U.S. patent application number 10/725329 was filed with the patent office on 2004-11-11 for pak5 screening methods.
This patent application is currently assigned to SUGEN, Inc.. Invention is credited to Martinez, Ricardo, Plowman, Gregory, Whyte, David.
Application Number | 20040224323 10/725329 |
Document ID | / |
Family ID | 22166386 |
Filed Date | 2004-11-11 |
United States Patent
Application |
20040224323 |
Kind Code |
A1 |
Plowman, Gregory ; et
al. |
November 11, 2004 |
PAK5 screening methods
Abstract
The present invention relates to the nucleic acid molecules
encoding an STE20-related family of novel protein kinases, ZC1,
ZC2, ZC3, ZC4, STLK2, STLK3, STLK4, STLK5, STLK6, STLK7, KHS2,
SULU1, SULU3, GEK2, PAK4 and PAK5, segments and domains thereof, as
well as various methods useful for the diagnosis and treatment of
various kinase-related diseases and conditions. Mammalian nucleic
acid molecules encoding these kinases are particularly disclosed,
and more specifically human sources of these nucleic acids are
disclosed.
Inventors: |
Plowman, Gregory; (San
Carlos, CA) ; Martinez, Ricardo; (Foster City,
CA) ; Whyte, David; (Belmont, CA) |
Correspondence
Address: |
FOLEY AND LARDNER
SUITE 500
3000 K STREET NW
WASHINGTON
DC
20007
US
|
Assignee: |
SUGEN, Inc.
|
Family ID: |
22166386 |
Appl. No.: |
10/725329 |
Filed: |
December 2, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10725329 |
Dec 2, 2003 |
|
|
|
09688188 |
Oct 16, 2000 |
|
|
|
6656716 |
|
|
|
|
09688188 |
Oct 16, 2000 |
|
|
|
09291417 |
Apr 13, 1999 |
|
|
|
6680170 |
|
|
|
|
60081784 |
Apr 14, 1998 |
|
|
|
Current U.S.
Class: |
435/6.13 ;
435/6.18 |
Current CPC
Class: |
C12N 9/1205 20130101;
A61P 35/00 20180101; A61P 13/12 20180101; A61P 9/00 20180101; A61P
9/10 20180101; A61K 38/00 20130101; A61P 25/00 20180101; A61P 37/00
20180101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Claims
What is claimed is:
1. A method for identifying a substance that modulates kinase
activity comprising the steps of: (a) contacting a PAK5 kinase
polypeptide or a catalytic fragment thereof with a test substance;
(b) measuring the activity of said polypeptide; and (c) determining
whether said substance modulates the activity of said
polypeptide.
2. The method of claim 1, wherein said polypeptide or catalytic
fragment thereof comprises the amino acid sequence set forth in SEQ
ID NO: 30.
3. The method of claim 1, wherein said polypeptide or catalytic
fragment thereof comprises the amino acid sequence set forth in SEQ
ID NO: 103.
4. A method for identifying a substance that modulates kinase
activity in a cell comprising the steps of: (a) expressing a PAK5
kinase polypeptide or a catalytic fragment thereof in a cell; (b)
adding a test substance to said cell; and (c) monitoring a change
in cell phenotype or the interaction between said polypeptide and a
natural binding partner.
5. The method of claim 4, wherein said polypeptide or catalytic
fragment thereof comprises the amino acid sequence set forth in SEQ
ID NO: 30.
6. The method of claim 4, wherein said polypeptide or catalytic
fragment thereof comprises the amino acid sequence set forth in SEQ
ID NO: 103.
7. A method of detecting an agonist or antagonist of PAK5 kinase
activity or kinase binding partner activity comprising (a)
incubating cells that express PAK5 in the presence of a compound
and (b) detecting changes in said kinase activity or said kinase
binding partner activity.
8. The method of claim 3 wherein said compound is present in serum,
body fluid, or a cell extract.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 09/688,188 filed Oct. 16, 2000, which is a divisional of U.S.
application Ser. No. 09/291,417, filed Apr. 13, 1999, which in turn
claims priority to U.S. Provsional Application Ser. No. 60/081,784,
filed Apr. 14, 1998. This application claims only subject matter
disclosed in the parent application and therefore presents no new
matter.
[0002] The instant application contains a "lengthy" Sequence
Listing which has been submitted via triplicate CD-R in lieu of a
printed paper copy, and is hereby incorporated by reference in its
entirety. Said CD-R are labeled "CRF", 'opy 1 " and "Copy 2",
respectively, and each contains only one identical 329 Kb file
(38602329.APP).
FIELD OF THE INVENTION
[0003] The present invention relates to novel kinase polypeptides,
nucleotide sequences encoding the novel kinase polypeptides, as
well as various products and methods useful for the diagnosis and
treatment of various kinase-related diseases and conditions.
BACKGROUND OF THE INVENTION
[0004] The following description of the background of the invention
is provided to aid in understanding the invention, but is not
admitted to be or to describe prior art to the invention.
[0005] Cellular signal transduction is a fundamental mechanism
whereby external stimuli that regulate diverse cellular processes
are relayed to the interior of cells. One of the key biochemical
mechanisms of signal transduction involves the reversible
phosphorylation of proteins, which enables regulation of the
activity of mature proteins by altering their structure and
function.
[0006] The best characterized protein kinases in eukaryotes
phosphorylate proteins on the hydroxyl moiety of serine, threonine
and tyrosine residues. These kinases largely fall into two groups,
those specific for phosphorylating serines and threonines, and
those specific for phosphorylating tyrosines. Some kinases,
referred to as "dual specificity" kinases, are able to
phosphorylate on tyrosine as well as serine/threonine residues.
[0007] Protein kinases can also be characterized by their location
within the cell. Some kinases are transmembrane receptor-type
proteins capable of directly altering their catalytic activity in
response to the external environment such as the binding of a
ligand. Others are non-receptor-type proteins lacking any
transmembrane domain. They can be found in a variety of cellular
compartments from the inner surface of the cell membrane to the
nucleus.
[0008] Many kinases are involved in regulatory cascades wherein
their substrates may include other kinases whose activities are
regulated by their phosphorylation state. Ultimately the activity
of some downstream effector is modulated by phosphorylation
resulting from activation of such a pathway.
[0009] Protein kinases are one of the largest families of
eukaryotic proteins with several hundred known members. These
proteins share a 250-300 amino acid domain that can be subdivided
into 12 distinct subdomains that comprise the common catalytic core
structure. These conserved protein motifs have recently been
exploited using PCR-based cloning strategies leading to a
significant expansion of the known kinases.
[0010] Multiple alignment of the sequences in the catalytic domain
of protein kinases and subsequent parsimony analysis permits the
segregation of related kinases into distinct branches or
subfamilies including: tyrosine kinases,
cyclic-nucleotide-dependent kinases, calcium/calmodulin kinases,
cyclin-dependent kinases and MAP-kinases, serine-threonine kinase
receptors, and several other less defined subfamilies.
SUMMARY OF THE INVENTION
[0011] Through the use of a targeted PCR cloning strategy and of a
"motif extraction" bioinformatics script, mammalian members of the
STE20-kinase family have been identified as part of the present
invention. Multiple alignment and parsimony analysis of the
catalytic domain of all of these STE20-family members reveals that
these proteins cluster into 9 distinct subgroups. Classification in
this manner has proven highly accurate not only in predicting
motifs present in the remaining non-catalytic portion of each
protein, but also in their regulation, substrates, and signaling
pathways. The present invention includes the partial or complete
sequence of new members of the STE20-family, their classification,
predicted or deduced protein structure, and a strategy for
elucidating their biologic and therapeutic relevance.
[0012] Thus, a first aspect of the invention features an isolated,
enriched, or purified nucleic acid molecule encoding a kinase
polypeptide selected from the group consisting of STLK2, STLK3,
STLK4, STLK5, STLK6, STLK7, ZC1, ZC2, ZC3, ZC4, KHS2, SULU1, SULU3,
GEK2, PAK4, and PAK5.
[0013] By "isolated" in reference to nucleic acid is meant a
polymer of nucleotides conjugated to each other, including DNA and
RNA, that is isolated from a natural source or that is synthesized.
The isolated nucleic acid of the present invention is unique in the
sense that it is not found in a pure or separated state in nature.
Use of the term "isolated" indicates that a naturally occurring
sequence has been removed from its normal cellular (i.e.,
chromosomal) environment. Thus, the sequence may be in a cell-free
solution or placed in a different cellular environment. The term
does not imply that the sequence is the only nucleotide chain
present, but that it is essentially free (about 90-95% pure at
least) of non-nucleotide material naturally associated with it, and
thus is distinguished from isolated chromosomes.
[0014] By the use of the term "enriched" in reference to nucleic
acid is meant that the specific DNA or RNA sequence constitutes a
significantly higher fraction (2-5 fold) of the total DNA or RNA
present in the cells or solution of interest than in normal or
diseased cells or in the cells from which the sequence was taken.
This could be caused by a person by preferential reduction in the
amount of other DNA or RNA present, or by a preferential increase
in the amount of the specific DNA or RNA sequence, or by a
combination of the two. However, it should be noted that enriched
does not imply that there are no other DNA or RNA sequences
present, just that the relative amount of the sequence of interest
has been significantly increased. The term "significant" is used to
indicate that the level of increase is useful to the person making
such an increase, and generally means an increase relative to other
nucleic acids of about at least 2 fold, more preferably at least 5
to 10 fold or even more. The term also does not imply that there is
no DNA or RNA from other sources. The other source DNA may, for
example, comprise DNA from a yeast or bacterial genome, or a
cloning vector such as pUC 19. This term distinguishes from
naturally occurring events, such as viral infection, or tumor type
growths, in which the level of one mRNA may be naturally increased
relative to other species of mRNA. That is, the term is meant to
cover only those situations in which a person has intervened to
elevate the proportion of the desired nucleic acid.
[0015] It is also advantageous for some purposes that a nucleotide
sequence be in purified form. The term "purified" in reference to
nucleic acid does not require absolute purity (such as a
homogeneous preparation). Instead, it represents an indication that
the sequence is relatively more pure than in the natural
environment (compared to the natural level this level should be at
least 2-5 fold greater, e.g., in terms of mg/mL). Individual clones
isolated from a cDNA library may be purified to electrophoretic
homogeneity. The claimed DNA molecules obtained from these clones
could be obtained directly from total DNA or from total RNA. The
cDNA clones are not naturally occurring, but rather are preferably
obtained via manipulation of a partially purified naturally
occurring substance (messenger RNA). The construction of a cDNA
library from mRNA involves the creation of a synthetic substance
(cDNA) and pure individual cDNA clones can be isolated from the
synthetic library by clonal selection of the cells carrying the
cDNA library. Thus, the process which includes the construction of
a cDNA library from mRNA and isolation of distinct cDNA clones
yields an approximately 10.sup.6-fold purification of the native
message. Thus, purification of at least one order of magnitude,
preferably two or three orders, and more preferably four or five
orders of magnitude is expressly contemplated.
[0016] By a "kinase polypeptide" is meant 32 (preferably 40, more
preferably 45, most preferably 55) or more contiguous amino acids
set forth in the amino acid sequence of SEQ ID NO:5, SEQ ID NO:6,
or SEQ ID NO:7, or the corresponding full-length amino acid
sequence; 250 (preferably 255, more preferably 260, most preferably
270) or more contiguous amino acids set forth in the amino acid
sequence SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID
NO:105, or the corresponding full-length amino acid sequence; 27
(preferably 30, more preferably 40, most preferably 45) or more
contiguous amino acids set forth in the amino acid sequence SEQ ID
NO: 18; 16 (preferably 20, more preferably 25, most preferably 35)
or more contiguous amino acids set forth in the amino acid sequence
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID
NO:31, or SEQ ID NO: 103 or the corresponding full-length amino
acid sequence; 6 (preferably 10, more preferably 15, most
preferably 25) or more contiguous amino acids set forth in the
amino acid sequence of SEQ ID NO:97 or SEQ ID NO:99, 22 (preferably
30, more preferably 35, most preferably 45) or more contiguous
amino acids set forth in the amino acid sequence of SEQ ID NO: 101,
or the corresponding full-length amino acid sequence; 78
(preferably 80, more preferably 85, most preferably 90) or more
contiguous amino acids set forth in the amino acid sequence SEQ ID
NO:107 or functional derivatives thereof as described herein. For
sequences for which the full-length sequence is not given, the
remaining sequences can be determined using methods well-known to
those in the art and are intended to be included in the invention.
In certain aspects, polypeptides of 100, 200, 300 or more amino
acids are preferred. The kinase polypeptide can be encoded by a
full-length nucleic acid sequence or any portion of the full-length
nucleic acid sequence, so long as a functional activity of the
polypeptide is retained, not to include fragments containing only
amino acids 1-22 of SEQ ID NO: 13 or only amino acids 1-33 of SEQ
ID NO:107.
[0017] The amino acid sequence will be substantially similar to the
sequence shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID
NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ
ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:97,
SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:103, SEQ ID NO:105, or SEQ
ID NO:107, or the corresponding full-length amino acid sequence, or
fragments thereof, not to include fragments consisting only of the
amino acid sequences 1-22 of SEQ ID NO:13 or 1-33 of SEQ ID NO:107.
A sequence that is substantially similar to the sequence of SEQ ID
NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:13, SEQ ID NO:14, SEQ ID
NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ
ID NO:29, SEQ ID NO:31, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101,
SEQ ID NO:103, SEQ ID NO:105, or SEQ ID NO:107 will preferably have
at least 90% identity (more preferably at least 95% and most
preferably 99-100%) to the sequence of SEQ ID NO:5, SEQ ID NO:6,
SEQ ID NO:7, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID
NO:18, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ
ID NO:31, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103,
SEQ ID NO:105, or SEQ ID NO:107.
[0018] By "identity" is meant a property of sequences that measures
their similarity or relationship. Identity is measured by dividing
the number of identical residues by the total number of residues
and gaps and multiplying the product by 100. "Gaps" are spaces in
an alignment that are the result of additons or deletions of amino
acids. Thus, two copies of exactly the same sequence have 100%
identity, but sequences that are less highly conserved, and have
deletions, additions, or replacements, may have a lower degree of
identity. Those skilled in the art will recognize that several
computer programs are available for determining sequence identity
using standard parameters, for example Blast (Altschul, et al.
(1997) Nucleic Acids Res. 25:3389-3402), Blast2 (Altschul, et al.
(1990) J. mol. biol. 215:403-410), and Smith-Waterman (Smith, et
al. (1981) J. Mol. Biol. 147:195-197).
[0019] In preferred embodiments, the invention features isolated,
enriched, or purified nucleic acid molecules encoding a kinase
polypeptide comprising a nucleotide sequence that: (a) encodes a
polypeptide having the amino acid sequence set forth in SEQ ID
NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:13, SEQ ID NO:14, SEQ ID
NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ
ID NO:29, SEQ ID NO:31, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101,
SEQ ID NO:103, SEQ ID NO: 105, or SEQ ID NO: 107; (b) is the
complement of the nucleotide sequence of (a); (c) hybridizes under
highly stringent conditions to the nucleotide molecule of (a) and
encodes a naturally occurring kinase polypeptide; (d) encodes a
kinase polypeptide having the amino acid sequence of SEQ ID NO:5,
SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15,
SEQ ID NO:18, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID
NO:29, SEQ ID NO:31, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO: 103,
SEQ ID NO: 105, or SEQ ID NO: 107, except that it lacks one or
more, but not all, of the following segments of amino acid
residues: 1-21, 22-274, or 275-416 of SEQ ID NO:5, 1-31, 32-308,
309-489 or 490-516 of SEQ ID NO:6, 1-178 or 179-414 of SEQ ID NO:7,
1-22, 23-289, 290-526, 527-640, 641-896, or 897-1239 of SEQ ID
NO:13, 1-255, 256-442, 443-626, 627-954, or 955-1297 of SEQ ID
NO:14, 1-255, 256-476, 477-680, 681-983, or 984-1326 of SEQ ID
NO:15, 1-13, 14-273, 274-346, 347-534, or 535-894 of SEQ ID NO: 18,
1-21, 22-277, 278-427, 428-637, 638-751, or 752-898 of SEQ ID
NO:22, 1-66, 67-215, 216-425, 426-539, 540-786, or 787-887 of SEQ
ID NO:23, 1-25, 26-273, 274-422, 423-632, or 633-748 of SEQ ID
NO:24, 1-51, 52-224, 225-393, 394-658, or 659-681 of SEQ ID NO:29,
1-25, 26-281, 284-430, 431-640, 641-754, 755-901, or 902-1001 of
SEQ ID NO:31, 1-10, 11-321, or 322-373 of SEQ ID NO:97, 1-57,
58-369, or 370-418 of SEQ ID NO:99, 1-52, 53-173, 174-307, 308-572,
or 573-591 of SEQ ID NO:103, 1-24, 25-289, 290-397, 398-628,
629-872, or 873-1227 of SEQ ID NO:105, or 1-33, 34-294, 295-337,
338-472, 473-724, or 725-968 of SEQ ID NO: 107; (e) is the
complement of the nucleotide sequence of (d); (f) encodes a
polypeptide having the amino acid sequence set forth in SEQ ID
NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:13, SEQ ID NO:14, SEQ ID
NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ
ID NO:29, SEQ ID NO:31; SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:103,
SEQ ID NO:105, or SEQ ID NO:107 from amino acid residues 1-21,
22-274, or 275-416 of SEQ ID NO:5, 1-31, 32-308, 309-489, or
490-516 of SEQ ID NO:6, 1-178 or 179-414 of SEQ ID NO:7, 23-289,
290-526, 527-640, 641-896, or 897-1239 of SEQ ID NO:13, 1-255,
256-442, 443-626, 627-954, or 955-1297 of SEQ ID NO:14, 1-255,
256-476, 477-680, 681-983, or 984-1326 of SEQ ID NO:15, 1-13,
14-273, 274-346, 347-534, or 535-894 of SEQ ID NO:18, 1-21, 22-277,
278-427, 428-637, 638-751, or 752-898 of SEQ ID NO:22, 1-66,
67-215, 216-425, 426-539, 540-786, or 787-887 of SEQ ID NO:23,
1-25, 26-273, 274-422, 423-632, or 633-748 of SEQ ID NO:24, 1-51,
52-224, 225-393, 394-658, or 659-681 of SEQ ID NO:29, 1-25, 26-281,
282-430, 431-640, 641-754, 755-901, or 902-1001 of SEQ ID NO:31,
1-10, 11-321, or 322-373 of SEQ ID NO:97, 1-57, 58-369, or 370-418
of SEQ ID NO:99, 1-52, 53-173, 174-307, 308-572, or 573-591 of SEQ
ID NO:103, 1-24, 25-289, 290-397, 398-628, 629-872, or 873-1227 of
SEQ ID NO:105, or 1-33, 34-294, 295-337, 338-472, 473-724, or
725-968 of SEQ ID NO: 107; (g) is the complement of the nucleotide
sequence of (f); (h) encodes a polypeptide having the amino acid
sequence set forth in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID
NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: 18, SEQ ID NO:22, SEQ
ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:97,
SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, or SEQ
ID NO:107, except that it lacks one or more of the domains selected
from the group consisting of a N-terminal domain, a catalytic
domain, a C-terminal domain, a coiled-coil structure region, a
proline-rich region, a spacer region, an insert, and a C-terminal
tail; or (i) is the complement of the nucleotide sequence of
(h).
[0020] The term "complement" refers to two nucleotides that can
form multiple favorable interactions with one another. For example,
adenine is complementary to thymine as they can form two hydrogen
bonds. Similarly, guanine and cytosine are complementary since they
can form three hydrogen bonds. A nucleotide sequence is the
complement of another nucleotide sequence if all of the nucleotides
of the first sequence are complementary to all of the nucleotides
of the second sequence.
[0021] The term "domain" refers to a region of a polypeptide which
contains a particular function. For instance, N-terminal or
C-terminal domains of signal transduction proteins can serve
functions including, but not limited to, binding molecules that
localize the signal transduction molecule to different regions of
the cell or binding other signaling molecules directly responsible
for propagating a particular cellular signal. Some domains can be
expressed separately from the rest of the protein and function by
themselves, while others must remain part of the intact protein to
retain function. The latter are termed functional regions of
proteins and also relate to domains.
[0022] The term "N-terminal domain" refers to the extracatalytic
region located between the initiator methionine and the catalytic
domain of the protein kinase. The N-terminal domain can be
identified following a Smith-Waterman alignment of the protein
sequence against the non-redundant protein database to define the
N-terminal boundary of the catalytic domain. Depending on its
length, the N-terminal domain may or may not play a regulatory role
in kinase function. An example of a protein kinase whose N-terminal
domain has been shown to play a regulatory role is PAK65, which
contains a CRIB motif used for Cdc42 and rac binding (Burbelo, P.
D. et al. (1995) J. Biol. Chem. 270, 29071-290740).
[0023] The N-terminal domain spans amino acid residues 1-21 of the
sequence set forth in SEQ ID NO:5, amino acid residues 1-31 of the
sequence set forth in SEQ ID NO:6, amino acid residues 1-22 of the
sequence set forth in SEQ ID NO: 13, amino acid residues 1-13 of
the sequence set forth in SEQ ID NO: 18, amino acid residues 1-21
of the sequence set forth in SEQ ID NO:22, amino acid residues 1-25
of the sequence set forth in SEQ ID NO:24, amino acid residues 1-51
of the sequence set forth in SEQ ID NO:29, amino acid residues 1-25
of the sequence set forth in SEQ ID NO:31, amino acid residues 1-57
of the sequence set forth in SEQ ID NO:99, amino acid residues 1-52
of the sequence set forth in SEQ ID NO: 103, amino acid residues
1-24 of the sequence set forth in SEQ ID NO:105, or amino acid
residues 1-33 of the sequence set forth in SEQ ID NO:107.
[0024] The term "catalytic domain" refers to a region of the
protein kinase that is typically 25-300 amino acids long and is
responsible for carrying out the phosphate transfer reaction from a
high-energy phosphate donor molecule such as ATP or GTP to itself
(autophosphorylation) or to other proteins (exogenous
phosphorylation). The catalytic domain of protein kinases is made
up of 12 subdomains that contain highly conserved amino acid
residues, and are responsible for proper polypeptide folding and
for catalysis. The catalytic domain can be identified following a
Smith-Waterman alignment of the protein sequence against the
non-redundant protein database.
[0025] The catalytic domain spans amino acid residues 22-274 of the
sequence set forth in SEQ ID NO:5, residues 32-308 of the sequence
set forth in SEQ ID NO:6, residues 1-178 of the sequence set forth
in SEQ ID NO:7, residues 23-289 of the sequence set forth in SEQ ID
NO:13, residues 1-255 of the sequence set forth in SEQ ID NO:14,
residues 1-255 of the sequence set forth in SEQ ID NO: 15, residues
14-273 of the sequence set forth in SEQ ID NO:18, residues 22-277
of the sequence set forth in SEQ ID NO:22, residues 1-66 of the
sequence set forth in SEQ ID NO:23, residues 26-273 of the sequence
set forth in SEQ ID NO:24, residues 394-658 of the sequence set
forth in SEQ ID NO:29, residues 26-281 of the sequence set forth in
SEQ ID NO:31, residues 1-278 of the sequence set forth in SEQ ID
NO:97, residues 58-369 of the sequence set forth in SEQ ID NO:99,
residues 1-103 of the sequence set forth in SEQ ID NO:101, residues
308-572 of the sequence set forth in SEQ ID NO:103, residues 25-289
of the sequence set forth in SEQ ID NO:105, or residues 34-294 of
the sequence set forth in SEQ ID NO: 107.
[0026] The term "catalytic activity", as used herein, defines the
rate at which a kinase catalytic domain phosphorylates a substrate.
Catalytic activity can be measured, for example, by determining the
amount of a substrate converted to a phosphorylated product as a
function of time. Catalytic activity can be measured by methods of
the invention by holding time constant and determining the
concentration of a phosphorylated substrate after a fixed period of
time. Phosphorylation of a substrate occurs at the active-site of a
protein kinase. The active-site is normally a cavity in which the
substrate binds to the protein kinase and is phosphorylated.
[0027] The term "substrate" as used herein refers to a molecule
phosphorylated by a kinase of the invention. Kinases phosphorylate
substrates on serine/threonine or tyrosine amino acids. The
molecule may be another protein or a polypeptide.
[0028] The term "C-terminal domain" refers to the region located
between the catalytic domain or the last (located closest to the
C-terminus) functional domain and the carboxy-terminal amino acid
residue of the protein kinase. By "functional" domain is meant any
region of the polypeptide that may play a regulatory or catalytic
role as predicted from amino acid sequence homology to other
proteins or by the presence of amino acid sequences that may give
rise to specific structural conformations (i.e. coiled-coils). The
C-terminal domain can be identified by using a Smith-Waterman
alignment of the protein sequence against the non-redundant protein
database to define the C-terminal boundary of the catalytic domain
or of any functional C-terminal extracatalytic domain. Depending on
its length and amino acid composition, the C-terminal domain may or
may not play a regulatory role in kinase function. An example of a
protein kinase whose C-terminal domain may play a regulatory role
is PAK3 which contains a heterotrimeric G.sub.b subunit-binding
site near its C-terminus (Leeuw, T. et al (1998) Nature, 391,
191-195).
[0029] The C-terminal domain spans amino acid residues 275-416 of
the sequence set forth in SEQ ID NO:5, residues 309-489 of the
sequence set forth in SEQ ID NO:6, residues 179-414 of the sequence
set forth in SEQ ID NO:7, residues 897-1239 of the sequence set
forth in SEQ ID NO:13, residues 955-1297 of the sequence set forth
in SEQ ID NO:14, residues 984-1326 of the sequence set forth in SEQ
ID NO:15, residues 535-894 of the sequence set forth in SEQ ID NO:
18, residues 752-898 of the sequence set forth in SEQ ID NO:22,
residues 279-330 of the sequence set forth in SEQ ID NO:97,
residues 370-418 of the sequence set forth in SEQ ID NO:99, or
residues 873-1227 of the sequence set forth in SEQ ID NO:105.
[0030] The term "signal transduction pathway" refers to the
molecules that propagate an extracellular signal through the cell
membrane to become an intracellular signal. This signal can then
stimulate a cellular response. The polypeptide molecules involved
in signal transduction processes are typically receptor and
non-receptor protein tyrosine kinases, receptor and non-receptor
protein phosphatases, SRC homology 2 and 3 domains, phosphotyrosine
binding proteins (SRC homology 2 (SH2) and phosphotyrosine binding
(PTB and PH) domain containing proteins), proline-rich binding
proteins (SH3 domain containing proteins), nucleotide exchange
factors, and transcription factors.
[0031] The term "coiled-coil structure region" as used herein,
refers to a polypeptide sequence that has a high probability of
adopting a coiled-coil structure as predicted by computer
algorithms such as COILS (Lupas, A. (1996) Meth. Enzymology
266:513-525). Coiled-coils are formed by two or three amphipathic
.quadrature.-helices in parallel. Coiled-coils can bind to
coiled-coil domains of other polypeptides resulting in homo- or
heterodimers (Lupas, A. (1991) Science 252:1162-1164).
Coiled-coil-dependent oligomerization has been shown to be
necessary for protein function including catalytic activity of
serine/threonine kinases (Roe, J. et al. (1997) J. Biol. Chem.
272:5838-5845).
[0032] The coiled-coil structure region spans amino acid residues
290-526 of the sequence set forth in SEQ ID NO: 13, residues
256-442 of the sequence set forth in SEQ ID NO:14, residues 256-476
of the sequence set forth in SEQ ID NO:15, residues 428-637 of the
sequence set forth in SEQ ID NO:22, residues 216-425 or 540-786 of
the sequence set forth in SEQ ID NO:23, residues 423-632 of the
sequence set forth in SEQ ID NO:24, residues 431-640 or 755-901 of
the sequence set forth in SEQ ID NO:31, residues 291-398 or 629-668
of the sequence set forth in SEQ ID NO: 105, or residues 473-724 or
725-968 of the sequence set forth in SEQ ID NO:107.
[0033] The term "proline-rich region" as used herein, refers to a
region of a protein kinase whose proline content over a given amino
acid length is higher than the average content of this amino acid
found in proteins (i.e., >10%). Proline-rich regions are easily
discernable by visual inspection of amino acid sequences and
quantitated by standard computer sequence analysis programs such as
the DNAStar program EditSeq. Proline-rich regions have been
demonstrated to participate in regulatory protein -protein
interactions. Among these interactions, those that are most
relevant to this invention involve the "PxxP" (SEQ ID NO: 148)
proline rich motif found in certain protein kinases (i.e., human
PAK1) and the SH3 domain of the adaptor molecule Nck (Galisteo, M.
L. et al. (1996) J. Biol. Chem. 271:20997-21000). Other regulatory
interactions involving "PxxP" (SEQ ID NO: 148) proline-rich motifs
include the WW domain (Sudol, M. (1996) Prog. Biochys. Mol. Bio.
65:113-132).
[0034] The proline-rich region spans amino acid residues 527-640 of
the sequence set forth in SEQ ID NO:13, residues 443-626 of the
sequence set forth in SEQ ID NO:14, residues 477-680 of the
sequence set forth in SEQ ID NO:15, residues 347-534 of the
sequence set forth in SEQ ID NO: 18, residues 398-628 of the
sequence set forth in SEQ ID NO:105, or residues 338-472 of the
sequence set forth in SEQ ID NO:107.
[0035] The term "spacer region" as used herein, refers to a region
of the protein kinase located between predicted functional domains.
The spacer region has no detectable homology to any amino acid
sequence in the database, and can be identified by using a
Smith-Waterman alignment of the protein sequence against the
non-redundant protein database to define the C- and N-terminal
boundaries of the flanking functional domains. Spacer regions may
or may not play a fundamental role in protein kinase function.
Precedence for the regulatory role of spacer regions in kinase
function is provided by the role of the src kinase spacer in
inter-domain interactions (Xu, W. et al. (1997) Nature
385:595-602).
[0036] The spacer region spans amino acid residues 641-896 of the
sequence set forth in SEQ ID NO:13, residues 627-954 of the
sequence set forth in SEQ ID NO:14, residues 681-983 of the
sequence set forth in SEQ ID NO: 15, residues 274-346 of the
sequence set forth in SEQ ID NO:18, residues 278-427 or 638-751 of
the sequence set forth in SEQ ID NO:22, residues 67-215 or 426-539
of the sequence set forth in SEQ ID NO:23, residues 274-422 or
633-748 of the sequence set forth in SEQ ID NO:24, residues 225-393
of the sequence set forth in SEQ ID NO:29, residues 282-430 or
641-754 of the sequence set forth in SEQ ID NO:31, residues 174-307
of the sequence set forth in SEQ ID NO:103, residues 669-872 of the
sequence set forth in SEQ ID NO:105, or residues 295-337 of the
sequence set forth in SEQ ID NO:107.
[0037] The term "insert" as used herein refers to a portion of a
protein kinase that is absent from a close homolog. Inserts may or
may not by the product alternative splicing of exons. Inserts can
be identified by using a Smith-Waterman sequence alignment of the
protein sequence against the non-redundant protein database, or by
means of a multiple sequence alignment of homologous sequences
using the DNAStar program Megalign. Inserts may play a functional
role by presenting a new interface for protein-protein
interactions, or by interfering with such interactions. Inserts
span amino acid residues 52-224 of the sequence set forth in SEQ ID
NO:29 or residues 53-173 of the sequence set forth in SEQ ID
NO:103.
[0038] The term "C-terminal tail" as used herein, refers to a
C-terminal domain of a protein kinase, that by homology extends or
protrudes past the C-terminal amino acid of its closest homolog.
C-terminal tails can be identified by using a Smith-Waterman
sequence alignment of the protein sequence against the
non-redundant protein database, or by means of a multiple sequence
alignment of homologous sequences using the DNAStar program
Megalign. Depending on its length, a C-terminal tail may or may not
play a regulatory role in kinase function.
[0039] The C-terminal tail spans amino acid residues 490-516 of the
sequence set forth in SEQ ID NO:6, residues 787-887 of the sequence
set forth in SEQ ID NO:23, residues 659-681 of the sequence set
forth in SEQ ID NO:29, residues 994-1093 of the sequence set forth
in SEQ ID NO:31, or residues 573-591 of the sequence set forth in
SEQ ID NO:103.
[0040] Various low or high stringency hybridization conditions may
be used depending upon the specificity and selectivity desired.
These conditions are well-known to those skilled in the art. Under
stringent hybridization conditions only highly complementary
nucleic acid sequences hybridize. Preferably, such conditions
prevent hybridization of nucleic acids having more than 1 or 2
mismatches out of 20 contiguous nucleotides, more preferably, such
conditions prevent hybridization of nucleic acids having more than
1 or 2 mismatches out of 50 contiguous nucleotides, most
preferably, such conditions prevent hybridization of nucleic acids
having more than 1 or 2 mismatches out of 100 contiguous
nucleotides. In some instances, the conditions may prevent
hybridization of nucleic acids having more than 5 mismatches in the
full-length sequence.
[0041] By stringent hybridization assay conditions is meant
hybridization assay conditions at least as stringent as the
following: hybridization in 50% formamide, 5.times. SSC, 50 mM
NaH.sub.2PO.sub.4, pH 6.8, 0.5% SDS, 0.1 mg/mL sonicated salmon
sperm DNA, and 5.times. Denhart solution at 42.degree. C.
overnight; washing with 2.times. SSC, 0.1% SDS at 45 DC; and
washing with 0.2.times. SSC, 0.1% SDS at 45.degree. C. Under some
of the most stringent hybridization assay conditions, the second
wash can be done with 0.1.times. SSC at a temperature up to
70.degree. C. (Berger et al. (1987) Guide to Molecular Cloning
Techniques pg 421, hereby incorporated by reference herein
including any figures, tables, or drawings.). However, other
applications may require the use of conditions falling between
these sets of conditions. Methods of determining the conditions
required to achieve desired hybridizations are well-known to those
with ordinary skill in the art, and are based on several factors,
including but not limited to, the sequences to be hybridized and
the samples to be tested.
[0042] In other preferred embodiments, the invention features
isolated, enriched, or purified nucleic acid molecules encoding
kinase polypeptides, further comprising a vector or promoter
effective to initiate transcription in a host cell. The invention
also features recombinant nucleic acid, preferably in a cell or an
organism. The recombinant nucleic acid may contain a sequence set
forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:9, SEQ ID
NO:10, SEQ ID NO:11, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ
ID NO:21, SEQ ID NO:27, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:100,
SEQ ID NO:102, SEQ ID NO:104, or SEQ ID NO:106, or a functional
derivative thereof and a vector or a promoter effective to initiate
transcription in a host cell. The recombinant nucleic acid can
alternatively contain a transcriptional initiation region
functional in a cell, a sequence complementary to an RNA sequence
encoding a kinase polypeptide and a transcriptional termination
region functional in a cell. Specific vectors and host cell
combinations are discussed herein.
[0043] The term "vector" relates to a single or double-stranded
circular nucleic acid molecule that can be transfected into cells
and replicated within or independently of a cell genome. A circular
double-stranded nucleic acid molecule can be cut and thereby
linearized upon treatment with restriction enzymes. An assortment
of nucleic acid vectors, restriction enzymes, and the knowledge of
the nucleotide sequences cut by restriction enzymes are readily
available to those skilled in the art. A nucleic acid molecule
encoding a kinase can be inserted into a vector by cutting the
vector with restriction enzymes and ligating the two pieces
together.
[0044] The term "transfecting" defines a number of methods to
insert a nucleic acid vector or other nucleic acid molecules into a
cellular organism. These methods involve a variety of techniques,
such as treating the cells with high concentrations of salt, an
electric field, detergent, or DMSO to render the outer membrane or
wall of the cells permeable to nucleic acid molecules of interest
or use of various viral transduction strategies.
[0045] The term "promoter" as used herein, refers to nucleic acid
sequence needed for gene sequence expression. Promoter regions vary
from organism to organism, but are well known to persons skilled in
the art for different organisms. For example, in prokaryotes, the
promoter region contains both the promoter (which directs the
initiation of RNA transcription) as well as the DNA sequences
which, when transcribed into RNA, will signal synthesis initiation.
Such regions will normally include those 5'-non-coding sequences
involved with initiation of transcription and translation, such as
the TATA box, capping sequence, CAAT sequence, and the like.
[0046] In preferred embodiments, the isolated nucleic acid
comprises, consists essentially of, or consists of a nucleic acid
sequence set forth in SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ
ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:17, SEQ ID NO:19,
SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:27, SEQ ID NO:96, SEQ ID
NO:98, SEQ ID NO: 100 SEQ ID NO: 102, SEQ ID NO: 104, or SEQ ID NO:
106, or the corresponding full-length sequence, encodes the amino
acid sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID
NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ
ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:97,
SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, or SEQ
ID NO: 107, or the corresponding full-length amino acid sequence, a
functional derivative thereof, or at least 40, 45, 50, 60, 100,
200, or 300 contiguous amino acids of SEQ ID NO:5, SEQ ID NO:6, or
SEQ ID NO:7, or of the corresponding full-length amino acid
sequence; at least 250, 255, 275, 300, or 400 contiguous amino
acids of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, or of the
corresponding full-length amino acid sequence; at least 27, 30, 35,
40, 50, 100, 200, or 300 contiguous amino acids of SEQ ID NO:18; at
least 16, 25, 35, 50, 100, 200, or 300 contiguous amino acids of
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID
NO:31, or SEQ ID NO:103, or of the corresponding full-length amino
acid sequence; 6 (preferably 10, more preferably 15, most
preferably 25) or more contiguous amino acids set forth in the
amino acid sequence of SEQ ID NO:97 or SEQ ID NO:99, or the
corresponding full-length amino acid sequence; 22 (preferably 30,
more preferably 35, most preferably 45) or more contiguous amino
acids set forth in the amino acid sequence of SEQ ID NO: 101, or
the corresponding full-length amino acid sequence; or at least 80,
85, 90, 100, 200, or 300 contiguous amino acids of SEQ ID NO: 107,
or functional derivatives thereof. The kinase polypeptides,
selected from the group consisting of STLK2, STLK3, STLK4, STLK5,
STLK6, STLK7, ZC1, ZC2, ZC3, ZC4, KHS2, SULU1, SULU3, GEK2, PAK4,
and PAK5, comprise, consist essentially of, or consist of at least
at least 40, 45, 50, 60, 100, 200, or 300 contiguous amino acids of
SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7; at least 250, 255, 275,
300, or 400 contiguous amino acids of SEQ ID NO:13, SEQ ID NO:14,
SEQ ID NO:15, or SEQ ID NO:105; at least 27, 30, 35, 40, 50, 100,
200, or 300 contiguous amino acids of SEQ ID NO:18; at least 35,
40, 45, 50, 100, 200, or 300 contiguous amino acids of SEQ ID
NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:31 or
SEQ ID NO:103; 6 (preferably 10, more preferably 15, most
preferably 25) or more contiguous amino acids set forth in the
amino acid sequence of SEQ ID NO:97 or SEQ ID NO:99; 22 (preferably
30, more preferably 35, most preferably 45) or more contiguous
amino acids set forth in the amino acid sequence of SEQ ID NO:101;
or at least 80, 85, 90, 100, 200, or 300 contiguous amino acids of
SEQ ID NO:107, or the corresponding full-length sequences or
derivatives thereof. The nucleic acid may be isolated from a
natural source by cDNA cloning or by subtractive hybridization. The
natural source may be mammalian, preferably human, blood, semen, or
tissue, and the nucleic acid may be synthesized by the triester
method or by using an automated DNA synthesizer.
[0047] The term "mammal" refers preferably to such organisms as
mice, rats, rabbits, guinea pigs, sheep, and goats, more preferably
to cats, dogs, monkeys, and apes, and most preferably to
humans.
[0048] In yet other preferred embodiments, the nucleic acid is a
conserved or unique region, for example those useful for: the
design of hybridization probes to facilitate identification and
cloning of additional polypeptides, the design of PCR probes to
facilitate cloning of additional polypeptides, obtaining antibodies
to polypeptide regions, and designing antisense
oligonucleotides.
[0049] By "conserved nucleic acid regions", are meant regions
present on two or more nucleic acids encoding a kinase polypeptide,
to which a particular nucleic acid sequence can hybridize under
lower stringency conditions. Examples of lower stringency
conditions suitable for screening for nucleic acid encoding kinase
polypeptides are provided in Abe, et al. (J. Biol. Chem.
19:13361-13368, 1992), hereby incorporated by reference herein in
its entirety, including any drawings, figures, or tables.
Preferably, conserved regions differ by no more than 5 out of 20
nucleotides, even more preferably 2 out of 20 nucleotides or most
preferably 1 out of 20 nucleotides.
[0050] By "unique nucleic acid region" is meant a sequence present
in a nucleic acid coding for a kinase polypeptide that is not
present in a sequence coding for any other naturally occurring
polypeptide. Such regions preferably encode 32 (preferably 40, more
preferably 45, most preferably 55) or more contiguous amino acids
set forth in the amino acid sequence of SEQ ID NO:5, SEQ ID NO:6,
or SEQ ID NO:7, or the corresponding full-length amino acid
sequence; 250 (preferably 255, more preferably 260, most preferably
270) or more contiguous amino acids set forth in the amino acid
sequence SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15, or SEQ ID
NO:105, or the corresponding full-length amino acid sequence; 27
(preferably 30, more preferably 40, most preferably 45) or more
contiguous amino acids set forth in the amino acid sequence SEQ ID
NO: 18; 16 (preferably 20, more preferably 25, most preferably 35)
or more contiguous amino acids set forth in the amino acid sequence
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID
NO:31, or SEQ ID NO:103, or the corresponding full-length amino
acid sequence; 6 (preferably 10, more preferably 15, most
preferably 25) or more contiguous amino acids set forth in the
amino acid sequence of SEQ ID NO:97 or SEQ ID NO:99, 22 (preferably
30, more preferably 35, most preferably 45) or more contiguous
amino acids set forth in the amino acid sequence of SEQ ID NO:101,
or the corresponding full-length amino acid sequence; or 78
(preferably 80, more preferably 85, most preferably 90) or more
contiguous amino acids set forth in the amino acid sequence SEQ ID
NO:107, or functional derivatives thereof. In particular, a unique
nucleic acid region is preferably of mammalian origin.
[0051] A second aspect of the invention features a nucleic acid
probe for the detection of nucleic acid encoding a kinase
polypeptide in a sample, wherein said polypeptide is selected from
the group consisting of STLK2, STLK3, STLK4, STLK5, STLK6, STLK7,
ZC1, ZC2, ZC3, ZC4, KHS2, SULU1, SULU3, GEK2, PAK4, and PAK5.
Preferably, the nucleic acid probe encodes a kinase polypeptide
that is a fragment of the protein encoded by the amino acid
sequence set forth in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID
NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ
ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:97,
SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, or SEQ
ID NO: 107, or the corresponding full-length amino acid sequences,
not to include fragments consisting only of amino acids 1-22 of SEQ
ID NO: 13 or amino acids 1-33 of SEQ ID NO:107. The nucleic acid
probe contains a nucleotide base sequence that will hybridize to a
sequence set forth in SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ
ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:17, SEQ ID NO:19,
SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:27, SEQ ID NO:96, SEQ ID
NO:98, SEQ ID NO:100, SEQ ID NO: 102, SEQ ID NO: 104, or SEQ ID NO:
106, or the corresponding full-length sequence, or a functional
derivative thereof.
[0052] In preferred embodiments, the nucleic acid probe hybridizes
to nucleic acid encoding at least 6, 12, 75, 90, 105, 120, 150,
200, 250, 300 or 350 contiguous amino acids of the sequence set
forth in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:13, SEQ
ID NO:14, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ ID NO:23,
SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:31 SEQ ID NO:97, SEQ ID
NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, or SEQ ID
NO:107, or the corresponding full-length amino acid sequence, or
functional derivatives thereof.
[0053] Methods for using the probes include detecting the presence
or amount of kinase RNA in a sample by contacting the sample with a
nucleic acid probe under conditions such that hybridization occurs
and detecting the presence or amount of the probe bound to kinase
RNA. The nucleic acid duplex formed between the probe and a nucleic
acid sequence coding for a kinase polypeptide may be used in the
identification of the sequence of the nucleic acid detected (Nelson
et al., in Nonisotopic DNA Probe Techniques, Academic Press, San
Diego, Kricka, ed., p. 275, 1992, hereby incorporated by reference
herein in its entirety, including any drawings, figures, or
tables). Kits for performing such methods may be constructed to
include a container means having disposed therein a nucleic acid
probe.
[0054] In a third aspect, the invention describes a recombinant
cell or tissue comprising a nucleic acid molecule encoding a kinase
polypeptide selected from the group consisting of STLK2, STLK3,
STLK4, STLK5, STLK6, STLK7, ZC1, ZC2, ZC3, ZC4, KHS2, SULU1, SULU3,
GEK2, PAK4, and PAK5. In such cells, the nucleic acid may be under
the control of the genomic regulatory elements, or may be under the
control of exogenous regulatory elements including an exogenous
promoter. By "exogenous" it is meant a promoter that is not
normally coupled in vivo transcriptionally to the coding sequence
for the kinase polypeptides.
[0055] The polypeptide is preferably a fragment of the protein
encoded by the amino acid sequence set forth in SEQ ID NO:5, SEQ ID
NO:6, SEQ ID NO:7, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID
NO:18, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ
ID NO:31, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103,
SEQ ID NO:105, or SEQ ID NO:107, or the corresponding full-length
amino acid sequence, not to include fragments consisting only of
amino acids 1-22 of SEQ ID NO:13 or amino acids 1-33 of SEQ ID
NO:107. By "fragment," is meant an amino acid sequence present in a
kinase polypeptide. Preferably, such a sequence comprises at least
32, 45, 50, 60, 100, 200, or 300 contiguous amino acids of SEQ ID
NO:5, SEQ ID NO:6, or SEQ ID NO:7, or of the corresponding
full-length amino acid sequence; at least 250, 255, 275, 300, or
400 contiguous amino acids of SEQ ID NO:13, SEQ ID NO:14, SEQ ID
NO:15, OR SEQ ID NO:105, or of the corresponding full-length amino
acid sequence; at least 27, 30, 35, 40, 50, 100, 200, or 300
contiguous amino acids of SEQ ID NO:18; at least 16, 25, 35, 50,
100, 200, or 300 contiguous amino acids of SEQ ID NO:22, SEQ ID
NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:31 or SEQ ID NO: 103,
or of the corresponding full-length amino acid sequence; 6
(preferably 10, more preferably 15, most preferably 25) or more
contiguous amino acids set forth in the amino acid sequence of SEQ
ID NO:97 or SEQ ID NO:99, 22 (preferably 30, more preferably 35,
most preferably 45) or more contiguous amino acids set forth in the
amino acid sequence of SEQ ID NO:101; at least 78, 85, 90, 100,
200, or 300 contiguous amino acids of SEQ ID NO:107, or the
corresponding full-length amino acid sequence; or a functional
derivative thereof.
[0056] In a fourth aspect, the invention features an isolated,
enriched, or purified kinase polypeptide selected from the group
consisting of STLK2, STLK3, STLK4, STLK5, STLK6, STLK7, ZC1, ZC2,
ZC3, ZC4, KHS2, SULU1, SULU3, GEK2, PAK4, and PAK5.
[0057] By "isolated" in reference to a polypeptide is meant a
polymer of amino acids (2 or more amino acids) conjugated to each
other, including polypeptides that are isolated from a natural
source or that are synthesized. The isolated polypeptides of the
present invention are unique in the sense that they are not found
in a pure or separated state in nature. Use of the term "isolated"
indicates that a naturally occurring sequence has been removed from
its normal cellular environment. Thus, the sequence may be in a
cell-free solution or placed in a different cellular environment.
The term does not imply that the sequence is the only amino acid
chain present, but that it is essentially free (about 90-95% pure
at least) of non-amino acid material naturally associated with
it.
[0058] By the use of the term "enriched" in reference to a
polypeptide is meant that the specific amino acid sequence
constitutes a significantly higher fraction (2-5 fold) of the total
amino acid sequences present in the cells or solution of interest
than in normal or diseased cells or in the cells from which the
sequence was taken. This could be caused by a person by
preferential reduction in the amount of other amino acid sequences
present, or by a preferential increase in the amount of the
specific amino acid sequence of interest, or by a combination of
the two. However, it should be noted that enriched does not imply
that there are no other amino acid sequences present, just that the
relative amount of the sequence of interest has been significantly
increased. The term significant here is used to indicate that the
level of increase is useful to the person making such an increase,
and generally means an increase relative to other amino acid
sequences of about at least 2-fold, more preferably at least 5- to
10-fold or even more. The term also does not imply that there is no
amino acid sequence from other sources. The other source of amino
acid sequences may, for example, comprise amino acid sequence
encoded by a yeast or bacterial genome, or a cloning vector such as
pUC19. The term is meant to cover only those situations in which
man has intervened to increase the proportion of the desired amino
acid sequence.
[0059] It is also advantageous for some purposes that an amino acid
sequence be in purified form. The term "purified" in reference to a
polypeptide does not require absolute purity (such as a homogeneous
preparation); instead, it represents an indication that the
sequence is relatively purer than in the natural environment.
Compared to the natural level this level should be at least 2-5
fold greater (e.g., in terms of mg/mL). Purification of at least
one order of magnitude, preferably two or three orders, and more
preferably four or five orders of magnitude is expressly
contemplated. The substance is preferably free of contamination at
a functionally significant level, for example 90%, 95%, or 99%
pure.
[0060] In preferred embodiments, the kinase polypeptide is a
fragment of the protein encoded by the amino acid sequence set
forth in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:13, SEQ
ID NO:14, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ ID NO:23,
SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:97, SEQ ID
NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, or SEQ ID
NO:107, or the corresponding full-length amino acid sequences, not
to include fragments consisting only of amino acids 1-22 of SEQ ID
NO:13 or amino acids 1-33 of SEQ ID NO:107. Preferably, the kinase
polypeptide contains at least 32, 45, 50, 60, 100, 200, or 300
contiguous amino acids of SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7,
or the corresponding full-length amino acid sequence; at least 250,
255, 275, 300, or 400 contiguous amino acids of SEQ ID NO:13, SEQ
ID NO:14, SEQ ID NO:15, or SEQ ID NO:105, or the corresponding
full-length amino acid sequence; at least 27, 30, 35, 40, 50, 100,
200, or 300 contiguous amino acids of SEQ ID NO:18; at least 16,
25, 35, 50, 100, 200, or 300 contiguous amino acids of SEQ ID
NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:31, or
SEQ ID NO:103, or the corresponding full-length amino acid
sequence; 6 (preferably 10, more preferably 15, most preferably 25)
or more contiguous amino acids set forth in the amino acid sequence
of SEQ ID NO:97 or SEQ ID NO:99, 22 (preferably 30, more preferably
35, most preferably 45) or more contiguous amino acids set forth in
the amino acid sequence of SEQ ID NO:101, or the corresponding
full-length amino acid sequence; or at least 78, 85, 90, 100, 200,
or 300 contiguous amino acids of SEQ ID NO: 107, or a functional
derivative thereof.
[0061] In preferred embodiments, the kinase polypeptide comprises
an amino acid sequence having (a) the amino acid sequence set forth
in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:13, SEQ ID
NO:14, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ ID NO:23, SEQ
ID NO:24, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:97, SEQ ID NO:99,
SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, or SEQ ID NO:107; (b)
the amino acid sequence set forth in SEQ ID NO:5, SEQ ID NO:6, SEQ
ID NO:7, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:18,
SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID
NO:31, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:103, SEQ ID NO:105, or
SEQ ID NO:107, except that it lacks one or more, but not all, of
the following segments of amino acid residues: 1-21, 22-274, or
275-416 of SEQ ID NO:5, 1-31, 32-308, 309-489 or 490-516 of SEQ ID
NO:6,1-178 or 179-414 of SEQ ID NO:7, 1-22, 23-289, 290-526,
527-640, 641-896, or 897-1239 of SEQ ID NO:13, 1-255, 256-442,
443-626, 627-954, or 955-1297 of SEQ ID NO:14, 1-255, 256-476,
477-680, 681-983, or 984-1326 of SEQ ID NO:15, 1-13, 14-273,
274-346, 347-534, or 535-894 of SEQ ID NO:18, 1-21, 22-277,
278-427, 428-637, 638-751, or 752-898 of SEQ ID NO:22, 1-66,
67-215, 216-425, 426-539, 540-786, or 787-887 of SEQ ID NO:23,
1-25, 26-273, 274-422, 423-632, or 633-748 of SEQ ID NO:24, 1-51,
52-224, 225-393, 394-658, or 659-681 of SEQ ID NO:29, 1-25, 26-281,
282-430, 431-640, 641-754, 755-901, or 902-1001 of SEQ ID NO:31,
1-10, 11-321, or 322-373 of SEQ ID NO:97, 1-57, 58-369, or 370-418
of SEQ ID NO:99, 1-52, 53-173, 174-307, 308-572, or 573-591 of SEQ
ID NO:103, 1-24, 25-289, 290-397, 398-628, 629-668, 669-872, or
873-1227 of SEQ ID NO:105, or 1-33, 34-294, 295-337, 338-472,
473-724, or 725-968 of SEQ ID NO:107; (c) the amino acid sequence
set forth in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:13,
SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ ID
NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:97, SEQ ID NO:99, SEQ
ID NO:103, SEQ ID NO:105, or SEQ ID NO:107 from amino acid residues
1-21, 22-274, or 275-416 of SEQ ID NO:5, 1-31, 32-308, 309-489, or
490-516 of SEQ ID NO:6, 1-178 or 179-414 of SEQ ID NO:7, 23-289,
290-526, 527-640, 641-896, or 897-1239 of SEQ ID NO:13, 1-255,
256-442, 443-626, 627-954, or 955-1297 of SEQ ID NO:14, 1-255,
256-476, 477-680, 681-983, or 984-1326 of SEQ ID NO:15, 1-13,
14-273, 274-346, 347-534, or 535-894 of SEQ ID NO:18, 1-21, 22-277,
278-427, 428-637, 638-751, or 752-898 of SEQ ID NO:22, 1-66,
67-215, 216-425, 426-539, 540-786, or 787-887 of SEQ ID NO:23,
1-25, 26-273, 274-422, 423-632, or 633-748 of SEQ ID NO:24, 1-51,
52-224, 225-393, 394-658, or 659-681 of SEQ ID NO:29, 1-25, 26-273,
274-422, 423-632, 633-746, 747-993, or 994-1093 of SEQ ID NO:31,
1-10,11-321, or 322-373 of SEQ ID NO:97, 1-57, 58-369, or 370-418
of SEQ ID NO:99, 1-52, 53-173, 174-307, 308-572, or 573-591 of SEQ
ID NO:103, 1-24, 25-289, 290-397, 398-628, 629-668, 669-872, or
873-1227 of SEQ ID NO:105, or 1-33, 34-294, 295-337, 338-472,
473-724, or 725-968 of SEQ ID NO:107; or (d) the amino acid
sequence set forth in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID
NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ
ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:97,
SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, or SEQ
ID NO:107, except that it lacks one or more, but not all, of the
domains selected from the group consisting of a C-terminal domain,
a catalytic domain, an N-terminal domain, a spacer region, a
proline-rich region, a coiled-coil structure region, an insert, and
a C-terminal tail.
[0062] The polypeptide can be isolated from a natural source by
methods well-known in the art. The natural source may be mammalian,
preferably human, blood, semen, or tissue, and the polypeptide may
be synthesized using an automated polypeptide synthesizer. The
isolated, enriched, or purified kinase polypeptide is preferably: a
STLK2, STLK3, STLK4; STLK5, STLK6, or STLK7 polypeptide; a ZC1,
ZC2, ZC3, or ZC4 polypeptide; a KHS2 polypeptide; a SULU1 or SULU3
polypeptide; a GEK2 polypeptide; or a PAK4 or PAK5 polypeptide.
[0063] In some embodiments the invention includes a recombinant
kinase polypeptide selected from the group consisting of STLK2,
STLK3, STLK4, STLK5, STLK6, STLK7, ZC1, ZC2, ZC3, ZC4, KHS2, SULU1,
SULU3, GEK2, PAK4, and PAK5. By "recombinant kinase polypeptide" is
meant a polypeptide produced by recombinant DNA techniques such
that it is distinct from a naturally occurring polypeptide either
in its location (e.g., present in a different cell or tissue than
found in nature), purity or structure. Generally, such a
recombinant polypeptide will be present in a cell in an amount
different from that normally observed in nature.
[0064] In a fifth aspect, the invention features an antibody (e.g.,
a monoclonal or polyclonal antibody) having specific binding
affinity to a kinase polypeptide or a kinase polypeptide domain or
fragment where the polypeptide is selected from the group
consisting of STLK2, STLK3, STLK4, STLK5, STLK6, STLK7, ZC1, ZC2,
ZC3, ZC4, KHS2, SULU1, SULU3, GEK2, PAK4, and PAK5. By "specific
binding affinity" is meant that the antibody binds to the target
kinase polypeptide with greater affinity than it binds to other
polypeptides under specified conditions. Antibodies or antibody
fragments are polypeptides that contain regions that can bind other
polypeptides. The term "specific binding affinity" describes an
antibody that binds to a kinase polypeptide with greater affinity
than it binds to other polypeptides under specified conditions.
[0065] The term "polyclonal" refers to antibodies that are
heterogenous populations of antibody molecules derived from the
sera of animals immunized with an antigen or an antigenic
functional derivative thereof. For the production of polyclonal
antibodies, various host animals may be immunized by injection with
the antigen. Various adjuvants may be used to increase the
immunological response, depending on the host species.
[0066] "Monoclonal antibodies" are substantially homogenous
populations of antibodies to a particular antigen. They may be
obtained by any technique which provides for the production of
antibody molecules by continuous cell lines in culture. Monoclonal
antibodies may be obtained by methods known to those skilled in the
art (Kohler et al., Nature 256:495-497, 1975, and U.S. Pat. No.
4,376,110, both of which are hereby incorporated by reference
herein in their entirety including any figures, tables, or
drawings).
[0067] The term "antibody fragment" refers to a portion of an
antibody, often the hyper variable region and portions of the
surrounding heavy and light chains, that displays specific binding
affinity for a particular molecule. A hyper variable region is a
portion of an antibody that physically binds to the polypeptide
target.
[0068] Antibodies or antibody fragments having specific binding
affinity to a kinase polypeptide of the invention may be used in
methods for detecting the presence and/or amount of kinase
polypeptide in a sample by probing the sample with the antibody
under conditions suitable for kinase-antibody immunocomplex
formation and detecting the presence and/or amount of the antibody
conjugated to the kinase polypeptide. Diagnostic kits for
performing such methods may be constructed to include antibodies or
antibody fragments specific for the kinase as well as a conjugate
of a binding partner of the antibodies or the antibodies
themselves.
[0069] An antibody or antibody fragment with specific binding
affinity to a kinase polypeptide of the invention can be isolated,
enriched, or purified from a prokaryotic or eukaryotic organism.
Routine methods known to those skilled in the art enable production
of antibodies or antibody fragments, in both prokaryotic and
eukaryotic organisms. Purification, enrichment, and isolation of
antibodies, which are polypeptide molecules, are described
above.
[0070] Antibodies having specific binding affinity to a kinase
polypeptide of the invention may be used in methods for detecting
the presence and/or amount of kinase polypeptide in a sample by
contacting the sample with the antibody under conditions such that
an immunocomplex forms and detecting the presence and/or amount of
the antibody conjugated to the kinase polypeptide. Diagnostic kits
for performing such methods may be constructed to include a first
container containing the antibody and a second container having a
conjugate of a binding partner of the antibody and a label, such
as, for example, a radioisotope. The diagnostic kit may also
include notification of an FDA approved use and instructions
therefor.
[0071] In a sixth aspect, the invention features a hybridoma which
produces an antibody having specific binding affinity to a kinase
polypeptide or a kinase polypeptide domain, where the polypeptide
is selected from the group consisting of STLK2, STLK3, STLK4,
STLK5, STLK6, STLK7, ZC1, ZC2, ZC3, ZC4, KHS2, SULU1, SULU3, GEK2,
PAK4, and PAK5. By "hybridoma" is meant an immortalized cell line
that is capable of secreting an antibody, for example an antibody
to a kinase of the invention. In preferred embodiments, the
antibody to the kinase comprises a sequence of amino acids that is
able to specifically bind a kinase polypeptide of the
invention.
[0072] In a seventh aspect, the invention features a kinase
polypeptide binding agent able to bind to a kinase polypeptide
selected from the group consisting of STLK2, STLK3, STLK4, STLK6,
STLK7, STLK5, ZC1, ZC2, ZC3, ZC4, KHS2, SULU1, SULU3, GEK2, PAK4,
and PAK5. The binding agent is preferably a purified antibody that
recognizes an epitope present on a kinase polypeptide of the
invention. Other binding agents include molecules that bind to
kinase polypeptides and analogous molecules that bind to a kinase
polypeptide. Such binding agents may be identified by using assays
that measure kinase binding partner activity, such as those that
measure PDGFR activity.
[0073] The invention also features a method for screening for human
cells containing a kinase polypeptide of the invention or an
equivalent sequence. The method involves identifying the novel
polypeptide in human cells using techniques that are routine and
standard in the art, such as those described herein for identifying
the kinases of the invention (e.g., cloning, Southern or Northern
blot analysis, in situ hybridization, PCR amplification, etc.).
[0074] In an eighth aspect, the invention features methods for
identifying a substance that modulates kinase activity comprising
the steps of: (a) contacting a kinase polypeptide selected from the
group consisting of STLK2, STLK3, STLK4, STLK5, STLK6, STLK7, ZC1,
ZC2, ZC3, ZC4, KHS2, SULU1, SULU3, GEK2, PAK4, and PAK5 with a test
substance; (b) measuring the activity of said polypeptide; and (c)
determining whether said substance modulates the activity of said
polypeptide.
[0075] The term "modulates" refers to the ability of a compound to
alter the function of a kinase of the invention. A modulator
preferably activates or inhibits the activity of a kinase of the
invention depending on the concentration of the compound exposed to
the kinase.
[0076] The term "activates" refers to increasing the cellular
activity of the kinase. The term inhibit refers to decreasing the
cellular activity of the kinase. Kinase activity is preferably the
interaction with a natural binding partner.
[0077] The term "modulates" also refers to altering the function of
kinases of the invention by increasing or decreasing the
probability that a complex forms between the kinase and a natural
binding partner. A modulator preferably increases the probability
that such a complex forms between the kinase and the natural
binding partner, more preferably increases or decreases the
probability that a complex forms between the kinase and the natural
binding partner depending on the concentration of the compound
exposed to the kinase, and most preferably decreases the
probability that a complex forms between the kinase and the natural
binding partner.
[0078] The term "complex" refers to an assembly of at least two
molecules bound to one another. Signal transduction complexes often
contain at least two protein molecules bound to one another. For
instance, a protein tyrosine receptor protein kinase, GRB2, SOS,
RAF, and RAS assemble to form a signal transduction complex in
response to a mitogenic ligand.
[0079] The term "natural binding partner" refers to polypeptides,
lipids, small molecules, or nucleic acids that bind to kinases in
cells. A change in the interaction between a kinase and a natural
binding partner can manifest itself as an increased or decreased
probability that the interaction forms, or an increased or
decreased concentration of kinase/natural binding partner
complex.
[0080] The term "contacting" as used herein refers to mixing a
solution comprising the test compound with a liquid medium bathing
the cells of the methods. The solution comprising the compound may
also comprise another component, such as dimethyl sulfoxide (DMSO),
which facilitates the uptake of the test compound or compounds into
the cells of the methods. The solution comprising the test compound
may be added to the medium bathing the cells by utilizing a
delivery apparatus, such as a pipet-based device or syringe-based
device.
[0081] In a ninth aspect, the invention features methods for
identifying a substance that modulates kinase activity in a cell
comprising the steps of: (a) expressing a kinase polypeptide in a
cell, wherein said polypeptide is selected from the group
consisting of STLK2, STLK3, STLK4, STLK5, STLK6, STLK7, ZC1, ZC2,
ZC3, ZC4, KHS2, SULU1, SULU3, GEK2, PAK4, and PAK5; (b) adding a
test substance to said cell; and (c) monitoring a change in cell
phenotype or the interaction between said polypeptide and a natural
binding partner.
[0082] The term "expressing" as used herein refers to the
production of kinases of the invention from a nucleic acid vector
containing kinase genes within a cell. The nucleic acid vector is
transfected into cells using well known techniques in the art as
described herein.
[0083] In a tenth aspect, the invention provides methods for
treating a disease by administering to a patient in need of such
treatment a substance that modulates the activity of a kinase
selected from the group consisting of STLK2, STLK3, STLK4, STLK5,
STLK6, STLK7, ZC1, ZC2, ZC3, ZC4, KHS2, SULU1, SULU3, GEK2, PAK4,
and PAK5. Preferably, the disease is selected from the group
consisting of immune-related diseases and disorders, organ
transplantation, myocardial infarction, cardiovascular disease,
stroke, renal failure, oxidative stress-related neurodegenerative
disorders, and cancer. Most preferably, the immune-related diseases
and disorders include, but are not limited to, rheumatoid
arthritis, artherosclerosis, and autoimmune disorders.
[0084] In preferred embodiments, the invention provides methods for
treating or preventing a disease or disorder by administering to a
patient in need of such treatment a substance that modulates the
activity of a kinase polypeptide selected from the group consisting
of ZC1, ZC2, ZC3, ZC4, KHS2, PAK4, and PAK5. Preferably, the
disease or disorder is selected from the group consisting of
rheumatoid arthritis, artherosclerosis, autoimmune disorders, and
organ transplantation. The invention also features methods of
treating or preventing a disease or disorder by administering to a
patient in need of such treatment a substance that modulates the
activity of a kinase polypeptide selected from the group consisting
of STLK1, STLK2, STLK3, STLK4, STLK5, STLK6, and STLK7. Preferably
the disease or disorder is selected from the group consisting of
immune-related diseases and disorders, myocardial infarction,
cardiomyopathies, stroke, renal failure, and oxidative
stress-related neurodegenerative disorders. Most preferably, the
immune-related diseases and disorders are selected from the group
consisting of rheumatoid arthritis, chronic inflammatory bowel
disease, chronic inflammatory pelvic disease, multiple sclerosis,
asthma, osteoarthritis, psoriasis, atherosclerosis, rhinitis,
autoimmunity, and organ transplantation.
[0085] The invention also features methods of treating or
preventing a disease or disorder by administering to a patient in
need of such treatment a substance that modulates the activity of a
kinase polypeptide selected from the group consisting of ZC1, ZC2,
ZC3, and ZC4. Preferably the disease is selected from the group
consisting of immune-related diseases and disorders, cardiovascular
disease, and cancer. Most preferably, the immune-related diseases
and disorders are selected from the group consisting of rheumatoid
arthritis, chronic inflammatory bowel disease, chronic inflammatory
pelvic disease, multiple sclerosis, asthma, osteoarthritis,
psoriasis, atherosclerosis, rhinitis, autoimmunity, and organ
transplantation.
[0086] Substances useful for treatment of kinase-related disorders
or diseases preferably show positive results in one or more in
vitro assays for an activity corresponding to treatment of the
disease or disorder in question (Examples of such assays are
provided in the references in section VI, below; and in Example 7,
herein). Examples of substances that can be screened for favorable
activity are provided and referenced in section VI, below. The
substances that modulate the activity of the kinases preferably
include, but are not limited to, antisense oligonucleotides and
inhibitors of protein kinases, as determined by methods and screens
referenced in section VI and Example 7, below.
[0087] The term "preventing" refers to decreasing the probability
that an organism contracts or develops an abnormal condition.
[0088] The term "treating" refers to having a therapeutic effect
and at least partially alleviating or abrogating an abnormal
condition in the organism.
[0089] The term "therapeutic effect" refers to the inhibition or
activation factors causing or contributing to the abnormal
condition. A therapeutic effect relieves to some extent one or more
of the symptoms of the abnormal condition. In reference to the
treatment of abnormal conditions, a therapeutic effect can refer to
one or more of the following: (a) an increase in the proliferation,
growth, and/or differentiation of cells; (b) inhibition (i.e.,
slowing or stopping) of cell death; (c) inhibition of degeneration;
(d) relieving to some extent one or more of the symptoms associated
with the abnormal condition; and (e) enhancing the function of the
affected population of cells. Compounds demonstrating efficacy
against abnormal conditions can be identified as described
herein.
[0090] The term "abnormal condition" refers to a function in the
cells or tissues of an organism that deviates from their normal
functions in that organism. An abnormal condition can relate to
cell proliferation, cell differentiation, or cell survival.
[0091] Abnormal cell proliferative conditions include cancers such
as fibrotic and mesangial disorders, abnormal angiogenesis and
vasculogenesis, wound healing, psoriasis, diabetes mellitus, and
inflammation.
[0092] Abnormal differentiation conditions include, but are not
limited to neurodegenerative disorders, slow wound healing rates,
and slow tissue grafting healing rates.
[0093] Abnormal cell survival conditions relate to conditions in
which programmed cell death (apoptosis) pathways are activated or
abrogated. A number of protein kinases are associated with the
apoptosis pathways. Aberrations in the function of any one of the
protein kinases could lead to cell immortality or premature cell
death.
[0094] The term "aberration", in conjunction with the function of a
kinase in a signal transduction process, refers to a kinase that is
over- or under-expressed in an organism, mutated such that its
catalytic activity is lower or higher than wild-type protein kinase
activity, mutated such that it can no longer interact with a
natural binding partner, is no longer modified by another protein
kinase or protein phosphatase, or no longer interacts with a
natural binding partner.
[0095] The term "administering" relates to a method of
incorporating a compound into cells or tissues of an organism. The
abnormal condition can be prevented or treated when the cells or
tissues of the organism exist within the organism or outside of the
organism. Cells existing outside the organism can be maintained or
grown in cell culture dishes. For cells harbored within the
organism, many techniques exist in the art to administer compounds,
including (but not limited to) oral, parenteral, dermal, injection,
and aerosol applications. For cells outside of the organism,
multiple techniques exist in the art to administer the compounds,
including (but not limited to) cell microinjection techniques,
transformation techniques, and carrier techniques.
[0096] The abnormal condition can also be prevented or treated by
administering a compound to a group of cells having an aberration
in a signal transduction pathway to an organism. The effect of
administering a compound on organism function can then be
monitored. The organism is preferably a mouse, rat, rabbit, guinea
pig, or goat, more preferably a monkey or ape, and most preferably
a human.
[0097] In an eleventh aspect, the invention features methods for
detection of a kinase polypeptide in a sample as a diagnostic tool
for diseases or disorders, wherein the method comprises the steps
of: (a) contacting the sample with a nucleic acid probe which
hybridizes under hybridization assay conditions to a nucleic acid
target region of a kinase polypeptide selected from the group
consisting of STLK2, STLK3, STLK4, STLK5, STLK6, STLK7, ZC1, ZC2,
ZC3, ZC4, KHS2, SULU1, SULU3, GEK2, PAK4, and PAK5, said probe
comprising the nucleic acid sequence encoding the polypeptide,
fragments thereof, and the complements of the sequences and
fragments; and (b) detecting the presence or amount of the
probe:target region hybrid as an indication of the disease.
[0098] In preferred embodiments of the invention, the disease or
disorder is selected from the group consisting of rheumatoid
arthritis, artherosclerosis, autoimmune disorders, organ
transplantation, myocardial infarction, cardiomyopathies, stroke,
renal failure, oxidative stress-related neurodegenerative
disorders, and cancer. In other preferred embodiments, the kinase
polypeptide is selected from the group consisting of PAK4 and PAK5,
or the polypeptide is selected from the group consisting of ZC1,
ZC2, ZC3, and ZC4, and the disease is cancer.
[0099] The kinase "target region" is the nucleotide base sequence
set forth in SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:9,
SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:17, SEQ ID NO:19, SEQ ID
NO:20, SEQ ID NO:21, SEQ ID NO:27, SEQ ID NO:96, SEQ ID NO:98, SEQ
ID NO:100, SEQ ID NO:102, SEQ ID NO:104, or SEQ ID NO: 106, or the
corresponding full-length sequences, a functional derivative
thereof, or a fragment thereof to which the nucleic acid probe will
specifically hybridize. Specific hybridization indicates that in
the presence of other nucleic acids the probe only hybridizes
detectably with the kinase of the invention's target region.
Putative target regions can be identified by methods well known in
the art consisting of alignment and comparison of the most closely
related sequences in the database.
[0100] In preferred embodiments the nucleic acid probe hybridizes
to a kinase target region encoding at least 6, 12, 75, 90, 105,
120, 150, 200, 250, 300 or 350 contiguous amino acids of the
sequence set forth in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID
NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ
ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:97,
SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, or SEQ
ID NO:107, or the corresponding full-length amino acid sequence, or
a functional derivative thereof. Hybridization conditions should be
such that hybridization occurs only with the kinase genes in the
presence of other nucleic acid molecules. Under stringent
hybridization conditions only highly complementary nucleic acid
sequences hybridize. Preferably, such conditions prevent
hybridization of nucleic acids having more than 1 or 2 mismatches
out of 20 contiguous nucleotides. Such conditions are defined
supra.
[0101] The diseases for which detection of kinase genes in a sample
could be diagnostic include diseases in which kinase nucleic acid
(DNA and/or RNA) is amplified in comparison to normal cells. By
"amplification" is meant increased numbers of kinase DNA or RNA in
a cell compared with normal cells. In normal cells, kinases are
typically found as single copy genes. In selected diseases, the
chromosomal location of the kinase genes may be amplified,
resulting in multiple copies of the gene, or amplification. Gene
amplification can lead to amplification of kinase RNA, or kinase
RNA can be amplified in the absence of kinase DNA
amplification.
[0102] "Amplification" as it refers to RNA can be the detectable
presence of kinase RNA in cells, since in some normal cells there
is no basal expression of kinase RNA. In other normal cells, a
basal level of expression of kinase exists, therefore in these
cases amplification is the detection of at least 1-2-fold, and
preferably more, kinase RNA, compared to the basal level.
[0103] The diseases that could be diagnosed by detection of kinase
nucleic acid in a sample preferably include cancers. The test
samples suitable for nucleic acid probing methods of the present
invention include, for example, cells or nucleic acid extracts of
cells, or biological fluids. The samples used in the
above-described methods will vary based on the assay format, the
detection method and the nature of the tissues, cells or extracts
to be assayed. Methods for preparing nucleic acid extracts of cells
are well known in the art and can be readily adapted in order to
obtain a sample that is compatible with the method utilized.
[0104] In a final aspect, the invention features a method for
detection of a kinase polypeptide in a sample as a diagnostic tool
for a disease or disorder, wherein the method comprises: (a)
comparing a nucleic acid target region encoding the kinase
polypeptide in a sample, where the kinase polypeptide is selected
from the group consisting of STLK2, STLK3, STLK4, STLK5, STLK6,
STLK7, ZC1, ZC2, ZC3, ZC4, KHS2, SULU1, SULU3, GEK2, PAK4, and
PAK5, or one or more fragments thereof, with a control nucleic acid
target region encoding the kinase polypeptide, or one or more
fragments thereof; and (b) detecting differences in sequence or
amount between the target region and the control target region, as
an indication of the disease or disorder. Preferably, the disease
or disorder is selected from the group consisting of immune-related
diseases and disorders, organ transplantation, myocardial
infarction, cardiovascular disease, stroke, renal failure,
oxidative stress-related neurodegenerative disorders, and cancer.
Immune-related diseases and disorders include, but are not limited
to, those discussed previously.
[0105] The term "comparing" as used herein refers to identifying
discrepancies between the nucleic acid target region isolated from
a sample, and the control nucleic acid target region. The
discrepancies can be in the nucleotide sequences, e.g. insertions,
deletions, or point mutations, or in the amount of a given
nucleotide sequence. Methods to determine these discrepancies in
sequences are well-known to one of ordinary skill in the art. The
"control" nucleic acid target region refers to the sequence or
amount of the sequence found in normal cells, e.g. cells that are
not diseased as discussed previously.
[0106] The invention has been described broadly and generically
herein. Each of the narrower species and subgeneric groupings
falling within the generic disclosure also form part of the
invention. This includes the generic description of the invention
with a proviso or negative limitation removing any subject matter
from the genus, regardless of whether or not the excised material
is specifically recited herein. For example, in some instances the
nucleotide sequence of the ZC4 kinase polypeptide may not be part
of a preferred embodiment.
[0107] The summary of the invention described above is not limiting
and other features and advantages of the invention will be apparent
from the following detailed description of the invention, and from
the claims.
BRIEF DESCRIPTION OF THE FIGURES
[0108] FIGS. 1A, 1B and 1C show a multiple sequence alignment of
the amino acid sequences (SEQ ID NOS 84-85, 5-7, respectively, in
order of appearance) of the STE20-STE20 family kinases.
[0109] FIGS. 2A and 2B show a multiple sequence alignment of the
amino acid sequences (SEQ ID NOS 84, 86-87 & 8, respectively,
in order of appearance) of the STE20-STLK5 family kinases.
[0110] FIGS. 3A, 3B, 3C, 3D, 3E, 3F and 3G show a multiple sequence
alignment of the amino acid sequences (SEQ ID NOS 88-89, 13-16,
respectively, in order of appearance) of STE20-ZC family
kinases.
[0111] FIGS. 4A, 4B and 4C show a pairwise sequence (SEQ ID NOS 91
& 18, respectively, in order of appearance) alignment of
STE20-KHS family kinases.
[0112] FIGS. 5A, 5B, 5C and 5D show a multiple sequence alignment
of the amino acid sequences (SEQ ID NOS 90, 22, 24 & 151
respectively, in order of appearance) of STE20-SULU family
kinases.
[0113] FIGS. 6A, 6B and 6C show a pairwise sequence (SEQ ID NOS 92
& 26, respectively, in order of appearance) alignment of
STE20-GEK family kinases.
[0114] FIGS. 7A, 7B and 7C show a multiple sequence alignment of
the amino acid sequences (SEQ ID NOS 93-95, 29-30 respectively, in
order of appearance) of STE20-PAK family kinases.
[0115] FIGS. 8A, 8B, 8C, 8D, 8E, 8F and 8G show the amino acid
sequences of human STLK2(SEQ ID NO:5), human STLK3(SEQ ID NO:6),
human STLK4(SEQ ID NO:7), human STLK5(SEQ ID NO:8), human ZC1(SEQ
ID NO:13), human ZC2(SEQ ID NO:14), human ZC3(SEQ ID NO:15), human
ZC4(SEQ ID NO:16), human KHS2(SEQ ID NO:18), human SULU1(SEQ ID
NO:22), human SULU3(SEQ ID NO:23), murine SULU3(SEQ ID NO:24),
human GEK2(SEQ ID NO:26), human PAK4(SEQ ID NO:29), and human
PAK5(SEQ ID NO30).
[0116] FIGS. 9A, 9B, 9C, 9D, 9E, 9F, 9G, 9H, 91, 9J, 9K, 9L, 9M,
9N, 90, 9P, 9Q, 9R, 9S, 9T, 9U and 9V show the nucleic acid
sequences of human STLK2(SEQ ID NO: 1), human STLK3(SEQ ID NO:2),
human STLK4(SEQ ID NO:3), human STLK5(SEQ ID NO:4), human ZC1(SEQ
ID NO:9), human ZC2(SEQ ID NO:10), human ZC3(SEQ ID NO:11), human
ZC4(SEQ ID NO:12), human KHS2(SEQ ID NO:17), human SULU1(SEQ ID
NO:19), human SULU3(SEQ ID NO:20), murine SULU3(SEQ ID NO:21),
human GEK2(SEQ ID NO:25), human PAK4(SEQ ID NO:27), and human
PAK5(SEQ ID NO:28).
[0117] FIGS. 10A, 10B and 10C show the full-length amino acid
sequences of human STLK5 (SEQ ID NO: 97), human PAK5 (SEQ ID
NO:103), and human ZC4 (SEQ ID NO: 105), as well as the partial
amino acid sequences of human full-length STLK6 (SEQ ID NO: 99) and
human STLK7 (SEQ ID NO: 101) and human GEK2 (SEQ ID NO: 107).
[0118] FIGS. 11A, 11B, 11C, 11D, 11E, 11F, 11G and 11H show the
full-length nucleic acid sequences of human STLK5 (SEQ ID NO:96),
human PAK5 (SEQ ID NO:102), and human ZC4 (SEQ ID NO:104), as well
as the partial nucleic acid sequences of human STLK6 (SEQ ID NO:
98) and human STLK7 (SEQ ID NO: 100) and human GEK2 (SEQ ID NO:
106).
[0119] FIGS. 12A and 12B show a multiple sequence alignment among
human SPAK (SEQ ID NO: 153), human STLK6 (SEQ ID NO: 99), human
STLK7 (SEQ ID NO: 101) and full-length human STLK5 (SEQ ID NO:
152).
[0120] FIGS. 13A, 13B and 13C show a multiple sequence alignment
among human PAK1 (SEQ ID NO: 93), human PAK4 (SEQ ID NO: 29) and
human PAK5 (SEQ ID NO: 103).
[0121] FIGS. 14A, 14B and 14C show a pair-wise sequence alignment
between human ZC1 (SEQ ID NO: 15) and human ZC4 (SEQ ID NO:
105).
[0122] FIGS. 15A, 15B and 15C show a pair-wise sequence alignment
between LOK1 (SEQ ID NO: 154) and full-length GEK2 (SEQ ID NO:
155).
DETAILED DESCRIPTION OF THE INVENTION
[0123] The present invention relates in part to kinase
polypeptides, nucleic acids encoding such polypeptides, cells
containing such nucleic acids, antibodies to such polypeptides,
assays utilizing such polypeptides, and methods relating to all of
the foregoing. The present invention is based upon the isolation
and characterization of new kinase polypeptides. The polypeptides
and nucleic acids may be produced using well-known and standard
synthesis techniques when given the sequences presented herein.
[0124] The recent elucidation of the DNA sequence of Saccharomyces
cerevesiae has provided the first complete example of the genetic
information contained in a simple eukaryotic organism. Analysis of
this yeast genome revealed that it contains at least 113 protein
kinases. These kinases were further subdivided into several
structurally related groups. One of these newly defined groups was
termed the STE20-family to represent its founding member STE20,
which is a protein kinase involved in the yeast pheromone response
pathway that initiates a protein kinase cascade in response to a
G-protein mediated signal. S. cerevesiae has two additional members
of this family, CLA4, and YOL113W (HRA655).
[0125] Several mammalian homologues have recently been identified
that belong to the STE20-family, including SOK-1 (human STE20),
GC-kinase, KHS, HPK1, NIK, SLK, GEK, PAK1, PAK65, MST1, and CDC7.
Furthermore, the Drosophila and the C. elegans genome efforts have
identified additional protein kinases which belong to the
STE20-family, yet have structurally unique extracatalytic domains,
including ZC504.4 and SULU kinases from C. elegans, and NINAC of
Drosophila.
[0126] STE20-related protein kinases have been implicated as
regulating a variety of cellular responses, including response to
growth factors or cytokines, oxidative-, UV-, or
irradiation-related stress pathways, inflammatory signals (i.e.,
TNF.quadrature.), apoptotic stimuli (i.e., Fas), T and B cell
costimulation, the control of cytoskeletal architecture, and
cellular transformation. Typically, the STE20-related kinases serve
as upstream regulators of MAPK cascades. Examples include: HPK1, a
protein-serine/threonine kinase (STK) that possesses a STE20-like
kinase domain that activates a protein kinase pathway leading to
the stress-activated protein kinase SAPK/JNK; PAK1, an STK with an
upstream CDC42-binding domain that interacts with Rac and plays a
role in cellular transformation through the Ras-MAPK pathway; and
murine NIK, which interacts with upstream receptor tyrosine kinases
and connects with downstream STE11-family kinases.
[0127] The STE20-kinases possess a variety of non-catalytic domains
that are believed to interact with upstream regulators. Examples
include proline-rich domains for interaction with SH3-containing
proteins, or specific domains for interaction with Rac, Rho, and
Rab small G-proteins. These interactions may provide a mechanism
for cross-talk between distinct biochemical pathways in response to
external stimuli such as the activation of a variety of cell
surface receptors, including tyrosine kinases, cytokine receptors,
TNF receptor, Fas, T cell receptors, CD28, or CD40.
[0128] I. The Nucleic Acids of the Invention
[0129] Included within the scope of this invention are the
functional equivalents of the herein-described isolated nucleic
acid molecules. The degeneracy of the genetic code permits
substitution of certain codons by other codons that specify the
same amino acid and hence would give rise to the same protein. The
nucleic acid sequence can vary substantially since, with the
exception of methionine and tryptophan, the known amino acids can
be coded for by more than one codon. Thus, portions or all of the
kinase genes of the invention could be synthesized to give a
nucleic acid sequence significantly different from that shown in
SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO: 10,
SEQ ID NO: 11, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID
NO:21, SEQ ID NO:27, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:100, SEQ
ID NO:102, SEQ ID NO: 104, and SEQ ID NO: 106. The encoded amino
acid sequence thereof would, however, be preserved.
[0130] In addition, the nucleic acid sequence may comprise a
nucleotide sequence which results from the addition, deletion or
substitution of at least one nucleotide to the 5'-end and/or the
3'-end of the nucleic acid formula shown in SEQ ID NO: 1, SEQ ID
NO:2, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID
NO:17, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:27, SEQ
ID NO:96, SEQ ID NO:98, SEQ ID NO:100, SEQ ID NO:102, SEQ ID
NO:104, or SEQ ID NO:106, or a derivative thereof. Any nucleotide
or polynucleotide may be used in this regard, provided that its
addition, deletion or substitution does not alter the amino acid
sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:13,
SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:22, SEQ ID
NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:97, SEQ ID NO:99, SEQ
ID NO:101, SEQ ID NO:103, SEQ ID NO:105, or SEQ ID NO:107, which is
encoded by the nucleotide sequence. For example, the present
invention is intended to include any nucleic acid sequence
resulting from the addition of ATG as an initiation codon at the
5'-end of the inventive nucleic acid sequence or its derivative, or
from the addition of TTA, TAG or TGA as a termination codon at the
3'-end of the inventive nucleotide sequence or its derivative.
Moreover, the nucleic acid molecule of the present invention may,
as necessary, have restriction endonuclease recognition sites added
to its 5'-end and/or 3'-end.
[0131] Such functional alterations of a given nucleic acid sequence
afford an opportunity to promote secretion and/or processing of
heterologous proteins encoded by foreign nucleic acid sequences
fused thereto. All variations of the nucleotide sequence of the
kinase genes of the invention and fragments thereof permitted by
the genetic code are, therefore, included in this invention.
[0132] Further, it is possible to delete codons or to substitute
one or more codons with codons other than degenerate codons to
produce a structurally modified polypeptide, but one which has
substantially the same utility or activity as the polypeptide
produced by the unmodified nucleic acid molecule. As recognized in
the art, the two polypeptides are functionally equivalent, as are
the two nucleic acid molecules that give rise to their production,
even though the differences between the nucleic acid molecules are
not related to the degeneracy of the genetic code.
[0133] Mammalian STLK2
[0134] The full-length human STLK2 cDNA (SEQ ID NO: 1) is 3268 bp
long and consists of a 1248 bp open reading frame (ORF) flanked by
a 181 bp 5' untranslated region (UTR; 1-181) and a 1784 bp 3' UTR
(1433-3216) that is followed by a 52 nucleotide polyadenylated
region. A polyadenylation signal (AATAAA) is found at positions
(3193-3198). The sequence flanking the first ATG conforms to the
Kozak consensus (Kozak, M., Nucleic Acids Res. 15, 8125-8148
(1987)) for an initiating methionine, and is believed to be the
translational start site for STLK2. Furthermore, human STLK2 and
the related SOK-1 and MST3 proteins conserve the amino acid
sequence immediately following this presumed initiating
methionine.
[0135] Several EST fragments span the complete STLK2 sequence with
AA191319 at the 5' end and W16504 at the 3' end.
[0136] Mammalian STLK3
[0137] The partial human STLK3 cDNA (SEQ ID NO:2) is 3030 bp long
and consists of a 1548 bp ORF flanked by a 1476 bp 3' UTR
(1550-3025) and a 5 nucleotide polyadenylated region. A potential
polyadenylation signal (AATAAA) begins at position 3004. Since the
coding region is open throughout the 5' extent of this sequence,
this is apparently a partial cDNA clone lacking the N-terminal
start methionine.
[0138] Multiple EST fragments span the complete STLK3 sequence with
AA278967 at the 5' end and AA628477 and others at the 3' end.
[0139] Mammalian STLK4
[0140] The partial human STLK4 cDNA (SEQ ID NO:3) is 3857 bp long
and consists of a 1242 bp ORF flanked by a 2596 bp 3' UTR
(1244-3839) and an 18 nucleotide polyadenylated region. A potential
polyadenylation signal (AATAAA) is found at positions 2181-3822.
Since the coding region is open throughout the 5' extent of this
sequence, this is apparently a partial cDNA clone lacking the
N-terminal start methionine. A near full-length murine STLK4 cDNA
is represented in the 1773 bp EST AA117438. It extends an
additional 21 nucleotides 5' of the human STLK4 consensus, but
since its coding region is open throughout the 5' extent of the
sequence, this is also apparently a partial cDNA clone lacking the
N-terminal start methionine.
[0141] Several EST fragments span the complete STLK3 sequence with
AA297759 at the 5' end and AA100484 and others at the 3' end.
[0142] Mammalian STLK5
[0143] The full-length human STLK5 cDNA (SEQ ID NO:96) is 2110 bp
long and consists of a 1119 bp ORF flanked by a 229 bp 5' UTR and a
762 bp 3' UTR. The sequence flanking the first ATG conforms to the
Kozak consensus (supra) for an initiating methionine, and is
believed to be the translational start site for STLK5. Several EST
fragments span the complete STLK5 sequence with AA297059 and F07734
at the 5' end, and R46686 and F03423 and others at the 3' end.
[0144] Mammalian STLK6
[0145] The full-length human STLK6 cDNA (SEQ ID NO:98) is 2,001 bp
long and consists of a 1,254 bp ORF flanked by a 75 bp 5' UTR and a
673 bp 3' UTR. The sequence flanking the first ATG conforms to the
Kozak consensus (supra) for an initiating methionine, and is
believed to be the translational start site for STLK6.
[0146] Mammalian STLK7
[0147] The partial human STLK7 cDNA (SEQ ID NO: 100) is 311 bp long
and consists of a 309 bp ORF. Since the coding region is open
throughout both the 5' and 3' extent of this sequence, this is
apparently a partial cDNA clone lacking the N-terminal start
methionine and C-terminal stop codon.
[0148] Mammalian ZC1
[0149] The full-length human ZC1 cDNA (SEQ ID NO:9) is 3798 bp long
and consists of a 3717 bp ORF (7-3723) flanked by a 6 bp 5' UTR and
a 75 bp (3724-3798) 3' UTR. No polyadenylation signal (AATAAA) or
polyadenylated region are present in the 3' UTR. The sequence
flanking the first ATG conforms to the Kozak consensus for an
initiating methionine, and is believed to be the translational
start site for human ZC1.
[0150] Multiple EST fragments (W81656) match the 3' end of the
human ZC1 gene, but at the time of filing, the inventors believe
that none exist in GenBank or the EST database that match its 5'
end.
[0151] Mammalian ZC2
[0152] The partial human ZC2 cDNA (SEQ ID NO:10) is 4055 bp long
and consists of a 3891 bp ORF (1-3891) and a 164 bp (3892-4055) 3'
UTR. Since the coding region is open throughout the 5' extent of
this sequence, this is apparently a partial cDNA clone lacking the
N-terminal start methionine. No polyadenylation signal (AATAAA) or
polyadenylated region are present in the 3' UTR.
[0153] Multiple EST fragments (R51245) match the 3' end of the
human ZC2 gene, but at the time of filing, the inventors believe
that none exist in GenBank or the EST database that match its 5'
end.
[0154] Mammalian ZC3
[0155] The partial human ZC3 cDNA (SEQ ID NO:11) is 4133 bp long
and consists of a 3978 bp ORF (1-3978) and a 152 bp (3979-4133) 3'
UTR region. Since the coding region is open throughout the 5'
extent of this sequence, this is apparently a partial cDNA clone
lacking the N-terminal start methionine. No polyadenylation signal
(AATAAA) or polyadenylated region are present in the 3' UTR.
[0156] Multiple EST fragments (R54563) match the 3' end of the
human ZC3 gene, but at the time of filing, the inventors believe
that none exist in GenBank or the EST database that match its 5'
end.
[0157] Mammalian ZC4
[0158] The full-length human ZC4 cDNA (SEQ ID NO:104) is 3,684 bp
long and was originally assembled from X chromosome genomic DNA
sequence.
[0159] Multiple EST fragments (R98571) match the 3' end of the
human ZC4 gene, but at the time of filing, the inventors believe
that none exist in GenBank or the EST database that match its 5'
end. ZC4 gene is also contained within the human genomic clone
Z83850.
[0160] Mammalian KHS2
[0161] The full-length human KHS2 cDNA (SEQ ID NO:17) is 4023 bp
long and consists of a 2682 bp ORF (6-2687) flanked by a 5 bp (1-5)
5'UTR and a 1336 bp (2688-4023) 3' UTR. A potential polyadenylation
signal (AATAAA) is found at positions 4008-4013. No polyadenylated
region is present in the 3'UTR. The sequence flanking the first ATG
conforms to the Kozak consensus for an initiating methionine, and
is believed to be the translational start site for human KHS2.
[0162] Multiple EST fragments match the 5'end (AA446022) as well as
the 3' end (R37625) of the human KHS2 gene.
[0163] Mammalian SULU1
[0164] The full-length human SULU1 cDNA (SEQ ID NO:19) is 4177 bp
long and consists of a 2694 bp ORF (415-3108) flanked by a 414 bp
(1-414) 5'UTR and a 1069 bp (3109-4177) 3' UTR followed by a 19
nucleotide polydenylated region. A potential polyadenylation signal
(AATAAA) is found at positions 4164-4169. The sequence flanking the
first ATG conforms to the Kozak consensus for an initiating
methionine, and is believed to be the translational start site for
human SULU1.
[0165] Multiple EST fragments match the 5'end (N27153) as well as
the 3' end (R90908) of the human SULU1 gene.
[0166] Mammalian (Murine) SULU3
[0167] The partial murine SULU3 cDNA (SEQ ID NO:21) is 2249 bp long
and consists of a 2244 bp ORF (6-2249) flanked by a 5 bp (1-5)
5'UTR. The sequence flanking the first ATG conforms to the Kozak
consensus for an initiating methionine, and is believed to be the
translational start site for murine SULU3. The 3' end of the murine
SULU3 cDNA shares 90% DNA sequence identity over 1620 nucleotides
with human SULU3, suggesting that these two genes are functional
orthologues.
[0168] One EST fragment (AA446022) matches the 3' end of the
partial murine SULU3 gene, but at the time of filing, the inventors
believe that none exist in GenBank or the EST database that match
its 5' end.
[0169] Mammalian (Human) SULU3
[0170] The partial human SULU3 cDNA (SEQ ID NO:20) is 3824 bp long
and consists of a 2358 bp ORF (2-2359) flanked by a 1465 bp
(2360-3824) 3' UTR followed by a 19 nucleotide polydenylated
region. A potential polyadenylation signal (AATAAA) is found at
positions 2602-2607. Since the coding region is open throughout the
5' extent of this sequence, this is apparently a partial cDNA clone
lacking the N-terminal start methionine. The 5' end of the human
SULU3 cDNA shares 90% DNA sequence identity over 1620 nucleotides
with murine SULU3, suggesting that these two genes are functional
orthologues.
[0171] Multiple EST fragments (R02283) match the 3'end of the human
SULU3 gene, but at the time of filing, the inventors believe that
none exist in GenBank or the EST database that match its 5'
end.
[0172] Mammalian GEK2
[0173] The full-length human GEK2 cDNA (SEQ ID NO:106) is 2962 bp
long and consists of a 2737 bp ORF (59-2795) flanked by a 58 bp
(1-58) 5'UTR. The sequence flanking the first ATG conforms to the
Kozak consensus for an initiating methionine, and is believed to be
the translational start site for human GEK2.
[0174] Multiple EST fragments (AA465671) match the 5'end, but at
the time of filing, the inventors believe that only one (AA380492)
matches the 3' end of the human GEK2 gene.
[0175] Mammalian PAK4
[0176] The full-length human PAK4 cDNA (SEQ ID NO:27) is 3604 bp
long and consists of a 2043 bp ORF (143-2185) flanked by a 142 bp
(1-142) 5'UTR and a 1419 3'UTR followed by a 22 nucleotide
polydenylated region. A potential polyadenylation signal (AATTAAA)
is found at positions 3582-3588. The sequence flanking the first
ATG conforms to the Kozak consensus for an initiating methionine,
and is believed to be the translational start site for human
PAK4.
[0177] Multiple EST fragments (AA535791) match the 3'end of the
human PAK4 gene, but at the time of filing, the inventors believe
that none exist in GenBank or the EST database that match its 5'
end.
[0178] Mammalian PAK5
[0179] The full-length human PAK5 cDNA (SEQ ID NO:102) is 2806 bp
long and consists of a 1773 bp ORF flanked by a 201 bp 5' UTR and a
833 bp 3' UTR. The sequence flanking the first ATG conforms to the
Kozak consensus (supra) for an initiating methionine, and is
believed to be the translational start site for PAK5.
[0180] Multiple EST fragments (AA442867) match the 3'end of the
human PAK5 gene, but at the time of filing, the inventors believe
that none exist in GenBank or the EST database that match its 5'
end.
[0181] II. Nucleic Acid Probes, Methods, and Kits for Detection of
STE20-Related Kinases.
[0182] A nucleic acid probe of the present invention may be used to
probe an appropriate chromosomal or cDNA library by usual
hybridization methods to obtain other nucleic acid molecules of the
present invention. A chromosomal DNA or cDNA library may be
prepared from appropriate cells according to recognized methods in
the art (cf. "Molecular Cloning: A Laboratory Manual", second
edition, Cold Spring Harbor Laboratory, Sambrook, Fritsch, &
Maniatis, eds., 1989).
[0183] In the alternative, chemical synthesis can be carried out in
order to obtain nucleic acid probes having nucleotide sequences
which correspond to N-terminal and C-terminal portions of the amino
acid sequence of the polypeptide of interest. The synthesized
nucleic acid probes may be used as primers in a polymerase chain
reaction (PCR) carried out in accordance with recognized PCR
techniques, essentially according to PCR Protocols, "A Guide to
Methods and Applications", Academic Press, Michael, et al., eds.,
1990, utilizing the appropriate chromosomal or cDNA library to
obtain the fragment of the present invention.
[0184] One skilled in the art can readily design such probes based
on the sequence disclosed herein using methods of computer
alignment and sequence analysis known in the art ("Molecular
Cloning: A Laboratory Manual", 1989, supra). The hybridization
probes of the present invention can be labeled by standard labeling
techniques such as with a radiolabel, enzyme label, fluorescent
label, biotin-avidin label, chemiluminescence, and the like. After
hybridization, the probes may be visualized using known
methods.
[0185] The nucleic acid probes of the present invention include
RNA, as well as DNA probes, such probes being generated using
techniques known in the art. The nucleic acid probe may be
immobilized on a solid support. Examples of such solid supports
include, but are not limited to, plastics such as polycarbonate,
complex carbohydrates such as agarose and sepharose, and acrylic
resins, such as polyacrylamide and latex beads. Techniques for
coupling nucleic acid probes to such solid supports are well known
in the art.
[0186] The test samples suitable for nucleic acid probing methods
of the present invention include, for example, cells or nucleic
acid extracts of cells, or biological fluids. The samples used in
the above-described methods will vary based on the assay format,
the detection method and the nature of the tissues, cells or
extracts to be assayed. Methods for preparing nucleic acid extracts
of cells are well known in the art and can be readily adapted in
order to obtain a sample which is compatible with the method
utilized.
[0187] One method of detecting the presence of nucleic acids of the
invention in a sample comprises (a) contacting said sample with the
above-described nucleic acid probe under conditions such that
hybridization occurs, and (b) detecting the presence of said probe
bound to said nucleic acid molecule. One skilled in the art would
select the nucleic acid probe according to techniques known in the
art as described above. Samples to be tested include but should not
be limited to RNA samples of human tissue.
[0188] A kit for detecting the presence of nucleic acids of the
invention in a sample comprises at least one container means having
disposed therein the above-described nucleic acid probe. The kit
may further comprise other containers comprising one or more of the
following: wash reagents and reagents capable of detecting the
presence of bound nucleic acid probe. Examples of detection
reagents include, but are not limited to radiolabelled probes,
enzymatic labeled probes (horseradish peroxidase, alkaline
phosphatase), and affinity labeled probes (biotin, avidin, or
steptavidin).
[0189] In detail, a compartmentalized kit includes any kit in which
reagents are contained in separate containers. Such containers
include small glass containers, plastic containers or strips of
plastic or paper. Such containers allow the efficient transfer of
reagents from one compartment to another compartment such that the
samples and reagents are not cross-contaminated and the agents or
solutions of each container can be added in a quantitative fashion
from one compartment to another. Such containers will include a
container which will accept the test sample, a container which
contains the probe or primers used in the assay, containers which
contain wash reagents (such as phosphate buffered saline,
Tris-buffers, and the like), and containers which contain the
reagents used to detect the hybridized probe, bound antibody,
amplified product, or the like. One skilled in the art will readily
recognize that the nucleic acid probes described in the present
invention can readily be incorporated into one of the established
kit formats which are well known in the art.
[0190] III. DNA Constructs Comprising a STE20-Related Nucleic Acid
Molecule and Cells Containing These Constructs.
[0191] The present invention also relates to a recombinant DNA
molecule comprising, 5' to 3', a promoter effective to initiate
transcription in a host cell and the above-described nucleic acid
molecules. In addition, the present invention relates to a
recombinant DNA molecule comprising a vector and an above-described
nucleic acid molecule. The present invention also relates to a
nucleic acid molecule comprising a transcriptional region
functional in a cell, a sequence complementary to an RNA sequence
encoding an amino acid sequence corresponding to the
above-described polypeptide, and a transcriptional termination
region functional in said cell. The above-described molecules may
be isolated and/or purified DNA molecules.
[0192] The present invention also relates to a cell or organism
that contains an above-described nucleic acid molecule and thereby
is capable of expressing a polypeptide. The polypeptide may be
purified from cells which have been altered to express the
polypeptide. A cell is said to be "altered to express a desired
polypeptide" when the cell, through genetic manipulation, is made
to produce a protein which it normally does not produce or which
the cell normally produces at lower levels. One skilled in the art
can readily adapt procedures for introducing and expressing either
genomic, cDNA, or synthetic sequences into either eukaryotic or
prokaryotic cells.
[0193] A nucleic acid molecule, such as DNA, is said to be "capable
of expressing" a polypeptide if it contains nucleotide sequences
which contain transcriptional and translational regulatory
information and such sequences are "operably linked"0 to nucleotide
sequences which encode the polypeptide. An operable linkage is a
linkage in which the regulatory DNA sequences and the DNA sequence
sought to be expressed are connected in such a way as to permit
gene sequence expression. The precise nature of the regulatory
regions needed for gene sequence expression may vary from organism
to organism, but shall in general include a promoter region which,
in prokaryotes, contains both the promoter (which directs the
initiation of RNA transcription) as well as the DNA sequences
which, when transcribed into RNA, will signal synthesis initiation.
Such regions will normally include those 5'-non-coding sequences
involved with initiation of transcription and translation, such as
the TATA box, capping sequence, CAAT sequence, and the like.
[0194] If desired, the non-coding region 3' to the sequence
encoding a kinase of the invention may be obtained by the
above-described methods. This region may be retained for its
transcriptional termination regulatory sequences, such as
termination and polyadenylation. Thus, by retaining the 3'-region
naturally contiguous to the DNA sequence encoding a kinase of the
invention, the transcriptional termination signals may be provided.
Where the transcriptional termination signals are not
satisfactorily functional in the expression host cell, then a 3'
region functional in the host cell may be substituted.
[0195] Two DNA sequences (such as a promoter region sequence and a
sequence encoding a kinase of the invention) are said to be
operably linked if the nature of the linkage between the two DNA
sequences does not (1) result in the introduction of a frame-shift
mutation, (2) interfere with the ability of the promoter region
sequence to direct the transcription of a gene sequence encoding a
kinase of the invention, or (3) interfere with the ability of the
gene sequence of a kinase of the invention to be transcribed by the
promoter region sequence. Thus, a promoter region would be operably
linked to a DNA sequence if the promoter were capable of effecting
transcription of that DNA sequence. Thus, to express a gene
encoding a kinase of the invention, transcriptional and
translational signals recognized by an appropriate host are
necessary.
[0196] The present invention encompasses the expression of a gene
encoding a kinase of the invention (or a functional derivative
thereof) in either prokaryotic or eukaryotic cells. Prokaryotic
hosts are, generally, very efficient and convenient for the
production of recombinant proteins and are, therefore, one type of
preferred expression system for kinases of the invention.
Prokaryotes most frequently are represented by various strains of
E. Coli. However, other microbial strains may also be used,
including other bacterial strains.
[0197] In prokaryotic systems, plasmid vectors that contain
replication sites and control sequences derived from a species
compatible with the host may be used. Examples of suitable plasmid
vectors may include pBR322, pUC118, pUC 119 and the like; suitable
phage or bacteriophage vectors may include .gamma.gt10, .gamma.gt11
and the like; and suitable virus vectors may include pMAM-neo, pKRC
and the like. Preferably, the selected vector of the present
invention has the capacity to replicate in the selected host
cell.
[0198] Recognized prokaryotic hosts include bacteria such as E.
coli, Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia,
and the like. However, under such conditions, the polypeptide will
not be glycosylated. The prokaryotic host must be compatible with
the replicon and control sequences in the expression plasmid.
[0199] To express a kinase of the invention (or a functional
derivative thereof) in a prokaryotic cell, it is necessary to
operably link the sequence encoding the kinase of the invention to
a functional prokaryotic promoter. Such promoters may be either
constitutive or, more preferably, regulatable (i.e., inducible or
derepressible). Examples of constitutive promoters include the int
promoter of bacteriophage .lambda., the bla promoter of the
.beta.-lactamase gene sequence of pBR322, and the cat promoter of
the chloramphenicol acetyl transferase gene sequence of pPR325, and
the like. Examples of inducible prokaryotic promoters include the
major right and left promoters of bacteriophage .lambda.(P.sub.L
and P.sub.R), the trp, recA, .lambda.acZ, .lambda.acI, and gal
promoters of E. coli, the .alpha.-amylase (Ulmanen et al., J.
Bacteriol. 162:176-182, 1985) and the c-28-specific promoters of B.
subtilis (Gilman et al., Gene Sequence 32:11-20, 1984), the
promoters of the bacteriophages of Bacillus (Gryczan, In: The
Molecular Biology of the Bacilli, Academic Press, Inc., NY, 1982),
and Streptomyces promoters (Ward et al., Mol. Gen. Genet.
203:468-478, 1986). Prokaryotic promoters are reviewed by Glick
(Ind. Microbiot. 1:277-282, 1987), Cenatiempo (Biochimie
68:505-516, 1986), and Gottesman (Ann. Rev. Genet. 18:415-442,
1984).
[0200] Proper expression in a prokaryotic cell also requires the
presence of a ribosome-binding site upstream of the gene
sequence-encoding sequence. Such ribosome-binding sites are
disclosed, for example, by Gold et al. (Ann. Rev. Microbiol.
35:365-404, 1981). The selection of control sequences, expression
vectors, transformation methods, and the like, are dependent on the
type of host cell used to express the gene. As used herein, "cell",
"cell line", and "cell culture" may be used interchangeably and all
such designations include progeny. Thus, the words "transformants"
or "transformed cells" include the primary subject cell and
cultures derived therefrom, without regard to the number of
transfers. It is also understood that all progeny may not be
precisely identical in DNA content, due to deliberate or
inadvertent mutations. However, as defined, mutant progeny have the
same functionality as that of the originally transformed cell.
[0201] Host cells which may be used in the expression systems of
the present invention are not strictly limited, provided that they
are suitable for use in the expression of the kinase polypeptide of
interest. Suitable hosts may often include eukaryotic cells.
Preferred eukaryotic hosts include, for example, yeast, fungi,
insect cells, mammalian cells either in vivo, or in tissue culture.
Mammalian cells which may be useful as hosts include HeLa cells,
cells of fibroblast origin such as VERO or CHO-K1, or cells of
lymphoid origin and their derivatives. Preferred mammalian host
cells include SP2/0 and J558L, as well as neuroblastoma cell lines
such as IMR 332, which may provide better capacities for correct
post-translational processing.
[0202] In addition, plant cells are also available as hosts, and
control sequences compatible with plant cells are available, such
as the cauliflower mosaic virus 35S and 19S, and nopaline synthase
promoter and polyadenylation signal sequences. Another preferred
host is an insect cell, for example the Drosophila larvae. Using
insect cells as hosts, the Drosophila alcohol dehydrogenase
promoter can be used (Rubin, Science 240:1453-1459, 1988).
Alternatively, baculovirus vectors can be engineered to express
large amounts of kinases of the invention in insect cells (Jasny,
Science 238:1653, 1987; Miller et al., In: Genetic Engineering,
Vol. 8, Plenum, Setlow et al., eds., pp. 277-297, 1986).
[0203] Any of a series of yeast expression systems can be utilized
which incorporate promoter and termination elements from the
actively expressed sequences coding for glycolytic enzymes that are
produced in large quantities when yeast are grown in mediums rich
in glucose. Known glycolytic gene sequences can also provide very
efficient transcriptional control signals. Yeast provides
substantial advantages in that it can also carry out
post-translational modifications. A number of recombinant DNA
strategies exist utilizing strong promoter sequences and high copy
number plasmids which can be utilized for production of the desired
proteins in yeast. Yeast recognizes leader sequences on cloned
mammalian genes and secretes peptides bearing leader sequences
(i.e., pre-peptides). Several possible vector systems are available
for the expression of kinases of the invention in a mammalian
host.
[0204] A wide variety of transcriptional and translational
regulatory sequences may be employed, depending upon the nature of
the host. The transcriptional and translational regulatory signals
may be derived from viral sources, such as adenovirus, bovine
papilloma virus, cytomegalovirus, simian virus, or the like, where
the regulatory signals are associated with a particular gene
sequence which has a high level of expression. Alternatively,
promoters from mammalian expression products, such as actin,
collagen, myosin, and the like, may be employed. Transcriptional
initiation regulatory signals may be selected which allow for
repression or activation, so that expression of the gene sequences
can be modulated. Of interest are regulatory signals which are
temperature-sensitive so that by varying the temperature,
expression can be repressed or initiated, or are subject to
chemical (such as metabolite) regulation.
[0205] Expression of kinases of the invention in eukaryotic hosts
requires the use of eukaryotic regulatory regions. Such regions
will, in general, include a promoter region sufficient to direct
the initiation of RNA synthesis. Preferred eukaryotic promoters
include, for example, the promoter of the mouse metallothionein I
gene sequence (Hamer et al., J. Mol. Appl. Gen. 1:273-288, 1982);
the TK promoter of Herpes virus (McKnight, Cell 31:355-365, 1982);
the SV40 early promoter (Benoist et al., Nature (London)
290:304-31, 1981); and the yeast gal4 gene sequence promoter
(Johnston et al., Proc. Natl. Acad. Sci. (USA) 79:6971-6975, 1982;
Silver et al., Proc. Natl. Acad. Sci. (USA) 81:5951-5955,
1984).
[0206] Translation of eukaryotic mRNA is initiated at the codon
which encodes the first methionine. For this reason, it is
preferable to ensure that the linkage between a eukaryotic promoter
and a DNA sequence which encodes a kinase of the invention (or a
functional derivative thereof) does not contain any intervening
codons which are capable of encoding a methionine (i.e., AUG). The
presence of such codons results either in the formation of a fusion
protein (if the AUG codon is in the same reading frame as the
kinase of the invention coding sequence) or a frame-shift mutation
(if the AUG codon is not in the same reading frame as the kinase of
the invention coding sequence).
[0207] A nucleic acid molecule encoding a kinase of the invention
and an operably linked promoter may be introduced into a recipient
prokaryotic or eukaryotic cell either as a nonreplicating DNA or
RNA molecule, which may either be a linear molecule or, more
preferably, a closed covalent circular molecule. Since such
molecules are incapable of autonomous replication, the expression
of the gene may occur through the transient expression of the
introduced sequence. Alternatively, permanent expression may occur
through the integration of the introduced DNA sequence into the
host chromosome.
[0208] A vector may be employed which is capable of integrating the
desired gene sequences into the host cell chromosome. Cells which
have stably integrated the introduced DNA into their chromosomes
can be selected by also introducing one or more markers which allow
for selection of host cells which contain the expression vector.
The marker may provide for prototrophy to an auxotrophic host,
biocide resistance, e.g., antibiotics, or heavy metals, such as
copper, or the like. The selectable marker gene sequence can either
be directly linked to the DNA gene sequences to be expressed, or
introduced into the same cell by co-transfection. Additional
elements may also be needed for optimal synthesis of mRNA. These
elements may include splice signals, as well as transcription
promoters, enhancers, and termination signals. cDNA expression
vectors incorporating such elements include those described by
Okayama (Mol. Cell. Biol. 3:280-, 1983).
[0209] The introduced nucleic acid molecule can be incorporated
into a plasmid or viral vector capable of autonomous replication in
the recipient host. Any of a wide variety of vectors may be
employed for this purpose. Factors of importance in selecting a
particular plasmid or viral vector include: the ease with which
recipient cells that contain the vector may be recognized and
selected from those recipient cells which do not contain the
vector; the number of copies of the vector which are desired in a
particular host; and whether it is desirable to be able to
"shuttle" the vector between host cells of different species.
[0210] Preferred prokaryotic vectors include plasmids such as those
capable of replication in E. coli (such as, for example, pBR322,
ColE1, pSC101, pACYC 184, .quadrature.VX; "Molecular Cloning: A
Laboratory Manual", 1989, supra). Bacillus plasmids include pC194,
pC221, pT127, and the like (Gryczan, In: The Molecular Biology of
the Bacilli, Academic Press, NY, pp. 307-329, 1982). Suitable
Streptomyces plasmids include plJ101 (Kendall et al., J. Bacteriol.
169:4177-4183, 1987), and streptomyces bacteriophages such as
.quadrature.C31 (Chater et al., In: Sixth International Symposium
on Actinomycetales Biology, Akademiai Kaido, Budapest, Hungary, pp.
45-54, 1986). Pseudomonas plasmids are reviewed by John et al.
(Rev. Infect. Dis. 8:693-704, 1986), and Izaki (Jpn. J. Bacteriol.
33:729-742, 1978).
[0211] Preferred eukaryotic plasmids include, for example, BPV,
vaccinia, SV40, 2-micron circle, and the like, or their
derivatives. Such plasmids are well known in the art (Botstein et
al., Miami Wntr. Symp. 19:265-274, 1982; Broach, In: "The Molecular
Biology of the Yeast Saccharomyces: Life Cycle and Inheritance",
Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, p. 445-470,
1981; Broach, Cell 28:203-204, 1982; Bollon et al., J. Clin.
Hematol. Oncol. 10:39-48, 1980; Maniatis, In: Cell Biology: A
Comprehensive Treatise, Vol. 3, Gene Sequence Expression, Academic
Press, NY, pp. 563-608, 1980).
[0212] Once the vector or nucleic acid molecule containing the
construct(s) has been prepared for expression, the DNA construct(s)
may be introduced into an appropriate host cell by any of a variety
of suitable means, i.e., transformation, transfection, conjugation,
protoplast fusion, electroporation, particle gun technology,
calcium phosphate-precipitation, direct microinjection, and the
like. After the introduction of the vector, recipient cells are
grown in a selective medium, which selects for the growth of
vector-containing cells. Expression of the cloned gene(s) results
in the production of a kinase of the invention, or fragments
thereof. This can take place in the transformed cells as such, or
following the induction of these cells to differentiate (for
example, by administration of bromodeoxyuracil to neuroblastoma
cells or the like). A variety of incubation conditions can be used
to form the peptide of the present invention. The most preferred
conditions are those which mimic physiological conditions.
[0213] IV. The Proteins of the Invention
[0214] A variety of methodologies known in the art can be utilized
to obtain the polypeptides of the present invention. The
polypeptides may be purified from tissues or cells that naturally
produce the polypeptides. Alternatively, the above-described
isolated nucleic acid fragments could be used to express the
kinases of the invention in any organism. The samples of the
present invention include cells, protein extracts or membrane
extracts of cells, or biological fluids. The samples will vary
based on the assay format, the detection method, and the nature of
the tissues, cells or extracts used as the sample.
[0215] Any eukaryotic organism can be used as a source for the
polypeptides of the invention, as long as the source organism
naturally contains such polypeptides. As used herein, "source
organism" refers to the original organism from which the amino acid
sequence of the subunit is derived, regardless of the organism the
subunit is expressed in and ultimately isolated from.
[0216] One skilled in the art can readily follow known methods for
isolating proteins in order to obtain the polypeptides free of
natural contaminants. These include, but are not limited to:
size-exclusion chromatography, HPLC, ion-exchange chromatography,
and immuno-affinity chromatography.
[0217] Mammalian STLK2
[0218] Analysis of the deduced amino acid sequence predicts STLK2
to be an intracellular serine/threonine kinase, lacking both a
signal sequence and transmembrane domain. STLK2 contains a 21 amino
acid N-terminal domain, a 253 amino acid catalytic domain with all
the motifs characteristic of a serine/threonine kinase, followed by
a 142 amino acid C-terminal domain.
[0219] STLK2 is most closely related to human STE20-subfamily
kinases, MST3 (GB:AF024636) and SOK-1 (GB:X99325) and a C. elegans
kinase yk34b11.5 (GB:U53153) sharing 72.7%, 68.7%, and 69.3% amino
acid identity, respectively.
[0220] The 21 amino acid N-terminal domain of human STLK2 is 71.4%
identical to the N-terminus of MST3 (GB:AF024636). Human STLK2
lacks a glycine residue at position 2, and is therefore unlikely to
undergo myristylation. A Smith-Waterman search of the nonredundant
protein database does not reveal any significant homologies that
might suggest a potential function for this domain.
[0221] The 253 amino acid catalytic domain of human STLK2 is most
related to human SOK-1 (X99325), MST3 (GB:AF024636), C. elegans
yk32b11.5 (GB:U53153), and STLK3 (SEQ ID NO:6) sharing 88.9%,
87.4%, 78.3%, and 49% amino identity respectively, placing it in
the STLK-subfamily of STE20-related kinases. The STLK2 kinase
domain displayed lesser homology to other STE20-related kinases
including: 55.9% to human MST2 (GB:U26424), 49.2% to human GCK
(GB:U07349), 49.2% to human KHS1 (GB:U77129), and 44.2% to human
HPK1 (GB:U66464). The activation loop of human STLK2 catalytic
domain is identical to that of human SOK-1 and MST3 including the
presence of four potential threonine phosphorylation sites that
could serve an autoregulatory role on kinase activity.
[0222] The 142 amino acid C-terminal domain of human STLK2 is most
related to human SOK-1 (X99325), MST3 (GB:AF024636), and C. elegans
yk32b11.5 (GB:U53153), sharing 39.9%, 39.9%, and 33.3% amino acid
identity, respectively. This C-terminal domain shares some
significant amino acid similarity to the C-terminal domains of the
related human STLK3 (SEQ ID NO:6) and STLK4 (SEQ ID NO:7).
[0223] The C-terminus of the related human SOK-1 (GB:X99325) kinase
has been shown to be inhibitory to the catalytic activity of this
kinase (Pombo, C. M., Bonventre, J. V., Molnar, A., Kyriakis, J.
and Force, T. EMBO J. 15, 4537-4546 (1996)). Based on the sequence
identity between the C-termini of human SOK-1 (GB:X99325) and human
STLK2 (39.2%), the C-terminus of human STLK2 may also function as
an inhibitory domain for its kinase.
[0224] Mammalian STLK3
[0225] The 3030 bp human STLK3 nucleotide sequence of the partial
cDNA clone encodes a polypeptide of 516 amino acids (SEQ ID NO:6)
with a predicted molecular mass of 56,784 daltons. Analysis of the
deduced amino acid sequence predicts STLK3 to be an intracellular
serine/threonine kinase, lacking both a signal sequence and
transmembrane domain, however the cDNA clone lacks an initiating
ATG, so the full extent of it N-termius is not known. STLK3
contains a 31 amino acid N-terminal domain, a 277 amino acid
catalytic domain with all the motifs characteristic of a
serine/threonine kinase, followed by a 181 amino acid C-terminal
domain containing a 25 amino acid insert and a 27 amino acid tail
relative to the sequence of human STLK2.
[0226] STLK3 is most closely related to human STE20-subfamily
kinases, STLK4 (SEQ ID. NO:7), MST3 (GB:AF024636), SOK-1
(GB:X99325) and STLK2 (SEQ ID NO:5) sharing 71.1%, 37.6%, 38.1%,
and 38.4% amino acid identity respectively.
[0227] The 31 amino acid N-terminal domain of human STLK3 lacked
any significant amino acid sequence homologies using a
Smith-Waterman search of the nonredundant protein database, other
than sequence similarity to proline-alanine repeats.
[0228] The 277 amino acid catalytic domain of human STLK3 is most
related to human STLK4 (SEQ ID NO:7), SOK-1 (GB:X99325), MST3
(GB:AF024636), and STLK2 (SEQ ID NO:5) sharing 88.2%, 49.2%, 49%,
and 49% amino acid identity, respectively. It also shares strong
homology to other STKs from lower organisms including 51.7% to A.
thaliana (GB: AC002343), 43.1% to A. thaliana (GB: Z97336), 42.1%
to A. thaliana (GB: U96613), and 43.3% to C. elegans (GB: U53153).
The activation loop of the human STLK3 catalytic domain conserves
three potential threonine phosphorylation sites with other members
of the STLK-subfamily of STE20-related kinases (human STE20, MST3,
STLK2, STLK4) that could serve an autoregulatory role on kinase
activity.
[0229] The 181 amino acid C-terminal domain of human STLK3 shares
55.5% amino acid identity to human STLK4 (SEQ ID NO:7), and is 100%
identical to a partial human cDNA DCHT (GB:AF017635). The
C-terminal domain of human STLK3 contains a 26 amino acid insert
relative to human STE20. A similar (87.5% amino acid identity) 26
amino acid insert is also present in human STLK4.
[0230] The 27 amino acid C-terminal tail of human STLK3 shares
77.8% amino acid identity to human STLK4, but is absent from other
STLK-family members. This high degree of homology between the
C-tail of two STLK-family members suggests they may be involved in
an as yet unidentified protein-protein interaction.
[0231] The weak sequence homology between the C-termini of human
STLK3 and STE20, suggests it may also function as an inhibitory
domain for its kinase.
[0232] Mammalian STLK4
[0233] The 3857 bp human STLK4 nucleotide sequence of the partial
cDNA clone encodes a polypeptide of 414 amino acids (SEQ ID NO:7)
with a predicted molecular mass of 45,451 daltons. Analysis of the
deduced amino acid sequence predicts STLK4 to be an intracellular
serine/threonine kinase, lacking both a signal sequence and
transmembrane domain, however the cDNA clone lacks an initiating
ATG, so the full extent of it N-terminus is not known. The partial
STLK4 protein sequence contains a 178 amino acid catalytic domain
corresponding to the C-terminal motifs VI-XI of a serine/threonine
kinase, followed by a 236 amino acid C-terminal domain containing
two inserts of 25 and 41 amino acids each, relative to the sequence
of human STLK2.
[0234] STLK4 is most closely related to human STE20-subfamily
kinases, STLK3 (SEQ ID. NO 6), MST3 (GB:AF024636), STLK2 (SEQ ID
NO:5), and SOK-1 (GB:X99325) sharing 71.0%, 46.8%, 43.9%, and 37.7%
amino acid identity, respectively.
[0235] The 178 amino acid catalytic domain of human STLK4 is most
related to human STLK3 (SEQ ID NO. 7), SOK-1 (GB:X99325), MST3
(GB:AF024636), STLK2 (SEQ ID NO:5), and MST1 (GB:U18297), sharing
88.2%, 54.2%, 54.0%, 53.7 and 45.7% amino acid identity,
respectively. It also shares strong homology to other STKs from
lower organisms including 56.9% to A. thaliana (GB: AC002343),
52.5% to C. elegans (GB: U53153), 46.2% to A. thaliana (GB: Z97336)
and 45.7% to A. thaliana (GB: U96613). The activation loop of the
human STLK4 catalytic domain conserves three potential threonine
phosphorylation sites with other members of the STLK-subfamily of
STE20-related kinases (human STE20, MST3, STLK2 and STLK3) that
could serve an autoregulatory role on kinase activity.
[0236] The 236 amino acid C-terminal domain of human STLK4 shares
58.1% amino acid identity to both human STLK3 (SEQ ID NO:6) and to
a partial human cDNA, DCHT (GB:AF017635). The C-terminal domain of
human STLK4 contains a 25 amino acid insert relative to human SOK-1
and shares 87.5% amino acid identity to an insert present in human
STLK3.
[0237] The weak sequence homology between the C-termini of human
STLK4 and STE20, suggests it may also function as an inhibitory
domain for its kinase.
[0238] Mammalian STLK5
[0239] The full-length 2110 bp human STLK5 cDNA encodes a
polypeptide of 373 amino acids (SEQ ID NO:97) with a predicted
molecular mass of 41,700 daltons. Analysis of the deduced amino
acid sequence predicts STLK5 to be an intracellular STE20-subfamily
kinase, lacking both a signal sequence and transmembrane domain.
STLK5 contains a 10 amino acid N-terminal domain, a 311 amino acid
catalytic domain with all the motifs characteristic of a
serine/threonine kinase, and a 52 amino acid C-terminal domain.
[0240] STLK5 is most closely related to the human STE20-subfamily
kinases STLK6 (SEQ ID No. 99) and SPAK (AFO99989), sharing 51% and
33% amino acid identity, respectively, over its full extent. It
also shares significant homology to database entries from
Arabidopsis thaliana (GB:AC002343) and C. elegans (GB:AL023843,
GB:AL023843).
[0241] The 10 amino acid N-terminal domain of human STLK5 does not
reveal any significant homologies to the protein database.
[0242] The 311 amino acid catalytic domain of human STLK5 shares
51% and 34% identity to STLK6 and SPAK, respectively. The catalytic
domain of STLK5 contains a 45 amino acid insert between kinase
subdomains X and XI relative to human STE20. Multiple human EST
fragments as well as a murine EST (GB:AA575647) contain this insert
providing evidence that this region is an integral part of
STLK5.
[0243] The 52 amino acid C-terminal tail of human STLK5 shares
41.3% amino acid identity to human SOK-1 (GB:X99325). The weak
sequence homology between the C-termini of human STLK5 and STE20,
suggests it may also function as an inhibitory domain for its
kinase.
[0244] Mammalian STLK6
[0245] The 2,001 bp human STLK6 nucleotide sequence of the complete
cDNA encodes a polypeptide of 418 amino acids (SEQ ID NO:99) with a
predicted molecular mass of 47,025 daltons. Analysis of the deduced
amino acid sequence predicts STLK6 to be an intracellular
STE20-subfamily kinase, lacking both a signal sequence and
transmembrane domain. STLK6 contains a 57 amino acid N-terminal
domain, a 312 amino acid catalytic domain with all the motifs
characteristic of a serine/threonine kinase, followed by a 49 amino
acid C-terminal domain.
[0246] STLK6 is most closely related to human STE20-subfamily
kinases STLK5 (SEQ ID NO:97), STLK7 (SEQ ID NO:101), and SPAK
(AFO99989), sharing 50%, 35%, and 30% amino acid identity over its
full extent. It also shares significant homology to database
entries from Arabidopsis thaliana (GB:AC002343) and C. elegans
(GB:U53153).
[0247] The 57 amino acid N-terminal domain of human STLK6 does not
reveal any significant homologies in the protein database.
[0248] The 312 amino acid catalytic domain of human STLK6 shares 51
and 30% identity to human STLK5 and SPAK, respectively.
[0249] The 49 amino acid C-terminal tail of human STLK6 shares low
amino acid sequence identity (29%) with STLK5 and SPAK.
[0250] Mammalian STLK7
[0251] The 311 bp human STLK7 nucleotide sequence of the partial
cDNA encodes a polypeptide of 103 amino acids (SEQ ID NO: 101).
Analysis of the deduced amino acid sequence predicts STLK7 to be an
internal fragment of an intracellular STE20-family kinase. This
sequence lacks the N- and C-terminal portions of STLK7 and contains
only the N-terminal 103 amino acids of the predicted catalytic
domain.
[0252] Human STLK7 is most closely related to human STE20-subfamily
kinases SPAK (AFO99989), STLK5 (SEQ ID NO:97), and STLK6 (SEQ ID
NO:99), sharing 86%, 38%, and 35% amino acid identity within this
region of the kinase domain. It also shares significant homology to
database entries from Arabidopsis thaliana (GB:AC002343) and
Drosophila melanogaster (GB:AF006640).
[0253] Mammalian ZC1
[0254] The 3798 bp human ZC1 nucleotide sequence encodes a
polypeptide of 1239 amino acids (SEQ ID NO: 13) with a predicted
molecular mass of 142,140 daltons. Analysis of the deduced amino
acid sequence predicts ZC1 to be an intracellular serine/threonine
kinase, lacking both a signal sequence and transmembrane domain.
The full-length ZC1 protein contains a 22 amino acid N-terminus, a
267 amino acid catalytic domain with all the motifs characteristic
of a serine/threonine kinase, a 237 amino acid region predicted to
form a coiled-coil structure, a 114 amino acid proline-rich region,
a 256 amino acid spacer region, followed by a 343 amino acid
C-terminal domain containing a potential Rab/Rho-binding
region.
[0255] ZC1 is most closely related to the human STE20-subfamily
kinases ZC2 (SEQ ID NO:14), ZC3 (SEQ ID NO:15), and ZC4 (SEQ ID
NO:16), sharing 61.7%, 60.9%, and 43.8% amino acid identity,
respectively. ZC1 also shares 45.5% amino acid identity to a C.
elegans kinase encoded by the cosmid ZC504.4 (GB:Z50029). ZC1
exhibits 90.0% amino acid homology to murine NIK (GB:U88984),
suggesting it may be the human orthologue of this STK.
[0256] The 22 amino acid N-terminal domain of human ZC1 is 58.8%
identical to the C. elegans kinase encoded by the cosmid ZC504.4
(GB:Z50029), and 100% identical to murine NIK (GB: U88984). Human
ZC1 lacks a glycine residue at position 2, and is therefore
unlikely to undergo myristylation. A Smith-Waterman search of the
nonredundant protein database does not reveal any significant
homologies that might suggest a potential function for this
domain.
[0257] The 267 amino acid catalytic domain of human ZC1 is most
related to human STE20-subfamily kinases, ZC3 (SEQ ID NO: 15), ZC2
(SEQ ID NO: 14), KHS2 (SEQ ID NO:18), SOK-1 (GB:X99325), GCK
(GB:U07349), and GEK2 (SEQ ID NO:107), and to the C. elegans kinase
encoded by the cosmid ZC504.4 (GB:Z50029) sharing 90.6%, 90.2%,
50.6%, 47.4%, 45.4%, 42.5% and 82.6% amino acid identity,
respectively. The ZC1 kinase domain shares 98.1% identity to murine
NIK (GB:U88984). ZC1 contains the potential "TPY" regulatory
phosphorylation site in its activation loop. This "TPY" motif is
conserved in other STE20-related kinases, including ZC2, ZC3, ZC4,
GEK2, KHS2, SULU1, SULU3, PAK4 and PAK5.
[0258] Immediately C-terminal to the kinase domain of human ZC1 is
a 237 amino acid region predicted to form a coiled-coil structure
based on the Lupas algorithm (Lupas, A. Meth. Enzymol. 266, 513-525
(1996)). This region of ZC1 is most related to human
STE20-subfamily kinases, ZC3 (SEQ ID NO: 15), ZC2 (SEQ ID NO: 14),
and GEK2 (SEQ ID NO: 107), as well as to human PITSLRE (GB:U04824)
sharing 65.5%, 65.4%, 25.3%, and 29.0% amino acid identity,
respectively. The ZC1 coiled-coil domain also shares 90.6% amino
acid homology to murine NIK. The C. elegans homologue ZC504.4
shares 32.2% sequence identity over this region.
[0259] Within the predicted coiled-coil domain of human ZC1, and
the related ZC3, is a region predicted to form a leucine zipper
(Leu-X6-Leu-X6-Leu-X6-Leu-X20-Leu-X6-Leu) (SEQ ID NO: 149). The
fact that this leucine repeat exists within a predicted coiled-coil
structure suggests that the leucine zipper may have a high
probability of serving as a dimerization interface (Hirst, J. D. et
al Protein Engineering 9657-662 (1996)) mediating a potential
inter- or intra-molecular dimerization of human ZC1.
[0260] The 114 amino acid proline-rich region of human ZC1 is most
related to human STE20-subfamily kinases, ZC2 (SEQ ID NO: 14) and
ZC3 (SEQ ID NO: 15), sharing 35.8%, and 24.9%, respectively. The
ZC1 proline-rich domain shares 36.4% amino acid homology to murine
NIK (GB:U88984). Three potential "PxxP" (SEQ ID NO: 148) SH3
domain-binding motifs (I, II and III) are found within the
proline-rich region of human ZC1. Motif I is conserved in human ZC1
and C. elegans ZC504.4 (GB:Z50029). Motif II is conserved in ZC1,
ZC2, ZC3, ZC4 and C. elegans ZC504.4. Motif III is conserved in
ZC1, ZC2, ZC3 and ZC4. Motifs II and III of murine NIK have been
shown to bind the SH3 motif of the adaptor molecule Nck (Su, Y-C.
et al, EMBO J. 16, 1279-1290 (1997)). From this evidence, human ZC1
may have the potential to bind to Nck or other SH3 or WW
domain-containing proteins and participate in growth factor-induced
signaling pathways.
[0261] The 256 amino acid spacer region of human ZC1 is most
related to human STE20-subfamily kinases, ZC2 (SEQ ID NO: 14) and
ZC3 (SEQ ID NO: 15), as well as to human PITSLRE (GB:U04824),
sharing 59.9%, 33.1%, 29.6%, and 26.4% amino acid identity,
respectively. It also shares 59.9% amino acid homology to murine
NIK. The C. elegans homologue ZC504.4 has only limited sequence
similarity in this spacer region.
[0262] The 343 amino acid C-terminal of human ZC1 is most related
to human STE20-subfamily kinases, ZC3 (SEQ ID NO: 15), ZC2 (SEQ ID
NO: 14), and ZC4 (SEQ ID NO:16), sharing 89.2%, 88.9%, and 42.3%,
amino acid identity, respectively. The ZC1 C-terminal domain also
shares 98.8% amino acid identity to murine NIK. The C. elegans
homologue ZC504.4 also shares 68.7% amino acid identity with the
C-tail of human ZC1. A lower, yet significant, homology is also
evident to human KHS2 (SEQ ID NO: 18), GCK (GB:U07349), and murine
citron (GB:U07349) with 26.6%, 23.1% and 36.2% amino acid identity,
respectively. GCK is a STE20-family kinase whose C-terminal domain
has been shown to bind the small G-protein Rab8 (Ren, M. et al.,
Proc. Natl. Acad. Sci. 93, 5151-5155 (1996)). Citron is a
non-kinase Rho-binding protein (Madaule, P. et al., FEBS Lett. 377,
243-238 (1995)).
[0263] The sequence similarity of the C-terminal region of ZC1 to
proteins that have potential Rab- or Rho-binding domains suggests
that ZC1 may signal through a small G-protein-dependant
pathway.
[0264] Mammalian ZC2
[0265] The 4055 bp human ZC2 nucleotide sequence of the partial
cDNA encodes a polypeptide of 1297 amino acids (SEQ ID NO:14) with
a predicted molecular mass of 147,785 daltons. Analysis of the
deduced amino acid sequence predicts ZC2 to be an intracellular
serine/threonine kinase, lacking both a signal sequence and
transmembrane domain, however the cDNA clone lacks an initiating
ATG, so the full extent of it N-terminus is not known. The
N-terminally truncated ZC2 protein contains a 255 amino acid
catalytic domain with all the motifs characteristic of a
serine/threonine kinase, a 187 amino acid region predicted to form
a coiled-coil structure, a 184 amino acid proline-rich region, a
328 amino acid spacer region, followed by a 343 amino acid
C-terminal domain containing a potential Rab/Rho-binding
region.
[0266] ZC2 is most closely related to the human STE20-subfamily
kinases ZC3 (SEQ ID NO:15), ZC1 (SEQ ID NO:13), and ZC4 (SEQ ID
NO:16), sharing 88.3%, 61.7%, and 41.9% amino acid identity,
respectively, and shares 41.7% amino acid identity to a C. elegans
kinase encoded by the cosmid ZC504.4 (GB:Z50029).
[0267] The 255 amino acid catalytic domain of human ZC2 is most
related to human STE20-subfamily kinases, ZC1 (SEQ ID NO: 13), ZC3
(SEQ ID NO: 15), SOK-1 (GB:X99325), KHS2 (SEQ ID NO:18), MST1
(GB:U18297), and GCK (GB:U07349), and to the C. elegans kinase
encoded by the cosmid ZC504.4 (GB:Z50029) sharing 90.2%, 89.8%,
49.0%, 48.6%, 47.9%, 45.0 and 76.7% amino acid identity,
respectively. ZC2 contains the potential "TPY" regulatory
phosphorylation site in its activation loop. This "TPY" motif is
conserved in other STE20-related kinases, including ZC1, ZC3, ZC4,
GEK2, KHS2, SULU1, SULU3, PAK4 and PAK5.
[0268] Immediately C-terminal to the kinase domain of human ZC2 is
a 187 amino acid region predicted to form a coiled-coil structure
based on the Lupas algorithm (supra). This region of ZC2 is most
related to human STE20-subfamily kinases, ZC1 (SEQ ID NO:13), ZC3
(SEQ ID NO:15), and GEK2 (SEQ ID NO:107), as well as to human
PITSLRE (GB:U04824), sharing 65.8%, 61.5%, 29.7% and 29.6% amino
acid identity, respectively. The C. elegans homologue ZC504.4
shares 30.8% sequence identity over this region. Human ZC2 lacks
the potential leucine zipper found in ZC1 as a consequence of a 29
amino acid deletion relative to ZC1 and ZC3.
[0269] The 184 amino acid proline-rich region of human ZC2 is most
related to human STE20-subfamily kinases, ZC3 (SEQ ID NO: 15) and
ZC1 (SEQ ID NO: 13), sharing 35.9% and 28.6%, amino acid identity,
respectively. Significant homology is also evident to the murine WW
domain-binding protein WBP7 (GB:U92455), and to the human SH3
domain-binding protein 3BP-1 (GB:X87671), with 27.7% and 25.3%
amino acid identity, respectively.
[0270] ZC2 contains two of the potential "PxxP" (SEQ ID NO: 148)
SH3 domain-binding motifs (II and III) found within the
proline-rich region of human ZC1. Motif II is conserved in ZC1,
ZC3, ZC4 and C. elegans ZC504.4, and Motif III is conserved in ZC1,
ZC3 and ZC4. Motifs II and III of murine NIK have been shown to
bind the SH3 motif of the adaptor molecule Nck. From this evidence,
human ZC1 may have the potential to bind to Nck or other SH3 or WW
domain-containing proteins, and to participate in growth
factor-induced signaling pathways.
[0271] The 328 amino acid spacer region of human ZC2 is most
related to human STE20-subfamily kinases ZC1 (SEQ ID NO:13) and ZC3
(SEQ ID NO:15), and to murine NIK (GB:U88984), sharing 31.6%, 26.9%
and 25.9% amino acid identity, respectively. The C. elegans
homologue ZC504.4 has only limited sequence similarity in this
spacer region.
[0272] The 343 amino acid C-terminal of human ZC2 is most related
to human STE20-subfamily kinases ZC1 (SEQ ID NO: 13), ZC3 (SEQ ID
NO: 15) and ZC4 (SEQ ID NO:16), and to murine NIK (GB:U88984),
sharing 88.9%, 88.3%, 41.9%, and 88.0%, amino acid identity,
respectively. The C. elegans homologue, ZC504.4, also shares 67.2%
amino acid identity with the C-tail of human ZC2. A lower, yet
significant, homology is also evident to human GCK (GB:U07349),
murine citron (GB:U07349), and the S. cerevisiae ROM2 protein
(GB:U19103), a Rho1 GDP/GTP exchange factor, with 22.3%, 22.2% and
21.9% amino acid identity, respectively.
[0273] The sequence similarity of the C-terminal region of ZC2 to
proteins that have potential Rab- or Rho-binding domains suggests
that ZC2, like ZC1, may also signal through a small
G-protein-dependant pathway.
[0274] Mammalian ZC3
[0275] The 4133 bp human ZC3 nucleotide sequence of the partial
cDNA encodes a polypeptide of 1326 amino acids (SEQ ID NO: 15) with
a predicted molecular mass of 149,906 daltons. Analysis of the
deduced amino acid sequence predicts ZC3 to be an intracellular
serine/threonine kinase, lacking both a signal sequence and
transmembrane domain, however the cDNA clone lacks an initiating
ATG, so the full extent of it N-termius is not known. The
N-terminally truncated ZC3 protein contains a 255 amino acid
catalytic domain with all the motifs characteristic of a
serine/threonine kinase: a 221 amino acid region predicted to form
a coiled-coil structure, a 204 amino acid proline-rich region, and
a 303 amino acid spacer region followed by a 343 amino acid
C-terminal domain containing a potential Rab/Rho-binding
region.
[0276] ZC3 is most closely related to the human STE20-subfamily
kinases ZC1 (SEQ ID NO:13), ZC2 (SEQ ID NO:14), and ZC4 (SEQ ID
NO:16), sharing 62.0%, 61.0%, and 42.5% amino acid identity,
respectively and shares 46.7% amino acid identity to a C. elegans
kinase encoded by the cosmid ZC504.4 (GB:Z50029).
[0277] The 255 amino acid catalytic domain of human ZC3 is most
related to human STE20-subfamily kinases, ZC1 (SEQ ID NO: 13), ZC2
(SEQ ID NO: 14), SOK-1 (GB:X99325), KHS2 (SEQ ID NO:18), GCK
(GB:U07349), SULU1 (SEQ ID NO:22), and GEK2 (SEQ ID NO: 107), and
to the C. elegans kinase encoded by the cosmid ZC504.4 (GB:Z50029)
sharing 90.6%, 89.3%, 49.0%, 48.3%, 45.0%, 43.1%, 42.3% and 76.7%
amino acid identity, respectively. ZC1 contains the potential "TPY"
regulatory phosphorylation site in its activation loop. This "TPY"
motif is conserved in other STE20-related kinases, including ZC1,
ZC2, GEK2, KHS2, SULU1, SULU3, PAK4 and PAK5.
[0278] Immediately C-terminal to the kinase domain of human ZC3 is
a 221 amino acid region predicted to form a coiled-coil structure
based on the Lupas algorithm (supra). This region of ZC3 is most
homologous to human STE20-subfamily kinases, ZC1 (SEQ ID NO:13),
ZC2 (SEQ ID NO:14), and GEK2 (SEQ ID NO:107), sharing 66.9%, 61.5%,
and 27.5% identity, as well as to rat PLC-beta (GB:A45493) and
human PITSLRE (GB:H54024) sharing 29.6% and 25.9% amino acid
identity, respectively. The C. elegans homologue ZC504.4 shares
26.8% sequence identity over this region.
[0279] Within the predicted coiled-coil domain of human ZC3, and
the related ZC1, is a region predicted to form a leucine zipper
(Leu-X6-Leu-X6-Leu-X6-Leu-X20-Leu-X6-Leu) (SEQ ID NO: 149). The
fact that this leucine repeat exists within a predicted coiled-coil
structure suggests that the leucine zipper may have a high
probability of serving as a dimerization interface (Hirst, J. D. et
al Protein Engineering 9657-662 (1996)) mediating a potential
inter- or intra-molecular dimerization of human ZC3.
[0280] The 204 amino acid proline-rich region of human ZC3 is most
related to human STE20-subfamily kinases, ZC1 (SEQ ID NO: 13) and
ZC2 (SEQ ID NO: 14), sharing 66.9% and 61.5% amino acid identity,
respectively.
[0281] ZC3 contains two of the potential "PxxP" (SEQ ID NO: 148)
SH3 domain-binding motifs (II and III) found within the
proline-rich region of human ZC1. Motif II is conserved in ZC1,
ZC2, ZC4 and C. elegans ZC504.4; Motif III is conserved in ZC1, ZC2
and ZC4. Motifs II and III of murine NIK have been shown to bind
the SH3 motif of the adaptor molecule Nck. From this evidence,
human ZC3 may have the potential to bind to Nck or other SH3 or WW
domain-containing proteins and participate in growth factor-induced
signaling pathways.
[0282] The 303 amino acid acid spacer region of human ZC3 is most
related to human STE20-subfamily kinases, ZC1 (SEQ ID NO: 13) and
ZC2 (SEQ ID NO: 14) sharing 30.1%, and 27.1% amino acid identity,
respectively. The C. elegans homologue ZC504.4 lacks nearly the
entire spacer region of ZC3.
[0283] The 343 amino acid C-terminal of human ZC3 is most related
to human STE20-subfamily kinases, ZC1 (SEQ ID NO:13), ZC2 (SEQ ID
NO:14) and ZC4 (SEQ ID NO: 16), sharing 89.2%, 88.9%, and 42.5%,
amino acid identity, respectively. The C. elegans homologue ZC504.4
also shares 67.2% amino acid identity with the C-tail of human ZC3.
A lower, yet significant, homology is also evident to human GCK
(GB:U07349), as well as to the non-kinases murine citron
(GB:U07349) and the S. cerevisiae ROM2 protein (GB:U 19103), a Rho1
GDP/GTP exchange factor, with 21.6%, 32.4% and 22.9% amino acid
identity, respectively.
[0284] The sequence similarity of the C-terminal region of ZC3 to
proteins that have potential Rab- or Rho-binding domains suggests
that ZC3, like ZC1 and ZC2, may signal through a small
G-protein-dependant pathway.
[0285] Mammalian ZC4
[0286] The 3,684 bp human ZC4 nucleotide sequence of the complete
cDNA encodes a polypeptide of 1,227 amino acids (SEQ ID NO:105)
with a predicted molecular mass of 138,205 Daltons. Analysis of the
deduced amino acid sequence predicts ZC4 to be an intracellular
STE20-subfamily kinase, lacking both a signal sequence and a
transmembrane domain. The full-length ZC4 protein contains a 25
amino acid N-terminus, a 265 amino acid catalytic domain with all
the motifs characteristic of a serine/threonine kinase, a 108 amino
acid region predicted to form a coiled-coil structure, a 231 amino
acid proline-rich region, a 40 amino acid region predicted to form
a coiled-coil structure spacer region, a 204 amino acid spacer
region (domain B), followed by a 355 amino acid C-terminal domain
containing a potential Rab/Rho-binding region (domain C).
[0287] ZC4 is most closely related to human ZC1 (SEQ ID NO:13, also
known as human HGK, human KIAA0687, murine NIK, human AC005035,
human NIK, and C. elegans MIG-15), ZC2 (SEQ ID NO:14, similar to
partial sequence human KIAA0551), and ZC3 (SEQ ID NO:15). An
assembled genomic fragment in the database (Z83850) is identical to
ZC4, except for inappropriate identification of the exon
boundaries. (Abo et al. (1998) EMBO J. 17: 6527-6540.)
[0288] The 25 amino acid N-terminal domain of human ZC4 shares weak
homology to human ZC1 in its C-terminal extent, but otherwise does
not reveal any significant homologies to the protein database.
[0289] The 265 amino acid catalytic domain of human ZC4 is most
related to human ZC1 (SEQ ID NO:13), ZC3 (SEQ ID NO:15), and ZC2
(SEQ ID NO:14), sharing 63%, 64% and 62% amino acid identity,
respectively.
[0290] Immediately C-terminal to the kinase domain of human ZC4 is
a 108 amino acid region predicted to form a coiled-coil structure
based on the Lupas algorithm (supra). This region is most related
to human ZC1 (SEQ ID NO:13), ZC3 (SEQ ID NO:15), and ZC2 (SEQ ID
NO: 14), sharing 29%, 25% and 20% amino acid identity,
respectively.
[0291] The 231 amino acid proline-rich region of human ZC4 does not
reveal any significant homologies to the protein database. This
region of ZC4 contains two "PxxP" (SEQ ID NO: 148) motifs that
could potentially bind to proteins containing SH3 or WW domains and
allow ZC4 to participate in growth factor activated signaling
pathways. In addition, within the pro-rich domain of human ZC4 is a
region predicted to form a leucine zipper
(Leu-X6-Leu-X6-Leu-X6-Leu-X20-Leu-X6-Leu) (SEQ ID NO: 149) which
may serve as a dimerization interface. The ZC STE20 subfamily
kinases (ZC1, ZC2 and ZC3) have similarly located "PxxP" (SEQ ID
NO: 148) motifs and potential Leu zippers.
[0292] Immediately C-terminal to the proline-rich region of human
ZC4 is a 40 amino acid region also predicted to form a coiled-coil
structure based on the Lupas algorithm. This region of human ZC4
does not reveal any significant homologies to the protein
database.
[0293] The 204 amino acid acidic- and serine-rich domain "B" of ZC4
does not reveal any significant homologies to the protein
database.
[0294] The 355 amino acid C-terminal of human ZC4 is most related
to human ZC1 (SEQ ID NO:13), ZC3 (SEQ ID NO:15), and ZC2 (SEQ ID
NO:14), sharing 43%, 42% and 42% amino acid identity,
respectively.
[0295] The sequence similarity of the C-terminal region of ZC4 to
proteins that have potential Rab- or Rho-binding domains suggests
that ZC4, like other ZC-subfamily STE20 kinases, may signal through
a small G-protein-dependant pathway. Mammalian KHS2
[0296] The 4023 bp human KHS2 nucleotide sequence encodes a
polypeptide of 894 amino acids (SEQ ID NO: 18) with a predicted
molecular mass of 101,327 daltons. Analysis of the deduced amino
acid sequence predicts KHS2 to be an intracellular serine/threonine
kinase, lacking both a signal sequence and transmembrane domain.
The full-length KHS2 protein contains a 13 amino acid N-terminus, a
260 amino acid catalytic domain with all the motifs characteristic
of a serine/threonine kinase, a 73 amino acid spacer region, a 188
proline-rich region, followed by a 360 amino acid C-terminal domain
containing a potential Rab/Rho-binding site.
[0297] KHS2 is most closely related to the human STE20-subfamily
kinases KHS1 (GB:U177129), GCK (GB:U07349), and HPK1 (GB:U07349),
sharing 65.5%, 51.9%, and 44.9% amino acid identity, respectively
and shares 38.5% amino acid identity to a C. elegans STK
(GB:U55363).
[0298] The 13 amino acid N-terminal domain of human KHS2 does not
reveal any significant homologies that might suggest a potential
function for this domain when examined by a Smith-Waterman
alignment to the nonredundant protein database. Human KHS2 lacks a
glycine residue at position 2, and is therefore unlikely to undergo
myristylation.
[0299] The 260 amino acid catalytic domain of human KHS2 is most
related to human STE20-subfamily kinases KHS1 (GB:U177129), GCK
(GB:U07349), HPK1 (GB:U66464), SOK-1 (GB:X99325), MST1 (GB:U18297),
ZC1 (SEQ ID NO:13), and to the C. elegans kinase (GB:U55363),
sharing 85.4%, 75.1%, 67.7%, 51.4%, 48.1%, 49.8% and 72.0% amino
acid identity, respectively. KHS2 contains the potential "TPY"
regulatory phosphorylation site in its activation loop. This "TPY"
motif is conserved in other STE20-related kinases, including ZC1,
ZC2, ZC3, ZC4, GEK2, SULU1, SULU3, PAK4 and PAK5.
[0300] The 73 amino acid acid spacer region of human KHS2 is most
related to human STE20-subfamily kinases, KHS1 (GB:U177129), HPK1
(GB:U66464) and GCK (GB:U07349), sharing 60.3%, 43.5% and 44.0%,
amino acid identity, respectively.
[0301] The 188 amino acid proline-rich region of human KHS2 is most
related to human STE20-subfamily kinases, HPK1 (GB:U66464), GCK
(GB:U07349) and KHS1 (GB:U177129), sharing 33.3%, 31.9% and 31.4%,
amino acid identity, respectively.
[0302] Two potential "PxxP" (SEQ ID NO: 148) SH3 domain-binding
motifs (I and II) are found within the proline-rich region of human
KHS2. Motif I is conserved with human KHS1 and HPK1; motif II is
conserved with GCK and KHS2. A 192 amino acid region of human HPK1
containing motif II has been shown to bind to the C-terminal SH3
motif of the adaptor molecule Grb2 (Anafi, M et al, J. Biol. Chem.
J. 272, 27804-27811 (1997)). Human KHS2 may bind SH3 or WW
domain-containing proteins through this proline-rich region.
[0303] The 360 amino acid C-terminal of human KHS2 is most related
to KHS1 (GB:U177129), GCK (GB:U07349) and HPK1 (GB:U66464), and to
the C. elegans kinase (GB:U55363), sharing 74.9%, 54.8%, 42.9%, and
31.0%, amino acid identity, respectively. GCK is a STE20-family
kinase whose C-terminal domain has been shown to bind the small
G-protein Rab8 (Ren, M. et al., Proc. Natl. Acad. Sci. 93,
5151-5155 (1996)).
[0304] Mammalian SULU1
[0305] The 4196 bp human SULU1 nucleotide sequence encodes a
polypeptide of 898 amino acids (SEQ ID NO:22) with a predicted
molecular mass of 105,402 daltons. Analysis of the deduced amino
acid sequence predicts SULU1 to be an intracellular
serine/threonine kinase, lacking both a signal sequence and
transmembrane domain. The full-length SULU1 protein contains a 21
amino acid N-terminus, a 256 amino acid catalytic domain with all
the motifs characteristic of a serine/threonine kinase, a 150 amino
acid spacer region, a 210 amino acid region predicted to form a
coiled-coil structure, a 114 amino acid spacer region and a 147
amino acid C-terminal domain predicted to form a coiled-coil
structure.
[0306] SULU1 is most closely related to the STE20-subfamily kinases
murine SULU3 (SEQ ID NO:24), human SULU3 (SEQ ID NO:23), and to the
C. elegans kinase SULU (GB:U11280), sharing 68.9%, 72.2% and 38.2%
amino acid identity, respectively.
[0307] The 21 amino acid N-terminal domain of human SULU1 is most
related to murine SULU3 (SEQ ID NO:24) and to the C. elegans kinase
SULU (GB:U11280), sharing 86.3% and 62.3% amino acid identity.
Human SULU1 lacks a glycine residue at position 2, and is therefore
unlikely to undergo myristoylation. A Smith-Waterman search of the
nonredundant protein database does not reveal any significant
homologies that might suggest a potential function for this
domain.
[0308] The 256 amino acid catalytic domain of human SULU1 is most
related to murine SULU3 (SEQ ID NO:24), and to human SOK-1
(GB:X99325), STLK2 (SEQ ID NO:5), MST1 (GB:U18297), PAK1
(GB:U24152), ZC2 (SEQ ID NO:14), and KHS2 (SEQ ID NO:18) sharing
86.3%, 48.1%, 46.9%, 45.2%, 43.3%, 43.1% and 42.0% amino acid
identity, respectively. The C. elegans SULU STK (GB:U11280) shares
62.3% sequence identity over this region. SULU1 contains the
potential "TPY" regulatory phosphorylation site in its activation
loop. This "TPY" motif is conserved in other STE20-related kinases,
including ZC1, ZC2, ZC3, ZC4, GEK2, KHS2, SULU3, PAK4 and PAK5.
[0309] The 150 amino acid spacer region of human SULU1 is most
related to human SULU3 (SEQ ID NO:23) and to the C. elegans kinase
(GB:U11280), sharing 53.5% and 10.4% amino acid identity,
respectively.
[0310] Immediately C-terminal to the spacer region of human SULU1
is a 210 amino acid region predicted to form a coiled-coil
structure based on the Lupas algorithm. This region of SULU1 is
most related to SULU3 (SEQ ID NO:23), the C. elegans SULU kinase
(GB:U11280), GEK 2 (SEQ ID NO:107) and ZC1 (SEQ ID NO:13), sharing
68.6%,26.8%,23.2%, and 22.8% amino acid identity, respectively.
[0311] The 114 amino acid spacer region human SULU1 is most related
to human SULU3 (SEQ ID NO:24) with 73.7% amino acid sequence
identity. A lower, yet significant, homology is also evident to
murine PITSLRE (GB:U04824) and DLK (GB:A55318), human ZC1 (SEQ ID
NO:13) and GEK 2 (SEQ ID NO:107), as well as to the C. elegans SULU
STK (GB:U11280), sharing 39.7%, 35.4%, 29.5%, 23.6% and 37.6% amino
acid identity, respectively.
[0312] Immediately C-terminal to the second spacer region of human
SULU1 is a 147 amino acid region predicted to form a coiled-coil
structure based on the Lupas algorithm. This region of SULU1 is
most related to human SULU3 (SEQ ID NO:24), ZC1 (SEQ ID NO:13) and
GEK 2 (SEQ ID NO:107), as well as to the C. elegans SULU STK
(GB:U11280), sharing 73.3%, 28.4%, 26.1% and 39.5%, amino acid
identity, respectively.
[0313] Mammalian (human) SULU3
[0314] The 3824 bp partial cDNA human SULU3 nucleotide sequence
encodes a polypeptide of 786 amino acids (SEQ ID NO:23) with a
predicted molecular mass of 92,037 daltons. Analysis of the deduced
amino acid sequence predicts SULU3 to be an intracellular
serine/threonine kinase lacking a transmembrane domain. The
N-terminally truncated human SULU3 protein contains a 66 amino acid
partial catalytic domain followed by a 149 amino acid spacer
region, a 210 amino acid region predicted to form a coiled-coil
structure, a second spacer region of 114 amino acids, a 247 amino
acid C-terminal region predicted to form a second coiled-coil
structure and a 100 amino acid C-terminal tail.
[0315] Human SULU3 is most closely related murine SULU3 (SEQ ID
NO:24), human SULU1 (SEQ ID NO:22), and to the C. elegans SULU
kinase (GB:U 11280), sharing 66.3%, 68.9% and 32.9% amino acid
identity, respectively. The high sequence homology between murine
and human SULU3 suggests that these two proteins are orthologs of
each other.
[0316] The 66 amino acid partial catalytic domain of human SULU3 is
most related to murine SULU3 (SEQ ID NO:24), and to the human STE20
subfamily kinases ZC1 (SEQ ID NO:13), STE20 (GB:X99325),
KHS1(GB:U177129) and GEK 2 (SEQ ID NO: 107), as well as to the C.
elegans SULU kinase (GB:U11280), sharing 83.3%, 47.0%, 45.5%,
43.5%,41.8% and 55.6% amino acid identity, respectively.
[0317] The 149 amino acid spacer region of human SULU3 is most
related to murine SULU3 (SEQ ID NO:24), human STE20 (GB:X99325),
MST1 (GB:U18297), and to the C. elegans SULU kinase (GB:U11280)
sharing 98.7%, 21.9% and 21.8% amino acid identity,
respectively.
[0318] Immediately C-terminal to the first spacer region of human
SULU3 is a 210 amino acid region predicted to form a coiled-coil
structure based on the Lupas algorithm. This region of SULU3 is
most related to murine SULU3 (SEQ ID NO:24), and to human SULU1
(SEQ ID NO:22), ZC1 (SEQ ID NO:13) and GEK 2 (SEQ ID NO:107), as
well as to the C. elegans SULU kinase (GB:U11280), sharing 99.5%,
68.6%, 27.4% and 22.5% amino acid identity, respectively.
[0319] The 114 amino acid second spacer region of human SULU3 is
most related to murine SULU3 (SEQ ID NO:24), and to human SULU1
(SEQ ID NO:22) GEK 2 (SEQ ID NO:107), and ZC1 (SEQ ID NO:13), as
well as to the C. elegans SULU kinase (GB:U11280), sharing 99.1%,
73.7%, 24.6%,24.1% and 41.2% amino acid identity, respectively.
[0320] Immediately C-terminal to the second spacer region of human
SULU3 is a 247 amino acid region predicted to form a coiled-coil
structure based on the Lupas algorithm (supra). This region of
SULU3 is most related to human SULU1 (SEQ ID NO:22) and ZC1 (SEQ ID
NO:13) as well as to rat PKN-(GB:D26180) murine pl60 ROCK1
(GB:U58512), and the C. elegans SULU kinase (GB:U11280), sharing
73.7%, 26.7%, 24.0% and 21.0% amino acid identity,
respectively.
[0321] The 100 amino acid C-tail of human SULU3 is most related to
a human prion protein (GB:L38993), with 45.0% amino acid
identity.
[0322] Mammalian (murine) SULU3
[0323] The 2249 bp murine, partial cDNA SULU3 nucleotide sequence
encodes a polypeptide of 748 amino acids (SEQ ID NO:24) with a
predicted molecular mass of 87,520 daltons. Analysis of the deduced
amino acid sequence predicts SULU3 to be an intracellular
serine/threonine kinase, lacking both a signal sequence and
transmembrane domain. The partial murine SULU3 protein contains a
25 amino acid N-terminus, a 248 amino acid catalytic domain with
all the motifs characteristic of a serine/threonine kinase, a 149
amino acid spacer region, a 210 amino acid region predicted to form
a coiled-coil structure, and a 116 amino acid spacer region.
[0324] Murine SULU3 is most closely related to human SULU3 (SEQ ID
NO:23) and SULU1 (SEQ ID NO:22), as well as to the C. elegans SULU
kinase (GB:U112 80), sharing 97.0%, 72.3% and 38.4% amino acid
identity, respectively. The high sequence homology between murine
and human SULU3 suggests that these two proteins are orthologs.
[0325] The 25 amino acid N-terminal domain of murine SULU3 is most
related to human SULU1 (SEQ ID NO:22) and to the C. elegans SULU
kinase (GB:U11280), sharing 70.0% and 44.4% amino acid identity,
respectively.
[0326] Murine SULU3 lacks a glycine residue at position 2, and is
therefore unlikely to undergo myristoylation. A Smith-Waterman
search of the nonredundant protein database does not reveal any
significant homologies that might suggest a potential function for
this domain.
[0327] The 248 amino acid catalytic domain of murine SULU3 is most
related to human SULU1 (SEQ ID NO:22), STE20 (GB:X99325), ZC1 (SEQ
ID NO:13), and KHS1 (GB:U77129), as well as to the C. elegans SULU
kinase (GB:U11280), sharing 86.7%, 46.6%, 43.3%, 59.4% amino acid
identity, respectively. Murine SULU3 contains the potential "TPY"
regulatory phosphorylation site in its activation loop. This "TPY"
motif is conserved in other STE20-related kinases, including ZC2,
ZC3, ZC4, GEK2, KHS2, SULU1, SULU3, PAK4 and PAK5.
[0328] The 149 amino acid spacer of murine SULU3 is most related to
human SULU3 (SEQ ID NO:23), SULU1 (SEQ ID NO:22), and STE20
(GB:X99325), as well as to the C. elegans SULU (GB:U11280) and the
S. cerevisiae STE20 (GB:L04655) kinases, sharing 98.7%, 53.4%,
21.9%, 59.4% and 21.9% amino acid identity, respectively.
[0329] Immediately C-terminal to the spacer region of murine SULU3
is a 210 amino acid region predicted to form a coiled-coil
structure based on the Lupas algorithm. This region of murine SULU3
is most related to human SULU3 (SEQ ID NO:23), ZC1 (SEQ ID NO:13),
and GEK 2 (SEQ ID NO:107), as well as to the C. elegans SULU kinase
(GB:U11280), sharing 99.5%, 27.4%, 22.5% and 29.2% amino acid
identity, respectively.
[0330] The 116 amino acid C-terminal spacer region of murine SULU3
is most related to human SULU3 (SEQ ID NO:23), GEK 2 (SEQ ID
NO:107), and ZC1 (SEQ ID NO: 13), well as to the C. elegans SULU
kinase (GB:U11280), sharing 98.3%, 24.6%, 24.1% and 40.5% amino
acid identity, respectively.
[0331] Mammalian (Murine/Human) SULU3
[0332] The 2249 bp murine SULU3 and the 3824 bp human SULU3 cDNAs
contain a 1620 nucleotide overlap (541 amino acids) with 90% and
98% DNA and amino acid sequence identity, respectively. Owing to
the high degree of sequence identity in this extended overlap, we
propose that these are functional orthologues of a single gene. The
combined murine/human 4492 bp SULU3 sequence encodes a polypeptide
of 1001 amino acids (SEQ ID NO:31) with a predicted molecular mass
of 116,069 daltons. Analysis of the deduced amino acid sequence
predicts SULU3 to be an intracellular serine/threonine kinase,
lacking both a signal sequence and transmembrane domain. SULU3
contains a 25 amino acid N-terminus, a 248 amino acid catalytic
domain with all the motifs characteristic of a serine/threonine
kinase, a 149 amino acid spacer region, a 210 amino acid region
predicted to form a coiled-coil structure and a second spacer
region of 114 amino acids, a 247 amino acid C-terminal region
predicted to form a second coiled-coil structure and a 100 amino
acid C-terminal tail. The murine SULU3 clone lacks the region from
the second C-terminal coiled-coil to the C-terminus, whereas the
human clone lacks the N-terminal domain, and all but 66 amino acids
of the 248 amino acid kinase domain.
[0333] SULU3 is most closely related to SULU1 (SEQ ID NO:22) and
the C. elegans SULU kinase (GB:U11280) sharing 72.3% and 38.4%
amino acid identity, respectively.
[0334] The 25 amino acid N-terminal domain of SULU3 is most related
to human SULU1 (SEQ ID NO:22) and to the C. elegans SULU kinase
(GB:U11280), sharing 70.0% and 44.4% amino acid identity,
respectively. SULU3 lacks a glycine residue at position 2, and is
therefore unlikely to undergo myristylation. A Smith-Waterman
search of the nonredundant protein database does not reveal any
significant homologies that might suggest a potential function for
this domain.
[0335] The 248 amino acid catalytic domain of SULU3 is most related
to human SULU1 (SEQ ID NO:22), SOK-1 (GB:X99325), ZC1 (SEQ ID
NO:13), KHS1 (GB:U77129) and the C. elegans SULU kinase
(GB:U11280), sharing 86.7%, 46.6%, 43.3%, 42.0% and 59.4% amino
acid identity, respectively. SULU3 contains the potential "TPY"
regulatory phosphorylation site in its activation loop. This "TPY"
motif is conserved in other STE20-related kinases, including ZC2,
ZC3, ZC4, GEK2, KHS2, SULU1, PAK4 and PAK5.
[0336] The 149 amino acid spacer of SULU3 is most related to SULU1
(SEQ ID NO:22) and SOK-1 (GB:X99325), and to the C. elegans SULU
(GB:U11280), and S. cerevisiae STE20 (GB:L04655) kinases, sharing
53.4%, 21.9%, 59.4% and 21.9% amino acid identity,
respectively.
[0337] Immediately C-terminal to the spacer region of SULU3 is a
210 amino acid region predicted to form a coiled-coil structure
based on the Lupas algorithm. This region is most related to ZC1
(SEQ ID NO:13), GEK 2 (SEQ ID NO:107), and the C. elegans SULU
kinase (GB:U11280), sharing 27.4% 22.5% and 29.2% amino acid
identity, respectively.
[0338] The 114 amino acid spacer region of SULU3 is most related to
human SULU1 (SEQ ID NO:22), GEK 2 (SEQ ID NO:107), ZC1 (SEQ ID
NO:13), and to the C. elegans SULU kinase (GB:U11280), sharing
73.7%, 24.6%, 24.1% and 41.2% amino acid identity,
respectively.
[0339] Immediately C-terminal to the second spacer region of SULU3
is a 247 amino acid region predicted to form a coiled-coil
structure based on the Lupas algorithm. This region of SULU3 is
most related to human SULU1 (SEQ ID NO:22) and ZC1 (SEQ ID NO:13),
as well as to rat PKN (GB:D26180), murine pl60 ROCK1 (GB:U58512)
and the C. elegans SULU kinase (GB:U11280), sharing 73.7%, 26.7%,
24.0%, 21.0% and 37.6% amino acid identity, respectively.
[0340] The 100 amino acid C-tail of SULU3 is most related to a
human prion protein (GB:L38993) with 45.0% amino acid identity.
[0341] Mammalian GEK2
[0342] The 2926 bp human GEK2 nucleotide sequence of the complete
cDNA encodes a polypeptide of 968 amino acids (SEQ ID NO: 107) with
a predicted molecular mass of 112,120 daltons. Analysis of the
deduced amino acid sequence predicts GEK2 to be an intracellular
serine/threonine kinase, lacking both a signal sequence and
transmembrane domain. The complete GEK2 protein contains a 33 amino
acid N-terminus, a 261 amino acid catalytic domain with all the
motifs characteristic of a serine/threonine kinase, a 43 amino acid
spacer region, a 135 amino acid proline-rich region, a 252 amino
acid region predicted to form a coiled-coil structure followed by a
244 amino acid region also predicted to form a coiled-coil
structure.
[0343] GEK2 is most closely related to rat AT1-46 (GB:U33472) (a
partial cDNA that extends from the middle of the first potential
coiled-coil domain of GEK2 to the C-terminus), murine LOK
(GB:D89728), Xenopus laevis polo-like kinase 1 (GB:AF100165), and
human SLK (GB:AB002804), sharing 91.3%, 88.5%, 65.0%, and 44.7%
amino acid identity, respectively. The high sequence homology
between human GEK2, murine LOK and rat AT 1-46 suggests that human
GEK2 is a highly related protein to the rodent forms, or
alternatively, its orthologue. Recently, a full-length version of
GEK2 was reported (STK10 or human LOK AB015718). The 968 amino acid
sequence is 99% identical to GEK2 (SEQ ID NO:107).
[0344] The 33 amino acid N-terminal domain of human GEK2 is most
related to murine LOK (GB:D89728) and to human SLK (GB:AB002804),
sharing 100% and 54.5% amino acid identity, respectively.
[0345] Human GEK2 lacks a glycine residue at position 2, and is
therefore unlikely to undergo myristylation. A Smith-Waterman
search of the nonredundant protein database does not reveal any
significant homologies that might suggest a potential function for
this domain.
[0346] The 261 amino acid catalytic domain of human GEK2 is most
related to murine LOK (GB:D89728), rat AT1-46 (GB:D89728) and human
SLK (GB:AB002804) as well as to a C. elegans kinase (GB:Z81460),
sharing 97.7%, 90.8%, 54.5% and 55.9% amino acid identity,
respectively. GEK2 contains the potential "TPY" regulatory
phosphorylation site in its activation loop. This "TPY" motif is
conserved in other STE20-related kinases, including ZC2, ZC3, ZC4,
GEK2, KHS2, SULU1, SULU3, PAK4 and PAK5.
[0347] The 43 amino acid spacer region of human GEK2 is most
related to murine LOK (GB:D89728) and to human SLK, sharing 83.7%
and 77.6% amino acid identity, respectively.
[0348] The 135 amino acid proline-rich region of human GEK2 is most
related to murine LOK (GB:D89728) with 66.2% amino acid identity,
respectively. Within the proline-rich region of human GEK2 is a
potential "PxxP" (SEQ ID NO: 148) SH3-binding domain conserved with
murine LOK.
[0349] Immediately C-terminal to the proline-rich region of human
GEK2 is a 252 amino acid region predicted to form a coiled-coil
structure based on the Lupas algorithm. This region of human GEK2
is most related to rat AT1-46 (GB:D89728), murine LOK (GB:D89728)
and human SLK (GB:AB002804), and ZC2 (SEQ ID NO:14), sharing 90.8%,
86.9%, 42.2%, and 29.7% amino acid identity, respectively.
[0350] Immediately C-terminal to the predicted coiled-coil
structure of human GEK2 is a second potential coiled-coil structure
of 244 amino acids predicted based on the Lupas algorithm. This
region of human GEK2 is most related to rat AT1-46 (GB:D89728) and
murine LOK (GB:D89728) as well as to human SLK (GB:AB002804) and
ZC1 (SEQ ID NO:13), sharing 91.8%, 92.6%, 70.4% and 26.7% amino
acid identity, respectively. The C. elegans kinase (GB:Z81460)
shares 31.5% amino acid sequence identity over this region.
[0351] Mammalian PAK4
[0352] The 3604 bp human PAK4 nucleotide sequence encodes a
polypeptide of 681 amino acids (SEQ ID NO:29) with a predicted
molecular mass of 74,875 daltons. Analysis of the deduced amino
acid sequence predicts PAK4 to be an intracellular serine/threonine
kinase, lacking both a signal sequence and transmembrane domain.
The full-length PAK4 protein contains a 51 amino acid N-terminus
predicted to contain a rac-binding motif, a 173 amino acid insert
relative to the known mammalian PAK proteins, a 169 amino acid
spacer region, a 265 amino acid catalytic domain with all the
motifs characteristic of a serine/threonine kinase and a 23 amino
acid C-terminal tail.
[0353] PAK4 is most closely related to human PAK5 (SEQ ID NO:30),
PAK1 (GB: U24152), and PAK65 (GB:U25975), as well as to a C.
elegans kinase (GB: Z74029), sharing 76.8%, 49.5%, 49.8%, and 34.6%
amino acid identity, respectively.
[0354] The 51 amino acid N-terminal domain of human PAK4 is most
related to human PAK1 (GB:U24152), and PAK65 (GB:U25975), as well
as to a C. elegans kinase (GB: Z74029), sharing 50.0%, 50.0% and
49.0% amino acid identity, respectively.
[0355] The 10 amino acid region at positions 13-23 of human PAK4
fits the consensus for a Cdc42/Rac-binding motif (SXPX4-6HXXH) (SEQ
ID NO: 150) (Burbelo, P. D., Dreschel, D. and Hall, A. J. Bio.
Chem. 270, 29071-29074 (1995)).
[0356] The 173 amino acid insert of human PAK4, relative to the
known mammalian PAK proteins, is most related to a C. elegans
kinase (GB: Z74029) with 39.0% amino acid identity. A
Smith-Waterman search of the nonredundant protein database does not
reveal any significant homologies that might suggest a potential
function for this region.
[0357] The 169 amino acid spacer of human PAK4 does not reveal any
significant homologies that might suggest a potential function for
this region.
[0358] The equivalent spacer region in PAK1 binds to the guanine
nucleotide exchange factor PIX (Manser, E. et al (1998) Molecular
Cell, 1, 183-192). Since PAK4 differs substantially from PAK1 over
this region, the spacer domain of PAK4 may differ in its guanine
nucleotide exchange factor binding specificity, relative to
PAK1.
[0359] The 265 amino acid catalytic domain of human PAK4 is most
related to human PAK5 (SEQ ID NO:30), PAK1 (GB:U24152), GCK
(GB:U07349), SOK-1 (GB:X99325), and SLK (GB:AB002804), as well as
to the C. elegans (GB: Z74029), and S. cerevisiae STE20-related
kinases (GB:L04655), sharing 95.9%, 51.7%, 41.3%, 39.8%, 37.4%,
60.2% and 47.9% amino acid identity, respectively. PAK4 contains
the potential "TPY" regulatory phosphorylation site in its
activation loop. This "TPY" motif is conserved in other
STE20-related kinases, including ZC1, ZC2, ZC3, ZC4, GEK2, KHS2,
SULU1, SULU3 and PAK5.
[0360] The 23 amino acid C-tail of human PAK4 contains a sequence
that is homologous to a G-protein beta subunit binding site (Leeuw,
T. et al. Nature, 391, 191-195 (1998)). PAK4 has, therefore, the
potential to be activated by both Cdc42-as well as
G-protein-dependant pathways.
[0361] Mammalian PAK5
[0362] The 2,806 bp human PAK5 nucleotide sequence of the complete
cDNA encodes a polypeptide of 591 amino acids (SEQ ID NO:103) with
a predicted molecular mass of 64,071 Daltons. Analysis of the
deduced amino acid sequence predicts PAK5 to be an intracellular
STE20-subfamily kinase, lacking both a signal sequence and
transmembrane domain. The full-length PAK5 protein contains a 52
amino acid N-terminus predicted to contain a p21 (small G-protein)
binding domain (PDB or CRIB), a 121 amino acid insert relative to
the known mammalian PAK proteins, a 134 amino spacer region, a 265
amino acid catalytic domain with all the motifs characteristic of a
serine/threonine kinase and a 19 amino acid C-terminal tail.
[0363] PAK5 is most closely related to Human PAK4 (SEQ ID NO:29),
Drosophila melanogaster PAK (also known as "mushroom bodies tiny")
(AJ01578), C45B11.1b from C. elegans (Z74029), and human PAK3
(Q13177) sharing 48% (327/674 aa), 50% (330/651 aa), 43% (234/435
aa excluding gap), and 47% (190/405 aa excluding gap) amino acid
identity, respectively. Recently, a full length version of PAK5 was
reported (PAK4 AF005046) whose 591 amino acid sequence is identical
to PAK5 (SEQ ID NO:103). (Abo, et al. (1998) EMBO J.
17:6527-6540).
[0364] The 52 amino acid N-terminal domain of human PAK5 is most
related to human PAK4 (SEQ ID NO:29), Drosophila melanogaster PAK
(AJ011578), C45B11.b from C. elegans (Z74029), and human PAK3
(Q13177), sharing 65%, 57%, 54%, and 53% amino acid identity,
respectively.
[0365] The 10 amino acid region at positions 12-22 of human PAK5
(FIG. 18) fits the consensus for a small G-protein binding domain
(PDB or CRIB) (SXPX4-6HXXH) (SEQ ID NO: 150) (Burbelo, P. D.,
Dreschel, D. and Hall, A. J. Bio. Chem. 270, 29071-29074 (1995),
hereby incorporated by reference herein in its entirety including
any figures, tables, or drawings.).
[0366] The 121 amino acid insert of human PAK5 shares 43% amino
acid identity with a similar domain from PAK4 (SEQ ID NO:29), but
that is absent from other known PAKs.
[0367] The equivalent spacer region in PAK1 binds to the guanine
nucleotide exchange factor PIX (Manser, E. et al (1998) Molecular
Cell, 1, 183-192 hereby incorporated by reference herein in its
entirety including any drawings, figures, or tables.). Since PAK5
differs substantially from PAK1 over this region, the spacer domain
of PAK5 may differ in its guanine nucleotide exchange factor
binding specificity, relative to PAK1.
[0368] The 134 amino acid collagen-like region of human PAK5 shares
34% amino acid identity to pro-.alpha. I type collagen from several
species and is not present in other known PAKs.
[0369] The 265 amino acid catalytic domain of human PAK5 is most
related to human PAK4 (SEQ ID NO:29), Drosophila melanogaster PAK
(AJ011578), C45B11.1b from C. elegans (Z74029), and human PAK3
(Q13177), sharing 78%, 80%, 61%, and 55% amino acid identity,
respectively. PAK5 also contains the potential "TPY" regulatory
phosphorylation site in its activation loop. This "TPY" motif is
conserved in other STE20-related kinases, including ZC1, ZC2, ZC3,
ZC4, GEK2, KHS2, SULU1, SULU3 and PAK4.
[0370] The 19 amino acid C-tail shares 80% amino acid identity to a
PAK-like homologue identified from genomic DNA (AL031652).
Furthermore, this C-terminal region of human PAK5 contains a
sequence that is homologous to a G-protein beta subunit binding
site (Leeuw, T. et al. Nature, 391, 191-195 (1998) hereby
incorporated by reference herein in its entirety including any
figures, tables, or drawings). PAK5 has, therefore, the potential
to be activated by both, Cdc42 as well as G-protein-dependant
pathways.
[0371] V. Antibodies, Hybridomas, Methods of Use and Kits for
Detection of STE20-Related Kinases
[0372] The present invention relates to an antibody having binding
affinity to a kinase of the invention. The polypeptide may have the
amino acid sequence set forth in SEQ ID NO:5, SEQ ID NO:6, SEQ ID
NO:7, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:18, SEQ
ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:29, SEQ ID NO:97,
SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, or SEQ
ID NO:107, or a functional derivative thereof, or at least 9
contiguous amino acids thereof (preferably, at least 20, 30, 35, or
40 or more contiguous amino acids thereof).
[0373] The present invention also relates to an antibody having
specific binding affinity to a kinase of the invention. Such an
antibody may be isolated by comparing its binding affinity to a
kinase of the invention with its binding affinity to other
polypeptides. Those which bind selectively to a kinase of the
invention would be chosen for use in methods requiring a
distinction between a kinase of the invention and other
polypeptides. Such methods could include, but should not be limited
to, the analysis of altered kinase expression in tissue containing
other polypeptides.
[0374] The STE20-Related kinases of the present invention can be
used in a variety of procedures and methods, such as for the
generation of antibodies, for use in identifying pharmaceutical
compositions, and for studying DNA/protein interaction.
[0375] The kinases of the present invention can be used to produce
antibodies or hybridomas. One skilled in the art will recognize
that if an antibody is desired, such a peptide could be generated
as described herein and used as an immunogen. The antibodies of the
present invention include monoclonal and polyclonal antibodies, as
well fragments of these antibodies, and humanized forms. Humanized
forms of the antibodies of the present invention may be generated
using one of the procedures known in the art such as chimerization
or CDR grafting.
[0376] The present invention also relates to a hybridoma which
produces the above-described monoclonal antibody, or binding
fragment thereof. A hybridoma is an immortalized cell line which is
capable of secreting a specific monoclonal antibody.
[0377] In general, techniques for preparing monoclonal antibodies
and hybridomas are well known in the art (Campbell, "Monoclonal
Antibody Technology: Laboratory Techniques in Biochemistry and
Molecular Biology," Elsevier Science Publishers, Amsterdam, The
Netherlands, 1984; St. Groth et al., J. Immunol. Methods 35:1-21,
1980). Any animal (mouse, rabbit, and the like) which is known to
produce antibodies can be immunized with the selected polypeptide.
Methods for immunization are well known in the art. Such methods
include subcutaneous or intraperitoneal injection of the
polypeptide. One skilled in the art will recognize that the amount
of polypeptide used for immunization will vary based on the animal
which is immunized, the antigenicity of the polypeptide and the
site of injection.
[0378] The polypeptide may be modified or administered in an
adjuvant in order to increase the peptide antigenicity. Methods of
increasing the antigenicity of a polypeptide are well known in the
art. Such procedures include coupling the antigen with a
heterologous protein (such as globulin or .beta.-galactosidase) or
through the inclusion of an adjuvant during immunization.
[0379] For monoclonal antibodies, spleen cells from the immunized
animals are removed, fused with myeloma cells, such as SP2/0-Ag14
myeloma cells, and allowed to become monoclonal antibody producing
hybridoma cells. Any one of a number of methods well known in the
art can be used to identify the hybridoma cell which produces an
antibody with the desired characteristics. These include screening
the hybridomas with an ELISA assay, western blot analysis, or
radioimmunoassay (Lutz et al., Exp. Cell Res. 175:109-124, 1988).
Hybridomas secreting the desired antibodies are cloned and the
class and subclass are determined using procedures known in the art
(Campbell, "Monoclonal Antibody Technology: Laboratory Techniques
in Biochemistry and Molecular Biology", supra, 1984).
[0380] For polyclonal antibodies, antibody-containing antisera is
isolated from the immunized animal and is screened for the presence
of antibodies with the desired specificity using one of the
above-described procedures. The above-described antibodies may be
detectably labeled. Antibodies can be detectably labeled through
the use of radioisotopes, affinity labels (such as biotin, avidin,
and the like), enzymatic labels (such as horse radish peroxidase,
alkaline phosphatase, and the like) fluorescent labels (such as
FITC or rhodamine, and the like), paramagnetic atoms, and the like.
Procedures for accomplishing such labeling are well-known in the
art, for example, see Stemberger et al., J. Histochem. Cytochem.
18:315, 1970; Bayer et al., Meth. Enzym. 62:308-, 1979; Engval et
al., Immunol. 109:129-, 1972; Goding, J. Immunol._Meth. 13:215-,
1976. The labeled antibodies of the present invention can be used
for in vitro, in vivo, and in situ assays to identify cells or
tissues which express a specific peptide.
[0381] The above-described antibodies may also be immobilized on a
solid support. Examples of such solid supports include plastics
such as polycarbonate, complex carbohydrates such as agarose and
sepharose, acrylic resins and such as polyacrylamide and latex
beads. Techniques for coupling antibodies to such solid supports
are well known in the art (Weir et al., "Handbook of Experimental
Immunology" 4th Ed., Blackwell Scientific Publications, Oxford,
England, Chapter 10, 1986; Jacoby et al., Meth. Enzym. 34, Academic
Press, N.Y., 1974). The immobilized antibodies of the present
invention can be used for in vitro, in vivo, and in situ assays as
well as in immunochromotography.
[0382] Furthermore, one skilled in the art can readily adapt
currently available procedures, as well as the techniques, methods
and kits disclosed herein with regard to antibodies, to generate
peptides capable of binding to a specific peptide sequence in order
to generate rationally designed antipeptide peptides (Hurby et al.,
"Application of Synthetic Peptides: Antisense Peptides", In
Synthetic Peptides, A User's Guide, W. H. Freeman, NY, pp. 289-307,
1992; Kaspczak et al., Biochemistry 28:9230-9238, 1989).
[0383] Anti-peptide peptides can be generated by replacing the
basic amino acid residues found in the peptide sequences of the
kinases of the invention with acidic residues, while maintaining
hydrophobic and uncharged polar groups. For example, lysine,
arginine, and/or histidine residues are replaced with aspartic acid
or glutamic acid and glutamic acid residues are replaced by lysine,
arginine or histidine.
[0384] The present invention also encompasses a method of detecting
a STE20-related kinase polypeptide in a sample, comprising: (a)
contacting the sample with an above-described antibody, under
conditions such that immunocomplexes form, and (b) detecting the
presence of said antibody bound to the polypeptide. In detail, the
methods comprise incubating a test sample with one or more of the
antibodies of the present invention and assaying whether the
antibody binds to the test sample. Altered levels of a kinase of
the invention in a sample as compared to normal levels may indicate
disease.
[0385] Conditions for incubating an antibody with a test sample
vary. Incubation conditions depend on the format employed in the
assay, the detection methods employed, and the type and nature of
the antibody used in the assay. One skilled in the art will
recognize that any one of the commonly available immunological
assay formats (such as radioimmunoassays, enzyme-linked
immunosorbent assays, diffusion based Ouchterlony, or rocket
immunofluorescent assays) can readily be adapted to employ the
antibodies of the present invention. Examples of such assays can be
found in Chard ("An Introduction to Radioimmunoassay and Related
Techniques" Elsevier Science Publishers, Amsterdam, The
Netherlands, 1986), Bullock et al. ("Techniques in
Immunocytochemistry," Academic Press, Orlando, FL Vol. 1, 1982;
Vol. 2, 1983; Vol. 3, 1985), Tijssen ("Practice and Theory of
Enzyme Immunoassays: Laboratory Techniques in Biochemistry and
Molecular Biology," Elsevier Science Publishers, Amsterdam, The
Netherlands, 1985).
[0386] The immunological assay test samples of the present
invention include cells, protein or membrane extracts of cells, or
biological fluids such as blood, serum, plasma, or urine. The test
samples used in the above-described method will vary based on the
assay format, nature of the detection method and the tissues, cells
or extracts used as the sample to be assayed. Methods for preparing
protein extracts or membrane extracts of cells are well known in
the art and can be readily be adapted in order to obtain a sample
which is testable with the system utilized.
[0387] A kit contains all the necessary reagents to carry out the
previously described methods of detection. The kit may comprise:
(i) a first container means containing an above-described antibody,
and (ii) second container means containing a conjugate comprising a
binding partner of the antibody and a label. In another preferred
embodiment, the kit further comprises one or more other containers
comprising one or more of the following: wash reagents and reagents
capable of detecting the presence of bound antibodies.
[0388] Examples of detection reagents include, but are not limited
to, labeled secondary antibodies, or in the alternative, if the
primary antibody is labeled, the chromophoric, enzymatic, or
antibody binding reagents which are capable of reacting with the
labeled antibody. The compartmentalized kit may be as described
above for nucleic acid probe kits. One skilled in the art will
readily recognize that the antibodies described in the present
invention can readily be incorporated into one of the established
kit formats which are well known in the art.
[0389] VI. Isolation of Compounds Which Interact With STE20-Related
Kinases
[0390] The present invention also relates to a method of detecting
a compound capable of binding to a STE20-related kinase of the
invention comprising incubating the compound with a kinase of the
invention and detecting the presence of the compound bound to the
kinase. The compound may be present within a complex mixture, for
example, serum, body fluid, or cell extracts.
[0391] The present invention also relates to a method of detecting
an agonist or antagonist of kinase activity or kinase binding
partner activity comprising incubating cells that produce a kinase
of the invention in the presence of a compound and detecting
changes in the level of kinase activity or kinase binding partner
activity. The compounds thus identified would produce a change in
activity indicative of the presence of the compound. The compound
may be present within a complex mixture, for example, serum, body
fluid, or cell extracts. Once the compound is identified it can be
isolated using techniques well known in the art.
[0392] The present invention also encompasses a method of agonizing
(stimulating) or antagonizing kinase associated activity in a
mammal comprising administering to said mammal an agonist or
antagonist to a kinase of the invention in an amount sufficient to
effect said agonism or antagonism. A method of treating diseases in
a mammal with an agonist or antagonist of STE20-related kinase
activity comprising administering the agonist or antagonist to a
mammal in an amount sufficient to agonize or antagonize
STE20-related kinase associated functions is also encompassed in
the present application.
[0393] In an effort to discover novel treatments for diseases,
biomedical researchers and chemists have designed, synthesized, and
tested molecules that inhibit the function of protein kinases. Some
small organic molecules form a class of compounds that modulate the
function of protein kinases. Examples of molecules that have been
reported to inhibit the function of protein kinases include, but
are not limited to, bis monocyclic, bicyclic or heterocyclic aryl
compounds (PCT WO 92/20642, published Nov. 26, 1992 by Maguire et
al.), vinylene-azaindole derivatives (PCT WO 94/14808, published
Jul. 7, 1994 by Ballinari et al.),
1-cyclopropyl-4-pyridyl-quinolones (U.S. Pat. No. 5,330,992),
styryl compounds (U.S. Pat. No. 5,217,999), styryl-substituted
pyridyl compounds (U.S. Pat. No. 5,302,606), certain quinazoline
derivatives (EP Application No. 0 566 266 Al), seleoindoles and
selenides (PCT WO 94/03427, published Feb. 17, 1994 by Denny et
al.), tricyclic polyhydroxylic compounds (PCT WO 92/21660,
published Dec. 10, 1992 by Dow), and benzylphosphonic acid
compounds (PCT WO 91/15495, published Oct. 17, 1991 by Dow et
al).
[0394] Compounds that can traverse cell membranes and are resistant
to acid hydrolysis are potentially advantageous as therapeutics as
they can become highly bioavailable after being administered orally
to patients. However, many of these protein kinase inhibitors only
weakly inhibit the function of protein kinases. In addition, many
inhibit a variety of protein kinases and will cause multiple
side-effects as therapeutics for diseases.
[0395] Some indolinone compounds, however, form classes of acid
resistant and membrane permeable organic molecules. WO 96/22976
(published Aug. 1, 1996 by Ballinari et al.) describes hydrosoluble
indolinone compounds that harbor tetralin, naphthalene, quinoline,
and indole substituents fused to the oxindole ring. These bicyclic
substituents are in turn substituted with polar moieties including
hydroxylated alkyl, phosphate, and ether moieties. U.S. patent
application Ser. No. 08/702,232, filed Aug. 23, 1996, entitled
"Indolinone Combinatorial Libraries and Related Products and
Methods for the Treatment of Disease" by Tang et al. and
08/485,323, filed Jun. 7, 1995, entitled "Benzylidene-Z-Indoline
Compounds for the Treatment of Disease" by Tang et al. and
International Patent Publication WO 96/22976, published Aug. 1,
1996 by Ballinari et al., all of which are incorporated herein by
reference in their entirety, including any drawings, describe
indolinone chemical libraries of indolinone compounds harboring
other bicyclic moieties as well as monocyclic moieties fused to the
oxindole ring. Applications 08/702,232, filed Aug. 23, 1996,
entitled "Indolinone Combinatorial Libraries and Related Products
and Methods for the Treatment of Disease" by Tang et al.,
08/485,323, filed Jun. 7, 1995, entitled "Benzylidene-Z-Indoline
Compounds for the Treatment of Disease" by Tang et al., and WO
96/22976, published Aug. 1, 1996 by Ballinari et al. teach methods
of indolinone synthesis, methods of testing the biological activity
of indolinone compounds in cells, and inhibition patterns of
indolinone derivatives.
[0396] Other examples of substances capable of modulating kinase
activity include, but are not limited to, tyrphostins,
quinazolines, quinoxolines, and quinolines. The quinazolines,
tyrphostins, quinolines, and quinoxolines referred to above include
well known compounds such as those described in the literature. For
example, representative publications describing quinazolines
include Barker et al., EPO Publication No. 0 520 722 A1; Jones et
al., U.S. Pat. No. 4,447,608; Kabbe et al., U.S. Pat. No.
4,757,072; Kaul and Vougioukas, U.S. Pat. No. 5,316,553; Kreighbaum
and Comer, U.S. Pat. No. 4,343,940; Pegg and Wardleworth, EPO
Publication No. 0 562 734 A1; Barker et al., Proc. of Am. Assoc.
for Cancer Research 32:327 (1991); Bertino, J. R., Cancer Research
3:293-304 (1979); Bertino, J. R., Cancer Research 9(2 part
1):293-304 (1979); Curtin et al., Br. J. Cancer 53:361-368 (1986);
Fernandes et al., Cancer Research 43:1117-1123 (1983); Ferris et
al. J. Org. Chem. 44(2):173-178; Fry et al., Science 265:1093-1095
(1994); Jackman et al., Cancer Research 51:5579-5586 (1981); Jones
et al. J. Med. Chem. 29(6):1114-1118; Lee and Skibo, Biochemistry
26(23):7355-7362 (1987); Lemus et al., J. Org. Chem. 54:3511-3518
(1989); Ley and Seng, Synthesis 1975:415-522 (1975); Maxwell et
al., Magnetic Resonance in Medicine 17:189-196 (1991); Mini et al.,
Cancer Research 45:325-330 (1985); Phillips and Castle, J.
Heterocyclic Chem. 17(19):1489-1596 (1980); Reece et al., Cancer
Research 47(11):2996-2999 (1977); Sculier et al., Cancer Immunol.
and Immunother. 23:A65 (1986); Sikora et al., Cancer Letters
23:289-295 (1984); Sikora et al., Analytical Biochem. 172:344-355
(1988); all of which are incorporated herein by reference in their
entirety, including any drawings.
[0397] Quinoxaline is described in Kaul and Vougioukas, U.S. Pat.
No. 5,316,553, incorporated herein by reference in its entirety,
including any drawings.
[0398] Quinolines are described in Dolle et al., J. Med. Chem.
37:2627-2629 (1994); MaGuire, J. Med. Chem. 37:2129-2131 (1994);
Burke et al., J. Med. Chem. 36:425-432 (1993); and Burke et al.
BioOrganic Med. Chem. Letters 2:1771-1774 (1992), all of which are
incorporated by reference in their entirety, including any
drawings.
[0399] Tyrphostins are described in Allen et al., Clin. Exp.
Immunol. 91:141-156 (1993); Anafi et al., Blood 82:12:3524-3529
(1993); Baker et al., J. Cell Sci. 102:543-555 (1992); Bilder et
al., Amer. Physiol. Soc. pp. 6363-6143:C721-C730 (1991); Brunton et
al., Proceedings of Amer. Assoc. Cancer Rsch. 33:558 (1992);
Bryckaert et al., Experimental Cell Research 199:255-261 (1992);
Dong et al., J. Leukocyte Biology 53:53-60 (1993); Dong et al., J.
Immunol. 151(5):2717-2724 (1993); Gazit et al., J. Med. Chem.
32:2344-2352 (1989); Gazit et al., "J. Med. Chem. 36:3556-3564
(1993); Kaur et al., Anti-Cancer Drugs 5:213-222 (1994); Kaur et
al., King et al., Biochem. J. 275:413-418 (1991); Kuo et al.,
Cancer Letters 74:197-202 (1993); Levitzki, A., The FASEB J.
6:3275-3282 (1992); Lyall et al., J. Biol. Chem. 264:14503-14509
(1989); Peterson et al., The Prostate 22:335-345 (1993); Pillemer
et al., Int. J. Cancer 50:80-85 (1992); Posner et al., Molecular
Pharmacology 45:673-683 (1993); Rendu et al., Biol. Pharmacology
44(5):881-888 (1992); Sauro and Thomas, Life Sciences 53:371-376
(1993); Sauro and Thomas, J. Pharm. and Experimental Therapeutics
267(3):119-1125 (1993); Wolbring et al., J. Biol. Chem.
269(36):22470-22472 (1994); and Yoneda et al., Cancer Research
51:4430-4435 (1991); all of which are incorporated herein by
reference in their entirety, including any drawings.
[0400] Other compounds that could be used as modulators include
oxindolinones such as those described in U.S. patent application
Ser. No. 08/702,232 filed Aug. 23, 1996, incorporated herein by
reference in its entirety, including any drawings.
[0401] VII. Biological Significance, Applications and Clinical
[0402] Relevance of Novel STE20-Related Kinases
[0403] Human STLK2, STLK3, STLK4, STLK5, STLK6, and STLK7
[0404] STLK2, STLK4, STLK5, STLK6 and STLK7 belong to an expanding
family of intracellular STKs that have varying degrees of sequence
homology to SOK-1, a kinase implicated in oxidative stress agents
(Pombo, CM et al, EMBO J. (17) 4537-4546, 1996). Our data shows
that STLK2 is expressed highly in hematopoietic cells. Therefore,
STLK2 may participate in the oxidative response pathway during
inflammation. In addition, STLK2 could also be a possible component
in the signaling pathways leading to T cell activation. High levels
of STLK2 in several tumor cell lines could also imply that STLK2
might be involved in tumorigenesis.
[0405] STLK2 is most closely related to two human STE20-subfamily
kinases: MST3 and SOK-1. MST3 is a 52,000 daltons cytoplasmic
kinase that is ubiquitously expressed with its highest levels of
expression found in heart, skeletal muscle and pancreas. The
serine/threonine kinase activity of MST3 is activated by
phosphorylation. Unlike SOK-1, MST3 prefers Mn.sup.++ over
Mg.sup.++ and can use both GTP and ATP as phosphate donors. MST3
may undergo dimerization. No agonists have yet been identified that
activate MST3. The downstream signaling mechanism of this kinase is
unknown (Schinkmann, K and Blenis, J. (1997) J. Biol. Chem. 272,
28695-28703).
[0406] SOK-1 is a 50,000 daltons cytoplasmic kinase expressed
predominantly in testis, large intestine, brain and stomach and to
a lesser extent in heart and lung. SOK-1 is also expressed in the
germinal center B-cell line (RAMOS) and in a mature B cell line (HS
Sultan). The serine/threonine kinase activity of SOK-1 is activated
by phosphorylation. The C-terminus of SOK-1 has been shown to be
inhibitory to the catalytic activity of this kinase. The only
agonists known to activate SOK-1 are oxidant agents, like
H.sub.2O.sub.2 and menadione, a quinone that is a potent
intracellular generator of reactive oxygen species (Pombo, C. M. et
al. EMBO J. 15, 4537-4546). SOK-1 is also activated by chemical
anoxia through the generation of reactive oxygen species and
release of calcium into the cytoplasm from intracellular stores.
SOK-1, therefore, may play an important role in ischemia, the cause
of myocardial infarction, stroke and acute renal failure (Pombo, C.
M. et al. J. Biol. Chem. 272, 29372-29379 (1997)). The activity of
SOK-1 in the response to oxidant stress is inversely correlated
with the activity of the stress-activated protein kinases (SAPKs):
elevated SOK-1 activity correlates with absent SAPK activity and
vice-versa. SOK-1 does not activate any of the four MAP kinase
pathways, SAPKs, p38, ERK-1 or MEK-5/ERK-5 (Pombo, C. M. et al.
EMBO J. 15, 4537-4546). The downstream signaling mechanism of this
kinase remains unknown.
[0407] STLK2 is expressed in a wide variety of immune cell types
and tissues including thymus, dendrocytes, mast cells, monocytes, B
cells (primary, Jurkat, RPMI, SR), T cells (CD8/CD4+, TH1, TH2,
CEM, MOLT4) and megakaryocytes (K562), whereas STLK3 is restricted
to thymus and STLK4 is predominately expressed in thymus, T cells
(CD4/CD8+, TH1, CEM) and B cells (Jurkat, RPMI). Consequently,
these STKs might participate in the oxidative response pathway
during inflammation, reperfusion injury (stroke, surgery, shock),
TNF.alpha.-mediated signaling, insulin desensitization,
atherogenesis, vascular injury, T or B cell costimulation, or
alternatively, participate in other MAPK-related signal
transduction processes.
[0408] STLK5 is more distantly related to this STE20-subfamily
including SOK-1 and STLK2, STLK3 and STLK4. STLK5, may therefore
mediate a signaling pathway that is distinct from the oxidative
stress response pathway.
[0409] The high degree of sequence homology in the C-termini of
SOK-1, STLK2, STLK3, STLK4, STLK5, and STLK6 raises the possibility
that these novel STKs, like SOK-1, may be subject to autoinhibition
through a conserved C-terminal motif.
[0410] Human ZC1, ZC2, ZC3 and ZC4
[0411] ZC1 is a good candidate for any disease in which tyrosine
kinase, cytokine, or heterotrimeric G-protein coupled receptors
have been implicated. The mouse homologue binds to NCK, and is
recruited to activated PDGF (Su et al., EMBO 16: 1279-1290, 1997).
The Drosophila homolog has been shown to bind to TRAF2, implicating
it in TNF-.alpha. signaling (Liu et al., (1999) Curr. Biol.
9:101-104, 1999)). While ZC1 does not contain the exact NCK- and
TRAF2-binding domains, it is likely to bind to related
proteins.
[0412] Of the ZC subfamily of STE20-related protein kinases, ZC1
has very broad over-expression in many tumor types, suggesting that
it may be involved in cellular growth, transformation, or tumor
progression. A truncated form of ZC1 containing only the C-terminal
putative MEKK1-binding domain was found to reduce the number of
foci generated by H-Ras-V12 in Rat Intestinal Epithelial cells
(RIE-1). These data indicate that ZC1 may play a role in the
ability for these cells to overcome contact inhibition and
anchorage-dependent growth.
[0413] The ZC1 homolog, Misshapen (msn) in Drosophila melanogaster
was cloned as a result of complementing a mutation in a
developmental pathway required for dorsal closure, a process
involving changes in cell shape and position in the embryo
(Treisman et al. Gene 186 119-125, 1997). A D. melanogaster homolog
of the JNK1/JNK2 kinases from mammals was shown to function
downstream of msn in the dorsal-closure signaling pathway (Su et
al. Genes Dev. 12:2371-2380, 1998).
[0414] While ZC1 could be involved in multiple aspects of
tumorigenesis, by analogy with Drosophila, the role of misshapen in
dorsal closure suggests a critical role in the regulation of the
cytoskeleton for the processes of cell attachment, cell movement
and perhaps migration.
[0415] The association of the ZC1 family members msn and NIK with
TRAF2 may indicate a role for this kinase in cell survival and/or
in apoptosis. The ZC1 family contains a highly conserved domain
that in the mouse homolog, NIK, has been shown to bind to MEKK1
(Mitogen-activated/Extracel- lular-regulated Kinase Kinase 1) (Su
et al., (1997) EMBO 16(6): 1279-90). MEKK1 is involved in cell
survival and/or apoptosis in several systems (Schlesinger et al.,
Front. Biosci.3:D1181-6, 1998). Depending on the context, MEKK1
appears to be upstream of either the ERK1/MAPK or the JNK/SAPK
pathway [Schlesinger et al., (1998 Front. Biosci. 3:D1181-6). Three
homologues of ZC1: murine NIK (NCK-interacting kinase)(Su et al.
EMBO 16:1279-90, 1997), Drosophila msn (Liu et al. Curr. Biol.
9:101-104, 1999) and human HGK (HPK/GCK-like kinase)(Yao et al., J.
Biol. Chem. 274:2118-25, 1999) have all been shown to activate the
JNK pathway when over-expressed in 293T cells.
[0416] ZC1 shares a high degree of homology with these other family
members in both the kinase domain and the "MEKK"-binding domains,
yet it differs in the intervening region, which contains several
putative binding domains for upstream signaling adapter molecules
(e.g. NCK, TRAF2). Unlike the other family members, ZC1 does not
appear to activate the JNK pathway in 293T cells as seen by its
ability to induce expression of either a JUN or ATF2-driven
luciferase gene. Upon co-transfection into these cells with
HA-tagged JNK, modest activation of JNK was detected. ZC1 also
modestly activated co-transfected ERK1. Both the ERK and the JNK
activation were very slight compared with the positive controls in
the assay (activated forms of MEK1 and MEKK1, respectively). In
both cases, activation required the full-length kinase. While the
kinase domain alone is up to 5.times. more active in
autophosphorylation and in phosphorylation of MBP, it does not lead
to activation of these potential downstream kinases. Based on the
strong sequence homology of ZC1 with the other family members, it
is very likely that ZC1 will be important for either JNK or ERK
activation once the proper context is found.
[0417] ZC1 profoundly inhibits ERK1 kinase expression in
co-transfection assays. This effect is dependent on ZC1 kinase
activity, occurring with the wild-type and the kinase domain alone,
but not with the kinase-dead mutant even though all three forms of
ZC1 are expressed at similar levels. This may suggest a role for
this kinase in transcriptional or post-transcriptional
regulation.
[0418] ZC1 may be an important component in the signaling pathways
mediated by the co-stimulatory receptor CD28 in T cells and/or by
the pro-inflammatory cytokine TNF.alpha., since co-transfection of
the wild-type ZC1 activated the RE/AP-luciferase and
NF.kappa.B-luciferase reporter genes. While our data showed that
ZC1 strongly activates NF.kappa.B in T-cells, no activation of
NF.kappa.B driven luciferase was detectable in NIH 3T3 cells. A
recent paper (J. Biol. Chem. 274:2118-25; 1999.) has shown that a
human ZC1 splicing isoform, HGK, is involved in the
TNF.alpha.-signaling pathways.
[0419] Given the importance of T cell activation in autoimmunity
and transplantation, as well as the key role that TNF.alpha. plays
in inflammatory diseases, it is possible that ZC1 could be a
therapeutic target for immunological diseases which include but are
not limited to: rheumatoid arthritus, chronic inflammatory bowel
diseases (ie Crohn's disease), chronic inflammatory pelvic disease,
multiple sclerosis, asthma, osteoarthritis, psoriasis,
atherosclerosis, rhinitis, and autoimmunity as well as organ
transplantation and cardiovascular diseases.
[0420] ZC1 appears to be the human orthologue of murine NIK and
possibly an orthologue of a C. elegans STE20-subfamily kinase
encoded by the ZC504.4 cosmid.
[0421] Murine NIK is a 140,000 daltons kinase that is most highly
expressed in brain and heart. NIK interacts with the SH3 domains of
the adaptor molecule Nck through its proline-rich regions found in
the C-terminal extra-catalytic region. The specific regions that
mediate this interaction are two PxxP (SEQ ID NO: 148) motifs that
are nearly uniformly conserved between NIK, ZC1,2,3 and the C.
elegans STE20 ZC504.4 kinase. In addition, NIK binds MEKK1 through
its 719 amino acid C-terminal (Su, Y-C. et al. (1997) EMBO J. 16,
1279-1290). MEKK1 is a membrane-associated kinase responsible for
activating MKK4 (also known as SEKI), which in turn activates SAPK
(Yan, M et al. (1994) Nature, 372, 798-800). NIK may function as a
kinase that links growth factor activated pathways and the
stress-response pathway mediated by SAPKs. According to this
hypothesis, activation of growth factor receptors leads to receptor
tyrosine phosphorylation, Nck binding to the phosphorylated
tyrosines via its SH2 domain, NIK redistribution to a membrane
compartment via binding to the SH3 domain of Nck, and juxtaposition
to the membrane-associated MEKK1. The NIK-MEKK1 interaction would,
in this fashion, turn on the SAPK pathway in response to growth
factor stimulation (Su, Y-C. et al. (1997) EMBO J. 16,
1279-1290).
[0422] Given the high homology between ZC1, ZC2, ZC3, and ZC4 STKs
and NIK, it is conceivable that these kinases may each function to
connect growth factor- and stress-activated signaling pathways. The
heterogeneity that the ZC kinases exhibit within their putative
SH3-binding domain could provide signaling specificity in terms of
the nature of the adaptor molecule that they bind. The high level
of sequence conservation in the C-termini of the ZC1, ZC2 and ZC3
strongly suggests that these human kinases, like murine NIK, also
may bind to MEKK1 and activate SAPKs. The ZC kinases also display
strong homology at their C-termini to protein domains that bind
small GTPase proteins such as Rab, Rho and Rac. For example, the
C-termini of ZC1 is 36.2% identical to citron, a murine Rho-binding
protein, and 23.1% identical to the rab-binding region of GC
kinase. This suggests that, in addition to adaptor molecules, small
GTPase proteins may also mediate membrane association and
activation of the ZC kinases. The presence of a potential
coiled-coil region located immediately C-terminal to the catalytic
region strongly suggests that the ZC kinases may also be subject to
regulation via homo or heterodimerization events.
[0423] The C. elegans STE20 ZC504.4 kinase is the product of the
mig-15 gene. The product of this gene has been implicated in
several developmental processes such as epidermal development, Q
neuroblast migrations and muscle arm targeting in the developing
worm (Zhu, X. and Hedgecock E. (1997) Worm Breeder's Gazette 14,
76). The high level of sequence conservation between the ZC kinases
and the ZC504.4 C. elegans kinase will make C. elegans a valuable
model organism to study, through epistatic analysis, the signaling
properties of the human ZC kinases.
[0424] Human KHS2
[0425] KHS1 (kinase homologous to SPS1/STE20) is a 100,000 dalton
cytoplasmic STK that is expressed ubiquitously. KHS1 has been
implicated in the mechanism of SAPK activation in response to
inflammatory cytokines such as TNF.quadrature. as well as to
ultraviolight light, which also uses the TNF signaling pathway.
TNF.quadrature. binding to its receptors (TNFR1 and TNFR2) results
in the sequential association with the receptor C-tail of multiple
signaling molecules including TNFR1-associated death domain protein
(TRADD), Fas-associated death domain protein (FADD or MORT1),
TNFR-associated factor 2 (TRAF2), and the STK RIP (receptor
interacting protein). The TRADD-TRAF2 interaction is mediated by a
conserved region present at the C-terminus of TRAF2, the TRAF
domain. Activation of the NF.kappa.B and SAPK pathways is mediated
by the ring finger motif present at the N-terminus of TRAF2 (Curr.
Opinion in Cell. Biol. (1997) 9:247-251). KHS1 is activated by
TNF.alpha.stimulation in a TRAF2-dependant manner and inhibition of
KHS1 blocks TNF.alpha.-induced SAPK activation but not
NF.quadrature.B activation. The mechanism by which TRAF2 activates
KHS1 is not known. Cotransfection of TRAF2- and KHS1-expressing
constructs in 293T cells failed to reveal a direct association
between these two molecules. KHS1 activates the SAPK pathway by a
direct association with the constitutively active kinase MEKK1.
MEKK1 subsequently activates SEK1, which in turn activates SAPK.
Neither the MAPK nor the p38 kinase pathways are activated by KHS1
(Shi, C-S and Kehrl. J. H. (1997) J. Biol. Chem. 272, 32102-32107).
In addition to its catalytic domain, downstream signaling of KHS1
requires its conserved C-terminus (Diener, K. et al (1997) Proc.
Natl. Acad. Sci. 94, 9687-9692).
[0426] GCK (germinal center kinase) is a constitutively active
97,000 dalton STK that is broadly expressed. GCK may participate in
B-cell differentiation since its expression is localized to the
germinal center within lymphoid follicles. GCK activates the SAPK
pathway in response to TNF.alpha. via activation of SEK1. The
upstream activators of GCK in response to cytokines as well as the
immediate downstream target of this kinase are unknown. The
C-terminus of GCK is sufficient to activate SEK1 (Pombo, C. M. et
al (1995) Nature, 377, 750-754).
[0427] The murine orthologue of GCK, rab8ip (rab8-interacting
protein), is a 97,000 dalton protein that fractionates with both
the soluble cytoplasmic fraction as well as with a salt-sensitive
fraction associated with the basolateral membrane of the
trans-Golgi region in polarized MDCK epithelial cells. The
C-terminus of rab8ip binds to rab8, a small GTP-binding protein
required for vesicular transport from the Golgi apparatus (Ren, M.
et al. (1996) Proc. Natl. Acad. Sci. 93, 5151-5155). In addition to
inducing the transcriptional activation of cytokines like IL2 via
SAPK, GCK may also promote the rab-dependent release of secretory
proteins in response to TNF.alpha.(Buccione, R. et al (1995) Mol.
Bio. Cell 6, 291).
[0428] HPK1 (hematopoietic protein kinase) is a constitutively
active 90,000 dalton STK restricted to hematopoietic cells. HPK1
activates the SAPK pathway by directly binding to and activating
MEKK1 (Hu, M. et al (1996) Genes and Dev. 10:2251-2264) as well as
the ubiquitously expressed mixed-lineage kinase MLK-3 (Kiefer, F.
et al (1996) EMBO J. 15:7013-7025). This function of HPK1 requires,
in contrast to GCK, both its kinase domain as well as its
C-terminus. The upstream activators of HPK1 remain unknown. HPK1
also plays a key role as a mediator of transforming growth
factor-.beta.-(TGF.beta.) signaling. HPK1 activates the
TGFb-activated kinase (TAK), which in turn stimulates the SAPK
pathway by phosphorylating SEK1 (Wang W. et al (1997) J. Biol.
Chem. 272:22771-22775).
[0429] KHS2 is expressed in thymus, dendrocytes and monocytes. KHS2
could have a complementary function to that of KHS1 as a mediator
of SAPK activation in the cellular response to inflammatory
cytokines. KHS2 could have the potential to interact directly with
TRAF2 since a STK with the predicted molecular weight of KHS2
(approximately 101,000 daltons) is found in the TNFR-TRAF2 complex
upon TNF.quadrature. stimulation (VanArsdale, T. and Ware, C. F.
(1994) J. Immunol. 153, 3043-3050). The presence of a putative
binding domain for Rab or a Rab-like molecule at the C-terminus of
KHS2 indicates that KHS2, in addition to having a potential role in
the TRAF2-dependant TNF.alpha. cytokine response, could also
mediate signaling events that utilize small GTPase proteins.
Alternatively, the binding of a small GTPase protein to the
C-terminus of KHS2 may be required for its potential
TRAF2-dependant signaling to a downstream kinase such as MEKK1.
[0430] Human GEK2, SULU1 and SULU3
[0431] A recent report (Y-W Qian et al., Science
282:1701-1704,1998) described xPlkk1 as the activator of Plx1 (the
Xenopus Polo kinase). In Xenopus oocytes, the STK Plkk1 can
phosphorylate and activate Plx1 STK (the mammalian Polo kinase or
PLK). A dominant-negative (kinase-dead) form of xPlkk1 prevents
Plx1 activation and delays germinal vesicle breakdown. Yet another
unidentified kinase is probably responsible for xPlkk1 activation
during mitosis.
[0432] The homology through the entire length of the xPlkk1 protein
with GEK2 suggests that GEK2 might represent the human homologue
for xPlkk1. Based on this, GEK2 might be upstream of PLK in
mammalian cells. In addition, based on the phage display screen
results using the SULU1 coiled-coil2 domain as bait, SULU1 might
also interact in vivo with GEK2 and therefore regulate GEK2 (and/or
SLK through the coiled-coil domain) activation leading to PLK
activation and mitosis.
[0433] If such a cascade of events is required for mitosis in
mammalian cells, interruption of this signaling cascade at any
point might block mitosis and could be beneficial for cancer
treatment.
[0434] A recently cloned STE20-subfamily kinase, rat TAO1, is most
likely the rodent orthologue of human SULU3 (Hutchinson, M. et al.
J. Biol. Chem 273:28625-28632, 1998). TAO1 activates MEK3, 4 and 6
in vitro, while in transfected cells it associates and activates
only MEK3, resulting in phosphorylation and activation of p38.
These results implicate TAO1 (SULU3) in the regulation of the p38
containing stress-responsive MAP kinase pathway.
[0435] Human SULU1 is weakly expressed in hematopoietic sources
whereas SULU3 is found in B-cells and TH1-restricted T cells. These
mammalian SULU STKs display strong homology to the C. elegans SULU
kinase. The role that this kinase plays in nematode development is
unknown. The strong sequence homology between the catalytic domain
of mammalian SULU kinases and other STE20-subfamily kinases such as
SOK-1 (human STE20) and KHS2 suggests that the mammalian kinases
may participate in the stress-response pathway. The potential
coiled-coil domains found at the C-terminus of the SULU kinases may
play a role in the regulation of this kinase.
[0436] Murine LOK (lymphocyte-oriented kinase) is a constitutively
activated STK of approximately 130,000 daltons that is
predominantly expressed in spleen, thymus and bone marrow
(Kuramochi, S. et al (1997) J. Biol. Chem. 272: 22679-22684) as
well as in meiotic testicular and primordial germ cells. The LOK1
gene is located in chromosome 11 of the mouse near the wr locus, a
region that is associated with reproductive and neurological
defects (Yanagisawa, M. et al (1996) Mol. Reprod. and Dev.
45:411-420). LOK does not activate any of the known MAPK pathways
(ERK, JNK and p38) nor the NF.kappa.B pathway. The upstream
signaling elements of LOK as well as the extracellular stimuli that
utilize this kinase to elicit a biological response are also
unknown (Kuramochi, S. et al (1997) J. Biol. Chem. 272:
22679-22684).
[0437] Human GEK2 is highly related to murine LOK, but based on
sequence divergence in the non-catalytic domain, it appears to be a
distinct member of this STE20-subfamily. GEK2 may signal through a
pathway that remains to be defined. The presence of potential
coiled-coil regions at the C-terminus of GEK2 could play a key role
in regulating the functions of this kinase.
[0438] Human PAK4 and PAK5
[0439] The p21 activated protein kinases (PAK) are a closely
related subgroup of the STE20 family of serine/threonine kinases.
Extensive genetic and biochemical analysis of the budding yeast
STE20 has shown the critical role this serine/threonine kinase
plays at the juncture of several important intracellular pathways
required to appropriately respond to extracellular signals. STE20
links the transcriptional response by mediating the activation of
the appropriate downstream MAPK pathway as well as coupling changes
in cellular morphology via its control of the actin
cytoskeleton.
[0440] A hallmark of the PAK subgroup is their small G
protein-binding domain (PBD) that confers G protein-dependent
activation upon this group of kinases. Via the PBD, PAKs bind to
activated small G proteins resulting in the derepression of the
PAK's intrinsic kinase activity.
[0441] Until recently, there were three known PAK kinases: PAK1, a
68 kD protein whose expression is restricted expression to brain,
muscle, and spleen; PAK2 (PAK1, PAK65), a 62 kD protein whose
expression is ubiquitous; and PAK3, a 65kD protein whose expression
is restricted to the brain. Similar to STE20, the mammalian PAKs
(1,2, and 3) have been shown to respond to extracellular signals
(growth factors, mitogens, cytokines and a variety of cellular
stresses) (Bagrodia, et al. (1995). J. Biol. Chem. 270:
22731-22737; Zhang, S., et al. (1995). J. Biol. Chem. 270:
23934-23936, Frost, J. et al. (1998) J. Biol. Chem. 273:
28191-28198; Galisteo, M. et al. (1996) J. Biol. Chem. 271:
20997-21000), and are linked to TCR activation (Yablonski, D., et
al. (1998) EMBO J. 17: 5647-5657), and heterotrimeric G
protein-coupled receptors (Knaus, U. et al. (1995) Science 269:
221-223).
[0442] The PAKs were originally identified as effectors for members
of the Rho family of small G proteins (such as Rac and Cdc42),
hence their name, p21-activated kinases (PAK) (Manser et al Nature
367:40-46). The recruitment of the PAKs to the appropriate
intracellular location is critical to their function. Attempts to
elucidate the role played by PAKs in intracellular signaling and
morphological changes is complicated due to the complex
interactions by which they can be recruited by such factors as
activated small G proteins (rac, cdc42), adaptors (nck) and
exchange proteins (PIX, Cool).
[0443] The adaptor molecule, Nck, is constitutively bound via its
SH3 domain to the proline-rich motif in the N-terminal portion of
PAK1. Binding of the Nck-PAK complex to activated growth factor
receptors in response to growth factor stimulation provides a
mechanism to link growth factor-stimulated and stress-response
pathways (Galisteo, M. et al. (1996) J. Biol. Chem.
271:20997-21000).
[0444] The PBD found at the N-terminus of PAK1 is responsible for
its high-affinity interaction with the GTP-bound forms of Cdc42 and
Rac (Burbelo, P. et al. (1995) J. Biol. Chem. 270:29071-29074). The
exact mechanism through which the small GTPases activate PAKs may
involve, in part, association of the kinase with activated growth
factor receptors through guanine nucleotide exchange factors
(GEFs). GEFs activate small GTPases by catalyzing the formation of
their GTP-bound state, thereby promoting their association with,
and activation of, PAKs. The known mammalian PAK kinases, as well
as Drosophila and C. elegans PAKs, all conserve an N-terminal
extracatalytic motif responsible for a high-affinity interaction
with the GEF, PIX. The PAK-Cdc42 interaction and subsequent PAKs
occurs as a PIX/PAK complex (Manser, E. et al. (1998) Molecular
Cell, 1, 183-192).
[0445] PAK signaling stimulated by heterotrimeric G proteins is
mediated through the interaction between a short conserved amino
acid region located at the C-terminus of PAK1 with the G-protein
.beta.-subunit (Leeuw, T. et al.(1998) Nature, 391: 191-195).
[0446] A variety of studies have indicated that the human PAKs are
involved in mediating the activation of stress-activated protein
kinase pathways (JNK and to lesser extent p38). PAKs are also
potential mediators in the crosstalk between the pathways regulated
by the Rho family of small G proteins and the signaling pathways
directly downstream of Ras leading to the activation of the ERK
pathway (Bagrodia, et al. (1995). J. Biol. Chem. 270: 22731-22737;
Zhang, S., et al. (1995). J. Biol. Chem. 270: 23934-23936; Brown,
J., et al. (1996) Curr Biol. 6:598-60596; Frost, J., et al. (1996).
Mol. Cell. Biol. 16: 3707-3713).
[0447] PAK1 has been implicated in phosphorylating a regulatory
site in MEK1 that is necessary for MEK1's ability to interact with
Raf1 (Frost, et al. (1997) EMBO J. 16:6426-6438). PAK3 has been
shown to phosphorylate Raf1 on a site that is important for Raf1
activity (King, A., et al. (1998). Nature 396: 180-183).
[0448] PAKs play an important role in controlling morphological
changes in cell shape mediated by the actin cytoskeleton. Such
morphological changes are required for cellular functions ranging
from cell division and proliferation to cell motility and vesicle
transport. PAK activity has been implicated in the localized
assembly (leading edge) and disassembly (retracting edge) of focal
adhesions necessary for cell motility (Frost J. et al (1998) J.
Biol. Chem. 273:28191-28198).
[0449] PAK2 may have a role in the morphological changes induced
during apoptosis (Membrane and morphological changes in apoptotic
cells regulated by caspase-mediated activation of PAK2. (Rudel, T.
(1997) Science. 276:1571-4)), and PAK1 maybe important in
preventing apoptosis (Faure S, et al. (1997) EMBO J. (1997)
16:5550-61). In addition to overcoming mitogen- and
anchorage-independent growth, tumor cells need to escape the
programmed cell death that accompanies deregulated cell growth.
Thus, inhibition of PAKs may be effective in triggering apoptosis
in tumors.
[0450] A direct requirement for PAKs in the transformation of
mammalian cells has been shown for PAK1 and PAK2. Kinase-dead
alleles of PAK1 block ras transformation of RAT1 and Schwann cells
(Tang, Y., et al. (1997) Mol. Cell. Biol. 17, 4454-4464).
Dominant-negative alleles of PAK2 have been shown to interfere with
ras-mediated transformation of mammalian cells (Osada, S., (1997)
FEBS Lett 404:227-233)
[0451] Mutations in PAK3 have been implicated in nonsyndromic
X-linked mental retardation suggesting a role for PAK3 in cognitive
function (Allen, K. et al. (1998) Nat. Genet. 20: 25-30). PAK1 has
been implicated in neurite outgrowth in PC12 cells (Daniels, R. et
al. (1998) EMBO J. 17: 754-764; Nikolic, M. et al. (1998) Nature
395:194-198).
[0452] Finally, PAK-like STKs may also play a role in AIDS
pathogenesis since the myristoylated 27kD membrane-associated HIV
Nef gene product directly interacts with and activates these
kinases via cdc42 and Rac. The Nef-mediated activation of PAK-like
STKs correlates with the induction of high viral titers and the
development of AIDS in infected hosts (Cullen, B. R. (1996) Curr.
Biol. 6:1557-1559).
[0453] Our results show that PAK4 is expressed in thymus,
dendrocytes, mast cells, monocytes, as well as in T cells
(TH2-restricted cells and MOLT4) and the B cell line RPMI. PAK5 is
found in mast cells and in the T cell line MOLT4. These data
suggest potential roles for PAK4 and PAK5 in the immune system.
[0454] PAK4 and PAK5 share with the known PAKs a potential
cdc42-binding motif at their N-termini. Both PAK4 and PAK5 display
sequence homology in their C-termini to a motif responsible for an
interaction between PAK1 and the .beta.-subunit of heterotrimic
G-proteins (amino acid residues 665-676 in PAK 4, and amino acid
residues 386-398 in PAK5). Consequently, PAK4, and possibly PAK5,
could mediate signaling events originating from growth factors as
well as from ligands that stimulate G-protein-linked receptors.
[0455] PAK4 conserves a leucine (leu 44), that when mutated to a
phenylalanine renders the kinase activity of human PAK1
constitutively active, bypassing its cdc42-binding requirement for
activation (Brown J. et al (1996) Current Biol. 6:598-605). PAK5
contains an isoleucine at the equivalent position. Therefore, the
mechanism by which cdc42 potentially activates human PAK1, PAK4,
and possibly PAK5, may be very similar.
[0456] PAK4 and PAK5 however, lack the PIX-binding motif, and
consequently cdc42-activating GEFs other than PIX (for example Db1
and Cool) must be responsible for the activation of these kinases.
Alternatively, PAK4 and PAK5 may be activated by another GTPase,
such as Rac1 which uses the Tiam1 GEF for its activation to the
GTP-bound state.
[0457] PAK4 and PAK5 also lack the PxxP (SEQ ID NO: 148) motif
responsible for the Nck-PAK1 association. Between the PBD or
cdc42-binding N-terminal motifs and the putative GEF-binding
regions, PAK4 and PAK5 have long insertions (185 and 123 amino
acids for PAK4 and PAK5, respectively) relative to PAK1. This
region probably confers different binding characteristics to
adaptor molecules and/or GEFs from those exhibited by known
mammalian PAKs.
[0458] PAKs have been shown to be upstream in pathways leading to
activation of both the JNK (Bagrodia, S., et al. (1995) J. Biol.
Chem. 270: 22731-22737) and ERK kinase pathways (Brown, J., et al.
(1996). Curr Biol. 6:598-605). PAK1 was shown to synergize with ras
in activation of the ERK pathway through phosphorylation of MEK1
(Frost, J. et al. (1997). EMBO J. 16:6426-6438). Our data shows
that MEK1 serves as an in vitro substrate for PAK4, suggesting a
potential role for PAK4 in the activation of the ERK pathway and
mitogenesis.
[0459] PAK5 may also have a mitogenic role, and be linked to
cancer, based on its expression profile (elevated RNA and protein
levels in a wide variety of tumor cell lines), its interaction with
cdc42 via its PBD, and the ability of a kinase-dead allele (Lys350,
351 Ala) to block ras transformation of NIH3T3 cells. Thus, a
screen for small molecule inhibitors of PAK5 kinase activity may
yield compounds with therapeutic potential for intervention in
cancer derived from a wide variety of tissue types.
[0460] PAK4 and PAK5 may also play a role in HIV pathogenesis as
potential mediators of Nef signaling, since none of the known PAKs
correspond to the PAK-like kinase shown to interact with, and be
activated by, the HIV nef protein (Lu, X. et al. (1996) Current
Biology 6:1677-1684)
[0461] The 3' untranslated region of PAK4 contains a CA repeat that
is prone to undergo expansion. CA dinucleotide repeat instability
has been associated with disease (Toren, M. Z. et al (1998) Am. J.
Hematol. 57: 148-152), and expansion of such repeat in the 3'
untranslated region of PAK4 could implicate this kinase in as yet
unknown pathologies.
[0462] Clinical Applications
[0463] Human STLK2, STLK3, STLK4, STLK5, STLK6, and STLK7
[0464] STLK3, STLK5, STLK6 and STLK7, as well as other homologues
of the STLK subfamily of STE20 protein kinases such as STLK4, may
play an important role as mediators of the immune response. Thus,
they are targets for the development of specific small molecule
inhibitors to treat immunological diseases, including, but not
limited to, rheumatoid arthritis, chronic inflammatory bowel
diseases (e.g. Crohn's disease), chronic inflammatory pelvic
disease, multiple sclerosis, asthma, osteoarthritis, psoriasis,
atherosclerosis, rhinitis and autoimmunity, as well as in organ
transplantation. Other diseases include cardiovascular
diseases.
[0465] The human STLKs may also play an important role in cell
growth regulation. Thus, they are targets for developing small
molecule kinase inhibitors for the treatment of cancer and
metastases. STLK5 maps to a chromosomal region frequently amplified
in a variety of tumors including those from non-small cell lung
cancer, breast cancer and peripheral nerve tumors. This suggests
that STLK5 could play a role in the development, maintenance, or
progression of human tumors.
[0466] The potential role of human STLKs 2,3, and 4 in mediating
oxidative stress strongly suggests that drugs targeting these
kinases could prove useful in the treatment of myocardial
infarction, arrhythmia and other cardiomyopathies, stroke, renal
failure, oxidative stress-related neurodegenerative disorders such
amyotrophic lateral sclerosis, Parkinson's disease and Leigh
syndrome, a necrotizing mitochondrial encephalopathy, as well.
[0467] Human ZC1, ZC2, ZC3, and ZC4
[0468] ZC1 may be a component of the CD28-signaling pathway and
therefore important in T cell activation. As such, ZC1 as well as
other ZC subfamily kinases, are targets for the development of
specific small molecule inhibitors to treat immunological diseases,
including, but not limited to, rheumatoid arthritis, chronic
inflammatory bowel diseases (e.g. Crohn's disease), chronic
inflammatory pelvic disease, multiple sclerosis, asthma,
osteoarthritis, psoriasis, atherosclerosis, rhinitis and
autoimmunity, as well as organ transplantation. Other diseases
include cardiovascular diseases.
[0469] ZC1 and ZC2 are also implicated in cell growth regulation.
Thus, ZC subfamily kinases are targets for developing small
molecule inhibitors for the treatment of cancer and metastases. ZC2
maps to a chromosomal region frequently amplified in a variety of
tumors including those from non-small cell lung cancer, small cell
lung cancer, and cervical cancer. This suggests that ZC2 could play
a role in the development, maintenance, or progression of human
tumors.
[0470] The role of human ZC1, ZC2, ZC3, and ZC4 in the inflammatory
and stress-response pathways, strongly suggests that drugs
targeting these kinases could have strong immunosuppressive
actions. These drugs can prove valuable for the treatment of
rheumatoid arthritis, artherosclerosis, autoimmune disorders and
organ transplantation among others. At least one very important
class of immunosuppresants, corticosteroids, functions by blocking
SAPK activation at an as yet undefined site on this pathway
(Swantek, J. L. et al (1997) Mol. Cell. Biol. (1997) 6274-6282).
Other immunosuppresive drugs like the pyridinyl imidazoles
specifically target the p38 kinases (Kumar, S. et al (1997)
Biochem. Biophys. Res. Commun. 235: 533-528). Drug targeting of the
MAPK and p38 pathways could lead to the development of novel
immunosuppresants.
[0471] Human SULU and GEK
[0472] The potential role of these novel STE20-related protein
kinases in the control of mitosis strongly suggests that agents
that specifically inhibit these kinases could be useful for cancer
and metastases treatment.
[0473] The close homology of human STLK5, GEK2, SULU1 and SULU3 to
STE20-subfamily kinases involved in the stress and oxidative
response pathway strongly suggests that drugs targeting these
kinases may also be useful as immunosuppressants as well as to
treat ischemic disorders.
[0474] Human KHS2
[0475] The role of human KHS2 in the inflammatory and
stress-response pathways, strongly suggests that drugs targeting
this and related kinases could have strong immunosuppressive
actions. These drugs can prove valuable for the treatment of
rheumatoid arthritis, artherosclerosis, autoimmune disorders and
organ transplantation among others. At least one very important
class of immunosuppresants, corticosteroids, functions by blocking
SAPK activation at an as yet undefined site on this pathway
(Swantek, J. L. et al (1997) Mol. Cell. Biol. (1997) 6274-6282).
Other immunosuppresive drugs like the pyridinyl imidazoles
specifically target the p38 kinases (Kumar, S. et al (1997)
Biochem. Biophys. Res. Commun. 235: 533-528). Drug targeting of the
MAPK and p38 pathways could lead to the development of novel
immunosuppressants.
[0476] Human PAK Family
[0477] PAK5 has a role in cancer based on its expression profile
(elevated RNA and protein levels in wide variety of tumor lines),
its interaction with Cdc42 via its PBD, and the ability of the
kinase-dead allele of PAK5 (Lys350, 351Ala) to block ras
transformation of NIH3T3 cells. Thus, a screen for small molecule
inhibitors of PAK5 kinase activity may yield compounds with
therapeutic potential for intervention in cancers and metastases
derived from a wide range of tissue types.
[0478] PAK5 maps to a chromosomal region frequently amplified in a
variety of tumors including those from non-small cell lung cancer,
and small cell lung cancer. These findings suggest that PAK5 could
play a role in the development, maintenance, or progression of
human tumors and/or metastases.
[0479] The role of human PAK4, and PAK5 in the inflammatory and
stress-response pathways also strongly suggests that drugs
targeting these kinases could have strong immunosuppressive
actions. These drugs can prove valuable for the treatment of
rheumatoid arthritis, artherosclerosis, autoimmune disorders and
organ transplantation among others. At least one very important
class of immunosuppresants, corticosteroids, functions by blocking
SAPK activation at an as yet undefined site on this pathway
(Swantek, J. L. et al (1997) Mol. Cell. Biol. (1997) 6274-6282).
Other immunosuppresive drugs like the pyridinyl imidazoles
specifically target the p38 kinases (Kumar, S. et al (1997)
Biochem. Biophys. Res. Commun. 235: 533-528). Drug targeting of the
MAPK and p38 pathways could lead to the development of novel
immunosuppresants. In addition, drugs targeting PAK4 or PAK5 could
prove useful as immunosuppresants as well as in AIDS treatment.
[0480] VIII. Transgenic Animals.
[0481] A variety of methods are available for the production of
transgenic animals associated with this invention. DNA can be
injected into the pronucleus of a fertilized egg before fusion of
the male and female pronuclei, or injected into the nucleus of an
embryonic cell (e.g., the nucleus of a two-cell embryo) following
the initiation of cell division (Brinster et al., Proc. Nat. Acad.
Sci. USA 82: 4438-4442, 1985). Embryos can be infected with
viruses, especially retroviruses, modified to carry inorganic-ion
receptor nucleotide sequences of the invention.
[0482] Pluripotent stem cells derived from the inner cell mass of
the embryo and stabilized in culture can be manipulated in culture
to incorporate nucleotide sequences of the invention. A transgenic
animal can be produced from such cells through implantation into a
blastocyst that is implanted into a foster mother and allowed to
come to term. Animals suitable for transgenic experiments can be
obtained from standard commercial sources such as Charles River
(Wilmington, MA), Taconic (Germantown, NY), Harlan Sprague Dawley
(Indianapolis, IN), etc.
[0483] The procedures for manipulation of the rodent embryo and for
microinjection of DNA into the pronucleus of the zygote are well
known to those of ordinary skill in the art (Hogan et al., supra).
Microinjection procedures for fish, amphibian eggs and birds are
detailed in Houdebine and Chourrout (Experientia 47: 897-905,
1991). Other procedures for introduction of DNA into tissues of
animals are described in U.S. Pat. No., 4,945,050 (Sandford et al.,
Jul. 30, 1990).
[0484] By way of example only, to prepare a transgenic mouse,
female mice are induced to superovulate. Females are placed with
males, and the mated females are sacrificed by CO.sub.2
asphyxiation or cervical dislocation and embryos are recovered from
excised oviducts. Surrounding cumulus cells are removed. Pronuclear
embryos are then washed and stored until the time of injection.
Randomly cycling adult female mice are paired with vasectomized
males. Recipient females are mated at the same time as donor
females. Embryos then are transferred surgically. The procedure for
generating transgenic rats is similar to that of mice (Hammer et
al., Cell 63:1099-1112, 1990).
[0485] Methods for the culturing of embryonic stem (ES) cells and
the subsequent production of transgenic animals by the introduction
of DNA into ES cells using methods such as electroporation, calcium
phosphate/DNA precipitation and direct injection also are well
known to those of ordinary skill in the art (Teratocarcinomas and
Embryonic Stem Cells, A Practical Approach, E. J. Robertson, ed.,
IRL Press, 1987).
[0486] In cases involving random gene integration, a clone
containing the sequence(s) of the invention is co-transfected with
a gene encoding resistance. Alternatively, the gene encoding
neomycin resistance is physically linked to the sequence(s) of the
invention. Transfection and isolation of desired clones are carried
out by any one of several methods well known to those of ordinary
skill in the art (E. J. Robertson, supra).
[0487] DNA molecules introduced into ES cells can also be
integrated into the chromosome through the process of homologous
recombination (Capecchi, Science 244: 1288-1292, 1989). Methods for
positive selection of the recombination event (i.e., neo
resistance) and dual positive-negative selection (i.e., neo
resistance and gancyclovir resistance) and the subsequent
identification of the desired clones by PCR have been described by
Capecchi, supra and Joyner et al. (Nature 338: 153-156, 1989), the
teachings of which are incorporated herein in their entirety
including any drawings. The final phase of the procedure is to
inject targeted ES cells into blastocysts and to transfer the
blastocysts into pseudopregnant females. The resulting chimeric
animals are bred and the offspring are analyzed by Southern
blotting to identify individuals that carry the transgene.
Procedures for the production of non-rodent mammals and other
animals have been discussed by others (Houdebine and Chourrout,
supra; Pursel et al., Science 244:1281-1288, 1989; and Simms et
al., Bio/Technology 6:179-183, 1988).
[0488] Thus, the invention provides transgenic, nonhuman mammals
containing a transgene encoding a kinase of the invention or a gene
effecting the expression of the kinase. Such transgenic nonhuman
mammals are particularly useful as an in vivo test system for
studying the effects of introduction of a kinase, or regulating the
expression of a kinase (i.e., through the introduction of
additional genes, antisense nucleic acids, or ribozymes).
[0489] A "transgenic animal" is an animal having cells that contain
DNA which has been artificially inserted into a cell, which DNA
becomes part of the genome of the animal which develops from that
cell. Preferred transgenic animals are primates, mice, rats, cows,
pigs, horses, goats, sheep, dogs and cats. The transgenic DNA may
encode human STE20-related kinases. Native expression in an animal
may be reduced by providing an amount of anti-sense RNA or DNA
effective to reduce expression of the receptor.
[0490] IX. Gene Therapy
[0491] STE20-related kinases or their genetic sequences will also
be useful in gene therapy (reviewed in Miller, Nature 357:455-460,
1992). Miller states that advances have resulted in practical
approaches to human gene therapy that have demonstrated positive
initial results. The basic science of gene therapy is described in
Mulligan (Science 260:926-931, 1993).
[0492] In one preferred embodiment, an expression vector containing
STE20-related kinase coding sequence is inserted into cells, the
cells are grown in vitro and then infused in large numbers into
patients. In another preferred embodiment, a DNA segment containing
a promoter of choice (for example a strong promoter) is transferred
into cells containing an endogenous gene encoding kinases of the
invention in such a manner that the promoter segment enhances
expression of the endogenous kinase gene (for example, the promoter
segment is transferred to the cell such that it becomes directly
linked to the endogenous kinase gene).
[0493] The gene therapy may involve the use of an adenovirus
containing kinase cDNA targeted to a tumor, systemic kinase
increase by implantation of engineered cells, injection with
kinase-encoding virus, or injection of naked kinase DNA into
appropriate tissues.
[0494] Target cell populations may be modified by introducing
altered forms of one or more components of the protein complexes in
order to modulate the activity of such complexes. For example, by
reducing or inhibiting a complex component activity within target
cells, an abnormal signal transduction event(s) leading to a
condition may be decreased, inhibited, or reversed. Deletion or
missense mutants of a component, that retain the ability to
interact with other components of the protein complexes but cannot
function in signal transduction may be used to inhibit an abnormal,
deleterious signal transduction event.
[0495] Expression vectors derived from viruses such as
retroviruses, vaccinia virus, adenovirus, adeno-associated virus,
herpes viruses, several RNA viruses, or bovine papilloma virus, may
be used for delivery of nucleotide sequences (e.g., cDNA) encoding
recombinant kinase of the invention protein into the targeted cell
population (e.g., tumor cells). Methods which are well known to
those skilled in the art can be used to construct recombinant viral
vectors containing coding sequences (Maniatis et al., Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y.,
1989; Ausubel et al., Current Protocols in Molecular Biology,
Greene Publishing Associates and Wiley Interscience, N.Y., 1989).
Alternatively, recombinant nucleic acid molecules encoding protein
sequences can be used as naked DNA or in a reconstituted system
e.g., liposomes or other lipid systems for delivery to target cells
(e.g., Felgner et al., Nature 337:387-8, 1989). Several other
methods for the direct transfer of plasmid DNA into cells exist for
use in human gene therapy and involve targeting the DNA to
receptors on cells by complexing the plasmid DNA to proteins
(Miller, supra).
[0496] In its simplest form, gene transfer can be performed by
simply injecting minute amounts of DNA into the nucleus of a cell,
through a process of microinjection (Capecchi, Cell 22:479-88,
1980). Once recombinant genes are introduced into a cell, they can
be recognized by the cell's normal mechanisms for transcription and
translation, and a gene product will be expressed. Other methods
have also been attempted for introducing DNA into larger numbers of
cells. These methods include: transfection, wherein DNA is
precipitated with CaPO.sub.4 and taken into cells by pinocytosis
(Chen et al., Mol. Cell Biol. 7:2745-52, 1987); electroporation,
wherein cells are exposed to large voltage pulses to introduce
holes into the membrane (Chu et al., Nucleic Acids Res. 15:1311-26,
1987); lipofection/liposome fusion, wherein DNA is packaged into
lipophilic vesicles which fuse with a target cell (Felgner et al.,
Proc. Natl. Acad. Sci. USA. 84:7413-7417, 1987); and particle
bombardment using DNA bound to small projectiles (Yang et al.,
Proc. Natl. Acad. Sci. 87:9568-9572, 1990). Another method for
introducing DNA into cells is to couple the DNA to chemically
modified proteins.
[0497] It has also been shown that adenovirus proteins are capable
of destabilizing endosomes and enhancing the uptake of DNA into
cells. The admixture of adenovirus to solutions containing DNA
complexes, or the binding of DNA to polylysine covalently attached
to adenovirus using protein crosslinking agents substantially
improves the uptake and expression of the recombinant gene (Curiel
et al., Am. J. Respir. Cell. Mol. Biol., 6:247-52, 1992).
[0498] As used herein "gene transfer" means the process of
introducing a foreign nucleic acid molecule into a cell. Gene
transfer is commonly performed to enable the expression of a
particular product encoded by the gene. The product may include a
protein, polypeptide, anti-sense DNA or RNA, or enzymatically
active RNA. Gene transfer can be performed in cultured cells or by
direct administration into animals. Generally gene transfer
involves the process of nucleic acid contact with a target cell by
non-specific or receptor mediated interactions, uptake of nucleic
acid into the cell through the membrane or by endocytosis, and
release of nucleic acid into the cytoplasm from the plasma membrane
or endosome. Expression may require, in addition, movement of the
nucleic acid into the nucleus of the cell and binding to
appropriate nuclear factors for transcription.
[0499] As used herein "gene therapy" is a form of gene transfer and
is included within the definition of gene transfer as used herein
and specifically refers to gene transfer to express a therapeutic
product from a cell in vivo or in vitro. Gene transfer can be
performed ex vivo on cells which are then transplanted into a
patient, or can be performed by direct administration of the
nucleic acid or nucleic acid-protein complex into the patient.
[0500] In another preferred embodiment, a vector having nucleic
acid sequences encoding a STE20-related kinase polypeptide is
provided in which the nucleic acid sequence is expressed only in
specific tissue. Methods of achieving tissue-specific gene
expression are set forth in International Publication No. WO
93/09236, filed Nov. 3, 1992 and published May 13, 1993.
[0501] In all of the preceding vectors set forth above, a further
aspect of the invention is that the nucleic acid sequence contained
in the vector may include additions, deletions or modifications to
some or all of the sequence of the nucleic acid, as defined
above.
[0502] In another preferred embodiment, a method of gene
replacement is set forth. "Gene replacement" as used herein means
supplying a nucleic acid sequence which is capable of being
expressed in vivo in an animal and thereby providing or augmenting
the function of an endogenous gene which is missing or defective in
the animal.
[0503] X. Administration of Substances
[0504] Methods of determining the dosages of compounds to be
administered to a patient and modes of administering compounds to
an organism are disclosed in U.S. application Ser. No. 08/702,282,
filed Aug. 23, 1996 and International patent publication number WO
96/22976, published Aug. 1, 1996, both of which are incorporated
herein by reference in their entirety, including any drawings,
figures, or tables. Those skilled in the art will appreciate that
such descriptions are applicable to the present invention and can
be easily adapted to it.
[0505] The proper dosage depends on various factors such as the
type of disease being treated, the particular composition being
used, and the size and physiological condition of the patient.
Therapeutically effective doses for the compounds described herein
can be estimated initially from cell culture and animal models. For
example, a dose can be formulated in animal models to achieve a
circulating concentration range that initially takes into account
the IC.sub.50 as determined in cell culture assays. The animal
model data can be used to more accurately determine useful doses in
humans.
[0506] Plasma half-life and biodistribution of the drug and
metabolites in the plasma, tumors, and major organs can be also be
determined to facilitate the selection of drugs most appropriate to
inhibit a disorder. Such measurements can be carried out. For
example, HPLC analysis can be performed on the plasma of animals
treated with the drug and the location of radiolabeled compounds
can be determined using detection methods such as X-ray, CAT scan,
and MRI. Compounds that show potent inhibitory activity in the
screening assays, but have poor pharmacokinetic characteristics,
can be optimized by altering the chemical structure and retesting.
In this regard, compounds displaying good pharmacokinetic
characteristics can be used as a model.
[0507] Toxicity studies can also be carried out by measuring the
blood cell composition. For example, toxicity studies can be
carried out in a suitable animal model as follows: 1) the compound
is administered to mice (an untreated control mouse should also be
used); 2) blood samples are periodically obtained via the tail vein
from one mouse in each treatment group; and 3) the samples are
analyzed for red and white blood cell counts, blood cell
composition, and the percent of lymphocytes versus
polymorphonuclear cells. A comparison of results for each dosing
regime with the controls indicates if toxicity is present.
[0508] At the termination of each toxicity study, further studies
can be carried out by sacrificing the animals (preferably, in
accordance with the American Veterinary Medical Association
guidelines Report of the American Veterinary Medical Assoc. Panel
on Euthanasia, Journal of American Veterinary Medical Assoc.,
202:229-249, 1993). Representative animals from each treatment
group can then be examined by gross necropsy for immediate evidence
of metastasis, unusual illness, or toxicity. Gross abnormalities in
tissue are noted, and tissues are examined histologically.
Compounds causing a reduction in body weight or blood components
are less preferred, as are compounds having an adverse effect on
major organs. In general, the greater the adverse effect the less
preferred the compound.
[0509] For the treatment of cancers the expected daily dose of a
hydrophobic pharmaceutical agent is between 1 to 500 mg/day,
preferably 1 to 250 mg/day, and most preferably 1 to 50 mg/day.
Drugs can be delivered less frequently provided plasma levels of
the active moiety are sufficient to maintain therapeutic
effectiveness.
[0510] Plasma levels should reflect the potency of the drug.
Generally, the more potent the compound the lower the plasma levels
necessary to achieve efficacy.
EXAMPLES
[0511] The examples below are not limiting and are merely
representative of various aspects and features of the present
invention. The examples below demonstrate the isolation and
characterization of the STE20-related kinases of the invention.
Example 1
Isolation of cDNAs Encoding Mammalian STE20-Related Protein Kinases
Materials and Methods
[0512] Identification of novel clones
[0513] Total RNAs were isolated using the Guanidine Salts/Phenol
extraction protocol of Chomczynski and Sacchi (P. Chomczynski and
N. Sacchi, Anal. Biochem. 162, 156 (1987)) from primary human
tumors, normal and tumor cell lines, normal human tissues, and
sorted human hematopoietic cells. These RNAs were used to generate
single-stranded cDNA using the Superscript Preamplification System
(GIBCO BRL, Gaithersburg, MD; Gerard, GF et al. (1989), FOCUS 11,
66) under conditions recommended by the manufacturer. A typical
reaction used 10 .mu.g total RNA with 1.5 .mu.g oligo(dT).sub.12-18
in a reaction volume of 60 .mu.L. The product was treated with
RNaseH and diluted to 100 .mu.L with H.sub.2O. For subsequent PCR
amplification, 1-4 .mu.L of this sscDNA was used in each
reaction.
[0514] Degenerate oligonucleotides were synthesized on an Applied
Biosystems 3948 DNA synthesizer using established phosphoramidite
chemistry, precipitated with ethanol and used unpurified for PCR.
The sequence of some of the degenerate oligonucleotide primers and
the amino acid motif they encode is as follows:
1 TRK1 5'-CTGAATTCGGNGCNTTYGGNAAR (SEQ ID NO:32) GT-3' GAFGKV
(sense) (SEQ ID NO:37) TRK4 5'-GCTGGATCCYTCNGGNGGCATCC (SEQ ID
NO:33) A-3' WMPPE (antisense) (SEQ ID NO:38) ROS1
5'-GCNTTYGGNGARGTNTAYGARG (SEQ ID NO:34) G-3 ' AFGEVYEG (sense)
(SEQ ID NO:39) CCK4b 5'-GCTGGATCCYTCNGGNSWCATC (SEQ ID NO:35) CA-3'
WMSPE (antisense) (SEQ ID NO:40) CCK4c 5'-GAGTTYGGNGARGTNTTYYTNG
(SEQ ID NO:36) C-3' EFGEVYEG (sense) (SEQ ID NO:41)
[0515] These primers were derived from the sense and antisense
strands of conserved motifs within the catalytic domain of several
protein kinases. Degenerate nucleotide residue designations are:
N=A, C, G, or T; R=A or G; Y=C or T; H=A, C or T not G; D=A, G or T
not C; S=C or G; and W=A or T.
[0516] PCR reactions were performed using degenerate primers
applied to multiple single-stranded cDNAs. The primers were added
at a final concentration of 5 .mu.M each to a mixture containing 10
mM TrisHCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl.sub.2, 200 .mu.M each
deoxynucleoside triphosphate, 0.001% gelatin, 1.5 U AmpliTaq DNA
Polymerase (Perkin-Elmer/Cetus), and 1-4 .mu.L cDNA. Following 3
min denaturation at 95.degree. C., the cycling conditions were
94.degree. C. for 30 s, 50.degree. C. for 1 min, and 72.degree. C.
for 1 min 45 s for 35 cycles. PCR fragments migrating between
300-350 bp were isolated from 2% agarose gels using the GeneClean
Kit (Bio101), and T-A cloned into the pCRII vector (Invitrogen
Corp. U.S.A.) according to the manufacturer's protocol.
[0517] Colonies were selected for mini plasmid DNA-preparations
using Qiagen columns and the plasmid DNA was sequenced using a
cycle sequencing dye-terminator kit with AmpliTaq DNA Polymerase,
FS (ABI, Foster City, CA). Sequencing reaction products were run on
an ABI Prism 377 DNA Sequencer, and analyzed using the BLAST
alignment algorithm (Altschul, S. F. et al., J. Mol. Biol. 215:
403-10).
[0518] Additional PCR strategies were employed to connect various
PCR fragments or ESTs using exact or near exact oligonucleotide
primers as detailed in the results section for each cDNA. PCR
conditions were as described above except the annealing
temperatures were calculated for each oligo pair using the formula:
Tm=4(G+C)+2(A+T).
[0519] Isolation of cDNA Clones:
[0520] Human cDNA libraries were probed with PCR or EST fragments
corresponding to STE20-related genes. Probes were .sup.32P-labeled
by random priming and used at 2x 10.sup.6 cpm/mL following standard
techniques for library screening. Pre-hybridization (3 h) and
hybridization (overnight) were conducted at 42.degree. C. in
5.times. SSC, 5X Denhart's solution, 2.5% dextran sulfate, 50 mM
Na.sub.2PO.sub.4/NaHPO.sub.4, pH 7.0, 50% formamide with 100 mg/mL
denatured salmon sperm DNA. Stringent washes were performed at
65.degree. C. in 0.1.times. SSC and 0.1% SDS. DNA sequencing was
carried out on both strands using a cycle sequencing dye-terminator
kit with AmpliTaq DNA Polymerase, FS (ABI, Foster City, CA).
Sequencing reaction products were run on an ABI Prism 377 DNA
Sequencer.
[0521] Makegene Bioinformatics EST Assembler
[0522] The EST reports were downloaded from National Institute for
Biotechnology Information. After uncompressing the files, the
program `report2est` was scripted to extract the following
information: 1) EST names, 2) GenBank Accession numbers, 3) GenBank
gi numbers, 4) Clone Id numbers, 5) the nucleotide sequences of the
ESTs 6) the organism, 7) the library name, 8) the name of the lab,
and 9) the institution. The output of `report2est` is a file in
FASTA format with all of the information listed above in the first
line of each entry except the sequence, which is listed in the
second line of each entry. The resulting file is formatted for
BLAST using `pressdb` (available as part of the ncbi tool kit).
[0523] To build a gene or part of a gene from ESTs, the program
`makegene` was developed. Input to this program is a query sequence
and the organism/species for which a gene is to be built. An
initial search of the formatted EST database described above is
performed using BLAST (blastn). Any results that contain warnings,
such as polyA tails or other repeat elements, are eliminated from
future queries. The program `blast_parse_reports` was developed to
extract the FASTA header line from the search results and the
output is then filtered to extract only FASTA header lines for the
desired species.
[0524] The initial results, having been filtered for warnings and
species, go into a loop in which searches against the database are
repeated until no new ESTs are found. The loop consists of the
following steps: 1) when possible the names of both ends of the
ESTs are extracted from the database by searching using the `Clone
Id` field or the part of the `EST name` field before the .r or s
postscript, 2) any ESTs that have been used as queries in previous
loops are removed from the current query by the program `subtract`,
3) the resulting list of ESTs is used to extract the sequences from
the database by the program batch_parse_fasta, 4) BLAST is run
against the database using each sequence, 5) the output files from
BLAST containing warnings are removed, 6) the results are filtered
by species, and 7) the loop is reentered if there were new ESTs
found in the previous pass through the loop.
[0525] The ESTs chosen by `makegene` are used as input for the
program `mpd2_cluster` (Hide, W., Burke, J, and Davison, D. U. of
Houston, unpublished) which clusters overlapping sequences. The
programs `contig` (Kerlavage, T., TIGR, unpublished), `gde2mult`
and `gde2sing` (Smith, S. W., et al., CABIOS 10, 671-675 (1994)),
are used to make an alignment and consensus sequence of the
overlapping ESTs.
[0526] Results
[0527] cDNA Cloning and Characterization of STLK2
[0528] The human STLK2 cDNA sequence is composed of two overlapping
EST fragments, AA191319 and W16504, that were identified using a
Smith-Waterman search of the EST database with STLK1 (MST3
GB:AF024636) as a query. The complete sequence of both clones was
determined and used to generate the full-length human STL2
sequence.
[0529] EST clone AA191319 contains a 1327 bp insert and an ORF of
1146 bp (382 amino acids). EST clone W16504 contains a 2474 bp
insert (not including the poly-A tail) and an ORF of 687 bp (382
amino acids).
[0530] The full-length human STLK2 cDNA (SEQ ID NO. 1) is 3268 bp
long. AA191319 spans positions 1-1327 and W16504 positions
743-3216. The overlap between these two clones exhibits 100%
sequence identity. The human STLK2 cDNA constains a 1248 bp ORF
flanked by a 181 bp 5' UTR (1-181) and a 1784 bp 3' UTR (1433-3216)
that is followed by a 52 nucleotide polyadenylated region. A
polyadenylation signal (AATAAA) is found at positions 3193-3198.
The sequence flanking the first ATG conforms to the Kozak consensus
for an initiating methionine, and is believed to be the
translational start site for STLK2. Furthermore, human STLK2, and
the related SOK-1 and MST3 proteins, conserve the amino acid
sequence immediately following this presumed initiating
methionine.
[0531] Several EST fragments span the complete STLK2 sequence with
AA191319 at the 5' end and W16504 at the 3' end.
[0532] All searches against the public nucleic acid database (NRN)
and protein database (NRP) were conducted using the Smith-Waterman
gap alignment program ((Smith, T F and Waterman, M S (1981) J. Mol.
Biol, 147, 195-197).) with the PAM100 matrix and gap open -and
extension penalties of 14:1, respectively.
[0533] cDNA Cloning and Characterization of STLK3
[0534] A mammalian STLK3 clone, 135-31-19, was first identified
from a PCR screen with the degenerate oligos, TRK1 and TRK4,
applied to a sscDNA generated from adult rat brain substantia
nigra. Sequence analysis of the 457 bp insert indicated that it
represented a novel member of the STE20-subfamily of STKs.
[0535] A Smith-Waterman search of the EST database with the rat
STLK3 fragment and human STLK1 (MST3 GB:AF024636) as queries
identified several overlapping ESTs spanning most of the human
STLK3 cDNA sequence. A Makegene analysis generated a 3037 bp contig
from approximately 44 EST sequences. Since the 3' ESTs were not
commercially available, a pair of primers
(5'-CACAGAAACGGTCAGATTCAC-3'(SEQ ID NO: 42) and
5'-GATCAGGGTGACATCAAGGGAC-3'(SEQ ID NO: 43)) were derived from this
region to generate PCR clone 3R21-20-6 from human fetal liver
sscDNA. This clone and EST AA278967 were fully sequenced to
generate the full-length STLK2 cDNA sequence.
[0536] AA278967 is a 837 bp EST isolated by the IMAGE consortium
from cDNA made from CD20+/IgD-germinal center B cells sorted from
human tonsillar cells.
[0537] PCR clone 3R21-20-6 was isolated from human fetal sscDNA and
contains a 1116 bp insert, including a 1086 bp ORF encoding the 362
C-terminal amino acids of STLK3.
[0538] The full-length human STLK3 cDNA (SEQ ID NO. 2) is 3030 bp
long. AA278967 spans positions 1-814 and 3R21-20-6 spans positions
464-1579. The overlap between these two clones exhibits 100%
sequence identity. The remaining 1452 bp of 3' UTR is derived from
an assembly of multiple unconfirmed EST fragments.
[0539] The near full-length human STLK3 cDNA (SEQ ID NO.2) is 3030
bp long and consists of a 1548 bp ORF flanked by a 1476 bp 3' UTR
(1550-3025) and a 5 nucleotide polyadenylated region. A
polyadenylation signal (AATAAA) begins at position 3004. Since the
coding region is open throughout the 5' extent of this sequence,
this is apparently a partial cDNA clone lacking the N-terminal
start methionine. Six copies of a "GGCCCC" repeat were observed in
positions 21-67. Five independent ESTs (AA150838, AA286879,
AA251679, AA252004, AA278967) showed the same repeat, suggesting
that this sequence may be an integral region of the human STLK3
gene. Stronger evidence for this being the case is provided by the
sequence of the murine orthologue of STLK3 represented by a 876 bp
EST W20737.
[0540] Multiple EST fragments span the complete STLK3 sequence with
AA278967 at the 5' end and AA628477 and others at the 3' end.
[0541] cDNA Cloning and Characterization of STLK4
[0542] The human STLK4 cDNA sequence is composed of two overlapping
EST fragments, AA297759 and AA100484, that were identified using a
Smith-Waterman search of the EST database with STLK1 (MST3
GB:AF024636) as a query. The complete sequence of both clones was
determined and used to generate the near full-length human STLK4
sequence.
[0543] AA100484 is an IMAGE consortium cDNA clone isolated from the
T-84 colonic epithelium cell line. It has an insert of 3694 bp and
a coding region of 1146 bp (382 amino acids). A Smith-Waterman
sequence alignment against the NRN database showed this EST to be
71.4% identical to the human STE20-like kinase (GB:X99325).
[0544] W16504 is an IMAGE consortium clone isolated from a human
fetal heart cDNA library. It has an insert length of 2474 bp (not
including the poly-A tail) and a coding region of 687 bp (229 amino
acids). A Smith-Waterman sequence alignment of W16504 against the
NRN database showed this EST to be 69.2% identical to the human
STE20-like kinase (GB:X99325).
[0545] The full-length human STLK2 cDNA (SEQ ID NO. 1) is 3268 bp
long. AA191319 spans positions 1-1327, and W16504 positions
743-3216. The overlap between these two clones is 585 bp long with
100% sequence identity.
[0546] AA100484 is an IMAGE consortium cDNA clone isolated from the
T-84 colonic epithelium cell line. AA100484 covers the bulk of
Human STLK4 with its 3694 bp, which spans positions 146-3839 of SEQ
ID NO:3. A second EST, AA297759, isolated from a Jurkat T cell cDNA
library, spans positions 1-271 of the human STLK4 contig. The two
ESTs overlap over a 126 bp stretch that has only one nucleotide
discrepancy at position 149 (G in AA297759 and T in AA100484). A T
at this position was chosen for the SEQ ID NO:3 based on sequence
data generated from A100484. The 5' 145 bp of human STLK4 contains
three sequencing ambiguities (N's in SEQ ID NO:3) arising from
sequence errors in the GenBank entry for AA297759. Three amino acid
sequence ambiguities in the N-terminus of human STLK4 are present
also in SEQ ID NO:7 as a consequence of the sequence inaccuracies
from the EST entry.
[0547] The coding region of human STLK4 is 1242 bp long (2-1243),
capable of encoding a 414 amino acid polypeptide, and is followed
by a 2596 nucleotide 3' UTR (1244-3839). Human STLK4 ends in a
polyadenylated stretch that has 18 adenines (3840-3857). A
polyadenylation signal (AATAAA) is found between positions
3822-3827. Targeted-PCR cloning identified one rat orthologue of
human STLK4, clone 135-31-19. In addition, one murine orthologue of
human STLK4 was recognized in the EST database as AA 117483. None
of these orthologues add additional N-terminal sequence to the
human STLK4.
[0548] The near full-length human STLK4 cDNA (SEQ ID NO.3) is 3857
bp long and consists of a 1242 bp ORF flanked by a 2596 bp 3' UTR
(1244-3839) and an 18 nucleotide polyadenylated region.
Polyadenylation signals (AATAAA) begin at positions 2181 and 3822.
Since the coding region is open throughout the 5' extent of this
sequence, this is apparently a partial cDNA clone lacking the
N-terminal start methionine. A near full-length murine STLK4 cDNA
is represented in the 1773 bp EST AA117438. It extends an
additional 21 nucleotides 5' of the human STLK4 consensus, but
since its coding region is open throughout the 5' extent of the
sequence, this is also probably a partial cDNA clone lacking the
N-terminal start methionine.
[0549] Several EST fragments span the complete STLK3 sequence with
AA297759 at the 5' end and AA100484 and others at the 3' end.
[0550] cDNA Cloning and Characterization of STLK5
[0551] The human STLK5 cDNA sequence is composed of four
overlapping sequences, A1418298, 2R96-13-1, 3R25-45-3 and R46685. A
human STLK5 clone, F07734, was first identified using a
Smith-Waterman search of the EST database with SPS_sc (U33057) as a
query.
[0552] AI418298 is an IMAGE consortium cDNA clone with an 895 bp
insert.
[0553] PCR clone 2R96-13-1 was isolated from human brain sscDNA
using primers 5'-CTCATCTGTACACACTTCATGG(SEQ ID NO:44) and
5'-GATTCCCACACTGTAGATGTC(SEQ ID NO:45) derived from F07734.
2R96-13-1 contains a 330 bp insert and an ORF of 330 bp (110 amino
acids).
[0554] EST clone R46685 was identified using a Smith-Waterman
search of the EST database with the C-terminus of SPS_sc
(GB:U33057) as query. Sequence analysis of the 1047 bp insert
identified this EST to contain an ORF of 285 bp (95 amino acids)
encoding the C-terminus of human STLK5.
[0555] PCR clone 3R25-45-3 was isolated from human fetal brain
sscDNA using primers 5'-GGCCCTCGACTACATCCACCACAT(SEQ ID NO:46) and
5'-CAACGAAACTAACACAGCATAAGG(SEQ ID NO:47) derived from 2R96-13-1
and R46685, respectively. 3R25-45-3 contains a 330 bp insert and an
ORF of 750 bp (250 amino acids).
[0556] The full-length human STLK5 cDNA (SEQ ID NO:96) is 2110 bp
long and consists of a 1119 bp ORF flanked by a 229 bp 5' UTR and a
762 bp 3' UTR. The sequence flanking the first ATG conforms to the
Kozak consensus (supra) for an initiating methionine, and is
believed to be the translational start site for STLK5.
[0557] Several EST fragments span the complete STLK5 sequence with
AA297059 and F07734 at the 5' end and R46686 and F03423 and others
at the 3' end.
[0558] STLK5 displays a 100% match over a 41 bp stretch (position
2-42, SEQ ID NO. 97) to a human CpG island repeat (Z61277).
[0559] cDNA Cloning and Characterization of STLK6
[0560] Human STLK6 was first identified in the translated EST
database (AA219667) as a novel serine threonine kinase.
[0561] The partial human STLK6 cDNA (SEQ ID NO:98) is 2,001 bp long
and consists of a 1,254 bp ORF flanked by a 75 bp 5' UTR and a 673
bp 3' UTR. The sequence flanking the first ATG conforms to the
Kozak consensus (Kozak, M., Nucleic Acids Res. 15, 8125-8148
(1987)) for an initiating methionine, and is believed to be the
translational start site for STLK6.
[0562] At the time of filing, inventors believe that STLK6 does not
have any significant match in the nucleic acid database.
[0563] cDNA Cloning and Characterization of STLK7
[0564] Human STLK7 was first identified in the translated EST
database (AA988954) as a novel serine threonine kinase. The
original clone was not available through public sources, so a PCR
fragment amplified from the sequence of AA988954 yielded
5R54-21-2.
[0565] The partial human STLK7 cDNA (SEQ ID NO: 100) is 311 bp long
and consists of a 309 bp ORF. Since the coding region is open
throughout the 5' and 3' extent of this sequence, this appears to
be a partial cDNA clone lacking the N-terminal start methionine and
C-terminal stop codon.
[0566] STLK7 shares 80% sequence identity to human SPAK (AF099989)
over a 167 bp region and 50% nucleotide sequence identity to SLTK7
(SEQ ID NO. 101) over 391 nucleotides.
[0567] cDNA Cloning and Characterization of ZC1
[0568] The human ZC1 cDNA sequence is composed of two overlapping
PCR clones, 3R25-24-2 and R65-12-2.
[0569] A human ZC1 clone, 125-33-5, was first identified from a PCR
screen with degenerate oligos, TRK1 and TRK4, applied to sscDNA
generated from human small airway epithelial cells (Clontech).
Sequence analysis of the 503 bp insert identified a 501 bp ORF (167
amino acids) with the potential to encode a novel human STK related
to the C. elegans ZC504.4 gene product.
[0570] PCR clone 3R25-24-2 was isolated from human SNB19
glioblastoma sscDNA using primers 5'-ATGGCGAACGACTCTCCCGCGAA(SEQ ID
NO:48) and 5'-ACACCAAAATCAACAAGTTTCACCTC(SEQ ID NO:49) derived from
the N-terminus of a murine orthologue of ZC1 (NIK, GB:U88984) and
the original human ZC1 clone 125-33-5, respectively. 3R25-24-2
contains a 527 bp insert and an ORF of 519 bp (173 amino
acids).
[0571] PCR clone R65-12-2 was isolated as follows: A Smith-Waterman
search of the EST database with the C. elegans ZC504.4 gene
(GB:Z50029) as a query identified a human EST (W81656) whose ORF is
related to the C. elegans gene and terminates in an identical
residue (Trp). A primer was designed 3' to this stop codon
(5'-AGTTACAAGGAATTCCAAGTTCT(SEQ ID NO:50)) and used in a PCR
reaction with a primer derived from the original human ZC1 clone
125-33-5 (5'-ATGAAGAGGAAGAAATCAAACTG(SEQ ID NO:51)) using sscDNA
from human SNB19 glioblastoma as a template. PCR clone R65-12-2 was
identified and was found to contain a 3611 bp insert with a 3534 bp
ORF encoding the C-terminal portion of human ZC1 (1178 amino
acids).
[0572] The full-length human ZC1 cDNA (SEQ ID NO. 9) is 3798 bp
long. Clone 3R25-24-2 spans positions 1-527, and clone R65-12-2
spans positions 188-3798. The overlap between these two clones
exhibits 100% sequence identity. The human ZC1 contains a 3717 bp
ORF (17-3723) flanked by a 6 bp 5' UTR and a 75 bp (3724-3798) 3'
UTR. No polyadenylation signal (AATAAA) or polyadenylated region
are present in the 3' UTR. The sequence flanking the first ATG
conforms to the Kozak consensus for an initiating methionine, and
is believed to be the translational start site for human ZC1.
[0573] Multiple EST fragments (W81656) match the 3' end of the
human ZC1 gene, but at the time of filing, the inventors believe
that none exist in GenBank or the EST database that match its 5'
end.
[0574] cDNA Cloning and Characterization of ZC2
[0575] The human ZC2 cDNA sequence is composed of four overlapping
PCR clones, G75-31-17, R65-24-6, 2R28-8-1, and R99-6-10.
[0576] A human ZC2 clone, G75-31-17, was first identified from a
PCR screen with degenerate oligos, ROS
1(5'-GCNTTYGGNGARGTNTAYGARGG(SEQ ID NO:34)) and CCK4b
(5'-GCTGGATCCYTCNGGNSWCATCCA(SEQ ID NO:35)), applied to sscDNA
generated from the human HLT383 primary non-small cell lung cancer
tissue. Sequence analysis of the 492 bp insert identified a 492 ORF
(164 amino acids) with the potential to encode a novel human STK
related to the C. elegans ZC504.4 gene product.
[0577] PCR clone R99-6-10 was isolated as follows: A Smith-Waterman
search of the EST database with C. elegans ZC504.4 gene (GB:Z50029)
as a query identified two overlapping human EST fragments (AA115844
and R51245) whose ORFs were related to the C. elegans gene and
terminate in an identical residue (Trp). A primer was designed 3'
to the stop codon found in R51245 (5'-AGATGGACTGTACTGGGAGG(SEQ ID
NO:52)) and used in a PCR reaction with a primer derived from
AA115844 (5'-ACTTTGTGCAGCTCTGTGGG(SEQ ID NO:53)) using human fetal
brain sscDNA as a template. PCR clone R99-6-10 was identified and
was found to contain a 1095 bp insert with a 930 bp ORF encoding
the C-terminal portion of human ZC2 (310 amino acids).
[0578] PCR clone R65-24-6 was isolated from human HT29 colon cancer
cell line sscDNA using primers 5'-AAGGTTATGGATGTCACAGGG(SEQ ID
NO:54) and 5'-AGATGGACTGTACTGGGAGG(SEQ ID NO:52) derived from
G75-31-17 and R51245, respectively. The 3' primer used in this PCR
reaction misprimed between positions 1634-1653 of this gene leading
to the formation of a truncated product. R65-24-6 contains a 1593
bp insert and an ORF of 1593 bp (531 amino acids).
[0579] PCR clone 2R28-8-1 was isolated from human colon cancer cell
line HT29 sscDNA using primers 5'-CTCACAAGGTTGCCAACAGG(SEQ ID
NO:55) and 5'-AGTCCCCACCAGAAGGTTTAC(SEQ ID NO:56) derived from
R65-24-6 and R99-6-10, respectively. 2R28-8-1 contains a 1538 bp
insert and an ORF of 1536 bp (512 amino acids).
[0580] The partial human ZC2 cDNA (SEQ ID NO. 10) is 4055 bp long.
Clone G75-31-17 spans positions 1-492, clone R65-24-6 spans
positions 58-1650, clone 2R28-8-1 spans positions 1466-3003 and
clone R99-6-10 spans positions 2961-4055. The overlaping regions
between these clones exhibit 100% sequence identity except for a
single guanine (G75-31-17) to adenosine (R65-24-6) mismatch at
position 280 resulting in a Glu to Lys change. Based on the
presence of an acidic residue in this position in human ZC1 and ZC3
and C. elegans ZC504.4, the sequence encoding the Glu is probably
correct. The human ZC2 gene contains a 3891 bp ORF (1-3891) flanked
by 164 bp (3892-4055) 3' UTR. No polyadenylation signal (AATAAA) or
polyadenylated region is present in the 3' UTR.
[0581] Multiple EST fragments (R51245) match the 3' end of the
human ZC2 gene, but at the time of filing, the inventors believe
that none exist in GenBank or the EST database that match its 5'
end.
[0582] cDNA Cloning and Characterization of ZC3
[0583] The human ZC3 cDNA sequence is composed of four overlapping
PCR clones, G75-30-30, 3R33-5-3, 3R19-17-6, and R99-43-11.
[0584] A human ZC3 clone, G75-30-30, was first identified from a
PCR screen with degenerate oligos, ROS1 and CCK4b, applied to
sscDNA generated from a human HLT370 primary non-small cell lung
cancer tissue. Sequence analysis of the 492 bp insert identified a
492 ORF (164 amino acids) with the potential to encode a novel
human STK related to the C. elegans ZC504.4 gene product.
[0585] PCR clone R99-43-11 was isolated as follows: A
Smith-Waterman search of the EST database with the C. elegans
ZC504.4 gene (GB:Z50029) as a query identified a human EST (R54563)
whose ORF is related to the C. elegans gene and terminates in an
identical residue (Trp). A primer was designed 3' to the stop codon
found in R54563 (5'-TCAGGGGTCAGAGGTCACG(SEQ ID NO:57)) and used in
a PCR reaction with a primer derived from the 5' end of R54563
(5'-CCCAAACCCTACCACAAATTC(SEQ ID NO:58)) using sscDNA from human
fetal brain as a template. PCR clone R99-43-11 was identified and
was found to contain a 719 bp insert with a 564 bp ORF encoding the
C-terminal portion of human ZC3 (188 amino acids).
[0586] PCR clone 3R19-17-6 was isolated from human A549 lung cancer
cell line sscDNA using primers 5'-CCCCCGGGAAACGATGACCA and
5'-AGCCGCTGCCCCTCCTCTACTGT derived from G75-30-30 and R99-43-11,
respectively. The 3' primer used in this PCR reaction misprimed
leading to the formation of a truncated product. 3R19-17-6 contains
a 1172 bp insert and an ORF of 1170 bp (390 amino acids).
[0587] PCR clone 3R33-5-3 was isolated from human A549 lung cancer
cell line sscDNA using primers 5'-ACCGCAACATCGCCACCTACTAC(SEQ ID
NO:61) and 5'-CTCGACGTCGTGGACCACC(SEQ ID NO:62) derived from
G75-30-30 and 3R19-17-6, respectively. 3R33-5-3 contains a 2465 bp
insert and an ORF of 2463 bp (821 amino acids).
[0588] The full-length human ZC3 cDNA (SEQ ID NO. 11) is 4133 bp
long. Clone G75-30-30 spans positions 1-483, clone 3R33-5-3 spans
positions 134-2598, clone 3R19-17-6 spans positions 2356-3512 and
clone R99-43-11 spans positions 3415-4133. The overlaps between
these clones exhibit 100% sequence identity. The human ZC3 gene
contains a 3978 bp ORF (1-3978) flanked by a 152 bp 3' UTR
(3979-4133). No polyadenylation signal (AATAAA) or polyadenylated
region is present in the 3' UTR.
[0589] Multiple EST fragments (R54563) match the 3' end of the
human ZC3 gene, but at the time of filing, the inventors believe
that none exist in GenBank or the EST database that match its 5'
end.
[0590] cDNA Cloning and Characterization of ZC4
[0591] The human ZC4 cDNA sequence, represented by PCR fragment
3R25-27-1, was first identified in the human genomic cosmid 82J11
(GB:Z833850) containing exon sequences that displayed strong
homology to the ZC504.4 C. elegans gene.
[0592] PCR clone 3R25-27-1 was isolated from human fetal liver
sscDNA and primers 5'-CAATGTTAACCCACTCTATGTCTC(SEQ ID NO:63) and
5'-AGTTTGCCGATGTTTTTCTTTTC(SEQ ID NO:64) derived from a potential
ORF (positions 25729-25852) from the 82J11 cosmid and from an EST
(R98571) encoding the C-terminus of the human ZC4 gene,
respectively.
[0593] The partial human ZC4 cDNA (SEQ ID NO.12) is 1459 bp long
and consists of a 1047 bp ORF (2-1048) flanked by a 411 bp
(1049-1459) 3' UTR region. No polyadenylation signal (AATAAA) or
polyadenylated region is present in the 3' UTR.
[0594] The N-terminal coding sequence for ZC4_h was extended by
building a contiguous DNA sequence of 233,137 bp containing Z83850
and four other sequences: cU84B10 and cU230B10 (from the Sanger
Human Genome Sequencing Project) and Z97356 and Z69734 (available
from the National Institute for Biotechnology Information. The
position of each sequence in the contig is represented in the table
below.
2 Accession Length Start End cUS4B10 43273 0 43273 Z97356 21848
43171 65018 Z69734 37077 63073 100149 cU230B10 11841 88416 100256
Z83850 132981 100156 233137
[0595] Sequences in ZC4 genomic contig.
[0596] The 233,137 bp contig was analyzed for exons using the
programs FGENES 1.5 and FGENESH, human gene structure prediction
software available from The Sanger Centre.
[0597] The resulting human ZC4 coding sequence (SEQ ID NO:104) is
3,681 bp long (excluding the stop codon) and encodes for a STE20
kinase of 1227 amino acids.
[0598] cDNA Cloning and Characterization of KHS2
[0599] The human KHS2 cDNA sequence is composed of four overlapping
clones, 3R25-51-2, 3R16-34-2, 3R16-31-2, and T79916.
[0600] A human KHS2 clone, AA250855, was first identified using a
Smith-Waterman search of the EST database with KHS1 (GB:U77129) as
a query. Sequence analysis of the 1112 bp insert identified a 618
bp ORF (206 amino acids) with the potential to encode a novel STK
related to the human KHS1 gene product. Using AA250855 as a query,
a second EST (AA446022) was found whose sequence was shown to
contain the initiator methionine for human KHS2 based on a
comparison with KHS1.
[0601] PCR clone 3R25-51-2 was isolated from human testicular
cancer sscDNA using primers 5'-CCGCCATGAACCCCGGCTT(SEQ ID NO:65)
and 5'-CGATTGCCAAAGACCGTGTCA(SEQ ID NO:66) derived from AA446022
and AA250855, respectively. 3R25-51-2 contains an 850 bp insert and
an ORF of 849 bp (283 amino acids).
[0602] EST clone, T79916, was identified using a Smith-Waterman
search of the EST database with the C-terminus of KHS1 (GB:U77129)
as a query. Sequence analysis of the 2107 bp insert identified this
EST to contain an ORF of 345 bp (115 amino acids disrupted by a
single stop codon) encoding the C-terminus of human KHS2, followed
by 1762 bp 3' UTR.
[0603] PCR clone 3R16-34-2 was isolated from human testis sscDNA
using primers 5'-AGAAGTTGCAGCTGTTGAGAGGA(SEQ ID NO:67) and
5'-TATGGCCCGTGTAAGGATTTC(SEQ ID NO:68) derived from AA250885 and
T79916, respectively. 3R16-34-2 contains an 1516 bp insert and an
ORF of 1128 bp (376 amino acids).
[0604] PCR clone 3R16-31-2 was isolated from normal human colon
sscDNA using primers 5'-GTGCCAGAAGTGTTGTGTTGTAA(SEQ ID NO:69) and
5'-TATGGCCCGTGTAAGGATTTC(SEQ ID NO:68) derived from EST T79916.
3R16-31-2 contains a 728 bp insert and an ORF of 669 bp (223 amino
acids). This clone lacked the stop codon present within EST T79916
(postion 2662 in the KHS2 sequence).
[0605] The full-length human KHS2 cDNA (SEQ ID NO.17) is 4023 bp
long. Clone 3R25-51-2 spans positions 1-855, clone AA250885 spans
positions 336-923, clone 3R16-34-2 spans positions 545-2061, and
clone T79916 spans positions 1917-4023. The overlaping regions
between these clones exhibit 100% sequence identity, except for 4
nucleotide differences, two of which are silent, a third corrects
the internal stop codon at position 2662, and the fourth at
position 247 (T to C change) results in a Pro to Leu change. The
human KHS2 cDNA contains a 2682 bp ORF (6-2687) flanked by a 5 bp
(1-5) 5'UTR and a 1336 bp (2688-4023) 3' UTR. A potential
polyadenylation signal (AATAAA) is found at positions 4008-4013. No
polyadenylated region is present in the 3' UTR. The sequence
flanking the first ATG is in a poor context for translational
initiation, however, a 134 bp 5'UTR sequence from EST AA446022 did
not reveal any additional ATG's and displayed two in-frame stop
codons 5' to the putative start ATG for human KHS2.
[0606] Multiple EST fragments match the 5'end (AA446022) as well as
the 3' end (R37625) of the human KHS2 gene.
[0607] cDNA Cloning and Characterization of SULU1
[0608] The human SULU1 cDNA sequence is composed of three
overlapping clones, N40091, 2R90-1-1 and R90907.
[0609] A human SULU1 clone, N40091, was first identified using a
Smith-Waterman search of the EST database with the C. elegans SULU
gene (GB: U32275) as a query. Sequence analysis of the 1321 bp
insert identified a 906 bp ORF (302 amino acids) with the potential
to encode a novel human STK related to the C. elegans SULU gene
product.
[0610] EST clone R90907 was first identified using a Smith-Waterman
search of the EST database with the 3' end of the C. elegans SULU
gene (GB: U32275) as a query. Sequence analysis of the 1647 bp
insert identified a 578 bp ORF (192 amino acids) with the potential
to encode the C-terminus of the human SULU1 gene product.
[0611] PCR clone 2R90-1-1 was isolated from human HT29 colon cancer
cell sscDNA using primers 5'-TATTGAATTGGCGGAACGGAAG(SEQ ID NO:70)
and 5'-TTGTTTTGTGCTCATTCTTTGGAG(SEQ ID NO:71) derived from N40091
and R90907, respectively. 2R90-1-1 contains a 1625 bp insert and an
ORF of 1623 bp (541 amino acids).
[0612] The full-length human SULU1 cDNA (SEQ ID NO.19) is 4177 bp
long Clone N40091 spans positions 1-1321, clone 2R90-1-1 spans
positions 1048-2671, and clone R90907 spans positions 2531-4177.
The overlaping regions between these clones exhibit 100% sequence
identity. The human SULU1 cDNA contains a 2694 bp ORF (415-3108)
flanked by a 414 bp (1-414) 5'UTR and a 1069 bp (3109-4177) 3' UTR
followed by a 19 nucleotide polydenylated region. A potential
polyadenylation signal (AATAAA) is found at positions 4164-4169.
The sequence flanking the first ATG conforms to the Kozak consensus
for an initiating methionine, and is believed to be the
translational start site for human SULU1.
[0613] Multiple EST fragments match the 5'end (N27153) as well as
the 3' end (R90908) of the human SULU1 gene.
[0614] cDNA Cloning and Characterization of Murine SULU3
[0615] The murine SULU3 cDNA sequence is represented by PCR
fragment 2R92-1-6.
[0616] A murine SULU3 clone, G83-4-5, was first identified from a
PCR screen with degenerate oligos, CCK4c and CCK4b, applied to
sscDNA generated from murine day-12 embryos. Sequence analysis of
the 473 bp insert identified a 471 ORF (157 amino acids) with the
potential to encode a novel human STK related to the C. elegans
SULU gene (GB: U32275) product. The antisense strand of G83-4-5 is
identical at the nucleic acid level to the 5'UTR of the murine etsl
protooncogenic transcription factor (GB:X53953). This homology is
likely the result of a cloning artifact attached to the 5'-end of
the database entry for murine ets1.
[0617] PCR clone 3R19-17-6 was isolated from human A549 cell sscDNA
using primers 5'-CCCCCGGGAAACGATGACCA(SEQ ID NP:59) and
5'-AGCCGCTGCCCCTCCTCTAC- TGT(SEQ ID NO:60) derived from G75-30-30
and R99-43-11, respectively. The 3' primer used in this PCR
reaction misprimed leading to the formation of a truncated product.
3R19-17-6 contains a 1172 bp insert and an ORF of 1170 bp (390
amino acids).
[0618] PCR clone 2R92-1-6 was isolated from murine d8 embryo sscDNA
using primers 5'-ACCGCAACATCGCCACCTACTAC(SEQ ID NO:61) and
5'-GATTGCTTTGTGCTCATTCTTTGG(SEQ ID NO:72) derived from the 5' UTR
of the etsl gene and the human EST AA234623, respectively. The
latter (shown herein) encodes the C-terminus of human SULU3.
2R92-1-6 contains a 2249 bp insert and an ORF of 2244 bp (748 amino
acids).
[0619] The partial murine SULU3 cDNA (SEQ ID NO.21) is 2249 bp long
and consists of a 2244 bp ORF (6-2249) flanked by a 5 bp (1-5)
5'UTR. The sequence flanking the first ATG conforms to the Kozak
consensus for an initiating methionine, and is believed to be the
translational start site for murine SULU3.
[0620] One EST fragment (AA446022) matches the 3' end of the
partial murine SULU3 gene, but at the time of filing, the inventors
believe that none exist in GenBank or the EST database that match
its 5' end.
[0621] cDNA Cloning and Characterization of Human SULU3
[0622] The human SULU3 cDNA sequence is composed of two overlapping
clones, 2R90-22-1 and AA234623.
[0623] A human SULU3 clone, AA234623, was first identified using a
Smith-Waterman search of the EST database with the C. elegans SULU
gene (GB: U32275) as a query. Sequence analysis of the 2652 bp
insert identified a 1185 bp ORF (395 amino acids) with the
potential to encode the C-terminus of a novel human STK related to
the C. elegans SULU gene product.
[0624] PCR clone 2R90-22-1 was isolated from human SKMel128
melanoma cell line sscDNA using primers
5'-TATTGAATTGGCGGAACGGAAG(SEQ ID NO:70) and
5'-TTGTTCTAAGAGTGCCCTCCG(SEQ ID NO:73) derived from the murine
SULU3 2R92-1-6 clone and from AA234623, respectively. 2R92-1-6
contains a 1897 bp insert and an ORF of 1896 bp (632 amino
acids).
[0625] The partial human SULU3 cDNA (SEQ ID NO.20) is 3824 bp long.
Clone 2R90-22-1 spans positions 1-1897 and clone AA234623 spans
positions 1173. The overlaping region between these clones exhibits
100% sequence identity. The human SULU3 cDNA contains a 2358 bp ORF
(2-2359) flanked by a 1465 bp (2360-3824) 3' UTR followed by a 19
nucleotide polydenylated region. A potential polyadenylation signal
(AATAAA) is found at positions 2602-2607. Since the coding region
is open throughout the 5' extent of this sequence, this is
apparently a partial cDNA clone lacking the N-terminal start
methionine.
[0626] Multiple EST fragments (R02283) match the 3' end of the
human SULU3 gene, but at the time of filing, the inventors believe
that none exist in GenBank or the EST database that match its 5'
end.
[0627] cDNA Cloning and Characterization of GEK2
[0628] The human GEK2 cDNA sequence is composed of three
overlapping clones, AA459448, 3R25-48-1 and GEK2_h#3.
[0629] A human GEK2 clone, AA459448, was first identified using a
Smith-Waterman search of the EST database with the human SLK gene
(GB: AB002804) as a query. Sequence analysis of the 1286 bp insert
identified a 1227 bp ORF (409 amino acids) with the potential to
encode the N-terminus of a novel human STK related to the human SLK
gene product. An additional Smith-Waterman search using the
C-terminus of the SLK gene as a query yielded three additional
EST's, AA323687, AA380492 and AA168869, that encode the C-terminal
region of human GEK2.
[0630] PCR clone 2R98-41-17 was isolated from human testis sscDNA
using primers 5'-AAGACCATGCCGTGCGCCG(SEQ ID NO:74) and
5'-ATTCCTTCAGGTTCTGGTTAT- GG(SEQ ID NO:75) derived from AA323687
and from AA380492, respectively. 2R98-41-17 contains a 851 bp
insert and an ORF of 849 bp (283 amino acids).
[0631] PCR clone GEK2_h#3 was isolated from human sscDNA made from
the H23 tumor cell line using primers 5'-GCAGCAAGTGGAGAAGATGG(SEQ
ID NO: 109) and 5'-GGAAGCATCCCCAGAGCTGTAG(SEQ ID NO: 110) derived
from the sequence of clone 3R25-48-1 and from the 3' end of murine
LOK (GB:D89728), respectively. GEK2_h#3 contains a 1042bp insert
and an ORF of 1041 bp (347 amino acids).
[0632] The full-length human GEK2 cDNA (SEQ ID NO:106) is 2962 bp
long. Clone AA459448 spans positions 1-1286, clone 3R25-48-1 spans
positions 1100-2449 and clone GEK2_h#3 spans positions 1920-2962.
The overlapping regions between these clones exhibit 100% sequence
identity.
[0633] The human GEK2 cDNA contains a 2904 bp ORF (59-2962) flanked
by a 58 bp (1-58) 5'UTR. The sequence flanking the first ATG
conforms to the Kozak consensus for an initiating methionine, and
is believed to be the translational start site for human GEK2.
[0634] Multiple EST fragments (AA465671) match the 5'end of the
sequence, but only one (AA380492) matches the 3' end of the human
GEK2 gene.
[0635] cDNA Cloning and Characterization of PAK4
[0636] The human PAK4 cDNA sequence is represented by clone
SNB2#1.
[0637] A human PAK4 clone, R88460, was first identified using a
Smith-Waterman search of the EST database with the human PAK gene
(GB: U24152) as a query. Sequence analysis of the 2332 bp insert
identified a 930 bp ORF (310 amino acids) with the potential to
encode the C-terminus of a novel human STK related to the human PAK
gene product.
[0638] cDNA clone SNB2#1 was isolated from human glioblastoma cell
line SNB75 cDNA library using a probe derived from R88460. SNB2#1
contains a 3604 bp insert and an ORF of 2043 bp (681 amino
acids).
[0639] The full-length human PAK4 cDNA (SEQ ID NO.27) is 3604 bp
long and consists of a 2043 bp ORF (143-2185) flanked by a 142 bp
(1-142) 5'UTR and a 1419 3' UTR followed by a 22 nucleotide
polydenylated region. A potential polyadenylation signal (AATTAAA)
is found at positions 3582-3588. The sequence flanking the first
ATG conforms to the Kozak consensus for an initiating methionine,
and is believed to be the translational start site for human PAK4.
The 3' UTR of the PAK4 gene contains a GT dinucleotide repeat prone
to undergo expansion based on the number of repeats found in clones
SNB#1 and R88460, 32 and 23, respectively. Several neurologic
disorders have been correlated with the expansion of di- or
tri-nucleotide repeats similar to those found in the PAK4 sequence,
suggesting PAK 4 may also be a disease target and that this repeat
in its 3' UTR may serve as a diagnostic marker.
[0640] Multiple EST fragments (AA535791) match the 3'end of the
human PAK4 gene, but at the time of filing, the inventors believe
that none exist in GenBank or the EST database that match its 5'
end.
[0641] cDNA Cloning and Characterization of PAK5
[0642] The full-length human PAK5 cDNA sequence is composed of two
overlapping clones, H450#1-1 and SNB8#5.
[0643] A human PAK5 clone, RI 8825, was first identified using a
Smith-Waterman search of the EST database with the human PAK4 gene
as a query. Sequence analysis of the 1248 bp insert identified a
420 bp ORF (140 amino acids) with the potential to encode the
C-terminus of a novel human STK related to the human PAK4 gene
product.
[0644] cDNA clone SNB8#5 was isolated from human SNB75 cDNA library
using a probe derived from R18825. SNB2#1 contains a 2028 bp insert
and an ORF of 1194 bp (398 amino acids).
[0645] The partial human PAK5 cDNA (SEQ ID NO.28) is 2028 bp long
and consists of a 1194 bp ORF (2-1195) flanked by an 833 bp
(1196-2028) 3' UTR followed by a 22 nucleotide polydenylated
region. A potential polyadenylation signal (AATTAAA) is found at
positions 2004-2010. Since the coding region is open throughout the
5' extent of this sequence, this is apparently a partial cDNA clone
lacking the N-terminal start methionine.
[0646] Clone H460#1-1 was isolated from a human lung H460 cDNA
library using a probe derived from the partial SNB2#1 cDNA clone
described above. Sequence analysis of the 2526 bp insert identified
a 1773 bp ORF (592 amino acids) with the potential to encode a
full-length PAK5.
[0647] The human PAK5 cDNA (SEQ ID NO:102) is 2,806 bp long and
consists of a 1,773 bp ORF flanked by a 201 bp 5' UTR and a 833 bp
3' UTR. The sequence flanking the first ATG conforms to the Kozak
consensus (Kozak, M., Nucleic Acids Res. 15, 8125-8148 (1987)) for
an initiating methionine, and is believed to be the translational
start site for PAK5.
[0648] PAK5 shares 99% sequence identity over 2795 bp to a recent
database entry, AF005046. These sequences are presumed to be from
the same gene, with minor polymorphic variations.
Example 2
Expression Analysis of Mammalian STE20-Related Protein Kinases
[0649] Materials and Methods
[0650] Northern blot analysis
[0651] Northern blots were prepared by running 10 .mu.g total RNA
isolated from 60 human tumor cell lines (HOP-92, EKVX, NCI-H23,
NCI-H226, NCI-H322M, NCI-H460, NCI-H522, A549, HOP-62, OVCAR-3,
OVCAR-4, OVCAR-5, OVCAR-8, IGROV1, SK-OV-3, SNB-19, SNB-75, U251,
SF-268, SF-295, SF-539, CCRF-CEM, K-562, MOLT-4, HL-60, RPMI 8226,
SR, DU-145, PC-3, HT-29, HCC-2998, HCT-116, SW620, Colo 205, HTC15,
KM-12, UO-31, SN12C, A498, CaKil, RXF-393, ACHN, 786-0, TK-10, LOX
IMVI, Malme-3M, SK-MEL-2, SK-MEL-5, SK-MEL-28, UACC-62, UACC-257,
M14, MCF-7, MCF-7/ADR RES, Hs578T, MDA-MB-231, MDA-MB-435, MDA-N,
BT-549, T47D), from 22 human adult tissues (thymus, lung, duodenum,
colon, testis, brain, cerebellum, cortex, salivary gland, liver,
pancreas, kidney, spleen, stomach, uterus, prostate, skeletal
muscle, placenta, mammary gland, bladder, lymph node, adipose
tissue), and 2 human fetal normal tissues (fetal liver, fetal
brain), on a denaturing formaldehyde 1.2% agarose gel and
transferring to nylon membranes.
[0652] Filters were hybridized with random primed
[.alpha..sup.32P]dCTP-la- beled probes synthesized from the inserts
of several of the STE20-related kinase genes. Hybridization was
performed at 42.degree. C. overnight in 6X SSC, 0.1% SDS, 1.times.
Denhardt's solution, 100 .mu.g/mL denatured herring sperm DNA with
1-2 x 10.sup.6 cpm/mL of .sup.32P-labeled DNA probes. The filters
were washed in 0.1.times. SSC/0.1% SDS, 65.degree. C., and exposed
on a Molecular Dynamics phosphorimager.
[0653] Quantitative PCR Analysis
[0654] RNA was isolated from a variety of normal human tissues and
cell lines. Single stranded cDNA was synthesized from 10
.quadrature.g of each RNA as described above using the Superscript
Preamplification System (GibcoBRL). These single strand templates
were then used in a 25 cycle PCR reaction with primers specific to
each clone. Reaction products were electrophoresed on 2% agarose
gels, stained with ethidium bromide and photographed on a UV light
box. The relative intensity of the STK-specific bands were
estimated for each sample.
[0655] DNA Array Based Expression Analysis
[0656] Plasmid DNA array blots were prepared by loading 0.5
.quadrature.g denatured plasmid for each STE20-related kinase on a
nylon membrane. The [.alpha..sup.32P]dCTP labeled single stranded
DNA probes were synthesized from the total RNA isolated from
several human immune tissue sources or tumor cells (thymus,
dendrocytes, mast cells, monocytes, B cells (primary, Jurkat,
RPMI8226, SR), T cells (CD8/CD4+, TH 1, TH2, CEM, MOLT4), K562
(megakaryocytes). Hybridization was performed at 42.degree. C. for
16 hours in 6.times. SSC, 0.1% SDS, 1.times. Denhardt's solution,
100 .mu.g/mL denatured herring sperm DNA with 10.sup.6 cpm/mL of
[.alpha..sup.32P]dCTP labeled single stranded probe. The filters
were washed in 0.1.times. SSC/0.1% SDS, 65.degree. C., and exposed
for quantitative analysis on a Molecular Dynamics
phosphorimager.
[0657] Results
[0658] Distribution of STE20-Related Gene Transcripts in Normal
Tissues and Tumor Cell Lines
[0659] ZC1, ZC2, and ZC3 RNA expression was analyzed by
quantitative PCR from multiple human normal tissues, cultured
primary epithelial and endothelial cells, and tumor cell lines. The
results are summarized in Tables 1 and 2, with relative expression
values ranging from 0 (undetectable) to 23 (very strong). An "x"
refers to sample not tested. ZC1, ZC2, and ZC3 were all expressed
at very low levels in most normal human tissues, however ZC1 and
ZC2 were more abundant in cultured epithelial cells and ZC3 in
normal kidney and breast tissue.
[0660] Expression of these 3 genes was also examined in a panel of
human tumor cell lines representing a diverse sampling of tumor
types (Table 2). ZC1 and ZC2 showed strong expression in cell lines
from most melanomas and renal tumors and from some non-small cell
lung cancers and colon tumors. ZC3 expression was consistently
lower in the tumor cell lines except for high expression in most
breast cancers and leukemias. The robust overexpression ZC1, ZC2,
and ZC3 in tumor cells versus normal tissues may provide an
attractive target for oncology drug development.
[0661] Expression of all the novel STE20-related kinases was
examined in a panel of human immune tissues/cells by hybridization
to a DNA array blot containing plasmids encoding each of these
genes. STLK2 was broadly expressed in all 14 immune samples,
whereas STLK4 and PAK4 were highly expressed in a subset of 6-7 of
the samples (Table 3). Several other kinases (SULU3, ZC4, KHS2) had
more restricted expression, while others were expressed in only a
single immune source (STLK3, thymus; ZC1, dendrocytes; ZC3,
monocytes; PAK5, mast cells and MOLT4), and several more were
absent from all the immune sources assayed (GEK2, SULU1, ZC2,
STLK5). These expression patterns were quite distinct among members
of the same subfamily (i.e., ZC1, ZC2, ZC3 and ZC4, or PAK1, PAK2,
PAK3, PAK4, PAK5). This analysis suggests that some of these
kinases may be candidate targets for various immune disorders, and
that some, which are more broadly expressed, may mediate functions
vital to the basic biology of most proliferating cells.
3TABLE 1 ZC1, ZC2 and ZC3 Expression in Normal Human Tissues and
Cells Sample ZC1 ZC2 ZC3 NORMAL Brain Tiss 2.8 0.6 0.9 Duod Tiss
3.8 1.5 0.3 Heart Tiss 1.2 0.3 0.0 Kidney Tiss 0.7 0.0 7.0 Lung
Tiss 1.6 0.2 0.0 Pancreas Tiss 2.0 0.4 2.5 Placenta Tiss 1.4 0.0
0.0 Sal gl. Tiss 3.0 0.3 3.2 Sk mus. Tiss 2.3 0.1 0.1 Spleen Tiss
0.4 0.0 x Stomach Tiss 0.8 0.0 0.0 Thymus Tiss 3.5 0.4 1.5 Cereb
Tiss 2.8 1.1 4.4 Liver Tiss 1.8 0.0 0.4 Uterus Tiss 1.6 0.0 1.4
Prostate Tiss 1.4 0.0 1.6 Testis Tiss x x 5.8 f Brain Tiss x x 3.1
Mam gl Tiss x x 7.2 HCAEC ENDO 1.0 0.0 0.0 HMVEC-d ENDO 0.7 0.0 0.4
HMVEC-L ENDO 2.2 1.6 1.8 HPAEC ENDO 9.3 5.3 6.4 HMEC EPI 4.1 2.3
1.9 RPTEC EPI 3.6 2.2 0.2 HRCE EPI 5.3 3.5 1.3 HSAE EPI 0.9 3.3
4.8
[0662]
4TABLE 2 ZC1, ZC2 and ZC3 Expression in Tumor Cell 1Lnes Sample
Origin ZC1 ZC2 ZC3 Sample Origin ZC1 ZC2 ZC3 HOP-92 Lung 9.3 7.2
3.3 HCC-2998 Colon 2.4 3.8 3.0 EKVX Lung 10.7 3.7 3.5 HCT 116 Colon
2.2 2.1 5.4 NCI-H23 Lung 5.8 6.3 4.1 SW-620 Colon 7.8 12.1 3.1
NCI-H226 Lung 6.5 6.8 3.3 COLO 205 Colon 9.1 16.2 3.0 NCI-H322M
Lung 3.5 5.8 4.9 HCT-15 Colon 13.8 4.9 2.5 NCI-H460 Lung 4.5 3.7
2.9 KM-12 Colon 7.0 13.2 3.1 NCI-H522 Lung 4.7 3.3 4.6 UO-31 Colon
10.4 10.6 0.9 A549/ATCC Lung 3.8 3.6 4.1 SN12C Renal 8.1 3.4 2.8
HOP-62 Lung 4.3 3.8 4.2 A498 Renal 6.2 3.1 2.9 OVCAR-3 Ovary 2.9
3.1 1.5 Caki-1 Renal 9.2 14.4 2.3 OVCAR-4 Ovary 3.3 1.0 3.8 RXF 393
Renal 10.6 4.8 2.8 OVCAR-5 Ovary 2.6 3.6 2.2 ACHN Renal 9.3 6.0 3.9
OVCAR-8 Ovary 3.6 2.0 4.7 786-0 Renal 8.8 15.6 5.6 IGROV1 Ovary 3.8
1.7 3.2 TK-10 Renal 20.9 21.2 5.0 SK-OV-3 Ovary 4.9 0.0 3.5 LOX
IMVI Mel 2.3 2.4 3.3 SNB-19 CNS 5.1 5.4 4.2 Malme-3M Mel x x 2.2
SNB-75 CNS 2.5 0.9 0.7 SK-MEL-2 Mel 15.7 14.1 2.9 U251 CNS 1.5 1.2
0.6 SK-MEL-5 Mel 7.9 7.0 0.0 SF-268 CNS 5.8 2.7 3.0 SK-MEL-28 Mel
16.5 23.1 0.0 SF-295 CNS 6.4 1.1 3.2 UACC-62 Mel 12.1 18.3 5.3
SF-539 CNS 5.1 2.9 4.3 UACC-257 Mel 10.8 9.4 6.2 CCRF-CEM Leuk 3.4
2.7 3.1 M14 Mel 4.4 0.9 7.9 K-562 Leuk 4.1 6.3 4.3 MCF7 Breast 4.8
1.3 7.7 MOLT-4 Leuk 7.1 3.4 4.2 MCF-7/ADR Breast 8.8 3.4 7.7 HL-60
Leuk x x 0.4 Hs 578T Breast 6.9 2.6 5.7 RPMI 8226 Leuk 0.5 0.2 1.4
MDA-MB-231 Breast 5.7 1.9 6.4 SR Leuk 3.5 7.2 5.4 MDA-MB-435 Breast
4.8 6.7 9.1 DU-145 Pro x x 3.4 MDA-N Breast 7.3 6.3 9.1 PC-3 Pro x
x 3.4 BT-549 Breast 3.6 1.9 8.0 HT-29 Colon 2.4 5.9 6.6 T-47D
Breast 0.4 12.3 9.3
[0663]
5TABLE 3 STE20-related kinase expression in a human immune panel
Mast Mono- B CD8+ KINASE thymus Dendrocytes cells cytes cells CD4+
TH1 TH2 GEK2 350 350 350 350 350 350 350 350 SULU1 350 350 350 350
350 350 350 350 SULU3 350 350 350 350 12149 350 5115 350 STLK2
117770 13771 27620 92036 18305 39109 5408 3564 STLK3 8624 350 350
350 350 350 350 350 STLK4 8524 350 350 350 350 8685 5642 350 STLK5
xxx xxx xxx xxx 350 350 350 xxx ZC1 350 3377 350 350 350 350 350
350 ZC2 350 350 350 350 350 350 350 350 ZC3 350 350 350 20156 350
350 350 350 ZC4 xxx xxx xxx xxx 350 350 350 xxx KHS2 8766 2508 350
56575 350 350 350 350 PAK4 32658 7684 3729 100948 350 350 350 1604
PAK5 350 350 4905 350 350 350 350 350 CEM MOLT4 JURKAT RPMI8226 SR
K562 KINASE (T cell) (T cell) (B cell) (B cell) (B cell) (MO) GEK2
350 350 350 350 350 350 SULU1 350 350 350 350 350 350 SULU3 350 350
350 350 350 350 STLK2 47236 53262 47605 22560 65936 30390 STLK3 350
350 350 350 350 350 STLK4 3648 350 26772 1570 350 350 STLK5 350 350
350 xxx 350 350 ZC1 350 350 350 350 350 350 ZC2 350 350 350 350 350
350 ZC3 350 350 350 350 350 350 ZC4 1094 7813 14945 xxx 350 6385
KHS2 350 350 350 350 350 350 PAK4 350 10246 350 3229 350 350 PAK5
350 12672 350 350 350 350
[0664] Transcript Size from Northern Data
6 Kinase (kb) STLK2 3.8 STLK4 5.0 ZC1 6.9/4.7 ZC2 6.0/8.0 ZC4 5
KHS2 4.4 SULU1 4.5 SULU3 10.0 GEK2 5.5 PAK4 4.8 PAK5 3.5
[0665] STLK2is widely expressed; the highest expression levels were
found in placenta, spleen and PBL.
[0666] STLK4 is also widely expressed in normal tissues including
heart, brain, placenta, lung, liver, skeletal muscle, kidney,
pancreas, spleen, thymus, prostate, testis, ovary, small intestine,
colon, and peripheral blood lymphocytes. STLK4 was also detected in
Jurkat T cells.
[0667] ZC1 is highly overexpressed in the following human cancer
cell lines: HOP-92, EKVX, NCI-H23, NCI-H226, NCI-H322M, NCI-H522,
A549, HOP-62 (lung); OVCAR-3, OVCAR-4, OVCAR-5 (ovary); SNB-19,
U251, SF-268, SF-295, SF-539 (CNS); K-562, RPMI-8226 (leukemia);
DU-145, PC-3 (prostate); HT-29, HCC-2998, HCT-116, SW620, COLO-205,
HCT-15, KM-12 (colon); UO-31, CAKi-1, RXF-393, 786-0, TK-10
(renal); LOXIMVI, Malme-3M, SK-MEL-2, SK-MEL-28, UACC-62, UACC-257,
M14 (melanoma); and MCF-7, MCF-7/ADR, HIS 578T, MDA-MB-231,
MDA-MB-431, MDA-N, BT-549, T-47D (breast).
[0668] ZC2 is expressed in brain and testis. It is highly
overexpressed in the following human cancer cell lines: TK-10
(renal); SK-MEL-28, UACC-62 (melanoma); T47D (breast).
[0669] Moderate expression in HOP92 (lung); OVCAR4, IGROVI (ovary);
DNB75, U251 (brain); K-562 (leukemia); and COL0205 (colon).
[0670] SULU1 is overexpressed in the following human cancer cell
lines: HOP-92, EKVX, NCI-H23, NCI-H226, NCI-H322M, NCI-H522, A549,
HOP-62 (lung); OVCAR-3, OVCAR-4, OVCAR-5, SK-OV-3 (ovary); SNB-19,
U251, SF-268, SF-295, SF-539 (CNS); K-562, RPMI-8226 (leukemia);
DU-145, PC-3 (prostate); HT-29, HCC-2998, HCT-116, SW620, COLO-205,
HCT-15, KM-12 (colon); UO-31, CAKi-1, RXF-393, 786-0, TK-10
(renal); LOX, IMVI, Malme-3M, SK-MEL-2, SK-MEL-28, UACC-62,
UACC-257, M14 (melanoma); MCF-7, MCF-7/ADR, HIS 578T, MDA-MB-231,
MDA-MB-431, MDA-N, BT-549, T-47D (breast)
[0671] SULU3 showed a broad pattern of expression in the normal
tissue panel of RNAs.
[0672] GEK2 was expressed in spleen, thymus and testis. Expression
was high in the cell lines RBL-2H3 and H441.
[0673] PAK4 was expressed in the normal tissues: brain, testis and
prostate, and in the human cancer cell lines: HNCI-H23 (lung);
OVCAR-3 (ovary); SNB-19, U251 (CNS); RPMI-8226 (leukemia); DU-145
(prostate); COLO-205, HCT-15 (colon).
[0674] PAK5 showed weak expression levels in the normal tissues:
brain, testes, bladder, colon, adrenal medulla, spleen, fetal
liver, breast, cerebral cortex, cerebellum, thymus, salivary gland,
lung, stomach, duodenum, uterus, prostate, skeletal muscle and
placenta. PAK5 was overexpressed in the human cancer cell lines:
HOP-92, EKVX, NCI-H23, NCI-H226, NCI-H322M, NCI-H522, A549, HOP-62
(lung); OVCAR-3, OVCAR-4, OVCAR-5, SK-OV-3 (ovary); SNB-19, U251,
SF-268, SF-295, SF-539 (CNS); K-562, RPMI-8226 (leukemia); DU-145,
PC-3 (prostate); HT-29, HCC-2998, HCT-116, SW620, COLO-205, HCT-15,
KM-12 (colon); UO-31, CAKi-1, RXF-393, 786-0, TK-10 (renal);
LOXIMVI, Malme-3M, SK-MEL-2, SK-MEL-28, UACC-62, UACC-257, M14
(melanoma); MCF-7, MCF-7/ADR, HIS 578T, MDA-MB-231, MDA-MB-431,
MDA-N, BT-549, T-47D (breast).
Example 3
STE20-related Protein Kinase Gene Expression Vector
Construction
[0675] Materials and Methods
[0676] Expression Vector Construction
[0677] Several expression constructs were generated for some of the
human STE20-related cDNAs including: a) full-length clones in a
pCDNA expression vector; b) a GST-fusion construct containing the
catalytic domain of the novel STE20-related kinase fused to the
C-terminal end of a GST expression cassette; and c) a full-length
clone containing a Lys to Ala (K to A) mutation at the predicted
ATP binding site within the kinase domain, inserted in the pCDNA
vector.
[0678] The "K to A"mutants of the STE20-related kinase might
function as dominant negative constructs, and will be used to
elucidate the function of these novel STKs.
[0679] Results
[0680] Constructs for ZC1, ZC2, ZC3, SULU1, SULU3, PAK4 and PAK5
have been generated.
[0681] Numerous additional constructs have been generated for the
various STE20-subfamily kinases, including full length, kinase
inactive and tagged versions. In addition, the following three
constructs were designed for specific applications based on their
unique domain structure:
[0682] Construct 1: SULU1-Coiled-Coil2
[0683] Vector: pGEX-4T
[0684] Insert: Coiled-coil2
[0685] Sequence: Amino acids 752-898
[0686] Purpose: phage display
[0687] Result: Interacts with GEK2 CC 1
[0688] Construct 2: SULU3-Coiled-Coil2
[0689] Vector: pGEX4T
[0690] Insert: coiled-coil 2 domain fused to GST
[0691] Sequence range of insert: amino acids 802-898 of SEQ
[0692] Purpose: phage display
[0693] Result: Interacts with coiled-coiled region of human SLK
[0694] Construct 3: PAK5 Dominant Negative
[0695] Vector: pCAN5
[0696] Insert: Full length coding sequence of human PAK5 containing
the following mutation:
[0697] K350,351A (Lys at aa positions 350 and 351 changed to
Ala).
[0698] Purpose: to determine role of human PAK5 kinase activity in
cell growth and transformation.
[0699] Result: Interferes with Ras transformation.
Example 4
Generation of Specific Immunoreagents to STE20-Related Protein
Kinases
[0700] Materials and Methods
[0701] Specific immunoreagents were raised in rabbits against KLH-
or MAP-conjugated synthetic peptides corresponding to the human
STE20-related kinases. C-terminal peptides were conjugated to KLH
with glutaraldehyde, leaving a free C-terminus. Internal peptides
were MAP-conjugated with a blocked N-terminus. Additional
immunoreagents can also be generated by immunizing rabbits with the
bacterially expressed GST-fusion proteins containing the
cytoplasmic domains of each novel STK.
[0702] The various immune sera are first tested for reactivity and
selectivity to recombinant protein, prior to testing for endogenous
sources.
[0703] Western blots
[0704] Proteins in SDS PAGE are transferred to immobilon membrane.
The washing buffer is PBST (standard phosphate-buffered saline pH
7.4+0.1% triton x 100). Blocking and antibody incubation buffer is
PBST +5% milk. Antibody dilutions varied from 1:1000 to 1:2000.
[0705] Results
[0706] Three SULU1 antisera (against both 539A (SEQ ID NO: 79) and
540A (SEQ ID NO: 78)) and two SULU3 antisera (542A) (SEQ ID NO: 81)
reacted specifically with the peptide antigens. Antisera binding
was competable with peptide. Experiments with extracts from cells
transfected with epitope-tagged SULU1 and SULU3 genes are
underway.
[0707] Antisera against the PAK4 C-terminal peptide 554A (SEQ ID
NO: 82) reacted with purified Gst-PAK4 and detected a protein of
the correct molecular weight from tissue culture cells. Specific
immunoprecipitation experiments are ongoing to determine the
reactivity with native protein.
[0708] Similar immunization and antisera testing experiments are
underway for each of the other novel STE20-kinases.
[0709] STE20-related protein kinase peptide immunogens and their
specificity in recognizing endogenous protein by Western blots or
immunoprecipitations.
7 Aa Protein Sequence positions Conj West. IP STLK2 EKFQKCSADESP
405-416 KLH Y Y (SEQ ID No: 111) STLK4 SISNSELFPTTDPVGT 252-267 KLH
Y Y (SEQ ID NO: 112) SULU1 LDFPKEDYR 890-898 KLH Y Y (SEQ ID NO:
113) SULU1 HGDPRPEPRPTQ 409-420 KLH Y Y (SEQ ID NO: 114) SULU3
PSTNRAGSLKDPEC 2-14 KLH N ND (SEQ ID NO: 115) SULU3
DPRTRASDPQSPPQVS 411-429 KLH ND ND RHK (SEQ ID NO: 116) PAK4
CLVPLIQLYRKQTSTC 666-680 KLH ND Y (SEQ ID NO: 117) PAK5 PLMRQNRTR
390-398 KLH Y Y (SEQ ID NO: 118) PAK5 SGDRRRAGPEKRPKSS 148-163 KLH
Y Y (SEQ ID NO: 119) PAK5 (C) RRKSLVGTPYWM 471-485 KLH Y ND APE
(SEQ ID NO: 120) ND = not done yet
[0710] STE20-related protein kinase GST fusion protein immunogens
and their specificity in recognizing endogenous protein by Western
blots or immunoprecipitations.
8 Protein domain Aa positions West. IP ZC1 Coiled-coil/pro/B/C
350-867 Y Y ZC1 B 615-732 Y Y ZC2 Coiled-coil/pro/B 348-762 ND ND
ZC2 B 658-762 Y Y PAK4 Nterm 252-426 ND ND PAK4 Kinase/Cterm
350-681 ND Y PAK5 A/Nterm 53-330 ND ND PAK5 A/Nterm 53-309 ND ND ND
= not done yet
[0711] The 50 kD STLK2 protein was expressed highly in several
hematopoietic cell lines including Jurkat, pGL10, Ramos, A20,
WEHI-231, K562, HEL and freshly isolated thyrnocytes from C57/BL6
mice. High levels of STLK2 expression were also detected in several
tumor cell lines including Calu6, Colo205, LS 180, MDAM231 and
A549.
[0712] The 160 kD ZC1 protein was detected in Jurkat T cells,
Colo205, HCT116, RIE-1, 293T, MDAMB231, and SK-MEL28.
[0713] The 170 kD ZC2 protein was detected in SK-Mel28 and
UACC-62.
[0714] Elevated levels of the 64 kD PAK5 protein were confirmed in
the breast cancer cell lines MDA-231 and MCF-7, and in the lung
cancer cell line A549.
Example 5
Recombinant Expression and Biological Assays for STE20-Related
Protein Kinases
[0715] Materials and Methods
[0716] Transient Expression of the Ste20-Related Kinases in
Mammalian Cells
[0717] The pcDNA expression plasmids (10 .mu.g DNA/100 mm plate)
containing the STE20-related kinase constructs are introduced into
293 cells with lipofectamine (Gibco BRL). After 72 hours, the cells
are harvested in 0.5 mL solubilization buffer (20 mM HEPES, pH
7.35, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM
MgCl.sub.2, 1 mM EGTA, 2 mM phenylmethylsulfonyl fluoride, 1
.mu.g/mL aprotinin). Sample aliquots were resolved by SDS
polyacrylamide gel electrophoresis (PAGE) on 6% acrylamide/0.5%
bis-acrylamide gels and electrophoretically transferred to
nitrocellulose. Non-specific binding was blocked by preincubating
blots in Blotto (phosphate buffered saline containing 5% w/v
non-fat dried milk and 0.2% v/v nonidet P-40 (Sigma)), and
recombinant protein was detected using the various anti-peptide or
anti-GST-fusion specific antisera.
[0718] In Vitro Kinase Assays
[0719] Three days after transfection with the STE20-related kinase
expression contructs, a 10 cm plate of 293 cells was washed with
PBS and solubilized on ice with 2 mL PBSTDS containing phosphatase
inhibitors (10 mM NaHPO.sub.4, pH 7.25, 150 mM NaCl, 1% Triton
X-100, 0.5% deoxycholate, 0.1% SDS, 0.2% sodium azide, 1 mM NaF, 1
mM EGTA, 4 mM sodium orthovanadate, 1% aprotinin, 5 .mu.g/mL
leupeptin). Cell debris was removed by centrifugation (12000.times.
g, 15 min, 4.degree. C.) and the lysate was precleared by two
successive incubations with 50 .mu.L of a 1:1 slurry of protein A
sepharose for 1 hour each. One-half mL of the cleared supernatant
was reacted with 10 .mu.L of protein A purified kinase-specific
antisera (generated from the GST fusion protein or antipeptide
antisera) plus 50 .mu.L of a 1:1 slurry of protein A-sepharose for
2 hr at 4.degree. C. The beads were then washed 2 times in PBSTDS,
and 2 times in HNTG (20 mM HEPES, pH 7.5/150 mM NaCl, 0,1% Triton
X-100, 10% glycerol).
[0720] The immunopurified kinases on sepharose beads were
resuspended in 20 gL HNTG plus 30 mM MgCl.sub.2, 10 mM MnCl.sub.2,
and 20 .mu.Ci [.alpha..sup.32P]ATP (3000 Ci/mmol). The kinase
reactions were run for 30 min at room temperature, and stopped by
addition of HNTG supplemented with 50 mM EDTA. The samples were
washed 6 times in HNTG, boiled 5 min in SDS sample buffer and
analyzed by 6% SDS-PAGE followed by autoradiography. Phosphoamino
acid analysis was performed by standard 2D methods on
.sup.32P-labeled bands excised from the SDS-PAGE gel.
[0721] Similar assays were performed on bacterially expressed
GST-fusion constructs of the kinases.
[0722] ZC1 Assay buffer: 20 mM Tris pH 7.4, 200 mM NaCl, 0.5 mM
DTT, 3 mM MgCl2, 0.3 mM MnCl2, 100 .mu.M .sup.32P.gamma.ATP.
[0723] Substrates: myelin basic protein (MBP) at 0.28 mg/mL and
phosphorylated ZC1 peptide RTVGRRNTFIGT-PPYWMAPE(SEQ ID NO: 121) at
17 .mu.M (bold underlined residue shows site of
phosphorylation).
[0724] At higher concentrations of MgCl.sub.2 (3 mM), the activity
of ZC1 (both full-length and recombinant kinase domain) is up to
10-fold greater towards exogenous substrate MBP. In contrast, the
autophosphorylation and the phosphorylation of the activation loop
peptide substrate are both inhibited. Mn++ does not inhibit the
autophosphorylation and the peptide phosphorylation by the
truncated kinase domain form. However, both the MBP
phosphorylation, Mn++-preferring activity AND the
autophosphorylating, Mg++-preferring activity are eliminated with
mutation of the ATP-binding lysine in ZC1 (Lys54Ala) indicating
that both activities are attributable to the ZC1 kinase domain.
[0725] SULU1 Assay buffer: This buffer is identical to that for
ZC1, except for 5 mM MgCl2. Under these conditions, other STE20
family members (PAK4, ZC1) were inhibited for autophosphorylation
and required reducing the [Mn] to <0.3 mM for an efficient
autophosphorylation reaction.
[0726] Substrates: MBP, phosvitin, or .alpha.-casein at 0.28
mg/mL.
[0727] PAK4, PAK5 Assay Buffer: 20 mM Hepes pH 7.2, 130 mM KCl, 10
mM MgCl2, 1 mM NaF, 20 mM B-glycerolphosphate, 0.5 mM DTT, 50 .mu.M
ATP, 0.5 .mu.Ci .sup.32P.gamma.ATP.
[0728] Substrates: MBP at 0.28 mg/mL and peptide substrates derived
from PAK5 activation loop at 2.5 .mu.M.
[0729] STLK2 Assay buffer: Similar to that described above, except
for the inclusion of 5 mM MgCl.sub.2, 5 mM MnCl.sub.2 and 5 .mu.Ci
.sup.32P.gamma.ATP.
[0730] Transformation (PAK Experiments)
[0731] Low-passage NIH3T3 fibroblasts displaying normal morphology
(flat, non-refractile cellular morphology), as well as low rates of
spontaneous transformation, were used in transformation assays.
NIH3T3 cells were maintained in Dulbecco's modified Eagle's medium
supplemented with 10% (v/v) fetal calf serum, penicillin (100 U/mL)
and streptomycin (100 U/mL) and kept in an humidified incubator at
37.degree. C. and 5% CO.sub.2.
[0732] Cells were transfected with DNA-lipid complexes. As per
manufacturer instructions, lipofectamine was utilized to transfect
NIH3T3 cells. All transfections were with equal amounts of plasmid
DNA (DNA from the appropriate expression vector without insert was
used to give equivalent amounts of DNA per transfection). 1 .mu.g
of activated allele of H-Ras was co-transfected with increasing
amounts of various alleles of PAK5.
[0733] Foci were scored after 3 weeks by fixing 10 min in 10%
methanol, 10% acetic acid for 10 min, followed by staining with
0.4% (w/v) crystal violet in 10% methanol for 10 min, and washing
with deionized water and drying at room temperature.
[0734] Transfections Stimulations, and Luciferase Assays (ZC1
Experiments)
[0735] Cells (10.sup.7) were transiently transfected by
electroporation using a Gene Pulser (Bio-Rad Labs) with the setting
of 960_F and 250 V. 20-40 hours later, transfected cells (about
10.sup.5) were stimulated with various stimuli. After a 6-hour
stimulation, cells were lysed, and luciferase activities were
measured using the MicroLumatPlus (EG&G Berthold). (J. Exp.
Med. 183:611-620, 1996, hereby incorporated by reference herein in
its entirety including any drawings, tables, or figures.)
[0736] Results
[0737] Protein expression and kinase activity of novel
STE20-related protein kinases
9 Endogenous Observed size Predicted In vitro Kinase Kinase Protein
(kD) Size(kD) activity activity STLK2 50 46 y y STLK4 55 50 y ND
ZC1 160 140 y y ZC2 170 150 y y KHS2 ND 101 ND ND SULU1 119 105 y y
SULU3 140 115 ND Y PAK4 80 75 y y PAK5 64 64 y y
[0738] ZC1: Regulation of Kinase Activity
[0739] ZC1 is constitutively active as a full-length kinase when
expressed either in vitro (TNT rabbit reticulocyte system) or in
NIH 3T3, 293T, or H1299 tissue culture cells. The endogenously
expressed kinase is also active when immunoprecipitated from
carcinoma cell lines.
[0740] ZC1 Signaling Pathways
[0741] Using human leukemic T cell line Jurkat as a model system,
the impact of cotransfected wild-type ZC1 on the activation of two
reporter genes, RE/AP-luciferase and NF.kappa.B luciferase, was
examined. RE/AP is a composite in the IL-2 gene promoter containing
both a NF.kappa.B-like site and an AP-1 site.
[0742] Optimal activation of both RE/AP-luciferase and
NF.kappa.B-luciferase reporter genes in Jurkat T cells requires
signals generated from stimulation of both T cell receptor and the
costimulator receptor CD28. Cotransfection of wild-type ZC1 with
either the RE/AP-luciferase or the NF.kappa.B-luciferase reporter
results in the activation of RE/AP or NF.kappa.B when costimulated
with the anti-T cell receptor monoclonal antibody or the
pharmacological reagents PMA and ionomycin that bypass proximal T
cell receptor. No activation was seen when costimulated with an
anti-CD28 monoclonal antibody.
[0743] These results suggest that wild-type ZC1, when
overexpressed, was replacing a CD28-specific signal to activate
RE/AP or NF.kappa.B. These results imply that ZC1 is involved in
the CD28 signaling pathway. Since NF.kappa.B is one of the major
pathways also activated by the pro-inflammatory cytokine
TNF-.alpha. signaling, it is also likely that ZC1 may be a
component in the TNF-.alpha. signaling pathways.
[0744] PAK5: Design of Specific Peptide Substrates
[0745] To aid in the development of in vitro kinase assays for
screening small molecule libraries to identify specific inhibitors,
the search for specific peptide substrates for PAK5 was
undertaken.
[0746] The rationale used to design such peptides is based on the
hypothesis that upon binding activated small G protein, PAK5
undergoes a conformational change that results in derepression of
its kinase activity followed by autophosphorylation on the
activation loop resulting in a fully active kinase. The site of
autophosphorylation for related family members has been identified
by biochemical and/or genetic means (e.g. Wu, C, et al. J. Biol.
Chem 270:15984-15992 and Szczepanowska, et al. Proc. Natl. Acad.
Sci 94, 8503-8508, 1997). Specific peptide substrates for PAK5 were
designed from the sequence of the activation loop of this
kinase.
[0747] An activation loop PAK5 peptide phosphorylated on the Thr
residue of the TPY motif served as a high-affinity substrate for
PAK5.
[0748] PAK5 Activation Loop Peptides as Kinase Substrates
10 SEQ Peptide # Kinase Sequence Aa ID Kinase substrate 1 PAK5
(C)RRKSLVGTPYWMA 471-485 120 PAK5 yes PE 2 PAK5 (C)RRKSLVGTPYWMA
471-485 120 PAK5 yes PE 3 PAK5 (C)RRKSLVGTPYWMA 471-485 120 PAK5 no
PE 4 KHS1 KRKSFIGTPYWMAPE 171-185 122 PAK5 yes 5 STLK2
KRNTFVGTPFWMA 175-189 123 PAK5 poor PE 6 SULU1 PANSFVGTPYWMAPE
174-188 124 PAK5 poor 7 ZC1 RRNTFIGTPYWMAPE 184-198 125 PAK5 poor 8
ZC1 RRNTFIGTPYWMAPE 184-198 126 PAK5 poor 9 STLK4 RNKVRKTFVGTPCWM
66-83 127 PAK5 poor APE 10 PAK5 (C)RRKSLVGTPYWMA 471-485 120 PAK4
yes PE Note: underlined/bold reside was phosphorylated
[0749]
11 Peptide # Kinase Notes 1 PAK5 Equally well as MBB 2 PAK5 High Km
for PAK5 (1-10 .mu.M) 3 PAK5 S is the site of phosphorylation 4
KHS1 Similar to peptide 1 5 STLK2 6 SULU1 7 ZC1 8 ZC1 Better than 7
9 STLK4 10 PAK5 Same Km as phosph. by PAK5
[0750] PAK5: Transformation
[0751] Transformation of low-passage NIH3T3 cells by ras in the
presence or absence of various alleles of PAK5 showed that the
dominant negative, kinase-dead allele of PAK5 was able to block ras
transformation of NIH3T3 cells. Thus, PAK5 activity is required for
ras transformation of NIH3T3 cells. Inhibition of PAK5 activity may
have therapeutic value as an anti-proliferative agent for treating
cancer.
[0752] PAK4 and PAK5: Interaction with Cdc42
[0753] PAK 4 interacts with CDC42 small G-protein but not Rac,
RhoA, or Ras as determined by co-transfection of recombinant genes
and detection by kinase assays. PAK5 also interacts with Cdc42.
Coding sequences of activated alleles of small G proteins (ras,
Cdc42, Rac, Rho) tagged with a Myc epitope were transiently
expressed in 293T cells, various alleles of 35S-labeled PAK5 tagged
with HA epitope were expressed in vitro with the reticulocyte (TNT)
system.
Example 6
Chromosomal Localization of Ste20-Related Protein Kinases
[0754] Materials And Methods
[0755] STE20 protein kinases STLK3, STLK4, ZC1, ZC2, ZC3, KHS2,
SULU1, PAK4, and PAK5 were mapped using the GeneBridge 4 Radiation
Hybrid Panel, RH02.05 (Research Genetics). The GeneBridge 4 Panel
consists of 91 hybrid panel samples, in addition to one human
positive control (HFL), and one hamster negative control (A23). The
standard reaction conditions used to test and conduct PCR reactions
using the GeneBridge 4 Panel are available from Research
Genetics.
[0756] Oligonucleotide sequences (all 5' to 3') used for PCR
mapping were:
12 STLK3: CTCCCATTTCCTAGCAAAATCA, (SEQ ID NO:128)
AGAGGCAGTATTGTCAGATGTA (SEQ ID NO:129) STLK4:
CCACACATGCGTATCTCTGTTG, (SEQ ID NO:130) TTGCTAGAATTCACATCAGGTACA
(SEQ ID NO:131) ZC1: ATCCCTGGATCACACTGCTTCT, (SEQ ID NO:132)
CAAGGTGTTCTTTGCCTCTGTT (SEQ ID NO:133) ZC2: AGATGGACTGTACTGGGAGGG,
(SEQ ID NO:134) AGAAGAGCACTTGGCACTTATC (SEQ ID NO:135) ZC3:
CATCATGAACTGGTGACGGG, (SEQ ID NO:136) CCAGTGAAATCAAACCAGTAAAA (SEQ
ID NO:137) SULU1: CAAAACCTGGCCGTCTCTTCTATT, (SEQ ID NO:138)
ATTTGTGCTACTGGGATTCTGTG (SEQ ID NO:139) KHS2:
GAATAGCGGTACCATGATAGAATA, (SEQ ID NO:140) TACCAAAAAGAGCCAAAAGTGTG
(SEQ ID NO:141) PAK4: CTCAGTATTCTCTCCAAAGATTG, (SEQ ID NO:142)
GATGTTCTCTCCATTCTGTAAAG (SEQ ID NO:143) PAK5:
CATCACTGGAAGTCTGCAGTG, (SEQ ID NO:144) CAGGTGCAGTAGTCATTTGC (SEQ ID
NO:145)
[0757] Positive reactions were assigned a score of "1", negative
reactions are assigned a score of "0", and ambiguous reactions are
assigned a score of "2". Results were submitted to the Whitehead
Institute (www@genome.wi.mit.edu) for position analysis.
Chromosomal localizations for ZC4, SULU3, STLK2, STLK5 and STLK6
were available publicly (for example, from Unigene). The
chromosomal locations of GEK2 and STLK7 have not been
determined.
13 STLK2_h Xq25-27.1 (Public) STLK3 2q31.3 (Sugen) STLK4_h
3p22.3-p22.2 (Sugen) STLK5_h 17q23.2-24.2 (Public) STLK6_h
2q32.2-q33.3 (Public) STLK7_h NA ZC1_h 2p11.2 (Sugen) ZC2_h
3q26.31-3q26.32 (Sugen) ZC3_h 17p13.2-13.3 (Sugen) ZC4_h Xq22
(Public) KHS2_h 2p22-2p22.2 (Sugen) SULU1_h 12q24.21 (Sugen)
SULU3_h 17p11.2 (Public) GEK2_h NA PAK4_h 15q14 (Sugen) PAK5_h
19q13.2-q13.3 (Sugen)
[0758] Many of the STE 20 kinases were mapped to regions associated
with various human cancers, as shown below.
[0759] The regions were also cross-checked with the Mendalian
Iheritance in Man database, which tracks genetic information for
many human diseases, including cancer. References for association
of the mapped sites with chromosomal abnormalities found in human
cancer can be found in: Knuutila, et al., Am J Pathol, 1998,
152:1107-1123, hereby incorporated herein be reference in its
entirety including any figures, tables, or drawings. Association of
these mapped regions with other diseases is documented in the
Online Mendalian Inheritance in Man (OMIM).
[0760] STLK2_h, Xq25-27.1, (Public)
[0761] Osteosarcoma, Xq25-qter, 2 of 31.
[0762] Lymphoproliferative syndrome, X-linked (OMIM No. 308240)
[0763] human STLK3, 2q31.3, (Sugen)
[0764] Squamous cell carcinoma of Head and Neck, 3 of 30.
[0765] STLK4_h, 3p22.3-p22.2, (Sugen)
[0766] Mantle cell lymphoma 3p 14-p22 1 of 27
[0767] Squamous cell carcinoma of Head and Neck 3p22-p24 1 of
14
[0768] Cardiomyopathy, dilated (OMIM 601154)
[0769] STLK5_h, 17q23.2-24.2, (Public)
[0770] Cervical cancer, 17q, 1 of 30
[0771] Gastroesophageal junction adenocarcinoma xenograft, 17q, 1
of 5
[0772] Breast carcinoma, 17q12-qter, 1 of 16
[0773] Bladder carcinoma, 17q22-q23, 1 of 14
[0774] Breast carcinoma, 17q22-q25, 8 of 101
[0775] Non-small cell lung cancer, 17q24-q25, 6 of 50
[0776] Testis, 17q24-qter, 2 of 11
[0777] Malignant peripheral nerve sheath tumors, 17q24-qter, 5 of
7
[0778] Alzheimer disease, susceptibility to (OMIM 106180)
[0779] STLK6_h, 2q32.2-q33.3, (Public)
[0780] Non-small cell lung cancer, 2q31-q32, 1 of 50
[0781] Squamous cell carcinoma of Head and Neck, 2q31-q33, 3 of
30
[0782] Small cell lung cancer, 2q32-q35, 1 of 22
[0783] ZC1_h, 2p11.2, (Sugen)
[0784] non-small cell lung cancer, 2pter-q13, 1 of 10
[0785] non-small cell lung cancer, 2pter-q21, 1 of 10
[0786] Pulmonary alveolar proteinosis, congenital (OMIM
178640).
[0787] ZC2_h, 3q26.31-3q26.32, (Sugen)
[0788] Non-small cell lung cancer, 3q26.1-q26.3, 26 of 103
[0789] Cervical cancer, 3q26.1-q27, 4 of 30
[0790] Small cell lung cancer, 3q26.3-qter, 3 of 35
[0791] Squamous cell carcinoma of Head and Neck, 3q26.3-qter, 3 of
13
[0792] Marginal zone B-cell lymphoma, 3q26-q27, 1 of 25
[0793] Parosteal osteosarcoma, 3q26-q28, 1 of 1
[0794] Gastrointestinal stromal tumor, 3q26-q29, 1 of 16
[0795] Mantle cell lymphoma, 3q26-q29, 1 of 5
[0796] ZC3_h 17pl3.2-13.3 (Sugen)
[0797] Malignant fibrous histiocytoma of soft tissue, 17p, 2 of
58
[0798] Leiomyosarcoma, 17p, 7 of 29
[0799] Non-small cell lung cancer, 17p, 1 of 50
[0800] ZC4_h, Xq22, (Public)
[0801] Diffuse large cell lymphoma, Xq22-ter, 1 of 32
[0802] Deafness, X-linked 1, progressive. (OMIM 304700).
[0803] KHS2_h, 2p22-2p22.2, (Sugen)
[0804] Synovial sarcoma, 2p21-q14, 1_of.sub.--67
[0805] Follicular lymphoma, 2p22-p24, 1_of.sub.--46
[0806] Colorectal cancer, hereditary, nonpolyposis, type 1, Ovarian
cancer (MSH2, COCA1, FCC1). (OMIM 120435).
[0807] SULU1_h, 12q24.21 (Sugen)
[0808] Neuroglial tumors, 12q22-qter, 1_of.sub.--15
[0809] Gastroesophageal junction adenocarcinoma, 12q23-qter, 1 of
5.
[0810] Non-small cell lung cancer, 12q24.1-24.3, 2 of 50.
[0811] SULU3_h 17p 11.2 (Public)
[0812] Malignant fibrous histiocytoma of soft tissue, 17p,
2_of.sub.--58
[0813] Leiomyosarcoma, 17p, 7_of.sub.--29
[0814] non-small cell lung cancer, 17p, 1_of.sub.--50
[0815] Diffuse large cell lymphoma, 17p11.2, 1_of.sub.--32
[0816] Osteosarcoma, 17p11.2-p12, 4_of.sub.--31
[0817] PAK4_h: 15q14 (Sugen)
[0818] Schizophrenia, (OMIM 118511).
[0819] PAK5_h: 19q13.2-q13.3 (Sugen)
[0820] Follicular lymphoma, 19q13, 1 of 46*
[0821] Mantle cell lymphoma, 19q13, 1 of 5
[0822] Hepatocellular carcinoma, 19q13.1, 2 of 50
[0823] Small cell lung cancer, 19q13.1, 10 of 35
[0824] Breast carcinoma, 19q13.1-qter, 1 of 33
[0825] cervical cancer, 19q13.1-qter, 1 of 30
[0826] Testis, 19q13.1-qter, 1 of 11
[0827] Chondrosarcoma, 19q13.2, 1 of 29
[0828] Malignant fibrous histiocytoma of soft tissue, 19q13.2-qter,
2 of 58
[0829] Non-small cell lung cancer, 19qcen-q13.3, 6 of 104
Example 7
Demonstration Of Gene Amplification By Southern Blotting
[0830] Materials and Methods
[0831] Nylon membranes were purchased from Boehringer Mannheim.
Denaturing solution contains 0.4 M NaOH and 0.6 M NaCl.
Neutralization solution contains 0.5 M Tris-HCL, pH 7.5 and 1.5 M
NaCl. Hybridization solution contains 50% formamide, 6.times. SSPE,
2.5.times. Denhardt's solution, 0.2 mg/mL denatured salmon DNA, 0.1
mg/mL yeast tRNA, and 0.2% sodium dodecyl sulfate. Restriction
enzymes were purchased from Boehringer Mannheim. Radiolabeled
probes were prepared using the Prime-it 11 kit by Stratagene. The
beta actin DNA fragment used for a probe template was purchased
from Clontech.
[0832] Genomic DNA was isolated from 20 different tumor cell lines:
MCF-7, MDA-MB-231, Calu-6, A549, HCT-15, HT-29, Colo 205, LS-180,
DLD-1, HCT-116, PC3, CAPAN-2, MIA-PaCa-2, PANC-1, AsPc-1, BxPC-3,
OVCAR-3, SKOV3, SW 626 and PA-1, and from two normal cell lines:
human mammary epithelial cells and human umbilical vein endothelial
cells.
[0833] A 10 .mu.g aliquot of each genomic DNA sample was digested
with EcoR I restriction enzyme and a separate 10 .mu.g sample was
digested with Hind III restriction enzyme. The restriction-digested
DNA samples were loaded onto a 0.7% agarose gel and, following
electrophoretic separation, the DNA was capillary-transferred to a
nylon membrane by standard methods (Sambrook, J. et al (1989)
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory).
[0834] PAK5 Amplicon:
[0835] A 600 base pair fragment (EcoR I-Sac I) of the PAK5 gene was
used as a template for a radiolabeled DNA probe which was
hybridized to the blots at 42.degree. C. for 48 hours in
hybridization solution using standard methods (supra). The blots
were exposed to a phosphorimager screen for 4 days, then scanned
and analyzed using a Molecular Dynamics Storm 840 phosphorimager.
The relative mass and gene copy number values of the PAK5 DNA
fragments were calculated from the band density values obtained.
The blots were re-hybridized with a radiolabeled probe copied from
a fragment of human beta actin DNA and developed as above to
confirm the sample mass loading equivalency.
[0836] Results
[0837] The PAK5 gene was determined to exhibit 3-fold amplification
compared to the normal DNA copy number in PANC-1 (pancreatic
epithelioid carcinoma) and OVCAR-3 (ovarian adenocarcinoma) human
cell lines, and approximately 2 times the normal copy number in the
BxPC-3 (primary pancreatic adenocarcinoma) human cell line.
[0838] Similar Southern analyses can be performed for other STE20
kinases.
Example 8
Detection Of Protein-Protein Interaction Through Phage Display
[0839] Materials And Methods
[0840] Phage display provides a method for isolating molecular
interactions based on affinity for a desired bait. cDNA fragments
cloned as fusions to phage coat proteins are displayed on the
surface of the phage. Phage(s) interacting with a bait are enriched
by affinity purification and the insert DNA from individual clones
is analyzed.
[0841] T7 Phage Display Libraries
[0842] All libraries were constructed in the T7Select1-1b vector
(Novagen) according to the manufacturer's directions.
[0843] Bait Presentation
[0844] Protein domains to be used as baits were generated as
C-terminal fusions to GST and expressed in E. coli. Peptides were
chemically synthesized and biotinylated at the N-terminus using a
long chain spacer biotin reagent.
[0845] Selection
[0846] Aliquots of refreshed libraries (10.sup.10-10.sup.12 pfu)
supplemented with PanMix and a cocktail of E. coli inhibitors
(Sigma P-8465) were incubated for 1-2 hrs at room temperature with
the immobilized baits. Unbound phage was extensively washed (at
least 4 times) with wash buffer.
[0847] After 3-4 rounds of selection, bound phage was eluted in 100
.mu.L of 1% SDS and plated on agarose plates to obtain single
plaques.
[0848] Identification of Insert DNAs
[0849] Individual plaques were picked into 25 .mu.L of 10 mM EDTA
and the phage was disrupted by heating at 70.degree. C. for 10 min.
2 .mu.L of the disrupted phage were added to 50 .mu.L PCR reaction
mix. The insert DNA was amplified by 35 rounds of thermal cycling
(94.degree. C., 50sec; 50.degree. C., 1 min; 72.degree. C., 1
min).
[0850] Composition of Buffer
[0851] 10.times. PanMix
[0852] 5% Triton X100
[0853] 10% non-fat dry milk (Carnation)
[0854] 10 mM EGTA
[0855] 250 mM NaF
[0856] 250 .mu.g/mL Heparin (sigma)
[0857] 250 .mu.g/mL sheared, boiled salmon sperm DNA (sigma)
[0858] 0.05% Na azide
[0859] Prepared in PBS
[0860] Wash Buffer
[0861] PBS supplemented with:
[0862] 0.5% NP-40
[0863] 25 .mu.g/mL heparin
[0864] PCR Reaction Mix
[0865] 1.0 mL 10.times. PCR buffer (Perkin-Elmer, with 15 mM
Mg)
[0866] 0.2 mL each dNTPs (10 mM stock)
[0867] 0.1 mLT7UP primer (15 .mu.mol/.mu.L)
GGAGCTGTCGTATTCCAGTC
[0868] 0.1 mLT7DN primer (15 .mu.mol/.mu.L)
AACCCCTCAAGACCCGTTTAG
[0869] 0.2 mL25 mM MgCl.sub.2 or MgSO.sub.4 to compensate for
EDTA
[0870] Q.S. to 10 mL with distilled water
[0871] Add 1 unit of Taq polymerase per 50 .mu.L reaction
[0872] PCR Reaction Mix
[0873] 1.0 mL 10.times. PCR buffer (Perkin-Elmer, with 15 mM
Mg)
[0874] 0.2 mL each dNTPs (10 mM stock)
[0875] 0.1 mLT7UP primer (15 pmol/.mu.L) GGAGCTGTCGTATTCCAGTC(SEQ
ID NO:146)
[0876] 0.1 mLT7DN primer (15 pmol/.mu.L) AACCCCTCAAGACCCGTTTAG(SEQ
ID NO:147)
[0877] 0.2 mL25 mM MgCl.sub.2 or MgSO.sub.4 to compensate for
EDTA
[0878] Q.S. to 10 mL with distilled water
[0879] Add 1 unit of Taq polymerase per 50 .mu.L reaction
[0880] LIBRARY: T7 Select1-H441
[0881] Results
[0882] Phage Display Baits and Interactors
14 Sequence Patent CDNA Range Bait Domain Aa SEQ ID library
Interactor & SEQ ID SULU1 Coiled-coil2 752-898 22 H441 GEK2 cc
dom (1) 677-820 SEQ #26 SULU3 Coiled-coil2 755-898 23 H441 SLK
isoform M83780 SULU1 cc1 also interacted to a lesser extent with
the coiled-coil domain of an SLK isoform.
[0883] The phage display data suggest potential interactions of
SULU3 with SLK and SULU1 with GEK2 through their coiled-coil
domains. Therefore two members of the SULU subfamily of STE20
kinases interact with two members of a separate STE20 family, the
prototype being SLK.
[0884] These results suggest a specificity in the interaction, and
imply that these STE20 kinases may interact with each other through
homo- and hetero-dimerization. Alternatively SULU-related kinases
could act immediately up- or down-stream of the SLK-related kinases
in a signaling cascade.
[0885] One skilled in the art would readily appreciate that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those inherent
therein. The molecular complexes and the methods, procedures,
treatments, molecules, specific compounds described herein are
presently representative of preferred embodiments are exemplary and
are not intended as limitations on the scope of the invention.
Changes therein and other uses will occur to those skilled in the
art which are encompassed within the spirit of the invention are
defined by the scope of the claims.
[0886] It will be readily apparent to one skilled in the art that
varying substitutions and modifications may be made to the
invention disclosed herein without departing from the scope and
spirit of the invention.
[0887] All patents and publications mentioned in the specification
are indicative of the levels of those skilled in the art to which
the invention pertains.
[0888] The invention illustratively described herein suitably may
be practiced in the absence of any element or elements, limitation
or limitations which is not specifically disclosed herein. Thus,
for example, in each instance herein any of the terms "comprising",
"consisting essentially of" and "consisting of" may be replaced
with either of the other two terms. The terms and expressions which
have been employed are used as terms of description and not of
limitation, and there is no intention that in the use of such terms
and expressions of excluding any equivalents of the features shown
and described or portions thereof, but it is recognized that
various modifications are possible within the scope of the
invention claimed.
[0889] In particular, although some formulations described herein
have been identified by the excipients added to the formulations,
the invention is meant to also cover the final formulation formed
by the combination of these excipients. Specifically, the invention
includes formulations in which one to all of the added excipients
undergo a reaction during formulation and are no longer present in
the final formulation, or are present in modified forms.
[0890] In addition, where features or aspects of the invention are
described in terms of Markush groups, those skilled in the art will
recognize that the invention is also thereby described in terms of
any individual member or subgroup of members of the Markush group.
For example, if X is described as selected from the group
consisting of bromine, chlorine, and iodine, claims for X being
bromine and claims for X being bromine and chlorine are fully
described.
[0891] Other embodiments are within the following claims.
Sequence CWU 0
0
* * * * *