10 days. The transfected virus stock was harvested by
scraping cells in the culture and stored at -70.degree. C.
[0092] Plague Purification of Recombinant Constructs
[0093] Monolayers of MDBK cells in 6 cm or 10 cm plates were
infected with transfection stock, overlaid with nutrient agarose
media and incubated for 5-10 days at 37.degree. C. Once plaques
have developed, single and well-isolated plaque was picked onto
MDBK cells. After 5-10 days when 80-90% cytopathic effect was
reached, the infected cells (P1 stock) were harvested and stored at
-70.degree. C. This procedure was repeated one more time with P1
stock.
[0094] Cloning of Bovine Viral Diarrhea Virus (BVDV) Glycoprotein
53 (g53) Gene
[0095] The bovine viral diarrhea g53 gene was cloned by a PCR
cloning procedure essentially as described by Katz et al. (Journal
of Virology 64: 1808-1811 (1990)) for the HA gene of human
influenza. Viral RNA prepared from BVD virus Singer strain grown in
MDBK cells was first converted to cDNA utilizing an oligonucleotide
primer specific for the target gene. The cDNA was then used as a
template for polymerase chain reaction (PCR) cloning (M. A. Innis
et al., PCR Protocols: A Guide to Methods and Applications, 84-91,
Academic Press, Inc. San Diego (1990)) of the targeted region. The
PCR primers were designed to incorporate restriction sites which
permit the cloning of the amplified coding regions into vectors
containing the appropriate signals for expression in BAV-1. One
pair of oligonucleotides were required for the coding region. The
g53 gene coding region (amino acids 1-394) from the BVDV Singer
strain (M. S. Collett et al., Journal of Virology 65, 200-208,
(1988)) was cloned using the following primers:
5'-CTTGGATCCTCATCCATACTGAGTCCCTGA- GGCCTTCTGTTC-3' [SEQ ID NO: 1]
for cDNA priming and combined with
5'-CATAGATCTTGTGGTGCTGTCCGACTTCGCA-3' [SEQ ID NO: 2] for PCR.
[0096] Western Blotting Procedure
[0097] Samples of lysates and protein standards were run on a
polyacrylamide gel according to the procedure of Laemnli, Nature
227, 680-685 (1970)). After gel electrophoresis the proteins were
transferred and processed according to Sambrook, et al., Molecular
Cloning A Laboratory Manual Second Edition, Cold Spring Harbor
Press, Cold Spring Harbor, N.Y. (1989). The primary antibody was a
mouse monoclonal antibody (Mab 6.12.2 from Dubovi, Cornell
University, Ithaca, New York) diluted 1:100 with 5% non-fat dry
milk in Tris-sodium chloride, and sodium Azide (TSA: 6.61 g
Tris-HCl, 0.97 g Tris-base, 9.0 g NaCl and 2.0 g Sodium Azide per
liter H2O). The secondary antibody was a goat anti-mouse alkaline
phosphatase conjugate diluted 1:1000 with TSA.
[0098] Plasmid 990-11
[0099] Plasmid 990-11 contains the Left and Right ends of the BAV-1
genome. These sequences were cloned by standard PCR methods (M. A.
Innis, et al., PCR Protocols: A Guide To Methods And Applications,
pp. 84-91, Academic Press, Inc., San Diego, Calif. (1990) using
primers based on the sequences determined for the EcoR1 A and BamH1
F fragments respectively. Primers (1) 5'-3'
GGCCTTAATTAACATCATCAATAATATACGGAACAC [SEQ ID NO: 5] and (2) 5'-3'
GGAAGATCTTGAGCATGCAGAGCAATTCACGCCGGGTAT [SEQ ID NO: 6] were used to
PCR the Left end of BAV-1. Since three repetitive elements within
this region shared the same 5' end sequences (i.e. primer 1), 1760
bp, 1340 bp and 920 bp BAV-1 DNA fragments were amplified by PCR.
The 920 bp DNA fragment was cloned into PCR-Blunt vector
(Invitrogen, Carlsbad, Calif.). Primers (1) and (3)
5'-GGCAATGAGATCTTTTGGATGACAAGCTGAGCTACGCG-3' [SEQ ID NO: 7] were
used to PCR the Right end of BAV-1, 740 bp and 1160 bp PCR products
were amplified and 1160 bp fragment DNA was cloned into pCR-Blunt
vector (Invitrogen, Carlsbad, Calif.). Plasmid 990-11 was then
constructed by cloning the BAV-1 end fragments into the polylinker
of plasmid pPolyII (R. Lathe, J. L. Vilotte, and A. J. Clark, Gene,
57:193-201, 1997). The end fragments were cloned as a single PacI
fragment containing a unique BglII site at their internal junction.
Only the BamH1 and EcoR1 sites were retained from the
polylinker.
[0100] Plasmid 990-50 (Adenoviral Backbone Vector)
[0101] Plasmid 990-50 was constructed according to the method
described above (Construction of Recombinant BAV-1 Genomes in E.
coli). Briefly, co-transformation of the BglII-linearized plasmid
990-11 and BAV-1 genomic DNA regenerated a stable circular plasmid
containing the entire BAV-1 genome. In this plasmid PacI sites
flank the inserted BAV-1 genomic sequences. As PacI is absent from
BAV-1 genomic DNA, digestion with this enzyme allows the precise
excision of the full-length BAV-1 genome from the plasmid
990-50.
[0102] Plasmid 996-80D
[0103] Plasmid 996-80D contains DNA encompassing approximately 5945
base pairs of the Right end of the BAV-1 genome from which the
EcoR1 "G" and "H" fragments have been deleted and replaced with a
synthetic SmaI site. The plasmid was constructed for the purpose of
deleting a portion of the BAV-1 E4 region. It may also be used to
insert foreign DNA into recombinant BAV-1 genomes. It contains a
unique SmaI restriction enzyme site into which foreign DNA may be
inserted. The plasmid may be constructed utilizing standard
recombinant DNA techniques (see above Molecular Biological
Techniques) by joining restriction fragments from the following
sources with the synthetic DNA sequences indicated. The plasmid
vector is derived from an approximately 2774 base pair HindIII to
PvuII restriction fragment of pSP64 (Promega Corporation, Madison,
Wis.). The synthetic linker sequence
5'-CTGTAGATCTGCGGCCGCGTTTAAACGTCGACAAGCTTCC- C-3' [SEQ ID NO: 8] is
ligated to the PvuII site of pSP64 (Promega Corporation, Madison,
Wis.). Fragment 1 is an approximately 1693 base pair PstI to EcoR1
sub fragment of the BAV-1 BamH1 "C" fragment (positions 28241 to
29933 from SEQ ID NO: 3). The synthetic linker sequence
5'-AATTCGAGCTCGCCCGGGCGAGCTCGA-3' [SEQ ID NO: 9] is ligated to
fragment 1 retaining EcoR1 sites at both ends of the linker
sequence. Fragment 2 is an approximately 48 base pair EcoR1 to
BamH1 restriction sub fragment of the BAV-1 BamH1 "C" fragment
(positions 31732 to 31779 from SEQ ID NO: 3). Fragment 3 is the
approximately 2406 base pair BAV-1 BamH1 "F" fragment (positions
31780 to 34185 from SEQ ID NO: 3). The synthetic linker sequence
5'-GACTCTAGGGGCGGGGAGTTTAAACGCGGCCGCAGATCTAGCT-- 3' [SEQ ID NO: 10]
is ligated between fragment 3 and the HindIII site of pSP64
(Promega Corporation, Madison, Wis.). Note that the BAV-1 sequences
can be cut out of this plasmid via the NotI restriction sites
located in the flanking synthetic linker sequences.
[0104] Plasmid 1004-73.16.14
[0105] Plasmid 1004-73.16.14 contains a recombinant BAV-1 genome
from which the EcoR1 "G" and "H" fragments have been deleted and
replaced by a synthetic SmaI site
(5'-GAATTCGAGCTCGCCCGGGCGAGCTCGAATTC-3') [SEQ ID NO: 11]. This
plasmid may be used to generate recombinant bovine adenovirus
vectors with deletion and gene insertions at the E4 region. The
plasmid may be constructed according to the method above
(Construction of Recombinant BAV-1 Genomes in E. coli). The
homology DNA is derived from the NotI insert of plasmid 996-80D and
the adenoviral backbone vector plasmid 990-50 is linearized by
partial digestion with the PvuI.
[0106] Plasmid 1004-07.16
[0107] Plasmid 1004-07.16 was constructed by inserting a BVDV g53
gene, engineered to be under control of the human cytomegalovirus
immediate early promoter (Invitrogen, Carlsbad, Calif.), into the
unique SmaI site of plasmid 996-80D. The BVDV g53 gene was isolated
according to the method above (Cloning of Bovine Viral Diarrhea
virus g53 gene).
[0108] Plasmid 1004-40
[0109] Plasmid 1004-40 contains a recombinant BAV-1 genome from
which the EcoR1 G and H fragments have been deleted. The gene for
the bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino
acids 1-394) under the control of the HCMV immediate early promoter
was inserted into the deleted region. The plasmid may be
constructed according to the method above (Construction of
Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived
from the NotI insert of plasmid 1004-17.16 and the adenoviral
backbone vector plasmid 990-50 is linearized by partial digestion
with the PvuI.
[0110] Plasmid 1018-14.2
[0111] Plasmid 1018-14.2 contains DNA flanking the E3 region of
BAV-1, from which a specific region of this sequence flanked by
SalI and BamH1 sites (positions 25664 to 26840 from SEQ ID NO: 3)
has been deleted. The plasmid was constructed for the purpose of
deleting the corresponding portion of the BAV-1 E3 region. It may
also be used to insert foreign DNA into recombinant BAV-1 genomes.
It contains a unique HindIII restriction enzyme site into which
foreign DNA may be inserted. The plasmid may be constructed
utilizing standard recombinant DNA techniques (see above Molecular
Biological Techniques) by joining restriction fragments from the
following sources with the synthetic DNA sequences indicated. The
plasmid vector is derived from an approximately 2774 base pair
HindIII to PvuII restriction fragment of pSP64 (Promega
Corporation, Madison, Wis.). The synthetic linker sequence
5'-CTGTAGATCTGCGGCCGCGTTTAAACG-3' [SEQ ID NO: 12] is ligated to the
PvuII site of pSP64 (Promega Corporation, Madison, Wis.). Fragment
1 is an approximately 2665 base pair SalI to SalI sub fragment
(positions 22999 to 25663 from SEQ ID NO: 3) of the BAV-1 BamH1 B
fragment. Fragment 1 is ligated to the upstream synthetic sequence
retaining the SalI site at the junction. Fragment 1 contains a
unique AvaI site (positions 25317 to 25322 from SEQ ID NO: 3).
Fragment 1 is oriented such that the unique AvaI site is closer
(406 base pairs) to fragment 2 than to the plasmid vector. The
synthetic linker sequence 5'-TCGACAAGCTTCCC-3' [SEQ ID NO: 13] is
ligated to second end of fragment 1 again retaining the SalI site
at the junction. Fragment 2 is an approximately 4223 base pair
BamH1 to HindIII restriction sub fragment of the BAV-1 BamH1 C
fragment (positions 26851 to 31073 from SEQ ID NO: 3). Note that
the end of both fragments were blunt end by treatment with T4
polymerase. The synthetic linker sequence
5'-CCCGGGAGTTTAAACGCGGCCGCAGATC- TAGCT-3' [SEQ ID NO: 14] is
ligated between fragment 2 and the HindIII site of pSP64 (Promega
Corporation, Madison, Wis.). Note that the HindIII site is not
retained. The BAV-1 sequences can be cut out of this plasmid via
the NotI restriction sites located in the flanking synthetic linker
sequences.
[0112] Plasmid 1018-75
[0113] Plasmid 1018-75 contains a recombinant BAV-1 genome from
which a specific region of the BamH1 "B" fragment (positions 25664
to 26840 from SEQ ID NO: 3) has been deleted. This plasmid may be
used to generate recombinant bovine adenovirus vectors with
deletions and gene insertions at the E3 region. The plasmid may be
constructed according to the method above (Construction of
Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived
from the NotI insert of plasmid 1018-14.2 and the adenoviral
backbone vector plasmid 990-50 is linearized by partial digestion
with the PvuI.
[0114] Plasmid 1018-23C15
[0115] Plasmid 1018-23C15 was constructed by inserting a BVDV g53
gene, engineered to be under control of the human cytomegalovirus
immediate early promoter (Invitrogen, Carlsbad, Calif.), into the
unique HindIII site of plasmid 1018-14.2. The BVDV g53 gene was
isolated according to the method above (Cloning of Bovine Viral
Diarrhea virus g53 gene).
[0116] Plasmid 1018-42
[0117] Plasmid 1018-42 contains a recombinant BAV-1 genome from
which a specific region of the BamH1 "B" fragment (positions 25664
to 26840 from SEQ ID NO: 3) has been deleted. The gene for the
bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino
acids 1-394) under the control of the HCMV immediate early promoter
was inserted into the deleted region. The plasmid may be
constructed according to the method above (Construction of
Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived
from the NotI insert of plasmid 1018-23C15 and the adenoviral
backbone vector plasmid 990-50 is linearized by partial digestion
with the PvuI.
[0118] Plasmid 1018-45
[0119] Plasmid 1018-45 contains DNA flanking the E3 region of
BAV-1, from which a specific region of this sequence flanked by
EcoR1 and BamH1 sites (positions 25765 to 26850 from SEQ ID NO: 3)
has been deleted. The plasmid was constructed for the purpose of
deleting the corresponding portion of the BAV-1 E3 region. It may
also be used to insert foreign-DNA into recombinant BAV-1 genomes.
It contains a unique HindIII restriction enzyme site into which
foreign DNA may be inserted. The plasmid may be constructed
utilizing standard recombinant DNA techniques (see above Molecular
Biological Techniques) by joining restriction fragments from the
following sources with the synthetic DNA sequences indicated. The
plasmid vector is derived from an approximately 2774 base pair
HindIII to PvuII restriction fragment of pSP64 (Promega
Corporation, Madison, Wis.). The synthetic linker sequence
5'-CTGTAGATCTGCGGCCGCGTTTAAACG-3' [SEQ ID NO: 12] is ligated to the
PvuII site of pSP64 (Promega Corporation, Madison, Wis.). Fragment
1 is an approximately 1582 base pair SacI to EcoR1 sub fragment
(positions 24183 to 25764 from SEQ ID NO: 3) of the BAV-1 BamHI B
fragment. Fragment 1 is ligated to the upstream synthetic sequence.
The fragment was blunted end with T4 polymerase treatment so
neither the SacI nor EcoR1 sites are retained. Fragment 1 contains
a unique AvaI site (positions 25317 to 25322 from SEQ ID NO: 3).
Fragment 1 is oriented such that the unique AvaI site is closer
(406 base pairs) to fragment 2 than to the plasmid vector. The
synthetic linker sequence 5'-CAAGCTTCCC-3' [SEQ ID NO: 17] is
ligated to second end of fragment 1 again retaining the SalI site
at the junction. Fragment 2 is an approximately 4223 base pair
BamH1 to HindIII restriction sub fragment of the BAV-1 BamH1 C
fragment (positions 26851 to 31073 from SEQ ID NO: 3). Note that
the end of both fragments were blunt end by treatment with T4
polymerase. The synthetic linker sequence
5'-CCCGGGAGTTTAAACGCGGCCGCAGATC- TAGCT-3' [SEQ ID NO: 14] is
ligated between fragment 2 and the HindIII site of pSP64 (Promega
Corporation, Madison, Wis.). Note that the HindIII site is not
retained. The BAV-1 sequences can be cut out of this plasmid via
the NotI restriction sites located in the flanking synthetic linker
sequences.
[0120] Plasmid 1028-03
[0121] Plasmid 1028-03 contains a recombinant BAV-1 genome from
which a specific region of the BamH1 "B" fragment (positions 25765
to 26850 from SEQ ID NO: 3) has been deleted. This plasmid may be
used to generate recombinant bovine adenovirus vectors with
deletions and gene insertions at the E3 region. The plasmid may be
constructed according to the method above Construction of
Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived
from the NotI insert of plasmid 1018-45 and the adenoviral backbone
vector plasmid 990-50 is linearized by partial digestion with the
PvuI.
[0122] Plasmid 1028-77
[0123] Plasmid 1028-77 was constructed by inserting a BVDV g53
gene, engineered to be under control of the human cytomegalovirus
immediate early promoter (Invitrogen, Carlsbad, Calif.), into the
unique HindIII site of plasmid 1018-45. The BVDV g53 gene was
isolated according to the method above (Cloning of Bovine Viral
Diarrhea virus g53 gene).
[0124] Plasmid 1038-16
[0125] Plasmid 1038-16 contains a recombinant BAV-1 genome from
which a specific region of the BamH1 "B" fragment (positions 25765
to 26850 from SEQ ID NO: 3) has been deleted. The gene for the
bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino
acids 1-394) under the control of the HCMV immediate early promoter
was inserted into the deleted region. The plasmid may be
constructed according to the method above (Construction of
Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived
from the NotI insert of plasmid 1028-77 and the adenoviral backbone
vector plasmid 990-50 is linearized by partial digestion with the
PvuI.
[0126] Plasmid 1054-93
[0127] Plasmid 1054-93 contains DNA derived from the E4 region of
BAV-1. The sequence corresponding to positions 33614 to 33725 from
SEQ ID NO: 3 has been deleted and replaced with a synthetic PstI
site. The plasmid was constructed for the purpose of deleting a
portion of the BAV-1 E4 region. It may also be used to insert
foreign DNA into recombinant BAV-1 genomes. It contains a unique
PstI restriction enzyme site into which foreign DNA may be
inserted. The plasmid may be constructed utilizing standard
recombinant DNA techniques (see above Molecular Biological
Techniques) by joining restriction fragments from the following
sources with the synthetic DNA sequences indicated. Note that
fragments derived from BAV-1 DNA are ligated in the orientation
indicated by the positions given for each fragment. The plasmid
vector is derived from an approximately 2774 base pair HindIII to
PvuII restriction fragment of pSP64 (Promega Corporation, Madison,
Wis.). The synthetic linker sequence
5'-CTGTAGATCTGCGGCCGCGTTTAAACGTCGACAAGCTTCCC-3' [SEQ ID NO: 8] is
ligated to the PvuII site of pSP64 (Promega Corporation, Madison,
Wis.). Fragment 1 is an approximately 3538 base pair PstI to BamH1
sub fragment of the BAV-1 BamH1 "C" fragment positions 28241 to
31779 from SEQ. ID NO.3. Fragment 1 is ligated to the 3' end of the
synthetic linker sequence [SEQ ID NO: 8]. Fragment 2 is an
approximately 1832 base pair PCR fragment containing sequences
derived from the BAV-1 genome (positions 31780 to 33613 from SEQ ID
NO: 3). Fragment 2 is ligated to fragment 1 such that the BamH1
site at the junction is retained. The synthetic linker sequence
5'-CTGCAG-3' [SEQ ID NO: 4] is ligated to fragment 2. Fragment 3 is
an approximately 460 base pair PCR fragment containing sequences
derived from the BAV-1 genome (positions 33725 to 34185 from SEQ ID
NO: 3). Fragment 3 is ligated to the 3' end of the synthetic linker
sequence 5'-CTGCAG-3'. The synthetic linker sequence
5'-GACTCTAGGGGCGGGGAGTTTAAACG- CGGCCGCAGATCTAGCT-3' [SEQ ID NO: 10]
is ligated between fragment 3 and the HindIII site of pSP64
(Promega Corporation, Madison, Wis.). Note that the BAV-1 sequences
can be cut out of this plasmid via the NotI restriction sites
located in the flanking synthetic linker sequences.
[0128] Plasmid 1055-38
[0129] Plasmid 1055-38 contains DNA derived from the E4 region of
BAV-1. The sequence encoding nORF13 (see Table 1) has been deleted
and replaced with a synthetic PstI site. The plasmid was
constructed for the purpose of deleting a portion of the BAV-1 E4
region. It may also be used to insert foreign DNA into recombinant
BAV-1 genomes. It contains a unique PstI restriction enzyme site
into which foreign DNA may be inserted. The plasmid may be
constructed utilizing standard recombinant DNA techniques (see
above Molecular Biological Techniques) by joining DNA fragments
from the following sources with the synthetic DNA sequences
indicated. Note that fragments derived from BAV-1 DNA are ligated
in the orientation indicated by the positions given for each
fragment. The plasmid vector is derived from an approximately 2774
base pair HindIII to PvuII restriction fragment of pSP64 (Promega
Corporation, Madison, Wis.). The synthetic linker sequence
5'-CTGTAGATCTGCGGCCGCGTTTAAACGTCGACAAGCTTCCC-3' [SEQ ID NO: 8] is
ligated to the PvuII site of pSP64 (Promega Corporation, Madison,
Wis.). Fragment 1 is an approximately 1282 base pair PCR fragment
containing sequences derived from the BAV-1 genome (positions 28240
to 29522 from SEQ ID NO: 3). Fragment 1 is ligated to the 3' end of
the synthetic linker sequence indicated above [SEQ ID NO: 8]. The
synthetic linker sequence 5'-CTGCAG-3' [SEQ ID NO: 4] is ligated to
fragment 1. Fragment 2 is an approximately 1372 base pair PCR
fragment containing sequences derived from the BAV-1 genome
(positions 30407 to 31779 from SEQ ID NO: 3). Fragment 2 is ligated
to the 3' end of the synthetic linker sequence 5'-CTGCAG-3' [SEQ ID
NO: 4]. Fragment 3 is the approximately 2406 base pair BAV-1 BamH1
"F" fragment (positions 31779 to 34185 from SEQ ID NO: 3). Fragment
3 is ligated to the 3' end of fragment 2. The synthetic linker
sequence 5'-GACTCTAGGGGCGGGGAGTTTAAACGCGGCCGCAGAT- CTAGCT-3' [SEQ
ID NO: 10] is ligated between fragment 3 and the HindIII site of
pSP64 (Promega Corporation, Madison, Wis.). Note that the BAV-1
sequences can be cut out of this plasmid via the NotI restriction
sites located in the flanking synthetic linker sequences.
[0130] Plasmid 1055-52
[0131] Plasmid 1055-52 contains a recombinant BAV-1 genome from
which a portion of the E4 region (positions 29522-30407 from SEQ ID
NO: 3) has been deleted and replaced by a synthetic PstI site
(5'-CTGCAG-3') [SEQ ID NO: 4]. This plasmid may be used to generate
recombinant bovine adenovirus vectors with gene insertions and/or a
deletion at the E4 region. The plasmid may be constructed according
to the method above (Construction of Recombinant BAV-1 Genomes in
E. coli). The homology DNA is derived from the NotI insert of
plasmid 1055-38 and the adenoviral backbone vector plasmid 990-50
is linearized by partial digestion with the PvuI.
[0132] Plasmid 1055-47
[0133] Plasmid 1055-47 was constructed by inserting a BVDV g53 gene
into the unique Pst1 site of plasmid 1055-38. The BVDV coding
region was inserted in the reverse complimentary orientation such
that it is transcribed by the E4 region promoter located at the
right end of the genome. The BVDV g53 gene was isolated according
to the method above (Cloning of Bovine Viral Diarrhea virus g53
gene).
[0134] Plasmid 1055-56
[0135] Plasmid 1055-56 contains a recombinant BAV-1 genome from
which the BAV-1's sequence from positions 29522 to 30407 [SEQ ID
NO: 3] has been deleted. The gene for the BVDV g53 (amino acids
1-394) was inserted into the deleted region. The plasmid may be
constructed according to the method above (Construction of
Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived
from the NotI insert of plasmid 1055-47 and the adenoviral backbone
vector plasmid 990-50 is linearized by partial digestion with the
PvuI.
[0136] Plasmid 1055-93
[0137] Plasmid 1055-93 contains DNA derived from the E4 region of
BAV-1. The sequence encoding nORF13 (see Table 1) has been deleted
and replaced with a synthetic PstI site. The plasmid was
constructed for the purpose of deleting a portion of the BAV-1 E4
region. It may also be used to insert foreign DNA into recombinant
BAV-1 genomes. It contains a unique PstI restriction enzyme site
into which foreign DNA may be inserted. The plasmid may be
constructed utilizing standard recombinant DNA techniques (see
above Molecular Biological Techniques) by joining DNA fragments
from the following sources with the synthetic DNA sequences
indicated. Note that fragments derived from BAV-1 DNA are ligated
in the orientation indicated by the positions given for each
fragment. The plasmid vector is derived from an approximately 2774
base pair HindIII to PvuII restriction fragment of pSP64 (Promega
Corporation, Madison, Wis.). The synthetic linker sequence
5'-CTGTAGATCTGCGGCCGCGTTTAAACGTCGACAAGCTTCCC-3' [SEQ ID NO: 8] is
ligated to the PvuII site of pSP64 (Promega Corporation, Madison,
Wis.). Fragment 1 is an approximately 1282 base pair PCR fragment
containing sequences derived from the BAV-1 genome (positions 28240
to 29522 from SEQ ID NO: 3). Fragment 1 is ligated to the 3' end of
the synthetic linker sequence indicated above [SEQ ID NO: 8]. The
synthetic linker sequence 5'-CTGCAG-3' [SEQ ID NO: 4] is ligated to
fragment 1. Fragment 2 is an approximately 1372 base pair PCR
fragment containing sequences derived from the BAV-1 genome
(positions 30403 to 31779 from SEQ ID NO: 3). Fragment 2 is ligated
to the 3' end of the synthetic linker sequence 5'-CTGCAG-3' [SEQ ID
NO: 4]. Fragment 3 is the approximately 2406 base pair BAV-1 BamH1
"F" fragment (positions 31779 to 34185 from SEQ ID NO: 3). Fragment
3 is ligated to the 3' end of fragment 2. The synthetic linker
sequence 5'-GACTCTAGGGGCGGGGAGTTTAAACGCGGCCGCAGAT- CTAGCT-3' [SEQ
ID NO: 10] is ligated between fragment 3 and the HindIII site of
pSP64 (Promega Corporation, Madison, Wis.). Note that the BAV-1
sequences can be cut out of this plasmid via the NotI restriction
sites located in the flanking synthetic linker sequences.
[0138] Plasmid 1064-26
[0139] Plasmid 1064-26 contains a recombinant BAV-1 genome from
which a portion of the E4 region (positions 33613 to 33725 from SEQ
ID NO: 3) has been deleted and replaced by a synthetic PstI site
(5'-CTGCAG-3') [SEQ ID NO: 4]. The plasmid may be constructed
according to the method above (Construction of Recombinant BAV-1
Genomes in E. coli). The homology DNA is derived from the NotI
insert of plasmid 1054-93 and the adenoviral backbone vector
plasmid 990-50 is linearized by partial digestion with the
PvuI.
[0140] Plasmid 1066-29
[0141] Plasmid 1066-29 was constructed by inserting a BVDV g53 gene
into the unique Pst1 site of plasmid 1055-93. The BVDV coding
region was inserted in the reverse complimentary orientation such
that it is transcribed by the E4 region promoter located at the
right end of the genome. The BVDV g53 gene was isolated according
to the method above (Cloning of Bovine Viral Diarrhea virus g53
gene).
[0142] Plasmid 1066-44
[0143] Plasmid 1066-44 contains a recombinant BAV-1 genome from
which a portion of the E4 region (positions 29523 to 30403 from SEQ
ID NO: 3) has been deleted and replaced by a synthetic PstI site
(5'-CTGCAG-3') [SEQ ID NO: 4]. This plasmid may be used to generate
recombinant bovine adenovirus vectors with gene insertions and/or a
deletion at the E4 region. The plasmid may be constructed according
to the method above (Construction of Recombinant BAV-1 Genomes in
E. coli). The homology DNA is derived from the NotI insert of
plasmid 1055-93 and the adenoviral backbone vector plasmid 990-50
is linearized by partial digestion with the PvuI.
[0144] Plasmid 1066-51
[0145] Plasmid 1066-51 contains a recombinant BAV-1 genome from
which the BAV-1's sequence from positions 30403 to 29523 [SEQ ID
NO: 3] has been deleted. The gene for the BVDV g53 (amino acids
1-394) was inserted into the deleted region. The plasmid may be
constructed according to the method above (Construction of
Recombinant BAV-1 Genomes in E. coli). The homology DNA is derived
from the NotI insert of plasmid 1066-29 and the adenoviral backbone
vector plasmid 990-50 is linearized by partial digestion with the
PvuI.
EXAMPLES
Example 1
Sequence of BAV-1
[0146] By convention we will refer to the region containing the
EcoR1 A fragment as the Left end of the BAV-1 genome. To complement
the previously published restriction map (Maria Benko and B.
Harrach, 1990 Acta Veterinaria Hungarica 38:281-284) other
restriction enzyme sites in the BAV-1-genome were defined (PuvI,
SmaI). The complete genome was cloned as several large restriction
fragments. These included BamHI "B", "C", "D", "F", EcoR1 "A", "E",
and PvuI "B". The genome was also clone in its entirety as
described above (Construction of Recombinant BAV-1 Genomes in E.
coli). These clones and 126 different oligonucleotide primers were
used according to the method described above (DNA Sequencing) to
determine an over lapping sequence for the entire BAV-1 genome.
[0147] This sequence (34,185 base pairs) contains 43 methionine
initiated open reading frames (ORF) of greater than or equal to 110
amino acids (excluding smaller nested ORFs). All 43 ORFs were
compared to the current version of the Genbank protein subset as
described in the methods above (DNA Sequencing). Based on the BLAST
analysis 28 of the ORFs (ORFS 1-28) exhibited significant homology
to one or more other virus genes. Fifteen ORFs showed no
significant homology to virus genes in the current version of
Genbank (nORFs 1-15). Table 1 shows that the ORFs have a widely
varying homology to adenovirus genes from several different
species.
1TABLE 1 BAV-1 Left end Open reading frames (Orf) % ORF* Location**
Best Match to GenBank*** Similarity. ORF1 1400, 1867 BAV-2 E1A
49.5% ORF2 2189, 2656 BAV-2 E1B 58.6% ORF3 2566, 3777 SAV-3 E1B
42.3% ORF4 3838, 4185 BAV-2 Hexon 36.9% ORF5 RC 4197, 5315 HuAd-7
Maturation Protein 69.6% ORF6 RC 5285, 8530 BAV-2 Polymerase 72.9%
ORF7 6255, 6680 HuAd-7 unknown protein 59.4% ORF8 RC 8527, 10185
BAV-2 Terminal protein 71.2% ORF9 10376, 11437 CAV-1 Orf9 63.0%
ORF10 11465, 13174 CAV-2 Hexon protein 57.0% ORF11 13235, 14662
SAV-3 Penton base protein 74.6% ORF12 14725, 15207 BAV-2 Major core
protein 37.1% ORF13 15267, 16388 BAV-2 Minor core protein 62.2%
ORF14 16703, 17113 CAV-1 Minor capsid protein 60.5% ORF15 17509,
20238 CAV-1 Hexon Late protein 2 75.3% ORF16 20241, 20864 BAV-2
endoprotease 82.6% ORF17 RC 20906, 22246 OvAV DNA binding protein
77.8% ORF18 22258, 24498 BAV-3 Late 100 kd protein 59.0% ORF19
24212, 24796 BAV-3 Late 33 kd protein 44.0% ORF20 25009, 25680
BAV-1 Hexon protein 97.8% ORF21 25673, 26041 BAV-1 E3 12.5 kd
protein 87.7% ORF22 25923, 27287 BAV-1 unknown protein 85.8% ORF23
27483, 29294 HuAd-12 Fiber protein 31.2% ORF24 RC 29311, 29730
HuAd-40 E4 protein 38.2% ORF25 RC 30404, 30739 HuAd-12 unknown
protein 38.5% ORF26 RC 30730, 31464 HuAd-40 E4 30 kd protein 28.9%
ORF27 RC 31471, 32232 HuAd-9 E4 34 kd protein 40.8% ORF28 RC 32956,
33384 AvAd dUTPase 54.7% nOrf1 278, 736 nOrf2 697, 1167 nOrf3 5634,
5975 nOrf4 RC 10301, 10669 nOrf5 RC 12607, 13212 nOrf6 RC 14246,
14722 nOrf7 RC 15479, 16102 nOrf8 RC 17878, 18288 nOrf9 19031,
19621 nOrf10 21464, 21991 nOrf11 RC 24437, 24820 nOrf12 RC 27800,
28174 nOrf13 RC 29523, 30407 nOrf14 RC 32219, 32557 nOrf15 RC
33438, 33908 *RC, reverse compliment **positions on SEQ ID NO: 3
***AvAd, Avian adenovirus; HuAD, Human Adenovirus; CAV, Canine
Adenovirus, SAV, swine adenovirus; OvAd, sheep adenovirus
[0148] The E3 and E4 gene regions of BAV-1 can defined by homology
to genes from the corresponding regions of the human adenoviruses.
Evans et al (Virology 244:173-185) define the BAV-1 E3 gene region
as bound by the TATA box sequence at positions 25362 to 25365 and
the polyadenlyation signal at positions 27291 to 27296. Analysis of
the gene homologies from Table 1 indicates that the E4 region of
BAV-1 is bounded by the polyadenylation signal at positions 29059
to 29065 and the TATA box sequence at positions 34171 to 34174.
[0149] BAV-1 exhibits a complex sequence organization at its left
and right ends. The genome exhibits an inverted terminal repeat
(ITR) of 578 base pairs. A sequence of 419 base pairs is repeated
twice at the left end of the genome. A single inverted copy of this
repeat occurs at the right end of the genome. The two 419 base pair
repeats a the left end of the genome are followed by a 424 bp
sequence that appears as an inverted copy upstream of the 419 base
pair sequence at the right end of the genome.
[0150] The sequence of the BAV-1 genome is useful for the
construction of recombinant BAV-1 viral vectors. For example this
information may be used by analogy to human adenovirus vector
systems to predict non-essential regions that may be used as gene
insertion sites. The information may also be used to predict
intergenic regions, which may also be used as gene insertion
sites.
Example 2
Method of Constructing Recombinant BAV-1 Viral Vectors
[0151] We have developed a novel procedure for the generation of
recombinant bovine adenovirus vectors. This procedure takes
advantage of recombinant viral genomes constructed as bacterial
plasmids (see methods--Construction of Recombinant BAV-1 Genomes in
E. coli). When DNA derived from these bacterial plasmids is
transfected into the appropriate cells (see methods--Transfection
of BAV-1 DNA) recombinant bovine adenovirus vectors are
generated.
[0152] This procedure is exemplified by the infectivity of plasmid
990-50. DNA derived from this plasmid was transfected as described
above into MDBK cells. Progeny viruses recovered from independent
transfection stocks were amplified on MDBK cells and analyzed for
growth characteristics, virus production yields, and DNA
restriction patterns. In all cases, plasmid 990-50 derived
adenovirus (S-BAV-002) was indistinguishable from wild-type
BAV-1.
[0153] This procedure can be used to generate bovine adenovirus
vectors expressing useful foreign DNA sequences. The procedure may
also be used to delete genomic sequences from the bovine adenovirus
vector. The production of bovine adenovirus vectors bearing a
bovine diarrhea virus (BVDV) glycoprotein E2 (g53) expression
cassette and deletions in E4 and E3 regions of BAV-1 respectively
are described below (see examples 46).
Example 3
Preparation of Recombinant Adenovirus Vector S-BAV-003
[0154] S-BAV-003 is a BAV-1 virus that has a deletion in the E4
region of the genome. This deletion spans the EcoR1 H and G
fragments. This deletion removes all or a major portion of ORFs
25-27 and nORF13. A poly linker sequence
(GAATTCGAGCTCGCCCGGGCGAGCTCGAATTC) [SEQ ID NO: 15] containing a
SmaI site was inserted into the deletion. As SmaI is absent from
BAV-1 genomic DNA (see FIG. 1), the introduction of this poly
linker sequence creates a useful unique SmaI site that may be
exploited to directly engineer the virus.
[0155] S-BAV-003 was created by transfection of DNA derived from
plasmid 1004-73.16.14 according to the method described above
(Method of constructing recombinant BAV-1 viral vectors). The
resulting viruses were purified according to the method above
(Plague Purification of Recombinant Constructs). Progeny viruses
derived from independent transfection stocks were amplified on MDBK
cells and analyzed for BamH1, EcoR1, and SmaI DNA restriction
patterns. This analysis indicates that the EcoR1 G and H fragments
have been deleted and a SmaI site has been introduced into the
genome. S-BAV-003 was also shown to grow to similar titers as the
wild type BAV-1.
Example 4
Preparation of Recombinant Adenovirus Vector S-BAV-004
[0156] S-BAV-004 is a BAV-1 virus that has a deletion in the E4
region of the genome. This deletion spans the EcoR1 H and G
fragments. This deletion removes all or a major portion of ORFs
25-27 and nORF13. The gene for the bovine viral diarrhea virus
(BVDV) glycoprotein 53 (g53) (amino acids 1-394) under the control
of the HCMV immediate early promoter was inserted into the deleted
region.
[0157] S-BAV-004 was created by transfection of DNA derived from
plasmid 1004-40 according to the method described above (Method of
constructing recombinant BAV-1 viral vectors). The resulting
viruses were purified according to the method above (Plaque
Purification of Recombinant Constructs).
Example 5
Preparation of Recombinant Adenovirus Vector S-BAV-005
[0158] S-BAV-005 is a BAV-1 virus that has a deletion in the E3
region of the genome. The smaller SalI to BamH1 sub fragment of
BamH1 fragment "B" (positions 25664 to 26850 from SEQ ID NO: 3) has
been deleted. This deletion removes a major portion of ORFs 21 and
22. A poly linker sequence (5'-TCGACAAGCTTCCC-3') [SEQ ID NO: 16]
containing a HindIII site was inserted into the deletion.
[0159] S-BAV-005 was created by transfection of DNA derived from
plasmid 1018-75 according to the method described above (Method of
constructing recombinant BAV-1 viral vectors). The resulting
viruses were purified according to the method above (Plaque
Purification of Recombinant Constructs).
Example 6
Preparation of Recombinant Adenovirus Vector S-BAV-006
[0160] S-BAV-006 is a BAV-1 virus that has a deletion in the E3
region of the genome. The smaller SalI to BamH1 sub fragment of
BamH1 fragment B (positions 25664 to 26850 from SEQ ID NO: 3) has
been deleted. This deletion removes a major portion of ORFs 21 and
22. The gene for the BVDV g53 (amino acids 1-394) under the control
of the HCMV immediate early promoter was inserted into the deleted
region.
[0161] S-BAV-006 was created by transfection of DNA derived from
plasmid 1018-42 according to the method described above (Method of
constructing recombinant BAV-1 viral vectors). The resulting
viruses were purified according to the method above (Plaque
Purification of Recombinant Constructs).
Example 7
Preparation of Recombinant Adenovirus Vector S-BAV-007
[0162] S-BAV-005 is a BAV-1 virus that has a deletion in the E3
region of the genome. The smaller EcoR1 to BamH1 sub fragment of
BamH1 fragment "B" (positions 25765 to 26850 from SEQ ID NO: 3) has
been deleted. This deletion removes a major portion of ORFs 21 and
22. A poly linker sequence (5'-TCGACAAGCTTCCC-3') [SEQ ID NO:16]
containing a HindIII site was inserted into the deletion.
[0163] S-BAV-007 was created by transfection of DNA derived from
plasmid 101845 according to the method described above (Method of
constructing recombinant BAV-1 viral vectors). The resulting
viruses were purified according to the method above (Plague
Purification of Recombinant Constructs). Progeny viruses derived
from independent transfection stocks were amplified on MDBK cells
and analyzed for BamH1, EcoR1, and XbaI DNA restriction patterns.
S-BAV-007 was also shown to grow to similar titers as the wild type
BAV-1.
Example 8
Preparation of Recombinant Adenovirus Vector S-BAV-014
[0164] S-BAV-014 is a BAV-1 virus that has a deletion in the E3
region of the genome. The smaller EcolR1 to BamH1 sub fragment of
BamH1 fragment B (positions 25765 to 26850 from SEQ ID NO: 3) has
been deleted. This deletion removes a major portion of ORFs 21 and
22. The gene for the BVDV g53 (amino acids 1-394) under the control
of the HCMV immediate early promoter was inserted into the deleted
region.
[0165] S-BAV-014 was created by transfection of DNA derived from
plasmid 1038-16 according to the method described above (Method of
constructing recombinant BAV-1 viral vectors). The resulting
viruses were purified according to the method above (Plaque
Purification of Recombinant Constructs). Expression of the BVDV g53
gene was assayed by the Western Blotting Procedure. S-BAV-014
exhibited expression of a correct size protein with specific
reactivity to BVDV g53 antibody.
Example 9
Preparation of Recombinant Adenovirus Vector S-BAV-022
[0166] S-BAV-022 is a BAV-1 virus that has a deletion in the E4
region of the genome. This deletion spans from positions
29523-30407 of SEQ ID NO: 3. A linker sequence 5'-CTGCAG-3'
containing a PstI site was inserted into the deletion.
[0167] S-BAV-022 was created by transfection of DNA derived from
plasmid 1055-52 according to the method described above (Method of
constructing recombinant BAV-1 viral vectors). The resulting
viruses were purified according to the method above (Plague
Purification of Recombinant Constructs). Progeny viruses derived
from independent transfection stocks were amplified on MDBK cells
and analyzed for BamH1, EcoR1, and XbaI DNA restriction patterns.
S-BAV-022 was also shown to grow to similar titers as the wild type
BAV-1.
Example 10
Preparation of Recombinant Adenovirus Vector S-BAV-023
[0168] S-BAV-023 is a BAV-1 virus that has a deletion in the E4
region of the genome. This deletion spans from positions
29523-30407 of SEQ ID NO: 3. The gene for the BVDV g53 (amino acids
1-394) was inserted into the deleted region. The BVDV g53 gene was
under the control of E4 promoter(s).
[0169] S-BAV-023 was created by transfection of DNA derived from
plasmid 1055-56 according to the method described above (Method of
constructing recombinant BAV-1 viral vectors). The resulting
viruses were purified according to the method above (Plaque
Purification of Recombinant Constructs). Expression of the BVDV g53
gene was assayed by the Western Blotting Procedure. S-BAV-006
exhibited expression of a correct size protein with specific
reactivity to BVDV g53 antibody. Expression of the BDV g53 foreign
antigen in S-BAV-023 establishes the utility of the BAV-1 E4 region
promoter for transcription of foreign genes in vector systems.
Example 11
Preparation of Recombinant Adenovirus Vector S-BAV-025
[0170] S-BAV-025 is a BAV-1 virus that has a deletion in the E4
region of the genome. This deletion spans from positions
33614-33725 of SEQ. ID NO: 3. A linker sequence 5'-CTGCAG-3'
containing a PstI site was inserted into the deletion.
[0171] S-BAV-025 was created by transfection of DNA derived from
plasmid 1064-26 according to the method described above (Method of
constructing recombinant BAV-1 viral vectors). The resulting
viruses were purified according to the method above (Plaque
Purification of Recombinant Constructs). Progeny viruses derived
from independent transfection stocks were amplified on MDBK cells
and analyzed for BamH1, EcoR1, and PstlI DNA restriction patterns.
S-BAV-025 was also shown to grow to similar titers as the wild type
BAV-1.
Example 12
Preparation of Recombinant Adenovirus Vector S-BAV-026
[0172] S-BAV-026 is a BAV-1 virus that has a deletion in the E4
region of the genome. This deletion spans from positions
29523-30403 of SEQ ID NO: 3. A linker sequence 5'-CTGCAG-3'
containing a PstI site was inserted into the deletion.
[0173] S-BAV-026 was created by transfection of DNA derived from
plasmid 1066-44 according to the method described above (Method of
constructing recombinant BAV-1 viral vectors). The resulting
viruses were purified according to the method above (Plaque
Purification of Recombinant Constructs). Progeny viruses derived
from independent transfection stocks were amplified on MDBK cells
and analyzed for BamH1, EcoR1, and XbaI DNA restriction patterns.
S-BAV-026 was also shown to grow to similar titers as the wild type
BAV-1.
Example 13
Preparation of Recombinant Adenovirus Vector S-BAV-027
[0174] S-BAV-027 is a BAV-1 virus that has a deletion in the E4
region of the genome. This deletion spans from positions
29523-30403-of SEQ ID NO: 3. The gene for the BVDV g53 (amino acids
1-394) was inserted into the deleted region. The BVDV g53 gene was
under the control of E4 promoter(s).
[0175] S-BAV-027 was created by transfection of DNA derived from
plasmid 1066-51 according to the method described above (Method of
constructing recombinant BAV-1 viral vectors). The resulting
viruses were purified according to the method above (Plaque
Purification of Recombinant Constructs).
Example 14
Shipping Fever Vaccine
[0176] Shipping fever or bovine respiratory disease (BRD) complex
is manifested as a result of a combination of infectious diseases
of cattle and additional stress related factors (C. A. Hjerpe, The
Bovine Respiratory Disease Complex. In: Current Veterinary Therapy
2: Food Animal Practice. Ed. by J. L. Howard, Philadelphia, W. B.
Saunders Co., 1986, pp 670-680.). Respiratory virus infections,
augmented by pathophysiological effects of stress, alter the
susceptibility of cattle to Pasteurella organisms that are normally
present in the upper respiratory tract by a number of mechanisms.
Control of the viral infections that initiate BRD as well as
control of the terminal bacterial pneumonia is essential to
preventing the disease syndrome (F. Fenner, et al., "Mechanisms of
Disease Production: Acute Infections", Veterinary Virology.
Academic Press, Inc., Orlando, Fla., 1987, pp 183-202.).
[0177] The major infectious diseases that contribute to BRD are:
infectious bovine rhinotracheitis virus, parainfluenza type 3
virus, bovine viral diarrhea virus, bovine respiratory syncytial
virus, and Pasteurella haemolytica (F. Fenner, et al., "Mechanisms
of Disease Production: Acute Infections", Veterinary Virology.
Academic Press, Inc., Orlando, Fla., 1987, pp 183-202.). An
extension of this approach is to combine vaccines in a manner so as
to control the array of disease pathogens with a single
immunization. To this end, mixing of the various BAV-1 vectored
antigens (IBR, BRSV, PI-3, BVDV and P. Haemolytica) in a single
vaccine dose. Also, conventionally derived vaccines (killed virus,
inactivated bacterins and modified live viruses) could be included
as part of the BRD vaccine formulation should such vaccine
components prove to be more effective.
[0178] Many modifications and variations of this invention can be
made without departing from its spirit and scope, as will be
apparent to those skilled in the art. The specific embodiments
described herein are offered by way of example only, and the
invention is to be limited only by the terms of the appended
claims, along with the full scope of equivalents to which such
claims are entitled.
Sequence CWU 1
1
17 1 42 DNA Artificial Sequence Description of Artificial Sequence
DNA Primer 1 cttggatcct catccatact gagtccctga ggccttctgt tc 42 2 31
DNA Artificial Sequence Description of Artificial Sequence DNA
Primer 2 catagatctt gtggtgctgt ccgacttcgc a 31 3 34185 DNA Bovine
adenovirus type 1 3 catcatcaat aatatacgga acacttttgc gtgatgacgt
tgacgtgctg tgcgtaaggg 60 ggcgtgggaa aattgttcaa aggtcgctgg
gcgggagttt ctgggagggg cggggagtgt 120 ccgtgtgcgt gcgagcggcg
gggcgaggcg ctgagtcagg tgtatttatg atggggtgtt 180 tagggtatca
gctgttggac tttgactttc actgtcgtaa atttgccact ttattggagc 240
cctttgcccg cggacgtgga gggatttttc ccaatttatg gccactttta ctgcgatgcc
300 gcacgaaacc tgtctaaagg tctatgccac gtctcccatc atgggcggtc
ttttttctct 360 atgcaccact cccagtgagc tatatattac ctgcgcaggt
aaagaggtgc cactcttgac 420 atcatcaata atatacggaa cacttttgcg
tgatgacgtt gacgtgctgt gcgtaagggg 480 gcgtgggaaa attgttcaaa
ggtcgctggg cgggagtttc tgggaggggc ggggagtgtc 540 cgtgtgcgtg
cgagcggcgg ggcgaggcgc tgagtcaggt gtatttatga tggggtgttt 600
agggtatcag ctgttggact ttgactttca ctgtcgtaaa tttgccactt tattggagcc
660 ctttgcccgc ggacgtggag ggatttttcc caatttatgg ccacttttac
tgcgatgccg 720 cacgaaacct gtctaaaggt ctatgccacg tctcccatca
tgggcggtct tttttctcta 780 tgcaccactc ccagtgagct atatattacc
tgcgcaggta aagaggtgcc actcttgaca 840 tcatcaataa tatacggaac
acttttgcgt gatgacgttg acgtgctgtg cgtaaggggg 900 cgtgggaaaa
ttgttcaaag gtcgctgggc gggagtttct gggaggggcg gggagtgtcc 960
gtgtgcgtgc gagcggcggg gcgaggcgct gagtcactgc ccttttgcac tgtcttgtgc
1020 tttgtcacgc ggtttcggtt acgcctgtca ggcgccagaa gccctttcgc
ctcgtcacag 1080 accgcgcctt ttcgctctat aaagccattt ctctcctctg
ctcgtcattc gcctctgctc 1140 ctgagccttc tgtgctgcca tttctaaact
tacactcctt gctgtaggcc gtggtctact 1200 ttgccaagag taagtacatc
atggctgaca agctgctctt tgtgcgtgtg tctgactcgg 1260 cttgccacgt
ctcccatcat gggcggtctt ttttctctat gcaccactcc cagtgagcta 1320
tatattacct gcgcaggtaa agaggtgcca ctcttgagtc gaagagagta gagttttctc
1380 atctgctcat tcattcacca tgaggcacct aagactcgct tttgatgagc
gcttctggat 1440 agccgccgaa ggtttgctgg cggattctcc tgctgatgaa
gatgagggat ttcatgagcc 1500 tttgtctttg caggacttga ttgaaattga
tgacgcttca gacgtggtta gcttattttt 1560 ccctgaactt gaagttcagc
aagacctgcc aacagcggag gaggttgagg acttgttaca 1620 ctgtgaggag
actgctgctg acttagaatc tgtttctgac ttaccgcctg tggagtctcc 1680
tgaacctccg gattctcact tttccacatt tgagttggat tatcctgaga tacccggcgt
1740 gaattgctct gcatgctcat ttcatcgtca ggagactgga tctgaggagg
ctgtatgctc 1800 gctctgctat atgagaaaaa cggcttatgc tgtatatggt
aggttgcttt acatactttt 1860 cttttgatta ctcttgcatt gcaatattag
cctaatgtgt tgatttgtgc ttgcagagcc 1920 tgtttctcca gctccgccta
ctgttgatga gcaacatgag acaggtgcgc cagtttcgtc 1980 tccgcctgct
ggccgcaagc ggcgccacca ggatgacctc atactgttta accataaacg 2040
ctgcgcccag gatgaacctt tggacttgtc cttacccaag cccaatgccc aataaactat
2100 gttaatcagt acctagaaag gtgtggtcac tgcctatata aactagggag
cgctgctcag 2160 atgcagcctg gcgctcactt ggactaccat ggacatttct
ctgggctttt gcgaaaagct 2220 gtccgatttc caatacttaa gacgggtgct
gtactacgcc tcagccagac caggttggtg 2280 gacacgcact ctctgtgggg
acagactctc aagtttggtt tataatacaa aaattgagca 2340 ttggaaaaac
ttagaggaaa tttttaaacg cgattcaggt ttctggtcta tgctttctag 2400
tgggcgcagc cttgggtttg aggcgaaagt agttccttgg ctggattttt cgtctccagg
2460 gagaactgtg gccagtttat cgttactaac ttatattgtt gatactttgg
ataaacagac 2520 tcagctgagc ccagattaca ttttggactc gatttgcggc
ccagtatgtt tcaggctgaa 2580 aaccttggtt tcaatcagga aaatgcagca
agccgtgcgg ggtcaggagg gtccaattat 2640 agaggaagtg gattaaaccc
agacggtata ccataccagt ctatattgat ggagtttgct 2700 agagatccat
tttctactca tgacaaatat gattttgaga cagttcagac ttactttctt 2760
aagccagggg atgatttaga aacagtgatc agccagcatg ctaaaattgc tttagatcct
2820 gaggtagagt atgtgattga acatccagta aagattcgat ctctgtgtta
tataattggc 2880 aatggagcta aaataaaaat agcatgtcca gaacactttg
gaatagaaat ttatccaaga 2940 gatcacagcc ctggtatagt tggaatgtgg
cttgtcacat ttaacaatgt ggtgtttgaa 3000 agggaacgaa gtattcctgg
tggcattatt cagagtagga cattcttttt gtgccatggc 3060 tgtaatttct
tgggagcatt gggaacagct gtttcggctc tggctggtgg ggaagttagg 3120
gggtgccatt tctttggatg tttcaagtgt gttgatagta gaagtaaatt taaggtgaaa
3180 gttagccact ctgtaattga gacttgtatg gtaggcataa gcgcttcagg
gccagtgagt 3240 gtaaagcatt gtcaaggatt gagtgtgtac tgctttttgt
ttatgttagg agctggtaag 3300 gttgagggaa acagtgtgat caacccaaac
aagttttatg agtctgccct tacagagatg 3360 gtgtcttgct atggcaaaat
tgttttgccc ctggccactg ttcatatttc ggcctcgccg 3420 aaacatcagt
atccacactt tgaagcaaat gtgctgacaa gatgtaaggt gtttgtgggc 3480
gccaggcaag gcacttttac gccaatgctt tcatcactaa gttatacttc tattgtggct
3540 gaccgcgatg ctttcaaaag cctgaatctg aattatactt ttcaccaaac
tactactatt 3600 tggaagcttc tgagtgctgc tgatgctgac tttgaccatg
gaactgccag aaagtgcctg 3660 tgtggtgatt tgcatccatg tcctgtgttg
aagcagcttg attacacaag ccgggttagg 3720 cctaacccat acgaccactc
atgtgattcc agggtgtttt ctgatgacga gaattaaggt 3780 aagccacgcc
caccatctat ataagcggga gtaaaagcgt ggggtggtat ttgcacaatg 3840
actgatcaag gtgacattcg tacgtgtttt cttacagcga gactgcccag gtgggcaggt
3900 gttcgccaaa atgtcgtcgg gtcaaatatt tctggtggcg ttgtcgactc
cccggagacg 3960 cttctggcat ctagatctaa cgcggcagct gcgatgatga
ctttgaggaa catcgcgacc 4020 agcagacagt tggaagagca ggtggagact
ttgctggagc agaacttgga tctgacggcc 4080 cagcttaatg ccttgctgat
gcgtgtcaac gcgattgaac ggcagctagc tgatatgcag 4140 cgcgacttgg
aaccaatcat tcaacaacac aatgcaataa tttgatcaat aaatctttat 4200
ttctttgcat gataatatcg agtccagcgt tgtctgtcag caattacttt gctaattttt
4260 tccaaaatag agtacagttt acattgcaca tttagataca ttggtataag
tccttctgat 4320 gggtgtaggt atgaccactg tagggcttca ttttctggac
atgtattata aattatccag 4380 tcatagttgg tgttaatttt gtgatagttg
aatatgtctt ttagcaggag ggaaattggc 4440 aatggcagtc ctttagtgta
ttgatttata aatctattaa gctgtgaagg ctgcatttta 4500 ggagagatga
tgtgcagctt tgcttgtatt tttaaatttg atatgttccc agcgtgatct 4560
tttctggggt tcatattgtg caatactacc atgacagagt agcctgtgca ttttggaaac
4620 ttatcatgta gtttagatgg aaatgcgtgg aaaaactttg aaattccttt
gtgggctccc 4680 agatcctcca tacattcgtc tagtattata gcgattggac
cttttgatgc cgctttagca 4740 aatatgtttc tggggtcgct caggtcatag
ttgtattcct gcgttaggtc tgaatatgcc 4800 atttttatga attttggcat
cagcgagcca ctctgtggaa ctaaggtccc ctgaggcccc 4860 atgctgtagt
tgccttcaca gatctgtgtt tcccaagcac ttatctcttg ggggggtatc 4920
atgtcaattt gcggcactat aaagaaaaca gtttctgggg gcggtgtgat taactgtgag
4980 gaaattatgt tcctaagaag ttgggatttg ccgcagcctg tggggccgta
aacaacccct 5040 atgacaggct gcatctgaaa attaatagac ctgcatgccc
cttgcgggtt caaataaggt 5100 acgcatttat taagcaactc cctgacacaa
acattttctt cagccaaatc taaaagtaaa 5160 ctgtgtccgg ctaatgacat
cagttgctgg aaagaggaga acgtgtgaag aggttttagg 5220 ccttcagcaa
aaggcatgct ttttaagctg ttgtgcaaga cggtcagtct gtcccatagt 5280
tcatttatat gtcccacggt aatgtcatcc agcatttgtc gccgtttctt ggatttgggt
5340 tgcttttgga gtagggcatt agtcgatgct ggtcgaggtt tacgagggtt
ctgtccttcc 5400 acggcctcac tgtccgagtc agagttgtct ctgtcactgt
gaatggagcg gcgtttgctt 5460 ggtttgtcgc tagagtgcgc ttcaggctca
tccggctggt ctgaaagtgg tctgagccgt 5520 gctggctgtc cgctaggtag
cactgggcga gagtatcata agatagctca gtggttgcgt 5580 gccctttagc
tcttagcttg cctttcccca cgtgaccgca gttagggcag tgtatgcttt 5640
tcaacgcata cagctttggc gccaggaata cagattcagg actgtatgca tcactcttgc
5700 atttttcgca ctgcgtttcg cattctacta gccaggtgat gcttgggcag
cttgggtcaa 5760 acactagact tcctccattt tttttaattc tatgtttacc
tttttcttgc attaggcgat 5820 gtccttcttc tgtcacgaac aggctgtcgg
tgtcaccgta cacggacttg attgtgcgtt 5880 gttccatggg ctttcccctg
tcgtcgctgt acaggaactc ggcccactcc gccacaaaca 5940 ctcttgtcca
agctagcaca aaagaagcga tgtgagaagc gtaccggttg tttttgataa 6000
gtaaagaatt ttgctcgagg gtgtgtaaac aaatgtcatc gtcatcggtg tccatgaatg
6060 tgattggctt gtaagtgtag gtcacgtgac ccgccgtagg tataaaaggg
gcggggtcct 6120 cgtcttcctc atttgcttct ggctcgacgt gcggtgcagg
tgggtaggct acggtaaatt 6180 ctggcataag ttcagcactt aagttgtcgg
tttcaatgaa agaagaggat ttgacactgt 6240 aggtgccagt ggcgatgttt
tttgacattt ctgattcaag ctggtcagaa aacactattt 6300 ttttgttatc
gagtttagta gcaaagctgc cgtacagagc atttgacaac agtttggcta 6360
tgctgcgcat tgtttggttt ttgtttttgt ctgctttttc tttggcggct atgttcagct
6420 ggacatattc tttagccacg caacgccatt ctggaaatat tgttgttctt
tcatctggta 6480 gtatgcgcac tttccagcct ctgttgtgca gggttatcat
gtctactgat gtggcaacct 6540 caccgcggag aggctcgttt gtccagcata
gcctgcctcc cttcctggag cagaagggcg 6600 ggagctcgtc caggaagagt
tcgtctggag ggtcggcgtc cactgtgaag atacctggca 6660 acagcgtgtc
atcgaaataa tcaatgcgcg aaccatgcgc gctcaacctt ctgctccagt 6720
ctgatgcagc aactgcgcgc tcgaatgggt tcagcggctg ccccgctgga aatggatgag
6780 tcaatgcgct tgcatacatt ccacagatgt catacacata aataggctgt
tccagtatgc 6840 cgatgtatgt ggggtagcag cgtcccccac ggatgctttg
gcgaacgtaa tcatacatct 6900 cgtttgacgg cgcaagcagg gtgtttgaca
tgttggaacg gttaggtttg attgagcgat 6960 acaaaatttg tttgaagatt
gcatgggagt ttgagctaat tgttggtctt tgaaaaatgt 7020 tgaatgctgc
ttcaggtaag tcaacttctt tctgaatgaa ctgctggtat gagttttgga 7080
gttttctgac cagctcagag gtgactaaaa catcttgggc gcaatattca agcgtttgct
7140 ggatgatatc gtaagccccc acgttttttt ctctccacag cgctttgttg
agctcgtatt 7200 ctgctgtgtc cttccagtac cgaaggtgtg ggaaaccatc
ctcgtcctgc tggtaagagc 7260 ccaggcgata aaattcgttt accgcttcgt
acggacagct tcccttttct actggaagtt 7320 catacgccga tgcggcattt
ttcaagcttg tgtgtgtcaa cgcaaatgtg tctctgacca 7380 tgaacttaac
gaactgcatt ttgtagtctc ctgctgtcat ttttcccagt tcccagtcct 7440
caaatgtttt cctggaaaca aactttgggt ttggaagtcc aaatgtgatg tcattaaata
7500 aaatctttcc atttcttggc ataaagtttc tacttatttt aaatgctgga
aggacctcat 7560 ctctgttgtg aatcacttga gccgccagca cgatttcatc
gaaaccgcag atgttatgtc 7620 ccaccacata tatttccata aacttagggt
ctccgtttag ttgacacttt ctaagcatct 7680 caaatgtgat atcatctact
gcagctaggc catgttgctc tttaagctgt tccagatgtg 7740 ggttgtgagc
gagaaggtgc tcccatagta tggcggtcgt gcgccgctgt acggcgtcgc 7800
ggaacttttt aaaagctctt cccacctctc cctttgttgg ggtgatgata tagtaagtgt
7860 acttttcgcg ccacgctgtc cactctaggt ttatggcgac attattcgcg
gcttctagca 7920 gctcgctgtc cccagatagg tgcatcacta gcataaatgg
caccagttgt ttgccaaagc 7980 gcccgtgcca ggtgtaagtc tccacgtcgt
atgtgatgaa cagcctttga atgtcaacgt 8040 acgagcctat tggctgaaat
gggataagtt cccaccagtc ggcagattta tgattgacgt 8100 ggtgaaagta
aaaatcacgc ctccgcacag aacaagtgtg agaatgtttg taaaagtctc 8160
cacagaaatc acatttttgc gagggtgaaa tttcttttat taaaaacacc ttcccatgtt
8220 tgacgaagaa attaattgaa aaaggtagga tgctttcttc catgattgtg
gacttttttg 8280 aaattcttcc tttgttgtag ataaaaacac ctccgtcact
cggtagtagg ctttctaaca 8340 ttgcgagggc gtttcgtgga gtgaccgctg
cggcgttaaa gtgatcaggc atgtcaaata 8400 gatgaatgtg gaaaaggttt
gcaagtgctg gctgtagtgc gctgtggtat ttgatttcga 8460 cgtgggtccc
atcctccatt gtcccactgc ttgttagcgt ggcgcgtttg gccactactg 8520
tgcctctcat tgctcttccg gcggcggaag gcgcactgct tcgtttagcg ccggcagtgg
8580 acgccgttct tgacgcaaca ttgttgctgc gcgtatcact cgtcggttta
tattctggat 8640 ttccctcagg ccggagaaca ccacaggacc gctcactcga
aacctgaaag atatttcgat 8700 agaatcaatt tcagaatcat tggtggccac
ctgtcttaga atttctgtta catcgccgct 8760 gttttcgtga tatgctattt
ctgccataaa ttgttctatt tcctcctcct cgagctctcc 8820 tctgccagcg
cgctcaacgg tggctgccaa atcaacactt attctgttca taatagcaga 8880
aaacgcttgc tcgccgtttt cgttccagac gcgactgtag accagcctgc cgtcctgaga
8940 ccttgctctc atgaccactt gtgccagatt tagcatgacg tatcttccga
atgggctcgc 9000 gactctcagt tgatgattta agtagttgag agtggtggcg
atgtgctccg ccacgaagaa 9060 atacatcacc catcgcctga gtgtcagctc
gttgatatcc ccaagcgctt ctaaacgctg 9120 tataacttcg tagaagttca
cagcaaaact gaaaaactgc tgatttctgg ccgcaaccgt 9180 cagctcttct
tcaagcaatc tgattgcttc agccactgcc gctctaactt cttcttcaaa 9240
cgtagtctca gggctttctt cctcaacttc cattggcgcc tcttccggtg gtggaggcgg
9300 ctgtcttcgg cgccgtctgc gcatcggaag acggtccacg aactgttcta
tcatttctcc 9360 tctggctctt ctcatgcttt ctgtgactgc ccggtttcct
tctcttggtc gtagctggaa 9420 agcgcctcca ctcatggctg tgccgtggca
actggggagg ctcagtgcgc taataataca 9480 ttttgtcaat atttgcgcag
gaacttgttg cagcctcatt gcttcgctga tatcggcaga 9540 ttgatcgctt
tcggcgaact tctccacgaa ggcatttaac caatagcagt cgcaaggtaa 9600
gtttaactct tgctcttggg ctagtgggag gtggcggcat attagaaagt tgaaatatgc
9660 tgttttgagc ttgcgaatcg atgacagcac cactaagtct ttgcgcccgg
cgttttgcac 9720 tctgattctg tcagccagcc cccaggcttg gccctggcat
gcccctatgt ccttgtattg 9780 ttcctggagc aagtattcca cgggaacgtc
gtttctatcg actgaggtgc gaccaaatcc 9840 ccgcattggt cggataagag
ctaggtctgc tacgatgcgc tctgccagaa tagcctgctg 9900 gacggctgtg
agcgtttcag aaaagttgtc catgtctatg aagcgatggt atgccccggt 9960
gttcacagtg tatgagcagt ttgccattac tgaccaattc attatctgcg atccaaagct
10020 aagctgttcg gtgtatttta accggctgta tgctctggcg tcaaaaatgt
agtcgttgca 10080 tatctgcaac agcttttgat atccaaccaa aaagtgcggc
ggtgggtagt tatataacgg 10140 ccagttccta gtagccggct cccgcggcga
tagattcatc agcattaggc ggtgatattg 10200 gtagacgtgt cttgacagcc
atccgagccc ggctggtgtg acagcagccc ttgcccaatc 10260 ttggacacgg
ttccaaatgt tgcgcactgg cctaaacact tcaattgtgt aaacgctctg 10320
gccggtcagg cgcgcgcagt cgatggcgtt ctaaaagaaa taaacaacat gtccaatggg
10380 atttgtgcag atgcatccgg tgctgcgcca gctgaaacca ttgccccata
gtaaggcatc 10440 gcccgttgta acgtgggccg atgacgaccc cgcgcctacg
ccgcccatcc aggagggaga 10500 gggtgttgcg cgactgaacg tggagagccc
cgagcaacac ccccgtgttc agcttaagaa 10560 ggatgccgga gaggctttcg
tcccacccgc caatgtattc agagaccggg agggcgaaga 10620 ggaggctcag
atgaggcaca tgagatttaa agcgggagaa caaatgcatg tccctaagaa 10680
gcgcgtgcta agtgatactg actttgaagt ggatgaggtg tccggggtga gcccagccaa
10740 ggctcatatg gcggcagccg atctgctgac cgcctatcag caaactgtca
gagaggaggt 10800 caacttccaa aagacattta ataataatgt tcgaacactg
gtggccaggg aagaagtggc 10860 agtggggctc atgcatttgt gggactttgt
tgaggcgtac gttgtaaatc catcttccaa 10920 agctttaact gcccagctat
ttcttattgt ccaacactgc cgcgacgaag gcattctaaa 10980 ggaatcgctg
ttgaacattg cagagccaga gagcaggtgg ctgttagatc taataaatct 11040
gctccaaacg atagtggttc aagaacgggg catgtccatt acagaaaagg tggccgccat
11100 taactattct gtaataactc tcagcaagca ttatgccagg aaagtttata
ggactccgtt 11160 tgtccccatt gacaaggaag caaagatcac cactttttac
atgcgaattg tggttaaact 11220 gttggtgttg agcgatgact tgggcatgta
tcgtaatgag cgcatggagc gggtagtcag 11280 cgctgcccgc agacgagaat
tcacagataa agagctgatg ttcagtttgc gtaaagcgct 11340 ggcaggagaa
gacgaggtat atgacggcca attagaatct gctgttcaga gcgtgccagg 11400
tatagaatgg gcgcatgagg atgatgacga cgagtagtaa gatgttatct tggttacagc
11460 cgccatgttt cgctcccgca acaccgtgtc tgcggcgcgc aatcctaacg
ccttggcgcg 11520 cctgcagtct caagcgtctg gggacgtgga atgggccgat
gccattaagc gtataatggc 11580 tttgaccgcc agatacccgg aagcgttcgc
tagtcagcca tttgcaaata ggatcagcgc 11640 tattcttgag gcggtggttc
cttctagaaa aaatccgact catgaaaaag tgctgtcaat 11700 tgtcaacgcc
ttggtagaaa cgggcgctat tcgtcctgat gagggagggc aggtgtacaa 11760
cgctctgctt gagagggtat ctcgatacaa cagtatgaat gttcagacta gtatagacag
11820 gcttagtcaa gatgtgagaa acgtagttgc tcaaaaggaa aggatggttg
gagagaacat 11880 ggggtcgatg gtggccctta atgcattttt gtcaactctg
ccggccaatg tggagagagg 11940 gcaggaaaat tacacagctt tcataagcgc
tttgaggctg ttggtgtctg aagtgcctca 12000 gactgaagta tatcagtctg
ggccaaatta ctacctgcag acctctagga atggcagtca 12060 cactgtcaac
ctgactagag cttttgaaaa cctgagctct ttgtggggag tgaatgcgcc 12120
agtggccgaa cgaagtgcca tatcttccat tctcactcca aacactaggc tgctgcttct
12180 gcttatagcc ccgtttacag acggggttaa catttccaga gcttcataca
ttggttacct 12240 gctgacccta tacagggaaa ctatcgggca ggctcatatt
gacgaaagaa catacaatga 12300 gattactagc gtaagccggg ctgttggcaa
cgaagacgct gcaaacctgc aggccacatt 12360 gaatttccta ctgacaaatc
ggcagtacag gatccctaaa gagtactcat tgacgccaga 12420 ggaggagcga
atattacgtt ttgtgcagca gtctgtcagc ctgcatatga tgcaagacgg 12480
cagcacacct tctgccgccc ttgatgaaac aagccgtaat tttgaaccta gcttttatgc
12540 gggaaatagg ttattcatta acaagctgat ggattatttt cacagggctg
ccgctgtagc 12600 cccaaactat tttatgaacg cggttctaaa tccaaaatgg
ctccctcctg aagggttttt 12660 tactggcgtc tttgattttc ctgagggcga
tgacggtttt gtgtgggacg atacagatgt 12720 atctgaggtt ggggcgagag
gtgccgttcc ggcgctagtg gccaagaaag agggagggga 12780 tgattcagat
ctgtccatca cgatcccctc tattcccagg cagttacgca gggcttctgt 12840
tgtgtctgat actagcgaca tgagccgcgg tagggtgcgc agccgcagtc gtgtacgacg
12900 gccggtagac atagacattg ggcgctggct agaggacaaa aacactaatg
cgacccgagc 12960 ctcagctgct attaataacg aaatggaaaa tttagtcgac
aagatgacta gatggcgcac 13020 gtatgcccag gagcaaatgg aggaagtcag
agcgcgctct cccataaaaa tagaacagga 13080 tgatgatgat tggagaaacg
acaggttttt gaagtttgaa ggcagtgggg cagtcaatct 13140 gttcagccac
ttaaagccaa aaggcatggt gtaacaaaaa aaaaaaaaaa taaagtcact 13200
taccacagac atggtttggt tttgtgattg ctagatgata cgagccaggc cagtggaatc
13260 gcctcctcct tcctatgaga gcgtggtcgg cactatggat ccgctctacg
tgcccccgcg 13320 atacttgggt cctactgaag gaagaagcag catccgttac
tccctattgc ccccgcttta 13380 tgacaccacc aagctttact ttatcgataa
caagtcggca gatatttcgt cactcaatta 13440 tcaaaataac cacagcaatt
acctcaccag tgttgtgcaa aacagcgact acacgccgca 13500 ggaggctagc
acgcaaacta taaactttga tgataggtcg cggtgggggg cggactttaa 13560
aactattttg catatgaaca tgcccaacgt gactgaattt atgtttagca attcattcag
13620 ggctaaattg atgtctgcca aggtgggtgg caacccaacc tatgagtggt
tcactctcac 13680 cattccagag ggcaactact cagacattgc agtcttagac
ttgatgaata atgcgatagt 13740 agaaaattat ctgcaggttg gacgccagaa
tggagtagcg gaagaagaca taggcgtaaa 13800 gtttgacact agaaatttca
gattgggcta tgatcctgta acccagcttg taatgccagg 13860 gaaatatact
tatttggctt ttcacccaga catcatactc gcccctggct gtgcggtaga 13920
ctttacaacg agccgcctaa acaatctact tggtattcga aaaaggcagc catttcagga
13980 aggatttcaa atagcctatg aagatttggt aggtggtaat attccagctc
tccttgacgt 14040 ggacaactat gatgaggcag acccagccac aattaggcct
atagaggccg acccgtcagg 14100 ccgctcatac cacgtaggtc aagacccgtc
tgctggtccc acattcacgt attataggag 14160 ttggtacgtg gcttacaact
acggtgaccc acagactgga attcgcagca gtacgttgct 14220 ggtgacccct
gacgttacgt gtggttcaga gcaagtatac tggagtgttc cggacatgta 14280
tgtagagcct gtgacgttta aagctagcca aaacgtggca aattatcctg taattggggc
14340 agagctcatg cccgttcagt cgcgcagtta ttataacgcg caggctgtgt
attcgcaaat 14400 gattcaagaa agcactaatc agacactggt ttttaaccgc
tttcccgaca accagatttt 14460 ggtgcggccg cccgaatcta ctatcacgtt
cgtcagtgaa aacgtgccag cgcagactga 14520 tcacggaacg ctccccatca
gaaacagtgt gtctggggtg cagcgagtca ctctgactga 14580 cgctaggcgc
agagccagtc cttacgttta caaaagcata gccatagctc agccaaaggt 14640
tctgtccagc aggacgttct aaaatggcga ttttagtgtc cccaagcaac aacacagggt
14700 gggggattgg atgcaaaagc atgtatggcg gcgcccgcac gctatcagca
aactttccag 14760 tgctcgtgcg
aaagcactac agggccgtcg tggggaagca ggaaagggcg cgttgtcgca 14820
ccaacagttg aggttacaga cgaccctgtg gccgatgtag tcaacgccat tgctggtcag
14880 acacgccgcc gacgcggagc caggcgccgc aggcgcgcta cggcagcggt
gcgcgccgct 14940 agagcgttgg tgcgaaatgc acggcgcacg ctagcccgta
gggggcgcat gcggagaacc 15000 cggaatccag tggctgacgt ggtgagagca
gtggaagcca tcgcacgcgc aaacccacgc 15060 cgtcgaagcg ctaggttgat
ggcgcgtgct gccaacgcac cgcctccacg tccgcgcgcg 15120 aggaatatct
attgggtgcg agacagtaat ggagtccgcg ttcctgtgac gtcccgccct 15180
ccaagaactg tggggactgt ggtttaataa agcctcgttt gctgcatcac acagcgcgtg
15240 cctgttcgtg ctttgtgcca acgtcaatgt cttcgcgaaa gataaaagaa
gagatgcttg 15300 aaatcgtggc gccagagatc tatgcgccta gacgccggcg
tagtgttaaa gttgagacaa 15360 aaacgaggat taaggtccca aaagatgaaa
taaaatctaa acgcaagtgg aggcgtcctg 15420 gcatggctga catagatgag
gtcgaaatac tgggagccac tgctcctagg cgcccgtatc 15480 agtggcgcgg
taggcgcgta cagcgcatat tgcgtccagg aacggccgtg gtgtttacac 15540
cgggcgctcg tagtcgggaa cgagcaagca agcgttcttc cgacgaaatg tttgcggacg
15600 cagatatact ggaacagttt gaaagtggag atggcgagtt tagatacgga
aagcgtggcc 15660 ggtctgaggc gctagtgttg gacgcctcta acccaactcc
gagcatgcag cctgtaacgc 15720 cgcaggtacc tatcatgaca ccttcggtgg
cagctaagcg cggcgctagc gcagtgccca 15780 cggtgcaagt actggcgcca
aagaagcgac gcatagacgc agtagcgaca gacgatgtat 15840 ttgtcgctcc
ttctccactt agcgagatgg acaccgtaga gccaggcacg gccgtccttc 15900
ttccttctag agcagttaag cgagttagga agagacgcgg agttgaagaa atcaagagcg
15960 atcctatggt tcttgaagaa gtaaaggtta gggatgtaaa accgatcgct
cctgggatag 16020 gcgtgcagac aatagacgtg aaagtgccgg cggctcctcc
agaaataaag ccaccagtgt 16080 cagtggtgga gaagatggac ataagcacag
ctcccgcgtc acgaatcacc tatgggcccg 16140 ccagcaagat atttccacag
taccgacagc atccgagtca aatgggattt ccaaaagtag 16200 ttcgcactcg
aaggcgcgcg gttaggagga gacgaaggcg ggcggcgccc attggtgttg 16260
aaattacagc cgcgcgaaga cgggcgctag gcgccgcata ttgcttccgc ctgttcgcta
16320 tcacccgtcc ctgcagacgg cgcctcgctc tcaggtcgca atctggcgtt
gatcgatcat 16380 gcgaataaat tcctgtggta ctgcgtttag gcacctatct
aacgcgatgg ctggcgtccc 16440 gagaatcacg taccgagtcc gcgtgcccgt
gcacacacga gtgcggcgaa gtggaagact 16500 ggcgcggcgc gcgcctcgac
gaaggggact taagggcggc tttctacccg ctctaatacc 16560 tatcatagcg
gcggcaattg gcgctgcgcc cggcattgca tccgtagcaa tacaggccgc 16620
ccgccgcaaa taaagttagt tactgtctcc aagactcatt gttatcttta tttgcgccag
16680 ctgcctgcct gcgcccgtcg ccatggaagg aattaatttc tccgcgttgg
ctcccagatg 16740 cgggtcaaga cccatgctta gcagttggtc tgatatcgga
acaagctcca tgaacggcgg 16800 agcatttaac tggggaaacc tatggagcgg
cgttaagtcg tttggcagct ccattaaaaa 16860 ctggggcaat cgcgcctgga
acagtagcac tgggcaggcg ttgcgccaaa agctgaaaga 16920 cagcaacctg
caggaaaagg tggtagaggg gttggctagt ggcattcacg gcgctgtaga 16980
tattgctaac caggagattg ctaaggcggt gcagaagcgc ttagagtcta ggccgaccgt
17040 tcaaatagag gatccagatt taatgtcaac agccgaagaa ctggatcgtg
gaaaaaccgg 17100 ctccgtccac taaagcgcca gttaaagcca ctgtagaaga
gtgtagcgaa aaaaccgccc 17160 gtccgacgaa gaagagatag tcattcgtac
agaggagccg cccagatacg aagacatttt 17220 ccccaataac tccgcggttc
caataagcct gcgccctaca gcggttaggc cgtctgctcc 17280 agtagtcact
gtaccggcgg cccgccccgt aaccacggaa attgtagaag ttcctccaac 17340
gagacctagc gctcgtccgg cggtggtgcc ttctagaaca acaagaggat ggcaggggac
17400 gctcaacagc atagtgggcc taggtgttcg atcagtaaaa cgaagacgct
gtttttaagc 17460 atctcgctgc tctttccaag cgcgccccag tgatacccgg
ccgcgaagat ggcgactcca 17520 tcgatgatgc cccagtggtc gtacatgcac
atcgccgggc aggatgcctc agagtacctg 17580 tctcccggcc tggtgcagtt
cgcgcaggcc acagagacct actttaagct gggtaacaag 17640 tttagaaacc
ccactgtggc tccaacgcat gacgtcacca cagagcggtc acagcggctg 17700
cagctgcgat ttgttccagt tgaccgtgaa gacacgcagt acactcacaa gaccagattt
17760 cagttggctg tgggcgacaa ccgagtactt gacatggcga gcacttactt
tgacatccgc 17820 ggtactttgg acagaggtcc aagctttaag ccatacagcg
gcacggcata caacgctcta 17880 gcccctaagg ggtctatcaa taacactttc
gtatccgtgg ctggaaacaa caacgccaaa 17940 gcttttgcgc aagcccctca
gtcggcaaca gtagacggaa ctacgggcgc catccaaata 18000 gacggcgccg
ccatcgacaa cacctaccag ccagaacctc aaataggaga ggaatcttgg 18060
ttgtccggca ctgtgaaccc aatcgcgcag gctaccggaa gaatactgaa tacatctact
18120 gatcccctgc catgttacgg gtcttatgcc gctcctacga acattgaggg
agcccaaact 18180 cttaacaaca atttgataca agtgaatttt gtggctggag
gcgcgcctgg cgccccagac 18240 gtaggcatga ttatggaaga cgtggctctg
caaaccccag acacacattt agtgtacaag 18300 gtgccagccg ccaacgtagg
caacacggcg gccttagcgc agcaagctgc gccaaacaga 18360 gcaaactata
ttggcttcag agacaatttc atcggtctaa tgtactacaa cagcaatgga 18420
aacctagggg ttttggcggg gcaggcttcg caattgaatg ccgtcgtgga cctgcaagac
18480 agaaatacag agttgtctta ccagcttatg ctcgacaacc tgtatgacag
aagccggtat 18540 tttagcattt ggaaccaggc tgtagacagc tatgacccgg
atgttaggat aatagagaac 18600 cacggagtgg aagatgaatt gccaaactac
tgcttcccaa taagcggaat agttcctggc 18660 accacctcta ctagagtcac
cagaaacggt ggaaactggg aagccacggc aaacaacgat 18720 ccggcgtatg
tcaacaaagg caatttagac tgtatggaaa taaacctcgc ggctaatctg 18780
tggcgcgggt tcctatattc taatgttgcc ctgtacttgc cagacgacct taagttcaca
18840 ccgccaaatg tcacacttcc taacaacacc aatacgtatg catacatgaa
cggtcgcgtt 18900 ccagcggctg ggttggttga cacttacgtc aacattggcg
ctcggtggtc gttggatgtg 18960 atggataacg tgaacccatt caaccatcac
agaaacgcgg gcctgcgcta ccgctctcaa 19020 cttctaggca atggccggta
ctgtcatttt cacatccaag ttccgcagaa gtttttcgcc 19080 atcaagaacc
ttcttctgct gcctgggacg tacacttacg aatggtcttt cagaaaagac 19140
gttaacatgg ttcttcagag cactcttggg aatgatctgc gtgtggacgg agcctccatc
19200 acaattgaga gcgttaacct gtatgccagc tttttcccaa tggcacacaa
taccgcatcc 19260 actcttgaag ccatgctgcg caatgacaca aacgaccaat
cgttcatcga ctacctgtct 19320 tcagccaaca tgttgtatcc aattcctgcc
aatgccacta acctgccaat ttccatccca 19380 tctcgcaact gggccgcctt
ccgcggatgg agcttcacca gaattaagca gaaagaaaca 19440 cccgccttgg
gctctccatt cgacccctac ttcacatact caggcactat accatacttg 19500
gacggcacct tttatctcaa tcacaccttc agaagggtgt ctatacagtt tgattcgtcg
19560 gtgcagtggc cgggcaacga ccgcttgctc acaccaaatg agtttgagat
taaaaggcta 19620 gtggatggag aggggtacaa tgtagctcag agcaacatga
caaaggactg gtttctagtg 19680 cagatgcttg caaattacaa cattggctac
cagggctatc atctcccgga tggctataaa 19740 gatcgcacat attcttttct
gagaaacttt cagccaatga ctaggcagat agtggaccaa 19800 actaacgtgc
ccgcgtatca gaatgtccca atcacccacc agcacaataa ttctggcttt 19860
actggatttg ccagtccagc gctgccgcgt gagggacacc cgtatccagc taactggccg
19920 tatccactga ttagcgctac tgcagtggcc acgcaaacac agcgaaagtt
cctatgtgac 19980 aggacgctgt ggcgcattcc attctcgtcc aactttatgt
ctatgggatc gcttaccgat 20040 ctggggcaga acctgctgta tgcaaatgct
gctcacgcct tagacatgac ctttgaagtg 20100 gacgcgatgg acgagcccac
gctgctttat gttttatttg aagtgtttga cgtggttcgc 20160 gttcaccagc
ctcacagggg agtcatcgaa actgtctacc tcagaactcc attctctgcc 20220
ggcaacgcca ctacataagc atgggatcca gggaagagga actgcgcgcc attgtgcgcg
20280 acctcggagt tgggccatac ttcctgggga cgttcgacaa acgctttcct
ggttttctaa 20340 ataactcaaa gccgagctgc gccatcgtga ataccgcagg
tagagaaaca ggcggcgcgc 20400 attggctggc cctggcttgg ttccctaaat
ctaaggcttt ttactttttt gatccatttg 20460 gattcagtga tagcaaactg
aagcagatat atgagtttga gtatgaaggt ctgctgcgcc 20520 gcagcgcctt
ggcggctact ggcgatggct gcataaacct ggttaagagc agtgaatcgg 20580
tacagggtcc gaacagcgcc gcctgtggct tattttgctg catgttttta catgcttttg
20640 ctcactggcc ccacagtcct atgacccaca accccaccat ggacttgttg
actggtgtgc 20700 ctaaccataa cattatgtca cctagcgccc agcccacact
gcgagaaaat caagtcaagc 20760 tttataagtt tctagcagcc cattctcagt
actttcgcac ccatcgcccc caaattgaac 20820 gagacacctc ttttaataaa
ctgctggaat caaaattgca ataaatgatt ttattttgaa 20880 tcaacatttg
agcagcgtgg tgtgttcaaa ataacgcgtc gtcggcgtct tcctgaccgg 20940
tgggtaggat ggtgttctgc actctgtact ggggaagcca cttaaattct tgcacgacaa
21000 tgggcggttt cgtgccaacc attgaattcc agatttgctt tgcgagctgc
agccccatga 21060 ctacatctgt cgagctgatc ttaaagtcgc aattcttctg
agggtttgct ttggtattgc 21120 gaaatacagg gttgcagcac tgaaatacaa
gcactgcagg gtggtctagg gtggccaaca 21180 ccttagcgtc gtcaatcaag
gcgcgatcta tgctgttgag tgcagtcatc gcgaacggcg 21240 tgaccttgca
cgtctgcttt ccaagcaggg gtagaggctg atgaccgtag ttacaatcac 21300
ataccagcgg cattaagagc atctcaccag cttttggcat gttgggatac atcgccttta
21360 caaaagcgcc tatctgcttg aaggccatca gcgccttggg gccatctgtg
taaaaatacc 21420 cacaagactg agagctaaaa ctgttgattg gagactttag
atcatgatag caactcatcg 21480 cgtcgctatt cttgacttga accacgctgc
ggccccagcg gttggtgaca atcttcgcgc 21540 gctcaggtgt atccttcaat
gctcgctggc cattttcgct gttaatgtcc atctcaatga 21600 tctgctcctt
gtttatcatg ggcaagccgt gcaaacaata caatttgtcc tcgtctgcct 21660
tgtgctccca cacaacacaa ccagatgggt tccaatctgc cgccgttata tcggcgccgc
21720 gcagaatgaa atccagcaaa aaacgcgcta tcaccgtctg caggctcttc
tgagtagaaa 21780 acgtgagttg gatgaatttt tttcgatcat tcatccacgc
ctgggctgct tttttcaggc 21840 actccatggt gccggaatca ggaagcaagg
taaggtcttt tatgtccact ttcagtggca 21900 cgagaataga cacagccaaa
tccattgcgc gttgccactt ctgctcattt ttgtcaatca 21960 actgacgccc
catacgagcg acctgggata gctgcgggtc ttggttcttc ttgcgtccct 22020
ggggcgatct agaagggcct ggctgctcat cgtcggtgtc ggaaattggt ttcgattttt
22080 tacgctgcgg gccatccagt aacgcttcgg cgctctgcgg cgcagcgtcc
tcactgacgg 22140 ctttgcggcg tctggcaacg cgctttggct tcggtgtttc
gtcaatgaac agcttgccct 22200 cgtcgccgct gctttcagac acatcctcat
agtgataccg gctcattttc cttctagatg 22260 gaagaacaca gcggtcagtc
cagctccgag ccggcgccga atcacgagcc cgcggagctt 22320 agcttagaag
atgctttgtc tccccaaccc gcggttgaaa gcgccgctcc gggttccgag 22380
gatgaaagcg aagctctcaa acactacatt gactccgacg tgctatttaa gcacatcgct
22440 agacagagtc gcatcctcaa agatagcctc gccgaccgct ttgaagtgcc
tacagacgcg 22500 ctagaactaa gtctagcgta tgagcgctct ctattttctc
catctacccc acccaagaag 22560 caagaaaacg gcacctgcga gccaaaccct
cgaatcaatt tctacccaac cttcatgctg 22620 ccagaaacac tggcaacata
tcacatattc ttttttaacc acaaaattcc gctgtcgtgt 22680 cgcgctaatc
gcagtcgagc cgatgaaaag ttaatgctaa cagaaggaga ctgcatacct 22740
gattttccaa ccacggatcg ggttccaaaa atcttcgaag gtttgggctc agaagagaca
22800 gtggcctcca actcactaga agagaaaaga gacagcgctt tagtagaact
gcttaacgac 22860 tcgccgcggc tcgcgattat aaagcgctcc acagcgctga
ctcatttcgc atatcccgcc 22920 ataaacatgc cgccaaaagt gatgagttgt
gtcatggagg aaatgattgt gaaaaaggcc 22980 gaacccgtgg gagaagagtc
gacacctgac ggtccagaag ggggcgcgcc agttgtcagt 23040 gacgcagaat
tggccaagtg gcttggaagt agcgacgcca ccctgctcga agacaggcga 23100
aaactgatga tggccgttgt tctagtaaca gctcagctgg agtgcatgaa aaggtttttt
23160 acttcttctg acatgatcag aaagctaggt gaaacgctac actacacttt
caggcacgga 23220 tacgtcaaac aagcctgtaa aatatcaaat gtcgaactac
caaacctggt atcatacatg 23280 ggcatacttc atgaaaacag actaggtcag
cacgtactgc acaacacact ccgcgatgaa 23340 cagaggcggg actacattag
agacaccatc tttctgatgc ttttgtacac atggcagaca 23400 gcgatgggag
tgtggcaaca atgtcttgag gtcgaaaaca tcaaagaact aagtaaactg 23460
ctcagacgaa agagacgggc gctttggaca ggctttgatg agcgaacaac cgccggcgac
23520 ctagccgaca taatctttcc gtcaaaactg ctatcgacat tgcaagccgg
gctaccggat 23580 tttacaagcc agagcatgat gcaaaatttc cgcagcttca
tattagaaag gtctggaata 23640 ttgccagcat tatgcaacgc cataccttca
gactttgtgc caatagaata caaagagtgc 23700 ccgcctccgc tatgggcata
ctgttatttg ctaaaattgg caaactacct aatgttccac 23760 tctgacgtag
cttttaatat ggaaggagag gggctatttg agtgctactg tcgctgtaac 23820
ttgtgcaccc ctcaccgctg tcttgcaacc aacactgcct tactaaacga ggtgcaggcc
23880 attggcagtt ttgagcttca aaggccccca aatcctgacg ggtctatgcc
tcccacactg 23940 aaattaacgg cgggggcttg gacctcggca tatttgagaa
aatttgaacc tgcagactac 24000 cgtcacgatc aaattcgatt ctatgaggac
caatcaaaac caccaaaatc cgagccatct 24060 gcctgcatca tcacgcaagc
cgccattctc gcccaattac atgacataaa aaaagagcgg 24120 gaaaaattct
tgcttaaaaa gggccacggc gtgtacctag accccaaaac aggcgaagag 24180
ctcaacacgc tagagccatc agtctctcac aatgccgcga gccgtcagac cgaccagtct
24240 aaatttgaca aaaccgaagt cgcggaaaaa agccgcgcca gaaccccctc
ctccaacgcc 24300 agacgaggaa actctggaga gcattccagg cgaggacgta
gaggaggaat gggacgatat 24360 agacagtttg gtcgcggagg agagcgagat
ggaggacgag gaattggagg atggcgagac 24420 atcagtctcg gagctattaa
agaaggatca gcctccgccg ctcccgccga aaacaaggaa 24480 ggccccaaaa
cagcgtagat gggaccaaac tccaacatcg gcccctggta agcagaactc 24540
gtcggtggga ggaaaataca agtcgtggcg tccccacaaa catcacataa ttacggctct
24600 gctggcaagc gggtatgacg tgtccttcgc ccgcagattt atgctttacc
gccacggaat 24660 aaacgttcca aaaaatgtaa tccattacta caattcccaa
tgcaggacag aatccccaga 24720 agaagtctgg aaagcgaaca atccagtcag
ccagtacatc cgcagagccg gcgacgaccc 24780 aagagctgag agctaaaata
ttcccaacgt tgtacgccat attccagcaa agcagaggtg 24840 gcggagtatc
tctaaagata aagaaccgat ccttaagatc cctcacaaaa agctgccttt 24900
accacaagca ggagagtcag ctgcagagaa ccttggaaga cgccgaggct ctactccaga
24960 agtactgttc cgggctgaga ggctctgcgc cttatatctc agctcagcat
gagtaaagac 25020 atccccaccc cttacgtatg gactttccag ccccaattgg
ggcaggctgc cggcgcgtca 25080 caagactatt cgactcgcat gaactggcta
agtgcaggtc cttcaatgat taaccaggtg 25140 aactctgtcc gagccgaccg
aaacagaatc ttattgcgtc aagctgcagt atcggaaacg 25200 cccagactcg
tccgcaaccc gccaacgtgg cctgcccaat acctatttca gccaattggc 25260
gcgcctcaga cctttgagct tcccaggaat gagtcattgg aggtggcaat gagtaactcg
25320 ggcatgcaat tagccggggg cgggacgcat cgcactaagg atataaaacc
agaagacata 25380 gtgggacgcg gcctagagct gaacagcgac attccgagcg
cttcgttttt gcgtcctgac 25440 ggagttttcc agcttgccgg aggtagccgt
tcctctttca acccaggact gagtaccttg 25500 ctcacggtac aacctgcttc
aagcctgcct aggtccggag gaatcggcga agtgcaattt 25560 gtgcacgagt
ttgtgccgtc cgtgtacttt cagccttttt caggaccacc tggaacatat 25620
ccagacgaat ttatctacaa ctacgacata gtctcagatt ccgtcgacgg ttatgactga
25680 tacagagtct gatctttcgc tgtttggtgt ctgccggctg cactactccc
gctgccagtc 25740 taccaactgc ttctggaagc agggaattct gccaacctac
cagtgcattt tagacgcgga 25800 cctccacgcc gactgcgtgc cagactccct
gcaagccggc cacagcctgc ggctcgaact 25860 gccacaccgt tttgcctgtt
atcaaacctc aaatcacgga ttgcctatcg tgtgctccag 25920 caatgtcaag
tcaagcagct tcaaagttac atgctcctgt tccagtactg ggatgcatct 25980
ggcgctcgcc gatgctctct gtgatcttgt taaccattct atggcagatg aagagcgcta
26040 aatcgctgcc gcacaaccac acagcggtaa tccccaggag tgtctgcgtg
gccaacgttt 26100 cctgtacagg tgtggtgagt gcgacggcga ccctcacaga
cgcccagact accgcatcag 26160 ccgcgcgcca ccagtgggta tgcgtagtat
ccatcaactc cagcagcgac acaacgtgtg 26220 tttggaacgg ttggacatac
aaagaatttc cgcttgaaat tcaattggac gaacgcttag 26280 ccgacacccc
tgtggactgt gtggaaggaa ggcgccgcac aacatttgac ctaagagctc 26340
tgtgtcggtt tcgctacacg cctctatatg ttttgaaatt agccatacca atctatgcga
26400 ctgtgcttac cattgtgggg gcgctcattg cgtttccggc tctgcgctcc
cctctcgcca 26460 tcagcatgct cccagcagcc atggcagata atggctacca
ccaccaccac acctgcgcgc 26520 cgttgctact gaccatatta atgttaatcg
ccatgctgtg taaggtcacg aagcccacaa 26580 acaaactttt catcttagct
cttcttagtc tagctgtgcc aggaaattgt ttgaaccagt 26640 acagtgtgct
agaagggagt ccatgtgaac ttaaatctgc aacaaaacgc tacaccaaag 26700
cctcatggta tcgcgactct gaatctgcgc tgctttctcc tttcgccaca atcagtcaat
26760 cctcagtaac atactcttcc ccatcctcca gaataatcct agcttcaaac
ttgtctctaa 26820 tttttacttc tgtaaaacct tcagacaacg gatcctattt
tctaagcatc gactatcgcg 26880 aatttatcaa gtatgacctg cttgttagtc
ctaaaattca aatcaaccta gccatacaaa 26940 cacagccagg agttaatcac
acatgcataa tttctgccac ttgcagccca cacagcgccc 27000 agtacaggtc
agtgatcaag tggcagaacc acacttacca ttcaaaagcg cttttcacag 27060
ttttcactga gcagttaaat aacaacataa catgcacagt gtcttctcct cttgaaacta
27120 attccaagtc tttaacagcg tcacaaatgt gtgtttttca caatcctaat
gacttcagcc 27180 ctctaatcat tgtaggtgtt ttaactcttg tgttcatagc
catatggatc atctctatgt 27240 ttcatactgt acgcgtccca atctttaagt
atgaactggt gatataaatc aataaactca 27300 cgtgattatt agacgcagct
tctccgggtc ttcttttccc caacaatcta ttacagctcc 27360 ttcgtcaaga
ctgacataac gcaacttaag caggtaagct aactttctaa attgcctaaa 27420
aggcagcaaa acactaccta acggcactcc attatacttt atctccattg cagttatccg
27480 caatgaagcg ctcgattccg tcagatttcg atccagtata tccctatgga
aaaagacctt 27540 cacttaatat catgccgcca ttttacagcc aagacggttt
tcaagaagca ccaaccgcca 27600 ccctctcact caaaatcaca gacccaataa
cgtttaattc cagcggggca ctttcagtta 27660 aagtgggagg gggaataact
attaaccaaa acggccaatt agaaactact aacgcgacca 27720 cagcagttaa
cccaccatta gagtatgcta atggggcgat aagcctaaat accggaaacg 27780
gactggcagt tgactcaact caaaatctga caattcttac atcgagccca cttgccgtgt
27840 cacaatctgg tttaacgctg aacacaggtg atggcctaga ggtggatggt
gatgaagtga 27900 aagttaagag cgggcaaggt gtgagtgtag gcactactgg
agttgggata aatgccgcct 27960 catactttgc ctttccctca aatgtattat
ccctccttac tacagctcct ttaagtgtat 28020 ccagcggctc tcttggagta
gagctaggca acggattaca agtgtcaaat gaccaactga 28080 cgctcaacac
acagccacta tttacatttt ccaacggggc aatggggctg gcagtcggca 28140
acggaatcca aatagaaaat aacgctgtcg ccatttatgc ccaaccatat ttccaataca
28200 ccaacagagc cctgggcctt cgccttggaa atggcctgca gaccgaaaat
aatgcaattg 28260 ccttatattg tcagccgtac ttccaatata cagataacgc
actagcgctg cggctagggc 28320 aaggactgca aatctccaac aatcaagtag
ctttatatgc tcagtcttac tttcaatata 28380 ccaataatgc attggcattg
cgcttagcga acggtttagg cacgtctaac aataacgttg 28440 ttgtaaatta
tggaaaaggc ttatttataa actcaagcga ttcaaacaaa ttgcaagtga 28500
atattagatc tccgctaaac tactatggca gttcacacac aattggtcta aatacaggaa
28560 acggtctaac tgttactagt cttggcgcgc taggtggcaa tgtatccgtt
aatattggaa 28620 gcgggctatc ttttagctca actgggcagg tgcaggcttc
attaggaaac gggctccaaa 28680 tcgcttccag tgccatagaa gtcaaactag
gcaacggttt acagtttgac aatggcgcca 28740 tttccctatc agggtcatct
cccgcctaca cagactacac tttatggact actccggacc 28800 cctctccaaa
cgctaccatc agcgcagaat tagatgccaa gctggtgctt agtatttcaa 28860
aagcaggaag cactgctatc ggcaccatcg gtgtagttgg attgaaaggg cctctattaa
28920 gtttggccga gcaagccatc aatgttgaaa tttactttga caccagcggt
aatattattt 28980 ttagcacaag cacgctgaag tcatactggg gatttaggtc
tggtgattca tatgatccaa 29040 actccacact taatcctctt tatttaatgc
caaatcagac cgcataccct ccagggcgac 29100 aaaccataac ccaaatagcc
tcacttgaag tgtacttagg tggggatact accaaacctg 29160 ttcttttaga
ggtagctttt aacaccgcaa gtagtggcta ctccctgaag tttacttggc 29220
gaaacttggc cagctatgcc ggacagacct tcgctgtatc ccttggaacc ttcacatata
29280 tcacacaaca ataaataagt tttaacatct ttatttgagt cgtgaatttt
gtggcatcac 29340 tcttacagtc attccaccac caccactcca tgcaacctta
tacacaagcc tttcaaaatg 29400 cattccagtg ttataacaat cagctttttt
atgcaatttt acagcatgtt cataacattc 29460 aaagtcaggg gaagttatag
agacaaagcc agcgggcata gactccaaag atggtttcag 29520 gtctaaaagt
ttggatgcgt gtccacagtg tggtgaggct gattctccgg aggttctttc 29580
tggagcagat agcacttggg gcagccgcag cggtacttcg tcatcctcac tttgcagatc
29640 ggagtccctc tcgcaatcgc tagagtctcc actccaggaa caagacgaag
ttccagactc 29700 ggtgtcgctg actcgtccca gatctgacat tctgaagcct
caagtccttc tagtccacac 29760 aagtcggaca aagaacacct ggcataccac
ccaaacggaa catcgatcga cacattaaac 29820 ttcattactc
tagaactgcc cgcagttaat aacatatcac tttccgcaca caaatgagcc 29880
gtttccccac ttctaatagg ggccgggtta tgtgagcgaa aaagacagcg aggaattcgc
29940 cgcctacctt cccattcttt cctttcgctt tcgctcatcc tagcccatcg
ccgctcaaat 30000 cttaatttat tccttggctc gcaagcgtca tgcccacaat
catcatattc acaatcagca 30060 tatttataca tcaagacagg cgtgccggcg
cgcaaagcga tagggccttc ttcttccccc 30120 caccaaggca gctctatggt
aaatcctgga gaggtgcata gtgacaaatg actgctaaat 30180 gcccaagaaa
acacttttag atctggatta aacaatgatg aaagcatccc aactccataa 30240
tagccgtccg gatttctaat ctttacatca aacactatta cagttttttc ttttgtgaga
30300 attacatctt cttcaagaca cagatgaacc accgtcttgt cgctgttaaa
gattggccgg 30360 tgtttgcatt tctccccaac ctcgatatta attggaggcg
tgctcattct gaaagagatt 30420 ttttttcaat tgaaattttt actactggct
ctccaggatt agcataaatc acatagtcta 30480 cccactcata cattttacac
actatatttt taatcaaatt tggctcatgg gtgatgtctg 30540 catacagcca
tggaactaaa catgaaacac tgaaatcata accggggggt ataaacactt 30600
catgatctaa gcagaagtcg ctctccccat atggcaggaa aaccattttc ttaggtgcca
30660 gcagccacac ttcattatcc gacttaagta tcggagcaag tgcatctgga
ccggtgtaga 30720 caaataactt caactgcatc tgcaacacaa atgcgattta
cgcgtcaagc gcttaatcaa 30780 gcgttgcttg ttgcgctcat actcgctagg
tggcagtgaa agaatgttac atgcactgcc 30840 agcaagcagt aacaccgttc
tagttctctc tgcacatgct aatgcggcca cctgtgtcat 30900 ttcatgacag
tgtctacaaa ttattacaag atacaccccg gtataaccta tgcaaaacac 30960
cgccccttca aacctaagat tacgaattcg tggcacatcg ccccagtaat taatctttat
31020 aaaaatcaaa tgcaaacccc taaacataat actaccctca tataacagcc
taaagcttaa 31080 atctttgtta gtcagtggcc tataaaatgg aaacctaata
ttgtattctg tcccacccac 31140 cagctctttc acaatgtcag taataaagcg
cctgcgtgac aaggcttcca aagtgctccc 31200 ttcatgcaaa tcatgacaac
aaacagacca tttaaagcct ttattccttt tgaacattaa 31260 ttcaatgtct
ccaccacatt caacttttaa gcgagtcccc aagcacagat aatctttcaa 31320
caatctatat tgccaagaaa caagaatact tttccatgga attggaattt ctaaattcat
31380 agccaatggc agagctgact gtggagaatc aacataagaa ataattttgt
gctgaaattt 31440 cgaccgagtg gactccgctg tcatctgtaa ttaaagatat
ttaacatatt tttgagacat 31500 tggcaggcca tacttcataa gctgcaacag
ctctctctgc ctaactacct cttttttgct 31560 tggctgttta gggccagagc
agcaacccac agctcttttt aataggcgcc tagttcgttt 31620 tgcacacacc
ttggcttgaa tttcagataa attacatgac ctgcaaataa ctattaaaaa 31680
atttccatac aaaccatcca catatacagc ctctccaaaa tttaatttac gaattctctt
31740 catgtcgcca tctaaaatta ctctgatgta tataaggtgg atcccacgaa
tgtaaacact 31800 acccatgtac atcaacccct ctggtaaatt cttattcaca
caccccctgt aaaaccaaaa 31860 tagctgattg taaaatgtcc cttttaaaac
ctcttgaaac agtccagtaa gcactttacg 31920 ggaagacaag cactgaagac
tgccagagtt gtcacaatgg caatgtaaat accatcttga 31980 ttgcaatgaa
gaaaaatcag gttgaagatc tttagagaac acagaacaca tctctagttc 32040
aacgccgtca cacaaatggc gcttcaaaaa cacaaactca tgatgactta atatatgcat
32100 ccatggcacc ggcagttcca agcacatagc aaaacaggca gcagtgcgcg
gtgagcgaac 32160 aaaggctact ggatgactgt ctgttgaatt gcaacaaatt
aggccgctgc ctggaacctc 32220 aaaatgctcc atcctcaatc ttaagcagaa
gctgtcgcag tttaggttcg acggaactcc 32280 aggagcagaa agcctcagca
acctcttcgg gcactccctc gcccctaggg ccgcaattga 32340 tgtaattggc
caacacaaaa ccaacgtagt gcacttggcg cattagagtc tggtctgctt 32400
tcctggtgaa atgaattttc gcagttgact gattggaaga gtaaataatt gagattatct
32460 ctgatgattt ctgcaacgca agcgcctcag ttgaaatgct cattgggtaa
taatcacgaa 32520 gaatgcgctt cttaaagtga agacgtctgg atgtcattac
tgcaataatg caacagtgat 32580 tgttttacat tcttccagac tcacatcctc
accgattaat ctaaggtaat catacaaagc 32640 ctcatgtagg taatcccgca
aatccgaaac taagaagtct tcatcactgc ctccattagt 32700 cagcaaagcg
tccatagagc ttccagcaag gcaaaataat caacatagtt gcctcaagat 32760
ccgtatgatg ataggagcta acgtacagca agttagaacc agagaaatat aaagaagctc
32820 tggcagtcac aaaagccttt gccatagatg aaacagaagc aatgaaagat
tctctattct 32880 ccacctgaag gcgagatgta aggcaatggg gaatggaaat
ctgcatcatc tccccgtctc 32940 taacaggtgg tgccattata ctccagtaga
tccaaatccg ccttcccctc gctcagtgtc 33000 gtcaagtgta tcaacctcct
gaacctcagg caatgagatc ttttggatga caagctgagc 33060 tacgcgctgg
cctggcgaaa taaggacgtg atgattccca tggttaaaga gcaggacgaa 33120
cacctctccc ctgtagtcgc tgtcaatcac gccagcgccc acatccaagc cttgagtcac
33180 agacaagcca gagcgaggtg caacgcgtcc gtagtgtccc tcaggaatac
ggagctttag 33240 gccagtaggc acaagagcgc gagatccagc ctgaatctca
acgtaatgcg aagcgcacaa 33300 atcatatcca gccgcaccat tagaagctct
tttaggaggc acagccgagt cagacacacg 33360 cacaaagagc agcttgtcag
ccatgatgta cttactcttg gcaaagtaga ccacggccta 33420 cagcaaggag
tgtaagttta gaaatggcag cacagaaggc tcaggagcag aggcgaatga 33480
cgagcagagg agagaaatgg ctttatagag cgaaaaggcg cggtctgtga cgaggcgaaa
33540 gggcttctgg cgcctgacag gcgtaaccga aaccgcgtga caaagcacaa
gacagtgcaa 33600 aagggcagtg actcagcgcc tcgccccgcc gctcgcacgc
acacggacac tccccgcccc 33660 tcccagaaac tcccgcccag cgacctttga
acaattttcc cacgccccct tacgcacagc 33720 acgtcaacgt catcacgcaa
aagtgttccg tatattattg atgatgtcaa gagtggcacc 33780 tctttacctg
cgcaggtaat atatagctca ctgggagtgg tgcatagaga aaaaagaccg 33840
cccatgatgg gagacgtggc atagaccttt agacaggttt cgtgcggcat cgcagtaaaa
33900 gtggccataa attgggaaaa atccctccac gtccgcgggc aaagggctcc
aataaagtgg 33960 caaatttacg acagtgaaag tcaaagtcca acagctgata
ccctaaacac cccatcataa 34020 atacacctga ctcagcgcct cgccccgccg
ctcgcacgca cacggacact ccccgcccct 34080 cccagaaact cccgcccagc
gacctttgaa caattttccc acgccccctt acgcacagca 34140 cgtcaacgtc
atcacgcaaa agtgttccgt atattattga tgatg 34185 4 6 DNA Artificial
Sequence Description of Artificial Sequence Synthetic DNA Linker 4
ctgcag 6 5 36 DNA Artificial Sequence Description of Artificial
Sequence DNA Primer 5 ggccttaatt aacatcatca ataatatacg gaacac 36 6
39 DNA Artificial Sequence Description of Artificial Sequence DNA
Primer 6 ggaagatctt gagcatgcag agcaattcac gccgggtat 39 7 38 DNA
Artificial Sequence Description of Artificial Sequence DNA Primer 7
ggcaatgaga tcttttggat gacaagctga gctacgcg 38 8 41 DNA Artificial
Sequence Description of Artificial Sequence Synthetic DNA Linker 8
ctgtagatct gcggccgcgt ttaaacgtcg acaagcttcc c 41 9 27 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
DNA Linker 9 aattcgagct cgcccgggcg agctcga 27 10 42 DNA Artificial
Sequence Description of Artificial Sequence Synthetic DNA Linker 10
gactctaggg gcggggagtt taaacgcggc cgcagatcta gc 42 11 32 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
SmaI Site 11 gaattcgagc tcgcccgggc gagctcgaat tc 32 12 27 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
DNA Linker 12 ctgtagatct gcggccgcgt ttaaacg 27 13 14 DNA Artificial
Sequence Description of Artificial Sequence Synthetic DNA Linker 13
tcgacaagct tccc 14 14 33 DNA Artificial Sequence Description of
Artificial Sequence Synthetic DNA Linker 14 cccgggagtt taaacgcggc
cgcagatcta gct 33 15 32 DNA Artificial Sequence Description of
Artificial Sequence Synthetic DNA Linker 15 gaattcgagc tcgcccgggc
gagctcgaat tc 32 16 14 DNA Artificial Sequence Description of
Artificial Sequence Synthetic DNA Linker 16 tcgacaagct tccc 14 17
10 DNA Artificial Sequence Description of Artificial Sequence
Synthetic DNA Linker 17 caagcttccc 10
* * * * *