U.S. patent application number 10/862084 was filed with the patent office on 2004-11-11 for high affinity vascular endothelial growth factor(vegf) receptor nucleic acid ligands and inhibitors.
This patent application is currently assigned to Gilead Sciences, Inc.. Invention is credited to Gold, Larry, Janjic, Nebojsa.
Application Number | 20040224915 10/862084 |
Document ID | / |
Family ID | 23434941 |
Filed Date | 2004-11-11 |
United States Patent
Application |
20040224915 |
Kind Code |
A1 |
Janjic, Nebojsa ; et
al. |
November 11, 2004 |
High affinity vascular endothelial growth factor(VEGF) receptor
nucleic acid ligands and inhibitors
Abstract
Methods are described for the identification and preparation of
high-affinity nucleic acid ligands to a VEGF receptor. Included in
the invention are specific RNA ligands to a VEGF receptor
identified by the SELEX method. Also included are RNA ligands that
inhibit the interaction of a VEGF receptor with VEGF.
Inventors: |
Janjic, Nebojsa; (Boulder,
CO) ; Gold, Larry; (Boulder, CO) |
Correspondence
Address: |
SWANSON & BRATSCHUN L.L.C.
1745 SHEA CENTER DRIVE
SUITE 330
HIGHLANDS RANCH
CO
80129
US
|
Assignee: |
Gilead Sciences, Inc.
Foster City
CA
|
Family ID: |
23434941 |
Appl. No.: |
10/862084 |
Filed: |
June 4, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10862084 |
Jun 4, 2004 |
|
|
|
09364540 |
Jul 29, 1999 |
|
|
|
6762290 |
|
|
|
|
Current U.S.
Class: |
514/44R ;
435/6.14; 536/23.5 |
Current CPC
Class: |
C12N 2310/322 20130101;
C07H 21/00 20130101; G01N 2500/00 20130101; A61K 38/00 20130101;
C12N 15/1138 20130101; G01N 33/6863 20130101 |
Class at
Publication: |
514/044 ;
435/006; 536/023.5 |
International
Class: |
A61K 048/00 |
Claims
We claim:
1. A method of identifying nucleic acid ligands to a vascular
endothelial growth factor (VEGF) receptor, comprising: a)
contacting a candidate mixture of nucleic acids with a VEGF
receptor, wherein nucleic acids having an increased affinity to a
VEGF receptor relative to the candidate mixture may be partitioned
from the remainder of the candidate mixture. b) partitioning the
increased affinity nucleic acids from the remainder of the
candidate mixture; and c) amplifying the increased affinity nucleic
acids to yield a ligand enriched mixture of nucleic acids, whereby
nucleic acid ligands to a VEGF receptor may be identified.
2. The method of claim 1 wherein said candidate mixture of nucleic
acids is comprised of single stranded nucleic acids.
3. The method of claim 2 wherein said single stranded nucleic acids
are ribonucleic acids.
4. The method of claim 1 further comprising: d) repeating steps a),
b), and c).
5. The method of claim 3 wherein said candidate mixture of nucleic
acids comprises 2' position modified pyrimidines.
6. The method of claim 5 wherein said modified pyrimidines are 2'-F
modified pyrimidines.
7. A nucleic acid ligand to a vascular endothelial growth factor
(VEGF) receptor identified according to the method comprising: a)
contacting a candidate mixture of nucleic acids with a VEGF
receptor wherein nucleic acids having an increased affinity to a
VEGF receptor relative to the candidate mixture may be partitioned
from the remainder of the candidate mixture; b) partitioning the
increased affinity nucleic acids from the remainder of the
candidate mixture; and c) amplifying the increased affinity nucleic
acids to yield a ligand-enriched mixture of nucleic acids, whereby
a nucleic acid ligand to a VEGF receptor may be identified.
8. A purified and isolated non-naturally occurring nucleic acid
ligand to a VEGF receptor.
9. The nucleic acid ligand of claim 8 which is a ribonucleic
acid.
10. The nucleic acid ligand of claim 9 wherein the VEGF receptor is
selected from the group consisting of VEGFR1, VEGFR2, VEGFR3, and
neuropilin-1.
11. The nucleic acid ligand of claim 10 wherein the VEGF receptor
is VEGFR2.
12. The nucleic acid ligand of claim 11 wherein said ligand has
been chemically modified at the ribose and/or phosphate and/or base
positions.
13. The nucleic acid ligand of claim 12 wherein said ligand is
comprised of 2'-F modified nucleotides.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 09/364,540, filed Jul. 29, 1999, incorporated herein by
reference in its entirety.
FIELD OF THE INVENTION
[0002] Described herein are methods for identifying and preparing
high affinity nucleic acid ligands that bind to a VEGF receptor.
The method utilized herein for identifying such nucleic acid
ligands is called SELEX, an acronym for Systematic Evolution of
Ligands by EXponential Enrichment. This invention includes high
affinity nucleic acids to a VEGF receptor. Further disclosed are
RNA ligands to a VEGF receptor. Also included are oligonucleotides
containing nucleotide derivatives modified at the 2' position of
the pyrimidines. Additionally disclosed are ligands to a VEGF
receptor containing 2'-F modifications of the pyrimidines. This
invention also includes high affinity nucleic acid inhibitors of
VEGF signaling. The oligonucleotide ligands of the present
invention are useful in any process in which binding of VEGF to a
VEGF receptor is required. This includes, but is not limited to,
their use as pharmaceuticals, diagnostics, imaging agents, and
immunohistochemical reagents.
BACKGROUND OF THE INVENTION
[0003] Angiogenesis in Disease
[0004] The growth of new blood vessels from existing endothelium
(angiogenesis) is tightly controlled in healthy adults by opposing
effects of positive and negative regulators. Under certain
pathological conditions, including proliferative retinopathies,
rheumatoid arthritis, psoriasis and cancer, positive regulators
prevail and angiogenesis contributes to disease progression
(reviewed in Folkman (1995) Nature Med. 1:27-31). In cancer, the
notion that angiogenesis represents the rate limiting step of tumor
growth and metastasis (Folkman (1971) New Engl. J. Med.
285:1182-1186) is now supported by considerable experimental
evidence (reviewed in Aznavoorian et al. (1993) Cancer
71:1368-1383; Fidler and Ellis (1994) Cell 79:185-188; Folkman
(1990) J. Natl. Cancer Inst. 82:4-6). The quantity of blood vessels
in tumor tissue is a strong negative prognostic indicator in breast
cancer (Weidner et al. (1992) J. Natl. Cancer Inst. 84:1875-1887),
prostate cancer (Weidner et al. (1993) Am. J. Pathol. 143:401-409),
brain tumors (Li et al.(1994) Lancet 344:82-86), and melanoma (Foss
et al.(1996) Cancer Res. 56:2900-2903).
[0005] VEGF Signaling in Angiogenesis
[0006] A number of angiogenic growth factors have been described to
date among which vascular endothelial growth factor (VEGF) appears
to play a key role as a positive regulator of physiological and
pathological angiogenesis (reviewed in Brown et al. (1997) in
Control of Angiogenesis (Goldberg and Rosen, eds.), Birkhauser,
Basel, 233-269; Thomas (1996) J. Biol. Chem. 271:603-606; Neufeld
et al. (1999) FASEB J. 13:9-22). VEGF is a secreted
disulfide-linked homodimer that selectively stimulates endothelial
cells to proliferate, migrate, and produce matrix-degrading enzymes
(Conn et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87:1323-1327;
Ferrara and Henzel (1989) Biochem. Biophys. Res. Commun.
161:851-858; Gospodarowicz et al. (1989) Proc. Natl. Acad. Sci.
U.S.A. 86:7311-7315; Pepper et al. (1991) Biochem. Biophys. Res.
Commun. 181:902-906; Unemori et al. (1992) J. Cell. Physiol.
153:557-562), all of which are processes required for the formation
of new vessels. In addition to being the only known endothelial
cell specific mitogen, VEGF is unique among angiogenic growth
factors in its ability to induce a transient increase in blood
vessel permeability to macromolecules (hence its original and
alternative name, vascular permeability factor) (Dvorak et
al.(1979) J. Immunol. 122:166-174; Senger et al.(1983) Science
219:983-985; Senger et al.(1986) Cancer Res. 46:5629-5632).
Increased vascular permeability and the resulting deposition of
plasma proteins in the extravascular space assists the new vessel
formation by providing a provisional matrix for the migration of
endothelial cells (Dvorak et al.(1995) Am. J. Pathol.
146:1029-1039). Hyperpermeability is indeed a characteristic
feature of new vessels, including those associated with tumors
(Dvorak et al.(1995) Am. J. Pathol. 146:1029-1039). Furthermore,
compensatory angiogenesis induced by tissue hypoxia is now known to
be mediated by VEGF (Levy et al.(1996) J. Biol. Chem.
271:2746-2753); Shweiki et al. (1992) Nature 359:843-845).
[0007] VEGF is produced and secreted in varying amounts by
virtually all tumor cells (Brown et al. (1997) in Control of
Angiogenesis (Goldberg and Rosen, eds.), Birkhauser,
Basel:233-269). Direct evidence that VEGF and its receptors
contribute to tumor growth was recently obtained by a demonstration
that the growth of human tumor xenografts in nude mice could be
inhibited by neutralizing antibodies to VEGF (Kim et al. (1993)
Nature 362:841-844), by the expression of dominant-negative VEGFR2
(Millauer et al. (1996) Cancer Res. 56:1615-1620; Millauer et al.
(1994) Nature 367:576-579), by low molecular weight inhibitors of
VEGF receptor inhibitors (Strawn et al. (1966) Cancer Res.
56:3540-3545), or by the expression of antisense sequence to VEGF
mRNA (Saleh et al. (1996) Cancer Res. 56:393-401). Importantly, the
incidence of tumor metastases was also found to be dramatically
reduced by VEGF antagonists (Asano et al. (1995) Cancer Res.
55:5296-5301; Warren et al. (1995) J. Clin. Invest. 95:1789-1797;
Claffey et al. (1996) Cancer Res. 56:172-181; Melnyk et al. (1996)
Cancer Res. 56:921-924). Inhibitors of VEGF signaling may thus have
broad clinical utility as anticancer agents. In addition to cancer,
as noted above, other proliferative diseases characterized by
excessive neovascularization such as psoriasis, age-related macular
degeneration, diabetic retinopathy and rheumatoid arthritis could
be treated with antagonists of VEGF signaling.
[0008] VEGF occurs in several forms (VEGF-121, VEGF-145, VEGF-165,
VEGF-189, VEGF-206) as a result of alternative splicing of the VEGF
gene that consists of eight exons (Houck et al. (1991) Mol.
Endocrin. 5:1806-1814; Tischer et al. (1991) J. Biol. Chem.
266:11947-11954; Poltorak et al. (1997) J. Biol. Chem.
272:7151-7158). The three smaller forms are diffusable, while the
larger two forms remain predominantly localized to the cell
membrane as a consequence of their high affinity for heparin.
VEGF-165 and VEGF-145 also bind to heparin (as a consequence of
containing basic exon 7- and exon 6-encoded domains, respectively),
albeit with somewhat lower affinity compared with VEGF-189 (that
contains both exons 6 and 7). VEGF-165 appears to be the most
abundant form in most tissues (Houck et al. (1991) Mol. Endocrinol.
5:1806-1814; Carmeliet et al. (1999) Nature Med. 5:495-502).
VEGF-121, the only alternatively spliced form that does not bind to
heparin, appears to have a somewhat lower affinity for the
receptors (Gitay-Goren et al. (1996) J. Biol. Chem. 271:5519-5523)
as well as lower mitogenic potency (Keyt et al. (1996) J. Biol.
Chem. 271:7788-7795).
[0009] VEGF Receptors
[0010] Biological effects of VEGF are mediated by two homologous
tyrosine kinase receptors, Flt-1 (VEGFR1) and Flk-1/KDR (VEGFR2)
whose expression is highly restricted to cells of endothelial
origin (de Vries et al. (1992) Science 255:989-991; Millauer et al.
(1993) Cell 72:835-846; Terman et al. (1991) Oncogene 6:519-524).
Both receptors have an extracellular domain consisting of seven
IgG-like domains, a transmembrane domain and an intracellular
tyrosine kinase domain. The affinity of VEGFR1 for VEGF
(K.sub.d=1-20 .mu.M) is higher compared to that of VEGFR2
(K.sub.d=50-770 .mu.M) (Brown et al. (1997) in Regulation of
Angiogenesis, supra; de Vries et al. (1992) Science 255:989-991;
Terman et al. (1992) Biochem. Biophys. Res. Commun. 187:1579-1586).
In human umbilical cord endothelial cells (HUVECs) in 2-dimensional
culture, VEGFR2 is by far the more abundant receptor (Brown et al.
(1997) in Regulation of Angiogenesis, supra). In vivo, however, in
quiescent endothelial cells, both receptors are expressed at low
levels (Kremer et al. (1997) Cancer Res. 57:3852-3859; Barleon et
al. (1997) Cancer Res. 57:5421-5425).
[0011] Both receptors are substantially upregulated when
endothelial cells are activated by a variety of stimuli. Hypoxia,
for example, induces an increase in expression of both VEGFR1 and
VEGFR2 in endothelial cells (Tuder et al. (1995) J. Clin. Invest.
95:1798-1807; Gerber et al. (1997) J. Biol. Chem. 272:23659-23667;
Brogi et al. (1996) J. Clin. Invest. 97:469-476; Kremer et al.
(1997) Cancer Res. 57:3852-3859). For VEGFR1, hypoxia leads to both
direct activation via the flt-1 promoter that contains the
hypoxia-inducible-factor-1 (HIF-1) consensus binding site (Gerber
et al. (1997) J. Biol. Chem., supra) and indirect activation via
hypoxia-induced VEGF (Barleon et al. (1997) Cancer Res., supra).
VEGF-induced upregulation of VEGFR1 is mediated by both VEGFR1 and
VEGFR2 (Barleon et al. (1997) Cancer Res., supra). VEGFR2 is
upregulated by VEGF (through VEGFR2, but not VEGFR1) (Kremer et al.
(1997) Cancer Res., supra; Wilting et al. (1996) Dev. Biol.
176:76-85) and possibly by a yet unidentified factor in
hypoxia-conditioned media from myoblasts (Brogi et al. (1996) J.
Clin. Invest., supra). The expression of VEGFR2 in endothelial
cells is also upregulated by bFGF and this accounts in part for the
synergistic activation of endothelial cells by VEGF and bFGF
(Pepper et al. (1998) Exp. Cell Res. 241:414-425). In addition,
since both kdr and flt-1 promoters contain a cis-acting fluid
shear-stress-responsive element, VEGFR1 and VEGFR2 expression may
be sensitive to variations in blood flow (Tuder et al. (1995) J.
Clin. Invest., supra).
[0012] Experiments using porcine aortic endothelial (PAE) cells
transfected with the flt-1 or kdr receptor genes have suggested
that VEGFR2 is the primary transducer in endothelial cells of
VEGF-mediated signals related to changes in cell morphology and
mitogenicity (Waltenberger et al. (1994) J. Biol. Chem.
269:26988-26995). In the same study, stimulation of
flt-1-transfected PAE cells with VEGF did not appear to produce
detectable changes. More recently, however, it was demonstrated
that VEGF signaling through VEGFR1 induces migration of monocytes
and upregulation of tissue factor expression in both endothelial
cells and monocytes (Clauss et al. (1996) J. Biol. Chem.
271:17629-17634; Barleon et al. (1996) Blood 87:3336-3343). Based
on the observation that the extracellular domain of VEGFR2 is
retained on a cation exchange resin only in the presence of VEGFR1
and that the VEGFR2 retention is enhanced when both VEGFR1 and VEGF
were present, Kendall et al. have concluded that the two receptors
have some affinity for one another and that this interaction is
stabilized by VEGF (Kendall et al. (1996) Biochem Biophys. Res.
Commun. 226:324-328). When both receptors are expressed on cell
surface, it appears likely that the VEGFR1/R2 heterodimer
constitutes at least a fraction of the binding-competent VEGF
receptor.
[0013] Gene Deletion Studies of VEGF and VEGF Receptors
[0014] The functions of VEGFR1 and VEGFR2 have further been
elucidated by targeted gene deletion studies. While deletion of
either VEGFR1 or VEGFR2 results in embryonic lethality as a result
of vascular abnormalities, there are important differences in the
two phenotypes.
[0015] In mice deficient in VEGFR1, endothelial cells are formed
but organize into distended and dilated vessels (Fong et al. (1995)
Nature 376:66-70). Interestingly, mice that only lack the tyrosine
Chinese domain of VEGFR1 (and thus display the receptor on cell
surfaces that is incapable of signaling) are viable, with the only
detectable abnormality being the strongly suppressed macrophage
migration in response to VEGF (Hiratsuka et al. (1998) Proc. Natl.
Acad. Sci. 95:9349-9354). Since vascular abnormalities of VEGFR1
knockout mice are similar to those observed in transgenic mice that
overexpress VEGF during development, it has been suggested that
VEGFR1 is primarily a negative regulator of VEGF signaling, and
that partial inhibition of VEGF signaling is essential for proper
vessel development (Hiratsuka et al. (1998) Proc. Natl. Acad. Sci.,
supra). It is relevant to note in this context that VEGFR1 also
exists as an alternatively spliced secreted extracellular domain
that acts as a potent inhibitor of VEGF (Kendall et al. (1993)
Proc. Natl. Acad. Sci., U.S.A. 90:10705-10709). The importance of
tightly controlled VEGF signaling during development is further
evidenced by the lethal phenotype of mice that lack only one allele
of the VEGF gene (Carmeliet et al. (1996) Nature 380:435-439;
Ferrara et al. (1996) Nature 380:439-442) and also of mice that
only express the smallest isoform of VEGF (VEGF-120) (Carmeliet et
al. (1999) Nature Med. 5:495-502). Thus, deviations on either side
from a precisely determined level of VEGF signaling results in
embryonic lethality.
[0016] Mice deficient in VEGFR2 lack both endothelial cells and
hematopoietic cells, a more severe phenotype compared to that of
VEGFR1 knockout, that results in embryonic lethality at day 8
(Shalaby et al. (1995) Nature 376:62-66). This is presumably a
consequence of the fact that these two cell types arise from a
common, VEGFR2-expressing precursor, the hemangioblast (Eichmann et
al. (1997) Proc. Natl. Acad. Sci. 94:5141-5146).
[0017] Structural Requirements for Binding
[0018] Crystal structure of the receptor-binding domain of VEGF
(residues 8-109) has recently been reported (Muller et al. (1997)
Proc. Natl. Acad. Sci., U.S.A. 94:7192-7197; Muller et al. (1997)
Structure 5:1325-1338). In the VEGF homodimer, the monomers are
oriented in an antiparallel manner with two intersubunit disulfide
bonds being formed between Cys51 from one subunit and Cys60 from
the other. The three intrasubunit disulfide bonds are clustered in
a characteristic cysteine knot motif (Sun et al. (1995) Annu. Rev.
Biophys. Biomol. Struct. 24:269-291) also observed in PDGF and
TGF.beta.2. Despite low sequence homology (about 20%), PDGF and
VEGF have very similar structures. Both proteins have an elongated
shape in which each of the subunits consist primarily of four
antiparallel .beta. strands connected with three solvent accessible
loops. In the homodimer, loops I and III from one subunit are
adjacent to loop II from the other subunit. Alanine-scanning
mutagenesis studies of VEGF have identified discrete regions that
are important for high affinity binding to VEGFR1 and VEGFR2 (Keyt
et al. (1996) J. Biol. Chem. 271:5638-5646; Muller et al. (1997)
Proc. Natl. Acad. Sci., U.S.A. 94:7192-7197). Amino acid residues
most critical for binding of VEGF to VEGFR1 are D63 and E64 in loop
II. Residues most critical for binding of VEGF to VEGFR2 are
R82-H86 encompassing loop III, 146 in loop I and E64 in loop II.
Knowledge of the importance of these regions for receptor binding
has been utilized to generate VEGF mutants in which only one side
of the VEGF homodimer was rendered defective for receptor binding
(Siemeister et al. (1998) Proc. Natl. Acad. Sci., U.S.A.
95:4625-4629; Fuh et al. (1998) J. Biol. Chem. 273:11197-11204). As
expected, such monovalent VEGF mutants are inhibitors of
VEGF-induced signaling since they are deficient in their ability to
dimerize the receptors. Interestingly, avidity effects play a
greater role in the binding of VEGF to VEGFR2 than to VEGFR1. The
affinity of monomeric VEGFR1 for wild-type VEGF dimer is reduced
only about 2-fold compared to that of dimeric VEGFR1 (IgG fusion
construct) (Weismann et al. (1997) Cell 91:695-704). In contrast,
the affinity of monomeric VEGFR2 for VEGF is reduced 100-fold
compared to the dimeric VEGFR2 (Fuh et al. (1998) J. Biol. Chem.,
supra). Comparing only the monomeric forms, VEGFR1 binds to VEGF
with about 100-fold higher affinity compared to VEGFR2.
[0019] Domain deletion studies of the extracellular region of the
VEGF receptors have shown that out of seven IgG-like domains,
domains 2 and 3 of VEGFR1 (Davis-Smyth et al. (1996) EMBO J.
15:4919-4927; Barleon et al. (1997) J. Biol. Chem. 272:10382-10388)
and VEGFR2 (Fuh et al. (1998) J. Biol. Chem. 273:11197-11204;
Shinkai et al. (1998) J. Biol. Chem. 273:31283-31288) are essential
for VEGF binding. The crystal structure of the complex between
VEGF.sub.8-109 with IgG domain 2 of VEGFR1 (that bind to VEGF with
only 60-fold reduced affinity compared to the entire extracellular
domain of the receptor) shows the receptor to be in contact with
both subunits of VEGF.sub.8-109 in an interaction dominated by
hydrophobic contacts (Weismann et al. (1997) Cell, supra).
[0020] VEGF-165 Receptors
[0021] In addition to VEGFR1 and VEGFR2, receptors that only bind
VEGF-165 and not VEGF-121 have been identified on endothelial cells
and some tumor cells (Soker et al. (1996) J. Biol. Chem.
271:5761-5767; Soker et al. (1997) J. Biol. Chem. 272:31582-31588;
Omura et al. (1997) J. Biol. Chem. 272:23317-23322). One such
receptor unrelated in sequence to the tyrosine kinase receptors and
with a short cytoplasmic domain, neuropilin-1, is also a receptor
for semaphorins which play a role in neuronal chemorepulsion during
development (Soker et al. (1998) Cell 92:735-745). Since the
binding of VEGF-165 to neuropilin-1 involves the exon 7-encoded
domain that is not required for the binding to VEGFR1 and VEGFR2,
it has been suggested that neuropilin-1 serves as a co-receptor for
VEGF-165. The presence of such receptors on endothelial cells may
in part account for the enhanced mitogenic activity of VEGF-165
compared to VEGF-121. Consistent with this notion is the
observation that cardiovascular system of neuropilin-1 knockout
mice does not develop normally leading to embryonic lethality
(Kitsukawa et al. (1997) Neuron 19:995-1005). The questions of what
role VEGF may play in neuronal development and conversely, whether
semaphorins have a role in vascular development and function,
remain to be answered.
[0022] Receptor Binding Specificity of Various Forms of VEGF and
Other Proteins in the VEGF Family
[0023] In addition to the alternatively spliced forms of VEGF,
additional species can be generated by proteolytic processing.
Plasmin cleaves VEGF-165 and VEGF-189 between residues Arg-110 and
Ala-111 to generate VEGF-110 as the amino terminus fragment (Keyt
et al. (1996) J. Biol. Chem., supra; Plout et al. (1997) J. Biol.
Chem. 272:13390-13396). Since it contains the receptor binding
domain (supra), VEGF-110 bind to both VEGFR1 and VEGFR2. Like
VEGF-121, VEGF-110 does not bind to heparin and its potency is
lower compared to that of VEGF-165 (Keyt et al. (1996) J. Biol.
Chem., supra). Interestingly, VEGF-189 can bind to VEGFR1, but not
VEGFR2 and this renders it inactive as an endothelial cell mitogen
(Houck et al. (1991) Mol. Endocrinol., supra; Plout et al. (1997)
J. Biol. Chem. 272, supra). VEGF-189 thus requires proteolytic
processing either by plasmin or by urokinase-type plasminogen
activator (that cleaves VEGF-189 in the exon 6-encoded domain to
generate a 40 kDa fragment) to gain ability to bind to VEGFR2
(Plout et al. (1997) J. Biol. Chem., supra).
[0024] Proteins with sequence homology to VEGF (also referred to as
VEGF-A) have recently been described including placenta growth
factor (P1GF: Park et al. (1994) J. Biol. Chem. 269:25646-25654),
VEGF-B (Olofsson et al. (1996) Proc. Natl. Acad. Sci., U.S.A.
93:2576-2581), VEGF-C (Lee et al. (1996) Proc. Natl. Acad. Sci.,
U.S.A. 93:1988-1992; Joukov et al. (1996) EMBO J. 15:290-298),
VEGF-D (Achen et al. (1998) Proc. Natl. Acad. Sci., U.S.A.
95:548-553) and VEGF-E (Ogawa et al. (1998) J. Biol. Chem.
273:31273-31282). In terms of receptor binding specificity, P1GF
and VEGF-B can bind only to VEGFR1 with high affinity. VEGF-C and
VEGF-D bind to VEGFR2 and another related tyrosine kinase, Flt-4 or
VEGFR3. The expression of VEGFR3 appears to be confined to
lymphatic endothelial cells. VEGF-E, a protein encoded in the
genome of the Orf virus, binds only to VEGFR2 (Ogawa et al. (1998)
J. Biol. Chem. 273:31273-31282). Some of these proteins including
P1GF and VEGF-B can form heterodimers with VEGF (Cao et al. (1996)
J. Biol. Chem. 271:3154-3162; DiSalvo et al. (1996) J. Biol. Chem.
270:7717-7723). The function of these VEGF-related molecules in
physiological and pathological conditions remains to be precisely
defined, however, it is clear that some redundancy of signaling
mediated by VEGF receptors exists (Nicosia (1998) Am. J. Pathol.
153:11-16).
[0025] VEGF Receptors on Non-Endothelial Cells
[0026] Although VEGFR1 and VEGFR2 are expressed predominantly on
endothelial cells, they have also been detected on some
non-endothelial cells. VEGFR1 is expressed on trophoblasts
(Chamockjones et al. (1994) Biol. Reprod. 51:524-530), monocytes
(Barleon et al. (1996) Blood, supra), hematopoietic stem cells and
megakaryocytes/platelets (Katoh et al. Cancer Res. 55:5687-5692),
renal mesangial cells (Takahashi et al. (1995) Biochem. Biophys.
Res. Commun. 209:218-226) and pericytes (Yamagishi et al. (1999)
Lab. Invest. 79:501-509). In monocytes, VEGFR1 is responsible for
the VEGF-mediated induction of migration and tissue factor
expression (Clauss et al. (1996) J. Biol. Chem., supra; Barleon et
al. (1996) Blood, supra; Hiratsuka et al. (1998) Proc. Natl. Acad.
Sci., supra). In pericytes, VEGFR1 may mediate the recently
described ability of VEGF to act as a mitogen and chemotactic
factor (Yamagishi et al. (1999) Lab. Invest., supra). The role of
VEGFR1 in trophoblasts and mesangial cells remains to be
elucidated. The expression of VEGFR2 has been detected on
hematopoietic stem cells, megakaryocytes/platelets and retinal
progenitor cells (Katoh et al. (1995) Cancer Res. 55:5687-5692;
Yang et al. (1996) J. Neurosci. 16:6089-6099). VEGFR1 and VEGFR2
expression has also been reported on malignant cells including
leukemia cells (Katoh et al. (1995) Cancer Res., supra) and
melanoma cells (Gitay-Goren et al. (1993) Biochem. Biophys. Res.
Commun. 190:702-709).
[0027] SELEX
[0028] A method for the in vitro evolution of nucleic acid
molecules with high affinity binding to target molecules has been
developed. This method, Systematic Evolution of Ligands by
EXponential enrichment, termed SELEX, is described in U.S. patent
application Ser. No. 07/536,428, filed Jun. 11, 1990, entitled
"Systematic Evolution of Ligands by Exponential Enrichment," now
abandoned, U.S. Pat. No. 5,475,096, "Nucleic Acid Ligands," and
U.S. Pat. No. 5,270,163, entitled "Methods for Identifying Nucleic
Acid Ligands," (see also WO91/19813), each of which is herein
specifically incorporated by reference. Each of these applications,
collectively referred to herein as the SELEX Patent Applications,
describe a fundamentally novel method for making a nucleic acid
ligand to any desired target molecule.
[0029] The SELEX method involves selection from a mixture of
candidate oligonucleotides and step-wise iterations of binding,
partitioning and amplification, using the same general selection
theme, to achieve virtually any desired criterion of binding
affinity and selectivity. Starting from a mixture of nucleic acids,
preferably comprising a segment of randomized sequence, the SELEX
method includes steps of contacting the mixture with the target
under conditions favorable for binding, partitioning unbound
nucleic acids from those nucleic acids which have bound to target
molecules, dissociating the nucleic acid-target complexes,
amplifying the nucleic acids dissociated from the nucleic
acid-target complexes to yield a ligand-enriched mixture of nucleic
acids, then reiterating the steps of binding, partitioning,
dissociating and amplifying through as many cycles as desired to
yield high affinity nucleic acid ligands to the target
molecule.
[0030] The basic SELEX method may be modified to achieve specific
objectives. For example, U.S. patent application Ser. No.
07/960,093, filed Oct. 14, 1992, entitled "Method for Selecting
Nucleic Acids on the Basis of Structure," now abandoned, describes
the use of SELEX in conjunction with gel electrophoresis to select
nucleic acid molecules with specific structural characteristics,
such as bent DNA (see U.S. Pat. No. 5,707,796). U.S. patent
application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled
"Photoselection of Nucleic Acid Ligands," now abandoned, describes
a SELEX based method for selecting nucleic acid ligands containing
photoreactive groups capable of binding and/or photocrosslinking to
and/or photoinactivating a target molecule. U.S. patent application
Ser. No. 08/134,028, filed Oct. 7, 1993, entitled "High-Affinity
Nucleic Acid Ligands That Discriminate Between Theophylline and
Caffeine", now abandoned, describes a method for identifying highly
specific nucleic acid ligands able to discriminate between closely
related molecules, termed "Counter-SELEX" (see U.S. Pat. No.
5,580,737). U.S. patent application Ser. No. 08/143,564, filed Oct.
25, 1993, entitled "Systematic Evolution of Ligands by EXponential
Enrichment: Solution SELEX", now abandoned, (see also U.S. Pat. No.
5,567,588) and U.S. Pat. No. 5,861,254, entitled "Flow Cell SELEX",
describe SELEX-based methods which achieve highly efficient
partitioning between oligonucleotides having high and low affinity
for a Target molecule. U.S. Pat. No. 5,496,938, entitled "Nucleic
Acid Ligands to HIV-RT and HIV-1 Rev," describes methods for
obtaining improved nucleic acid ligands after the SELEX process has
been performed. U.S. Pat. No. 5,705,337, entitled "Systematic
Evolution of Ligands by EXponential Enrichment: Chemi-SELEX",
describes methods for covalently linking a ligand to its
target.
[0031] The SELEX method encompasses the identification of
high-affinity nucleic acid ligands containing modified nucleotides
conferring improved characteristics on the ligand, such as improved
in vivo stability or delivery. Examples of such modifications
include chemical substitutions at the ribose and/or phosphate
and/or base positions. Specific SELEX-identified nucleic acid
ligands containing modified nucleotides are described in U.S.
patent application Ser. No. 08/117,991, filed Sep. 8, 1993,
entitled "High Affinity Nucleic Acid Ligands Containing Modified
Nucleotides," now abandoned, that describes oligonucleotides
containing nucleotide derivatives chemically modified at the 5- and
2'-positions of pyrimidines, as well as specific RNA ligands to
thrombin containing 2'-amino modifications (see U.S. Pat. No.
5,660,985). U.S. patent application Ser. No. 08/134,028, supra,
describes highly specific nucleic acid ligands containing one or
more nucleotides modified with 2'-amino (2'-NH.sub.2), 2'-fluoro
(2'-F), and/or 2'-O-methyl (2'-OMe). U.S. patent application Ser.
No. 08/264,029, filed Jun. 22, 1994, entitled "Novel Method of
Preparation of Known and Novel 2' Modified Nucleosides by
Intramolecular Nucleophilic Displacement," describes
oligonucleotides containing various 2'-modified pyrimidines.
PCT/US98/00589 (WO 98/130720), filed Jan. 7, 1998, entitled
"Bioconjugation of Oligonucleotides" describes a method for
identifying bioconjugates to a target comprising nucleic acid
ligands derivatized with a molecular entity exclusively at the
5'-position of the nucleic acid ligands.
[0032] The SELEX method encompasses combining selected
oligonucleotides with other selected oligonucleotides and
non-oligonucleotide functional units as described in U.S. Pat. No.
5,637,459, entitled "Systematic Evolution of Ligands by Exponential
Enrichment: Chimeric SELEX," and U.S. Pat. No. 5,683,867, entitled
"Systematic Evolution of Ligands by Exponential Enrichment: Blended
SELEX," respectively. These applications allow the combination of
the broad array of shapes and other properties, and the efficient
amplification and replication properties, of oligonucleotides with
the desirable properties of other molecules. The full text of the
above described patent applications, including but not limited to,
all definitions and descriptions of the SELEX process, are
specifically incorporated herein by reference in their
entirety.
BRIEF SUMMARY OF THE INVENTION
[0033] The present invention includes methods of identifying and
producing nucleic acid ligands to a VEGF receptor and the nucleic
acid ligands so identified and produced. A VEGF receptor is any
receptor which VEGF binds, including, but not limited to, VEGFR1,
VEGFR2, VEGFR3 and neuropilin-1. In particular, RNA sequences are
provided that are capable of binding specifically to a VEGF
receptor. Also included are oligonucleotides containing nucleotide
derivatives modified at the 2' position of the pyrimidines.
Specifically included in the invention are the RNA ligand sequences
shown in Tables 2 and 3 and FIG. 1 (SEQ ID NOS:2-36). Also included
in this invention are RNA ligands of a VEGF receptor that inhibit
the function of VEGF signaling.
[0034] Further included in this invention is a method of
identifying nucleic acid ligands and nucleic acid ligand sequences
to a VEGF receptor, comprising the steps of (a) preparing a
candidate mixture of nucleic acids; (b) contacting the candidate
mixture of nucleic acids with a VEGF receptor; (c) partitioning
between members of said candidate mixture on the basis of affinity
to a VEGF receptor; and (d) amplifying the selected molecules to
yield a mixture of nucleic acids enriched for nucleic acid
sequences with a relatively higher affinity for binding to a VEGF
receptor.
[0035] More specifically, the present invention includes the RNA
ligands to a VEGF receptor, identified according to the
above-described method, including those ligands shown in Tables 2
and 3 and FIG. 1 (SEQ ID NOS:2-36). Also included are nucleic acid
ligands to a VEGF receptor that are substantially homologous to any
of the given ligands and that have substantially the same ability
to bind a VEGF receptor and inhibit VEGF signaling. Further
included in this invention are nucleic acid ligands to a VEGF
receptor that have substantially the same structural form as the
ligands presented herein and that have substantially the same
ability to bind a VEGF receptor and inhibit VEGF signaling.
[0036] The present invention also includes other modified
nucleotide sequences based on the nucleic acid ligands identified
herein and mixtures of the same.
BRIEF DESCRIPTION OF THE FIGURES
[0037] FIG. 1 shows the predicted secondary structures for
representative nucleic acid ligands from Table 2.
DETAILED DESCRIPTION OF THE INVENTION
[0038] The central method utilized herein for identifying nucleic
acid ligands to a VEGF receptor is called the SELEX process, an
acronym for Systematic Evolution of Ligands by EXponential
enrichment and involves (a) contacting the candidate mixture of
nucleic acids with a VEGF receptor; (b) partitioning between
members of said candidate mixture on the basis of affinity to a
VEGF receptor; and, (c) amplifying the selected molecules to yield
a mixture of nucleic acids enriched for nucleic acid sequences with
a relatively higher affinity for binding to a VEGF receptor.
[0039] The invention also includes RNA ligands to a VEGF receptor.
This invention further includes the specific RNA ligands to a VEGF
receptor shown in Tables 2 and 3 and FIG. 1.
[0040] SELEX is described in U.S. patent application Ser. No.
07/536,428, entitled "Systematic Evolution of Ligands by
EXponential Enrichment," now abandoned, U.S. Pat. No. 5,475,096,
entitled "Nucleic Acid Ligands," and U.S. Pat. No. 5,270,163,
entitled "Methods for Identifying Nucleic Acid Ligands," (see also
WO91/19813). These applications, each specifically incorporated
herein by reference, are collectively called the SELEX Patent
Applications. VEGF nucleic acid ligands have been described in U.S.
patent application Ser. No. 09/156,824, filed Sep. 18, 1998, U.S.
Pat. No. 5,849,479 and U.S. Pat. No. 5,811,533, each entitled "High
Affinity Oligonucleotide Ligands to Vascular Endothelial Growth
Factor (VEGF)," U.S. patent application Ser. No. 08/870,930, filed
Jun. 6, 1997, U.S. patent application Ser. No. 09/254,968, filed
Mar. 16, 1999, and U.S. Pat. No. 6,051,698, each entitled "Vascular
Endothelial Growth Factor (VEGF) Nucleic Acid Ligand Complexes."
These applications are each specifically incorporated herein by
reference.
[0041] Certain terms used to described the invention herein are
defined as follows:
[0042] "Nucleic acid ligand" as used herein is a non-naturally
occurring nucleic acid having a desirable action on a target. A
nucleic acid ligand is also referred to herein as an "aptamer." A
desirable action includes, but is not limited to, binding of the
target, catalytically changing the target, reacting with the target
in a way which modifies/alters the target or the functional
activity of the target, covalently attaching to the target as in a
suicide inhibitor, and facilitating the reaction between the target
and another molecule. In the preferred embodiment, the desirable
action is specific binding to a target molecule, such target
molecule being a three dimensional chemical structure other than a
polynucleotide that binds to the nucleic acid ligand through a
mechanism which predominantly depends on Watson/Crick base pairing
or triple helix binding, wherein the nucleic acid ligand is not a
nucleic acid having the known physiological function of being bound
by the target molecule. Nucleic acid ligands include nucleic acids
that are identified from a candidate mixture of nucleic acids, said
nucleic acid ligand being a ligand of a given target by the method
comprising: a) contacting the candidate mixture with the target,
wherein nucleic acids having an increased affinity to the target
relative to the candidate mixture may be partitioned from the
remainder of the candidate mixture; b) partitioning the increased
affinity nucleic acids from the remainder of the candidate mixture;
and c) amplifying the increased affinity nucleic acids to yield a
ligand-enriched mixture of nucleic acids.
[0043] "Candidate mixture" is a mixture of nucleic acids of
differing sequence from which to select a desired ligand. The
source of a candidate mixture can be from naturally-occurring
nucleic acids or fragments thereof, chemically synthesized nucleic
acids, enzymatically synthesized nucleic acids or nucleic acids
made by a combination of the foregoing techniques. In a preferred
embodiment, each nucleic acid has fixed sequences surrounding a
randomized region to facilitate the amplification process.
[0044] "Nucleic acid" means either DNA, RNA, single-stranded or
double-stranded and any chemical modifications thereof.
Modifications include, but are not limited to, those which provide
other chemical groups that incorporate additional charge,
polarizability, hydrogen bonding, electrostatic interaction, and
fluxionality to the nucleic acid ligand bases or to the nucleic
acid ligand as a whole. Such modifications include, but are not
limited to, 2'-position sugar modifications, 5-position pyrimidine
modifications, 8-position purine modifications, modifications at
exocyclic amines, substitution of 4-thiouridine, substitution of
5-bromo or 5-iodo-uracil, backbone modifications, methylations,
unusual base-pairing combinations such as the isobases isocytidine
and isoguanidine and the like. Modifications can also include 3'
and 5' modifications such as capping.
[0045] "SELEX" methodology involves the combination of selection of
nucleic acid ligands that interact with a target in a desirable
manner, for example binding to a protein, with amplification of
those selected nucleic acids. Iterative cycling of the
selection/amplification steps allows selection of one or a small
number of nucleic acids that interact most strongly with the target
from a pool which contains a very large number of nucleic acids.
Cycling of the selection/amplification procedure is continued until
a selected goal is achieved. In the present invention, the SELEX
methodology is employed to obtain nucleic acid ligands to a VEGF
receptor. The SELEX methodology is described in the SELEX Patent
Applications.
[0046] "Target" means any compound or molecule of interest for
which a ligand is desired. A target can be a protein, peptide,
carbohydrate, polysaccharide, glycoprotein, hormone, receptor,
antigen, antibody, virus, substrate, metabolite, transition state
analog, cofactor, inhibitor, drug, dye, nutrient, growth factor,
etc. without limitation. In this application, the target is a VEGF
receptor.
[0047] In its most basic form, the SELEX process may be defined by
the following series of steps:
[0048] 1) A candidate mixture of nucleic acids of differing
sequence is prepared. The candidate mixture generally includes
regions of fixed sequences (i.e., each of the members of the
candidate mixture contains the same sequences in the same location)
and regions of randomized sequences. The fixed sequence regions are
selected either: (a) to assist in the amplification steps described
below; (b) to mimic a sequence known to bind to the target; or (c)
to enhance the concentration of a given structural arrangement of
the nucleic acids in the candidate mixture. The randomized
sequences can be totally randomized (i.e., the probability of
finding a base at any position being one in four) or only partially
randomized (e.g., the probability of finding a base at any location
can be selected at any level between 0 and 100 percent).
[0049] 2) The candidate mixture is contacted with the selected
target under conditions favorable for binding between the target
and members of the candidate mixture. Under these circumstances,
the interaction between the target and the nucleic acids of the
candidate mixture can be considered as forming nucleic acid-target
pairs between the target and those nucleic acids having the
strongest affinity for the target.
[0050] 3) The nucleic acids with the highest affinity for the
target are partitioned from those nucleic acids with lesser
affinity to the target. Because only an extremely small number of
sequences (and possibly only one molecule of nucleic acid)
corresponding to the highest affinity nucleic acids exist in the
candidate mixture, it is generally desirable to set the
partitioning criteria so that a significant amount of the nucleic
acids in the candidate mixture (approximately 5-50%) are retained
during partitioning.
[0051] 4) Those nucleic acids selected during partitioning as
having the relatively higher affinity to the target are then
amplified to create a new candidate mixture that is enriched in
nucleic acids having a relatively higher affinity for the
target.
[0052] 5) By repeating the partitioning and amplifying steps above,
the newly formed candidate mixture contains fewer and fewer weakly
binding sequences, and the average degree of affinity of the
nucleic acids to the target will generally increase. Taken to its
extreme, the SELEX process will yield a candidate mixture
containing one or a small number of unique nucleic acids
representing those nucleic acids from the original candidate
mixture having the highest affinity to the target molecule.
[0053] The SELEX Patent Applications describe and elaborate on this
process in great detail. Included are targets that can be used in
the process; methods for partitioning nucleic acids within a
candidate mixture; and methods for amplifying partitioned nucleic
acids to generate enriched candidate mixture. The SELEX Patent
Applications also describe ligands obtained to a number of target
species, including both protein targets where the protein is and is
not a nucleic acid binding protein.
[0054] The SELEX method further encompasses combining selected
nucleic acid ligands with lipophilic or non-immunogenic, high
molecular weight compounds in a diagnostic or therapeutic complex
as described in U.S. Pat. No. 6,011,020, entitled "Nucleic Acid
Ligand Complexes." VEGF nucleic acid ligands that are associated
with a lipophilic compound, such as diacyl glycerol or dialkyl
glycerol, in a diagnostic or therapeutic complex are described in
U.S. Pat. No. 5,859,228, entitled "Vascular Endothelial Growth
Factor (VEGF) Nucleic Acid Ligand Complexes". VEGF nucleic acid
ligands that are associated with a Lipophilic Compound, such as a
glycerol lipid, or a non-immunogenic, high molecular weight
Compound, such as polyalkylene glycol, are further described in
U.S. patent application Ser. No. 08/897,351, filed Jul. 21, 1997,
entitled "Vascular Endothelial Growth Factor (VEGF) Nucleic Acid
Ligand Complexes". VEGF nucleic acid ligands that are associated
with a non-immunogenic, high molecular weight compound or
lipophilic compound are also further described in PCT/US 97/18944,
filed Oct. 17, 1997, entitled "Vascular Endothelial Growth Factor
(VEGF) Nucleic Acid Ligand Complexes" (WO 98/18480)". Each of the
above described patent applications which describe modifications of
the basic SELEX procedure are specifically incorporated by
reference herein in their entirety.
[0055] In certain embodiments of the present invention it is
desirable to provide a complex comprising one or more nucleic acid
ligands to a VEGF receptor covalently linked with a
non-immunogenic, high molecular weight compound or lipophilic
compound. A "complex" used herein describes the molecular entity
formed by the covalent linking of the nucleic acid ligand of a VEGF
receptor to a non-immunogenic, high molecular weight compound. A
non-immunogenic, high molecular weight compound is a compound
between approximately 100 Da to 1,000,000 Da, more preferably
approximately 1000 Da to 500,000 Da, and most preferably
approximately 1000 Da to 200,000 Da, that typically does not
generate an immunogenic response. For the purposes of this
invention, an immunogenic response is one that causes the organism
to make antibody proteins. In one preferred embodiment of the
invention, the non-immunogenic, high molecular weight compound is a
polyalkylene glycol. In the most preferred embodiment, the
polyalkylene glycol is polyethylene glycol (PEG). More preferably,
the PEG has a molecular weight of about 10-80K. Most preferably,
the PEG has a molecular weight of about 20-45K. In certain
embodiments of the invention, the non-immunogenic, high molecular
weight compound can also be a nucleic acid ligand.
[0056] In another embodiment of the invention it is desirable to
have a complex comprised of a nucleic acid ligand to a VEGF
receptor and a lipophilic compound. Lipophilic compounds are
compounds that have the propensity to associate with or partition
into lipid and/or other materials or phases with low dielectric
constants, including structures that are comprised substantially of
lipophilic components. Lipophilic compounds include lipids as well
as non-lipid containing compounds that have the propensity to
associate with lipid (and/or other materials or phases with low
dielectric constants). Cholesterol, phospholipid, and glycerol
lipids, such as dialkylglycerol, diacylglycerol, and glycerol amide
lipids are further examples of lipophilic compounds. In a preferred
embodiment, the lipophilic compound is a glycerol lipid.
[0057] The non-immunogenic, high molecular weight compound or
lipophilic compound may be covalently bound to a variety of
positions on the nucleic acid ligand to a VEGF receptor, such as to
an exocyclic amino group on the base, the 5-position of a
pyrimidine nucleotide, the 8-position of a purine nucleotide, the
hydroxyl group of the phosphate, or a hydroxyl group or other group
at the 5' or 3' terminus of the nucleic acid ligand to VEGF
receptor. In embodiments where the lipophilic compound is a
glycerol lipid, or the non-immunogenic, high molecular weight
compound is polyalkylene glycol or polyethylene glycol, preferably
the non-immunogenic, high molecular weight compound is bonded to
the 5' or 3' hydroxyl of the phosphate group thereof. In the most
preferred embodiment, the lipophilic compound or non-immunogenic,
high molecular weight compound is bonded to the 5' hydroxyl of the
phosphate group of the nucleic acid ligand. Attachment of the
non-immunogenic, high molecular weight compound or lipophilic
compound to the nucleic acid ligand of VEGF receptor can be done
directly or with the utilization of linkers or spacers.
[0058] A "linker" is a molecular entity that connects two or more
molecular entities through covalent bonds or non-covalent
interactions, and can allow spatial separation of the molecular
entities in a manner that preserves the functional properties of
one or more of the molecular entities. A linker can also be known
as a spacer.
[0059] The complex comprising a nucleic acid ligand to VEGF
receptor and a non-immunogenic, high molecular weight compound or
lipophilic compound can be further associated with a lipid
construct. Lipid constructs are structures containing lipids,
phospholipids, or derivatives thereof comprising a variety of
different structural arrangements which lipids are known to adopt
in aqueous suspension. These structures include, but are not
limited to, lipid bilayer vesicles, micelles, liposomes, emulsions,
lipid ribbons or sheets, and may be complexed with a variety of
drugs and components which are known to be pharmaceutically
acceptable. In the preferred embodiment, the lipid construct is a
liposome. The preferred liposome is unilamellar and has a relative
size less than 200 nm. Common additional components in lipid
constructs include cholesterol and alpha-tocopherol, among others.
The lipid constructs may be used alone or in any combination which
one skilled in the art would appreciate to provide the
characteristics desired for a particular application. In addition,
the technical aspects of lipid constructs and liposome formation
are well known in the art and any of the methods commonly practiced
in the field may be used for the present invention.
[0060] The SELEX method further comprises identifying bioconjugates
to a target. Copending PCT Patent Application No. US98/00589, filed
Jan. 7, 1998, entitled "Bioconjugation of Oligonucleotides," (WO
98/30720), describes a method for enzymatically synthesizing
bioconjugates comprising RNA derivatized exclusively at the
5'-position with a molecular entity, and a method for identifying
bioconjugates to a target comprising nucleic acid ligands
derivatized with a molecular entity exclusively at the 5'-position
of the nucleic acid ligands. A bioconjugate as used herein refers
to any oligonucleotide that has been derivatized with another
molecular entity. In a preferred embodiment, the molecular entity
is a macromolecule. As used herein, a "macromolecule" refers to a
large organic molecule. Examples of macromolecules include, but are
not limited to nucleic acids, oligonucleotides, proteins, peptides,
carbohydrates, polysaccharides, glycoproteins, lipophilic
compounds, such as cholesterol, phospholipids, diacyl glycerols and
dialkyl glycerols, hormones, drugs, non-immunogenic high molecular
weight compounds, fluorescent, chemiluminescent and bioluminescent
marker compounds, antibodies and biotin, etc. without limitation.
In certain embodiments, the molecular entity may provide certain
desirable characteristics to the nucleic acid ligand, such as
increasing RNA hydrophobicity and enhancing binding, membrane
partitioning and/or permeability. Additionally, reporter molecules,
such as biotin, fluorescein or peptidyl metal chelates for
incorporation of diagnostic radionuclides may be added, thus
providing a bioconjugate which may be used as a diagnostic
agent.
[0061] Certain VEGF receptors (e.g., VEGFR1 and VEGFR2) are
strongly upregulated in activated endothelial cells compared to
quiescent cells. Activated endothelial cells would be found at
areas of inflammation, ischemia reperfusion injury or angiogenesis.
Thus, in certain embodiments of the present invention, it is
contemplated that VEGF receptor nucleic acid ligands may be used to
deliver various chemotherapeutic, radiotherapeutic or imaging
entities to such sites.
[0062] Thus, the methods described herein and the nucleic acid
ligands identified by such methods are useful for both therapeutic
and diagnostic purposes. Therapeutic uses include the treatment or
prevention of diseases or medical conditions in human patients.
Therapeutic uses may also include veterinary applications. The VEGF
receptor nucleic acid ligands described herein can be used to
treat, inhibit, prevent or diagnose any disease state that involves
inappropriate VEGF production, particularly angiogenesis.
Angiogenesis rarely occurs in healthy adults, except during the
menstrual cycle and wound healing. Angiogenesis is a central
feature, however, of various disease states, including, but not
limited to cancer, diabetic retinopathy, macular degeneration,
psoriasis and rheumatoid arthritis. The present invention, thus,
also includes, but is not limited to, methods of treating,
inhibiting, preventing or diagnosing diabetic retinopathy, macular
degeneration, psoriasis and rheumatoid arthritis. Additionally,
VEGF is produced and secreted in varying amounts by virtually all
tumor cells. Thus, the present invention, includes methods of
treating, inhibiting, preventing, or diagnosing cancer.
[0063] Diagnostic utilization may include both in vivo, ex vivo or
in vitro diagnostic applications. The SELEX method generally, and
the specific adaptations of the SELEX method taught and claimed
herein specifically, are particularly suited for diagnostic
applications. SELEX identifies nucleic acid ligands that are able
to bind targets with high affinity and with surprising specificity.
These characteristics are, of course, the desired properties one
skilled in the art would seek in a diagnostic ligand.
[0064] The nucleic acid ligands of the present invention may be
routinely adapted for diagnostic purposes according to any number
of techniques employed by those skilled in the art or by the
methods described in PCT/US98/00589 (WO 98/30720). Diagnostic
agents need only be able to allow the user to identify the presence
of a given target at a particular locale or concentration. Simply
the ability to form binding pairs with the target may be sufficient
to trigger a positive signal for diagnostic purposes. Those skilled
in the art would also be able to adapt any nucleic acid ligand by
procedures known in the art to incorporate a labeling tag in order
to track the presence of such ligand. Such a tag could be used in a
number of diagnostic procedures. The nucleic acid ligands to a VEGF
receptor described herein may specifically be used for
identification of a VEGF receptor protein.
[0065] Labeling markers, such as radionuclides, magnetic compounds,
and the like can be conjugated to the VEGF receptor nucleic acid
ligand for imaging in an in vivo or ex vivo setting disease
conditions in which VEGF receptor is expressed. The marker may be
covalently bound to a variety of positions on the VEGF receptor
nucleic acid ligand, such as to an exocyclic amino group on the
base, the 5-position of a pyrimidine nucleotide, the 8-position of
a purine nucleotide, the hydroxyl group of the phosphate, or a
hydroxyl group or other group at the 5' or 3' terminus of the VEGF
receptor nucleic acid ligand. In one embodiment, the marker is
bonded to the 5' or 3' hydroxyl of the phosphate group thereof.
Attachment of the marker can be done directly or with the
utilization of a linker.
[0066] As discussed above, in other embodiments, the VEGF receptor
nucleic acid ligands are useful for the delivery of therapeutic
compounds (including, but not limited to, cytotoxic compounds and
immune enhancing substances) to tissues or organs expressing VEGF
receptor. Conditions in which VEGF receptor may be expressed
include, but are not limited to, inflammation, ischemia reperfusion
injury and angiogenesis. Those skilled in the art would be able to
adapt any VEGF receptor nucleic acid ligand by procedures known in
the art to incorporate a therapeutic compound in a complex. The
therapeutic compound may be covalently bound to a variety of
positions on the VEGF receptor nucleic acid ligand, such as to an
exocyclic amino group on the base, the 5-position of a pyrimidine
nucleotide, the 8-position of a purine nucleotide, the hydroxyl
group of the phosphate, or a hydroxyl group or other group at the
5' or 3' terminus of the VEGF receptor nucleic acid ligand. In one
embodiment, the therapeutic agent can be done directly or with the
utilization of a linker.
[0067] It is also contemplated that both the marker and therapeutic
agent may be associated with the VEGF receptor nucleic acid ligand
such that detection of the disease condition and delivery of the
therapeutic agent is accomplished together. It is also contemplated
that either or both the marker and/or the therapeutic agent may be
structure, such as a liposome. As discussed above, methods for
conjugating nucleic acid ligands with lipophilic compounds or
non-immunogenic compounds in a diagnostic or therapeutic complex
are described in U.S. Pat. No. 6,011,020, entitled "Nucleic Acid
Ligand Complexes," which is incorporated herein in its
entirety.
[0068] Furthermore, VEGFR1 and VEGFR2, for example, belong to a
class of tyrosine kinase receptors in which activating
phosphorylation and subsequent signaling is initiated by
ligand-induced receptor dimerization (Weiss and Schlessinger (1998)
Cell 94:277-280). Thus, in certain circumstances, it would be
desirable to enhance or control the VEGF signaling. For example,
increasing VEGF production may lead to the growth of new blood
vessels around a blood clot in heart disease. Surgery may be
avoided by having a biochemical alternative. See, for example, Van
Velle et al. (1998) Circulation 97:381-90. Thus, the VEGF receptor
aptamer can be used as a VEGF substitute. Therefore, it is
contemplated that nucleic acid ligands in dimeric or multimeric
formulations may reasonably be expected to serve as a receptor
agonist, provided that, as would be known to one of skill in the
art, the linkage between the aptamers is appropriate to induce
productive receptor dimerization.
[0069] SELEX provides high affinity ligands of a target molecule.
This represents a singular achievement that is unprecedented in the
field of nucleic acids research. The present invention applies the
SELEX procedure to the specific target of a VEGF receptor. In the
Example section below, the experimental parameters used to isolate
and identify the nucleic acid ligands to VEGF receptor are
described.
[0070] In order to produce nucleic acids desirable for use as a
pharmaceutical, it is preferred that the nucleic acid ligand (1)
binds to the target in a manner capable of achieving the desired
effect on the target; (2) be as small as possible to obtain the
desired effect; (3) be as stable as possible; and (4) be a specific
ligand to the chosen target. In most situations, it is preferred
that the nucleic acid ligand have the highest possible affinity to
the target.
[0071] In U.S. Pat. No. 5,496,938, methods are described for
obtaining improved nucleic acid ligands after SELEX has been
performed. This patent, entitled "Nucleic Acid Ligands to HIV-RT
and HIV-1 Rev," is specifically incorporated herein by
reference.
[0072] In the present invention, SELEX experiments were performed
in order to identify RNA ligands with specific high affinity for a
VEGF receptor. This invention includes the specific RNA ligands to
a VEGF receptor shown in Tables 2 and 3 and FIG. 1 (SEQ ID
NOS:2-36), identified by the methods described in Example 1. This
invention further includes RNA ligands to a VEGF receptor which
inhibit VEGF receptor function, presumably by inhibiting binding of
VEGF to its receptor or interfering with productive receptor
dimerization that is essential for receptor phosphorylation and
subsequent signal transduction. The scope of the ligands covered by
this invention extends to all nucleic acid ligands of a VEGF
receptor, modified and unmodified, identified according to the
SELEX procedure. More specifically, this invention includes nucleic
acid sequences that are substantially homologous to the ligands
shown in Tables 2 and 3 and FIG. 1 (SEQ ID NOS:2-36). By
substantially homologous it is meant a degree of primary sequence
homology in excess of 70%, most preferably in excess of 80%, and
even more preferably in excess of 90%, 95% or 99%. The percentage
of homology as described herein is calculated as the percentage of
nucleotides found in the smaller of the two sequences which align
with identical nucleotide residues in the sequence being compared
when 1 gap in a length of 10 nucleotides may be introduced to
assist in that alignment. A review of the sequence homologies of
the ligands of a VEGF receptor, shown in Tables 2 and 3 and FIG. 1
(SEQ ID NOS:2-36) shows that some sequences with little or no
primary homology may have substantially the same ability to bind a
VEGF receptor. For these reasons, this invention also includes
nucleic acid ligands that have substantially the same structure and
ability to bind a VEGF receptor as the nucleic acid ligands shown
in Tables 2 and 3 and FIG. 1 (SEQ ID NOS:2-36). Substantially the
same ability to bind VEGF receptor means that the affinity is
within one or two orders of magnitude of the affinity of the
ligands described herein. It is well within the skill of those of
ordinary skill in the art to determine whether a given
sequence--substantially homologous to those specifically described
herein--has substantially the same ability to bind a VEGF
receptor.
[0073] This invention also includes nucleic acid ligands that have
substantially the same postulated structure or structural motifs.
Substantially the same structure or structural motifs can be
postulated by sequence alignment using the Zukerfold program (see
Zuker (1989) Science 244:48-52). As would be known in the art,
other computer programs can be used for predicting secondary
structure and structural motifs. Substantially the same structure
or structural motif of nucleic acid ligands in solution or as a
bound structure can also be postulated using NMR or other
techniques as would be known in the art.
[0074] One potential problem encountered in the therapeutic,
prophylactic, and in vivo diagnostic use of nucleic acids is that
oligonucleotides in their phosphodiester form may be quickly
degraded in body fluids by intracellular and extracellular enzymes
such as endonucleases and exonucleases before the desired effect is
manifest. Certain chemical modifications of the nucleic acid ligand
can be made to increase the in vivo stability of the nucleic acid
ligand or to enhance or to mediate the delivery of the nucleic acid
ligand. See, e.g., U.S. patent application Ser. No. 08/117,991,
filed Sep. 8, 1993, entitled "High Affinity Nucleic Acid Ligands
Containing Modified Nucleotides," now abandoned and U.S. Pat. No.
6,011,020, entitled "Nucleic Acid Ligand Complexes," which are
specifically incorporated herein by reference. Modifications of the
nucleic acid ligands contemplated in this invention include, but
are not limited to, those which provide other chemical groups that
incorporate additional charge, polarizability, hydrophobicity,
hydrogen bonding, electrostatic interaction, and fluxionality to
the nucleic acid ligand bases or to the nucleic acid ligand as a
whole. Such modifications include, but are not limited to,
2'-position sugar modifications, 5-position pyrimidine
modifications, 8-position purine modifications, modifications at
exocyclic amines, substitution of 4-thiouridine, substitution of
5-bromo or 5-iodo-uracil, backbone modifications, phosphorothioate
or alkyl phosphate modifications, methylations, unusual
base-pairing combinations such as the isobases isocytidine and
isoguanidine and the like. Modifications can also include 3' and 5'
modifications such as capping.
[0075] Where the nucleic acid ligands are derived by the SELEX
method, the modifications can be pre- or post- SELEX modifications.
Pre-SELEX modifications yield nucleic acid ligands with both
specificity for their SELEX target and improved in vivo stability.
Post-SELEX modifications made to 2'-OH nucleic acid ligands can
result in improved in vivo stability without adversely affecting
the binding capacity of the nucleic acid ligand. The preferred
modifications of the nucleic acid ligands of the subject invention
are 5' and 3' phosphorothioate capping and/or 3'-3' inverted
phosphodiester linkage at the 3' end. In one preferred embodiment,
the preferred modification of the nucleic acid ligand is a 3'-3'
inverted phosphodiester linkage at the 3' end. Additional 2'-fluoro
(2'-F) and/or 2'-amino (2'-NH.sub.2) and/or 2'-O methyl (2'-OMe)
and/or 2'-OCH.sub.3 modification of some or all of the nucleotides
is preferred. Described herein are nucleic acid ligands that were
2'-F modified and incorporated into the SELEX process. Also
described herein are nucleic acid ligands that were 2'-OCH.sub.3
modified after the SELEX process was performed.
[0076] Other modifications are known to one of ordinary skill in
the art. Such modifications may be made post-SELEX (modification of
previously identified unmodified ligands) or by incorporation into
the SELEX process.
[0077] As described above, because of their ability to selectively
bind a VEGF receptor, the nucleic acid ligands to a VEGF receptor
described herein are useful as pharmaceuticals. This invention,
therefore, also includes a method for treating a VEGF
receptor-mediated pathological condition by administration of a
nucleic acid ligand capable of binding to a VEGF receptor.
[0078] Therapeutic compositions of the nucleic acid ligands may be
administered parenterally by injection, although other effective
administration forms, such as intraarticular injection, inhalant
mists, orally active formulations, transdermal iontophoresis or
suppositories, are also envisioned. One preferred carrier is
physiological saline solution, but it is contemplated that other
pharmaceutically acceptable carriers may also be used. In one
preferred embodiment, it is envisioned that the carrier and the
ligand constitute a physiologically-compatible, slow release
formulation. The primary solvent in such a carrier may be either
aqueous or non-aqueous in nature. In addition, the carrier may
contain other pharmacologically-acceptable excipients for modifying
or maintaining the pH, osmolarity, viscosity, clarity, color,
sterility, stability, rate of dissolution, or odor of the
formulation. Similarly, the carrier may contain still other
pharmacologically-acceptable excipients for modifying or
maintaining the stability, rate of dissolution, release, or
absorption of the ligand. Such excipients are those substances
usually and customarily employed to formulate dosages for parental
administration in either unit dose or multi-dose form.
[0079] Once the therapeutic composition has been formulated, it may
be stored in sterile vials as a solution, suspension, gel,
emulsion, solid, or dehydrated or lyophilized powder. Such
formulations may be stored either in a ready to use form or
requiring reconstitution immediately prior to administration. The
manner of administering formulations containing nucleic acid
ligands for systemic delivery may be via subcutaneous,
intramuscular, intravenous, intranasal or vaginal or rectal
suppository.
[0080] The following Examples are provided to explain and
illustrate the present invention and are not intended to be
limiting of the invention. Example 1 describes the various
materials and experimental procedures used in Examples 2-3. Example
2 describes VEGFR2 affinity selections. Example 3 describes VEGFR1
SELEX.
EXAMPLES
Example 1
VEGFR2 SELEX
[0081] Experimental Procedures
[0082] VEGFR2 for affinity selections was obtained from R&D
Systems (Minneapolis, Minn.). The commercial preparation consists
of the extracellular domain of human VEGFR2 (KDR; amino acid
residues 1-764; Terman et al. (1992) Biochem. Biophys. Res. Commun.
187:1579-1586) fused to human IgG1 domain (also referred to as the
Fc domain). The construct also contains a Factor Xa cleavage site
between the KDR and the IgG1 domains and six histidine residues at
the carboxy terminus. The protein is a disulfide-linked homodimer
expressed in NSO mouse myeloma cell line. For affinity selections,
KDR/Fc (50 .mu.g) was digested with Factor Xa (2 .mu.g; New England
Biolabs) in 50 mM Tris HCl pH 8.0, 100 mM NaCl, 5 mM CaCl.sub.2 at
room temperature for 18 hours. The Fc fragment was removed by
incubation with Protein G-Sepharose for 1 hour at 4.degree. C.
Removal of Factor Xa is accomplished by treatment with 50 .mu.l of
Xarrest Agarose (Novagen, Madison, Wis.) for 15 minutes at room
temperature. The KDR fragment was verified to be free of the Fc
fragment and Factor Xa by SDS-PAGE on 4-12% acrylamide gradient
gels and silver staining).
Example 2
VEGFR2 Affinity Selections
[0083] The SELEX process has been described in detail in the SELEX
Applications. The purified KDR extracellular domain was immobilized
on 4.5 .mu.m polystyrene paramagnetic beads (Dynal, Lake Success,
N.Y.) by incubating the protein in 1.7 mL microfuge tubes overnight
at 4.degree. C. in Hepes-buffered saline supplemented with 1 mM
MgCl.sub.2 and 1 mM CaCl.sub.2 (HBSMC). The beads were then washed
three times with 500 .mu.L HBSMC followed by three 500 .mu.L washes
with HBSMC containing 0.01% human serum albumin and 0.05% tween 20
(HBSMCHT). Affinity selections were performed by mixing 0.2-50
.mu.L of the bead slurry (0.6% solids w/v) containing about 0.075
.mu.g/mL KDR extracellular domain (based on micro BCA assay) with
50-100 .mu.L of RNA library 40N7 (5'-gggaggacgaugcgg [40N]
cagacgacucgcccga-3') (SEQ ID NO:1), 2'-fluoropyrimidine RNA) in
HBSMCHT (total volume 100 .mu.L) buffer followed by incubation at
37.degree. C. for 30 minutes and washing with five times with 500
.mu.L HBSMCHT. The beads were then transferred to a new microfuge
tube in 500 .mu.L HBSMCHT, the buffer was removed and the beads
were resuspended in 20 .mu.L water containing 5 .mu.M 3' primer.
Following heating to 95.degree. C. for 5 minutes and slow cooling
to room temperature, 5 .mu.L of 5.times.reverse transcriptase
solution (0.5 M Tris/HCl, pH 9.0 at 21.degree. C. (pH 8.3 at
48.degree. C.), 2.5 M NaCl, 0.5 M Mg(OAc).sub.2, 0.5 M DTT, 5 mM
dNTPs, 10 units AMV reverse transcriptase) was added to the tube
and the contents were incubated at 48.degree. C. for 30 minutes.
The beads were removed and the remainder of the reverse
transcription mixture (25 .mu.L) was added to 75 .mu.L of PCR
solution (66.7 mM KCl, 13.3 mM Tris/HCl, pH 8.3, 10 mM MgCl.sub.2,
1.33 mM dNTP, 1.33 .mu.M 3' N7 primer, 0.667 .mu.M 5' N7 primer,
0.667 .mu.M 5' primer-FD2, 2.67 .mu.M 5-(and 6-)
carboxy-X-rhodamine, 5 units Taq polymerase). Thirty-five cycles of
PCR were performed (after the initial heating at 95.degree. C. for
3 minutes, each cycle consisted of 95.degree. C. for 15 sec,
55.degree. C. for 10 sec, 72.degree. C. for 30 sec). In vitro
transcriptions were performed by mixing 50 .mu.L of the PCR product
with 150 .mu.L of the transcription solution (4 mM 2'-F CTP, 4 mM
2'-F UTP, 1.33 mM ATP, 1.33 mM GTP, 6.67 mM guanosine, 0.267 M
Hepes/KOH, pH 8.0, 0.267 M MgCl.sub.2, 0.267 M spermidine, 0.267 M
DTT, 0.2 units pyrophosphatase, 660 units T7 RNA polymerase) and
incubated at 37.degree. C. overnight. The transcripts were purified
by gel electrophoresis following a brief DNase treatment to remove
the template. The conditions for the six affinity selections
performed and the amount of RNA bound at each round is given in
Table 1.
[0084] Examination of the K.sub.d values of affinity enriched pools
from rounds 1-6 (Table 1) reveals that a substantial improvement in
affinity occurred already by round 2, with little, if any
subsequent improvement in affinity. To address the formal
possibility that the aptamers have evolved to the residual Fc
domain contaminant in the factor Xa-cleaved preparation, the
binding of the random starting pool (round 0) and round 5 pool to
KDR/Fc and cMet/Fc was examined. The two Fc-containing constructs
were obtained from the same manufacturer (R&D Systems), were
expressed in the same cell type (NSO cells) and have identical Fc
regions including the six histidines at the carboxy terminus. For
KDR/Fc, the K.sub.d values for aptamer pools from rounds 0 and
round 5 were 361.+-.16 nM and 0.76.+-.0.22 nM, respectively. The
same two pools bound to cMet/Fc with K.sub.d values of 58.+-.9 nM
and 74.+-.6 nM. These data suggest that the binding epitope for
aptamers in the round 5 pool is the KDR domain, as expected.
[0085] Sequences of 30 individual aptamer clones were obtained from
the round 5 affinity enriched pool. Most of the sequences (19)
could be grouped into a family shown in Table 2 (group A). Clones
without obvious sequence similarity to members of family A are
shown in Table 3 and are referred to as group B. Predicted
secondary structures for representative aptamers from group A are
shown in FIG. 1. It is of interest to note that two of the aptamers
in group A have circularly permuted primary structures compared to
the rest of the aptamers in the group (FIG. 1). This result
suggests that the regions outside of the conserved motif shown in
FIG. 1 (shading indicates conserved region) are not critical for
high affinity binding. We have measured the binding affinity of a
subset of aptamers from both groups A and B to KDR/Fc using the
nitrocellulose filter binding method. High affinity aptamers were
found in both group A and B (Tables 2 and 3).
[0086] We next examined whether a group of representative aptamers
was able to inhibit the binding of .sup.125I-VEGF-165 to VEGF
receptors expressed on HUVECs. Cells were seeded in 96-well plates
at a density of about 10,000 cells/well and maintained until
confluent. Culture medium was then replaced with growth factor
deficient medium (MEM, 5% heat inactivated fetal bovine serum, 1
.mu.g/mL heparin) for 3-4 hours. Cells were then washed with
Dulbecco's phosphate-buffered saline (DPBS) (containing 1 mM
CaCl.sub.2, 1 mM MgCl.sub.2 and 0.1% bovine serum albumin) followed
by the addition of 100 .mu.L/well of DPBS. .sup.125I-VEGF-165 (10
mg/mL) in the presence of varying amounts of aptamers (0.001-1000
nM) was then added to cells for 2 hours at room temperature.
Unbound .sup.125I-VEGF-165 was then removed by washing with DPBS
and the cells were lysed with Triton X-100. Lysates were harvested
onto glass fiber filters plates and processed for scintillation
counting. Aptamers K1, K10, K17 and K21 were tested. Aptamer K1 did
not displace .sup.125I-VEGF-165 at concentrations up to 1000 nM.
Aptamers K17 and K21 inhibited .sup.125I-VEGF-165 receptor binding
with IC.sub.50 values of 163 and 79 nM, respectively. Aptamer K10
was the most potent inhibitor of receptor binding with an IC.sub.50
of 1 nM. Thus, among the VEGFR2 aptamers tested, both receptor
binding antagonists and non-antagonists have been identified.
Example 3
VEGFR1 SELEX
[0087] VEGFR1 SELEX was conducted in a similar manner to that
described above for VEGFR2. For affinity selections, we used VEGFR1
(Flt-1) extracellular domain fused to the Fc domain. Like KDR/Fc,
Flt-1/Fc (R&D Systems, Minneapolis, Minn.) construct also
contains a Factor Xa cleavage site between the Flt-1 and the IgG1
domains and six histidine residues at the carboxy terminus. The
protein is a disulfide-linked homodimer expressed in NSO mouse
myeloma cell line.
[0088] Examination of the K.sub.d values of affinity enriched pools
from rounds 0 and 5 (Table 4) reveals that a only a modest
improvement in affinity occurred already by round 5. This is
probably due to the very high affinity of the extracellular domain
of VEGFR1 for nucleic acids, as reflected by the K.sub.d value of
0.20.+-.0.05 nM.
1TABLE 1 SELEX results for rounds 1-6. The number of molecules
bound was determined by quantitative PCR. Nitrocellulose filter
binding was used to determine the K.sub.d for each of the pools
using .sup.32P end-labeled transcripts and KDR/Fc dimer (in HBSMC
buffer at 37.degree. C.). The affinity of the unselected randomized
staffing library is 36 .+-. 3 nM. Bead [RNA], Molecules RNA
Molecules RNA bound Signal/ Round volume, .mu.l .mu.M bound to KDR
beads to empty beads noise K.sub.d pool, nM 1 50 5 3.2 .times.
10.sup.9 1.0 .times. 10.sup.9 3.2 Not determined 2 50 2 1.8 .times.
10.sup.10 4.9 .times. 10.sup.7 367 0.68 .+-. 0.14 3 10 6.1 3.3
.times. 10.sup.10 2.1 .times. 10.sup.8 157 0.80 .+-. 0.16 4 2 2.5
9.4 .times. 10.sup.9 5.5 .times. 10.sup.7 171 0.581 .+-. 0.08 5 0.4
5 8.5 .times. 10.sup.8 3.8 .times. 10.sup.7 22 0.83 .+-. 0.12 6 0.2
2.5 2.0 .times. 10.sup.8 5.2 .times. 10.sup.7 3.8 0.44 .+-.
0.05
[0089]
2TABLE 2 (Page 1) Aligned sequences a family of VEGFR2 aptamers.
Nucleotides from the fixed and initially randomized regions are
shown in lowercase and uppercase letters, respectively. Highly
conserved nucleotides are shown in boldface letters. Regions pre-
dicted to be base-paired are underlined. The last two sequences in
the set are circularly permuted and are split between two lines
(with equality sign) to allow alignment with the other sequences.
K.sub.d values for a subset of aptamers tested for binding to
KDR/Fc are shown. SEQ ID Clone NO: SEQUENCE K.sub.d, nM K3 2
gggaggacgaugcggCAUGGGGCCU-
GACU-GGAUCAUACCACCGCUUUCUCUGGUcagacgacucgcccga 0.51 .+-. 0.14 K5 3
gggaggacgaugcggCAUGGGGCCUGACU-GGAUCAUA-
CCACCGCUUCCUCUGGUcagacgacucgcccga 0.44 .+-. 0.07 K102 4
gggaggacgaugcggCAUGGGGCCUGACU-GGAUCAUACCACCGCUUCC-
UCUGGGUcagacgacucgcccga (n = 2) K119 5
gggaggacgaugcggCCUGGGGCCUGACU-GGAUCAUACCACCGCUUCCUCUGGGUcagacgacucgcc-
cga K7 6 gggaggacgaugcggAC-GAUAACACAGGGCCUGCUU-GGAUCACACUG-
AUUGCGCCcagacgacucgcccga 0.46 .+-. 0.02 K17 7
gggaggacgaugcggACANAUAACACAGGGCCUGCUU-GGAUCACACUGAUUGCGCCcagacgacuc-
gcccga 0.24 .+-. 0.08 K124 8
gggaggacgaugcggCGAUAACACAGGGCCUGCUU-GGAUCACACUGAUUGCGCCcagacgacucgcccga
K103 9 gggaggacgaugcggACGAUAACACAGGGCCUGCUU-GGAUCACACUGAUUG-
CGCCcagacgacucgcccga (n = 3) K1 10
gggaggacgaugcggGGCCUGUUU-GGAUCAUACCGAUCGUCAAUCCAAGAGUGGUcagacgacuc..
0.07 .+-. 0.01 K2 11
gggaggacgaugcggGGCCUGUUU-GGAUCAUACCGAUCGUCAAUCCUAAAGUGGUcagacgacuc..
0.27 .+-. (n = 4) 0.03 K101 12
gggaggacgaugcggGGCCUGCUU-GGAUCAUACCGAUCGUCAAUCCUAAAGUGGUcagacgacucgcccga
(n = 7) K115 13
gggaggacgaugcggGGCCUGCUU-GGAUCAUACCGAUCGUCAAGCCUAAAGUGGUcagacgacucgcccga
(n = 2) K118 14 gggaggacgaugcggUCUGAAGAGU-
AAGGGGCCUGUUC-GGAUCACACCUGCCGUcagacgacucgcccga (n = 3) K136 15
gggaggacgaugcggAGGGCCUAUUC-GGAUCAUACUCGCA-
GUUCUUUUACCCCGUcagacgacucgcccga K121 16
gggaggacgaugcggAGGGCCUAUUC-GGAUCAUACUCGCAGUUCUUACCCCGUcagacgacucgcccga
K127 17 gggaggacgaugcggGGGCCUAACUUGGAUCAU-CAGCAC-
CUGCCACCACCCCUcagacgacucgcccga K110 18
gggaggacgaugcggAGGUGCUCCUUUGGAACUU-CGUAUUUGUCUGCUCCCGGUcagacgacucgcccga
K21 19 5'gggaggacgaugcggAUCAUACCGAA- GAGA= 0.26 .+-.
=CACGGGGCCACCAUAUCCUCACCCCcagacgacucgcccga3' 0.05 K24 20
5'gggaggacgaugcggAUCAUACCGGGUCAUA= 0.97 .+-.
=ACACCGNUCACGGGGCCUUNUCGUcagacgacucgcccga3' 0.08
[0090]
3TABLE 3 Ungrouped sequences of VEGFR2 aptamers showing only the
initially randomized region. K.sub.d values for a subset of
aptamers tested for binding to KDR/Fc are shown. SEQ ID Clone NOS.
Sequence K.sub.d, nM K4 21 AGGUGCUCCUUUGGAACUUCGUAUUUGUCUGCUCCUGGU
0.28 .+-. 0.04 K10 22 UUGAUCGAGGUUCUAAGGCCUAUUUCCUGACUUUCUCCCC 0.47
.+-. 0.25 K11 (n = 4) 23 UUGAUCGAGGUUCUAAAGCCUAUUUCCUGACUUUCUCCCC
0.61 .+-. 0.13 K12 24 AAACGGAAGAAUUGGAGACCGACGUCGACCUCUUGGCCC 15.4
.+-. 2 K108 25 UUGAUCGAGGUUCUAAAGCCUAUUUCUGACUUUCUCC- CC K109 (n =
4) 26 ACGAUGCGGAAUCAGUGAAUGCUUAUAGCUCCGCCUGGU K111 27
AGCCGCCAGAAUUGGAACAACCCCUUUCGCACGCUCCCC K116 28
CGAAACGGAAUACUUGGAUACACCGCACUUCCCGACCCCU K6 29
AGCACUUGACCCACNACCAGAAAGCCAGCC 0.98 .+-. 0.05 K13 30
AACCAAUUAAGUCUGGCAAAUCUCUCUGUG 0.75 .+-. 0.09 K23 31
ACACACACAUCAUAAACAUUGUCCGUUGAC 2.2 .+-. 0.2
[0091]
4TABLE 4 SELEX results for rounds 1-6. The number of molecules
bound was determined by quantitative PCR. Nitrocellulose filter
binding was used to determine the K.sub.d for each of the pools
using .sup.32P end-labeled transcripts and Flt-1/Fc dimer (in HBSMC
buffer at 37.degree. C.). The affinity of the unselected randomized
starting library is 0.20 .+-. 0.05 nM. ND = not determined. Bead
[RNA], Molecules RNA Molecules RNA bound Signal/ Round volume,
.mu.l .mu.M bound to KDR beads to empty beads noise K.sub.d pool,
nM 1 50 2.7 2.6 .times. 10.sup.10 1.5 .times. 10.sup.8 173 ND 2 25
2 2.1 .times. 10.sup.12 1.2 .times. 10.sup.8 17500 ND 3 2.5 1.5 3.6
.times. 10.sup.11 7.2 .times. 10.sup.7 5000 ND 4 0.25 1.5 6.2
.times. 10.sup.10 8.6 .times. 10.sup.7 721 ND 5 0.025 1.5 1.1
.times. 10.sup.10 8 .times. 10.sup.6 1375 0.093 .+-. 0.037
[0092]
Sequence CWU 1
1
36 1 71 RNA Artificial Sequence modified_base (1)..(71) All
pyrimidines are 2'F; N at positions 16 - 55 is any base. 1
gggaggacga ugcggnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnncagac
60 gacucgcccg a 71 2 70 RNA Artificial Sequence modified_base
(1)..(70) All pyrimidines are 2'F. 2 gggaggacga ugcggcaugg
ggccugacug gaucauacca ccgcuuucuc uggucagacg 60 acucgcccga 70 3 70
RNA Artificial Sequence modified_base (1)..(70) All pyrimidines are
2'F. 3 gggaggacga ugcggcaugg ggccugacug gaucauacca ccgcuuccuc
uggucagacg 60 acucgcccga 70 4 71 RNA Artificial Sequence
modified_base (1)..(71) All pyrimidines are 2'F. 4 gggaggacga
ugcggcaugg ggccugacug gaucauacca ccgcuuccuc ugggucagac 60
gacucgcccg a 71 5 71 RNA Artificial Sequence modified_base
(1)..(71) All pyrimidines are 2'F. 5 gggaggacga ugcggccugg
ggccugacug gaucauacca ccgcuuccuc ugggucagac 60 gacucgcccg a 71 6 71
RNA Artificial Sequence modified_base (1)..(71) All pyrimidines are
2'F. 6 gggaggacga ugcggacgau aacacagggc cugcuuggau cacacugauu
gcgcccagac 60 gacucgcccg a 71 7 72 RNA Artificial Sequence
modified_base (1)..(72) All pyrimidines are 2'F; n at position 19
is any base. 7 gggaggacga ugcggacana uaacacaggg ccugcuugga
ucacacugau ugcgcccaga 60 cgacucgccc ga 72 8 70 RNA Artificial
Sequence modified_base (1)..(70) All pyrimidines are 2'F. 8
gggaggacga ugcggcgaua acacagggcc ugcuuggauc acacugauug cgcccagacg
60 acucgcccga 70 9 71 RNA Artificial Sequence modified_base
(1)..(71) All pyrimidines are 2'F. 9 gggaggacga ugcggacgau
aacacagggc cugcuuggau cacacugauu gcgcccagac 60 gacucgcccg a 71 10
71 RNA Artificial Sequence modified_base (1)..(71) All pyrimidines
are 2'F. 10 gggaggacga ugcggggccu guuuggauca uaccgaucgu caauccaaga
guggucagac 60 gacucgcccg a 71 11 71 RNA Artificial Sequence
modified_base (1)..(71) All pyrimidines are 2'F. 11 gggaggacga
ugcggggccu guuuggauca uaccgaucgu caauccuaaa guggucagac 60
gacucgcccg a 71 12 71 RNA Artificial Sequence modified_base
(1)..(71) All pyrimidines are 2'F. 12 gggaggacga ugcggggccu
gcuuggauca uaccgaucgu caauccuaaa guggucagac 60 gacucgcccg a 71 13
71 RNA Artificial Sequence modified_base (1)..(71) All pyrimidines
are 2'F. 13 gggaggacga ugcggggccu gcuuggauca uaccgaucgu caagccuaaa
guggucagac 60 gacucgcccg a 71 14 70 RNA Artificial Sequence
modified_base (1)..(70) All pyrimidines are 2'F. 14 gggaggacga
ugcggucuga agaguaaggg gccuguucgg aucacaccug ccgucagacg 60
acucgcccga 70 15 71 RNA Artificial Sequence modified_base (1)..(71)
All pyrimidines are 2'F. 15 gggaggacga ugcggagggc cuauucggau
cauacucgca guucuuuuac cccgucagac 60 gacucgcccg a 71 16 69 RNA
Artificial Sequence modified_base (1)..(69) All pyrimidines are
2'F. 16 gggaggacga ugcggagggc cuauucggau cauacucgca guucuuaccc
cgucagacga 60 cucgcccga 69 17 69 RNA Artificial Sequence
modified_base (1)..(69) All pyrimidines are 2'F. 17 gggaggacga
ugcgggggcc uaacuuggau caucagcacc ugccaccacc ccucagacga 60 cucgcccga
69 18 70 RNA Artificial Sequence modified_base (1)..(70) All
pyrimidines are 2'F. 18 gggaggacga ugcggaggug cuccuuugga acuucguauu
ugucugcucc cggucagacg 60 acucgcccga 70 19 71 RNA Artificial
Sequence modified_base (1)..(71) All pyrimidines are 2'F. 19
gggaggacga ugcggaucau accgaagaga cacggggcca ccauauccuc acccccagac
60 gacucgcccg a 71 20 71 RNA Artificial Sequence modified_base
(1)..(71) All pyrimidines are 2'F; n at positions 38 and 51 is any
base. 20 gggaggacga ugcggaucau accgggucau aacaccgnuc acggggccuu
nucgucagac 60 gacucgcccg a 71 21 70 RNA Artificial Sequence
modified_base (1)..(70) All pyrimidines are 2'F. 21 gggaggacga
ugcggaggug cuccuuugga acuucguauu ugucugcucc uggucagacg 60
acucgcccga 70 22 71 RNA Artificial Sequence modified_base (1)..(71)
All pyrimidines are 2'F. 22 gggaggacga ugcgguugau cgagguucua
aggccuauuu ccugacuuuc ucccccagac 60 gacucgcccg a 71 23 71 RNA
Artificial Sequence modified_base (1)..(71) All pyrimidines are
2'F. 23 gggaggacga ugcgguugau cgagguucua aagccuauuu ccugacuuuc
ucccccagac 60 gacucgcccg a 71 24 70 RNA Artificial Sequence
modified_base (1)..(70) All pyrimidines are 2'F. 24 gggaggacga
ugcggaaacg gaagaauugg agaccgacgu cgaccucuug gccccagacg 60
acucgcccga 70 25 70 RNA Artificial Sequence modified_base (1)..(70)
All pyrimidines are 2'F. 25 gggaggacga ugcgguugau cgagguucua
aagccuauuu cugacuuucu cccccagacg 60 acucgcccga 70 26 70 RNA
Artificial Sequence modified_base (1)..(70) All pyrimidines are
2'F. 26 gggaggacga ugcggacgau gcggaaucag ugaaugcuua uagcuccgcc
uggucagacg 60 acucgcccga 70 27 71 RNA Artificial Sequence
modified_base (1)..(71) All pyrimidines are 2'F. 27 gggaggacga
ugcggaagcc gccagaauug gaacaacccc uuucgcacgc ucccccagac 60
gacucgcccg a 71 28 71 RNA Artificial Sequence modified_base
(1)..(71) All pyrimidines are 2'F. 28 gggaggacga ugcggcgaaa
cggaauacuu ggauacaccg cacuucccga ccccucagac 60 gacucgcccg a 71 29
61 RNA Artificial Sequence modified_base (1)..(61) All pyrimidines
are 2'F; n at position 30 is any base. 29 gggaggacga ugcggagcac
uugacccacn accagaaagc cagcccagac gacucgcccg 60 a 61 30 61 RNA
Artificial Sequence modified_base (1)..(61) All pyrimidines are
2'F. 30 gggaggacga ugcggaacca auuaagucug gcaaaucucu cugugcagac
gacucgcccg 60 a 61 31 61 RNA Artificial Sequence modified_base
(1)..(61) All pyrimidines are 2'F. 31 gggaggacga ugcggacaca
cacaucauaa acauuguccg uugaccagac gacucgcccg 60 a 61 32 64 RNA
Artificial Sequence modified_base (1)..(64) All pyrimidines are
2'F. 32 gggaggacga ugcgggcggc auggggccug acuggaucau accaccgcca
gacgacucgc 60 ccga 64 33 63 RNA Artificial Sequence modified_base
(1)..(63) All pyrimidines are 2'F. 33 gggaggacga ugcgguaaca
cagggccugc uuggaucaca cugauugcag acgacucgcc 60 cga 63 34 67 RNA
Artificial Sequence modified_base (1)..(67) All pyrimidines are
2'F. 34 gggaggacga ugcgggacga ugcggggccu guuuggauca uaccgaucgu
ccagacgacu 60 cgcccga 67 35 59 RNA Artificial Sequence
modified_base (1)..(59) All pyrimidines are 2'F. 35 gggaggacga
ugcggcggau cauaccgaag agacacgggg ccacagacga cucgcccga 59 36 68 RNA
Artificial Sequence modified_base (1)..(68) All pyrimidines are
2'F; n at position 41 is any base. 36 gggaggacga ugcggcggau
cauaccgggu cauaacaccg nucacggggc cucagacgac 60 ucgcccga 68
* * * * *