U.S. patent application number 10/759519 was filed with the patent office on 2004-11-11 for haplotype analysis.
This patent application is currently assigned to The Trustees of Boston University. Invention is credited to Cantor, Charles R., Ding, Chunming.
Application Number | 20040224331 10/759519 |
Document ID | / |
Family ID | 32771894 |
Filed Date | 2004-11-11 |
United States Patent
Application |
20040224331 |
Kind Code |
A1 |
Cantor, Charles R. ; et
al. |
November 11, 2004 |
Haplotype analysis
Abstract
The present invention provides an efficient way for high
throughput haplotype analysis. Several polymorphic nucleic acid
markers, such as SNPs, can be simultaneously and reliably
determined through multiplex PCR of single nucleic acid molecules
in several parallel single molecule dilutions and the consequent
statistical analysis of the results from these parallel single
molecule multiplex PCR reactions results in reliable determination
of haplotypes present in the subject. The nucleic acid markers can
be of any distance to each other on the chromosome. In addition, an
approach wherein overlapping DNA markers are analyzed can be used
to link smaller haplotypes into larger haplotypes. Consequently,
the invention provides a powerful new tool for diagnostic
haplotyping and identifying novel haplotypes.
Inventors: |
Cantor, Charles R.; (Del
Mar, CA) ; Ding, Chunming; (Waltham, MA) |
Correspondence
Address: |
Ronald I. Eisenstein
NIXON PEABODY LLP
100 Summer Street
Boston
MA
02110
US
|
Assignee: |
The Trustees of Boston
University
Boston
MA
|
Family ID: |
32771894 |
Appl. No.: |
10/759519 |
Filed: |
January 16, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60441046 |
Jan 17, 2003 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/91.2 |
Current CPC
Class: |
C12Q 1/6858 20130101;
C12Q 2600/156 20130101; C12Q 1/6827 20130101; C12Q 1/6858 20130101;
C12Q 1/6858 20130101; C12Q 1/6858 20130101; C12Q 2537/143 20130101;
C12Q 2537/143 20130101; C12Q 2527/137 20130101; C12Q 1/6827
20130101; C12Q 2537/143 20130101; C12Q 2565/627 20130101; C12Q
2527/137 20130101; C12Q 2537/143 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
We claim:
1. A method for determining a haplotype of a subject comprising the
steps of: (a) diluting a nucleic acid sample from the subject into
a single molecule dilution; (b) amplifying the diluted single
nucleotide dilution with at least two different primer pairs
designed to amplify a region comprising at least two polymorphic
sites in the nucleic acid template; (c) genotyping the polymorphic
sites in the single nucleic acid molecule; and (d) determining the
haplotype from the genotypes of at least the two polymorphic sites
to obtain a haplotype for the subject.
2. The method of claim 1, further comprising repeating steps a-c at
least three times from the same nucleic acid sample to obtain at
least four genotype replicas from the same subject and thereafter
comparing the at least four genotype replicas to determine the
haplotype.
3. The method of claim 2, further comprising comparing the
haplotype with a haplotype from a control or a database of
haplotypes from controls to determine association of the haplotype
with a biological trait.
4. The method of claim 1, wherein the polymorphism is a single
nucleotide polymorphism.
5. The method of claim 1, wherein the polymorphism is a deletion,
an insertion, a substitution or an inversion.
6. The method of claim 1, wherein the polymorphism is a combination
of one or more markers selected from the group consisting of a
single nucleotide polymorphism, deletion, an insertion, a
substitution or an inversion.
7. The method of claims 1-6, wherein genotyping is performed using
primer extension and mass spectrometric detection.
8. The method of claim 2, wherein 12-18 genotype replicas are
produced.
9. A method of diagnosing a disease condition or disease
susceptibility by determining a disease related haplotype in a
subject comprising the steps of: (a) diluting a nucleic acid sample
from the subject into a single molecule dilution; (b) amplifying
the diluted single nucleotide dilution with at least two primer
pairs designed to amplify a region comprising at least two
polymorphic sites in the nucleic acid template; (c) genotyping the
polymorphic sites in the single nucleic acid molecule; (d)
determining the haplotype from the genotype of at least two
polymorphic sites to obtain a haplotype for the subject; and (e)
comparing the haplotype of the subject to known disease-associated
haplotypes, wherein a match in the sample haplotype with a
disease-associated haplotype indicates that the subject has the
disease or that the subject is susceptible for the disease.
10. The method of claim 9, further comprising repeating steps a-c
at least three times from the same nucleic acid sample to obtain at
least four genotype replicas from the same subject and thereafter
comparing the at least four genotype replicas to determine the
haplotype.
11. The method of claim 10, wherein 12-18 replicas are
produced.
12. A method of determining a haplotype of a subject comprising the
steps of: (a) treating a nucleic acid sample from the subject with
a composition that differentially affects an epigenetically
modified nucleotide in the nucleic acid sample to effectively
create polymorphisms based on the epigenetic modification; (b)
diluting the treated nucleic acid sample into a single copy
dilution; (c) amplifying the diluted nucleic acid sample using at
least two different primer pairs; (d) genotyping the amplified
sample; and (e) determining the haplotype of the subject from the
genotyped sample.
13. The method of claim 12, further comprising repeating the steps
b-d at least three times to obtain at least four genotype replicas
from the same subject and thereafter determining a haplotype of the
subject based on the genotype replicas.
14. The method of claim 13, wherein 12-18 replicas are
produced.
15. The method of claim 12, wherein the epigenetically modified
nucleotide is a methylated nucleotide.
16. The method of claim 15, wherein the nucleic acid sample is
treated with bisulfite.
17. A method of determining a haplotype in a subject comprising the
steps -of: (a) digesting a nucleic acid sample from the subject
with a methylation-sensitive restriction enzyme so that either
unmethylated DNA or methylated DNA is left intact, depending on
which enzyme is used; (b) diluting the digested nucleic acid sample
to a single molecule concentration; (c) amplifying the diluted and
undiluted nucleic acid sample with at least two different primer
pairs; (d) genotyping the amplified samples; and (e) determining a
haplotype of a methylated nucleic acid wherein at least one
polymorphic markers next to the methylation site, together with the
methylation site, constitutes a haplotype.
18. The method of claim 17, further comprising repeating the steps
b-d at least three times to obtain at least four genotype replicas
from the same subject and thereafter determining a haplotype of the
subject based on the genotype replicas.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims benefit of the U.S.
provisional application Serial No. 60/441,046, filed on Jan. 17,
2003, which is herein incorporated by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0002] Genetic polymorphisms are well recognized mechanisms
underlying inter-individual differences in disease risk as well as
treatment response in humans (Evans and Relling (1999) Science
286:487-491; Shields and Harris (2000) J. Clin. Onc. 18:2309-2316).
Single nucleotide polymorphism (SNP) analysis has drawn much
attention with the hope of identifying genetic markers for and
genes involved in common diseases because of the frequency of the
SNPs. Also, for many genes, the detection of SNPs known to confer
loss of function provides a simple molecular diagnostic to select
optimal medications and dosages for individual patients (Evans and
Relling (1999) Science 286:487-491). It is common for genes to
contain multiple SNPs, with haplotype structure being the principal
determinant of phenotypic consequences (Collins et al. (1997)
Science 278, 1580-81; Drysdale et al. (2000) Proc. Natl. Acad. Sci.
97:10483-8; Krynetski and Evans (1998) Am. J. Hum. Gen. 63:11-16).
Therefore, to more accurately associate disease risks and
pharmacogenomic traits with genetic polymorphisms, reliable methods
are needed to unambiguously determine haplotype structure for
multiple SNPs or other nucleic acid polymorphisms or mutations
within genes as well as non-coding genomic regions.
[0003] However, current genotyping technologies are only able to
determine each polymorphism, including SNPs, separately. In other
words, there is a lack of information on how several polymorphisms
are associated with each other physically on a chromosome. A DNA
haplotype, the phase determined association of several polymorphic
markers (e.g., SNPs) is a statistically much more powerful method
for disease association studies. Yet unfortunately, it is also much
harder to determine a haplotype. Current experimental approaches
include a physical separation of homologous chromosomes via means
of mouse cell line hybrid, cloning into a plasmid and allele
specific PCR. Neither of them is simple enough a method for routine
high-throughput analysis. There are also ways to computationally
determine haplotypes, but the accuracy of such computational
analysis is uncertain.
[0004] 4 Approaches that can be used to haplotype SNPs or other
nucleic acid polymorphisms, modifications and/or mutations that
reside within relatively close proximity include, but are not
limited to, single-strand conformational polymorphism (SSCP)
analysis (Orita et al. (1989) Proc. Natl. Acad. Sci. USA
86:2766-2770), heteroduplex analysis (Prior et al. (1995) Hum.
Mutat. 5:263-268), oligonucleotide ligation (Nickerson et al.
(1990) Proc. Natl. Acad. Sci. USA 87:8923-8927) and hybridization
assays (Conner et al. (1983) Proc. Natl. Acad. Sci. USA
80:278-282). A major drawback to these procedures is that they are
limited to polymorphism detection along short segments of DNA and
typically require stringent reaction conditions and/or labeling.
Traditional Taq polymerase PCR-based strategies, such as PCR-RFLP,
allele-specific amplification (ASA) (Ruano and Kidd (1989) Nucleic
Acids Res. 17:8392), single-molecule dilution (SMD) (Ruano et al.
(1990) Proc. Natl. Acad. Sci. USA 87:6296-6300), and coupled
amplification and sequencing (CAS) (Ruano and Kidd (1991) Nucleic
Acids Res. 19:6877-6882), are easily performed and highly
sensitive, but these methods are also limited to haplotyping SNPs
along short DNA segments (<1 kb) (Michalatos-Beloin et al.
(1996) Nucleic Acids Res. 24:4841-4843; Barnes (1994) Proc. Natl.
Acad. Sci. USA 91:5695-5699; Ruano and Kidd (1991) Nucleic Acids
Res. 19:6877-6882).
[0005] Long-range PCR (LR-PCR) offers the potential to haplotype
SNPs that are separated by kilobase lengths of genomic DNA. LR-PCR
products are commonly genotyped for SNPs, and haplotypes inferred
using mathematical approaches (e.g., Clark's algorithm (Clark
(1990) Mol. Biol. Evol. 7:111-122). However, inferring haplotypes
in this manner does not yield unambiguous haplotype assignment when
individuals are heterozygous at two or more loci (Hodge et al.
(1999) Nature Genet. 21:360-361). Physically separating alleles by
cloning, followed by sequencing, eliminates any ambiguity, but this
method is laborious and expensive. Long-range allele-specific
amplification negates both of these problems, but is limited to
SNP-containing alleles that have heterozygous insertion/deletion
anchors for PCR primers (Michalatos-Beloin et al. (1996) Nucleic
Acids Res. 24:4841-4843). More complex technologies have also been
used, such as monoallelic mutation analysis (MAMA) (Papadopoulos et
al. (1995) Nature Genet. 11:99-102) and carbon nanotube probes
(Woolley et al. (2000) Nature Biotech. 18:760-763), but these are
either time consuming (MAMA), or require technology that is not
widely available (nanotubes). U.S. patent application No.
2002/0081598 discloses a haplotying method which involves the use
of PCR amplification and DNA ligation to bring the polymorphic
nucleic acid sites in a particular allele into close proximity to
facilitate the determination of haplotypes spanning kilobase
distances. However, this method relies on at least two enzymatic
steps to create DNA fragments that can be ligated with other DNA
fragments, and subsequently ligases to combine the DNA fragments to
form one large fragment with several polymorphic sites in a shorter
distance. These additional sample preparation steps make large
scale use and automation of this technique cumbersome and error
prone.
[0006] Haplotypes, combinations of several phase-determined
polymorphic markers in a chromosome, are extremely valuable for
studies like disease association.sup.1,2 and chromosome evolution.
Direct molecular haplotyping has relied heavily on family data, but
is limited to short genomic regions (a few kilobases). Statistical
estimation of haplotype frequencies can be inconclusive and
inaccurate.sup.3.
[0007] With the rapid discovery and validation of several million
single nucleotide polymorphisms (SNP), it is now increasingly
practical to use genome-wide scanning to find genes associated with
common diseases.sup.1,2. However, individual SNPs have limited
statistical power for locating disease susceptibility genes.
Haplotypes can provide additional statistical power in the mapping
of disease genes.sup.4-7.
[0008] Haplotype determination of several markers for a diploid
cell is complicated since conventional genotyping techniques cannot
determine the phases of several different markers. For example, a
genomic region with three heterozygous markers can yield 8 possible
haplotypes. This ambiguity can, in some cases, be solved if
pedigree genotypes are available. However, even for a haplotype of
only 3 markers, genotypes of father-mother-offspring trios can fail
to yield offspring haplotypes up to 24% of the time. Computational
algorithms such as expectation-maximization (EM), subtraction and
PHASE are used for statistical estimation of haplotypes.sup.4,8,9.
However, these computational methods have serious limitations in
accuracy, number of markers and genomic DNA length. For example,
for a haplotype of only 3 markers from doubly heterozygous
individuals, the error rates of the EM and PHASE methods for
haplotype reconstruction can be as high as 27% and 19%,
respectively.sup.3. Alternatively, direct molecular haplotyping can
be used based on the physical separation of two homologous genomic
DNAs prior to genotyping. DNA cloning, somatic cell hybrid
construction, allele specific PCR and single molecule PCR
.sup.10-12 have been used, and these approaches are largely
independent of pedigree information. These methods are limited to
short genomic regions (allele-specific PCR and single molecule PCR)
and are prone to errors.
[0009] Therefore, a simple and more reliable method, which is also
suitable for large scale and automated haplotype determination of
several polymorphic alleles separated by several kilobase distances
is needed to facilitate the analysis of haplotype structure in
pharmacogenomic, disease pathogenesis, and molecular
epidemiological studies.
SUMMARY OF THE INVENTION
[0010] The present invention provides an efficient way for high
throughput haplotype analysis. Several polymorphic nucleic acid
markers, such as SNPs, can be simultaneously and reliably
determined through multiplex PCR of single nucleic acid molecules
in several parallel single molecule dilutions and the consequent
statistical analysis of the results from these parallel single
molecule multiplex PCR reactions results in reliable determination
of haplotypes present in the subject. The nucleic acid markers can
be of any distance to each other on the chromosome. In addition, an
approach wherein overlapping DNA markers are analyzed can be used
to link smaller haplotypes into larger haplotypes. Consequently,
the invention provides a powerful new tool for diagnostic
haplotyping and identifying novel haplotypes.
[0011] The method of the present invention enables direct molecular
haplotyping of several polymorphic markers separated by several
kilobases even spanning an entire chromosome. Distances of about 1,
2, 3, 4, 5-10, 15-20, kilobases (kb) or as far as about at least
25, 30, 35, 40, 45, or 50 kb or more are preferred.
[0012] Polymorphic nucleic acids useful according to the present
invention include any polymorphic nucleic acids in any given
nucleic acid region including, but not limited to, single
nucleotide substitutions (single nucleotide polymorphisms or SNPs),
multiple nucleotide substitutions, deletions, insertions,
inversions, short tandem repeats including, for example, di-, tri-,
and tetra-nucleotide repeats, and methylation and other polymorphic
nucleic acid modification differences. Preferably the polymorphic
nucleotides are SNPs.
[0013] A nucleic acid sample, preferably genomic nucleic acid
sample from a subject organism is first diluted to a single copy
dilution. The phrase "single copy dilution" refers to a dilution
wherein substantially only one molecule of nucleic acid is present
or wherein one or more copies of the same allele are present. When
the molecular mass of the nucleic acid is known, a dilution
resulting in one single molecule dilution can be readily calculated
by a skilled artisan. For example, for human genomic DNA, about 3
pg of DNA represents about one molecule. Due to stochastic
fluctuation in very dilute DNA solutions, the diluted sample may
have no template nucleic acid molecules or it may have two or more
molecules. If no molecules are present in the sample, PCR
amplification will not be achieved and the result will be "no
genotype". If two or more molecules are present in the sample, the
resulting amplification products may either be a mixture of two
different alleles or represent one allele and consequently either a
mixed genotype or a single allele genotype, respectively, is
obtained.
[0014] To obtain statistical weight to accurately determine the
haplotype comprising at least two markers, more than one replica of
dilutions will be needed. For example, a replicate of four
independent multiplex genotyping assays using about 3-4.5 pg of
human genomic DNA, including the steps of diluting the nucleic acid
sample, amplifying the diluted sample, and genotyping the amplified
sample, enables about 90% of direct haplotyping efficiency.
Therefore, preferably at least about 4-25, more preferably at least
about 6-20, 8-20, 10-18, 12-18 and most preferably about 10-12
replicates of same sample are included in the analysis according to
the present invention, one replica including the steps of diluting
the isolated nucleic acid sample from a subject organism, multiplex
amplification of the diluted sample and genotyping the polymorphic
nucleic acid sites from the amplified sample.
[0015] After the step of diluting the nucleic acid sample into a
substantially single nucleic acid dilution, the regions containing
the polymorphic sites of interest in the nucleic acid are
amplified, using, for example polymerase chain reaction (PCR) and
at least two, preferably more than two primer pairs flanking at
least two different polymorphic nucleic acid sites in the target
molecule. The primers are selected so that they amplify a fragment
of at least about 50 base pairs (bp), more preferably at least
about 100, 200, 300, 400, 500, 600-1000 bp and up to about 10000
bp, wherein the fragment contains at least one polymorphic
nucleotide site. Most preferably, the primer pairs are designed so
that the amplification products are about 90-350 bp long, still
more preferably about 100-250 bp long. It is preferable to maximize
the efficiency of amplification from the single molecule template
and therefore, at least with the current technology, the shorter
fragments are preferred. However, it will be self evident to a
skilled artisan that the nucleic acid amplification techniques are
constantly developing and the efficiency of amplifying longer
nucleic acid fragments using very small quantities of template can
be perfected and consequently, primers amplifying long fragments,
even longer that those indicated above, may also be used according
to the present invention.
[0016] After the amplification of the single molecule template with
at least two different primer pairs, preferably at least 3, 4, 5,
6, 7, 8, 9, 10, primer pairs are used in a multiplex amplification
reaction, the amplification product is subjected to genotyping. Use
of up to at least about 15, 20, 30, 40, 50 or more primer pairs in
one multiplex reaction is preferred on one embodiment of the
invention.
[0017] Genotyping can be performed by any means known to one
skilled in the art including, for example, restriction fragment
length polymorphism (RFLP) analysis using restriction enzymes,
single-strand conformational polymorphism (SSCP) analysis,
heteroduplex analysis, chemical cleavage analysis, oligonucleotide
ligation and hybridization assays, allele-specific amplification,
solid-phase minisequencing, or MASSARRAY.TM. system.
[0018] The haplotype is subsequently determined by analyzing
replicas of at least four dilution/amplification/genotyping
reactions so as to allow statistically accurate determination of
the correct haplotype in the subject. The steps including dilution,
amplification and genotyping from the same subject organism sample
are repeated several times to obtain a data set which can be
statistically analyzed to reveal the correct haplotype in the
subject organism's sample.. The approach does not rely on pedigree
data and does not require prior amplification of the genomic region
containing the selected markers thereby simplifying the analysis
and allowing speedy and automated haplotyping.
[0019] In one embodiment, the invention is drawn to methods for
determining a novel haplotype of nucleic acid segments,
particularly of genes or other contiguous nucleic acid segments
comprising at least two, preferably at least 3, 4, 5, 6, 7, 8, 9,
10-15, 20, 30, 40, 50-100 or even more distantly spaced nucleic
acid polymorphisms.
[0020] The methods of the present invention are useful in medicine
in determining the differences in disease risk or susceptibility
and determining treatment response between individual patients. The
methods, however, are not limited to applications in medicine and
can be used to determine the haplotype structure of a particular
gene, or other contiguous DNA segment, within an organism having at
least two distally spaced nucleotide polymorphisms. Thus, the
methods of the invention find further use in the field of
agriculture, particularly in the breeding of improved livestock and
crop plants.
[0021] In one embodiment, the invention provides a method of
determining a haplotype in a sample obtained from an organism and
comparing it to known haplotypes to diagnose a disease or disease
susceptibility of an organism comprising the steps of identifying
at least two polymorphic markers within a genomic region; isolating
a nucleic acid sample from the subject organism and preferably
purifying the isolated nucleic acid; diluting the nucleic acid
sample into substantially single molecule dilution; amplifying the
diluted nucleic acid sample with at least two primer pairs each
capable of amplifying a different region flanking each of the
polymorphic sites in a multiplex PCR reaction; genotyping the
polymorphic sites from the amplified sample; producing at least
three additional genotype replicas from the nucleic acid sample of
the subject organism as described above to allow statistically
accurate determination of the haplotype in the subject organism
sample. In a preferred method the genotyping is performed using
primer extension, terminator nucleotides and matrix-assisted laser
desorption/ionization time-of-flight mass spectrometry MALDI-TOF MS
analysis. The haplotype is thereafter compared to an existing
haplotype collection such as a haplotype database comprising
disease- or disease susceptibility-associated haplotypes, or
haplotypes associated with treatment responsiveness or
unresponsiveness of the specific polymorphic markers. An
non-limiting example of an existing haplotype database is a Y-STR
Haplotype Reference Database which can be found at
http://ystr.charite.de/index_gr.html.
[0022] For example, the R117H mutation in the cystic fibrosis
transmembrane receptor (CFTR) gene shows mild effect without the 5T
mutation, and severe effect when the 5T mutation is present on the
same chromosome. Thus, a haplotype of RI1 7H-5T is important for
clinical application to determine the severity of the prognosis of
this type of cystic fibrosis. The method of the present invention
allows direct determination of the haplotypes with no requirement
for patient pedigree genotype information, i.e. information of the
genotypes from the patient's family members. The same approach can
be applied in other genetic diseases where, for example, a second
mutation on the same chromosome can change the disease
manifestation from the first mutation.
[0023] The invention further provides a method wherein two
haplotypes comprising several different polymorphic markers can be
combined to form a larger haplotype covering a larger genomic
region. This can be achieved by using one or more primer pairs to
amplify one common polymorphic marker in two parallel multiplex
amplification reactions after first diluting the sample as
described above. The genotyping is performed as described above and
the overlapping marker(s) provide a means to combine the two
smaller haplotypes into one larger large haplotype comprising all
the markers analyzed in both of the two different multiplex
amplification reactions.
[0024] In one embodiment, the present invention provides a method
for constructing a database of haplotypes associated with one or
more disease or biological trait using the methods described above.
Such haplotype databases are useful for diagnostic and prognostic
applications. A haplotype obtained from a subject organism
suspected can be compared against the haplotype database and allows
diagnosis and/or prognosis of a condition of interest. A condition
may be a disease condition or a biochemical or other biological
trait which is associated, for example, in responsiveness to a
particular treatment or pharmaceutical and is determinative of
choosing a treatment regime that, for example, a human patient
would be responsive to.
[0025] In one embodiment, the polymorphism is a nucleic acid
modification, such as a methylation difference. For example, in one
embodiment, the present invention provides a method of determining
haplotypes comprised of markers including methylation differences.
The DNA sample can be treated with any composition, for example,
inorganic or organic compounds, enzymes, etc., that differentially
affects the modified, for example, methylated, nucleotide to
effectively create polymorphisms based on methylation states. For
example, DNA sample is treated with bisulfite (Frommer, M., L. E.
McDonald, D. S. Millar, C. M. Collis, F. Watt, G. W. Grigg, P. L.
Molloy, and C. L. Paul. 1992. A genomic sequencing protocol that
yields a positive display of 5-methylcytosine residues in
individual DNA strands. Proc. Natl. Acad. Sci U.S.A. 89:1827-1831)
so that unmethylated cytosine residues are converted into uracil
while methylated cytosines remain the same, thus effectively
creating polymorphisms based on methylation states. Haplotypes
consisting polymorphisms in the DNA region next to the methylation
region and the methylation region itself can be determined in a
similar fashion as described above. Bisulfite treated DNA is
diluted to approximately single copy, amplified by multiplex PCR
(each PCR specific for each polymorphism), and genotyped by the
MassARRAY system.
[0026] The methylation detection procedure as described above is
repeated at least 3, 4, 5, 6, 7, 8, 9, 10-15, 15-20, 30, 40, 50 or
more times, preferably about 12-18 times so as to allow statistical
analysis of the correct methylation haplotype in the subject
organism.
[0027] In the preferred embodiment, the methods of the present
invention use mass spectrometry, for example, MASSARRAY.TM. system,
to genotype the samples.
[0028] Therefore in one embodiment, the present invention provides
a method for determining a haplotype of a subject comprising the
steps of diluting a nucleic acid sample from the subject into a
single molecule dilution; amplifying the diluted single nucleotide
dilution with at least two different primer pairs designed to
amplify a region comprising at least two polymorphic sites in the
nucleic acid template; genotyping the polymorphic sites in the
single nucleic acid molecule; and determining the haplotype from
the genotypes of at least the two polymorphic sites to obtain a
haplotype for the subject.
[0029] In one embodiment, the steps of diluting, amplifying and
genotyping the nucleic acid sample from the subject are repeated at
least three times from the same nucleic acid sample to obtain at
least four genotype replicas from the same subject and thereafter
comparing the at least four genotype replicas to determine the
haplotype. Preferably, at least 4, 5, 6, 7, 8-10, 10-15, 15-20, 30,
50, 50-100 or more genotype replicas are obtained. In one
embodiment about 12-18 replicas are obtained and the results are
analyzed statistically, using for example a method of Poisson
distribution.
[0030] In one embodiment, the method further comprises comparing
the haplotype with a haplotype from a control or a database of
haplotypes from controls to determine association of the haplotype
with a biological trait, which can be any biological trait
including but not limited to various diseases.
[0031] The polymorphisms useful according to the present invention
include, but are not limited to single nucleotide polymorphisms
(SNPs), deletions, insertions, substitutions or inversions. The
polymorphisms may also be a combination of one or more markers
selected from the group consisting of a single nucleotide
polymorphism, deletion, an insertion, a substitution or an
inversion or other types of nucleic acid polymorphisms.
[0032] In one embodiment, the genotyping step of the method
described above is performed using primer extension, preferably
MASSARRAY.TM. technology, and mass spectrometric detection,
preferably MALDI-TOF mass spectrometry.
[0033] In another embodiment, the invention provides a method of
diagnosing a disease condition or disease susceptibility by
determining a disease related haplotype in a subject comprising the
steps of diluting a nucleic acid sample from the subject into a
single molecule dilution; amplifying the diluted single nucleotide
dilution with at least two primer pairs designed to amplify a
region comprising at least two polymorphic sites in the nucleic
acid template; genotyping the polymorphic sites in the single
nucleic acid molecule; determining the haplotype from the genotype
of at least two polymorphic sites to obtain a haplotype for the
subject; and comparing the haplotype of the subject to known
disease-associated haplotypes wherein a match in the sample
haplotype with a disease-associated haplotype indicates that the
subject has the disease or that the subject is susceptible for the
disease.
[0034] In one embodiment, the method further comprises repeating
the dilution, amplification and genotyping steps at least three
times from the same nucleic acid sample to obtain at least four
genotype replicas from the same subject and thereafter comparing
the at least four genotype replicas to determine the haplotype.
Preferably at least 4, 5, 6, 7, 8, 9, 10-15, 15-20, 25, 30, 40,
50-100 or more genotype replicas are produced. In one embodiment,
about 12-18 replicas are produced.
[0035] The invention also provides a method of determining a
haplotype of a subject comprising the steps of treating a nucleic
acid sample from the subject with a composition that differentially
affects an epigenetically modified nucleotide in the nucleic acid
sample to effectively create polymorphisms based on the epigenetic
modification; diluting the treated nucleic acid sample into a
single copy dilution; amplifying the diluted nucleic acid sample
using at least two different primer pairs; genotyping the amplified
sample; and determining the haplotype of the subject from the
genotyped sample. The terms "epigenetic" modification or
"epigenetically" modified nucleotides as described herein means
nucleic acids that are modified by methylation, acetylation, or
other epigenetic manner, i.e. by addition or deletion of a chemical
or molecular structure on the nucleic acid which addition or
deletion has an effect on the phenotype of the subject by altering
the function of the modified nucleic acid.
[0036] In one embodiment, the method further comprises repeating
the steps of dilution, amplification and genotyping at least three
times to obtain at least four genotype replicas from the same
subject and thereafter determining a haplotype of the subject based
on the genotype replicas. In a preferred embodiment, at least 4, 5,
6, 7, 8, 9, 10-15, 15-20, 25, 30, 40, 50-100, or more replicas are
produced. In one preferred embodiment, about 12-18 replicas are
produced. The method of claim 13, wherein 12-18 replicas are
produced.
[0037] In one embodiment, the epigenetic modification is
methylation.
[0038] In yet another embodiment, the epigenetic modification is
methylation and the composition that is used to treat the nucleic
acid is bisulfite.
[0039] In another embodiment, the invention provides a method of
determining a haplotype in a subject comprising the steps of:
digesting a nucleic acid sample from the subject with a
methylation-sensitive restriction enzyme so that either
unmethylated DNA or methylated DNA is left intact, depending on
which enzyme is used; diluting the digested nucleic acid sample to
a single molecule concentration; amplifying the diluted nucleic
acid sample with at least two different primer pairs; genotyping
the amplified sample; and determining a haplotype of a methylated
nucleic acid wherein at least two polymorphic markers next to the
methylation site, together with the methylation site, constitutes a
haplotype.
[0040] In one embodiment, the methylation sensitive enzyme is
HpaII.
[0041] In one embodiment, the method further comprises repeating
the steps of diluting, amplifying and genotyping at least three
times to obtain at least four genotype replicas from the same
subject and thereafter determining a haplotype of the subject based
on the genotype replicas. Preferably at least 4, 5, 6, 7, 8, 9,
10-15, 4, 5, 6, 7, 8, 9, 10-15, 15-20, 25, 30, 40, 50-100, or more
replicas are produced. In one preferred embodiment, about 12-18
replicas are produced. The method of claim 13, wherein 12-18
replicas are produced.
BRIEF DESCRIPTION OF FIGURES
[0042] FIGS. 1A-1B show a flow chart of multiplex genotyping of
single DNA molecules for haplotype analysis using single nucleotide
polymorphisms (SNPs) as markers. Traditional genotyping methods
using a few nano-grams (ng) genomic DNA (about 1600 copies of
genomic templates) yield only the genotypes of each individual SNP
marker, but the phases of these SNPs are not determined (shown in
top right in the mass spectra in FIG. 1A). Simultaneous genotyping
of several markers using multiplex assays with single DNA molecules
(FIG. 1B) allows haplotyping analysis since the two alleles can be
physically separated with very dilute DNA concentrations, shown in
bottom right in the mass spectra in FIG. 1B. In contrast to other
molecular haplotyping methods, the entire haplotype block does not
have to be amplified in this approach. Instead, only about 100 bp
around each individual SNP is amplified for genotyping, resulting
in very high efficiency of PCR amplification from single DNA
molecules. The SNP markers can be as far apart as desired, as long
as there is no significant break between them.
[0043] FIG. 2 shows effects of genomic DNA concentration on
haplotyping efficiency. About 3 pg, 5 pg and 9 pg (or 1, 1.6 and 3
copies of human genomic templates, respectively) were used for
haplotyping of three SNP markers in the CETP region. The DNA copy
number in a specific reaction was estimated by the Poisson
distribution. The haplotyping result can either be a failed assay,
successful haplotyping, both alleles present (no phase
determination for the markers), or an incomplete multiplex. Except
for incomplete multiplexes, values are percentages from 54 to 144
individual multiplex assays (see specification and example for
details on the calculation), followed by predicted values using the
Poisson distribution.
[0044] FIG. 3 shows overlapping multiplex genotyping assays with
single DNA molecules. Seven SNP markers (A: rs289744, B: rs2228667,
C: rs5882, D: rs5880, E: rs5881, F: rs291044, G: 2033254) from an 8
kb genomic region of the CETP locus were chosen (details of these
SNPs, their chromosome position and oligonucleotides used for
genotyping are provided in Table 2). Two 5-plex genotyping assays
were designed for these 7 markers and the overlapping heterozygous
SNPs were used to obtain the entire haplotype of 7 SNP markers.
Assays on individual 6 were used to demonstrate how this is carried
out. Multiplex assay 1 determined the haplotype of 5 SNPs as AGAGT
and CGGGC. Multiplex assay 2 determined the other haplotype of 5
SNPs as GGGCT and AGGTT. Then, the genotypes of the overlapping
SNPs (SNP C, E, F) were used to combine the two 5-SNP haplotypes
into a haplotype of 7 SNPs covering the entire region under
investigation.
DETAILED DESCRIPTION OF THE INVENTION
[0045] The present invention provides a direct molecule haplotyping
approach which is based upon a surprising discovery that a single
molecule dilution of genomic DNA can be used for separation of two
homologous genomic DNAs and that using repeated dilutions from the
same subject organisms as a starting material for multiplex
amplification of different nucleic acid markers, haplotypes of any
subject organisms can be determined and are statistically accurate.
The diluted, amplified sample is then genotyped using, for example,
the MASSARRAY.TM. system (FIG. 1). Parallel genotyping of several
different dilutions from the same subject results in statistically
accurate haplotype determination in the subject organism.
[0046] The approach of the present invention differs significantly
from previous single molecule PCR method in that the method of the
present invention does not require the amplification of the
complete genomic region containing the markers of interest; thus it
is not limited to only a few kb DNA. The method of the present
invention achieves close to 100% genotype and haplotype success
rates for single DNA molecules. Additionally, the multiplex
genotyping assay approach enables direct haplotype determination
without pedigree genotype information. High throughput haplotyping
can easily be achieved by incorporating the method of the present
invention with any commercially available genotyping systems, such
as the MASSARRAY.TM. system.
[0047] In one embodiment, the invention provides a method of
determining a haplotype of a subject comprising the steps of
obtaining a nucleic acid, preferably a genomic DNA sample, diluting
the nucleic acid sample into substantially a single molecule
dilution, amplifying the nucleic acid sample with at least two
primer pairs designed to amplify a genomic region containing a
nucleic acid polymorphism on one chromosome and genotyping the
amplified DNA. Repeating the steps from diluting the nucleic acid
sample, at least 3 or more times and statistically analyzing the
results, thereby determining the haplotype of the subject
organisms.
[0048] The "subject" as used in the specification refers to any
organism with at least diploid genome including, but not limited to
worms, fish, insects, plants, murine and other mammals including
domestic animals such as cows, horse, dogs, cats, and, most
preferably humans.
[0049] The methods of the present invention are useful, for
example, in diagnosing or determining a prognosis in a disease
condition known to be associated with a specific haplotype(s), to
map a disease or other biological trait the cause of which is
currently unknown to a defined chromosomal region using haplotypes
in the linkage analysis, to determine novel haplotypes, to detect
haplotype associations with responsiveness to pharmaceuticals.
[0050] Genomic DNA can be obtained or isolated from a subject using
any method of DNA isolation known to one skilled in the art.
Examples of DNA isolation methods can be found in general
laboratory manuals, such as Sambrook and Russel, MOLECULAR CLONING:
A LABORATORY MANUAL, 3rd Ed., Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. (2001), the entirety of which is herein
incorporated by reference
[0051] Polymorphic Markers and Oligonucleotides. The number of
polymorphic nucleic acid useful according to the present invention
is ever increasing. Currently, such markers are readily available
from a variety of publicly accessible databases and new ones are
constantly being added to the pool of available markers. Markers
including restriction length polymorphisms, short tandem repeats
such as di-, tri-, and tetra-nucleotide repeats as well as
methylation status can be used as polymorphic markers according to
the present invention. Such markers are well known to one skilled
in the art and can be found in various publications and databases
including, for example, ATCC short tandem repeat (STR) database at
http://www.atcc.org/Cultures/str.cfm.
[0052] Particularly useful markers according to the present
invention are single nucleotide polymorphisms (SNPs). Examples of
useful SNP databases include, but are not limited to Human SNP
Database at http://www-genome.wi.mit.edu/snp/human, NCBI dbSNP Home
Page at http://www.ncbi.nlm.nih.gov/SNP,
http://lifesciences.perkinelmer.com/SNPD- atabase/welcome.asp,
Celera Human SNP database at http://www.celera.com/ge-
nomics/academic/home.cfm?ppage=cds&cpage=snps, the SNP Database
of the Genome Analysis Group (GAN) at
http://www-gan.iarc.fr/SNPdatabase.html,
[0053] A number of nucleic acid primers are already available to
amplify DNA fragments containing the polymorphisms and their
sequences can be obtained, for example, from the above-identified
databases. Additional primers can also be designed, for example,
using a method similar to that published by Vieux, E. F., Kwok, P-Y
and Miller, R. D. in BioTechniques (June 2002) Vol. 32. Supplement:
"SNPs: Discovery of Marker Disease, pp. 28-32. Novel SNPs can also
be identified using a method of MASSARRAY.TM. Discovery-RT
(SNP-Discovery) system by SEQUENOM Inc. (San Diego, Calif.).
[0054] A number of different nucleotide polymorphism genotyping
methods useful according to the present invention are known to one
skilled in the art. Methods such as restriction length polymorphism
analysis (RFLP), single-strand conformation polymorphism (SSCP)
analysis, denaturing gradient gel electrophoresis (DGGE),
temperature gradient gel electrophoresis (TGGE), chemical cleavage
analysis, direct sequencing of nucleic acids using labels including
but not limited to fluorescent and radioactive labels. All these
methods have been available or at least a decade and are well known
to one skilled in the art. SNP genotyping can be performed using a
number of different techniques known to one skilled in the art. For
example, SNP genotyping by MALDI-TOF mass spectrometry can
performed using, for example, the Sequenom's mass spectrometry
system, MASSARRAY.TM.. In this method, after multiplexed PCR has
been performed using more than one primer pair, each flanking
different SNPs, a minisequencing primer extension reaction is
performed in a single well using chain terminator nucleotides. The
size of reaction products is determined directly by MALDI-TOF mass
spectrometry, yielding the genotype information. It should be
possible based upon this teaching. Multiplexing permits
determination of, for example, at least 2, 3, 4, and 5 SNPs in a
single well of a, for example 384 well plate. For example, at least
6, 7, 8, 9, 10-12-plex genotyping can be performed using the
MASSARRAY.TM. system. The MASSARRAY.TM. system, for example, can be
used to increase the multiplexity level of the genotyping reactions
to even higher, for example at least 12-15, 20, 30, 40, and 50-100
and even higher.
[0055] Alternatively, fragment analysis for SNP detection can be
performed on batches of several samples on a capillary
electrophoresis system, for example an ABI PRISM.RTM. 3100 GENETIC
ANALYZER (Applied Biosystems, Foster City, Calif.). For capillary
electrophoretic analysis, the primers can be labeled using dyes,
including, but not limited to FAM, HEX, NED, LIZ, ROX, TAMRA, PET
and VIC.
[0056] Single SNP allelic discrimination can further be carried out
using the ABI PRISM.RTM. 7900HT Sequence Detection System (Applied
Biosystems, Foster City, Calif.), which allows analysis of single
nucleotide polymorphisms (SNPs) using the fluorogenic 5' nuclease
assay.
[0057] Yet another available method useful according to the present
invention is an Arrayed Primer Extension (APEX) which is a
resequencing method for rapid identification of polymorphisms that
combines the efficiency of an microarray-based assay (alternative
to gel-based methods, see, e.g., U.S. Pat. No. 6,153,379 and
Shumaker et al. Hum. Mutat. 7(4):346-354, 1996) with the Sanger
nucleic acid sequencing method (Sanger et al., Proc. Natl. Acad.
Sci. 74:5463-5467 (1977)). Generally, microarrays are microchips,
for example glass slides, containing thousands of DNA segments in
an ordered array, witch allows the simultaneous analysis of
thousands of genetic markers.
[0058] A yet another genotyping method useful according to the
present invention is a solid-phase mini-sequencing technique, which
is also based upon a primer extension reaction and can be used for
genotyping of SNPs and can also be easily automated (U.S. Pat. No.
6,013,431, Suomalainen et al. Mol. Biotechnol. June;15(2):123-31,
2000).
[0059] In general, a primer extension reaction is a modified cycle
sequencing reaction in which at least one dideoxynucleotide
(terminator) is present and not all deoxynucleotides are present at
any significant concentration. When a terminator is incorporated
onto a DNA strand, no further extension can occur on that strand.
In a standard cycle sequencing reaction, terminators are present
only in small concentrations along with high concentrations of
typical nucleotides. In the single base extension reactions for SNP
assays, two or more fluorescently or radioactively labeled
terminator nucleotides (corresponding to the two or more alleles
present at the SNP to be typed) are used.
[0060] The steps of the method of the present invention include
diluting the nucleic acid sample into single nucleotide dilution,
amplifying the diluted sample, and genotyping the amplified sample.
These steps are repeated at least 3 times, preferably at least 4,
5, 6, 7, 8, 9, 10-15, 15-20, 20-25, or even 25-50 times.
Preferably, the steps are repeated about 12-18 times so that the
results can be statistically analyzed. The Poisson distribution
analysis is used to analyze the results using the methods known to
one skilled in the art. The analysis is described in detail, for
example in Stephens et al. Am J Hum Genet 46: 1149-1155, 1990.
[0061] Haplotype is defined as a combination of alleles or nucleic
acid polymorphisms, such as SNPs of closely linked loci that are
found in a single chromosome and which tend to be inherited
together. Recombinations occur at different frequency in different
parts of the genome and therefore, the length of the haplotypes
vary throughout the chromosomal regions and chromosomes. For a
specific gene segment, there are often many theoretically possible
combinations of SNPs, and therefore there are many theoretically
possible haplotypes.
[0062] Traditionally, information about gene flow in a pedigree has
been used to reconstruct likely haplotypes for families and
individuals. However, even if nucleic acid samples from all the
family members were available, which is rarely the case,
statistics-based haplotype analysis does frequently not reveal the
correct phase, i.e. haplotype, of the markers. Additionally,
collection of large sample materials from, for example human
families, is time consuming and expensive. In one embodiment, the
present invention provides a method wherein novel haplotypes are
determined using either established or novel nucleic acid
polymorphisms. For example, novel SNPs are first identified using
nucleic acid samples isolated from several subject organisms of the
same species, each polymorphic SNP marker from a subject is then
genotyped individually, for example using about 1-10 ng, preferably
about 5 ng genomic DNA. The genomic DNA sample is then diluted into
about 1 copy of genomic template per dilution. The haplotype is
determined by determining the SNP's in a diluted sample, i.e.,
sample diluted into a substantially single molecule dilution.
Alternatively, the sample can be genotyped first or in parallel for
each maker using more concentrated nucleic acid solution. This can
be used to verify or control the haplotype determination using the
diluted sample replicas.
[0063] The genomic region to be haplotyped using the method of the
present invention is preferably at least about 1, 2, 3, 4, 5, 6, 7,
8, or 9 kb, more preferably at least about 10 kb or more, at least
about 15 kb or more, at least about 20 kb or more. In one
embodiment, the size of the region containing the polymorphic
nucleotides is at least about 25 kb or more, at least about 35 kb
or more, at least about 40-45 kb, or 45-50 or even about 50-100 kb
or more. Most preferably the genomic region is about 25 kb ore
more.
[0064] In determining the haplotypes, both the PCR and the
genotyping reactions are preferably "multiplexed" which term is
meant to include combining at least two, preferably more than at
least 3, 4, 5, 6, 7, 8, 9, 10-15, or 20-25 extension primers in the
same reaction are used to identify, preferably at least about 3, 4,
5, 6, 7, 8, 9, 10-15, or 20-25 polymorphic nucleic acid regions in
the same genotyping reaction. In one embodiment, at least 30 primer
pairs or more are used.
[0065] In one embodiment, the polymorphism is at least one nucleic
acid modification, such as a methylation difference. In one
embodiment, the present invention provides a method of determining
haplotypes comprised of markers including methylation differences.
The method of haplotyping methylation differences according to the
present invention comprises the steps of diluting a nucleic acid
sample from a subject organism into two parallel substantially
single molecule dilutions. The two dilutions are consequently
subjected to a methylation detection assay, for example, an AFLP
assay (see, e.g., Vos et al. Nucleic Acids Res 23: 4407-4414, 1995;
Xu et al., Plant Molecular Biology Reporter 18: 361-368, 2000). The
assay described by Vos et al. and Xu et al is modified to perform
according the method of present invention.
[0066] In short, two single molecule dilutions are digested in two
parallel reactions with a mixture comprising a methylation
sensitive enzyme and another enzyme, preferably a less frequent
cutting restriction enzyme, wherein the less frequent cutting
restriction enzyme in both digestion reactions is the same and the
methylation sensitive enzymes added to the two parallel reactions
differ in their capacity to digest methylated/non-methylated
nucleic acids. For example, one dilution is digested with a
combination of EcoRI and HpaII and the parallel dilution is treated
digested with EcoRI and MspI. The two digested samples are then
ligated using an adapter-ligation solution as described in Vos et
al. and Xu et al., and amplified in parallel reactions using at
least two, preferably more than two primer pairs which are capable
of recognizing the restriction enzyme recognition sites in the
templates. In the above-described example, EcoRI and HpaII--MspI
primers are used. One of the primers is labeled so as to allow
detection of the fragments from the digestions using, for example
gel electrophoretic methods or mass spectrometric detection.
[0067] The methylation detection procedure as described above is
repeated at least 3 more times, preferably at least about 6-12
times so as to allow statistical analysis of the correct
methylation haplotype in the subject organism.
[0068] In light of this disclosure, other nucleic acid modification
detection technologies including methylation detection techniques
may be readily adapted to be used according to the principle steps
of the present invention including single molecule dilution,
digestion, multiplex amplification and multiplex genotyping.
Methylation detection methods may also be combined to detect both
methylation and other polymorphic markers, such as SNPs. In such
embodiment, the amplification after restriction enzyme digestion is
performed not only with methylation specific primers but also with
primers designed to amplify fragments containing known nucleic acid
polymorphisms, such as SNPs.
[0069] In one embodiment, the invention provides a method of
creating haplotypes of several polymorphic nucleotides using
overlapping multiplex genotyping assays with single DNA molecules.
For example, markers from a large genomic region are chosen and one
or more separate multiplex amplification reactions are performed
from single nucleotide dilutions and overlapping heterozygous
polynucleotide markers are used to obtain the entire haplotype.
[0070] For example, FIG. 3 shows seven SNP markers (A: rs289744, B:
rs2228667, C: rs5882, D: rs5880, E: rs5881, F: rs291044, G:
2033254) from an 8 kb genomic region of the CETP locus that were
chosen to determine a haplotype. Details of these SNPs, their
chromosome position and oligonucleotides used for genotyping are
provided in Table 2. Two 5-plex genotyping assays were designed for
the 7 markers and the overlapping heterozygous SNPs were used to
obtain the entire haplotype of 7 SNP markers. Assays on individual
No. 6 were used to demonstrate how this is carried out. Multiplex
assay 1 determined the haplotype of 5 SNPs as AGAGT and CGGGC.
Multiplex assay 2 determined the other haplotype of 5 SNPs as GGGCT
and AGGTT. Then, the genotypes of the overlapping SNPs (SNP C, E,
F) were used to combine the two 5-SNP haplotypes into a haplotype
of 7 SNPs covering the entire region under investigation.
EXAMPLE
[0071] The effects of genomic DNA concentration on haplotyping
efficiency were determined as follows. We used 3 picograms (pg), 5
pg and 9 pg (equivalent of 1, 1.6 and 3 genomic template copies) of
genomic DNA for PCR amplification and genotyping of 3 SNPs in the
CETP region from 12 individuals. Each 3-plex assay was repeated
12-18 times to evaluate the PCR and haplotyping efficiency. A
typical assay result is summarized in Table 1. The copy number of
the genomic DNA region of interest for very dilute DNA solutions is
estimated by the Poisson distribution.sup.13. Haplotyping results
were categorized into 4 groups (Table 1).
[0072] Failed assays can result from either failed PCR
amplification from single copy DNAs or simply no template present
due to stochastic fluctuation of very dilute DNA solutions.
[0073] Partially failed genotyping calls (or incomplete
multiplexes) are those that have only 1 or 2 SNPs successfully
genotyped. This is most likely due to unsuccessful PCR for 1 or 2
of the SNP DNA regions, since in most cases the 3 SNP markers are
present or absent at the same time due to the close proximity of
the SNP markers (<628 bp). Poisson distribution may also result
in the presence both alleles in the solution and hence the
inability to resolve the phase of the SNPs.
[0074] Successful haplotyping analysis is achieved when a single
copy of the allele or multiple copies of the same allele are
present and the genotyping is successful.
[0075] Incomplete multiplex genotyping can be used to estimate the
efficiency of genotyping from single copy DNA molecules. A partial
genotyping call suggests the presence of the SNP DNA but a failure
to genotype some of the SNPs. We typically observed 5-10%
incomplete multiplex genotyping calls (FIG. 2), suggesting a PCR
efficiency of about 90-95% with single DNA molecules. This approach
may overestimate the PCR efficiency, since we did not take the
completely failed assays into account. We also carried out detailed
comparison between observed and theoretical values of failed
assays, successful haplotyping and the presence of both alleles
(FIG. 2 and see methods section for details of calculation).
Theoretical values are based on the Poisson distribution of very
dilute DNA solutions and the assumption of 100% PCR amplification
efficiency. The close agreement between theoretical estimate and
experimental observation substantiates the earlier estimate of
extremely high PCR efficiency with single DNA molecules.
[0076] High PCR efficiency is mainly due to the high efficiency of
amplification of very short amplicons (typically 100 bp) and the
high sensitivity of MALDI-TOF mass spectrometric detection of DNA
oligonucleotides. High PCR efficiency is preferred for
high-throughput haplotyping analysis. For example, with our current
PCR efficiency, we can achieve 40-45% haplotyping efficiency with
one single reaction using 3-4.5 pg genomic DNA. A replicate of 4
independent multiplex genotyping assays will enable about 90% of
direct haplotyping efficiency.
[0077] We next demonstrated an approach for determining haplotypes
where there are too many markers to be determined in one multiplex
genotyping assay. Overlapping informative SNPs were used to combine
haplotypes from several multiplex assays. We chose six SNP markers
in an 8 kb CETP genomic region, and 2 overlapping 4-plex genotyping
assays were used for haplotyping analysis (FIG. 3). We were able to
determine the haplotypes of all 12 individuals for this genomic
region, with absolutely no optimization of the assay system.
[0078] The approach presented here provides a powerful and unique
technology platform for direct molecular haplotyping analysis of
long-range genomic regions. This approach is completely independent
of pedigree genotype information.
[0079] We have further incorporated this technique with the
commercially available MASSARRAY.TM. system for high-throughput
applications. This technology is extremely useful in large-scale
haplotyping and haplotype-based diagnostics.
[0080] Materials and Methods
[0081] Genomic DNAs and oligo nucleotides. Human genomic DNA
samples used for haplotyping of the CETP locus were provided by
SEQUENOM Inc. (San Diego, Calif.). These DNAs were isolated using
the Puregene DNA isolation kit (Gentra Systems) from blood samples
purchased from the Blood Bank (San Bernadino County, Calif.). The
personal background of the blood donors is not accessible for these
samples. Human genomic DNAs samples for haplotyping of a 25 kb
segment on chromosome 5q31 were CETP family DNAs purchased from
Coriell Cell Repositories (see Table 3). Information on SNPs and
oligonucleotides for genotyping is provided in Table 2.
[0082] Genotyping and haplotyping analysis. Genotyping analyses
were carried out using the MassArray.TM. system (SEQUENOM Inc.).
Each SNP from every individual was first genotyped individually
using 5 ng genomic DNA. For haplotyping analysis, multiplex
genotyping assays were carried out using 3 pg (or approximately 1
copy of genomic template, unless otherwise specified) genomic
DNA.
[0083] Analysis of effects of genomic DNA concentration on
haplotyping. To calculate the percentage of failed assays, we
simply counted all failed assays (no calls for either SNP), divided
by the total number of assays. We typically do 12 to 18 replicates
for each. 6 or 12 individuals. The percentage of incomplete assays
is calculated in the same way. To calculate percentage of
successful haplotyping and both alleles, we excluded the data from
those individuals with homozygous haplotypes. Theoretical
predictions are based on the Poisson distribution of very diluted
DNA solutions, according to a published method .sup.13.
1TABLE 1 Sample Haplotype analysis with triplex genotyping
assay.sup.a Repeat Genotype Calls 1 GGC.sup.b 2 GGC 3 --.sup.c 4
-GC.sup.d 5 -- 6 GGC 7 -- 8 ACA 9 -GC 10 A/G C/G A/C.sup.e 11 ACA
12 ACA .sup.aGenotypes of 3 SNP markers were determined with
triplex assays from 3 pg genomic DNA. .sup.bThe 3 SNPs are G, G, C
genotype respectively. .sup.cFailed to genotype any of the 3 SNPs.
.sup.dFailed to genotype the first SNP, the rest two SNPs are G and
C respectively. .sup.eFailed to separate the two alleles, thus the
genotypes are A/G, C/A and A/C for the 3 SNPs.
[0084]
2TABLE 2 Single nucleotide polymorphism (SNP) markers, their
chromosomal locations, primer pairs to amplify the markers and
terminator mixes used in the reaction. Chrom. Term. SNP ID Position
PCR primer 1 PCR primer 2 Extension Primer Mix AAGTCCATCAGCAGC 4728
TCTACCAGCTTGGCTC AGCAG (SEQ ID NO.: GGGAGTCAGCCCAGCTC (SEQ ID NO.:
ACT rs289741 2625 CCTC (SEQ ID NO.: 1) 2) 3) 4728 ACTGGTGAGACAATC
CCACTGGCATTAAAGT AGCCACAGAAGAAGGACTCC (SEQ ID ACT rs289742 2337
CCTTC (SEQ ID NO.: 4) GCTG (SEQ ID NO.: 5) NO.: 6) AGTGCTGGACAGAAA
4728 TACCAGAAACCAGAC GTGAG (SEQ ID NO.: TGAGGATGGTGGGAGGG (SEQ ID
NO.: ACT rs289744 1997 CTCTG (SEQ ID NO.: 7) 8) 9) AGTGCTGGACAGAAA
4728 TCTACCAGAAACCAGA GTGAG (SEQ ID NO.: ACCTCTGAGGGCCCCTTAC (SEQ
ID CG rs289744.sup.a 1997 CCTC (SEQ ID NO.: 10) 11) NO.: 12)
AGGTAGTGTTTACAG 4728 CTCGAGTGATAATCTC CCCTC (SEQ ID NO.:
TGATGATGTCGAAGAGGCTCATG (SEQ CG rs2228667.sup.a 2820 AGGG (SEQ ID
NO.: 13) 14) ID NO.: 15) GCATTTGATTGGCAG 4728 TTACGAGACATGACCT
AGCAG (SEQ ID NO.: CTGCAGGAAGCTCTGGATG (SEQ ID CG rs5882.sup.a 4007
CAGG (SEQ ID NO.: 16) 17) NO.: 18) 4728 GCATTTGATTGGCAGA
TTACGAGACATGACCT AGAGCAGCTCCGAGTCC (SEQ ID NO.: ACT rs5882.sup.b
4007 GCAG (SEQ ID NO.: 19) CAGG (SEQ ID NO.: 20) 21)
GCAGCACATACTGGA 4728 AATCC (SEQ ID NO.: TTTCTCTCCCCAGGAT
GCTTTTTCTTAGAATAGGAGG (SEQ ID ACT rs5880.sup.b 5008 22) ATCG (SEQ
ID NO.: 23) NO.: 24) 4728 AGATCTTGGGCATCTT ACCCCTGTCTTCCACA
TGGGCCTGGCTGGGGAAGC (SEQ ID CG rs5881.sup.a 8087 GAGG (SEQ ID NO.:
25) GGTT (SEQ ID NO.: 26) NO.: 27) AGATCTTGGGCATCTT 4728
ACCCCTGTCTTCCACA GAGG (SEQ ID NO.: TGTCTTCCACAGGTTGTCGGC (SEQ ID
ACT rs5881.sup.b 8087 GGTT (SEQ ID NO.: 28) 29) NO.: 30)
TGACTAGGTCAGGTC 4728 GTAAAACTGCAGCTGA CCCTC (SEQ ID NO.:
GGAGTATTTAAAGGAGAGACACACTAG CG rs291044.sup.a 8647 GGAG (SEQ ID
NO.: 31) 32) (SEQ ID NO.: 33) TGACTAGGTCAGGTC GTAAAACTGCAGCTG 4728
CCCTC (SEQ ID NO.: AGGAG (SEQ ID NO.: CCCTCGTGCCACAGCCT (SEQ ID
NO.: ACT rs291044.sup.b 8647 34) 35) 36) GGACATCAAAGGAAC 4729 AGGAC
(SEQ ID NO.: ACTCACAATATTGGGC CAAGGGGCTAAGGGAGAAG (SEQ ID ACT
rs2033254.sup.b 0114 37) AGGC (SEQ ID NO.: 38) NO.: 39)
GGGTTGCATGAGCAT CACATCAAGGATAAG IGR2198A 5062 TAAGT (SEQ ID NO.:
ACTGC (SEQ ID NO.: ATCTCTTCAGTAGACGAAC (SEQ ID AC _1.sup.c 66.sup.d
40) 41) NO.: 42) AGATGAAGGAAATCC IGR2175A 4950 TGGCCTTGATTCAAAC
CAAGG (SEQ ID NO.: TGCCACTAACATACATAGTAAC (SEQ ID AC _2 82 CCTG
(SEQ ID NO.: 43) 44) NO.: 45) ATTTGGAGGAGTGCA IGR2150A 4821
CCTTGGCTTGATAGTC GAGAG (SEQ ID NO.: AGTCAAACTCTCACCAC (SEQ ID NO.:
AC _1 71 AAAC (SEQ ID NO.: 46) 47) 48) .sup.aMultiplex Group a
.sup.bMultiplex Group b .sup.cSNP ID from ref .sup.dPosition of SNP
from ref Term. Mix = terminator nucleotide mix. Chrom. Position =
chromosomal position
[0085]
3TABLE 3 DNA samples used in the Example. Repository Number Sample
Type Sample Description Relation GM12547 Lymphoblast CEPH/FRENCH
PEDIGREE 66 father GM12548 Lymphoblast CEPH/FRENCH PEDIGREE 66
mother GM12549 Lymphoblast CEPH/FRENCH PEDIGREE 66 son GM12550
Lymphoblast CEPH/FRENCH PEDIGREE 66 daughter GM12551 Lymphoblast
CEPH/FRENCH PEDIGREE 66 daughter GM12552 Lymphoblast CEPH/FRENCH
PEDIGREE 66 son GM12553 Lymphoblast CEPH/FRENCH PEDIGREE 66
daughter GM12554 Lymphoblast CEPH/FRENCH PEDIGREE 66 daughter
GM12555 Lymphoblast CEPH/FRENCH PEDIGREE 66 son GM12556 Lymphoblast
CEPH/FRENCH PEDIGREE 66 paternal grandfather GM12557 Lymphoblast
CEPH/FRENCH PEDIGREE 66 paternal grandmother GM12558 Lymphoblast
CEPH/FRENCH PEDIGREE 66 maternal grandfather GM12559 Lymphoblast
CEPH/FRENCH PEDIGREE 66 maternal grandmother GM07038 Lymphoblast
CEPH/UTAH PEDIGREE 1333 father GM06987 Lymphoblast CEPH/UTAH
PEDIGREE 1333 mother GM07004 Lymphoblast CEPH/UTAH PEDIGREE 1333
son GM07052 Lymphoblast CEPH/UTAH PEDIGREE 1333 son GM06982
Lymphoblast CEPH/UTAH PEDIGREE 1333 son GM07011 Lymphoblast
CEPH/UTAH PEDIGREE 1333 daughter GM07009 Lymphoblast CEPH/UTAH
PEDIGREE 1333 son GM07678 Lymphoblast CEPH/UTAH PEDIGREE 1333 son
GM07026 Lymphoblast CEPH/UTAH PEDIGREE 1333 son GM07679 Lymphoblast
CEPH/UTAH PEDIGREE 1333 son GM07049 Lymphoblast CEPH/UTAH PEDIGREE
1333 paternal grandfather GM07002 Lymphoblast CEPH/UTAH PEDIGREE
1333 paternal grandmother GM07017 Lymphoblast CEPH/UTAH PEDIGREE
1333 maternal grandfather GM07341 Lymphoblast CEPH/UTAH PEDIGREE
1333 maternal grandmother GM11820 Lymphoblast CEPH/UTAH PEDIGREE
1333 daughter GM07029 Lymphoblast CEPH/UTAH PEDIGREE 1340 father
GM07019 Lymphoblast CEPH/UTAH PEDIGREE 1340 mother GM07062
Lymphoblast CEPH/UTAH PEDIGREE 1340 daughter GM07053 Lymphoblast
CEPH/UTAH PEDIGREE 1340 daughter GM07008 Lymphoblast CEPH/UTAH
PEDIGREE 1340 son GM07040 Lymphoblast CEPH/UTAH PEDIGREE 1340 son
GM07342 Lymphoblast CEPH/UTAH PEDIGREE 1340 son GM07027 Lymphoblast
CEPH/UTAH PEDIGREE 1340 son GM06994 Lymphoblast CEPH/UTAH PEDIGREE
1340 paternal grandfather GM07000 Lymphoblast CEPH/UTAH PEDIGREE
1340 paternal grandmother GM07022 Lymphoblast CEPH/UTAH PEDIGREE
1340 maternal grandfather GM07056 Lymphoblast CEPH/UTAH PEDIGREE
1340 maternal grandmother GM11821 Lymphoblast CEPH/UTAH PEDIGREE
1340 son GM07349 Lymphoblast CEPH/UTAH PEDIGREE 1345 father GM07348
Lymphoblast CEPH/UTAH PEDIGREE 1345 mother GM07350 Lymphoblast
CEPH/UTAH PEDIGREE 1345 daughter GM07351 Lymphoblast CEPH/UTAH
PEDIGREE 1345 son GM07352 Lymphoblast CEPH/UTAH PEDIGREE 1345 son
GM07353 Lymphoblast CEPH/UTAH PEDIGREE 1345 son GM07354 Lymphoblast
CEPH/UTAH PEDIGREE 1345 daughter GM07355 Lymphoblast CEPH/UTAH
PEDIGREE 1345 son GM07356 Lymphoblast CEPH/UTAH PEDIGREE 1345 son
GM07347 Lymphoblast CEPH/UTAH PEDIGREE 1345 paternal grandfather
GM07346 Lymphoblast CEPH/UTAH PEDIGREE 1345 paternal grandmother
GM07357 Lymphoblast CEPH/UTAH PEDIGREE 1345 maternal grandfather
GM07345 Lymphoblast CEPH/UTAH PEDIGREE 1345 maternal
grandmother
[0086] References
[0087] The references cited herein and throughout the specification
are incorporated herein by reference in their entirety.
[0088] 1. Grupe, A. et al. In silico mapping of complex
disease-related traits in mice. Science 292, 1915-8. (2001).
[0089] 2. Hirschhorn, J. N., Lohmueller, K., Byrne, E. &
Hirschhorn, K. A comprehensive review of genetic association
studies. Genet Med 4, 45-61. (2002).
[0090] 3. Zhang, S., Pakstis, A. J., Kidd, K. K. & Zhao, H.
Comparisons of two methods for haplotype reconstruction and
haplotype frequency estimation from population data. Am J Hum Genet
69, 906-14. (2001).
[0091] 4. Templeton, A. R., Sing, C. F., Kessling, A. &
Humphries, S. A cladistic analysis of phenotype associations with
haplotypes inferred from restriction endonuclease mapping. II. The
analysis of natural populations. Genetics 120, 1145-54. (1988).
[0092] 5. Kruglyak, L. Prospects for whole-genome linkage
disequilibrium mapping of common disease genes. Nat Genet 22,
139-44. (1999).
[0093] 6. Judson, R., Stephens, J. C. & Windemuth, A. The
predictive power of haplotypes in clinical response.
Pharmacogenomics 1, 15-26. (2000).
[0094] 7. Martin, E. R. et al. Analysis of association at single
nucleotide polymorphisms in the APOE region. Genomics 63, 7-12.
(2000).
[0095] 8. Clark, A. G. Inference of haplotypes from PCR-amplified
samples of diploid populations. Mol Biol Evol 7, 111-22.
(1990).
[0096] 9. Stephens, M., Smith, N. J. & Donnelly, P. A new
statistical method for haplotype reconstruction from population
data. Am J Hum Genet 68, 978-89. (2001).
[0097] 10. Ruano, G. & Kidd, K. K. Direct haplotyping of
chromosomal segments from multiple heterozygotes via
allele-specific PCR amplification. Nucleic Acids Res 17, 8392.
(1989).
[0098] 11. Ruano, G., Kidd, K. K. & Stephens, J. C. Haplotype
of multiple polymorphisms resolved by enzymatic amplification of
single DNA molecules. Proc Natl Acad Sci USA 87, 6296-300.
(1990).
[0099] 12. Douglas, J. A., Boehnke, M., Gillanders, E., Trent, J.
M. & Gruber, S. B. Experimentally-derived haplotypes
substantially increase the efficiency of linkage disequilibrium
studies. Nat Genet 28, 361-4. (2001).
[0100] 13. Stephens, J. C., Rogers, J. & Ruano, G. Theoretical
underpinning of the single-molecule-dilution (SMD) method of direct
haplotype resolution. Am J Hum Genet 46, 1149-55. (1990).
[0101] 14. Daly, M. J., Rioux, J. D., Schaffner, S. F., Hudson, T.
J. & Lander, E. S. High-resolution haplotype structure in the
human genome. Nat Genet 29, 229-32. (2001).
[0102] 15. Gabriel, S. B. et al. The structure of haplotype blocks
in the human genome. Science 296, 2225-9. (2002).
Sequence CWU 1
1
48 1 20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 1 tctaccagct tggctccctc 20 2 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 2
aagtccatca gcagcagcag 20 3 17 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 3 gggagtcagc ccagctc 17 4
20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 4 actggtgaga caatcccttc 20 5 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 5
ccactggcat taaagtgctg 20 6 20 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 6 agccacagaa gaaggactcc 20
7 20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 7 taccagaaac cagacctctg 20 8 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 8
agtgctggac agaaagtgag 20 9 17 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 9 tgaggatggt gggaggg 17 10
20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 10 tctaccagaa accagacctc 20 11 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 11
agtgctggac agaaagtgag 20 12 19 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 12 acctctgagg gccccttac 19
13 20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 13 ctcgagtgat aatctcaggg 20 14 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 14
aggtagtgtt tacagccctc 20 15 23 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 15 tgatgatgtc gaagaggctc
atg 23 16 20 DNA Artificial Sequence Description of Artificial
Sequence Synthetic primer 16 ttacgagaca tgacctcagg 20 17 20 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 17 gcatttgatt ggcagagcag 20 18 19 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 18 ctgcaggaag
ctctggatg 19 19 20 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 19 gcatttgatt ggcagagcag 20 20
20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 20 ttacgagaca tgacctcagg 20 21 17 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 21
agagcagctc cgagtcc 17 22 20 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 22 gcagcacata ctggaaatcc 20 23
20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 23 tttctctccc caggatatcg 20 24 21 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 24
gctttttctt agaataggag g 21 25 20 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 25 agatcttggg
catcttgagg 20 26 20 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 26 acccctgtct tccacaggtt 20 27
19 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 27 tgggcctggc tggggaagc 19 28 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 28
acccctgtct tccacaggtt 20 29 20 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 29 agatcttggg catcttgagg 20
30 21 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 30 tgtcttccac aggttgtcgg c 21 31 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 31
gtaaaactgc agctgaggag 20 32 20 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 32 tgactaggtc aggtcccctc 20
33 27 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 33 ggagtattta aaggagagac acactag 27 34 20 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
primer 34 tgactaggtc aggtcccctc 20 35 20 DNA Artificial Sequence
Description of Artificial Sequence Synthetic primer 35 gtaaaactgc
agctgaggag 20 36 17 DNA Artificial Sequence Description of
Artificial Sequence Synthetic primer 36 ccctcgtgcc acagcct 17 37 20
DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 37 ggacatcaaa ggaacaggac 20 38 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 38
actcacaata ttgggcaggc 20 39 19 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 39 caaggggcta agggagaag 19
40 20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 40 gggttgcatg agcattaagt 20 41 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 41
cacatcaagg ataagactgc 20 42 19 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 42 atctcttcag tagacgaac 19
43 20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 43 tggccttgat tcaaaccctg 20 44 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 44
agatgaagga aatcccaagg 20 45 22 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 45 tgccactaac atacatagta ac
22 46 20 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 46 ccttggcttg atagtcaaac 20 47 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 47
atttggagga gtgcagagag 20 48 17 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 48 agtcaaactc tcaccac
17
* * * * *
References