U.S. patent application number 10/701122 was filed with the patent office on 2004-11-11 for chimeric flavivirus vaccines.
Invention is credited to Arroy, Juan, Chambers, Thomas J., Guirakhoo, Farshad, Monath, Thomas P..
Application Number | 20040223979 10/701122 |
Document ID | / |
Family ID | 31499153 |
Filed Date | 2004-11-11 |
United States Patent
Application |
20040223979 |
Kind Code |
A1 |
Chambers, Thomas J. ; et
al. |
November 11, 2004 |
Chimeric flavivirus vaccines
Abstract
A chimeric live, infectious, attenuated virus containing a
yellow fever virus, in which the nucleotide sequence for a prM-E
protein is either deleted, truncated, or mutated, so that
functional prM-E protein is not expressed, and integrated into the
genome of the yellow fever virus, a nucleotide sequence encoding a
prM-E protein of a second, different flavivirus, so that the prM-E
protein of the second flavivirus is expressed.
Inventors: |
Chambers, Thomas J.; (St.
Louis, MO) ; Monath, Thomas P.; (Harvard, MA)
; Guirakhoo, Farshad; (Melrose, MA) ; Arroy,
Juan; (S. Weymouth, MA) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Family ID: |
31499153 |
Appl. No.: |
10/701122 |
Filed: |
November 4, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10701122 |
Nov 4, 2003 |
|
|
|
09452638 |
Dec 1, 1999 |
|
|
|
6696281 |
|
|
|
|
09452638 |
Dec 1, 1999 |
|
|
|
09121587 |
Jul 23, 1998 |
|
|
|
09121587 |
Jul 23, 1998 |
|
|
|
PCT/US98/03894 |
Mar 2, 1998 |
|
|
|
PCT/US98/03894 |
Mar 2, 1998 |
|
|
|
09007664 |
Jan 15, 1998 |
|
|
|
09007664 |
Jan 15, 1998 |
|
|
|
08807445 |
Feb 28, 1997 |
|
|
|
Current U.S.
Class: |
424/199.1 ;
435/235.1 |
Current CPC
Class: |
A61K 39/29 20130101;
C12N 7/00 20130101; Y02A 50/396 20180101; C07K 14/005 20130101;
C12N 2770/24161 20130101; Y02A 50/394 20180101; A61K 39/12
20130101; C12N 2770/24134 20130101; A61K 35/13 20130101; Y02A
50/388 20180101; A61K 2039/5254 20130101; Y02A 50/386 20180101;
Y02A 50/39 20180101; C12N 2770/24143 20130101; A61K 39/00 20130101;
A61P 31/14 20180101; C12N 2770/24162 20130101; Y02A 50/30 20180101;
A61P 35/00 20180101; C07K 2319/02 20130101; A61K 2039/5256
20130101; A61K 39/193 20130101; A61K 48/00 20130101; C12N
2770/24122 20130101 |
Class at
Publication: |
424/199.1 ;
435/235.1 |
International
Class: |
A61K 039/12; C12N
007/00 |
Claims
What is claimed is:
1-9. (Cancelled)
10. A method of preventing or treating flavivirus infection in a
patient, said method comprising administering to said patient a
chimeric, live, infectious, attenuated virus comprising: a yellow
fever virus in which the nucleotide sequence encoding a prM-E
protein is either deleted, truncated, or mutated so that functional
yellow fever virus prM-E protein is not expressed, and integrated
into the genome of said yellow fever virus, a nucleotide sequence
encoding a prM-E protein of a second, different flavivirus, so that
said prM-E protein of said second flavivirus is expressed.
11. The method of claim 10, wherein said second flavivirus is a
Japanese Encephalitis (JE) virus.
12. The method of claim 10, wherein said second flavivirus is a
Dengue virus selected from the group consisting of Dengue types 1,
2, 3, and 4.
13. The method of claim 12, wherein said nucleotide sequences
derived from said Dengue virus are derived from two or more
different Dengue strains.
14. The method of claim 10, wherein said second flavivirus is
selected from the group consisting of a Murray Valley Encephalitis
virus, a St. Louis Encephalitis virus, a West Nile virus, a
Tick-borne Encephalitis virus, a Hepatitis C virus, a Kunjin virus,
a Central European Encephalitis virus, a Russian Spring-Summer
Encephalitis virus, a Powassan virus, a Kyasanur Forest Disease
virus, and an Omsk Hemorrhagic Fever virus.
15. The method of claim 10, wherein the nucleotide sequence
encoding the prM-E protein of said second, different flavivirus
replaces the nucleotide sequence encoding the prM-E protein of said
yellow fever virus.
16. The method of claim 10, wherein said nucleotide sequence
encoding said prM-E protein of said second, different flavivirus
comprises a mutation that prevents prM cleavage to produce M
protein.
17. The method of claim 10, wherein the prM signal of said chimeric
virus is that of yellow fever virus.
18. The method of claim 10, wherein the NS2B-NS3 protease
recognition site and the signal sequences and cleavage sites at the
C/prM and E/NS1 junctions are maintained in construction of said
chimeric flavivirus.
19. A nucleic acid molecule encoding a chimeric live, infectious,
attenuated virus comprising: a yellow fever virus in which the
nucleotide sequence encoding a prM-E protein is either deleted,
truncated, or mutated so that functional yellow fever virus prM-E
protein is not expressed, and integrated into the genome of said
yellow fever virus, a nucleotide sequence encoding a prM-E protein
of a second, different flavivirus, so that said prM-E protein of
said second flavivirus is expressed.
20. The nucleic acid molecule of claim 19, wherein said second
flavivirus is a Japanese Encephalitis (JE) virus.
21. The nucleic acid molecule of claim 19, wherein said second
flavivirus is a Dengue virus selected from the group consisting of
Dengue types 1, 2, 3, and 4.
22. The nucleic acid molecule of claim/21, wherein said nucleotide
sequences derived from said Dengue virus are derived from two or
more different Dengue strains.
23. The nucleic molecule of claim 19, wherein said second
flavivirus is selected from the group consisting of a Murray Valley
Encephalitis virus, a St. Louis Encephalitis virus, a West Nile
virus, a Tick-borne Encephalitis virus (i.e., a Central European
Encephalitis virus or a Russian Spring-Summer Encephalitis virus),
a Hepatitis C virus, a Kunjin virus, a Powassan virus, a Kyasanur
Forest Disease virus, and an Omsk Hemorrhagic Fever virus.
24. The nucleic acid molecule of claim 19, wherein the nucleotide
sequence encoding the prM-E protein of said second, different
flavivirus replaces the nucleotide sequence encoding the prM-E
protein of said yellow fever virus.
25. The nucleic acid molecule of claim 19, wherein said nucleotide
sequence encoding said prM-E protein of said second, different
flavivirus comprises a mutation that prevents prM cleavage to
produce M protein.
26. The nucleic acid molecule of claim 19, wherein the prM signal
of said chimeric virus is that of yellow fever virus.
27. The nucleic acid molecule of claim 19, wherein NS2B-NS3
protease recognition site and the signal sequences and cleavage
sites at the C/prM and E/NS1 junctions are maintained in
construction of said chimeric flavivirus.
28. A method of producing a gene product in a cell in a patient,
said method comprising introducing into said cell a yellow fever
virus vector comprising a gene encoding said gene product.
29. The method of claim 28, wherein said cell is a cell of the
lymphoid system or the reticuloendothelial system, or a precursor
thereof.
30. The method of claim 28, wherein said patient has cancer.
31. The method of claim 30, wherein said cancer is leukemia.
32. The method of claim 30, wherein said gene product is a tumor
antigen or a cytokine.
33. A vaccine composition comprising: a chimeric flavivirus
comprising the capsid and non-structural proteins of Yellow Fever
virus and the pre-membrane and envelope proteins of Dengue-1 virus;
a chimeric flavivirus comprising the capsid and non-structural
proteins of Yellow Fever virus and the pre-membrane and envelope
proteins of Dengue-2 virus; a chimeric flavivirus comprising the
capsid and non-structural proteins of Yellow Fever virus and the
pre-membrane and envelope proteins of Dengue-3 virus; and a
chimeric flavivirus comprising the capsid and non-structural
proteins of Yellow Fever virus and the pre-membrane and envelope
proteins of Dengue-4 virus.
34. A method of inducing an immune response to the four serotypes
of dengue virus in a patient, the method comprising administering
to the patient a vaccine comprising: a chimeric flavivirus
comprising the capsid and norl-structural proteins of Yellow Fever
virus and the pre-membrane and envelope proteins of Dengue-I virus;
a chimeric flavivirus comprising the capsid and non-structural
proteins of Yellow Fever virus and the pre-membrane and envelope
proteins of Dengue-2 virus; a chimeric flavivirus comprising the
capsid and non-structural proteins of Yellow Fever virus and the
pre-membrane and envelope proteins of Dengue-3, virus; and a
chimeric flavivirus comprising the capsid and non-structural
proteins of Yellow Fever virus and the pre-membrane and envelope
proteins of Dengue-4 virus.
Description
[0001] This is a continuation of U.S. Ser. No. 09/452,638, filed
Dec. 1, 1999 (pending), which is a continuation-in-part of U.S.
Ser. No. 09/121,587, filed on Jul. 23, 1998 (pending), which is a
continuation-in-part of PCT/US98/03894, filed on Mar. 2, 1998,
which is a continuation-in-part of U.S. Ser. No. 09/007,664, filed
on Jan. 15, 1998 (abandoned), which is a continuation-in-part of
U.S. Ser. No. 08/807,445, filed on Feb. 28, 1997 (abandoned).
BACKGROUND OF THE INVENTION
[0002] This invention relates to infectious, attenuated viruses
useful as vaccines against diseases caused by flaviviruses.
[0003] Several members of the flavivirus family pose current or
potential threats to global public health. For example, Japanese
encephalitis is a significant public health problem involving
millions of at risk individuals in the Far East. Dengue virus, with
an estimated annual incidence of 100 million cases of primary
dengue fever and over 450,000 cases of dengue hemorrhagic fever
worldwide, has emerged as the single most important
arthropod-transmitted human disease.
[0004] Other flaviviruses continue to cause endemic diseases of
variable nature and have the potential to emerge into new areas as
a result of changes in climate, vector populations, and
environmental disturbances caused by human activity. These
flaviviruses include, for example, St. Louis encephalitis virus,
which causes sporadic, but serious, acute disease in the midwest,
southeast, and western United States; West Nile virus, which causes
febrile illness, occasionally complicated by acute encephalitis,
and is widely distributed throughout Africa, the Middle East, the
former Soviet Union, and parts of Europe; Murray Valley
encephalitis virus, which causes endemic nervous system disease in
Australia; and Tick-borne encephalitis virus, which is distributed
throughout the former Soviet Union and eastern Europe, where its
Ixodes tick vector is prevalent and responsible for a serious form
of encephalitis in those regions.
[0005] Hepatitis C virus (HCV) is another member of the flavivirus
family, with a genome organization and replication strategy that
are similar, but not identical, to those of the flaviviruses
mentioned above. HCV is transmitted mostly by parenteral exposure
and congenital infection, is associated with chronic hepatitis that
can progress to cirrhosis and hepatocellular carcinoma, and is a
leading cause of liver disease requiring orthotopic transplantation
in the United States.
[0006] The Flaviviridae family is distinct from the alphaviruses
(e.g., WEE, VEE, EEE, SFV, etc.) and currently contains three
genera, the flaviviruses, the pestiviruses, and the hepatitis C
viruses. Fully processed mature virions of flaviviruses contain
three structural proteins, envelope (E), capsid (C), and membrane
(M), and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A,
NS4B, and NS5). Immature flavivirions found in infected cells
contain pre-membrane (prM) protein, which is the precursor to the M
protein.
[0007] After binding of virions to host cell receptors, the E
protein undergoes an irreversible conformational change upon
exposure to the acidic pH of endosomes, causing fusion between the
envelope bilayers of the virions and endocytic vesicles, thus
releasing the viral genome into the host cytosol. PrM-containing
tick-borne encephalitis (TBE) viruses are fusion-incompetent,
indicating that proteolytic processing of prM is necessary for the
generation of fusion-competent and fully infectious virions
(Guirakhoo et al., J. Gen. Virol. 72(Pt. 2):333-338, 1991). Using
ammonium chloride late in the virus replication cycle,
prM-containing Murray Valley encephalitis (MVE) viruses were
produced and shown to be fusion incompetent. By using
sequence-specific peptides and monoclonal antibodies, it was
demonstrated that prM interacts with amino acids 200-327 of the E
protein. This interaction is necessary to protect the E protein
from the irreversible conformational changes caused by maturation
in the acidic vesicles of the exocytic pathway (Guirakhoo et al.,
Virology 191:921-931, 1992).
[0008] The cleavage of prM to M protein occurs shortly before
release of virions by a furin-like cellular protease (Stadler et
al., J. Virol. 71:8475-8481, 1997), which is necessary to activate
hemagglutinating activity, fusogenic activity, and infectivity of
virions. The M protein is cleaved from its precursor protein (prM)
after the consensus sequence R--X--R/K-R (X is variable), and
incorporated into the virus lipid envelope together with the E
protein.
[0009] Cleavage sequences have been conserved not only within
flaviviruses, but also within proteins of other, unrelated viruses,
such as PE2 of murine coronaviruses, PE2 of alphaviruses, HA of
influenza viruses, and p 160 of retroviruses. Cleavage of the
precursor protein is essential for virus infectivity, but not
particle formation. It was shown that, in case of a TBE-dengue 4
chimera, a change in the prM cleavage site resulted in decreased
neurovirulence of this chimera (Pletnev et al., J. Virol.
67:4956-4963, 1993), consistent with the previous observation that
efficient processing of the prM is necessary for full infectivity
(Guirakhoo et al., 1991, supra; Guirakhoo et al., 1992, supra;
Heinz et al., Virology 198:109-117, 1994). Antibodies to prM
protein can mediate protective immunity, apparently due to
neutralization of released virions that contain some uncleaved prM.
The proteolytic cleavage site of the PE2 of VEE (4 amino acids) was
deleted by site-directed mutagenesis of the infectious clone (Smith
et al., ASTMH meeting, Dec. 7-11, 1997). Deletion mutants
replicated with high efficiency and PE2 proteins were incorporated
into particles. This mutant was evaluated in lethal mouse and
hamster models and shown to be attenuated; in non-human primates it
caused 100% seroconversion and protected all immunized monkeys from
a lethal challenge.
SUMMARY OF THE INVENTION
[0010] The invention features chimeric, live, infectious,
attenuated viruses that are each composed of:
[0011] (a) a first yellow fever virus (e.g., strain 17D),
representing a live, attenuated vaccine virus, in which the
nucleotide sequence encoding the prM-E protein is either deleted,
truncated, or mutated so that the functional prM-E protein of the
first flavivirus is not expressed, and
[0012] (b) integrated into the genome of the first flavivirus, a
nucleotide sequence encoding the viral envelope (prM-E) protein of
a second, different flavivirus, so that the prM-E protein of the
second flavivirus is expressed from the altered genome of the first
flavivirus.
[0013] The chimeric virus is thus composed of the genes and gene
products responsible for intracellular replication belonging to the
first flavivirus and the genes and gene products of the envelope of
the second flavivirus. Since the viral envelope contains antigenic
determinants responsible for inducing neutralizing antibodies, the
result of infection with the chimeric virus is that such antibodies
are generated against the second flavivirus.
[0014] A preferred live virus for use as the first yellow fever
virus in the chimeric viruses of the invention is YF 17D, which has
been used for human immunization for over 50 years. YF 17D vaccine
is described in a number of publications, including publications by
Smithburn et al. ("Yellow Fever Vaccination," World Health Org., p.
238, 1956), and Freestone (in Plotkin et al., (Eds.), Vaccines, 2
edition, W. B. Saunders, Philadelphia, 1995). In addition, the
yellow fever virus has been studied at the genetic level (Rice et
al., Science 229:726-733, 1985) and information correlating
genotype and phenotype has been established (Marchevsky et al., Am.
J. Trop. Med. Hyg. 52:75-80, 1995). Specific examples of yellow
fever substrains that can be used in the invention include, for
example, YF 17DD (GenBank Accession No. U17066), YF 17D-213
(GenBank Accession No. U17067), YF-17D-204 France (XI 5067, XI
5062), and YF-17D-204, 234 US (Rice et al., Science 229:726-733,
1985; Rice et al., New Biologist 1:285-296, 1989; C 03700, K
02749). Yellow Fever virus strains are also described by Galler et
al., Vaccine 16 (9/10):1024-1028, 1998.
[0015] Preferred flaviviruses for use as the second flavivirus in
the chimeric viruses of the invention, and thus sources of
immunizing antigen, include Japanese Encephalitis (JE, e.g., JE
SA14-14-2), Dengue (DEN, e.g., any of Dengue types 1-4; for
example, Dengue-2 strain PUO-218) (Gruenberg et al., J. Gen. Virol.
67:1391-1398, 1988) (sequence appendix 1; SEQ ID NO:50; nucleotide
sequence of Dengue-2 insert; Pr-M: nucleotides 1-273; M:
nucleotides 274-498; E: nucleotides 499-1983) (sequence appendix 1;
SEQ ID NO:51; amino acid sequence of Dengue-2 insert; Pr-M: amino
acids 1-91; M: amino acids 92-166; E: amino acids 167-661), Murray
Valley Encephalitis (MVE), St. Louis Encephalitis (SLE), West Nile
(WN), Tick-borne Encephalitis (TBE) (i.e., Central European
Encephalitis (CEE) and Russian Spring-Summer Encephalitis (RSSE)
viruses), and Hepatitis C(HCV) viruses. Additional flaviviruses for
use as the second flavivirus include Kunjin virus, Powassan virus,
Kyasanur Forest Disease virus, and Omsk Hemorrhagic Fever virus. As
is discussed further below, the second flavivirus sequences can be
provided from two different second flaviviruses, such as two Dengue
strains.
[0016] It is preferable to use attenuated inserts, for example, in
the case of inserts from neurotropic viruses, such as JE, MVE, SLE,
CEE, and RSSE. In the case of non-neurotropic viruses, such as
dengue viruses, it may be preferable to use unmodified inserts,
from unattenuated strains. Maintenance of native sequences in such
inserts can lead to enhanced immunogenicity of the proteins encoded
by the inserts, leading to a more effective vaccine.
[0017] In a preferred chimeric virus of the invention, the prM-E
protein coding sequence of the second flavivirus is substituted for
the prM-E protein coding sequence of the live yellow fever virus.
Also, as is described further below, the prM portion of the protein
can contain a mutation or mutations that prevent cleavage to
generate mature membrane protein. Finally, as is discussed in
detail below, the chimeric viruses of the invention include the prM
signal of yellow fever virus.
[0018] Also included in the invention are methods of preventing or
treating flavivirus infection in a mammal, such as a human, by
administering a chimeric flavivirus of the invention to the mammal;
use of the chimeric flaviviruses of the invention in the
preparation of medicaments for preventing or treating flavivirus
infection; nucleic acid molecules encoding the chimeric
flaviviruses of the invention; and methods of manufacturing the
chimeric flaviviruses of the invention.
[0019] The invention provides several advantages. For example,
because they are live and replicating, the chimeric viruses of the
invention can be used to produce long-lasting protective immunity.
Also, because the viruses have the replication genes of an
attenuated virus (e.g., Yellow Fever 17D), the resulting chimeric
virus is attenuated to a degree that renders it safe for use in
humans.
[0020] Other features and advantages of the invention will be
apparent from the following detailed description, the drawings, and
the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1A is a schematic representation of processing events
at the C/prM junction of parental viruses that can be used in the
invention.
[0022] FIG. 1B is a schematic representation of the sequences in
the capsid, prM signal, and prM regions of flaviviruses that can be
used in the invention (SEQ ID NOs:54-70).
[0023] FIG. 2 is a schematic representation of the approach to
making chimeric flaviviruses at the prM signal region (SEQ ID
NOs:71 and 72) used by C. J. Lai (WO 93/06214).
[0024] FIG. 3 is a schematic representation of an attempt to use
the method of C. J. Lai (WO 93/06214) with a yellow fever backbone
(SEQ ID NOs:73 and 74).
[0025] FIG. 4 is a schematic representation illustrating that the
viability of flavivirus chimeras depends on the choice of
signal.
[0026] FIG. 5 is a schematic representation of the cloning method
used in the present invention, at the prM signal region (SEQ ID
NOs:75-77).
[0027] FIG. 6 is a schematic representation of the C, prM, E, and
NS1 regions and junction sequences of a YF/JE chimera of the
invention. The amino acid sequences flanking cleavage sites at the
junctions are indicated for JE, YF, and the YF/JE chimera (SEQ ID
NOs:78-85).
[0028] FIG. 7 is a schematic representation of genetic manipulation
steps that were carried out to construct a Yellow-Fever/Japanese
Encephalitis (YF/JE) chimeric virus of the invention.
[0029] FIG. 8 is a set of growth curves for chimeric YF/JE viruses
of the invention in cell cultures of vertebrate and mosquito
origin.
[0030] FIG. 9 is a growth curve of RMS (Research Master Seed, YF/JE
SA14-14-2) in Vero and LLC-MK2 cells.
[0031] FIG. 10 is a graph showing a growth comparison between RMS
(YF/JE SA14-14-2) and YF-Vax.RTM. (Yellow Fever 17D Vaccine) in
MRC-5 cells.
[0032] FIG. 11A is a graph showing the effects of indomethacin (IM)
or 2-aminopurine (2-AP) on growth kinetics of YF/JE SA14-14-2 (0.01
MOI) in FRhL cells.
[0033] FIG. 11B is a graph showing the effects of indomethacin (IM)
or 2-aminopurine (2-AP) on growth kinetics of YF/JE SA14-14-2 (0.1
MOI) in FRhL cells.
[0034] FIG. 12 is a graph and a table showing the results of a
mouse neurovirulence analysis carried out with a YF/JE chimeric
virus of the invention.
[0035] FIG. 13 is a graph showing the neutralizing antibody
response of mice immunized with a YF/JE SA14-14-2 chimeric vaccine
of the invention. Three week old mice were immunized, and samples
for testing were taken at 6 weeks.
[0036] FIG. 14A is a graph showing the results of neurovirulence
testing of YF-Vax.RTM. (Yellow Fever 17D Vaccine) in 4 week old ICR
mice by the i.c. route.
[0037] FIG. 14B is a graph showing the results of neurovirulence
testing of YF/JE SA14-14-2 in 4 week old ICR mice by the i.c.
route.
[0038] FIG. 15 is a set of graphs showing the results of PRNT
analysis of neutralizing antibody titers in mice inoculated s.c.
with graded doses of YF/JE vaccine. The results in the top graph
are 3 weeks post immunization, and the results in the bottom graph
are 8 weeks post immunization.
[0039] FIG. 16 is a series of graphs showing the serological
responses of mice immunized with a single dose of the live viruses
indicated in the figure.
[0040] FIG. 17 is a set of graphs showing viremia and GMT of
viremia in 3 rhesus monkeys inoculated with CHIMERIVAX.TM.
(chimeric flavivirus vaccine) or YF-Vax.RTM. (Yellow Fever 17D
Vaccine) by the i.c. route.
[0041] FIG. 18 is a graph showing the PRNT neutralizing antibody
titers (50%) in rhesus monkeys 2 and 4 weeks post inoculation with
a single dose of YF-Vax.RTM. (Yellow Fever 17D Vaccine) or
CHIMERIVAX.TM. (chimeric flavivirus vaccine) vaccines by the i.c.
route.
[0042] FIG. 19 is a graph showing the results of neurovirulence
testing of YF/JE SA14-14-2 (E-138 K--->mutant).
[0043] FIG. 20 is a schematic representation of a two plasmid
system for generating chimeric YF/DEN-2 virus. The strategy is
essentially as described for the YF/JE chimeric virus.
[0044] FIG. 21 is a schematic representation of the structure of
modified YF clones designed to delete portions of the NS1 protein
and/or express foreign proteins under control of an internal
ribosome entry site (IRES). The figure shows only the E/NS1 region
of the viral genome. A translational stop codon is introduced at
the carboxyl terminus of the envelope (E) protein. Downstream
translation is initiated within an intergenic open reading frame
(ORF) by IRES-1, driving expression of foreign proteins (e.g., HCV
proteins E1 and/or E2). The second IRES (IRES-2) controls
translational initiation of the YF nonstructural region, in which
nested, truncated NS1 proteins (e.g., NS1del-1, NS1del-2, or
NS1del-3) are expressed. The size of the NS1 deletion is inversely
proportional to that of the ORF linked to IRES-1.
[0045] FIG. 22 is a graph showing the neurovirulence phenotype of
CHIMERIVAX-DEN2.TM. (chimeric flavivirus vaccine comprising Dengue
2 prM and E proteins) in outbred (CD-1) suckling mice inoculated by
the I.C. route with 10,000 PFU/0.02 ml.
[0046] FIG. 23 is a graph showing the neurovirulence phenotype of
17D vaccine (YF-Vax.RTM.g (Yellow Fever 17D Vaccine)) in outbred
(CD-1) suckling mice inoculated by the I.P. route with 1000
PFU/0.02 ml.
[0047] FIGS. 24A-C are graphs showing the growth of JE SA14, JE
SA14-14-2, CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine
comprising Japanese Encephalitis virus prM and E proteins) and YF
17D intrathoracically inoculated mosquitoes: (A) Cx.
tritaeniorhynchusmosquitoes, (B) Ae. albopictus mosquitoes, and (C)
Ae. aegypti. Mean titer =geometric mean of the titers of three
individual mosquitoes; log.sub.10 pfu/mosquito.
[0048] FIGS. 25A-C are graphs showing the growth of JE SA14, JE
SA14-14-2, CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine
comprising Japanese Encephalitis virus prM and E proteins) and YF
17D IT orally exposed mosquitoes: (A) Cx.
tritaeniorhynchusmosquitoes, (B) Ae. albopictus mosquitoes, and (C)
Ae. aegypti mosquitoes. Mean titer =geometric mean of the titers of
three individual mosquitoes; log.sub.10 pfu/mosquito.
[0049] FIG. 26A and B are graphs showing the growth of virus in IT
inoculated Ae. aegypti (A) and Ae. albopictus (B) mosquitoes.
[0050] FIG. 27 is a schematic representation of an overview of
construction of a YF/DEN1 chimera of the invention.
[0051] FIG. 28 is a schematic representation of a plasmid and
fragment map relating to construction of a YF/DEN1 chimera of the
invention.
[0052] FIG. 29 is a schematic representation of RT-PCR
amplification of the prM-E region of the PaH881/88 DEN3 virus
genome. The virus genome is shown on the top diagram. Regions
encoding hydrophobic signals for corresponding downstream proteins
are shadowed. The prM-E region was amplified in two fragments
(black solid lines). Restriction sites introduced for subsequent
in-frame in vitro ligation into YF backbone (BstBI and Narn) and
cloning (NheI) are indicated.
[0053] FIG. 30 is a schematic representation of construction of a
YF/DEN3 chimera of the invention. YF- and DEN3-specific sequences
are shown as shadowed and black boxes, respectively. The chimeric
YF/DEN3 genome was reconstituted by in vitro ligation of three
fragments: the large BstBI-AatII portion of 5'3'/Den3/DXho plasmid,
a PCR fragment containing the DEN3-specific part of 5.2/Den3
without the one nucleotide deletion (DI) digested with BstBI and
EheI (an isoschizomer of Narn), and the large EheI-AatII fragment
of YFM5.2 JE SA14-14-2. Ligation products were linearized with XhoI
and then transcribed in vitro with SP6. RNA polymerase. Vero PM
cells were transfected with in vitro RNA transcripts to recover the
chimeric virus.
[0054] FIG. 31 is a schematic representation of an overview of
construction of a YF/DEN4 chimera of the invention.
[0055] FIG. 32 is a schematic representation of a plasmid and
fragment map relating to construction of a YF/DEN4 chimera of the
invention.
DETAILED DESCRIPTION
[0056] The invention provides chimeric flaviviruses that can be
used in vaccination methods against flavivirus infection.
Construction and analysis of chimeric flaviviruses of the
invention, such as chimeras of yellow fever virus and Japanese
Encephalitis (JE), Dengue types 1-4 (DEN 1-4), Murray Valley
Encephalitis (MVE), St. Louis Encephalitis (SLE), West Nile (WN),
Tick-borne Encephalitis (TBE), and Hepatitis C(HCV) viruses are
described as follows.
[0057] Yellow fever (YF) virus is a member of the Flaviviridae
family of small, enveloped positive-strand RNA viruses. Flavivirus
proteins are produced by translation of a single long open reading
frame to generate a polyprotein, and a complex series of
post-translational proteolytic cleavages of the polyprotein by a
combination of host and viral proteases, to generate mature viral
proteins (Amberg et al., J. Virol. 73:8083-8094, 1999; Fields,
"Flaviviridae," In Virology, Fields (ed.), Raven-Lippincott, New
York, 1995, Volume I, p. 937). The virus structural proteins are
arranged in the order C-prM-E, where "C" is capsid, "prM" is a
precursor of the viral envelope-bound M protein, and "E" is the
envelope protein. These proteins are present in the N-terminal
region of the polyprotein, while the non-structural proteins (NS1,
NS2A, NS2B, NS3, NS4A, NS4B, and NS5) are located in the C-terminal
region of the polyprotein. The amino termini of prM, E, NS1, and
NS4B are generated by host signalase cleavage within the lumen of
the endoplasmic reticulum (ER), while most cleavages within the
non-structural region are mediated by a viral protease complex
known as NS2B-NS3 (Fields, "Flaviviridae," In Virology, Fields
(ed.), Raven-Lippincott, New York, 1995, Volume I, p. 937). In
addition, the NS2B-NS3 protease complex is responsible for
mediating cleavages at the C terminus of both the C protein and the
NS4A protein (Amberg et al., J. Virol. 73:8083-8094, 1999).
[0058] Several research efforts suggest a regulatory role for
NS2B-NS3-mediated cleavage at the C terminus of the capsid protein.
This site is the only site in the structural region of polyprotein
that is cleaved by the NS2B-NS3 protease and, in addition, it
includes a highly conserved dibasic-site motif of flaviviruses,
which indicates a functional role (Amberg et al., J. Virol.
68:3794-3802, 1994; Yamshchikov et al., J. Virol. 68:5765-5771,
1994). In vitro data from various flavivirus models suggest that
efficient generation of the prM protein, an early step in proper
release of structural proteins, is dependent on the function of the
viral protease at the capsid protein site (see summary in Amberg et
al., J. Virol. 73:8083-8094, 1999).
[0059] Maintenance of this mechanism of coordinate cleavages by
NS2B-NS3 at the C terminus of the capsid protein and signalase at
the N terminus of prM in the chimeras described below is central to
the present invention. In particular, in the chimeras of the
present invention, the length of the so-called "prM signal," which
separates the two cleavage sites by 20 amino acids in YF (FIGS. 1A
and 1B), is substantially maintained, to ensure polyprotein
proteolytic processing and subsequent growth of chimeric viruses
that are created in a YF backbone. A hydrophobic domain within this
signal serves to direct the translocation of prM into the ER lumen,
where efficient signalase cleavage occurs only after cleavage at
the NS2B-NS3 site in the capsid protein (Amberg et al., J. Virol.
73:8083-8094, 1999; FIGS. 1A and 1B).
[0060] In the chimeras of the present invention, only the regions
encoding the membrane and envelope proteins (i.e., the prME region)
of a non-yellow fever flavivirus are used to replace the
corresponding genes in a yellow fever virus clone. The prM signal
of the yellow fever virus backbone is maintained. Another method,
described in a patent application by C. J. Lai, WO 93/06214,
suggests a universal approach to constructing chimeric
flaviviruses, involving cloning the prME region of a donor virus
into the backbone of an acceptor virus, such that the prM signal
sequence is contributed by the incoming prM protein gene. This
approach was illustrated using dengue 4 virus as the backbone
(acceptor) and tick-borne encephalitis as the donor prME gene. As
is illustrated in FIG. 2, the approach described in WO 93/06214
suggests that variability in this cloning strategy, with other
chimeric models using flaviviruses as backbone, will have no effect
on proper processing of the resulting polyprotein. That is, that
flavivirus prM signals are exchangeable when producing viable
chimeric viruses. However, attempts to use this approach with YF as
a backbone for the insertion of prME genes of dengue 2 virus to
create a chimera in which dengue 2 sequences were inserted at the
5' NS2B/NS3 cleavage site (e.g., by R. Galler, see FIG. 3) failed
to produce a viable virus, and the use of the 14 amino acid signal
of the dengue 2 virus prM in this construct explains why. When the
cloning strategy was altered to maintain the YF prM signal of 20
amino acids (i.e., only the Den 2 prME region was replaced), it was
successful. The failure to make a viable chimera in YF using the
shorter signal of dengue prM demonstrates that the approach
described in WO 93/06214 does not work for all chimeras, such as
those including a YF backbone.
[0061] The explanation of the success of the approach described in
WO 93/06214, using a dengue virus backbone, is that both the viral
protease and the prM signal of dengue viruses were maintained. The
dengue prM signal is 6-8 amino acids shorter than that of other
flaviviruses, such as YF, TBE, MVE, and JE. Dengue, and chimeric
flaviviruses with a dengue backbone, rely on dengue NS2B-NS3
protease complex for eventual signalase cleavage at the prM signal.
Possibly dengue strain evolution favors a short signal sequence for
optimum cascade-event processing of structural viral proteins,
proper assembly, and virus production. If a longer signal is cloned
in a dengue chimera, the amino acid additions favors translocation
of prME, and perhaps cleavage, but not necessarily optimal viral
growth. On the other hand, YF, TBE, MVE, and JE have evolved using
a long prM signal, and cloning of a shorter signal in any of these
backbones obliterates C-prM-E processing and viral growth (FIG.
4).
[0062] Thus, central to the present invention is the length of the
prM signal (FIG. 5). The cloning of the prME region of any
flavivirus into a YF backbone according to the invention always
takes place after the prM signal sequence (i.e., LMTGG/VTL for
yellow fever); in this way, all prME chimeras encode the yellow
fever prM signal, thus ensuring proper processing of the
polyprotein. In addition, it is preferable to maintain the length
and sequence of the YF prM signal in the chimeras of the invention.
That is, preferably, the length of the prM signal is 20 amino
acids. Less preferably, the length of the prM signal is 15, 16, 17,
18, 19, or more than 20 amino acids in length. Also, it is
preferable that the amino acid sequence of the YF prM signal is
maintained in the chimeras of the invention, although this sequence
can be modified using, for example, conservative amino acid
substitutions. Preferably, the sequence of the prM signal is 100%,
less preferably, 90%, 80%, 70%, 60%, 50%, or 40% identical to the
YF prM signal.
[0063] As an example of construction of a chimera of the invention,
FIG. 6 illustrates a YF/JE chimera in which the YF NS2B-NS3
protease recognition site is maintained. Thus, the recognition site
for cleavage of the cytosolic from membrane-associated portions of
capsid is homologous for the YF NS2B-NS3 enzyme. At the C/pr-M
junction, the portion of the signalase recognition site upstream of
the cleavage site is that of the backbone, YF, and the portion
downstream of the cleavage site is that of the insert, JE. At the
E/NS1 junction, the portion of the signalase recognition site
upstream of the cleavage site is similar to that of the insert, JE
(four of five of the amino acids are identical to those of the JE
sequence), and the portion downstream of the cleavage site is that
of the backbone, YF. It is preferable to maintain this or a higher
level of amino acid sequence identity to the viruses that form the
chimera. Alternatively, at least 25, 50, or 75% sequence identity
can be maintained in the three to five amino acid positions
flanking the signalase and NS2B-NS3 protease recognition sites.
[0064] Also possible, though less preferable, is the use of any of
numerous known signal sequences to link the C and pre-M or E and
NS1 proteins of the chimeras (see, e.g., von Heijne, Eur. J.
Biochem. 133:17-21, 1983; von Heijne, J. Mol. Biol. 184:99-105,
1985) or, for example, using the known sequences for guidance, one
skilled in the art can design additional signal sequences that can
be used in the chimeras of the invention. Typically, for example,
the signal sequence will include as its last residue an amino acid
with a small, uncharged side chain, such as alanine, glycine,
serine, cysteine, threonine, or glutamine. Other requirements of
signal sequences are known in the art (see, e.g., von Heijne, 1983,
supra; von Heijne, 1985, supra).
[0065] Following the approach described above, we have succeeded in
making viable YF chimeric constructs for JE (section 1) and dengue
serotypes 1 through 4 (sections 2-5, respectively). Construction
and characterization of these, as well as other, constructs are
described further below.
[0066] 1.0 Construction of cDNA Templates for Generation of YF/JE
Chimeric Virus
[0067] The derivation of full-length cDNA templates for YF/JE
chimeras of the invention described below employed a strategy
similar to that earlier workers used to regenerate YF 17D from cDNA
for molecular genetic analysis of YF replication. The strategy is
described, e.g., by Nestorowicz et al. (Virology 199:114-123,
1994).
[0068] Briefly, derivation of a YF/JE chimera of the invention
involves the following. YF genomic sequences are propagated in two
plasmids (YF5'3'IV and YFM5.2), which encode the YF sequences from
nucleotides 1-2,276 and 8,279-10,861 (YF5'3'IV) and from
1,373-8,704 (YFM5.2) (Rice et al., The New Biologist 1:285-296,
1989). Full-length cDNA templates are generated by ligation of
appropriate restriction fragments derived from these plasmids. This
method has been the most reliable for ensuring stable expression of
YF sequences and generation of RNA transcripts of high specific
infectivity.
[0069] Our strategy for construction of chimeras involves
replacement of YF sequences within the YF5'3'IV and YFM5.2 plasmids
by the corresponding JE sequences from the start of the prM protein
(nucleotide 478, amino acid 128) through the E/NS1 cleavage site
(nucleotide 2,452, amino acid 817). In addition to cloning of JE
cDNA, several steps were required to introduce or eliminate
restriction sites in both the YF and JE sequences to permit in
vitro ligation. The structure of the template for regenerating
chimeric YF (C)/JE (prM-E) virus is shown in FIG. 7. A second
chimera, encoding the entire JE structural region (C-prM-E) was
engineered using a similar strategy. The second chimera was not
able to generate RNA of high infectivity.
[0070] 1.1 Molecular Cloning of the JE Virus Structural Region
[0071] Clones of authentic JE structural protein genes were
generated from the JE SA14-14-2 strain (JE live, attenuated vaccine
strain), because the biological properties and molecular
characterization of this strain are well-documented (see, e.g.,
Eckels et al., Vaccine 6:513-518, 1988; JE SA14-14-2 virus is
available from the Centers for Disease Control, Fort Collins, Colo.
and the Yale Arbovirus Research Unit, Yale University, New Haven,
Conn., which are World Health Organization-designated Reference
Centers for Arboviruses in the United States). JE SA14-14-2 virus
at passage level PDK-5 was obtained and passaged in LLC-MK.sub.2
cells to obtain sufficient amounts of virus for cDNA cloning. The
strategy used involved cloning the structural region in two pieces
that overlap at an NheI site (JE nucleotide 1,125), which can then
be used for in vitro ligation.
[0072] RNA was extracted from monolayers of infected LLC-MK.sub.2
cells and first strand synthesis of negative sense cDNA was carried
out using reverse transcriptase with a negative sense primer (JE
nucleotide sequence 2,456-71) containing nested XbaI and Narn
restriction sites for cloning initially into pBluescript II KS(+),
and subsequently into YFM5.2(NarI), respectively. First strand cDNA
synthesis was followed by PCR amplification of the JE sequence from
nucleotides 1,108-2,471 using the same negative sense primer and a
positive sense primer (JE nucleotides sequence 1, 108-1,130)
containing nested XbaI and NsiI restriction sites for cloning into
pBluescript and YFM5.2(NarI), respectively. JE sequences were
verified by restriction enzyme digestion and nucleotide sequencing.
The JE nucleotide sequence from nucleotides 1 to 1,130 was derived
by PCR amplification of negative strand JE cDNA using a negative
sense primer corresponding to JE nucleotides 1,116 to 1,130 and a
positive sense primer corresponding to JE nucleotides 1 to 18, both
containing an EcoRI restriction site. PCR fragments were cloned
into pBluescript and JE sequences were verified by nucleotide
sequencing. Together, this represents cloning of the JE sequence
from nucleotides 1-2,471 (amino acids 1-792).
[0073] 1.2 Construction of YF5'3'IV/JE and YFM5.2/JE
Derivatives
[0074] To insert the C terminus of the JE envelope protein at the
YF E/NS1 cleavage site, a unique Narn restriction site was
introduced into the YFM5.2 plasmid by oligonucleotide-directed
mutagenesis of the signalase sequence at the E/NS1 cleavage site
(YF nucleotides 2,447-2,452, amino acids 816-817) to create
YFM5.2(NarI). Transcripts derived from templates incorporating this
change were checked for infectivity and yielded a specific
infectivity similar to the parental templates (approximately 100
plaque-forming units/250 nanograms of transcript). The JE sequence
from nucleotides 1,108 to 2,471 was subcloned from several
independent PCR-derived clones of pBluescript/JE into YFM5.2(NarI)
using the unique NsiI and Narn restriction sites. YF5'3'IV/JE
clones containing the YF 5' untranslated region (nucleotides 1-118)
adjacent to the JE prM-E region were derived by PCR
amplification.
[0075] To derive sequences containing the junction of the YF capsid
and JE prM, a negative sense chimeric primer spanning this region
was used with a positive sense primer corresponding to YF5'3'IV
nucleotides 6,625-6,639 to generate PCR fragments that were then
used as negative sense PCR primers in conjunction with a positive
sense primer complementary to the pBluescript vector sequence
upstream of the EcoRI site, to amplify the JE sequence (encoded in
reverse orientation in the pBluescript vector) from nucleotide 477
(N-terminus of the prM protein) through the NheI site at nucleotide
1,125. The resulting PCR fragments were inserted into the YF5'3'IV
plasmid using the NotI and EcoRI restriction sites. This construct
contains the SP6 promoter preceding the YF 5'-untranslated region,
followed by the sequence: YF (C) JE (prM-E), and contains the NheI
site (JE nucleotide 1,125) required for in vitro ligation. 1.3
Engineering YFM5.2 and YF5'3'IV to Contain Restriction Sites for in
vitro Ligation
[0076] To use the NheI site within the JE envelope sequence as a 5'
in vitro ligation site, a redundant NheI site in the YFM5.2 plasmid
(nucleotide 5,459) was eliminated. This was accomplished by silent
mutation of the YF sequence at nucleotide 5,461 (T C; alanine,
amino acid 1820). This site was incorporated into YFM5.2 by
ligation of appropriate restriction fragments and introduced into
YFM5.2(NarI)/JE by exchange of an NsiI/NarI fragment encoding the
chimeric YF/JE sequence.
[0077] To create a unique 3' restriction site for in vitro
ligation, a BspEI site was engineered downstream of the AatII site
normally used to generate full-length templates from YF5'3'IV and
YFM5.2. (Multiple AatII sites are present in the JE structural
sequence, precluding use of this site for in vitro ligation.) The
BspEI site was created by silent mutation of YF nucleotide 8,581 (A
C; serine, amino acid 2,860), and was introduced into YFM5.2 by
exchange of appropriate restriction fragments. The unique site was
incorporated into YFM5.2/JE by exchange of the XbaI/SphI fragment,
and into the YF5'3'IV/JE(prM-E) plasmids by three-piece ligation of
appropriate restriction fragments from these parent plasmids and
from a derivative of YFM5.2 (BspEI) deleting the YF sequence
between the EcoRIsites at nucleotides 1 and 6,912.
[0078] 1.4 Exchange of JE Nakayama cDNA into YF/JE Chimeric
Plasmids
[0079] Because of uncertainty about the capacity of the PCR-derived
JE SA14-14-2 structural region to function properly in the context
of the chimeric virus, we used cDNA from a clone of the JE Nakayama
strain that has been extensively characterized in expression
experiments and for its capacity to induce protective immunity
(see, e.g., McIda et al., Virology 158:348-360, 1987; the JE
Nakayama strain is available from the Centers for Disease Control,
Fort Collins, Colo., and the Yale Arbovirus Research Unit, Yale
University, New Haven, Conn.). The Nakayama cDNA was inserted into
the YF/JE chimeric plasmids using available restriction sites
(HindIII to PvuII and BpmI to MunI) to replace the entire prM-E
region in the two plasmid system except for a single amino acid,
serine, at position 49, which was left intact in order to utilize
the NheI site for in vitro ligation. The entire JE region in the
Nakayama clone was sequenced to verify that the replaced cDNA was
authentic (Table 1).
[0080] 1.5 Generation of Full-Length cDNA Templates, RNA
Transfection, and Recovery of Infectious Virus
[0081] Procedures for generating full-length cDNA templates are
essentially as described in Rice et al. (The New Biologist
1:285-96, 1989; also see FIG. 7). In the case of chimeric
templates, the plasmids YF5'3'IV/JE (prM-E) and YFM5.2/JE are
digested with NheI/BspEI and in vitro ligation is performed using
300 nanograms of purified fragments in the presence of T4 DNA
ligase. The ligation products are linearized with XhoI to allow
run-off transcription. SP6 transcripts are synthesized using 50
nanograms of purified template, quantitated by incorporation of
.sup.3H-UTP, and integrity of the RNA is verified by non-denaturing
agarose gel electrophoresis. Yields range from 5 to 10 micrograms
of RNA per reaction using this procedure, most of which is present
as full-length transcripts. Transfection of RNA transcripts in the
presence of cationic liposomes is carried out as described by Rice
et al. (supra) for YF 17D. In initial experiments, LLC-MK.sub.2
cells were used for transfection and quantitation of virus, since
we have determined the permissiveness for replication and plaque
formation of the parental strains of YF and JE. Table 2 illustrates
typical results of transfection experiments using Lipofectin
(GIBCO/BRL) as a transfection vehicle. Vero cell lines have also
been used routinely for preparation of infectious virus stocks,
characterization of labeled proteins, and neutralization tests.
[0082] Amplification products from Vero cells were sent to the FDA
(CBER) for preparation of the RMS in diploid, Fetal Rhesus lung
cells. Fetal rhesus lung cells were received from the ATCC as
cultured cells and were infected with YF/JE SA14-14-2 (clone A-1)
at an MOI of 1.0. After 1 hour of incubation at 37.degree. C., the
inoculum was aspirated and replaced with 50 ml of EMEM, containing
2% FBS. Virus was harvested 78 hours later, aliquoted into 1 ml
vials (a total of 200 vials) and frozen at -70.degree. C. Virus
titers were determined in Vero, LLC MK2, and CV-1 cells using a
standard plaque assay. Titers (pfu/ml) were 1.6.times.10.sup.6 in
Vero cells, 1.25.times.10.sup.6 in LLC MK2 cells, and
1.35.times.10.sup.5 in CV-1 cells.
[0083] 1.6 Nucleotide Sequencing of Chimeric cDNA Templates
[0084] Plasmids containing the chimeric YF/JE cDNA were subjected
to sequence analysis of the JE portion of the clones to identify
the correct sequences of the SA14-14-2 and Nakayama envelope
protein. The nucleotide sequence differences between these
constructs in comparison to the reported sequences (McAda et al.,
supra) are shown in Table 1.
[0085] Five amino acid differences at positions 107, 138, 176, 264,
and 279 separate the virulent from the attenuated strains of JE
virus. Amino acid differences map to three subregions of Domains I
and II of the flavivirus E protein model (Rey et al., Nature
375:291-298, 1995). These include the putative fusion peptide
(position 107), the hinge cluster (positions 138, 279), the exposed
surface of Domain I (positions 176 and 177), and the alpha-helix
located in the dimerization Domain II (position 264). Changes at
position 107, 138, 176, and 279 were selected early in the passage
history, resulting in attenuation of JE SA14-14-2, and remained
stable genetic differences from the SA.sub.14-14-2 parent (Ni et
al., J. Gen. Virol. 75:1505-1510, 1994), showing that one or more
of these mutations are critical for the attenuation phenotype. The
changes at positions 177 and 264 occurred during subsequent
passage, and appear to be genetically unstable between two
SA14-14-2 virus passages in PHK and PDK cells, showing that this
mutation is less critical for attenuation.
[0086] The nucleotide sequence of the E protein coding region of
the RMS was determined to assess potential sequence variability
resulting from viral passage. Total RNA was isolated from
RMS-infected Vero cells, reversed transcribed, and PCR amplified to
obtain sequencing templates. Several primers specific for SA14-14-2
virus were used in individual sequencing reactions and standard
protocols for cycle sequencing were performed.
[0087] Sequence data revealed two single nucleotide mutations in
the RMS E protein, when compared to the published SA14-14-2 JE
strain sequence data. The first mutation is silent, and maps to
amino acid position 4 (CTT to CTG); the second is at amino acid
position 243 (AAA to GAA) and introduces a change from lysine to
glutamic acid. Both mutations identified are present in the
sequence of the JE wild type strains Nakayama, SA14 (parent of
SA14-14-2), and JaOArS982 (Sumiyoshi et al., J. Infect. Dis.
171:1144-1151, 1995); thus, they are unlikely to contribute to
virulence phenotype. We conclude that in vitro passage in FRhL
cells to obtain the RMS did not introduce unwanted mutations in the
E protein.
[0088] 1.7 Structural and Biological Characterization of Chimeric
YF/JE Viruses
[0089] The genomic structure of chimeric YF/JE viruses recovered
from transfection experiments was verified by RT/PCR-based analysis
of viral RNA harvested from infected cell monolayers. These
experiments were performed to eliminate the possibility that virus
stocks were contaminated during transfection procedures. For these
experiments, first-pass virus was used to initiate a cycle of
infection, to eliminate any possible artifacts generated by the
presence of residual transfected viral RNA. Total RNA extracts of
cells infected with either the YF/JE (prM-E)-SA14-14-2 or YF/JE
(prM-E)-Nakayama chimera were subjected to RT/PCR using YF and
JE-specific primers that allowed recovery of the entire structural
region as two PCR products of approximately 1 kilobase in size.
These products were then analyzed by restriction enzyme digestion
using the predicted sites within the JE SA14-14-2 and Nakayama
sequences that allow differentiation of these viruses. Using this
approach, the viral RNA was demonstrated to be chimeric and the
recovered viruses were verified to have the appropriate restriction
sites. The actual C-prM boundary was then verified to be intact at
the sequence level by cycle sequence analysis across the chimeric
YF/JE C-prM junction.
[0090] The presence of the JE envelope protein in the two chimeras
was verified by both immunoprecipitation with JE-specific antisera
and by plaque reduction neutralization testing using YF and
JE-specific antisera. Immunoprecipitation of .sup.35S-labeled
extracts of LLC-MK.sub.2 cells infected with the chimeras using a
monoclonal antibody to the JE envelope protein showed that the JE
envelope protein could be recovered as a 55 kDa protein, while the
same antisera failed to immunoprecipitate a protein from
YF-infected cells. Both JE and YF hyperimmune sera demonstrated
cross-reactivity for the two envelope proteins, but the size
difference between the proteins (YF=53 kDa, unglycosylated; JE=55
kDa, glycosylated) could reproducibly be observed. Use of YF
monoclonal antibodies was not satisfactory under the
immunoprecipitation conditions, thus, the specificity was dependent
on the JE monoclonal antibodies in this analysis.
[0091] Plaque reduction neutralization testing (PRNT) was performed
on the chimeric viruses and the YF and JE SA14-14-2 viruses using
YF and JE-specific hyperimmune ascitic fluid (ATCC) and YF-specific
purified IgG (monoclonal antibody 2E10). Significant differences in
the 50% plaque reduction titer of these antisera were observed for
the chimeras when compared to the control viruses in these
experiments (Table 3). The YF/JE SA14-14-2 chimeric vaccine
candidate, as well as the Nakayama chimera and SA14-14-2 viruses,
were neutralized only by JE ascitic fluid, whereas YF 17D was
neutralized in a specific fashion by YF ascites and the monoclonal
antibody (Table 3). Thus, epitopes required for neutralization are
expressed in the infectious chimeric YF/JE viruses, and are
specific for the JE virus.
[0092] 1.8 Growth Properties in Cell Culture
[0093] The growth capacity of the chimeras has been examined
quantitatively in cell lines of both primate and mosquito origin.
FIG. 8 illustrates the cumulative growth curves of the chimeras on
LLC-MK.sub.2 cells after low multiplicity infection (0.5
plaque-forming units/cell). In this experiment, YF5.2iv (cloned
derivative) and JE SA14-14-2 (uncloned) viruses were used for
comparison. Both chimeric viruses reached a maximal virus yield of
approximately one log higher than either parental virus. In the
case of the YF/JE SA.sub.14-14-2 chimera, the peak of virus
production occurred 12 hours later than the YF/JE Nakayama chimera
(50 hours vs. 38 hours). The YF/JE Nakayama chimera exhibited
considerably more cytopathic effects than the YF/JE SA14-14-2
chimera on this cell line.
[0094] A similar experiment was carried out in C6/36 cells after
low multiplicity infection (0.5 plaque-forming units/cell). FIG. 8
also illustrates the growth kinetics of the viruses in this
invertebrate cell line. Similar virus yields were obtained at all
points used for virus harvest in this experiment, further
substantiating the notion that chimeric viruses are not impaired in
replication efficiency.
[0095] Additional experiments showing the growth properties of RMS
are shown in FIG. 9. Briefly, Vero cells were grown in EMEM, 1%
L-Glutamine, 1% non-essential amino acid, and 10% FBS buffered with
sodium bicarbonate. LLC-MK2 cells were purchased from the ATCC
(CLL-7.1, passage 12) and were grown in the same medium as Vero
cells. Cells were inoculated with the RMS virus at an MOI of 0.1.
Supernatant fluid was sampled at 24 hour intervals for 7 days and
frozen at -70.degree. C. for subsequent plaque assay. Plaque assays
were performed in 6-well plates. The RMS reached more than 8
log.sub.10pfu/ml in 5 days. In LLC-MK2 cells, the RMS grew slower
and peaked (6 log.sub.10 pfu/ml) at about 6 days.
[0096] 1.9 Comparison of Growth Kinetics of the RMS (YF/JE
SA14-14-2) with YF 17D Vaccine in MRC-5 Cells
[0097] An experiment was performed to assess the ability of the
vaccine candidate to propagate in a cell line acceptable for human
vaccines. Commercial Yellow Fever 17D vaccine (YF-VAX.RTM. (Yellow
Fever 17D Vaccine) was obtained from Connaught Laboratories,
Swiftwater, PA. MRC-5 (diploid human embryonal lung cells) were
purchased from ATCC (171-CCL, Batch#: F-14308, passage 18) and
grown in EMEM, 2 mM L-Gln, Earle's BSS adjusted to contain 1.5 g/L
sodium bicarbonate, 0.1 mM non-essential amino acids, and 10%
FBS.
[0098] To compare growth kinetics of RMS (sequence appendices 2 and
3; Research Master Seed, YF/JE SA14-14-2; nucleotide sequence of
ORF; C: nucleotides 119-421; Pr-M: nucleotides 422-982; E:
nucleotides 983-2482; and Non-structural proteins: 2483-10381);
(amino acid sequence of ORF; C: amino acids 1-101; Pr-M: amino
acids 102-288; E: amino acids 289-788; and Non-structural proteins:
amino acids 789-3421); (nucleotide sequence of RMS; the coding
sequence is from nucleotide 119 to nucleotide 10381)) with
YF-VAX.RTM. (Yellow Fever 17D Vaccine), cells were grown to 90%
confluency and infected with RMS or YF-VAX.RTM. (Yellow Fever 17D
Vaccine) at an MOI of 0.1 pfu. Since MRC-5 cells generally grow
slowly, these cells were kept for 10 days post inoculation. Samples
were frozen daily for 7-10 days and infectivity determined by
plaque assay in Vero cells. YF-VAX.RTM. (Yellow Fever 17D Vaccine)
and the YF/JE chimera grew to modest titers in MRC-5 cells (FIG.
10). The peak titer was .about.4.7 log.sub.10 pfu for YF-VAX.RTM.
(Yellow Fever 17D Vaccine) achieved on the second day and was
slightly lower, 4.5 log.sub.10 pfu, for the RMS after 6 days.
[0099] 1.10 Growth Curve of YF/JE SA14-14-2 in FRhL cells with and
without IFN-inhibitors
[0100] Fetal rhesus lung cells were obtained from the ATCC and
propagated as described for MRC-5 cells. Growth kinetics of the RMS
were determined with and without interferon inhibitors.
[0101] Double-stranded RNA appears to be the molecular species most
likely to induce interferon (IFN) in many virus infected cells.
Induction of interferon apparently plays a significant role in the
cellular defense against viral infection. To escape cellular
destruction, many viruses have developed strategies to
down-regulate induction of interferon-dependent activities. Sindbis
virus and vesicular stomatitis virus have been shown to be potent
IFN inducers. Using chick embryo cells, mouse L cells, and
different viral inducers of IFN, it was shown that 2-aminopurine
(2AP) and indomethacin (IM) efficiently and reversibly inhibit IFN
action (Sekellick et al., J. IFN Res. 5:651, 1985; Marcus et al.,
J. Gen. Virol. 69:1637, 1988).
[0102] To test whether inhibition of IFN (if present) in FRhL cells
will increase the virus yield, we added 2AP at a concentration of
10 mM or IM at a concentration of 10 mg/ml to the FRhL cells at the
time of infection with 0.1 or 0.01 MOI of RMS. Samples were taken
daily and frozen for determination of virus infectivity by plaque
assay. As shown in FIG. 11A, virus titers peaked on day 4 in the
presence or absence of inhibitors. When cells were infected at 0.01
MOI (FIG. 11A), virus titer reached 2.65.times.10.sup.7 pfu/ml on
day 4 in the absence of inhibitors. In cells infected in the
presence of IM, virus titer was increased about 2-fold, to.
5.95.times.10.sup.7 pfu/ml on day 4. This increase was more
dramatic (4-fold) when 2AP was used (9.7.times.10.sup.7 pfu/ml).
Addition of IM did not increase virus yield when cells were
infected at a higher MOI (0.1). A titer of 5.42.times.10.sup.7 was
reached without inhibitor and 3.45.times.10.sup.7 was achieved in
the presence of IM. Addition of 2AP increased virus yields to
1.1.times.10.sup.8 pfu/ml by day 4 and only 1 log.sub.10 pfu was
lost in the following 3 days (9.5.times.10.sup.6 pfu/ml on day 7)
(FIG. 11B). We conclude from this experiment that the YF/JE
SA14-14-2 vaccine candidate replicates to titers of .about.7.5
log.sub.10/ml in an acceptable cell substrate. The addition of
interferon inhibitors can result in a modest increase in yields,
but is not a requirement for vaccine production.
[0103] 1.11 Neurovirulence Testing in Normal Adult Mice
[0104] The virulence properties of the YF/JE SA14-14-2 chimera was
analyzed in young adult mice by intracerebral inoculation. Groups
of 10 mice (4 week old male and female ICR mice, 5 each per group)
were inoculated with 10,000 plaque-forming units of the YF/JE
SA14-14-2 chimera, YF 17D 5.2iv, or the Chinese vaccine strain JE
SA14-14-2 and observed daily for 3 weeks. The results of these
experiments are illustrated in FIG. 12. Mice receiving the YF5.2iv
parent succumbed by approximately one week post-inoculation. No
mortality or illness was observed among mice receiving either the
JE SA14-14-2 parent or the chimera. The inocula used for the
experiments were titered at the time of injection and a subgroup of
the surviving mice were tested for the presence of neutralizing
antibodies to confirm that infection had taken place. Among those
tested, titers against the JE SA14-14-2 virus were similar for
animals receiving either this strain or the chimera.
[0105] The results of additional experiments investigating the
neurovirulence of the YF/JE SA14-14-2 chimera in mice are
illustrated in Table 4. In these experiments, all of the mice
inoculated with YF5.2iv died within 7-8 days. In contrast, none of
the mice inoculated with YF/JE SA14-14-2 died during two weeks of
post-inoculation observation.
[0106] The results of experiments investigating the
neuroinvasiveness and pathogenesis of YF/JE chimeras are
illustrated in Table 5. In these experiments, the chimeric viruses
were inoculated into 3 week old mice at doses varying between
10,000 and 1 million plaque-forming units via the intraperitoneal
route. None of the mice inoculated with YF/JE Nakayama or YF/JE
SA14-14-2 died during three weeks of post-inoculation observation,
indicating that the virus was incapable of causing illness after
peripheral inoculation. Mice inoculated with YF/JE SA14-14-2
developed neutralizing antibodies against JE virus (FIG. 13).
[0107] In additional experiments testing the neurovirulence
phenotype and immunogenicity of the RMS, 4-week old ICR mice (n=5)
were inoculated by the i.c. route with 0.03 ml of graded doses of
the RMS or YF-VAX.RTM. (Yellow Fever 17D Vaccine) (Table 6).
Control mice received only diluent medium by this route. Mice were
observed daily and mortality rates were calculated.
[0108] Mice inoculated with YF-VAX.RTM. (Yellow Fever 17D Vaccine)
started to die on day 7 (FIG. 14A). The icLD.sub.50 of unpassaged
YF-VAX.RTM. (Yellow Fever 17D Vaccine), calculated by the method of
Reed and Muench, was 1.62 log.sub.10 and the average survival time
(AST) at the highest dose (4.2 log.sub.10 pfu) was 8.8 days. In
contrast, all mice receiving the RMS survived challenge at all
doses (FIG. 14B), indicating that the virus is not neurovirulent
for mice. None of the mice inoculated with YF-VAX.RTM. (Yellow
Fever 17D Vaccine) or the RMS by the peripheral (subcutaneous)
route (as shown in Table 6) showed signs of illness or death. Thus,
as expected, yellow fever 17D virus was not neuroinvasive.
[0109] 1.12 Comparison of Immunogenicity of YF/JE RMS with YF 17D
Vaccine
[0110] The immunogenicity of the of the RMS was compared with that
of the YF 17D vaccine in outbred ICR mice. Groups of five 4
week-old mice received graded doses of the vaccines shown in Table
6. Mice were inoculated with 100 .mu.l of each virus dilution by
the s.c. route. For comparison, two groups of mice received two
weekly doses of commercial inactivated JE vaccine prepared in mouse
brain tissue JE-VAX.RTM. (inactivated Japanese encephalitis virus
vaccine) at 1:30 and 1:300 dilution, representing 10.times. and
1.times. the human equivalent dose based on body weight,
respectively. Animals were bled 3 and 8 weeks later and
neutralizing antibody titers were measured in heat-inactivated sera
against homologous viruses by PRNT. End-point titers were the
highest dilution of sera that reduced the number of viral plaques
by 50% compared to a normal mouse serum control.
[0111] The highest N antibody titers were observed 8 weeks after
immunization in mice receiving 5 log.sub.10 pfu of the RMS (FIG. 15
and Table 7). The geometric mean N antibody titer in these mice was
5,614. N antibody responses induced by YF/JE SA14-14-2 vaccine
against JE were higher than N antibody responses against YF induced
by YF 17D vaccine. Interestingly, the highest concentration of the
YF 17D vaccine did not induce significant titers of neutralizing
antibodies 3 or 8 weeks post immunization, but antibodies were
elicited at lower doses.
[0112] Very low doses (1.4-2.4 log.sub.10 PFU) of YF 17D vaccine
elicited an immune response in mice 8 weeks after inoculation
(Table 7). This result may indicate delayed replication of the
vaccine in mice receiving low virus inocula. In contrast, the YF/JE
SA14-14-2 chimeric vaccine in this dose range was not immunogenic.
It is likely that the chimeric vaccine is somewhat less infectious
for mice than YF 17D. However, when inoculated at an infective
dose, the chimera appears to elicits a higher immune response. This
may be due to higher replication in, or altered tropism for, host
tissues. Animals that received two doses of JE-VAX.RTM.
(inactivated Japanese Encephalitis virus vaccine) did not mount a
significant antibody response. Only one animal in the 1:30 dose
group developed a neutralizing titer of 1:10 eight weeks after
immunization. This might be due to the route (s.c.) and dilution
(1:30) of the vaccine.
[0113] 1.13 Protection of YF/JE SA14-14-2 RMS Immunized Mice
Against Challenge with Virulent JE
[0114] The YF/JE SA14-14-2 RMS and other viruses were evaluated for
immunogenicity and protection in C57/BL6 mice in collaboration with
Dr. Alan Barrett, Department of Pathology, University of Texas
Medical Branch, Galveston. Experimental groups are shown in Table
8. Ten-fold dilutions (10.sup.2-10.sup.5) of each virus were
inoculated by the s.c. route into groups of 8 mice. Mice were
observed for 21 days, at which time surviving animals were bled
from the retro-orbital sinus and serum frozen for neutralization
tests. The 50% immunizing dose (ID.sub.50) for each virus and GMT
was determined (see below).
[0115] Surviving mice that received viruses by the s.c. route were
challenged on day 28 by i.p. inoculation of 158 LD.sub.50 (2,000
PFU) of JE virus (JaOArS982, IC37). Animals were observed for 21
days following challenge. Protection is expressed as the proportion
of mice surviving challenge (Table 9).
[0116] As expected, YF 17D virus afforded minimal cross-protection
against JE challenge. The YF/JE SA14-14-2 RMS chimera was
protective at doses >103 PFU. The 50% protective dose of the
chimeric vaccine was 2.32 log.sub.10 PFU. Animals that received 3
doses of JE-VAX.RTM. (inactivated Japanese Encephalitis virus
vaccine) were solidly protected against challenge. Mice given a
single dose of the SA14-14-2 vaccine were poorly protected.
Wild-type Nakayama virus was lethal for a proportion of animals, in
a dose-dependent fashion; survivors were poorly protected against
challenge indicating that the lethal dose was close to the
infecting dose for this virus.
[0117] The YF/JE.sub.Nakayama chimeric virus was somewhat more
virulent than the Nakayama strain, in that all mice given 10.sup.5
of the chimera died after inoculation. This is in contrast to
earlier studies in outbred mice, in which this virus was not
neuroinvasive, confirming the increased susceptibility of C57/BL6
mice to peripheral challenge with JE viruses. Survivors were fully
protected against challenge, showing that the infection established
by the chimeric virus was more active (immunogenic) than infection
by Nakayama virus without the YF replication background. These
results show that the combination of viral envelope determinants of
a neurovirulent strain (Nakayama) with a replication-efficient
virus (YF 17D) can enhance virulence of the recombinant,
emphasizing the need for genetic stability of the mutations
conferring attenuation in the YF/JE.sub.Nakayama chimera.
[0118] 1.14 Serological Response
[0119] Sera from mice in groups shown in Table 8 were tested 21
days after immunization for neutralizing antibodies. N tests were
performed as follows. Six-well plates were seeded with Vero cells
at a density of 10.sup.6 cells/well in MEM alpha containing 10%
FBS, 1% nonessential amino acids, buffered with sodium bicarbonate.
One hundred .mu.l of each test serum (inactivated at 60.degree. C.
for 30 minutes) diluted two-fold was mixed with an equal volume of
virus containing 200-300 PFU. The virus-serum mixtures were
incubated at 4.degree. C. overnight and 100 .mu.l added to each
well after removal of growth medium. The plates were overlaid after
1 hour incubation at 37.degree. C. with 0.6% agarose containing 3%
fetal calf serum, 1% L-glutamine, 1% HEPES, and 1%
pen-strep-amphotericin mixed 1:1 with 2.times.M 199. After 4 days
of incubation at 37.degree. C., 5% CO.sub.2, a second overlay
containing 3% Neutral red was added. After appearance of plaques,
the monolayer was fixed with 1% formaldehyde and stained with
crystal violet. The plaque reduction titer is determined as the
highest dilution of serum inhibiting 50% of plaques compared with
the diluent-virus control.
[0120] Results are shown in Table 10 and FIG. 16. NT antibody
responses in mice immunized with the YF/JE SA14-14-2 chimera showed
a dose response and good correlation with protection. At doses of
4-5 logs, the chimeric vaccine elicited higher N antibody responses
against JE than either SA14-14-2 virus or wild-type Nakayama virus.
Responses were superior to those elicited by YF-VAX.RTM. (Yellow
Fever 17D Vaccine) against YF 17D virus. No prozone effect was
observed in animals receiving the chimera or infectious-clone
derived YF 5.2iv; responses at the highest vaccine dose (5 logs)
were higher than at the next lower dose (4 logs). In contrast, mice
that received SA14-14-2, Nakayama, and YF-VAX.RTM. (Yellow Fever
17D Vaccine) at the highest dose responded less well than animals
inoculated with diluted virus.
[0121] 1.15 Safety and Immunogenicity of CHIMERIVAX.TM. (Chimeric
Flavivirus Vaccine) in Monkeys
[0122] The safety of RMS was tested in monkeys, essentially as
described in WHO Biological Standards for YF 17D vaccine with minor
modifications (see below). Two groups (N=3) of rhesus monkeys were
bled and shown to be free from HI antibodies to YF, JE, and SLE.
Group 1 received undiluted CHIMERIVAX.TM. (chimeric flavivirus
vaccine) (Vero-passage 2) by the I.C. route (frontal lobe). Group 2
(N=3) received 0.25 ml of 1:10 diluted commercial YF 17D vaccine
(YF-VAX.RTM. (Yellow Fever 17D Vaccine) by the same route. The
virus inocula were frozen, back titrated, and shown to contain 7.0
and 5.0 log.sub.10 pfu/0.25 ml of YF/JE SA14-14-2 and YF-VAX.RTM.
(Yellow Fever 17D Vaccine), respectively.
[0123] Monkeys were observed daily for clinical signs and scored as
in WHO standards. Sera were collected daily for 7 days after
inoculations and tested for viremia by plaque assay in Vero cells.
Blood collected 2 and 4 weeks post inoculation and tested for NT
antibodies to the homologous viruses. None of the monkeys showed
sign of illness. Monkeys were euthanized on Day 30, and brains and
spinal cords were examined for neuropathology as described in the
WHO standards. A sample of the brain and spinal cord from each
animal was collected and stored frozen for virus isolation attempts
and immunocytochemistry experiments.
[0124] As shown in FIG. 17, a low level viremia was detected in all
animals in both groups, and lasted for 2-3 days for the RMS and 1-2
days for YF-VAX.RTM. (Yellow Fever 17D Vaccine). All viruses were
cleared from the blood by Day 4. According to the WHO standards,
monkeys receiving 5,000-50,000 (3.7-4.7 log.sub.10) pfu should not
have viremia greater than 165,000 pfu/ml (approximately 16,500
mLD.sub.50). None of the monkeys in the experiments had viremia of
more than 15,000 pfu/ml, despite receiving 6 log.sub.10 pfu of the
RMS.
[0125] Neutralizing antibody titers were measured at 2 and 4 weeks
post inoculation (FIG. 18). All monkeys seroconverted and had high
titers of neutralizing antibodies against the inoculated viruses.
The level of neutralizing antibodies in 2 of 3 monkeys in both
groups exceeded a titer of 1:6,400 (the last dilution of sera
tested) at 4 weeks post inoculation. The geometric mean antibody
titers for CHIMERIVAX.TM. (chimeric flavivirus vaccine) were 75 and
3,200 after 2 and 4 weeks respectively and were 66 and 4971 for the
YF-VAX.RTM.V (Yellow Fever 17D Vaccine) for the same time points
(Table 11).
[0126] Histopathological examination of coded specimens of brain
and spinal cord were performed by an expert neuropathologist (Dr.
I. Levenbook, previously CBER/FDA), according to the WHO biological
standards for yellow fever vaccine. There were no unusual target
areas for histopathological lesions in brains of monkeys inoculated
with CHIMERIVAX-JE (chimeric flavivirus vaccine comprising Japanese
Encephalitis virus prM and E proteins. Mean lesion scores in
discriminator areas were similar in monkeys inoculated with
YF-VAX.RTM. (Yellow Fever 17D Vaccine) (0.08) and monkeys
inoculated with a 100-fold higher dose of (CHIMERIVAX-JE.TM.
(chimeric flavivirus vaccine comprising Japanese Encephalitis virus
prM and E proteins) (0.07). Mean lesion scores in discriminator
+target areas were higher in monkeys inoculated with YF-VAX.RTM.
(Yellow Fever 17D Vaccine) (0.39) than in monkeys inoculated with a
100-fold higher dose of (CHIMERIVAX-JE.TM. (chimeric flavivirus
vaccine comprising Japanese Encephalitis virus prM and E proteins)
(0.11). These preliminary results show an acceptable neurovirulence
profile and immunogenicity for (CHIMERIVAX-JE.TM. (chimeric
flavivirus vaccine comprising Japanese Encephalitis virus prM and E
proteins) vaccine. A summary of the histopathology results is
provided in Table 22.
[0127] 1.16 Efficacy of YF/JE Chimera in Protecting Monkeys Against
Intracerebral Challenge
[0128] The YF/JE chimera were given to adult rhesus monkeys without
pre-existing flavivirus immunity by the subcutaneous route. Three
monkeys received 4.3 log pfu and three monkeys received 5.3 log pfu
of YF/JE SA14-14-2 virus. All 6 monkeys developed very low level
(1-2 log/ml) viremias. All animals developed neutralizing
antibodies by day 15 (earliest time tested) and titers rose by day
30. Five of six animals survived a very severe intracerebral
challenge with a highly virulent JE virus (100,000 mouse LD50 were
injected IC 60 days after immunization). None of 4 sham immunized
monkeys survived; all died between days 8-10 after challenge. The
single death in the immunized group was a pregnant female;
pregnancy could have suppressed the cellular immune response to the
vaccine. The results show the immunogenicity and protective
efficacy of the vaccine, while validating safety with respect to
low vaccine viremia. The results of these experiments are
illustrated in Tables 12-15.
[0129] 1.17 Genetic Stability of the RMS
[0130] The E protein of the attenuated SA14-14-2 virus used to
construct the YF/JE chimera differs from its virulent parent (SA14
or Nakayama) at 6 positions: 107, 138, 176, 177, 264, and 279.
Because the presence of a single residue controlling virulence
would be a disadvantage for any vaccine candidate because of the
potential for reversion, studies are being undertaken to determine
which residue(s) are responsible for attenuation and in particular
whether a single residue is responsible for the difference.
[0131] 1.18 Position 138 on the E protein
[0132] A single mutation of an acidic residue glutamic acid (E) to
a basic residue, lysine (K) at position 138 on the E protein of JE
virus results in attenuation (Sumyoshi et al., J. Infect. Dis.
171:1144, 1995). Experiments were carried out to determine whether
the amino acid at position 138 of the JE envelope protein (K in the
vaccine chimera and E in the virulent Nakayama chimera) is a
critical determinant for neurovirulence in mice. Chimeric YF/JE
SA14-14-2 (K 138---->E) virus containing the single reversion of
K---->E at position 138 was generated from an engineered cDNA
template. The presence of the substitution and the integrity of the
entire E protein of the resulting virus was verified by RT/PCR
sequencing of the recovered virus. A standard fixed-dose
neurovirulence test of the virus was conducted in 4-week-old
outbred mice by i.c. inoculation with 10.sup.4 pfu of virus. The
YF/JE SA14-14-2 and YF/JE Nakayama chimeric viruses were used as
controls. The virulence phenotype of YF/JE SA14-14-2 (K--->E)
was indistinguishable from that of its attenuated parent YF/JE
SA14-14-2 in this assay, with no morbidity or mortality observed in
the mice during the observation period (FIG. 19).
[0133] We conclude that the single mutation at position 138 to the
residue found in the JE-Nakayama virus does not exert a dominant
effect on the neurovirulence of the YF/JE SA14-14-2 chimera, and
that one or more additional mutations are required to establish the
virulent phenotype.
[0134] 1.19 Other Putative Attenuation loci
[0135] Additional experiments to address the contributions of the
other 6 residues (mentioned above) using the format described here
were conducted. The mutant viruses constructed by site directed
mutagenesis of the YF and JE infectious clones are listed in Table
16. The E proteins of these viruses were sequenced and confirmed to
contain the desired mutations. Upon inoculation into weanling mice
by the I.C. route it is possible to determine those residues
involved in attenuation of the vaccine.
[0136] Additional experiments to address the contributions of other
residues are underway. The mutant viruses constructed to date by
site-directed mutagenesis of the YF and JE infectious clones are
listed in Table 16. The methodology is as described above. Results
to date confirm that at least two and possibly more than 2
mutations are responsible for the attenuation phenotype of YF/JE
SA14-14-2 virus (Table 23).
[0137] 1.20 Stability of the RMS in Tissue Cultures:
Characterization of Genetic Changes, Neurovirulence and
Immunogenicity, Serial Passages In Vitro
[0138] The RMS was used to inoculate a T75 flask of FRhL2 cells at
an m.o.i. of 0.1. Subsequent passages were carried out in T75
flasks and harvested 3 days post-inoculation. At each passage, the
culture supernatant was assumed to hold 107 pfu/ml and an aliquot
corresponding to an moi of approximately 0.1 was added to a fresh
flask of cells. The remainder of the culture supernatant was stored
at -80.degree. C. for later characterization.
[0139] 1.21 Quasispecies and DNA Sequencing
[0140] The chimeric JE vaccine is an RNA virus. Selective pressure
can cause rapid changes in the nucleic acid sequences of RNA
viruses. A mutant virus that invades FRhL cells more rapidly, for
example, may gain a selective advantage by competing more
effectively with the original vaccine virus and take over the
culture. Therefore, mutant strains of the vaccine that grow better
than the original vaccine may be selected by subculturing in vitro.
One concern that addressed experimentally is whether such selective
pressures might lead to mutant vaccine viruses with increased
virulence.
[0141] In theory, molecular evolution should occur more rapidly for
RNA viruses than DNA viruses because viral RNA polymerases have
higher error rates than viral DNA polymerases. According to some
measurements, RNA virus mutation rates approach one mutation per
replication event. This is why an RNA virus can be thought of as a
family of very closely related sequences (or "quasispecies"),
instead of a single unchanging sequence (a "classical
species").
[0142] Two different approaches can be taken to determine the
sequence of an RNA virus:
[0143] 1) purify viral genomic RNA from the culture supernatant,
reverse-transcribe the RNA into cDNA and sequence this cDNA. This
is the approach we have taken. It yields an averaged, or consensus
sequence, such that only mutations which represent a large
proportion (roughly, >20%) of the viruses in the culture can be
detected.
[0144] 2) Alternatively, cDNA can be cloned and individual clones
sequenced. This approach would reveal the quasispecies nature of
the vaccine by identifying individual mutations (deviations from
the consensus sequence) in some proportion of the clones.
[0145] 1.22 Biological Characterization of Serially Passaged
RMS
[0146] As stated above, we demonstrated experimentally that the
selective pressures exerted by serial passaging of the RMS does not
lead to mutant vaccine viruses with increased virulence. Here,
three biological properties of Passages 10 and 18 (P10 and P18)
were examined. First, neurovirulence was tested by inoculating mice
i.c. with graded doses of P1 as well as P10 and P18. Second,
immunogenicity was compared by inoculating mice s.c. with graded
doses of the RMS, P10 and P18. Blood was drawn from these mice 30
days post inoculation and serum neutralizing titers were determined
and compared. Finally, the growth kinetics of the RMS and of P10
and P18 were compared by inoculating FRhL cells at moi's of 0.1 and
0.01 and collecting samples of culture supernatant daily. The
titers in each flask were plotted as a function of time and
compared.
[0147] 1.23 Stability of prM and E Genes
[0148] The M and E genes of P10 and P18 were sequenced completely
from base 642 to base 2454. Both sequences were identical and
carried only one mutation (A-->G) resulting an amino acid
substitution from H to R at position 394 on the E protein. This
means that selective pressures did not lead to the loss of any of
the attenuating mutations of the E gene. Codon H394 (CAC) encodes a
Histidine in the RMS but we have found that the second base of this
codon is mutated to a G in a significant proportion of the viruses,
leading to the expression of Arginine. It is important to emphasize
that a mixture of A and G are observed at this position in the
sequence data. The ratio of A to G (A/G) was also determined for
P1, P4, and P8. Interestingly, the ratio decreases steadily from P1
to P10, but at P18 it is back to the value seen at P8. One possible
explanation for this observation is that a mutant bearing the H394R
mutation gradually became as abundant as the original virus but was
then out-competed by a new mutant bearing other mutations not
present in the M or E genes and therefore, only detected as a
rebound in the A/G ratio. We are reproducing these results by doing
a second passaging experiment under identical conditions. It must
also be noted that duplicate samples of viral genomic RNA were
isolated, reverse-transcribed, amplified, and sequenced in parallel
for each passage examined. Reported results were seen in both
duplicate samples, arguing against any RT-PCR artifacts obscuring
the data.
[0149] These observations show that minor genetic changes (one
nucleotide substitution in the entire envelope E and M genes) have
occurred in the JE sequences of the chimeric vaccine upon
passaging, but that selective pressures did not lead to the loss of
any of the attenuating mutations of the E gene.
[0150] 1.24 Neurovirulence Phenotype of Passages 10 and 18
[0151] Groups of five female ICR mice, 3 to 4 weeks-old, received
30 .mu.l i.c. of undiluted, P1, P10, or P18, as well as 30 .mu.l of
10-fold dilutions. None of the mice injected with P1, P10, or P18
(doses >7 log.sub.10 pfu) showed any sign of illness over a
five-week period. As determined by back-titration, the doses
administered (pfu) were measured as shown in Table 17.
[0152] 1.25 Immunogenicity of Passages 10 and 18
[0153] Groups of five female ICR mice were injected subcutaneously
(s.c.) with 100 .mu.l of undiluted virus stock of either the RMS or
P10 or P18, as well as with doses of 10.sup.5 and 10.sup.4 pfu (see
Table 18, results of back-titration).
[0154] 1.26 Growth Kinetics of Passages 10 and 18
[0155] Monolayers (90% confluent) of FRhL cells were infected with
an moi of 0.1 or 0.01 of RMS, P10, or P18. Time points were then
taken daily for seven days and the titer of each time point was
determined by plaque assay. Visual observation of cytopathic
effects (CPE) on FRhL cells used in this growth curve experiment
show that later passages of the RMS have different growth
properties than the RMS itself. CPE is clearly greater for P18 and
P10 than for the RMS at 4 days postinfection showing that these
viruses might replicate much faster than the RMS.
[0156] Other observations also show that the growth properties of
P10 and P18 differ from those of the RMS. The titers of P1, P10,
and P18 are 2.times.10.sup.7, 2.times.10.sup.8, and
3.times.10.sup.8, respectively. The relative yields of RT-PCR
products suggest higher titers of P10 and P18 compared to P1.
Although the PCR data are not necessarily quantitative, they are
consistent with the observed titers.
[0157] These results raise the possibility that we have discovered
a variant of the vaccine that is immunogenic, attenuated for mouse
neurovirulence, and that grows to titers ten-fold higher than the
original vaccine (RMS) in tissue culture. Such a mutant may have
value for manufacturing.
[0158] Finally, the sequences of the entire genomes of the RMS and
p18 were determined and found to be identical, except for the
E-H394 mutation (Table 25). There are 6 nucleotide (NT) differences
(NT positions are shaded) between the published YF 17D sequences
and RMS shown in bold letters. Changes in positions 5461, 5641,
8212, and 8581 are silent and do not result in amino acid
substitution, whereas changes in positions 4025 (ns2a) and 7319
(ns4b) result in amino acid substitutions from V to M and from E to
K, respectively. Amino acid Methionine (M) at position 4025 is
unique for RMS and is not found in any other YF strains, including
parent Asibi virus and other yellow fever 17D strains (e.g., 204,
213, and 17DD), whereas Lysine (K) at position 7319 is found in
17D204F, 17D213, and 17DD, but not in 17D204 US or Asibi strain.
Since the RMS is more attenuated than YF 17D with respect to
neurovirulence, and thus has better biological attributes as a
human vaccine, it is possible that the amino acid differences at
positions 4025 and 7319 in the nonstructural genes of the yellow
fever portion of the chimeric virus contribute to attenuation.
Other workers have shown that the nonstructural genes of yellow
fever virus play an important role in the attenuation of
neurovirulence (Monath, "Yellow Fever," in Plotkin et al., (Eds.),
Vaccines, 2.sup.nd edition, W. B. Saunders, Philadelphia,
1998).
[0159] 1.27 Experiment to Identify Possible Interference Between YF
17D and YF/JE SA14-14-2
[0160] It is well-established that yellow fever virus encodes
antigenic determinants on the NS1 protein that induce
non-neutralizing, complement-fixing antibodies. Passive
immunization of mice with monoclonal anti-NS1 antibodies confers
protection against challenge. Active immunization with purified or
recombinant NS1 protects mice and monkeys against lethal challenge.
The mechanism of protection is presumed to involve
antibody-mediated complement-dependent cytotoxicity.
[0161] In addition to protective determinants on NS1, CTL epitopes
on other nonstructural proteins, including NS3, NS2a, and possibly
NS5 may be involved in protection. Thus, infection with the YF/JE
chimeric virus may stimulate humoral or cellular anti-yellow fever
immunity. It is possible, therefore, that use of the chimeric
vaccine may interfere with subsequent immunization against YF 17D,
or that prior immunization with YF 17D may interfere with
seroconversion to YF/JE SA14-14-2. Against this hypothesis is a
substantial body of data showing that reimmunization with YF 17D
results in a boost in yellow fever N antibodies. Those data show
that it should be possible to successfully immunize against JE in
an individual with prior YF immunity and vice versa.
[0162] To investigate possible interference effects, the experiment
shown in Table 19 was initiated. Mice are immunized with one
vaccine and subsequently boosted with the heterologous vaccine.
Mice are bled every 30 days and sera tested for neutralizing
antibodies against heterologous and homologous viruses.
[0163] 1.28 Seroconversion Rate and Antibody Titers After Primary
Immunization
[0164] Three groups (n=8) of 3-4 weeks old female outbred ICR mice
were immunized with a single dose (5.3 log.sub.10 pfu) of
CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine comprising Japanese
Encephlaitis virus prM and E proteins (YF/JE SA14-14-2), three
groups (n=8) were immunized with two doses of JE-VAX.RTM.
(inactivated Japanese Encephalitis virus vaccine) (0.5 ml of a 1:5
dilution of reconstituted vaccine) and three groups (n=8) were
immunized with a single dose of YF-VAX.RTM. (inactivated Japanese
Encephalitis virus vaccine) (0.1 ml of a 1:2 dilution of
reconstituted vaccine, containing 4.4 log.sub.10 pfu, previously
determined to induce the highest immune response to YF virus). Six
groups (n=4) of mice (similar age, 3-4 weeks old) were kept as
controls for booster doses at 3, 6, and 12 months post primary
immunization.
[0165] All mice were bled 4 and 8 weeks after primary immunization
and their neutralizing antibody titers were measured against
homologous viruses in a plaque assay. 21/24 (87.5%) of the animals
immunized with a single dose of CHIMERIVAX-JE.TM. (chimeric
flavivirus vaccine comprising Japanese Encephalitis virus prM and E
proteins) developed anti-JE neutralizing antibodies 1 month after
immunization; at 2 months, 18/24 (75%) were seropositive. Geometric
mean increased somewhat between 1 and 2 months post inoculation. In
contrast, only 25%-33% of the mice immunized with YF-VAX.RTM.
(Yellow Fever 17D vaccine) seroconverted and antibody responses
were low. These results show that YF 17D virus and chimeric viruses
derived from YF 17D are restricted in their ability to replicate in
the murine host; however, when the envelope of JE virus is
incorporated in the chimeric virus, the ability to replicate in and
immunize mice is apparently enhanced. Mice receiving two doses of
JE-VAX.RTM. (inactivated Japanese Encephalitis virus vaccine)
developed high neutralizing titers against parent Nakayama virus,
and titers increased between 1 and 2 months post immunization.
[0166] 1.29 Secondary Immunization of CHIMERIVAX-JE.TM. (Chimeric
Flavivirus Vaccine Comprising Japanese Encephalitis Virus prM and E
Proteins) and JE-VAX.RTM. (Inactivated Japanese Enceplalitis Virus
Vaccine) Immunized Mice With YF-VAX.RTM. (Yellow Fever 17D
Vaccine)
[0167] Three months and six months after primary immunization with
CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine comprising Japanese
Encephalitis virus prM and E proteins), mice were inoculated with
YF-VAX.RTM. (Yellow Fever 17D Vaccine) (1:2 dilution of a human
dose containing 4.4 log.sub.10 pfu). Control mice not previously
immunized and of identical age received CHIMERIVAX-JE.TM. (chimeric
flavivirus vaccine comprising Japanese Encephalitis virus prM and E
proteins) only or YF-VAX.RTM. (Yellow Fever 17D Vaccine) (Groups
10-13). One month later, mice were tested for presence of
YF-specific neutralizing antibodies.
[0168] At the 3 month time point, none of the control mice or mice
previously immunized with CHIMERIVAX-JE.TM. (chimeric flavivirus
vaccine comprising Japanese Encephalitis virus prM and E proteins)
or JE-VAX.RTM. (inactivated Japanese Encephalitis virus vaccine)
seroconverted to YF-VAX.RTM. (inactivated Japanese Encephalitis
virus vaccine), again confirming the poor immunogenicity of
YF-VAX.RTM. (inactivated Japanese Encephalitis virus vaccine) at
the dose used. However, all mice immunized with YF-VAX.RTM.&
(inactivated Japanese Encephalitis virus vaccine) 6 months after
primary immunization with CHIMERIVAX-JE.TM. (chimeric flavivirus
vaccine comprising Japanese Encephalitis virus prM and E proteins)
and 7/8 mice previously immunized with JE-VAX.RTM. (inactivated
Japanese Encephalitis virus vaccine), seroconverted after
immunization with YF-VAX.RTM. (Yellow Fever 17D Vaccine) (Table
24). There was no difference in seroconversion rate or GMT in mice
with and without prior immunization with either JE vaccine.
[0169] 1.30 Secondary Immunization of YF-VAX.TM. (Yellow Fever 17D
Vaccine) Immunized Mice with CHIMERIVAX-JE.TM. (Chimeric Flavivirus
Vaccine Comprising Japanese Encephalitis Virus prM and E
Proteins)
[0170] All mice previously immunized with YF-VAX.RTM. (Yellow Fever
17D Vaccine) and reimmunized with CHIMERIVAX-JE.TM. (chimeric
flavivirus vaccine comprising Japanese Encephalitis virus prM and E
proteins) 3 months later developed neutralizing antibodies to JE
(group 7, Table 10). None of the controls seroconverted. Five of 6
mice (83%) previously immunized to YF-VAX.RTM. (Yellow Fever 17D
Vaccine) and reimmunized with CHIMERIVAX-JE.TM. (chimeric
flavivirus vaccine comprising Japanese Encephalitis virus prM and E
proteins) 6 months later seroconverted to JE (group 8, Table 10, as
did all controls (group 13)), and the GMTs were similar across
these groups.
[0171] There was no evidence for cross-protection between YF and JE
viruses or limitation of antibody response to sequential
vaccination with these viruses. Yellow fever 17D vaccine elicits a
poor antibody response in the mouse; while this limited
interpretation of the data somewhat, it provided a sensitive test
of any restriction in replication and immunogenicity of YF 17D
virus in mice previously immunized with CHIMERIVAX-JE.TM. (chimeric
flavivirus vaccine comprising Japanese Encephalitis virus prM and E
proteins). The fact that all mice immunized with CHIMERIVAX-JE.TM.
(chimeric flavivirus vaccine comprising Japanese Encephalitis virus
prM and E proteins) responded 6 months later to immunization with
YF-VAX.RTM. (Yellow Fever 17D Vaccine) and that the GMT and range
of neutralizing antibody titers were similar to controls suggests
that the chimeric vaccine imposed no significant barrier to yellow
fever immunization.
[0172] 2.0 Construction of cDNA Templates for Generation of Yellow
Fever/Dengue (YF/DEN) Chimeric Viruses
[0173] Derivation of chimeric Yellow Fever/Dengue (YF/DEN) viruses
is described as follows, which, in principle, is carried out the
same as construction of the YF/JE chimeras described above. Other
flavivirus chimeras can be engineered with a similar strategy,
using natural or engineered restriction sites and, for example,
oligonucleotide primers as shown in Table 20.
[0174] 2.1 Construction of YF/DEN Chimeric Virus
[0175] Although several molecular clones for dengue viruses have
been developed, problems have commonly been encountered with
stability of viral cDNA in plasmid systems, and with the efficiency
of replication of the recovered virus. We chose to use a clone of
DEN-2 developed by Dr. Peter Wright, Dept. of Microbiology, Monash
University, Clayton, Australia, because this system is relatively
efficient for regenerating virus and employs a two-plasmid system
similar to our own methodology. (See Table 21 for a comparison of
the sequences of Dengue-2 and YF/Den-2.sub.218 viruses;
YF/Den-2.sub.218 contains the nucleotide and amino acid sequences
of PUO-218. The NGC and PR-159 strains, which are also listed in
Table 21, are other wild strains of dengue that differ from PUO-218
and can be used in the chimeras of the invention.) The complete
sequence of this DEN-2 clone is available and facilitated the
construction of chimeric YF/DEN templates because only a few
modifications of the YF clone were required. The relevant steps are
outlined as follows.
[0176] Similar to the two plasmid system for YF5.2iv and YF/JE
viruses, the YF/DEN system uses a unique restriction site within
the DEN-2 envelope protein (E) as a breakpoint for propagating the
structural region (prM-E) within the two plasmids, hereinafter
referred to as YF5'3'IV/DEN (prM-E') and YFM5.2/DEN (E'-E) (see
FIG. 20). The two restriction sites for in vitro ligation of the
chimeric template are AatII and SphI. The recipient plasmid for the
3' portion of the DEN E protein sequence is YFM5.2(NarI[+]SphI[-]).
This plasmid contains the NarI site at the E/NSI junction, which
was used for insertion of the carboxyl terminus of the JE E
protein. It was further modified by elimination of an extra SphI
site in the NS5 protein region by silent site-directed mutagenesis.
This allowed insertion of DEN-2 sequence from the unique SphI site
to the Narn site by simple directional cloning. The appropriate
fragment of DEN-2 cDNA was derived by PCR from the DEN-2 clone
MON310 furnished by Dr. Wright. PCR primers included a 5' primer
flanking the SphI site and a 3' primer homologous to the DEN-2
nucleotides immediately upstream of the signalase site at the E/NSI
junction and replacing the signalase site by substitutions that
create a novel site, but also introduce. a Narn site. The resulting
1,170 basepair PCR fragment was then introduced into
YFM5.2(NarI[+]SphI[-]).
[0177] The 5' portion of the YF/den-2 clone, including the C/prM
junction was engineered by PCR. The C/prM junction was created by
incorporating a TfiI restriction site at the junction using
synthetic oligonucleotides. A 5' PCR fragment encompassing the
flanking YF sequence 5' untranslated and capsid sequence and a 3'
TfiI site, together with a 3' PCR fragment beginning with a TfiI
site at the amino terminus of the dengue-2 prM protein and the
flanking dengue-2 prM protein sequence, were ligated into the
YF5'3'IV plasmid after intermediate construction in pBluescript.
Screening with TfiI was used to confirm correct assembly of the
chimeric junction in the final plasmid YF5'3'IV/DEN(prM-E).
[0178] 2.2 Construction of Chimeric YF/DEN Viruses Containing
Portions of Two DEN Envelope Proteins
[0179] Since neutralization epitopes against DEN viruses are
present on all three domains of the E protein, it is possible to
construct novel chimeric virus vaccines that include sequences from
two or more different DEN serotypes. In this embodiment of the
invention, the C/prM junction and gene encoding the carboxyl
terminal domain (Domain III) of one DEN serotype (e.g., DEN-2) and
the N-terminal sequences encoding Domains I and II of another DEN
serotype (e.g., DEN-1) are inserted in the YF 17D cDNA backbone.
The junctions at C/prM and E/NS1 proteins are retained, as
previously specified, to ensure the infectivity of the
double-chimera. The resulting infectious virus progeny contains
antigenic regions of two DEN serotypes and elicits neutralizing
antibodies against both.
[0180] 2.3 Transfection and Production of Progeny Virus
[0181] Plasmid YF5'3'IV/DEN(prME) and YFM5.2/DEN(E'-E) were cut
with SphI and AatII restriction enzymes, appropriate YF and dengue
fragments were isolated and ligated in vitro using T4 DNA ligase.
After digestion with XhoI to allow run-off transcription, RNA was
transcribed (using 50 ng of purified template) from the SP6
promoter and its integrity was verified by non-denaturing agarose
gel electrophoresis. Vero cells were transfected with YF/Den-2 RNA
using Lipofectin (Gibco/BRL), virus was recovered from the
supernatants, amplified twice in Vero cells, and titrated in a
standard plaque assay on Vero cells. The virus titer was
2.times.10.sup.6 PFU/ml.
[0182] 2.4 Nucleotide Sequencing of YF/Den-2 Chimera
[0183] Vero cells were infected with YF/DEN-2 (clone 5.75) at an
MOI of 0.1. After 96 hours, cells were harvested with Trizol (Life
Technologies, Inc.). Total RNA was primed with a YF-5' end NS1
minus oligo, and reverse transcribed with Superscript II RT
following a long-RT protocol (Life Technologies, Inc.).
Amplification of cDNA was achieved with XL-PCR kit (Perkin Elmer).
Several primers specific for dengue type 2 strain PUO-218 were used
in individual sequencing reactions and standard protocols for cycle
sequencing were performed. Sequence homology comparisons were
against the PUO-218 strain prME sequence (GenBank accession number
D00345).
[0184] Sequencing showed that the YF/DEN-2 chimera prME sequence is
identical to that of PUO-218 (Gruenberg et al., J. Gen. Virol
69:1391-1398, 1988). In addition, a Narn site was introduced at the
3' end of E, resulting in amino acid change Q494G (this residue is
located in the transmembrane domain and not compared in Table 21).
In Table 21, amino acid differences in the prME region of YF/Den2
is compared with prototype New Guinea C (NGC) virus and the
attenuated dengue-2 vaccine strain PR-159 S1 (Hahn et al., Virology
162:167-180, 1988).
[0185] 2.5 Growth Kinetics in Cell Culture
[0186] The growth kinetics of the YF/Den-2 chimera were compared in
Vero and FeRhL cells (FIG. 16). Cells were grown to confluency in
tissue culture flask (T-75). FeRhL cells were grown in MEM
containing Earle's salt, L-Glu, non-essential amino acids, 10% FBS
and buffered with sodium bicarbonate, and Vero cells were grown in
MEM-Alpha, L-Glu, 10% FBS (both media purchased from Gibco/BRL).
Cells were inoculated with YF/Den2 at 0.1 MOI. After 1 hour of
incubation at 37.degree. C., medium containing 3% FBS was added,
and flasks were returned to a CO.sub.2 incubator. Every 24 hours,
aliquots of 0.5 ml were removed, FBS was added to a final
concentration of 20%, and frozen for determination of titers in a
plaque assay. Forty-eight hours post infection CPE was observed in
FeRhL cells and reached 100% by day 3. In Vero cells, CPE was less
dramatic and did not reached 100% by the completion of the
experiment (day 5). As shown, the YF/Den2 reached its maximum titer
(7.4 log.sub.10 pfu/ml) by day 3 and lost about one log (6.4
log.sub.10 pfu/ml) upon further incubation at 37.degree. C.,
apparently due to death of host cells and virus degradation at this
temperature. The maximum virus titer in Vero cells was achieved by
day 2 (7.2 log.sub.10 pfu/ml) and only half log virus (6.8
log.sub.10 pfu/ml) was lost on the following 3 days. This higher
rate of viable viruses in Vero cells may be explained by incomplete
CPE observed in these cells. In sum, the chimera grows well in
approved cell substrate for human use.
[0187] 2.6 Neurovirulence Phenotype in Suckling Mice
[0188] Although wild-type unpassaged dengue viruses replicate in
brains of suckling mice and hamsters inoculated by the
intracerebral route (Brandt et al., J. Virol 6:500-506, 1970), they
usually induce subclinical infection and death occur only in rare
cases. However, neurovirulence for mice can be achieved by
extensive passage in mouse brain. Such neuroadapted viruses can be
attenuated for humans. For example, the New Guinea C (NGC), the
prototype dengue 2 virus isolated in 1944 and introduced into the
Americas in 1981, is not neurovirulent for suckling mice; however
after sequential passage in mouse brain it became neurovirulent for
mice, but was attenuated for humans (Sabin, Am. J. Trop. Med. Hyg.,
1:30-50, 1952; Sabin et al., Science 101:640-642, 1945; Wisseman et
al., Am. J. Trop. Med. Hyg.12:620-623, 1963). The PUO-218 strain is
a wild type dengue 2 virus isolated in 1980 epidemic in Bangkok. It
is closely related to the NGC strain by nucleotide sequencing
(Gruenberg et al., J. Gen. Virol 69:1391-1398, 1988). When the prME
genes of the PUO-218 strain were inserted into the neuroadapted NGC
backbone, the chimeric virus was attenuated for 3-days old mice
inoculated by the I.C. route (Peter Wright, X.sup.th International
Congress of Virology, Jerusalem, Israel, 1996). The PUO218 virus
differs from NGC in one amino acid in prM (residue 55 is F in NGC
and is L in PUO218) and 6 amino acids in the E protein (71 D->E,
126K->E, 141I->V, 164I->V, 402I->F, and 484 V->I)
(see Table 21). All amino acid differences (except residue E-126)
are also present in PR S1 strain (attenuated vaccine strain),
indicating that they may not be involved in attenuation. Only
residue 126 on the E protein is different between these viruses.
This residue was shown to be responsible for the neurovirulent
phenotype of the mouse adapted NGC (Bray et al., J. Virology
72:1647-1651, 1998). Although mouse neurovirulence does not predict
virulence/attenuation of dengue viruses for humans, it is important
to determine the neurovirulence of a YF/Den-2 chimeric virus. YF
17D retains a degree of neurotropism for mice, and causes
(generally subclinical) encephalitis in monkeys. after IC
inoculation. For vaccine development of a den/YF chimera it will be
necessary to show that the construct does not exceed YF 17D in
neuroinvasiveness and neurovirulence. Ultimately safety studies in
monkeys will be required. In initial studies, we determined if
insertion of the prME of the PUO218 into YF 17D vaccine strain will
affect its neurovirulence for suckling mice (Table 24). Groups of
3, 5, 7, and 9 days old suckling mice were inoculated by the I.C.
route with 10,000 pfu of YF/Den-2 or YF/JE SA14-14-2 chimera and
observed for paralysis or death for 21 days. For controls similar
age groups were inoculated either sham with medium (I.C. or I.P.)
or with 1,000 pfu of unpassaged commercial YF vaccine YF-VAX.RTM.
(Yellow Fever 17D Vaccine)) by the I.P. route (it is not necessary
to inoculate suckling mice with YF-VAX.RTM. (Yellow Fever 17D
Vaccine) by the I.C. route because we have previously shown that
this vaccine is virulent for 4-weeks old mice by this route).
[0189] As shown in FIG. 22, all suckling mice (3 to 7 days old)
inoculated by the I.C. route with the YF/Den2 chimera died between
11 and 14 days post inoculation, whereas 8 out of 10 suckling mice
(9 days old) survived. Similarly, all suckling mice (3-5 days old)
inoculated with YF-VAX.RTM.V (Yellow Fever 17D Vaccine) by the I.P.
route, with a dose which was 10-fold lower than the YF/Den2
chimera, died between 11 to 13 days post inoculation (FIG. 23). All
nine day old, as well as 8 out of 9 seven day old, mice inoculated
with the YF-VAX.RTM. (Yellow Fever 17D Vaccine) survived. Similar
results to the YF/Den2 chimera obtained with suckling mice
inoculated with the YF/JE SA14-14-2 chimera.
[0190] As is mentioned above, when prME genes of the PUO218 strain
were inserted into the NGC backbone the chimeric virus was not
neurovirulent for 3 days old suckling mice inoculated by the I.C.
route. In contrast, when these genes were inserted into the 17D
backbone, the resulting YF/Den2 chimera demonstrated a
neurovirulence phenotype (for suckling mice) similar to the YF/JE
SA14-14-2. This experiment also demonstrated that the replacement
of the prME genes of the YF 17 D with prME genes of the Dengue 2
PUO218 resulted in a chimeric virus that was less neurovirulent
than the 17D parent strain.
[0191] Unlike most flaviviruses, there is no correlation between
neurovirulence of dengue viruses in mice and humans. Currently the
most suitable animal models for dengue infection are Old World
monkeys, New World monkeys, and apes that develop subclinical
infection and viremia. There is, however, no animal model for the
most severe illness (DHF) in humans, which occurs when individuals
become infected with a heterologous serotype due to antibody
dependent enhancement of infection. Today it is generally accepted
that a tetravalent vaccine is required to induce protective
immunity in human beings against all four serotypes to avoid
sensitizing vaccinee to more severe illness DHF. For the last fifty
years, many approaches have been undertaken to produce effective
dengue vaccines and although dengue viruses have been satisfactory
attenuated (e.g., PR-159/S-1 for Dengue 2) in many cases in vitro
or in vivo correlation of attenuation were not reproducible in
humans. A current strategy is to test selected live virus vaccine
candidates stepwise in small numbers of human volunteers. Many
laboratories around the world are exploring various strategies to
produce suitable vaccine candidates. These range from subunit
vaccines including prME (protein vaccine or DNA vaccine) of dengue
viruses to live attenuated whole viruses (produced by tissue
culture passage or recombinant DNA technology). Although some of
these candidates have shown promise in preclinical and human
volunteers, development of a successful dengue vaccine remained to
implemented.
[0192] Evaluating the immunogenicity and protective efficacy of the
YF/Den2 chimera in monkeys should shed light on selection of
appropriate prME genes (form wild type or attenuated strain) for
construction of all 4 serotypes of chimeric dengue viruses.
[0193] 2.7 Stability of prME genes of CHIMERIVAX-DEN2.TM. (Chimeric
Flavivirus Vaccine Comprising Dengue 2 prM and E Proteins) Virus in
Vitro
[0194] The CHIMERIVAX-DEN2.TM. (chimeric flavivirus vaccine
comprising Dengue 2 prM and E proteins) virus at passage 2 post
transfection was used to inoculate a 25 cm.sup.2 flask of Vero
cells. Total RNA was isolated and the complete nucleotide sequence
of the CHIMERIVAX-DEN2.TM. (chimeric flavivirus vaccine comprising
Dengue 2 prM and E proteins) was determined (P3) and compared to
the published sequence of the YF 17D virus (Rice et al., Science
229:726-733, 1985). There was one nucleotide difference: at
position 6898 there was an A in the chimera (P3), which was a C in
the 17D nucleotide sequence. No difference in the prME region was
found when the sequence of CHIMERIVAX-DEN2.TM. (chimeric flavivirus
vaccine comprising Dengue 2 prM and E proteins) was compared to its
parent dengue 2 virus (PUO218 strain). Also, no mutations were
found in the prME genes of the chimera upon 18 passages in VeroPM
cells. Within the YF genes, however, there was one silent mutation
in position 6910 (C to A), and at position 3524 the P18 virus
appeared to be heterozygous (both parent nucleotides, G and mutant
A, were present). This would translate into a mixture of E and K
amino acids at position 354 of the NS1 protein.
[0195] Similar to the passage 3 virus, the passage 18 virus was not
neurovirulent for 4 week old outbred mice inoculated by the IC
route (5 log.sub.10 pfu was the highest dose tested). Passage 3,
passage 5, passage 10, and passage 18 of CHIMERIVAX-DEN2.TM.
(chimeric flavivirus vaccine comprising Dengue 2 prM and E
proteins) were inoculated into mice by SC and IC routes, and
antibody responses were compared. There were no significant
differences in production of anti-dengue 2 neutralizing antibodies
across 18 passages (Table 26).
[0196] 2.8 Viremia, Immunogenicity, and Protective Efficacy of
CHIMERIVAX-DEN2.TM. (Chimeric Flavivirus Vaccine Comprising Dengue
2 prM and E Proteins) in YF Immune Monkeys
[0197] Because CHIMERIVAX.TM. (chimeric flavivirus
vaccines)-viruses contain core and NS genes of the YF 17D virus, it
is important to determine if preimmunity to the 17D vaccine
interferes with vaccination with CHIMERIVAX-DEN2.TM. (chimeric
flavivirus vaccine comprising Dengue 2 prM and E proteins) virus.
As is discussed above, in the case of CHIMERIVAX-JE.TM. (chimeric
flavivirus vaccine comprising Japanese Encephalitis virus prM and E
proteins), there was no significant interference between YF 17D
immunity and CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine
comprising Japanese Encephalitis virus prM and E proteins), virus,
measured by production of neutralizing antibodies in mice.
[0198] Since YF17D vaccine and both CHIMERIVAX-JE.TM. (chimeric
flavivirus vaccine comprising Japanese Encephalitis virus prM and E
proteins) and CHIMERIVAX-DEN2.TM. (chimeric flavivirus vaccine
comprising Dengue 2 prM and E proteins) were not highly immunogenic
in mice inoculated by the SC route (see also table 26), non-human
primates were used, which are more susceptible/relevant for
evaluation of flavivirus vaccines for humans. Sixteen rhesus
monkeys (some of which were previously immunized with YF 17D
vaccine) received CHIMERIVAX-DEN2 .TM. (chimeric flavivirus vaccine
comprising Dengue 2 prM and E proteins), YF 17D vaccine, or a wild
type dengue 2 virus (strain S16803). As is shown in Table 27, all
YF immune monkeys seroconverted to the YF/dengue 2 or wild type
dengue 2 virus, demonstrating a lack of vector immunity. These
monkeys were also protected from viremia after challenge with wild
type dengue 2 virus. In contrast, YF 17D immunized monkeys, as well
as non-immunized animals, became viremic after challenge with wild
type dengue 2 virus. Wild type dengue 2 viruses produce a high
level of viremia (3-5 logs) in rhesus monkeys, which lasts between
3-6 days. Attenuation of dengue 2 viruses can therefore be
estimated by comparing the level and duration of viremia with
reference wild-type strains. These experiments clearly showed that
core and non-structural proteins of YF 17D virus present in
CHIMERIVAX-DEN2.TM. (chimeric flavivirus vaccine comprising Dengue
2 prM and E proteins) do not interfere with CHIMERIVAX-DEN2.TM.
(chimeric flavivirus vaccine comprising Dengue 2 prM and E
proteins) immunization.
[0199] 2.9 Dose Response Effectiveness of CHIMERIVAX-DEN2.TM.
(Chimeric Flavivirus Vaccine Comprising Dengue 2 prM and E
proteins) in monkeys.
[0200] The goals of this experiment were to (i) determine the
viremia profile of the vaccine candidate, using YF 17D and wild
type dengue 2 virus controls, (ii) compare neutralizing antibody
responses to the vaccine candidate and wildtype virus, and (iii)
determine minimum dose required for protection against challenge
with wild type dengue-2 virus. It was anticipated that these
experiments would define the viremia profile of the
CHIMERIVAX-DEN2.TM. (chimeric flavivirus vaccine comprising Dengue
2 prM and E proteins) virus in non-YF immune monkeys, and would
determine whether immunization with a single dose results in
protection of animals against challenge with a wild type dengue 2
virus. Protection in these experiments is defined as reduction of
viremia in test monkeys compared to control viruses.
[0201] As is shown in table 28, all monkeys became viremic, and the
duration of viremia was dose-dependent. The peak level of viremia
for CHIMERIVAX-DEN2.TM. (chimeric flavivirus vaccine comprising
Dengue 2 prM and E proteins) was between 1.3 to 1.6 log.sub.10 pfu,
which was significantly lower than that of the wild type dengue
virus (3.6 log.sub.10 pfu).
[0202] All monkeys developed anti-dengue 2 neutralizing antibodies
by day 15. Lower dose of the vaccine resulted in lower GMTs,
however, by day 30 post-immunization, all monkeys developed high
titers of neutralizing antibodies, independent of the dose they
received. Upon challenge, no viremia was detected in any immunized
monkeys, demonstrating that even at its lowest dose (2 log.sub.10
pfu), CHIMERIVAX-DEN2.TM. (chimeric flavivirus vaccine comprising
Dengue 2 prM and E proteins) had protected these animals from
dengue infection (Table 29).
[0203] 2.10 Growth Characteristics of CHIMERIVAX-JE.TM. (Chimeric
Flavivirus Vaccine Comprising Japanese Encephalitis Virus prM and E
Proteins) Virus in Culex tritaeniorhynchus, Aedes albopictus, and
Aedes aegypti mosquitoes
[0204] As is described above, CHIMERIVAX-JE.TM. (chimeric
flavivirus vaccine comprising Japanese Encephalitis virus prM and E
proteins), which consists of a YF 17D virus backbone containing the
prM and E genes from the JE vaccine strain SA14-14-2, exhibited
restricted replication in non-human primates, producing only a low
level viremia following peripheral inoculation. Although this
reduces the likelihood that hematophagous insects could become
infected by feeding on a vaccinated host, it is prudent to
investigate the replication kinetics of the vaccine virus in
mosquito species that are known to vector the viruses from which
the chimera is derived. In this study, CHIMERIVAX-JE.TM. (chimeric
flavivirus vaccine comprising Japanese Encephalitis virus prM and E
proteins), virus was compared to its parent viruses (YF 17D and JE
SA14-14-2), as well as to wild type JE SA14 virus, for its ability
to replicate in Culex tritaeniorhyncus, Aedes albopictus, and Aedes
aegypti mosquitoes. Individual mosquitoes were exposed to the
viruses by intrathoracic (IT) virus inoculation or by oral
ingestion of a virus-laden blood meal.
[0205] 2.11 Intrathoracic Inoculation
[0206] Mosquitoes were inoculated 7-10 days post-emergence with
0.34 ml of approximately 6.0 log.sub.10 pfu/ml virus suspension
(5.5 log.sub.10 pfu/mosquito). This route of inoculation was chosen
to avoid variables, such as threshold titer, that might limit
midgut infection and subsequent dissemination of the viruses. Three
mosquitoes per virus were collected either at 24 hour intervals for
5-10 days or at 72 hour intervals for 18 days. Individual
mosquitoes were triturated in 1 ml of M199 media (Gibco BRL, Grand
Island, N.Y.) supplemented with 5% fetal calf serum, clarified by
brief centrifugation, and then titrated in Vero cells to monitor
virus replication.
[0207] Both JE SA14 and JE SA14-14-2 viruses replicated in Cx.
tritaeniorhynchusfollowing IT inoculation, reaching titers at day
14 of 6.7 and 6.0 log.sub.10 pfu/mosquito, respectively (FIG. 24A).
Additionally, IFA conducted on head squashes from JE SA14 and JE
SA14-14-2-inoculated Cx. tritaeniorhynchusmosquitoes was positive
for detection of JE virus antigen. In contrast, YF 17D and
CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine comprising Japanese
Encephalitis virus prM and E proteins) did not replicate in Cx.
tritaeniorhynchusmosquitoes. Virus titers declined rapidly
following inoculation, and no virus was detectable by plaque
titration assay in YF 17D or CHIMERIVAX-JE.TM. (chimeric flavivirus
vaccine comprising Japanese Encephalitis virus prM and E
proteins)-inoculated mosquitoes by days 1 and 2, respectively (FIG.
24A). IFA analysis of head squashes from Cx.
tritaeniorhynchusmosquitoes inoculated with CHIMERIVAX-JE.TM.
(chimeric flavivirus vaccine comprising Japanese Encephalitis virus
prM and E proteins) or YF 17D was negative for JE or YF virus
antigens, supporting our observation that neither the chimera nor
YF 17D replicate in this mosquito species.
[0208] CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine comprising
Japanese Encephalitis virus prM and E proteins) did replicate in
IT-inoculated Ae. albopictus mosquitoes, reaching a titer of 5.2
log.sub.10 pfu/mosquito at day 18 (FIG. 24B) and IFA results were
weakly positive for both JE virus and YF virus antigens. The JE
SA14 and JE SA14-14-2 viruses also replicated in Ae. albopictus
mosquitoes, reaching maximum titers of 6.3 and 6.0 log.sub.10
pfu/mosquito, respectively. YF 17D virus did not replicate to high
titers in Ae. albopictus mosquitoes, however, a low level of
detectable virus was maintained (3.8 log.sub.10 pfu/mosquito at day
18) (FIG. 24B) and IFA-stained head squashes were weakly positive
for YF virus antigen. CHIMERIVAX-JE.TM. (chimeric flavivirus
vaccine comprising Japanese Encephalitis virus prM and E proteins)
and YF 17D inoculated IT into Ae. aegypti mosquitoes replicated at
low levels over the 18 day incubation period (FIG. 24C). Peak
titers of 3.6 and 4.4 log.sub.10 pfu/mosquito, respectively, were
reached on day 15. IFA staining of head tissues from
CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine comprising Japanese
Encephalitis virus prM and E proteins) and YF 17D IT-inoculated
mosquitoes was weakly positive. Both JE SA14 and JE SA14-14-2
viruses proliferated in Ae. aegypti mosquitoes, reaching peak
titers of 6.3 and 6.1 log.sub.10 pfu/mosquito on days 9 and 18,
respectively.
[0209] 2.12 Oral Infection
[0210] Seven to ten day old Ae. albopictus and Ae. aegypti
mosquitoes were orally exposed to an artificial virus-containing
blood meal that was prepared from equal parts of washed calf red
blood cells (Colorado Serum Company, Denver, Colo.) and freshly
harvested virus. The blood/virus mixture was heated to 37.degree.
C. immediately prior to feeding. Mosquitoes were starved for 48-72
hours prior to feeding on virus/blood soaked cotton pledgets. Cx.
tritaeniorhynchus mosquitoes are reluctant to feed from
blood-soaked pledgets, and were therefore fed using a membrane
feeder. Mosquitoes were allowed to feed for 15-30 minutes, after
which fully engorged mosquitoes were collected. Three mosquitoes
per virus were harvested at 48-72 hour intervals over a 15-18 day
period, or, in a second experiment, all mosquitoes were harvested
at 22 days after feeding.
[0211] FIG. 25A illustrates growth of the viruses in orally exposed
Cx. tritaeniorhynchus mosquitoes. Individuals that were fed a blood
meal containing 6.9 log.sub.10 pfu/ml CHIMERIVAX-JE.TM. (chimeric
flavivirus vaccine comprising Japanese Encephalitis virus prM and E
proteins) virus did not become infected. Similar results were
observed in mosquitoes that had ingested a blood meal containing YF
17D virus. In contrast, high virus titers were detected in Cx.
tritaeniorhynchus mosquitoes that had ingested JE SA14 or JE
SA14-14-2 viruses.
[0212] FIGS. 25B and 25C illustrate growth of the viruses in orally
exposed Ae. albopictus and Ae. aegypti mosquitoes, respectively.
Only JE SA14 and JE SA14-14-2 viruses successfully infected and
replicated in these species. For example, in Ae. aegypti mosquitoes
on day 15, the titers of JE SA14 and JE SA14-14-2 viruses were 5.4
and 5.5 log.sub.10 pfu, respectively. In contrast, mosquitoes that
had ingested 4.7 log.sub.10 pfu/mosquito of YF17D virus or 4.5
log.sub.10 pfu/mosquito of CHIMERIVAX-JE.TM. (chimeric flavivirus
vaccine comprising Japanese Encephalitis virus prM and E proteins)
virus failed to become infected.
[0213] In a separate experiment, Ae. aegypti and Ae. albopictus
mosquitoes were orally exposed to JE SA14-14-2, YF 17D, and
CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine comprising Japanese
Encephalitis virus prM and E proteins) viruses and processed after
22 days extrinsic incubation to permit growth to maximum virus
titers. The results of this experiment are summarized in Table 30.
Only JE SA14-14-2 virus was detectable in mosquitoes. Because
CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine comprising Japanese
Encephalitis virus prM and E proteins) did not grow in any of the
mosquito species tested, transmission studies were not
performed.
[0214] Viruses recovered from Ae. Albopictus after IT or oral
inoculation, or from Ae. Aegypti after IT inoculation, were
identical to their parent CHIMERIVAX-JE.TM. (chimeric flavivirus
vaccine comprising Japanese Encephalitis virus prM and E proteins)
virus (Vero2 FrhL1) in the prME region.
[0215] 2.13 Amplification and Sequencing of the "Late Replicating"
CHIJMERIVAX-JE.TM. (chimeric Flavivirus Vaccine Comprising Japanese
Encephalitis virus prM and E Proteins) Viruses Isolated From
Mosquitoes
[0216] Ae. albopictus mosquitoes inoculated with CHIMERIVAX-JE.TM.
(chimeric flavivirus vaccine comprising Japanese Encephalitis virus
prM and E proteins) by IT or oral routes and Ae. aegypti inoculated
with CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine comprising
Japanese Encephalitis virus prM and E proteins) by IT route, were
harvested on day 15 post-inoculation. After triturating in 1 ml of
M199 (supplemented with 5% fetal calf serum), samples were
clarified by centrifugation, filtered through a 0.2 micron filter,
and used to inoculate a T-25 cm.sup.2 flask of VeroPM cells,
passage 144 (0.5 ml/flask). After 1 hour, virus adsorption at
37.degree. C., 5 ml MEM-containing 5% FBS was added and flasks
returned to the 37.degree. C. CO.sub.2 incubator. Viruses were
harvested from supernatants 4 days later (at 2+CPE) and kept frozen
at -70.degree. C. Total RNA was extracted from infected monolayers
by the use of the Trizol.TM. reagent (Gibco/BRL),
reverse-transcribed, amplified by XL PCR (Perkin-Elmer), and the
prME region was sequenced. Viruses recovered from Ae. Albopictus
after IT or oral inoculation, or from Ae. Aegypti after IT
inoculation, were identical to their parent CHIMERIVAX-JE.RTM.
(chimeric flavivirus vaccine comprising Japanese Encephalitis virus
prM and E proteins) virus (Vero2 FrhL1) in the prME region.
[0217] 2.14 Growth Characteristics of CHIMERIVAX-DEN2.TM. (Chimeric
Flavivirus Vaccine Comprising Dengue 2 prM and E Proteins) Virus in
Aedes albopictus and Aedes aegypti Mosquitoes
[0218] Similar experiments were carried out in Ae. albopictus and
Ae. aegypti mosquitoes with CHIMERIVAX-DEN2 .TM. (chimeric
flavivirus vaccine comprising Dengue 2 prM and E proteins) virus.
For controls, the YF17D vaccine and a dengue 2 wild type virus were
used. Dengue 2 wild type virus grew to more than 5 log.sub.10
pfu/ml in both mosquito species inoculated by IT or oral routes.
The growth of YF17D vaccine was lower than the wild type dengue 2
virus, and did not exceed 4 log.sub.10 pfu/ml. Interestingly, the
CHIMERIVAX-DEN2.TM. (chimeric flavivirus vaccine comprising Dengue
2 prM and E proteins) virus revealed the most restricted growth in
both mosquito species inoculated by either route (its titer did not
exceed 3 log.sub.10 pfu/ml) (FIG. 26).
[0219] 2.15 Summary of JE and Den2 Experiments in Mosquitos
[0220] In summary, CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine
comprising Japanese Encephalitis virus prM and E proteins) virus
did not replicate following ingestion by any of the three mosquito
species. Additionally, replication was not detected after IT
inoculation of CHIMERIVAX-JE.TM. (chimeric flavivirus vaccine
comprising Japanese Encephalitis virus prM and E proteins) in the
primary JE virus vector, Cx. tritaeniorhynchus. CHIMERIVAX-JE.TM.
(chimeric flavivirus vaccine comprising Japanese Encephalitis virus
prM and E proteins) exhibited moderate growth following IT
inoculation into Ae. aegypti and Ae. albopictus mosquitoes,
reaching titers of 3.6-5.0 log.sub.10 pfu/mosquito. There was no
change in the virus genotype associated with replication in
mosquitoes. Similar results were observed in mosquitoes of all
three species that were IT inoculated or had orally ingested the YF
17D vaccine virus. In contrast, all mosquitoes either IT inoculated
with, or orally fed, wild type and vaccine JE viruses became
infected, reaching maximum titers of 5.4-7.3 log.sub.10
pfu/mosquito. The growth of CHIMERIVAX-DEN2.TM. (chimeric
flavivirus vaccine comprising Dengue 2 prM and E proteins) in both
Ae. albopictus and Ae. aegypti mosquitoes inoculated by IT or oral
routes was also significantly lower than its parent wild type
dengue 2 and YF17D vaccine viruses.
[0221] These results showed that CHIMERIVAX-JE.TM. (chimeric
flavivirus vaccine comprising Japanese Encephalitis virus prM and E
proteins) and CHIMERIVAX-DEN2.TM. (chimeric flavivirus vaccine
comprising Dengue 2 prM and E proteins) viruses are restricted in
their abilities to infect and replicate in these mosquito vectors.
The low viremia caused by the viruses in primates and poor
infectivity for mosquitoes are safeguards against secondary spread
of the vaccine virus.
[0222] 3.0 Construction of CHIMERIVAX-DEN.TM. (Chimeric Flavivirus
Comprising Dengue 1 prMand E Proteins)
[0223] A yellow fever/dengue 1 (YF/DEN-1) chimeric virus was
constructed using a novel technology, which differs from the
approaches used to construct Yellow fever/Japanese encephalitis
(YF/JE) chimeric viruses as described by Chambers et al. (J. Virol.
73:3095-4101, 1999; see above), and the construction of YF/DEN-4
chimera (see below). We used the same two plasmid system used to
create YF/DEN-4. These plasmids first encoded the yellow fever (YF)
genome as created by Rice et al. (New Biol. 1:285-296, 1989).
Later, the structural membrane precursor and envelope protein
genes, i.e., the prME region, of the YF genome plasmids was
replaced with those of the JE SA14-14-2 sequence, and the resulting
plasmids were used to produce RNA in vitro, which was then
transfected into cells to produce live YF/JE chimeric virus.
Although the two-plasmid system was suitable for the construction
of JE, DEN-2, and DEN-4 chimeras in a YF backbone, the marked
instability of one of the plasmids created with DEN-1 sequences was
such that we opted for a PCR alternative to replace it.
[0224] Here we describe in detail the procedures for construction
of the YF/DEN-1 chimera (FIGS. 27 and 28). Dengue 1 (strain PUO359
isolated in 1980 in Thailand) was passed once in C6/36 and total
RNA was isolated. The dengue 1 prME region was first amplified and
sequenced using primers derived from consensus sequences (Genbank).
The sequence data created was applied to primer design and was
used, with the cDNA produced earlier, as a PCR starting point for
assembly of chimeric YF/DEN-1 virus. A dengue 1 PCR product
encoding prM and the 5' end of E was then used as a template, along
with template encoding the capsid (C) of yellow fever derived from
plasmid pYF5'3'IV/JE SA14-14-2, in an overlap extension PCR to
result in a single fusion product, which was then cloned into a
vector fragment of pYFM5'3'IV in which JE sequences were deleted.
In contrast to the construction of the YF/DEN-4 (see below) and
YF/JE SA14-14-2 (see above) plasmid systems, the 3' end of the
DEN-1 envelope was fused to the YF non-structural genes normally
present in the pYFM5.2/JE SA14-14-2 plasmid using an overlap
extension PCR similar to that used to construct the fusion of YF
capsid to the DEN-I prM and envelope gene 5' end. Next, the
pYD1-5'3' plasmid was transformed into E. coli strain MC1061
(RecA-) for amplification, followed by midi-scale plasmid
purification, while the DEN-1 Env/YF5.2 (Fragment H) was gel
purified. In vitro ligation of the plasmid to the PCR product
resulted in full-length virus cDNA template for RNA transcription.
All steps involving cDNA fragments, plasmids, and PCR products were
carried out in a BL-2 lab designated for recombinant DNA work.
Steps involving manipulations of infectious RNA and virus were
carried out in a limited access BL-2+ virus lab.
[0225] 3.1 Amplification of Dengue 1 Sequence
[0226] Dengue 1 cDNA was synthesized from RNA using the Superscript
II.TM. method. All primers for this experiment were synthesized by
Life Technologies and are listed in Table 31. Upon arrival as
lyophilized material, they were dissolved to 250 .mu.M stock
solutions using RODI-water. From this, 25 .mu.M working solutions
were made. The fragment encoding the SP6 promoter and the yellow
fever capsid (Fragment A) was amplified using XL-PCR Reaction Kit
.TM. (Perkin-Elmer Part#N808-0192), with 0.5 ill (250 ng) of
pYF5'3'IV plus 3.5 .mu.l RODI-water as template and primers 1 and 2
(see Table 31). The fragment encoding dengue 1 prM and 5' end of E
(Fragment B) was amplified using the XL-PCR Reaction Kit.TM.
(Perkin-Elmer Part#N808-0192) and primers 3 and 4. The fragment
encoding the 3' end of the Dengue 1 envelope gene (Fragment F) was
amplified using the same protocol, but with primers 5 and 7. The
fragment encompassing the YF portion of pYFM5.2 (Fragment G) was
amplified using the same protocol, but with primers 8 and 9 and 1
.mu.l of pYFM5.2/2 with 39 .mu.l water. The PCR for fragments F and
G required an annealing temperature of 50 C and an extension time
of 6.5 minutes. The PCR reaction was performed using the following
master mixes for each reaction.
1 Upper Mix (UM) 3.3 .times. buffer 18 .mu.l RTth 1.25 .mu.l
H.sub.2O 1 .mu.l Volume 20.25 .mu.l
[0227]
2 Lower Mix (LM) 3.3 .times. buffer 12 .mu.l 10 mM dNTPs 8 .mu.l 5'
primer 1 .mu.l 3' primer 1 .mu.l Mg(OAc).sub.2 4 .mu.l H.sub.2O 14
.mu.l Volume 40 .mu.l
[0228]
3 cDNA Mix H.sub.2O 36 .mu.l Dengue 1 cDNA 4 .mu.l Volume 40
.mu.l
[0229] The LM was added to a Perkin-Elmer thin-walled 0.2 ml tube.
Next, Ampliwax 100 (Perkin-Elmer) was added to the tube, which was
then placed in a Perkin-Elmer 2400 Thermal Cycler and heated to
80.degree. C. for 5 minutes, and then cooled to 4.degree. C. The
cDNA and UM were then added to the top of the wax layer. The tube
was then cycled in a Perkin-Elmer 2400 as follows: 94.degree. C., 1
minute; repeat 30.times. (94.degree. C., 15 seconds; 53.degree. C.,
15 seconds; 68.degree. C., 3 minutes), 72.degree. C., 4 minutes;
4.degree. C., hold. The expected sizes for the fragments are as
follows.
4 Fragment Approximate Size (kb) A 0.94 B 0.65 F 1.3 G 6.0
[0230] Forty .mu.l of each fragment was then separated on a 1%
Agarose/TAE gel and purified using the QIAquick Gel Extraction Kit
(Qiagen cat#28704). Next, the concentrations of the purified
fragments were determined by UV absorption using 1:40 dilutions in
RODI-water.
5 Sample A280 A260 280/260 260/280 Concentration Fragment A 0.0116
0.0260 0.4453 2.2457 52 ng/.mu.l Fragment B 0.0076 0.0202 0.3782
2.6440 40.4 ng/.mu.l Fragment F 0.0160 0.0335 0.4785 2.0898 67
ng/.mu.l Fragment G 0.0199 0.0380 0.5242 1.9076 76 ng/.mu.l
[0231] 3.2 Recombinant PCR
[0232] To create a fusion between the yellow fever capsid and DEN-1
prM, a recombinant PCR technique known as overlap-extension PCR was
used to create Fragment E. The same basic UM and LM were used, and
primers 1 and 4 replaced earlier primers. The same approach was
used to create a fusion between fragment F and G, resulting in
fragment H. For this, primers 5 and 9 were used. The cDNA mixes
were as follows:
6 Fragment B Fragment A Fragment E control control H.sub.2O 37.82
.mu.l 38.97 .mu.l 38.85 .mu.l Fragment A 1.15 .mu.l 0 .mu.l 1.15
.mu.l Fragment B 1.03 .mu.l 1.03 .mu.l 0 .mu.l Volume 40 .mu.l 40
.mu.l 40 .mu.l
[0233]
7 Fragment F Fragment G Fragment H control control H.sub.2O 38.9
.mu.l 39.7 .mu.l 39.2 .mu.l Fragment F 0.3 .mu.l 0.3 .mu.l 0 .mu.l
Fragment G 0.8 .mu.l 0 .mu.l 0.8 .mu.l Volume 40 .mu.l 40 .mu.l 40
.mu.l
[0234] The same protocol that was used for creation of fragments A,
B, F, and G was used, except that only 1/2 the cDNA, UM, and LM
were used for the control reactions. The tubes were cycled in a
Perkin-Elmer 2400 as follows: 94.degree. C., 1 minute; repeat
30.times. (94.degree. C., 15 seconds; 55.degree. C., 15 seconds;
68.degree. C., 2 minutes; 72.degree. C., 7 minutes; 4.degree. C.,
hold, for Fragment C and its controls. For Fragment H and its
controls, the annealing temperature was 50.degree. C. and the
extension time was 6.5 minutes. The expected sizes were as
follows:
8 Fragment Approximate Size (kb) E 1.59 H 7.3
[0235] Forty ill of Fragment E and 50 .mu.l of Fragment H was then
separated on a 1% Agarose/TAE gel and purified using the QIAquick
Gel Extraction Kit (Qiagen cat#28704). Next, the concentration of
the purified fragment was determined by UV absorption using 1:40
dilutions in RODI-water.
9 Sample A280 A260 280/260 260/280 Concentration Fragment E 0.0334
0.0516 0.6473 1.5449 103.2 ng/.mu.l Fragment H 0.0035 0.0068 0.5088
1.9655 13.6 ng/.mu.l
[0236] 3.3 Cloning of Fragment E into the Yellow Fever Vector
[0237] The capsid-prME fusion was cloned into the yellow fever
plasmid needed, and after digestion of the purified Fragment E, as
well as pYF5'3'IV, with the appropriate enzymes. The digested
plasmid resulted in two bands. Lower bands seen contain a fragment
of Japanese encephalitis virus equivalent to Fragment E. All
restriction enzymes, buffers, and 100.times. BSA were from New
England Biolabs. All the digestions were incubated in a
Perkin-Elmer 480 cycler set to hold at 37.degree. C. overnight.
10 Fragment E Digest Fragment E (600 ng) 5.8 .mu.l NEB Buffer 4 4
.mu.l 10 .times. BSA 4 .mu.l H.sub.2O 24.2 .mu.l Not I 1 .mu.l Nhe
I 1 .mu.l Volume 40 .mu.l
[0238]
11 pYFMIV5'3' Dig st pYFMIV5'3'(1.02 .mu.g) 2 .mu.l NEB Buffer 4 2
.mu.l 10 .times. BSA 2 .mu.l H.sub.2O 12 .mu.l Not I 1 .mu.l Nhe I
1 .mu.l Volume 20 .mu.l
[0239] 3.4 Vector Dephosphorylation
[0240] Calf Intestinal Phosphatase (CIP) from New England Biolabs
(cat#290S) was diluted 1:10 in 1.times. CIP Buffer. One .mu.l of
this dilution was then added to the pYFMIV5'3' digest, and
incubated for 1 hour at 37.degree. C. Then, 0.8 .mu.l 125 mM EDTA
was added to the tube, which was placed at 75.degree. C. for 10
minutes to deactivate CIP.
[0241] 3.5 Gel Excision
[0242] The digested fragment E and the digested plasmid were
separated on a 1.0% Agarose/TAE gel, and were purified using the
QIAquick Gel Extraction Kit (Qiagen cat#28704).
[0243] 3.6 Ligations
[0244] The digested Fragment E and pYF5'3'IV were ligated using T4
DNA Ligase (New England Biolabs cat#202S) to create pYD1-5'3'. All
ligation reactions were incubated in a Perkin-Elmer 480 cycler set
to hold at 16.degree. C. overnight.
12 PYD1-5'3' Ligation Fragment E (97.5 ng) 12.8 .mu.l pYFM5'3' (50
ng) 3.0 .mu.l H.sub.2O 1.2 .mu.l 10 .times. T4 ligase buffer 2
.mu.l T4 DNA ligase 1 .mu.l Volume 20 .mu.l
[0245]
13 pYFM-5'3' Control Ligation Fragment E (97.5 ng) 0 .mu.l pYFM5'3'
(50 ng) 3.0 .mu.l H.sub.2O 14 .mu.l 10 .times. T4 ligase buffer 2
.mu.l T4 DNA ligase 1 .mu.l Volume 20 .mu.l
[0246] 3.7 Transformations
[0247] Ligation reactions were individually transformed into E.
coli strain MC1061 (recA-). Briefly, an aliquot of MC1061 was
removed from storage at -80.degree. C. and allowed to thaw on ice
for one to two minutes. 0.9 ml of cold 0.1 M CaCl.sub.2 was added
to the cells. One hundred ill of cells was aliquoted into three 12
ml culture tubes on ice. Ten .mu.l of each ligation reaction was
added to each culture tube, leaving the third tube as a no DNA
control. Culture tubes were left on ice for 30 minutes. The tubes
were heat shocked in a water bath at 42.degree. C. for 45 seconds,
and then were put back on ice for 2 minutes. 0.9 ml SOC medium was
added to each culture tube and incubated at 225 pm in a shaking
incubator at 37.degree. C. for 1 hour. Each transformation mix was
aliquoted into 1.5 ml microcentrifuge tubes. One hundred .mu.l of
each mix was spread onto LB/Agar-Amp (100 .mu.g/ml) plates and
labeled as "neat." Each tube was spun at 14,000 rpm in a
microcentrifuge for 2-3 seconds to pellet the cells. The
supernatant was poured into the waste container and the pellet
resuspended in the residual broth by pipetting up and down. This
material was plated (approximately 100 .mu.l) onto LB/Agar-Amp (100
.mu.g/ml) plates and labeled as 10.times.. All plates were inverted
in a 37.degree. C. incubator overnight.
[0248] 3.8 Transformant Screening
[0249] Resulting bacterial colonies were patch-plated onto fresh
LB/Agar-Amp (100 .mu.g/ml) and placed inverted in a 37.degree. C.
incubator overnight. The following day, 50 .mu.l of RODI-water was
aliquoted into 0.5 ml tubes. Using a sterile plastic pick, a small
amount of each patch was scraped into one of the 0.5 ml tubes
containing water. These were then placed at 95.degree. C. for 10
minutes, and spun at 14,000 rpm for 10 minutes in a
microcentrifuge. To identify the proper insert in pYD1-5'3',
colonies were screened by PCR using Taq Polymerase (Promega) and
primers 4 and 10. The PCR reaction was performed using the
following master mix.
14 Component 4 rxs 10 rxns 15 rxns 20 rxns 25 rxns 30 rxns
RODI-water 161.5 .mu.l 355.5 .mu.l 516.8 .mu.l 678.3 .mu.l 839.8
.mu.l 1001.3 .mu.l H.sub.2O 25 .mu.l 55 .mu.l 80 .mu.l 105 .mu.l
130 .mu.l 155 .mu.l MgCl.sub.2 10 .mu.l 22 .mu.l 32 .mu.l 42 .mu.l
52 .mu.l 62 .mu.l P1 (100 .mu.M) 1 .mu.l 2.2 .mu.l 3.2 .mu.l 4.2
.mu.l 5.2 .mu.l 6.2 .mu.l P2 (100 .mu.M) 1 .mu.l 2.2 .mu.l 3.2
.mu.l 4.2 .mu.l 5.2 .mu.l 6.2 .mu.l dNTPs (10 mM) 40 .mu.l 88 .mu.l
128 .mu.l 168 .mu.l 208 .mu.l 248 .mu.l Taq polymerase 1.5 .mu.l
3.3 .mu.l 4.8 .mu.l 6.3 .mu.l 7.8 .mu.l 9.3 .mu.l
[0250] Forty eight .mu.l of each master mix was added to a 0.5 ml
tube along with 5 .mu.l of the template prepared from the colony
patches. Additionally, a tube using RODI-water as a template was
also made as a negative control. These tubes were then placed in
the Ericomp Delta Cycler and cycled as follows: 96.degree. C., 4
minutes; 30.times. (94.degree. C., 30 seconds; 50.degree. C., 1
minute; 72.degree. C., 1 minute 25 seconds), 72.degree. C., 4
minutes; 4.degree. C., Hold. The PCR products were then run on 1.5%
Agarose/TAE gels to check for positive colonies.
[0251] 3.9 Glycerol Stocks
[0252] One hundred twenty ml of LB-Amp (100 .mu.g/ml) was then
inoculated from a patch pYD1-5'3'/2 and shaken at 225 rpm overnight
at 37.degree. C. Two .times.1 ml of this culture was then spun at
14 Krpm for 2-3 seconds to pellet the cells. These were resuspended
in LB-Glycerol (30%) and frozen at -80.degree. C.
[0253] 3.10 MIDI Plasmid Preparation
[0254] Qiagen Midi-Prep was performed on the remaining culture
using the following modified protocol.
[0255] 1. Spin 150 ml of each culture at 7 Krpm in GSA rotor for 10
minutes to pellet.
[0256] 2. Decant Supernatant
[0257] 3. Resuspend pellet in 4 ml P1 buffer; Transfer to 50 ml
Falcon tube.
[0258] 4. Rinse centrifuge bottle with 1 ml P1 buffer and transfer
to the Falcon tube.
[0259] 5. Add 5 ml P2 buffer; invert gently; incubate 5 minutes at
room temperature or until lysed (no more than 12 minutes).
[0260] 6. Add 5 ml P3 buffer; mix as above; incubate 10 minutes on
ice.
[0261] 7. Transfer supernatant to Qiagen Syringe Filter; Let sit
for 10 minutes.
[0262] 8. Equilibrate Q-100 tip with 4 ml QBT.
[0263] 9. Gently push plunger to filter supernatant onto Q-100
tip.
[0264] 10. Allow to drain by gravity.
[0265] 11. Wash with 10 ml 2.times. QC.
[0266] 12. Elute into 50 ml polypropylene centrifuge tube with 5 ml
QF.
[0267] 13. Add 14 ml 100% EtOH (or 8 ml isopropanol); Place in dry
ice/ethanol bath for 10 minutes (or at -20.degree. C. for 2 hours
or at 4.degree. C. overnight).
[0268] 14. Spin at 15 K.times.G for 30 minutes at 4.degree. C.
[0269] 15. Wash with 5 ml 70% ethanol; Spin 15 K.times.G for 20
minutes.
[0270] 16. Air Dry.
[0271] 17. Resuspend in 150 .mu.l EB.
[0272] DNA concentration was measured as before.
15 Sample A280 A260 280/260 260/280 Concentration pYD1-5'3'/2
0.1708 0.3010 0.5675 1.7621 602 .mu.g/ml
[0273] 3.11 In Vitro Ligation to Create Full-length cDNA Chimeric
Template and RNA Production Digestion with AatII and BstBI
[0274] The plasmid and fragment H were then digested with Aat II
and BstB I (NEB) in a sequential digest as follows.
16 pYD1-5'3'/2 (AatII digest) pYD1-5'3'/2 (10 .mu.g) 16.6 .mu.l
Buffer 4 (NEB) 5 .mu.l Aat II (NEB) 4 .mu.l H.sub.2O 24.4 .mu.l
Volume 50 .mu.l
[0275]
17 Fragment H (AatII digest) Fragment H (0.7 .mu.g) 51.0 .mu.l
Buffer 6 (NEB) 5 .mu.l Aat II (NEB) 3 .mu.l H.sub.2O 0 .mu.l Volume
60 .mu.l
[0276] Both reactions were incubated in a 37.degree. C. block
overnight. Five ill of each digestion was run out on a 1.5%
Agarose/TAE gel to check for complete digestion. The digestion was
then incubated at 65.degree. C. for 20 minutes to inactivate the
enzyme. 2.5 .mu.l Bst BI (NEB) was added to each reaction and
placed at 65.degree. C. overnight. The expected results of the
digest are as follows:
18 pYD1-5'3'/2 Fragment H 5.6 kb 7.2 kb 0.14 kb 0.1 kb
[0277] The largest band from each reaction was gel excised and the
UV concentration was determined (as previously described).
19 Sample A280 A260 280/260 260/280 Concentration pYD1-5.2 0.0089
0.0154 0.5777 1.7309 30.8 ng/.mu.l fragment Fragment H 0.0020
0.0018 1.1333 0.8824 3.6 ng/.mu.l
[0278] There was not enough fragment H for the ligation. Another 50
.mu.l of fragment H was cleaned over a Qiagen Qiaquick column and
digested with Aat II and Bst BI as described previously. The
digested fragment was then gel excised as before and the Uv
concentration determined.
20 Sample A280 A260 280/260 260/280 Concentration Fragment H 0.0000
0.0021 0.0000 NA 4.2 ng/.mu.l
[0279] 3.12 Precipitation of Fragments
[0280] The following was prepared in a 1.5 ml tube.
21 pYD1-5'3'/2 9.7 .mu.l fragment (298 ng) Fragment H (3.6
ng/.mu.l) 38 .mu.l Fragment H (4.2 ng/.mu.l) 32 .mu.l Water 20.3
.mu.l Volume 100 .mu.l
[0281] The fragments were then ethanol precipitated and resuspended
in 43.5 .mu.l water to facilitate the ligation reaction.
[0282] 3.13 Ligation
[0283] The following ligation reaction was setup using high
concentration T4 DNA ligase (NEB). The ligations were incubated at
16.degree. C. overnight.
22 Precipitated fragments 43.5 .mu.l 100 .times. BSA (NEB) 0.5
.mu.l T4 DNA ligase buffer (NEB) 5 .mu.l *T4 DNA ligase 1 .mu.l
Volume 50 .mu.l *heat reaction at 37.degree. C. for 5 minutes, then
briefly chill on ice before adding ligase
[0284] 3.14 Linearization of Template
[0285] The ligation was heat inactivated at 65.degree. C. for 10
minutes. The ligated material was then linearized at the 3' end of
the Yellow Fever sequence to allow proper RNA transcription. 5.5
.mu.l of Buffer 2 (NEB) was added to the ligation, followed by 1.5
.mu.l XhoI (NEB), and then the reaction was put at 37.degree. C.
for 2 hours.
[0286] 3.15 Linear cDNA Extraction (RNAse Free Phase)
[0287] 1. Add H.sub.2O to 100 .mu.l total volume.
[0288] 2. Add {fraction (1/10)}.sup.th volume 3 M Sodium
Acetate
[0289] 3. Add 100 .mu.l Phenol/Chloroform/Isoamyl Alcohol and spin
at 14 Krpm for 5 minutes in a microcentrifuge. Extract upper layer
into RNAse-free 1.5 ml tube. Repeat once.
[0290] 4. Add 100 .mu.l RNAse-free Chloroform. Spin at 14 Krpm for
5 minutes in a microcentrifuge. Extract upper layer into RNAse-free
1.5 ml tube. Repeat once.
[0291] 5. Add 200 .mu.l 100% RNAse-free ethanol.
[0292] 6. Place on dry-ice/ethanol bath for 10 minutes.
[0293] 7. Spin at 14 Krpm for 20 minutes in a microcentrifuge.
[0294] 8. Wash with 200 .mu.l 70% ethanol (RNAse-free).
[0295] 9. Repeat 70% ethanol wash two more times.
[0296] 10. Dry in Speed-Vac for 8 minutes (or until no more ethanol
is present).
[0297] 11. Resuspend in 22 .mu.l nuclease free water from the SP6
kit listed below.
[0298] 3.16 SP6 Transcription
[0299] The following reaction was setup using the SP6 transcriptase
kit (Epicentre) and Rnasin (Promega) in an RNAse-free 1.5 ml tube
using RNAse-free tips in a BL-2 hood. The reaction was then placed
in a 40.degree. C. water bath for 1 hour.
23 Capping NTP solution 6 .mu.l 10 .times. buffer 2 .mu.l 20 mM Cap
Analog 3 .mu.l 100 mM DTT 2 .mu.l Linearized DNA 5 .mu.l Rnasin 0.5
.mu.l SP6 transcriptase 2 .mu.l Volume 20.5 .mu.l
[0300] 3.17 Transfection with RNA
[0301] Three six well tissue culture plates were seeded with
Vero-PM cells (p#162 from Cell Culture Facility) (2 plates at
1.times.10.sup.6 cells/well and 1 plate at 2.times.10.sup.6
cells/well) in growth media (Minimum Essential Media, Sodium
Pyruvate, Non-Essential Amino Acids, Penicillin/Streptomycin, and
5% Fetal Bovine Serum) and placed in a 37.degree. C. CO.sub.2
incubator until confluent.
[0302] The following transfection reactions were made using
Lipofectin (Life Technologies) and RNAse-free PBS (Sigma).
24 YF/DEN-1 PBS 250 .mu.l Lipofectin 20 .mu.l YF/DEN-1 RNA 10 .mu.l
Volume 280 .mu.l
[0303]
25 Total RNA control PBS 250 .mu.l Lipofectin 20 .mu.l YF/JE total
RNA 10 .mu.l Volume 280 .mu.l
[0304]
26 Lipofectin control PBS 260 .mu.l Lipofectin 20 .mu.l Volume 280
.mu.l
[0305] 1. Allow reactions to sit at room temperature for 10
minutes, and then remove Media from the six well plates.
[0306] 2. Wash 3 times with PBS.
[0307] 3. Remove last of PBS.
[0308] 4. Overlay with each lipofectin reaction (add the YF/DEN-1
RNA to the 2.times.10.sup.6 cells/well plate). Add 280 .mu.l media
to the remaining wells.
[0309] 5. Rock for 10 minutes at room temperature.
[0310] 6. Wash 2 times with media.
[0311] 7. Add 2 ml of media to each well and place in the
37.degree. C. CO.sub.2 incubator for 4 days or more.
[0312] 3.18 Harvest of the First Vero-PM Passage (P1)
[0313] The supernatant from YF/DEN-1 was harvested on day 6 by
splitting the 2 ml of supernatant between two cryovials (each
containing 1 ml FBS) that were labeled YF/DEN-1 (PCR) (P1). The
cell monolayer was harvested with 1 ml Trizol into a 1.5 ml tube.
All vials and tubes were then placed at -80.degree. C.
[0314] 3.19 Amplification of YF/DEN-1
[0315] Vero-PM Passage #2
[0316] 1. Three T-25 flasks containing Vero-PM cells (p#166) were
obtained from the Cell Culture Facility. A frozen aliquot of
YF/DEN-1 (PCR) (P1) was removed from the -80.degree. C. freezer,
thawed, and then placed on ice. The same was done for an aliquot of
YF/JE (frozen stock from the P1 control transfection) to be used as
a control.
[0317] 2. Media was removed from each T-25 flask.
[0318] 3. One ml of YF/DEN-1 (PCR) (P1) was added to the first
flask, 1 ml of media only (the same as was used in the
transfection) was added to the second flask, and 1 ml of YF/JE(P1)
was added to the third flask.
[0319] 4. Each flask was then put in the 37.degree. C., 5% CO.sub.2
incubator for 1 hour with rocking every 10 minutes.
[0320] 5. Four ml of media was then added to each flask.
[0321] 6. The flasks were then placed in the 37.degree. C., 5%
CO.sub.2 incubator for 4 days.
[0322] Harvest P2 and Passage #3
[0323] 1. The supernatant from YF/DEN-1 flask was harvested on day
7.
[0324] 2. Five hundred ml of YF/DEN-1 (P2) was harvested and
subsequently overlayed onto a T-25 flask containing Vero-PM cells
(p##168 from the Cell Culture Facility).
[0325] 3. Five hundred ml of media (same as used for transfection)
was added to the monolayer.
[0326] 4. One ml of media only was added to a control flask.
[0327] 5. The flasks were placed in a 37.degree. C. CO.sub.2
incubator and rocked every 15 minutes for 1 hour.
[0328] 6. Meanwhile, the remaining YF/DEN-1 (P2) was harvested into
4 cryovials containing 1 ml FBS and 1 cryovial containing 0.5 ml
FBS and labeled as YF/DEN-1 (P2). The cell monolayer was harvested
with 3 ml Trizol into 1.5 ml tubes. All vials were placed at
-80.degree. C. in a box labeled YF/DEN-1.
[0329] 7. After infection (Step 5), 4 ml of media was added to each
flask and were transferred to the incubator for 4 or more days.
[0330] Harvest of P3
[0331] The supernatant from YF/DEN-(P3) was harvested on day 5 by
splitting the 5 ml of supernatant between five cryovials (each
containing 1 ml FBS), which were labeled YF/DEN-1 (P3). The cell
monolayer was harvested with 3 ml Trizol into 1.5 ml tubes. All
vials and tubes were then placed at -80.degree. C.
[0332] 3.20 Virus Identification
[0333] The RNA from P3 was extracted using Trizol methods according
to the manufacturer's protocol, RT-PCR was performed followed by
sequencing of the YF/DEN-1 prME region 5', 3' junctions, inclusive.
The expected sequence of the prME region was confirmed.
[0334] 4.0 Construction of CHIMERIVAX-DEN3 .TM. (Chimeric
Flavivirus Comprising Dengue 3 Virus and preM and E Proteins)
[0335] A viable yellow fever/dengue type 3 chimera (YF/DEN3) was
constructed that contains the pre-membrane (prM) and envelope (E)
genes of dengue type 3 virus (DEN3) replacing the corresponding
prM-E region of the genome of the attenuated 17D yellow fever virus
(YF). Virion RNA of wild-type DEN3 (strain PaH881/88) was used as a
template to synthesize by RT-PCR two cDNA fragments that cover the
DEN3 prM-E region. These fragments were cloned and sequenced. A
modified protocol was used to prepare infectious YF/DEN3 in vitro
RNA transcripts in which three appropriate DNA fragments were
ligated in vitro followed by linearization with XhoI and in vitro
transcription with SP6 RNA polymerase (standard ChimeriVax protocol
employs two-fragment ligation). Following transfection of Vero PM
cells with the RNA transcripts, virus-specific CPE was detectable
as early as on day 5 post-transfection (and on day 3 post-infection
in subsequent passages). The presence of the chimeric virus in the
post-transfection (postinfection) media and the DEN3-specificity of
its prM-E region were confirmed by RT-PCR and sequencing.
[0336] These results demonstrate that a chimeric YF virus
containing DEN3-specific envelope is readily recoverable. The
obtained YF/DEN3 chimera is a candidate part of our proposed
tetravalent vaccine directed against all four dengue virus
serotypes (dengue types 1-4).
[0337] The purpose of these experiments was to determine whether it
is possible to create a viable YF/DEN3 chimera containing
DEN3-specific envelope. At the same time, the proposed chimera was
designed to contain the prM-E region from a pathogenic wild type
strain of DEN3 (a prerequisite for high immunogenicity) in a
backbone of the 17D vaccine strain of YF that includes the 5' and
3' UTRs, the C gene, and the nonstructural protein genes, NS1-5, (a
prerequisite for safety).
[0338] To engineer a YF/DEN3 chimera containing the prM-E cassette
from DEN3 in place of the prM-E cassette of YF we first wanted to
use the two-plasmid approach that was successful in previous
studies where 17D YF virus (Rice et al., New Biol. 1:285-296, 1989)
and the YF/JE chimera (Chambers et al., J. Virol. 73:3095-3101,
1999) were recovered following in vitro transcription and
transfection. The DEN3 (strain PaH881/88) prM-E region was RT-PCR
amplified in two adjacent fragments (FIG. 29). To determine
consensus sequence of this region of the parental virus, the RT-PCT
fragments were directly sequenced in both directions. Since
oligonucleotide primers used to synthesize these fragments were
designed based on the published sequence of the H87 reference
strain of DEN3 (Osatomi et al., Virology 176:643-647, 1990), actual
viral sequences in the primer areas (at the beginning of prM,
nucleotides 437-459; at the junction between the two fragments,
nucleotides 1079-1131; and at the end of E, nucleotides 2385-2413)
could not be determined. A total of 83 nucleotides changes were
found compared to H87 strain. The rate of nucleotides differences,
4.44%, was similar to that (4.5%) reported previously by Delenda et
al. (J. Gen. Virol. 75:1569-1578, 1994) who sequenced roughly 80%
of PaH881/88 E gene. Although the majority of nucleotides
differences in the 80% E area coincided with those found by Delenda
et al. (V. Deubel, personal communication) (53 changes coincided),
there were 4 additional changes that were not found by Delenda et
al. In addition, we did not observe 3 of the changes reported by
these authors. The PaH881/88 virus (a starting material in our
experiments) was isolated from a patient by single amplification in
mosquito AP61 cells. We propagated this virus in C6/36, another
mosquito cell line. Sequences of both our P1 and P3 viruses were
found to be identical indicating that there was no selective
pressure on the virus in C6/36 cells. Therefore, it is more likely
that the few discrepancies were due to sequencing mistakes in
(Delenda et al., J. Gen. Virol. 75:1569-1578, 1994). They resulted
in three discrepancies in the amino acid sequence of the
corresponding region of E protein (C-terminally truncated E;
compare Table 32 below with Table 1 in Delenda et al., J. Gen.
Virol. 75:1569-1578, 1994). A complete list of amino acid
differences we found in the prM-E region between the H87 and
PaH881/88 strains is given in Table 33 (a total of 12 changes).
[0339] The RT-PCR fragments were used to replace corresponding
JE-specific sequences in YFM5'3'IV JE SA14-14-2 and YFM5.2 JE
SA14-14-2 plasmids, which resulted in 5'3'/Den3 and 5.2/Den3
plasmids (FIG. 30). Inserts of both plasmids were sequenced. Since
an extra XhoI site was found in the DEN3-specific region of
5'3'/Den3, the site was ablated by silent mutagenesis that resulted
in 5'3'/Den3/DXho plasmid. The insert of this plasmid was also
sequenced to ensure the absence of mutations introduced by PCR.
[0340] Difficulties were encountered in obtaining high quality
5.2/Den3 plasmid without mutations within its DEN3-specific region.
Different growth conditions of plasmid-containing cultures and
modifications in the extraction protocol (e.g., reduction of alkali
concentration in the lysis buffer), as well as growth of the
plasmid in different E. coli strains were examined to overcome
these difficulties. Finally, a clone of the plasmid (#26) was
selected (propagated in ABLE C cells) that was of high quality and
contained no nucleotide changes except for a single one nucleotide
deletion at the 3' end of the DEN3 insert which could be easily
eliminated by PCR (other sequenced clones contained more
mutations). Therefore, the standard ChimeriVax procedure for
preparation of infectious in vitro RNA transcripts that employs two
fragment ligation prior to in vitro transcription was modified.
According to the standard protocol, the large BstBI-AatII fragment
from 5.2/Den3 would be ligated with the large BstBI-AatII fragment
of 5'3'/Den3/DXho (see in FIG. 30). Instead, to correct the
deletion, three-fragment ligation was done (FIG. 30). The DEN-3
part of 5.2/Den3 was PCR-amplified on the #26 clone template with
high-fidelity LA Taq polymerase and digested with BstBI and EheI
(isoschizomer of Narn). The opposite PCR primer was expected to
correct the deletion. Second fragment, corresponding to the
NarI-AatII part of 5.2/Den3, was derived by digestion of YFM5.2
JESA14-14-2 with Ehel and AatII. The two fragments were ligated
with the large BstBI-AatII fragment of 5'3'/Den3/Xho. Ligation
products were digested with XhoI and transcribed in vitro with SP6
RNA polymerase.
[0341] Vero PM cells (at passage 149) grown in 6 well plates were
transfected with the in vitro RNA transcripts. A first indication
that the expected YF/DEN3 chimera was present was the appearance of
CPE characteristic of other chimeras created to date based on the
YF backbone. It was first noticeable on day 5 post-transfection and
became apparent (.about.10% of detached and rounded cells) on day 7
when virus-containing medium was harvested (P1). Subsequent P2 and
P3 viruses were obtained by infecting fresh monolayers of Vero PM
cells (at passages 150 and 151, respectively) with the P1 and P2
viruses (1 and 0.5 ml of the viruses were used for each infection,
respectively) and harvesting the virus when apparent CPE
(.about.10%) was observable (on days 3 and 4 for P2, and day 3 for
P3).
[0342] The presence and DEN3-specificity of the YF/DEN3 chimera was
confirmed by RT-PCR with YF- and/or DEN3-specific primers using P1
and P2 virion and intracellular RNAs as templates. All these
reactions yielded specific RT-PCR products of expected sizes. As
was expected, when DEN3-specific primers were used for RT-PCR on a
control YF/JE RNA template, no product was recovered. The entire
prM-E region of the P2 virus was sequenced. This also confirmed
that the chimera contained the DEN3 envelope glycoprotein genes. In
addition to the silent mutation introduced to ablate the XhoI site
in the E gene, only one more silent nucleotide change was detected
in the virus (A G at nucleotide 2341 in the chimeric genome that
corresponds to nucleotide 2296 in the parental DEN3). Since one of
the DNA fragments used in the three-fragment ligation was
synthesized by PCR (albeit on a plasmid template with known
sequence), it is possible that the P1-3 viruses described here
contain minor subpopulations with mutations introduced by PCR. To
ensure homogeneity, these viruses can be plaque-purified and then
sequenced. In addition, we are currently developing alternative
cloning techniques that, if necessary, will allow recreation of the
YF/DEN3 genome without using the intermediate PCR step. For
instance, the DEN3-specific BstBI-NarI fragment of 5.2/Den3 plasmid
was recently cloned without any mutations in low-copy number
vectors (pCL and pACYC series). This fragment can be excised from
the new plasmids and used instead of the PCR fragment in the
three-fragment ligation to regenerate the chimera.
[0343] In conclusion, the prM-E region of the PaH881/88 DEN3 was
sequenced and cloned. We demonstrate that a recombinant flavivirus
genome (e.g., YF/DEN3 in this study) can be reconstituted in vitro
by using three-fragment ligation (instead of two-fragment ligation
used previously to create other YF chimeras). This approach can be
helpful in overcoming technical difficulties that are often
encountered during cloning of genetic material from many
flaviviruses in E. coli (especially dengue viruses). A viable 17D
YF/DEN3 chimeric virus was recovered which is yet another
successful example of the usefulness of the approach developed by
Chambers et al. (J. Virol. 73:3095-3101, 1999; see above), in which
the prM-E cassette of a heterologous flavivirus is inserted into
the YF backbone such that the hydrophobic signal for prM remains
YF-specific.
[0344] The materials and methods used to make and characterize the
YF/DEN3 chimera are described as follows.
[0345] 4.1 Virus and Cells
[0346] DEN3 strain PaH881/88 was isolated from a patient by single
amplification in AP61 (mosquito) cells. C6/36 cells were maintained
in MEM (Gibco, Cat. # 11095-072) supplemented with 10% FBS
(HyClone, Cat. # SH30070103) and 1.times. non-essential amino acids
(Sigma, Cat. # M7145) (OraVax ML-8 medium, Lot # 108H2308) at
28.degree. C. under 5% CO.sub.2. DEN3 was passaged two times by
infecting monolayers of C6/36 at an unknown MOI and harvesting
virus-containing growth media on day 7 post-infection (P1 and P2)
and one time by infecting C6/36 cells with the P2 virus at an MOI
of .about.0.01 pfu/cell and harvesting the medium on day 6 (P3;
pronounced virus-specific CPE was observed in P3). Virus-containing
media were mixed with an equal volume of FBS, aliquoted and stored
at 70.degree. C. Following transfection/infection, Vero PM cells
were maintained in MEM (Gibco, Cat. # 11095-080, Lot # 1017611)
supplemented with 5% heat-deactivated FBS (OraVax Lot # AGE6578)
and penicillin/streptomycin (100 U/0.1 mg per ml; Sigma, Cat. #
P-0781, Lot # 78H2386) at 37.degree. C. under 5% CO.sub.2.
[0347] 4.2 RNA Extraction
[0348] DEN3 virion RNA was extracted from 0.5 ml of clarified P3
virus-containing medium using TR1 Reagent-LS (Molecular Research
Center, Inc., Cat. # TS-120) according to the manufacturer's
procedure and redissolved in 10 .mu.l H.sub.2O. Alternatively,
(e.g., to confirm the presence of YF/DEN3 chimera), intracellular
RNA from infected cells was extracted using TRI Reagent (Molecular
Research Center, Cat. # TR-118).
[0349] 4.4 Reverse Transcription, PCR, and Sequencing
[0350] First strand cDNA syntheses were done in a total volume of
20 .mu.l using 2.5 .mu.l of DEN3 virion RNA as a template,
indicated oligonucleotide primers (see below) and SuperScript II
reverse transcriptase (Gibco, Cat. # 18064-014) according to the
manufacturer's procedure. Prior to PCR, RT products were treated
with RNAse H (Promega). High-fidelity PCR on RT products or
indicated plasmid DNAs as templates was done using the GeneAmp XL
PCR kit (Perkin Elmer, Cat. # N808-0192), or the TaKaRa LA Taq
polymerase kit (PanVera, Cat. # TAK RR002M) according to the
protocols provided by the kit manufacturers with a GeneAmp 2400
thermocycler (Perkin Elmer). Sequencing of indicated PCR products
or plasmid DNAs was done using the ABI Prism dRhodamine Terminator
Cycle Sequencing kit (Perkin Elmer, Cat. # 403042). Sequencing
reaction products were resolved with ABI Prism 310 automated
sequencer (Perkin Elmer). Data were analyzed using Sequencher 3.0
software and stored on the Internet
(ORAVAX/VOLTEMP/GROUPS/LABTECH/KOSTIA/folder "KP sequencing
data"/Exp.##). With each area of interest, both DNA strands were
sequenced and analyzed. Oligonucleotide primers are listed in Table
32.
[0351] Primers were ordered from Custom Primers (Life
Technologies/GibcoBRL). In the names of primers, numbers indicate
approximate localization of oligos on the DEN3 genome and "+/-"
indicates orientation of each primer, with the following
exceptions: oligo 5 is colinear with a region of YFM5'3' series of
plasmids upstream from the NotI cloning site; oligos 6 (opposite)
and 7 (direct) are YF-specific; the former corresponds to the end
of YF C gene; oligos 15 (direct) and 16 (opposite) were designed
for amplification and sequencing of inserts in the YFM5.2 series of
plasmids and correspond to regions of the plasmids located within
.about.60 nucleotides upstream and downstream from the
corresponding inserts, respectively; oligo 8 (direct) was used to
mutate the XhoI site at nucleotide 1052 of the recombinant YF/DEN3
genome (within 5'3'/Den3 plasmid); and oligo 17 is colinear with
the SP6 promoter and a few of the 5' terminal nucleotides from
YF.
[0352] 4.3 DNA Manipulations
[0353] Standard molecular biology techniques were in accordance
with Maniatis et al., Molecular Cloning: a Laboratory Manual,
2.sup.nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1992. All restriction enzymes, except for Ehel
(Fermentas) and T4 DNA ligase, were from New England Biolabs.
[0354] 4.4 Construction of 5'3'/Den3/DXho plasmid
[0355] The 5' terminal part of the DEN3 prM-E region was
synthesized on purified virion RNA of the P3 virus by
RT-high-fidelity PCR (XL PCR) using oligonucleotide primers 1 and
2. It starts precisely at the beginning of the coding region for
prM protein (at nucleotide 437; DEN3 nucleotide numbering is
according to the sequence of H87 reference strain (Osatomi et al.,
Virology 176:643-647, 1990)) that is generated by signalase and
ends at nucleotide 1106 and thus contains the entire prM and
approximately one-seventh of the E gene. In addition to DEN3
sequences, the resulting RT-PCR product contains the last 23
nucleotides of the YF C gene for subsequent overlapping PCR (at its
5' end). The last six nucleotides of DEN3 sequence (nucleotides
1101-1106) are changed to a BstBI site by introduction of three
silent nucleotide changes for subsequent in vitro ligation, which
is followed by a NheI site for cloning.
[0356] To combine the RT-PCR product with the upstream YF-specific
sequences, a fragment of YFM5'3'IV JE SA14-14-2 plasmid (an analog
of 5'3'/Den3 plasmid used to generate a similar YF/JE chimera
(Chambers et al., J. Virol. 73:3095-3101, 1999; see above))
containing SP6 RNA polymerase promoter followed by the 17D YF 5'
UTR and C gene (first 481 nucleotides of YF genome) was amplified
by XL PCR with oligos 5 and 6. For overlapping PCR, the resulting
DNA fragment was mixed with the RT-PCR product and XL PCR amplified
with oligos 2 and 5. Consensus sequence of the dengue type 3 region
was determined by sequencing the RT-PCR and the overlapping PCR
products in both directions using oligos 1, 2, 5, 7, 9, and 10.
[0357] The overlapping PCR product was used to replace the short
NotI-NheI fragment in YFM5'3'IV JE SA14-14-2. The replaced region
of the resulting 5'3'/Den3, which is a pBR322-based plasmid
maintained in E. coli MC1061 RecA- cells, was sequenced using
oligos 1, 2, 9, 10, and 17, and a correct clone (#3) was selected,
which does not have any mutations compared to the consensus
sequence.
[0358] Sequencing revealed that the DEN3-specific portion of
5'3'/Den3 contains an additional XhoI site located in the beginning
of E gene (nucleotides 1007-1012 in DEN3 genome). Another XhoI site
used for linearization prior to in vitro transcription (see below)
is located at the end of YF sequence in 5'3'/Den3. The additional
site was destroyed by silent oligonucleotide-directed mutagenesis
(LA PCR; DEN3-specific C at nucleotide 1009 was changed to G) using
oligo 8, resulting in a plasmid 5'3'/Den3/DXho. The entire region
of the plasmid replaced during mutagenesis was sequenced with
oligos 1, 2, 9, 10, and 17 and a clone (#10) was selected that does
not have any mutations, except for the desired C to G nucleotide
change.
[0359] 4.5 Construction of 5.2/Den3 Plasmid
[0360] The 3' terminal part of DEN3 prM-E region was RT-PCR
amplified (XL PCR) on the P3 virion RNA template using primers 3
and 4. It starts with BstBI site introduced at nucleotides
1101-1106 for in-frame ligation with 5'3'/Den3/DXho plasmid and
ends with a Narn site introduced precisely at the 3' end of E gene
(nucleotides 2408-2413) for in-frame ligation with YF NS1. The Narn
site that leads to Q to G change of the penultimate amino acid
residue in the DEN3 E was used previously to generate YF/JE chimera
(Chambers et al., J. Virol. 73:3095-3101, 1999; see above). An NheI
cloning site was placed upstream from the BstBI site. The consensus
sequence of this DEN3 region was determined by sequencing of the
RT-PCR product in both orientations using oligos 3, 4, 11, 12, 13,
and 14.
[0361] The PCR product was cloned in place of the short NheI-NarI
fragment in YFM5.2 JE SA14-14-2 plasmid (Chambers et al., J. Virol.
73:3095-3101, 1999; see above), resulting in the 5.2/Den3 plasmid.
Originally it was propagated in E. coli MC1061 RecA- cells, and the
DNA extracted from these cells was of poor quality (partially
denatured), which hindered restriction digestions. Subsequently,
several of the extracted plasmid clones were propagated in E. coli
ABLE C cells (Stratagene), and good quality DNAs were recovered.
Six of these clones were thoroughly analyzed by restriction
analysis and then sequenced. For sequencing, the DEN3-specific
insert with adjacent regions of the vector was PCR amplified using
oligos 15 and 16, and the product was sequenced in both
orientations with oligos 11, 12, 13, 14, 15, and 16. Clone #26 was
chosen for subsequent manipulations. It contains no mutations,
compared to the consensus sequence, except for a single nucleotide
deletion (nucleotide 2407, in the region of the opposite PCR primer
4).
[0362] 4.6 In vitro Transcription and Transfection
[0363] These techniques were essentially as described by Rice et
al. (New Biol. 1:285-296, 1989). Approximately 1 .mu.g total of
equimolar amounts of appropriate gel-purified DNA fragments were
ligated overnight in 20 .mu.l volume at 40.degree. C. T4 DNA ligase
was heat-inactivated (10 minutes, 65.degree. C.). Ligation products
were digested with XhoI to provide run-off transcription,
phenol-chloroform extracted, and precipitated with ethanol. The
resulting DNA was transcribed in vitro with SP6 RNA polymerase in
the presence of m7G(5')ppp(5')G cap analog and Rnasin in a 20 .mu.l
reaction (AmpliScribe SP6 Kit With Cap Analog; Epicentre
Technologies; Cat. # AS2606C2). RNA transcripts were analyzed by
electrophoresis of 2 .mu.l aliquots in 1% agarose gel. Monolayers
of Vero PM cells grown in 6 well tissue culture plates were
transfected with RNA transcripts using Lipofectin reagent (Gibco,
Cat. # 18292-011). Following transfections, cells were incubated as
is described above, and virus-containing media were harvested on
indicated days post-transfection, mixed with equal volume of FBS,
aliquoted and stored at -70.degree. C.
[0364] 5.0 Construction of CHIMERIVAX-DEN4.TM. (Chimeric Flavivirus
comprising Dengue 4 virus prM and Eproteins)
[0365] The purpose was to generate yellow fever/dengue 4 (YF/DEN-4)
chimeric virus as a dengue vaccine candidate (see FIGS. 31 and 32).
To attain this, we used a technology derived from the construction
of Yellow fever/Japanese encephalitis (YF/JE SA14-14-2) chimeric
virus (Chambers et al., J. Virol. 73:3095-3101, 1999). It consists
of a two plasmid system which originally encoded the yellow fever
(YF) genome. These YF plasmids were created by Charlie Rice (Rice
et al., New Biol. 1:285-296, 1989). The structural membrane
precursor and envelope protein genes, i.e., the prME portion, of
the YF genome plasmids with that of JE SA14-14-2 sequence and used
the resulting plasmids to produce RNA in vitro, which was then
transfected into cells to produce live YF/JE chimeric virus. The
system seemed suitable to construct other flavivirus chimeras using
YF as backbone and here we describe the use of dengue 4 as a start
point. The dengue 4 strain, #1228 isolated in 1978 in Indonesia and
passaged twice in mosquitoes, was passed once in C6/36 and total
RNA was isolated to synthesize cDNA for PCR of the prME region as
needed for cloning. Here we describe in detail the procedures for
construction of the YF/DEN-4 chimera. The dengue 4 prME region was
first amplified and sequenced using primers derived from consensus
sequences (Genbank). The sequence data created was applied to
primer design which were used, with the cDNA produced earlier, as
PCR starting point for assembly of the two-plasmid system for
dengue 4 (i.e., by replacing the corresponding prME JE sequences in
each plasmid). A PCR product encoding dengue prM and 5' end of E
was used as template, along with template encoding the capsid (C)
gene of yellow fever derived from the plasmid pYF5'3'IV/JE
SA14-14-2, in an overlap extension PCR to result in a single fusion
product which was then cloned into a fragment of pYFM5'3'IV where
JE sequences were deleted. The 3' end of dengue 4 envelope protein
gene was also amplified and then cloned into a vector fragment of
pYFM5.2/JE SA14-14-2, resulting in replacement of JE sequence with
that of dengue 4. Both plasmids were then transformed into E. coli
strain MC1061 (RecA-) and midi-scale plasmid cultures were grown.
In vitro ligation of the two plasmids resulted in full-length virus
DNA template of YF/DEN-4 for RNA transcription. All steps involving
cDNA fragments and plasmids were carried out in a BL-2 lab
designated for recombinant DNA work. Steps involving manipulations
of infectious RNA and virus were carried out in a limited access
BL-2+virus lab.
[0366] 5.1 Amplification of Dengue 4 Sequence
[0367] Dengue 4 cDNA was synthesized from RNA using the Superscript
II.TM. method. All primers for this experiment were synthesized by
Life Technologies and are listed in Table 34. Upon arrival as
lyophilized material, primers were dissolved to 250 mM stock
solutions in RODI-water. From this, 25 mM working solutions were
made. The fragment encoding the SP6 promoter and yellow fever
capsid (Fragment A) was amplified using the XL-PCR Reaction Kit
.TM. (Perkin-Elmer Part # N808-0192), 0.5 ml (250 ng) of template
pYF5'3'IV plus 3.5 ml RODI-water, and primers 1 and 2. The fragment
encoding dengue 4 prM and the 5' end of E (Fragment B) was
amplified using the XL-PCR Reaction Kit.TM. (Perkin-Elmer Part #
N808-0192) and primers 3 and 4. The fragment encoding the 3' end of
dengue 4 envelope (Fragment C) was amplified using the same
protocol but using primers 5 and 6. Each PCR reaction was performed
as indicated in master mixes (see section 3.1, above).
[0368] For each reaction, the lower mix (LM) was added to a
Perkin-Elmer thin-walled 0.2 ml tube. Next, Ampliwax 100
(Perkin-Elmer) was added to the tube, which was then placed in a
Perkin-Elmer 2400 Thermal Cycler and heated to 80.degree. C. for 5
minutes, and then cooled to 4.degree. C. The cDNA and UM were then
added to the top of the wax layer. The tube was then cycled in a
Perkin-Elmer 2400 as follows: 94.degree. C., 1 minute; repeat
30.times. (94.degree. C., 15 seconds; 53.degree. C., 15 seconds;
68.degree. C., 3 minutes), 72.degree. C., 4 minutes; 4.degree. C.,
hold. The expected sizes of the PCR fragments for cloning were as
follows:
27 Fragment Approximate Size (kb) A 0.940 B 0.650 C 1.300
[0369] Forty .mu.l of each fragment was then separated on a 1%
Agarose/TAE gel and purified using the QIAquick Gel Extraction Kit
(Qiagen cat. # 28704). Next, the concentration of the purified
fragments was determined by UV absorption using 1:40 dilutions in
RODI-water.
28 Sample A280 A260 280/260 260/280 Concentration Fragment A 0.0247
0.0340 0.7271 1.3754 68 ng/.mu.l Fragment B 0.0086 0.0152 0.5643
1.7721 30 ng/.mu.l Fragment C 0.0099 0.0179 0.5536 1.8065 36
ng/.mu.l
[0370] 5.2 Recombinant PCR
[0371] To create a fusion between the yellow fever capsid gene and
the 5' end of the dengue 4 prM, a recombinant PCR technique,
Overlap-extension PCR was used to create Fragment E. The same basic
UM and LM were used and primers 1 and 4 replaced earlier primers;
the cDNA templates used were mixes shown below:
29 Fragment A Fragment B Fragment E control control H.sub.2O 37.8
.mu.l 39.1 .mu.l 38.7 .mu.l Fragment A 0.9 .mu.l 0.9 .mu.l 0 .mu.l
Fragment B 1.3 .mu.l 0 .mu.l 1.3 .mu.l Volume 40 .mu.l 40 .mu.l 40
.mu.l
[0372] The same protocol that was used for creation of Fragments A,
B, and C was used except that only 1/2 of the cDNA, UM, and LM were
used for the control reactions. The tube was then cycled in a
Perkin-Elmer 2400 cycler as follows: 94.degree. C., 1 minute;
repeat 30.times.(94.degree. C., 15 seconds; 55.degree. C., 15
seconds; 68.degree. C., 2 minutes; 72.degree. C., 7 minutes;
4.degree. C., hold. The expected sizes were as follows.
30 Fragment Approximate Size (kb) E 1.59 A control no product B
control no product
[0373] Forty .mu.l of Fragment E was then separated on a 1%
Agarose/TAE gel and purified using the QIAquick Gel Extraction Kit
(Qiagen cat. # 28704). Next, the concentration of the purified
fragment was determined by UV absorption using 1:40 dilutions in
RODI-water.
31 Sample A280 A260 280/260 260/280 Concentration Fragment E 0.0049
0.0110 0.4489 2.2276 22 ng/.mu.l
[0374] 5.3 Cloning of Fragments C and E into Yellow Fever
Vectors
[0375] The fragments were then cloned into the yellow fever
two-plasmid system by digestion of the purified Fragments C and E
as well as the plasmids pYF5'3'IV and pYFM5.2/2 with appropriate
restriction enzymes as shown below. The digested plasmids resulted
in two bands. The smaller bands contain a fragment of Japanese
encephalitis corresponding to either Fragment C or Fragment E for
the new dengue 4 constructs. All restriction enzymes, buffers, and
100.times.BSA were from New England Biolabs. All the digestions
were carried in a Perkin-Elmer 480 cycler set to hold at 37.degree.
C. overnight.
32 Fragment E digest Fragment E (528 ng) 27 .mu.l NEB buffer 4 4
.mu.l 10 .times. BSA 4 .mu.l H.sub.2O 3 .mu.l Not I 1 .mu.l Nhe I 1
.mu.l Volume 40 .mu.l
[0376]
33 pYF5.2 digest pYF5.2 (1 .mu.g) 9.5 .mu.l NEB buffer 2 2 .mu.l 10
.times. BSA 2 .mu.l H.sub.2O 4 .mu.l Sfo I 1.5 .mu.l Nhe I 1 .mu.l
Volume 20 .mu.l
[0377]
34 pYFMIV5'3' digest pYFMIV5'3'(1.02 .mu.g) 2 .mu.l NEB buffer 4 2
.mu.l 10 .times. BSA 2 .mu.l H.sub.2O 12 .mu.l Not I 1 .mu.l Nhe I
1 .mu.l Volume 20 .mu.l
[0378]
35 Fragment C digest Fragment C (710 ng) 20 .mu.l NEB buffer 2 4
.mu.l 10 .times. BSA 4 .mu.l H.sub.2O 9.5 .mu.l Sfo I 1.5 .mu.l Nhe
I 1 .mu.l Volume 40 .mu.l
[0379] 5.4 Vector Dephosphorylation
[0380] Calf Intestinal Phosphatase (CIP) from New England Biolabs
(cat. # 290S) was diluted 1:10 in 1.times.CIP Buffer. One .mu.l of
this dilution was then added to the pYFMIV5'3' digest. 0.62 .mu.l
of stock CIP was added directly to the pYF5.2 digest. Both were
incubated for 1 hour at 37.degree. C. Then, 0.8 .mu.l 125 mM EDTA
was added to the two tubes and placed at 75.degree. C. for 10
minutes to inactivate CIP
[0381] 5.5 Gel Excision
[0382] The digested PCR fragments were separated on a 1.0%
Agarose/TAE gel, while the digested plasmids were separated on a
0.8% Agarose/TAE gel. All were purified using the QIAquick Gel
Extraction Kit (Qiagen cat. # 28704).
[0383] 5.6 Ligations
[0384] The digested Fragment E and pYF5'3'IV were ligated using T4
DNA Ligase (New England Biolabs cat. # 202S) to create pYD4-5'3'.
The digested Fragment C and pYFM5.2 were ligated to create
pYD4-5.2. All ligation reactions were incubated in a Perkin-Elmer
480 cycler set to hold at 16.degree. C. overnight.
36 PYD4-5'3' Ligation Fragment E (97.5 ng) 9.5 .mu.l pYFM5'3' (50
ng) 3.6 .mu.l H.sub.2O 3.9 .mu.l 10 .times. T4 ligase buffer 2
.mu.l T4 DNA ligase 1 .mu.l Volume 20 .mu.l
[0385]
37 PYD4-5.2 Ligation Fragment C (56 ng) 4.5 .mu.l pYFM5.2 (70 ng)
8.8 .mu.l H.sub.2O 3.7 .mu.l 10 .times. T4 ligase 2 .mu.l buffer T4
DNA ligase 1 .mu.l Volume 20 .mu.l
[0386]
38 pYFM-5'3' Control Ligation Fragment E 0 .mu.l pYFM5'3' (50 ng)
3.6 .mu.l H.sub.2O 13.4 .mu.l 10 .times. T4 ligase 2 .mu.l buffer
T4 DNA ligase 1 .mu.l Volume 20 .mu.l
[0387]
39 pYF5.2 Control Ligation Fragment C 0 .mu.l pYFM5.2 (70 ng) 8.8
.mu.l H.sub.2O 8.2 .mu.l 10 .times. T4 ligase 2 .mu.l buffer T4 DNA
ligase 1 .mu.l Volume 20 .mu.l
[0388] 5.7 Transformations
[0389] All four ligation reactions were transformed into E. coli
strain MC1061 (recA-). An aliquot of MC1061 (OraVax Notebook 661-4)
was removed from storage at -80.degree. C. and allowed to thaw on
ice for one to two minutes. 0.9 ml of cold 0.1 M CaCl.sub.2 was
added to the cells. One hundred .mu.l of cells was aliquoted into
five 12 ml culture tubes on ice. Ten .mu.l of each ligation
reaction was added to each culture tube, leaving the fifth tube as
a negative (no DNA) control. Culture tubes were left on ice for 30
minutes. The tubes were heat shocked in a water bath at 42.degree.
C. for 45 seconds. The tubes were put back on ice for 2 minutes.
0.9 ml SOC medium was added to each culture tube and incubated at
225 pm in a shaking incubator at 37.degree. C. for 1 hour. Each
transformation mix was aliquoted into 1.5 ml microcentrifuge tubes.
One hundred .mu.l of each was spread onto LB/Agar-Amp (100
.mu.g/ml) plates and labeled as "neat." Each tube was spun at 14
Krpm in a microcentrifuge for 2-3 seconds to pellet the cells. The
supernatant was poured into the waste container and the pellet
resuspended in the residual broth by pipetting up and down. This
material was plated (approximately 100 .mu.l) onto LB/Agar-Amp (100
.mu.g/ml) plates and labeled as 10.times.. All plates were inverted
in a 37.degree. C. incubator overnight.
[0390] 5.8 Transformant Screening
[0391] The resulting bacterial colonies were patch-plated onto
fresh LB/Agar-Amp (100 .mu.g/ml) and placed inverted in a
37.degree. C. incubator overnight. The following day, 50 .mu.l of
RODI-water was aliquoted into 0.5 ml tubes. Using a sterile plastic
pick, a small amount of each patch was scraped into one of the 0.5
ml tubes containing water. These were then placed at 95.degree. C.
for 10 minutes and spun at 14,000 rpm for 10 minutes in a
microcentrifuge. To identify the proper insert in pYD4-5'3',
colonies were screened by PCR using Taq Polymerase (Promega) and
primers 4 and 7. The pYD4-5.2 was screened using primers 5 and 6.
The PCR reaction was performed using the following master mix.
40 Component 4 rxns 10 rxns 15 rxns 20 rxns 25 rxns 30 rxns
RODI-water 161.5 .mu.l 355.5 .mu.l 516.8 .mu.l 678.3 .mu.l 839.8
.mu.l 1001.3 .mu.l H.sub.2O 25 .mu.l 55 .mu.l 80 .mu.l 105 .mu.l
130 .mu.l 155 .mu.l MgCl.sub.2 10 .mu.l 22 .mu.l 32 .mu.l 42 .mu.l
52 .mu.l 62 .mu.l P1 (100 .mu.M) 1 .mu.l 2.2 .mu.l 3.2 .mu.l 4.2
.mu.l 5.2 .mu.l 6.2 .mu.l P2 (100 .mu.M) 1 .mu.l 2.2 .mu.l 3.2
.mu.l 4.2 .mu.l 5.2 .mu.l 6.2 .mu.l dNTPs (10 mM) 40 .mu.l 88 .mu.l
128 .mu.l 168 .mu.l 208 .mu.l 248 .mu.l Taq Polymerase 1.5 .mu.l
3.3 .mu.l 4.8 .mu.l 6.3 .mu.l 7.8 .mu.l 9.3 .mu.l
[0392] Forty eight .mu.l of each master mix was added to a 0.5 ml
tube along with 5 ml of the template prepared from the colony
patches. Additionally, a tube using RODI-water as a template was
also made as a negative control. These tubes were then placed in
the Ericomp Delta Cycler and cycled as follows: 96.degree. C., 4
minutes; 30.times.(94.degree. C., 30 seconds; 50.degree. C., 1
minute; 72.degree. C., 1 minute 25 seconds), 72.degree. C., 4
minutes; 4.degree. C. hold. The PCR products were then run on 1.5%
Agarose/TAE gels to check for positive colonies.
[0393] 5.9 Glycerol Stocks
[0394] Five ml of LB-Amp (100 .mu.g/ml) was then inoculated from a
patch pYD4-5'3'/2 or pYD4-5.2/1 and shaken at 225 rpm overnight at
37.degree. C. One ml of this culture was then spun at 14 Krpm for
2-3 seconds to pellet the cells. This was then resuspended in
LB-Glycerol (30%) and frozen at -80.degree. C.
[0395] 5.10 MIDI Plasmid Preparation
[0396] Fifty .mu.l of each glycerol stock was added to 150 ml
LB-Amp (100 .mu.g/ml) in separate 4 L flasks and shaken at 225 rpm
overnight at 37.degree. C. Qiagen Midi-Prep (Qiagen) was performed
using the following modified protocol.
[0397] 1. Spin 150 ml of each culture at 7 Krpm in GSA rotor for 10
minutes to pellet.
[0398] 2. Decant Supernatant.
[0399] 3. Resuspend pellet in 4 ml P1 Buffer; transfer to 50 ml
Falcon tube.
[0400] 4. Rinse centrifuge bottle with 2 ml P1 buffer and transfer
to the Falcon tube.
[0401] 5. Add 6 ml P2 buffer; invert gently; 5 minutes at room
temperature or until lysed (no more than 12 minutes).
[0402] 6. Add 6 ml P3; mix as above; 10 minutes on ice.
[0403] 7. Transfer supernatant to Qiagen Syringe Filter; let sit
for 10 minutes.
[0404] 8. Equilibrate Q-100 tip with 4 ml QBT.
[0405] 9. Gently push plunger to filter supernatant onto Q-100
tip.
[0406] 10. Allow to drain by gravity.
[0407] 11. Wash with 2.times.10 ml QC.
[0408] 12. Elute into 50 ml polypropylene centrifuge tube with 5 ml
QF.
[0409] 13. Add 14 ml 100% ETOH (or 8 ml isopropanol); Place in dry
ice/ethanol bath for 10 minutes (or at -20.degree. C. for 2 hours
or at 4.degree. C. overnight).
[0410] 14. Spin at 15 K.times.G for 30 minutes at 4.degree. C.
[0411] 15. Wash with 5 ml 70% ethanol; Spin 15 K.times.G for 20
minutes.
[0412] 16. Air Dry.
[0413] 17. Resuspend in 150 .mu.l EB.
[0414] DNA concentrations were measured as before.
41 Sample A280 A260 280/260 260/280 Concentration pYD4-5'3'/2
0.0516 0.0939 0.5498 1.1817 1.87.8 ng/.mu.l pYD4-5.2/1 0.0900
0.1407 0.6399 1.5629 281.4 ng/.mu.l
[0415] 5.11 In Vitro Ligation to Create Full-length cDNA Chimeric
Template and RNA Production
[0416] Digestion with AatII and BstBI
[0417] Plasmids pYD4-5'3'/2 and pYD4-5.2/1 were digested with AatII
and BstBI (NEB) in a sequential digest as follows.
42 YD4-5'3'/2 (AatII digest) pYD4-5'3'/2 42.5 .mu.l (8 .mu.g)
Buffer 4 (NEB) 5 .mu.l AatII (NEB) 2 .mu.l H.sub.2O 0.5 .mu.l
Volume 50 .mu.l
[0418]
43 YD4-5.2/1 (AatII digest) pYD4-5.2 35.5 .mu.l (10 .mu.g) Buffer 4
(NEB) 5 .mu.l AatII (NEB) 2 .mu.l H.sub.2O 7.5 .mu.l Volume 50
.mu.l
[0419] Both reactions were incubated in a 37.degree. C. block for 2
hours. Five .mu.l of each digest was run out on a 1.5% Agarose/TAE
gel to check for complete digestion. The pYD4-5'3'/2 digest did not
cut completely so the reaction was cleaned over a Qiaprep spin
column (Qiagen). The digest was repeated using this material and 3
.mu.l of Aat II. In addition, 3 .mu.l of Aat II was added to the
existing pYD4-5.2/1 reaction. Both were incubated in a 37.degree.
C. block, overnight. After confirmation of digest on another gel
(as previously described), 2.5 .mu.l Bst BI (NEB) was added to each
reaction and placed at 65.degree. C. for 3 hours. The results of
the digest were as follows.
44 PYD4-5'3'/2 PYD4-5.2/1 5.6 kb 7.2 kb 2.0 kb 0.14 kb 0.4 kb
[0420] The largest band from each reaction was gel excised as and
the UV concentration was determined (as previously described).
[0421] 5.12 Ligation
[0422] The following ligation reaction was setup using high
concentration T4 DNA ligase (NEB). The ligations were incubated at
16.degree. C. overnight.
45 H.sub.2O 13.5 .mu.l pYD4-5.2 fragment 23 .mu.l (600 ng)
pYD4-5'3' 7 .mu.l fragment (300 ng) 100 .times. BSA (NEB) 0.5 .mu.l
T2 DNA ligase buffer 5 .mu.l (NEB) *T4 DNA ligase 1 .mu.l Volume 50
.mu.l *Heat reaction at 37.degree. C. for 5 minutes, then briefly
chill on ice before adding ligase
[0423] 5.13 Linearization of Template
[0424] The ligation was heat inactivated at 65.degree. C. for 10
minutes. The ligated material was then linearized at 3' end of the
yellow fever sequence to allow proper RNA transcription, as
follows: 5.5 ml Buffer 2 (NEB) was added to the ligation, followed
by 1.5 .mu.l XhoI (NEB), and this reaction mixture was placed at
37.degree. C. for 2 hours.
[0425] 5.14 Linear cDNA Extraction (RNAse Free Phase)
[0426] 1. Add H.sub.2O to 100 .mu.l total volume.
[0427] 2. Add {fraction (1/10)}.sup.th volume 3 M Sodium
Acetate.
[0428] 3. Add 100 .mu.l Phenol/Chloroform/Isoamyl Alcohol and spin
at 14 Krpm for 5 minutes in a microcentrifuge. Extract upper layer
into RNAse-free 1.5 ml tube. Repeat once.
[0429] 4. Add 100 .mu.l RNAse-free Chloroform. Spin at 14 Krpm for
5 minutes in a microcentrifuge. Extract upper layer into RNAse-free
1.5 ml tube. Repeat once.
[0430] 5. Add 200 .mu.l 100% RNASE-free ethanol.
[0431] 6. Place on dry-ice/ethanol bath for 10 minutes.
[0432] 7. Spin at 14 Krpm for 20 minutes in a microcentrifuge.
[0433] 8. Wash with 200 .mu.l 70% ethanol (RNAse-free).
[0434] 9. Repeat 70% ethanol wash two more times.
[0435] 10. Dry in Speed-Vac for 8 minutes (or until no more ethanol
is present).
[0436] 11. Resuspend in 22 .mu.l nuclease free water from the SP6
kit listed below.
[0437] 5.15 SP6 Transcription
[0438] The following reaction was setup using the SP6 transcriptase
kit (Epicentre) and Rnasin (Promega) in an RNAse-free 1.5 ml tube
using RNAse-free tips in a BL-2 hood. The reaction was then placed
in a 40.degree. C. water bath for 1 hour.
46 Capping NTP solution 6 .mu.l 10 .times. buffer 2 .mu.l 20 mM Cap
Analog 3 .mu.l 100 mM DTT 2 .mu.l Linearized DNA 5 .mu.l Rnasin 0.5
.mu.l SP6 transcriptase 2 .mu.l Volume 20.5 .mu.l
[0439] 5.16 RNA Transfection
[0440] Two six well tissue culture plates were seeded with Vero-PM
(p#153 OraVax notebook#743-7) cells at 7.4.times.10.sup.5
cells/well in growth media (Gibco MEM; Sodium Pyruvate; NEAA;
Penicillin/Streptomycin; 5% fetal bovine serum), and placed in a
37.degree. C. CO.sub.2 incubator until confluent.
[0441] The following transfection reactions were made using
Lipofectin (Life Technologies) and RNAse-free PBS (Sigma), and
allowed to sit at room temperature for 10 minutes.
47 YF/DEN-4 PBS 250 .mu.l Lipofectin 20 .mu.l YF/DEN-4 RNA 10 .mu.l
Volume 280 .mu.l
[0442]
48 Total RNA control PBS 250 .mu.l Lipofectin 20 .mu.l YF/JE total
RNA 10 .mu.l Volume 280 .mu.l
[0443]
49 Lipofectin control PBS 260 .mu.l Lipofectin 20 .mu.l Volume 280
.mu.l
[0444] 1. Remove Media from the 6 well plates.
[0445] 2. Wash 3 times with PBS.
[0446] 3. Remove last of PBS.
[0447] 4. Overlay with each lipofectin reaction. Add 280 .mu.l PBS
for the remaining wells.
[0448] 5. Rock for 10 minutes at room temperature.
[0449] 6. Wash 2 times with media (MEM, Sodium Pyruvate, NEAA, P/S,
5% FBS).
[0450] 7. Add 2 ml of media to each well and place in the
37.degree. C. CO.sub.2 incubator for 4 days or more.
[0451] 5.17 Chimeric Virus Harvest
[0452] The supernatant from YF/DEN-4 was harvested on day 6 by
splitting the 2 ml of supernatant between two cryovials (each
containing 1 ml FBS), which were labeled YF/DEN-4 (P1). The cell
monolayer was harvested with 1 ml Trizol into a 1.5 ml tube. All
vials and tubes were then placed at -80.degree. C.
[0453] 5.18 Amplification of YF/DEN-4
[0454] Passage #2
[0455] 1. Three T-25 flasks containing Vero-PM cells (p#149) were
obtained from the Cell Culture Facility. A frozen aliquot of
YF/DEN-4 (P1) was removed from the -80.degree. C. freezer, thawed,
then placed on ice. The same was done for an aliquot of YF/JE
(frozen stock from the P1 control transfection).
[0456] 2. Media was removed from each T-25 flask.
[0457] 3. Five hundred .mu.l of YF/DEN-4(P1) was added to the first
flask, 500 .mu.l of media (MEalphaM, NEAA, Sodium Pyruvate, 5% FBS,
P/S) was added to the second flask, and 500 .mu.l of YF/JE(P1) was
added to the third flask.
[0458] 4. Two hundred .mu.l of the media was added to each flask to
ensure complete coverage.
[0459] 5. Each flask was then put in the 37.degree. C. CO.sub.2
incubator for 1 hour with rocking every 15 minutes.
[0460] 6. 4.5 ml of media was then added to each flask.
[0461] 7. The flasks were then placed in the 37.degree. C. CO.sub.2
incubator for 4 days.
[0462] Harvest P2
[0463] The supernatant from YF/DEN-4 was harvested on day 4 by
splitting the 5 ml of supernatant between five cryovials (each
containing 1 ml FBS), which were labeled YF/DEN-4 (P2). The cell
monolayer was harvested in 3 ml Trizol and aliquoted into 3 tubes.
All vials and tubes were then placed at -80.degree. C.
[0464] Passage#3 (Titration of P2)
[0465] 1. A 12 well tissue culture plate containing Vero-PM cells
(p#163) was obtained from the Cell Culture Facility. A frozen
aliquot of YF/DEN-4 (P2) was removed from the -80.degree. C.
freezer, thawed, and then placed on ice.
[0466] 2. Serial dilutions were made in a 24 well tissue culture
plate ending at 10.sup.-4 in a total volume of 300 .mu.l. The plate
was then placed on ice.
[0467] 3. The media was removed from each well of the 12 well plate
and 100 .mu.l of virus stock, as well as each dilution, was added
to the wells in duplicate. One hundred .mu.l of media only was
added to the last set of wells as a negative control.
[0468] 4. The plate was then put in the 37.degree. C. CO.sub.2
incubator for 1 hour with rocking every 20 minutes.
[0469] 5. The 1.sup.st overlay was made by preheating 25 ml
M199(2.times.), 1.5 ml FBS, and 0.5 ml PSA at 42.degree. C. in a 50
ml Falcon tube (tube #1). Additionally, 23 ml Agarose (0.6% in
water) was heated at 42.degree. C. in a 50 ml Falcon tube (tube
#2). At the end of the 1 hour incubation, tube #1 was added to tube
#2 and mixed thoroughly.
[0470] 6. One ml of this overlay was then added to the edge of each
well.
[0471] 7. The plate was then put in the 37.degree. C. CO.sub.2
incubator for 4 days.
[0472] 8. The 2.sup.nd overlay was made by preheating 25 ml
M199(2.times.), 1.5 ml FBS, 1.5 ml Neutral Red, and 0.5 ml PSA at
42.degree. C. in a 50 ml Falcon tube (tube #1). Additionally, 21.5
ml Agarose (0.6% in water) was heated at 42.degree. C. in a 50 ml
Falcon tube (tube #2). Tube #1 was added to tube #2 and mixed
thoroughly.
[0473] 9. One ml of this overlay was added to the center of each
well.
[0474] 10. It was then placed in the 37.degree. C. CO.sub.2
incubator
[0475] Titration of P2 results
[0476] Instead of titer determination, plaques were picked for
purification to segregate a mixed population of large and small
plaques observed. The RNA from P2 was extracted using Trizol
methods according to the manufacturer's protocol, RT-PCR was
performed followed by sequencing of the YF/DEN-4 prME region 5', 3'
junctions, inclusive. The expected sequence of the prME was
confirmed.
[0477] 6.0 Construction of Chimeric Templates for Other
Flaviviruses
[0478] Procedures for generating full-length cDNA templates
encoding chimeric YF/MVE, YF/SLE, YF/WN, YF/TBE viruses are similar
to those described above for the YF/DEN-2 system. Table 20
illustrates the features of the strategy for generating YF
17D-based chimeric viruses. The unique restriction sites used for
in vitro ligation, and the chimeric primers for engineering the
C/prM and E/NSI junctions are also shown. Sources of cDNA for these
heterologous flaviviruses are readily available (MVE: Dalgamo et
al., J. Mol. Biol. 187:309-323, 1986; SLE: Trent et al., Virology
156:293-304, 1987; TBE: Mandl et al., Virology 166:197-205, 1988;
Dengue 1: Mason et al., Virology 161:262-267, 1987; Dengue 2:
Deubel et al., Virology 155:365-377, 1986; Dengue 3: Hahn et al.,
Virology 162:167-180, 1988; Dengue 4: Zhao et al., Virology
155:77-88, 1986).
[0479] An alternative approach to engineering additional chimeric
viruses is to create the C/prM junction by blunt end ligation of
PCR-derived restriction fragments having ends that meet at this
junction and 5' and 3' termini that flank appropriate restriction
sites for introduction into YF5'3'IV or an intermediate plasmid
such as pBS-KS(+). The option to use a chimeric oligonucleotide or
blunt-end ligation will vary, depending on the availability of
unique restriction sites within the envelope protein coding region
of the virus in question.
[0480] 6.1 Construction of YF Viruses Encoding HCVAntigens
[0481] Because the structural proteins E1 and E2 of HCV are not
homologous to the structural proteins of the flaviviruses described
above, the strategy for expression of these proteins involves
insertion within a nonessential region of the genome, such that all
of these proteins are then co-expressed with yellow fever proteins
during viral replication in infected cells. The region to be
targeted for insertion of the proteins is the N terminal portion of
the NS1 protein, since the entire NS1 protein is not required for
viral replication. Because of the potential problems with stability
of the YF genome in the presence of heterologous sequence exceeding
the normal size of the genome (approximately 10,000 nucleotides),
the detection strategy described below can be used. In addition,
deletion of NS1 may be advantageous in the chimeric YF/Flavivirus
systems described above, because partial deletion of this protein
may abrogate the immunity to YF associated with antibodies against
NS1, and thus avoid problems with vector immunity if more than one
chimeric vaccine was to be needed in a given recipient, or if a YF
vaccine had been previously given or needed at a future point.
[0482] The strategy involves creating a series of in-frame
deletions within the NS1 coding region of the YFM5.2 plasmid, in
conjunction with engineering a translational termination codon at
the end of E, and a series of two IRESs (internal ribosome entry
sites). One IRES is immediately downstream of the termination codon
and allows for expression of an open reading frame within the
region between E and NS1. The second IRES initiates translation
from truncated NS1 proteins, providing expression of the remainder
of the YF nonstructural polyprotein. These derivatives are tested
for recovery of infectious virus and the construct with the largest
deletion is used for insertion of foreign sequences (e.g., HCV
proteins) in the first IRES. This particular construct can also
serve as a basis for determining whether deletion of NS1 will
affect vector-specific immunity in the context of YF/Flavivirus
chimeric viruses expressing prM-E, as described above.
[0483] The insertion of nucleotides encoding E1, E2, and/or E1 plus
E2 HCV proteins is limited by the size of the deletion tolerated in
the NS1 protein. Because of this, truncated HCV proteins can be
used to enhance stability within the modified YF clone. The HCV
proteins are engineered with an N-terminal signal sequence
immediately following the IRES and a termination codon at the C
terminus. This construction will direct the HCV proteins into the
endoplasmic reticulum for secretion from the cell. The strategy for
this construction is shown schematically in FIG. 21. Plasmids
encoding HCV proteins of genotype I can be used for these
constructions, for example, HCV plasmids obtained from Dr. Charles
Rice at Washington University (Grakoui et al., J. Virology
67:1385-1395, 1993), who has expressed this region of the virus in
processing systems and within a replication-complement full-length
HCV clone.
[0484] 6.2 PrM Cleavage Deletion Mutants as Attenuating Vaccine
Candidates for Flaviviruses
[0485] Additional chimeric viruses included in the invention
contain mutations that prevent prM cleavage, such as mutations in
the prM cleavage site. For example, the prM cleavage site in
flavivirus infectious clones of interest, such as dengue, TBE, SLE,
and others can be mutated by site-directed mutagenesis. Any or all
of the amino acids in the cleavage site, as set forth above, can be
deleted or substituted. A nucleic acid fragment containing the
mutated prM-E genes can then be inserted into a yellow fever virus
vector using the methods described above. The prM deletion can be
used with or without other attenuating mutations, for example,
mutations in the E protein, to be inserted into the yellow fever
virus. These mutants have advantages over single substitution
mutants as vaccine candidates, because it is almost impossible to
revert the deleted sequence and restore virulence.
[0486] The following chimeric flaviviruses of the invention were
deposited with the American Type Culture Collection (ATCC) in
Rockville, Md., U.S.A. under the terms of the Budapest Treaty and
granted a deposit date of Jan. 6, 1998: Chimeric Yellow Fever
17D/Dengue Type 2 Virus (YF/DEN-2; ATCC accession number ATCC
VR-2593) and Chimeric Yellow Fever 17D/Japanese Encephalitis
SA14-14-2 Virus (YF/JE A1.3; ATCC accession number ATCC
VR-2594).
50TABLE 1 Sequence comparison of JE strains and YF/JE chimeras E E
E E E E E E E E Virus 107 138 176 177 227 243 244 264 279 315 JE
SA14-14-2 F K V T S K G H M V YF/JE SA14-14-2 F K V A S E G H M V
YF/JE Nakayama L E I T P E E Q K A JE Nakayama L E I T P E E Q K A
JE SA14 L E I T S E G Q K V
[0487]
51TABLE 2 Characterization of YF/JE chimeras Infectivity PBS RNAse
DNAse Yield plaques/100 ng log titer log titer log titer Clone
(.mu.g) LLC-MK2 VERO VERO VERO YF5.21v 5.5 15 7.2 0 7 YF/JE-S 7.6
50 6.2 0 6.2 YF/JE-N 7 60 5 0 5.4
[0488]
52TABLE 3 Plaque reduction neutralization titers on YF/JE chimeras
non-immune YF ascitic JE ascitic non-immune Virus ascitic fluid
fluid fluid IgG YF IgG YF5.2iv <1.3 3.7 <1.3 <2.2 >4.3
JE SA14-14-2 <1.3 <1.3 3.4 <2.2 <2.2 YF/JE SA.sub.14-
<1.3 <1.3 3.1 <2.2 <1.9 14-2 YF/JE <1.3 <1.3 3.4
<2.2 <2.2 Nakayama JE Nakayama <1.3 <1.3 3.4 not not
virus determined determined
[0489]
53TABLE 4 Neurovirulence of YF/JE SA14-14-2 Chimera 3 week old male
ICR mice log dose I.C. % Mortality YF5.2iv 4 100 (7/7) YF/JE
SA14-14-2 4 0 (0/7) YF/JE SA14-14-2 5 0 (0/7) YF/JE SA14-14-2 6 0
(0/8)
[0490]
54TABLE 5 Neuroinvasiveness of YF/JE Chimeras 3 week old male ICR
mice log dose (intraperitoneal) % mortality YF/JE Nakayama 4 0
(0/5) YF/JE Nakayama 5 0 (0/4) YF/JE Nakayama 6 0 (0/4) YF/JE
SA14-14-2 4 0 (0/5) YF/JE SA14-14-2 5 0 (0/4) YF/JE SA14-14-2 6 0
(0/4)
[0491]
55TABLE 6 Doses and routes of virus inoculation into groups of
4-week-old ICR mice YF-VAX .RTM. (Yellow YF-VAX .RTM. (Yellow Fever
17D Vaccine) Fever 17D Vaccine) YF/JE s.c. YF/JE i.c. s.c. i.c.
Group log.sub.10pfu log.sub.10pfu log.sub.10pfu log.sub.10pfu mice
1 5 4.5 4.7 4.2 20 2 4 4 4.4 3.9 20 3 3 3 3.4 3.4 20 4 2 2 2.4 2.4
20 5 1 1 1.4 1.4 20 6 JE-VAX .RTM. (inactivated Japanese
Encephalitis virus vaccine) 5 (BIKEN) 1:30, day 0, 7, s.c. 7 JE-VAX
.RTM. (inactivated Japanese Encephalitis virus vaccine) 5 (BIKEN)
1:300, day 0, 7, s.c. 8 control s.c. (medium +10% FBS) 5 9 control
i.c. (medium +10% FBS) 5
[0492]
56TABLE 7 Geometric mean neutralizing antibody titers 3 and 8 weeks
after immunization, outbred mice inoculated with graded doses of
vaccines by the s.c. route Antibody titer (GMT + SD) vs. Dose JE
YF17D Vaccine log.sub.10PFU 3w 8w 3w 8w YF/JE 5.0 151 .+-. 93 5,614
.+-. 3514 4.0 38 .+-. 60 127 .+-. 247 3.0 19 .+-. 65 43 .+-. 560
2.0 7 .+-. 12 3 .+-. 71 1.0 2 .+-. 8 0 YF 17D 4.7 2 .+-. 4 18 .+-.
13 4.4 35 .+-. 24 250 .+-. 109 3.4 9 .+-. 20 54 .+-. 179 2.4 1 .+-.
0 53 .+-. 22 1.4 0 46 .+-. 18
[0493]
57TABLE 8 Immunogenicity and protection vs. challenge Mice were
immunized on Day 0 with live vaccines and on days 0, 7, and 20 with
JE-VAX .RTM. (inactivated Japanese Encephalitis virus vaccine),
bled on day 21 and challenged on day 28. No./ Total Virus group
Dose (pfu) Route no. mice 1. YF/JE 8 10.sup.2-10.sup.5 sc 32
(SA14-14-2 RMS)* 2. YF17D 8 10.sup.2-10.sup.5 sc 32 (iv5.2) (Vero)
3. YF17D (PMC) 8 10.sup.2-10.sup.5 sc 32 4. JE Nakayama 8
10.sup.2-10.sup.5 sc 32 5. JE SA14-14-2 (BHKP1)** 8
10.sup.2-10.sup.5 sc 32 6. YF/JE (Nakayama)# 8 10.sup.2-10.sup.5 sc
32 7. JE-VAX .RTM. (inactivated 8 100 ul 1:300 dilution sc 8
Japanese Encephalitis virus on Day 0, 7 and vaccine) Connaught lot
EJN*151B 100 ul 1:5 dilution on D 20 8. None (challenged) 8 -- ip 8
9. None (unchallenged) 8 -- -- 8 *YF/JE SA14-14-2 vaccine candidate
**Chinese live vaccine, passed once in BHK cells #Chimeric YF/JE
virus, with prM-E insert of wild-type JE Nakayama
[0494]
58TABLE 9 Protection of C57/BL6 mice by a single SC inoculum of
graded doses of live virus vaccines against IP challenge with 158
LD50 of wild-type JE virus (IC-37). Mice were challenged 28 days
after immunization. Number of survivors/number challenged (%
survivors) by vaccine dose (log.sub.10pfu) Vaccine None 1 2 3 4 5
Other Yellow fever 17D NT* 3/8 1/8 1/8 2/8 (YF-VAX .RTM. (Yellow
(37.5%) (12.5%) (12.5%) (25%) Fever 17D vaccine) unpassaged) Yellow
fever 17D NT 0/8 1/8 1/8 1/8 (YF5.2iv (0%) (12.5%) (12.5%) (12.5%)
infectious clone) Yellow fever/JE 1/8 2/8 7/7 7/8 7/7 SA14-14-2
chimera (12.5%) (25%) .sup. (100%).sup. (87.5%) .sup. (100%).sup.
Chinese JE vaccine NT 1/8 1/8 0/8 3/8 SA14-14-2 (BHK1) (12.5%)
(12.5%) (0%) (37.5%) Wild-Type JE NT 2/7 1/6 1/3 1/4 (Nakayama)#
(29%) (17%) (33%) (25%) YF/JE (Nakayama) 3/3 5/5 3/3 {circumflex
over ( )} .sup. (100%).sup. .sup. (100%).sup. .sup. (100%).sup.
Mouse brain vaccine 7/8 (JE-VAX .RTM. (87.5%) (inactivated Japanese
Encephalitis virus vaccine))** Control (challenge) 1/8 (12.5%)
Control (no challenge) 8/8 .sup. (100%).sup. *Not tested; #Some
mice died as a result of inoculation of the wild-type virus at high
doses, thus fewer mice remained for challenge; **Three doses at 1
week intervals; {circumflex over ( )}No mice survived initial
inoculation at this dose
[0495]
59TABLE 10 Geometric mean neutralizing antibody titers, C57/BL6
mice 21 days after immunization with a single SC inoculum of graded
doses of live virus vaccines and 1 day after the third dose of
inactivated JE- VAX .TM. (inactivated Japanese Encephalitis virus
vaccine). Antibody titer (GMT .+-. SD) Dose vs. Vaccine
(log.sub.10PFU) JEV YF 17D YF/JE SA14-14-2 5 44.8 .+-. 25.2 4 26.5
.+-. 23.1 3 6.2 .+-. 4.9 2 1.1 .+-. 0.35 1 1 .+-. 0 SA14-14-2
(BHK1) 5 2.5 .+-. 4.3 4 3.5 .+-. 20.5 3 4.7 .+-. 15.5 2 1 .+-. 0 JE
Nakayama 5 1.32 .+-. 1 4 4 .+-. 4.0 3 1.6 .+-. 1.8 2 1 .+-. 0
YF/JE-Nakayama 5 10 .+-. 70* 4 102.5 .+-. 45.7 3 76.8 .+-. 63.9 2
19.8 .+-. 8.1 JE-VAX .RTM. (inactivated 3 2.8 .+-. 6.5 Japanese
Encephalitis doses** vaccine) (mouse brain) YF-VAX .RTM. (Yellow 5
11 .+-. 9.6 Fever 17D vaccine) 4 13.8 .+-. 19.1 3 4.3 .+-. 11.7 2 1
.+-. 0 YF5.2iv (17D infect. 5 29.3 .+-. 47.1 clone) 4 11 .+-. 15.2
3 8 .+-. 19.4 2 2.1 .+-. 3.2 Controls 0 1 .+-. 0 *only 2/8 mice
survived immunization with this virus; the low antibody titers in
these animals probably reflect low level virus replication
consistent with survival. **3 doses on days 0, 7, 20; animals were
bled on day 21, 1 day after their third immunization. The day 20
boost was performed with a higher dose of vaccine, thus antibody
titers pre-challenge are expected to be higher than those shown
here.
[0496]
60TABLE 11 Geometric mean neutralizing antibody titers (GMT) in 3
monkeys 2 and 4 weeks post inoculation with a single dose of YF-VAX
.RTM. (Yellow Fever 17D vaccine) or CHIMERIVAX .TM. (chimeric
flavivirus vaccine) by the I.C. route GMT Dose JE YF Vaccine
(log.sub.10pfu) 2W 4W 2W 4W CHIMERIVAX .TM. 7.0 75 3200 (chimeric
flavivirus vaccine) YF-VAX .RTM. 5.0 66 4971 (Yellow Fever 17D
vaccine)
[0497]
61TABLE 12 Immunization and protection: rhesus monkeys Screening H1
test for flavivirus antibodies: negative Dose, route JE Challenge
Group N Virus (log.sub.10PFU/0.5 ml) Day 60 1 3 YF/JE SA14-14-2 4.3
SC 5.0 IC 2 3 YF/JE SA14-14-2 5.3 SC 5.0 IC 3 4 Saline/sham SC 5.0
IC Viremia days 1-7 after immunization and challenge Neutralization
test days 0, 15, 30, 45, and 60 after immunization and days 15 and
30 after challenge Necropsy day 30 post challenge
[0498]
62TABLE 13 Viremia, rhesus monkeys immunized with ChimeriVax .TM.
by the SC route Dose Day post-inoculation Monkey log.sub.10PFU 0 1
2 3 4 5 6 R423 4.3 <1.0* <1.0 <1.0 1.1 1.7 1.0 <1.0
R073 <1.0 <1.0 <1.0 1.0 1.0 <1.0 <1.0 R364 <1.0
1.0 <1.0 1.0 1.0 <1.0 <1.0 R756 5.3 <1.0 1.0 1.0 1.6
1.0 <1.0 <1.0 R174 <1.0 1.3 1.8 1.6 1.1 <1.0 <1.0
R147 <1.0 2.0 1.6 1.0 1.0 <1.0 <1.0 *log.sub.10PFU/ml
[0499]
63TABLE 14 JE neutralizing antibody responses, rhesus monkeys
immunized with ChimeriVax .TM. by the SC Route 50% PRNT titers,
heat-inactivated serum, no added complement Dose Day
post-inoculation Monkey log.sub.10PFU Baseline 15 30 R423 4.3
<10 160 2560 R073 <10 80 640 R364 <10 160 320 R756 5.3
<10 20 320 R174 <10 640 2560 R147 <10 160 2560
[0500]
64TABLE 15 Protection against IC challenge, rhesus monkeys
immunized with ChimeriVax .TM. by the SC route Monkeys challenged
IC on Day 60 with 100,000 pfu/mouse LD50 Vaccine Dose log.sub.10PFU
No. survived/No. tested 4.3 2/3 (67%)* 5.3 3/3 (100%) Sham 0/4 (0%)
*1 monkey that died was a pregnant female
[0501]
65TABLE 16 List of chimeric YF/JE mutants (1 to 9) constructed to
identify residues involved in attenuation of the CHIMERIVAX .TM.
(chimeric flavivirus vaccine). Mutated amino acids on the
E-proteins are shown in bold letters. CHIMERIVAX .TM. (chimeric
flavivirus Mutant Viruses Positions Nakayama vaccine) 1 2 3 4 5 6 7
8 9 10 11 107 L F L F F L L F L F L F L 138 E K K E K K E E E E E E
E 176 I V V V I I V I I V V I I 177 T A A A T T A T T A A T T 227 P
S S S S S S S S P P P P 264 Q H H H H H H H H Q Q Q Q 279 K M M M M
M M M M K K K K
[0502]
66TABLE 17 Dose administered i.c. (pfu) Group P1 P10 P18 Neat
.gtoreq.6 .times. 10.sup.4 1 .times. 10.sup.6 2 .times. 10.sup.7
10.sup.-1 .gtoreq.6 .times. 10.sup.3 1 .times. 10.sup.5 2 .times.
10.sup.6
[0503]
67TABLE 18 Dose administered s.c. (pfu) Group RMS P10 P18 Neat 2
.times. 10.sup.5 2 .times. 10.sup.7 3 .times. 10.sup.7 10.sup.5 1
.times. 10.sup.5 5 .times. 10.sup.5 5 .times. 10.sup.4 10.sup.4 1
.times. 10.sup.4 5 .times. 10.sup.4 5 .times. 10.sup.3
[0504]
68TABLE 19 Design of an experiment to determine
cross-protection/interference between YF 17D and YF/JE SA14-14-2 #
of female 1st 2nd vaccine ICR mice Vaccine 3 months 6 months 12
months 8 YF/JE YF-VAX .RTM. SA14-14-2 (Yellow Fever 17D Vaccine) 8
YF/JE YF-VAX .RTM. SA14-14-2 (Yellow Fever 17D Vaccine) 8 YF/JE
YF-VAX .RTM. (Yellow SA14-14-2 Fever 17D Vaccine) 8 JE-VAX .RTM.
YF-VAX .RTM. (inactivated (Yellow Fever Japanese 17D Vaccine)
Encephalitis virus vaccine) 8 JE-VAX .RTM. YF-VAX .RTM.
(inactivated (Yellow Fever Japanese 17D Vaccine) Encephalitis virus
vaccine) 8 JE-VAX .RTM. YF-VAX .RTM. (Yellow (inactivated Fever 17D
Vaccine) Japanese Encephalitis virus vaccine) 8 YF-VAX .RTM. YF/JE
SA14-14-2 (Yellow Fever 17D Vaccine) 8 YF-VAX .RTM. YF/JE SA14-14-2
(Yellow Fever 17D Vaccine) 8 YF-VAX .RTM. YF/JE SA14-14-2 (Yellow
Fever 17D Vaccine) 4 YF-VAX .RTM. (Yellow Fever 17D Vaccine) 4
YF/JE SA14-14-2 4 YF-VAX .RTM. (Yellow Fever 17D Vaccine) 4 YF/JE
SA14-14-2 4 YF-VAX .RTM. (Yellow Fever 17D Vaccine) 4 YF/JE
SA14-14-2 One dose of YF/JE SA14-14-2, 5.3 log.sub.10 pfu/mouse,
sc. One dose of YF-VAX .RTM. (Yellow Fever 17D Vaccine), 4.4
log.sub.10 pfu/mouse, sc. Two doses of JE-VAX .RTM. (inactivated
Japanese Encephalitis virus vaccine) (PMC), 0.5 ml of 1:5 dilution
administered ip at 1 week intervals.
[0505]
69TABLE 20 Engineering of YF/Flavivirus chimeras Sites.sup.5
Chimeric C/prM Chimeric E/NS1 5' 3' eliminated Virus junction.sup.1
junction.sup.2 ligation.sup.3 ligation.sup.4 or (created) YF/WN
X-cactgggagagcttgaaggtc aaagccagttgcagccgcggtttaa AatII NsiI (SEQ
ID NO:1) (SEQ ID NO:2) YF/DEN-1 X-aaggtagactggtgggctccc
gatcctcagtaccaaccgcggtttaa AatII SphI SphI in DEN (SEQ ID NO:3)
(SEQ ID NO:4) YF/DEN-2 X-aaggtagattggtgtgcattg
aaccctcagtaccacccgcggtttaa AatII SphI (SEQ ID NO:5) (SEQ ID NO:6)
YF/DEN-3 X-aaggtgaattgaagtgctcta acccccaccaccacccgcggtttaa AatII
SphI XhoI in DEN (SEQ ID NO:7) (SEQ ID NO:8) (Sphl in DEN) YF/DEN-4
X-aaaaggaacagttgttctcta acccgaagtgtcaaccgcggtttaa AatII NsiI (SEQ
ID NO:9) (SEQ ID NO:10) YF/SLE X-aacgtgaatagttggatagtc
accgttggtcgcacccgcggtttaa AatII SphI AatII in SLE (SEQ ID NO:11)
(SEQ ID NO:12) YF/MVE X-aatttcgaaaggtggaaggtc
gaccggtgtttacagccgcggtttaa AatII AgeI (AgeI in YF) (SEQ ID NO:13)
(SEQ ID NO:14) YF/TBE X-tactgcgaacgacgttgccac
actgggaacctcacccgcggtttaa AatII AgeI (AgeI in YF) (SEQ ID NO:15)
(SEQ ID NO:16) .sup.1, 2The column illustrates the oligonucleotide
used to generate chimeric YF/Flavivirus primers corresponding to
the C/prM or E/NS1 # junction. (See text). X = carboxyl terminal
coding sequence of the YF capsid. The underlined region corresponds
to the targeted heterologous sequence immediately upstream of the
NarI site (antisense-ccgcgg). This site allows insertion of PCR
products into the Yfm5.2 (NarI) plasmid required for generating
full-length cDNA templates. Other nucleotides are specific # to the
heterologous virus. Oligonucleotide primers are listed 5' to 3'.
.sup.3, 4The unique restriction sites used for creating restriction
fragments that can be isolated and ligated in vitro to produce
full-length chimeric cDNA templates are listed. Because some
sequences do not contain convenient sites, engineering of
appropriate sites is required in some cases (footnote 5). .sup.5In
parentheses are the restriction enzyme sites that must be created
either in the YF backbone or the heterologous virus to allow
efficient in vitro ligation. Sites not in parentheses must be
eliminated. All such modifications are done by silent mutagenesis
of the cDNA for the respective clone. Blank spaces indicate that no
modification of the cDNA clones is required.
[0506]
70TABLE 21 Sequence comparison of Dengue-2 and YF/Den-2.sub.218
viruses prM Virus 28 31 55 57 125 152 161 YF/D2.sub.218 E V L R I A
V PUO- E V L R I A V 218 NGC E V F R T A V PR-159 K T F K T V I
(S1) ENVELOPE Virus 71 81 126 129 139 141 162 164 202 203 335 352
390 402 484 YF/D2.sub.218 E S E V I V I V E N I I N F I PUO- E S E
V I V I V E N I I N F I 218 NGC D S K V I I I I E N I I N I V
PR-159 D T E I V I V I K D T T D F I (S1)
[0507]
71TABLE 22 Summary of histopathology results, monkeys inoculated
with YF-VAX .RTM. (Yellow Fever 17D vaccine) or YF/JE SA14-14-2 by
the IC route CHIMERTVAX-JE .TM. (chimeric flavivirus vaccine
comprising Japanese Encephalitis virus YF-VAX .RTM. (Yellow Fever
17D vaccine) prM and E proteins) Discriminator Discriminator plus
Discriminator Discriminator plus Monkey No. area score target area
score Monkey No. area score target area score N030 0.21 0.64 N191 0
0.17 N492 0.04 0.36 N290 0.09 0.06 N479 0 0.17 N431 0.13 0.09 Group
means 0.08 0.39 0.07 0.11
[0508]
72TABLE 23 List of initial chimeric YF/JE mutants constructed to
identify residues involved in attenuation of the CHIMERIVAX .TM.
(chimeric flavivirus vaccine). Reverted amino acids on the
E-proteins are shown in BOLD Positions on CHIMERIVAX .TM. (chimeric
MUTANT VIRUSES E-Protein Nakayama flavivirus vaccine) 1 2 3 4 5 6 7
8 9 10 11 107 L F L F F L L F L F L F L 138 E K K E K K E E E E E E
E 176 I V V V I I V I I V V I I 177 T A A A T T A T T A A T T 227 P
S S S S S S S S P P P P 264 Q H H H H H H H H Q Q Q Q 279 K M M M M
M M M M K K K K
[0509]
73TABLE 24 Experiment to determine neurovirulence and
neuroinvasiveness phenotypes of vaccine candidates in suckling mice
AGE OF MICE (DAYS) Virus Route 3 5 7 9 YF/Den-2 I.C. 10.sup.4*
10.sup.4 10.sup.4 10.sup.4 YF/JESA14-14-2 I.C. 10.sup.4 10.sup.4
10.sup.4 10.sup.4 YF 17D I.P. 10.sup.3 10.sup.3 10.sup.3 10.sup.3
MED + 5% FBS I.C., I.P. -- -- -- -- *PFU/0.02 ml of inoculum
[0510]
74TABLE 25 Summary of differences between virulent (Asibi) and
attenuated (17D, 17DD, RMS, P18) yellow fever viruses Gene NT Asibi
17D204US RMS P18 17D204F 17D213 17DD AA C 264 G A A A A A A 376 T C
C C C C C non-M 643 A A -- -- A A G M 864 C T -- -- T T T LF 883 A
G -- -- G G A E 1127 G A -- -- A A A GR 1140 C T -- -- T T C AV
1431 A A -- -- A C A NT 1436 G G -- -- G G A DS 1437 A A -- -- A A
G 1453 C T -- -- T T T AV 1491 C T -- -- T T T TI 1558 C C -- -- C
C A 1572 A C -- -- C C C KT 1750 C T -- -- T T T 1819 C T -- -- T T
T 1870 G A -- -- A A A MI 1887 C T -- -- T T T SF 1946 C T -- -- T
T C PS 1965 A G -- -- G G G KR 2110 G G -- -- G G A 2112 C G -- --
G G G TR 2142 C A -- -- A A A PH 2219 G A -- -- A A G AT 2320 C C
-- -- C C T TI 2356 C T -- -- T T T NS1 2687 C T T T T T T FL 2704
A G G G G G G 3374 G A A A A A A 3371 A G G G G G G VI 3599 T T T T
T T C 3613 G A A A A A A 3637 C C C C C C T ns2a 3817 G.A G G G G G
G 3860 A G G G G G G VM 3915 T.A T T T T T T 4007 A G G G G G G AT
4013 C T T T T T C FL 4022 A G G G G G G AT 1 G G A A G G G VM 4054
C T T T T T C 4056 C T T T T T T FS ns2b 4204 C C C C C C T 4289 A
C C C C C C LI 4387 A G G G G G G 4505 A C C C C C C LI 4507 T C C
C C C C NS3 4612 T C C C C C C 4864 G.A G G G G G G 4873 T G G G G
G T 4942 A A A A A A G 4957 C C C C C C T 4972 G G G G G G A 5115 A
A A A A A G OR 5131 G.T G G G G G G MM.I 5153 A G G G G G A VI 5194
T C C C C C C 5225 A C C C C C C 5362 C C C C C T A 5431 C T T T T
T T NS3 2 T T C C T T T 5473 C T T T T T T 3 G A G G A G G 6013 C T
T T T T T 6023 G A A A A A A ND ns4a 6070 C C C C C C T 6448 G T T
T T T T 6514 T T T T T T C 6529 T C C C T T T 6625 A A A A A C C
6758 A G G G A A A VI 6829 T C C C C C C 6876 T C C C C C C AV ns4b
7171 A G G G G G G MI 4 G G A A A A A EK 7497 T T T T T C T LS 7571
C A A A A A C NS5 7580 T C C C C C C HY 7642 T C C C C C C 7701 A G
G G G G A RO 7945 C T T T T T C 7975 C C C C C C T 8008 C C C C C C
T 8029 T T T T T T C 5 C C T T C C C 6 A A C C A A A 8629 C T T T T
T T 8808 A A A A A A G NS 9397 A A A A A A G 9605 A G G G A A A DN
10075 G.T G G G G G G MM.I 10142 G A A A A A A KE 10243 G A A A A A
A 10285 T C C C C C C 10312 A -- G G G G G G 10316 T.C T T T T T T
SS.P 3' NC 10339 C G G G G G G 10367 T C C C C C C 10418 T C C C C
C C 10454 A G A A A A A 10550 T C C C C C T 10722 G G G G A G G
10800 G A A A A A A 10847 A C C C C C C NT: nucleotide numbers are
from 5' terminus ot the genome. Where clonal differences were
present, both nucleotides as well as amino acids (if appropriate)
are shown. If nucleotide change results in an amino acid
substitution, the amino acid (AA) is shown from left to right (e.g.
from Asibi to 17D). --: The genes for prME in RMS
(YF17D/JESA14-14-2) and P18 (passage 18th of the RMS) are from JEV
strain SA14-14-2, therefore not comparable with YFV sequences.
Sequences for Asibi is taken from Hahn et al. 1987. 17D204US from
Rice et al. 1985, 17D204F from Dupuy et al. 1989. RMS and P18 are
unpublished sequences (OraVax, Inc.,), 17D213 and 17DD from Duarte
dos Santos et al. 1994. Note that there is no sequence difference
between RMS and passage 18th. There are 6 nucleotide differences
(nucleotide positions are shaded) between published YF17D sequence
and RMS shown in bold letters; Changes in 5461, 5641, 8212 and 8581
are silent and do not result in amino acid substitution. Changes in
positions 4025 and 7319 result in amino acid substitution.
[0511]
75TABLE 26 Immunogenicity of CHIMERTVAX .TM. (chimeric flavivirus
vaccine comprising Dengue-2 virus prM and E proteins) passed in
Vero cells for mice. Passage Dose GMT.sup.b GMT.sup.b level.sup.a
(Log.sub.10pfu) SC IC P3 5 .sup. 1 .+-. 0.sup.c 61 .+-. 47 4 1 .+-.
0 7 .+-. 15 P5 5 1 .+-. 0 46 .+-. 16 4 1 .+-. 0 9 .+-. 20 P10 5 1.8
.+-. 7.7 46 .+-. 53 4 1 .+-. 0 7 .+-. 15 P18 5 1 .+-. 0 53 .+-. 17
4 1 .+-. 0 2 .+-. 16 .sup.aCHIMERIVAX .TM. (chimeric flavivirus
vaccine comprising Dengue-2 virus prM and E proteins) virus was
passaged in Vero .sub.PM cells (P141-147) at MOI of 0.1-0.5 and
harvested 2-3 days PI. .sup.bGeometric Mean Titers measured as the
last dilution of sera which resulted in 50% reduction in number of
virus plaques. .sup.cTiters less than 1:10
[0512]
76TABLE 27 Immunization and challenge of yellow fever immune
monkeys Viremic after 1.sup.st 2.sup.nd Seroconversion wt Den2
Vaccine Vaccine Den2 YF challenge YF17D CHIMERIVAX .TM. 3/3 3/3 0/3
(chimeric flavivirus vaccine comprising Dengue-2 virus prM and E
proteins) YF17D Dengue-2 wt 4/4 4/4 0/4 YF17D YF17D 0/3 3/3 3/3
YF17D None 0/2 2/2 2/2 None None 0/2 0/2 2/2
[0513]
77TABLE 28 Viremia in rhesus monkeys inoculated SC with graded
doses of ChimeriVax .TM.-Den-2 virus. Dose No. Duration Titer Virus
(Log.sub.10PFU) viremic (%) (days) mean mean peak ChimeriVax .TM.-
2.0 4/4 (100) 3.2 1.6 Den-2 3.0 5/5 (100) 3.8 1.6 4.0 5/5 (100) 4.0
1.3 5.0 4/4 (100) 4.3 1.4 Dengue-2 4.0 4/4 (100) 5 3.6 (18603)
[0514]
78TABLE 29 Neutralizing antibody responses in monkeys inoculated
with graded doses of ChimeriVax .TM.-Den-2 and protection against
wild-type dengue-2 challenge No.Viremic after Dose No. GMT by day
Challenge Log.sub.10PFU seroconverted 0 15 30 (D60) 2.0 4/4 <10
47 316 0/4 3.0 5/5 <10 112 275 0/5 4.0 5/5 <10 269 316 0/5
5.0 4/4 <10 631 376 0/4 Sham 0/4 <10 <10 <10 4/4
[0515]
79TABLE 30 Mean virus titer in orally exposed mosquitoes 22 days
post feeding Mosquito # Infected/ Mean Species Virus # Fed Titer*
Ae. aegypti JE SA14-14-2 20/20 6.0 YF 17D 0/30 <1.0 ChimeriVax
.TM.-JE 0/40 <1.0 Ae. JE SA14-14-2 38/38 5.8 albopictus YF 17D
0/44 <1.0 ChimeriVax .TM.-JE 0/56 <1.0 *log.sub.10pfu/ml
[0516]
80TABLE 31 Primers (restriction sites are underlined) #1)
YFM5'3'(4.56) + (GTGAGCATTGAGAAAGCGCCACGCTTC) (SEQ ID NO:17) #2)
YF0.481 - (TCCACCCGTCATCAACAGCATTCCCAAAATTAG) (SEQ ID NO:18) #3)
1DE 0.42 + (GAATGCTGTTGATGACGGGTGGATTTCATCTGACCACACGAGGG) (SEQ ID
NO:19) #4) 1DE 1.095 - (NheI/BstBI)(GCCGCTAGCTTTTCGAAGGACGGCAGGG-
TTTGTGACTTC) (SEQ ID NO:20) #5) 1DE 1.102 +
(BstBI)(GCCATGCATTTCGAAAACTGTGCATCGAAGCTAAAATATC) (SEQ ID NO:21)
#7) 1DE 2.409FUSE - (GGCGCATCCTTGATCGGCGCCAACCATGACTCCTAGGTACAG)
(SEQ ID NO:22) #8) YF NarI + (GGCGCCGATCAAGGATGCGCCATC) (SEQ ID
NO:23) #9) YF 8.545 - (CCAAGAGGTCATGTACTCAG) (SEQ ID NO:24) #10)
SP6YFa + (ATTTAGGTGACACTATAGAGTAAATCCTGTGT- GCTAATT) (SEQ ID
NO:25)
[0517]
81TABLE 32 Oligonucleotide primers. No. Sequence Name 1 3D 0.432 +
5'-GAATGCTGTTGATGACGGGTGGATTCCACTTAACTTCACGAGATGG (SEQ ID NO:26) 2
3DE 1.095 - 5'-GCCGCTAGCCTTTCGAAGGGTCGCCAGCTGAGTGGCCTC (SEQ ID
NO:27) 3 3DE 1.102 + 5'-GCCGCTAGCTTCGAAAGCTATGCATTGAGGGAA- AAATTAC
(SEQ ID NO:28) 4 3DE 2.409 - 5'-GCCGCCGGCGCCCACCACGACCCCCAGATAGAGTG
(SEQ ID NO:29) 5 YFM5'3'(4.65) + 5'-GTGAGCATTGAGAAAGCGCCACGCTTC
(SEQ ID NO:30) 6 YF 0.481 - 5'-TCCACCCGTCATCAACAGCATTCCCAAAATTAG
(SEQ ID NO:31) 7 YF 0.2 + 5'-ATGGTACGACGAGGAGTTCGC (SEQ ID NO:32) 8
Kpd3/-Xho/+ 5'-GGTTGATGTGGTGCTGGAGCACGGTGGGTGTG (SEQ ID NO:33) 9
PsD3/.7 + 5'-TACATCGACATGGGTGAC (SEQ ID NO:34) 10 KPsD3/.75 -
5'-GACATGGGGAGCTAACGC (SEQ ID NO:35) 11 KPsD3/1.5 -
5'-CCCGAGGGTTCCATATTCAGG (SEQ ID NO:36) 12 KPsD3/1.6 +
5'-GGAACAGGAAAGAGCTTC (SEQ ID NO:37) 13 KPsD3/1.9 -
5'-GAGTATTGTCCCATGCTG (SEQ ID NO:38) 14 KPsD3/2.1 +
5'-GGAATTGGAGACAAAGCC (SEQ ID NO:39) 15 KPs5.2 0.23 +
5'-TGGATAGTGGACAGACAGTGG (SEQ ID NO:40) 16 KPs5.2 1.66 -
5'-CTCTAAATATGAAGATACCATC (SEQ ID NO:41) 17 SP6-yfa
5'-ATTTAGGTGACACTATAGAGTAAATCCTGTGTGCTAATT (SEQ ID NO:42)
[0518]
82TABLE 33 Amino acid differences in the prM-E region of DEN3 H87
and PaH881/88 strains Position H87(PaH881/88 Position H87(PaH881/88
(nt/gene).sup.1 (codon change) (a.a.).sup.2 (a.a. change) 599/prM
CAC CTC 168 HL 605/prM ACC GCC 171 TA 932/prM ACA GCA 280 TA 1373/E
GAC AAC 427 DN 1394/E GAA GAC 434 ED 1424/E TCC CCC 444 SP 1439/E
GCT GTT 449 AV 1607/E AAA GAG 505 KE 1742/E ACC AAC 550 TN 1805/E
AAA GAA 571 KE 2105/E AGG AAG 671 RK 2366/E ATT GTT 758 IV
.sup.1Positions of nucleotides in the DEN3 genome; numbering is
according to (Osatomi et al., Virology 176:643-647, 1990).
.sup.2Positions of amino acid residues in the DEN3 polyprotein;
numbering is according to (Osatomi et al., Virology 176:643-647,
1990).
[0519]
83TABLE 34 #1) YFM5'3'(4.56) + (GTGAGCATTGAGAAAGCGCCACGCTTC) (SEQ
ID NO:43) #2) YF0.481 - (TCCACCCGTCATCAACAGCATTCCCAAAATTAG) (SEQ ID
NO:44) #3) 4DE 0.432 +
(GAATGCTGTTGATGACGGGTGAATTTCACCTGTCAAGAAGAGACGG) (SEQ ID NO:45) #4)
4DEE 1.095 - (GCCGCTAGCGGTTCGAAATAGAGCCACTTCCT- TGGCTGT) (SEQ ID
NO:46) #5) 4DE 1.102 + (GCCGCTAGCTTCGAACCTATTGCATTGAAGCCTCGATATC)
(SEQ ID NO:47) #6) 4DE 2.409 -
(GCCGCCGGCGCCAACTGTGAAACCTAGAAACACAG) (SEQ ID NO:48) #7) sp6YFa +
(ATTTAGGTGACACTATAGAGTAAATCCTGTGTGCTAATT) (SEQ ID NO:49)
Other Embodiments
[0520] Other embodiments are within the following claims. For
example, the prM-E protein genes of other flaviviruses of medical
importance can be inserted into the yellow fever vaccine virus
backbone to produce vaccines against other medically important
flaviviruses (see, e.g., Monath et al., "Flaviviruses," In
Virology, Fields (ed.), Raven-Lippincott, New York, 1995, Volume
1,961-1034). Examples of additional flaviviruses from which genes
to be inserted into the chimeric vectors of the invention can be
obtained include, e.g., Kunjin, Central European Encephalitis,
Russian Spring-Summer Encephalitis, Powassan, Kyasanur Forest
Disease, and Omsk Hemorrhagic Fever viruses. In addition, genes
from even more distantly related viruses can be inserted into the
yellow fever vaccine virus to construct novel vaccines.
[0521] Vaccine Production and Use
[0522] The vaccines of the invention are administered in amounts,
and by using methods, that can readily be determined by persons of
ordinary skill in this art. The vaccines can be administered and
formulated, for example, in the same manner as the yellow fever 17D
vaccine, e.g., as a clarified suspension of infected chicken embryo
tissue, or a fluid harvested from cell cultures infected with the
chimeric yellow fever virus. Thus, the live, attenuated chimeric
virus is formulated as a sterile aqueous solution containing
between 100 and 1,000,000 infectious units (e.g., plaque-forming
units or tissue culture infectious doses) in a dose volume of 0.1
to 1.0 ml, to be administered by, for example, intramuscular,
subcutaneous, or intradermal routes. In addition, because
flaviviruses may be capable of infecting the human host via the
mucosal routes, such as the oral route (Gresikova et al.,
"Tick-borne Encephalitis," In The Arboviruses, Ecology and
Epidemiology, Monath (ed.), CRC Press, Boca Raton, Fla., 1988,
Volume IV, 177-203), the vaccine virus can be administered by a
mucosal route to achieve a protective immune response. The vaccine
can be administered as a primary prophylactic agent in adults or
children at risk of flavivirus infection. The vaccines can also be
used as secondary agents for treating flavivirus-infected patients
by stimulating an immune response against the flavivirus.
[0523] It may be desirable to use the yellow fever vaccine vector
system for immunizing a host against one virus (for example,
Japanese Encephalitis virus) and to later reimmunize the same
individual against a second or third virus using a different
chimeric construct. A significant advantage of the chimeric yellow
fever system is that the vector will not elicit strong immunity to
itself. Nor will prior immunity to yellow fever virus preclude the
use of the chimeric vaccine as a vector for heterologous gene
expression. These advantages are due to the removal of the portion
of the yellow fever vaccine E gene that encodes neutralizing
(protective) antigens to yellow fever, and replacement with
another, heterologous gene that does not provide cross-protection
against yellow fever. Although YF 17D virus nonstructural proteins
may play a role in protection, for example, by eliciting antibodies
against NS1, which is involved in complement-dependent antibody
mediated lysis of infected cells (Schlesinger et al., J. Immunology
135:2805-2809, 1985), or by inducing cytotoxic T cell responses to
NS3 or other proteins of the virus, it is unlikely that these
responses will abrogate the ability of a live virus vaccine to
stimulate neutralizing antibodies. This is supported by the facts
that (1) individuals who have been previously infected with JE
virus respond to vaccination with YF 17D similarly to persons
without previous JE infection, and (2) individuals who have
previously received the YF 17D vaccine respond to revaccination
with a rise in neutralizing antibody titers (Sweet et al., Am. J.
Trop. Med. Hyg. 11:562-569, 1962). Thus, the chimeric vector can be
used in populations that are immune to yellow fever because of
prior natural infection or vaccination, and can be used repeatedly,
or to immunize simultaneously or sequentially with several
different constructs, including yellow fever chimeras with inserts
from, for example, Japanese Encephalitis, St. Louis Encephalitis,
or West Nile viruses.
[0524] For vaccine applications, adjuvants that are known to those
skilled in the art can be used. Adjuvants that can be used to
enhance the immunogenicity of the chimeric vaccines include, for
example, liposomal formulations, synthetic adjuvants, such as
saponins (e.g., QS21), muramyl dipeptide, monophosphoryl lipid A,
or polyphosphazine. Although these adjuvants are typically used to
enhance immune responses to inactivated vaccines, they can also be
used with live vaccines. In the case of a chimeric vaccine
delivered via a mucosal route, for example, orally, mucosal
adjuvants such as the heat-labile toxin of E. coli (LT) or mutant
derivations of LT are useful adjuvants. In addition, genes encoding
cytokines that have adjuvant activities can be inserted into the
yellow fever vectors. Thus, genes encoding cytokines, such as
a-interferon, GM-CSF, IL-2, IL-12, IL-13, or IL-5, can be inserted
together with heterologous flavivirus genes to produce a vaccine
that results in enhanced immune responses, or to modulate immunity
directed more specifically towards cellular, humoral, or mucosal
responses.
[0525] In addition to vaccine applications, as one skilled in the
art can readily understand, the vectors of the invention can be
used in gene therapy methods to introduce therapeutic gene products
into a patient's cells and in cancer therapy. In these methods,
genes encoding therapeutic gene products are inserted into the
vectors, for example, in place of the gene encoding the prM-E
protein.
[0526] Yellow fever 17D virus targets cells of the lymphoid and
reticuloendothelial systems, including precursors in bone marrow,
monocytes, macrophages, T cells, and B cells (Monath, "Pathobiology
of the Flaviviruses," pp. 375-425, in Schlesinger & Schlesinger
(Eds.), "The Togaviridae and Flaviviridae," Plenum Press, New York
1986). The yellow fever 17D virus thus naturally targets cells
involved in antigen presentation and immune stimulation.
Replication of the virus in these cells, with high-level expression
of heterologous genes, makes yellow fever 17D vaccine virus an
ideal vector for gene therapy or immunotherapy against cancers of
the lymphoreticular system and leukemias, for example. Additional
advantages are that (1) the flavivirus genome does not integrate
into host cell DNA, (2) yellow fever virus appears to persist in
the host for prolonged periods, and (3) that heterologous genes can
be inserted at the 3' end of the yellow fever vector, as described
above in the strategy for producing a Hepatitis C vaccine. Yellow
fever 17D virus can be used as a vector carrying tumor antigens for
induction of immune responses for cancer immunotherapy. As a second
application, yellow fever 17D can be used to target lymphoreticular
tumors and express heterologous genes that have anti-tumor effects,
including cytokines, such as TNF-alpha. As a third application,
yellow fever 17D can be used to target heterologous genes to bone
marrow to direct expression of bioactive molecules required to
treat hematologic diseases, such as, for example, neutropenia; an
example of a bioactive molecule that can be used in such an
application is GM-CSF, but other appropriate bioactive molecules
can be selected by those skilled in the art.
[0527] An additional advantage of the yellow fever vector system is
that flaviviruses replicate in the cytoplasm of cells, so that the
virus replication strategy does not involve integration of the
viral genome into the host cell (Chambers et al., "Flavivirus
Genome Organization, Expression, and Replication," In Annual Review
of Microbiology 44:649-688, 1990), providing an important safety
measure.
[0528] All references cited herein are incorporated by reference in
their entirety.
Sequence CWU 1
1
85 1 21 DNA Artificial Sequence derived from Yellow Fever virus and
West Nile virus 1 cactgggaga gcttgaaggt c 21 2 25 DNA Artificial
Sequence derived from Yellow Fever virus and West Nile virus 2
aaagccagtt gcagccgcgg tttaa 25 3 21 DNA Artificial Sequence derived
from Yellow Fever virus and Dengue-1 virus 3 aaggtagact ggtgggctcc
c 21 4 26 DNA Artificial Sequence derived from Yellow Fever virus
and Dengue-1 virus 4 gatcctcagt accaaccgcg gtttaa 26 5 21 DNA
Artificial Sequence derived from Yellow Fever virus and Dengue-2
virus 5 aaggtagatt ggtgtgcatt g 21 6 26 DNA Artificial Sequence
derived from Yellow Fever virus and Dengue-2 virus 6 aaccctcagt
accacccgcg gtttaa 26 7 21 DNA Artificial Sequence derived from
Yellow Fever virus and Dengue-3 virus 7 aaggtgaatt gaagtgctct a 21
8 25 DNA Artificial Sequence derived from Yellow Fever virus and
Dengue-3 virus 8 acccccagca ccacccgcgg tttaa 25 9 21 DNA Artificial
Sequence derived from Yellow Fever virus and Dengue-4 virus 9
aaaaggaaca gttgttctct a 21 10 25 DNA Artificial Sequence derived
from Yellow Fever virus and Dengue-4 virus 10 acccgaagtg tcaaccgcgg
tttaa 25 11 21 DNA Artificial Sequence derived from Yellow Fever
virus and St. Louis Encephalitis virus 11 aacgtgaata gttggatagt c
21 12 25 DNA Artificial Sequence derived from Yellow Fever virus
and St. Louis Encephalitis virus 12 accgttggtc gcacccgcgg tttaa 25
13 21 DNA Artificial Sequence derived from Yellow Fever virus and
Murray Valley Encephalitis virus 13 aatttcgaaa ggtggaaggt c 21 14
26 DNA Artificial Sequence derived from Yellow Fever virus and
Murray Valley Encephalitis virus 14 gaccggtgtt tacagccgcg gtttaa 26
15 21 DNA Artificial Sequence derived from Yellow Fever virus and
Tick-Borne Encephalitis virus 15 tactgcgaac gacgttgcca c 21 16 25
DNA Artificial Sequence derived from Yellow Fever virus and
Tick-Borne Encephalitis virus 16 actgggaacc tcacccgcgg tttaa 25 17
27 DNA Yellow Fever virus 17 gtgagcattg agaaagcgcc acgcttc 27 18 33
DNA Yellow Fever virus 18 tccacccgtc atcaacagca ttcccaaaat tag 33
19 43 DNA Dengue virus 19 gaatgctgtt gatgacgggt ggatttcatc
tgaccacacg agg 43 20 39 DNA Dengue virus 20 gccgctagct tttcgaagga
cggcagggtt tgtgacttc 39 21 40 DNA Dengue virus 21 gccatgcatt
tcgaaaactg tgcatcgaag ctaaaatatc 40 22 42 DNA Dengue virus 22
ggcgcatcct tgatcggcgc caaccatgac tcctaggtac ag 42 23 24 DNA Yellow
Fever virus 23 ggcgccgatc aaggatgcgc catc 24 24 20 DNA Yellow Fever
virus 24 ccaagaggtc atgtactcag 20 25 39 DNA Yellow Fever virus 25
atttaggtga cactatagag taaatcctgt gtgctaatt 39 26 46 DNA Dengue-3
virus 26 gaatgctgtt gatgacgggt ggattccact taacttcacg agatgg 46 27
39 DNA Dengue-3 virus 27 gccgctagcc tttcgaaggg tcgccagctg agtggcctc
39 28 40 DNA Dengue-3 virus 28 gccgctagct tcgaaagcta tgcattgagg
gaaaaattac 40 29 35 DNA Dengue-3 virus 29 gccgccggcg cccaccacga
cccccagata gagtg 35 30 27 DNA Dengue-3 virus 30 gtgagcattg
agaaagcgcc acgcttc 27 31 33 DNA Dengue-3 virus 31 tccacccgtc
atcaacagca ttcccaaaat tag 33 32 21 DNA Dengue-3 virus 32 atggtacgac
gaggagttcg c 21 33 32 DNA Dengue-3 virus 33 ggttgatgtg gtgctggagc
acggtgggtg tg 32 34 18 DNA Dengue-3 virus 34 tacatcgaca tgggtgac 18
35 18 DNA Dengue-3 virus 35 gacatgggga gctaacgc 18 36 21 DNA
Dengue-3 virus 36 cccgagggtt ccatattcag g 21 37 18 DNA Dengue-3
virus 37 ggaacaggaa agagcttc 18 38 18 DNA Dengue-3 virus 38
gagtattgtc ccatgctg 18 39 18 DNA Dengue-3 virus 39 ggaattggag
acaaagcc 18 40 21 DNA Dengue-3 virus 40 tggatagtgg acagacagtg g 21
41 22 DNA Dengue-3 virus 41 ctctaaatat gaagatacca tc 22 42 39 DNA
Dengue-3 virus 42 atttaggtga cactatagag taaatcctgt gtgctaatt 39 43
27 DNA Dengue-3 virus 43 gtgagcattg agaaagcgcc acgcttc 27 44 33 DNA
Dengue-3 virus 44 tccacccgtc atcaacagca ttcccaaaat tag 33 45 46 DNA
Dengue-3 virus 45 gaatgctgtt gatgacgggt gaatttcacc tgtcaacaag
agacgg 46 46 39 DNA Dengue-3 virus 46 gccgctagcg gttcgaaata
gagccacttc cttggctgt 39 47 40 DNA Dengue-3 virus 47 gccgctagct
tcgaacctat tgcattgaag cctcgatatc 40 48 35 DNA Dengue-3 virus 48
gccgccggcg ccaactgtga aacctagaaa cacag 35 49 39 DNA Dengue-3 virus
49 atttaggtga cactatagag taaatcctgt gtgctaatt 39 50 1983 DNA
Dengue-2 virus CDS (1)...(1983) 50 ttc cat cta acc aca cgt aac gga
gaa cca cac atg atc gtc agt aga 48 Phe His Leu Thr Thr Arg Asn Gly
Glu Pro His Met Ile Val Ser Arg 1 5 10 15 caa gag aaa ggg aaa agt
ctt ttg ttt aaa aca gag gat ggc gtg aac 96 Gln Glu Lys Gly Lys Ser
Leu Leu Phe Lys Thr Glu Asp Gly Val Asn 20 25 30 atg tgc acc ctc
atg gcc atg gac ctt ggt gaa ttg tgt gaa gac aca 144 Met Cys Thr Leu
Met Ala Met Asp Leu Gly Glu Leu Cys Glu Asp Thr 35 40 45 atc acg
tac aag tgt ccc ctt ctc agg cag aat gag cca gaa gac ata 192 Ile Thr
Tyr Lys Cys Pro Leu Leu Arg Gln Asn Glu Pro Glu Asp Ile 50 55 60
gac tgc tgg tgc aac tcc acg tcc acg tgg gta acc tat ggg act tgt 240
Asp Cys Trp Cys Asn Ser Thr Ser Thr Trp Val Thr Tyr Gly Thr Cys 65
70 75 80 acc acc acg gga gaa cat aga aga gaa aaa aga tca gtg gca
ctc gtt 288 Thr Thr Thr Gly Glu His Arg Arg Glu Lys Arg Ser Val Ala
Leu Val 85 90 95 cca cat gtg gga atg gga ctg gag acg cga act gaa
aca tgg atg tca 336 Pro His Val Gly Met Gly Leu Glu Thr Arg Thr Glu
Thr Trp Met Ser 100 105 110 tca gaa ggg gct tgg aaa cat gcc cag aga
att gaa att tgg atc ctg 384 Ser Glu Gly Ala Trp Lys His Ala Gln Arg
Ile Glu Ile Trp Ile Leu 115 120 125 aga cat cca ggc ttc acc ata atg
gca gca atc ctg gca tac acc ata 432 Arg His Pro Gly Phe Thr Ile Met
Ala Ala Ile Leu Ala Tyr Thr Ile 130 135 140 ggg acg aca cat ttc cag
aga gca ctg att ttc atc tta ctg aca gct 480 Gly Thr Thr His Phe Gln
Arg Ala Leu Ile Phe Ile Leu Leu Thr Ala 145 150 155 160 gtc gct cct
tca atg aca atg cgt tgc ata gga ata tca aat aga gac 528 Val Ala Pro
Ser Met Thr Met Arg Cys Ile Gly Ile Ser Asn Arg Asp 165 170 175 ttt
gta gaa ggg gtt tca gga gga agc tgg gtt gac ata gtc tta gaa 576 Phe
Val Glu Gly Val Ser Gly Gly Ser Trp Val Asp Ile Val Leu Glu 180 185
190 cat gga agc tgt gtg acg acg atg gca aaa aac aaa cca aca ttg gat
624 His Gly Ser Cys Val Thr Thr Met Ala Lys Asn Lys Pro Thr Leu Asp
195 200 205 ttt gaa ctg ata aaa aca gaa gcc aaa cag cct gcc acc cta
agg aag 672 Phe Glu Leu Ile Lys Thr Glu Ala Lys Gln Pro Ala Thr Leu
Arg Lys 210 215 220 tac tgt ata gag gca aag cta acc aac aca aca aca
gaa tct cgt tgc 720 Tyr Cys Ile Glu Ala Lys Leu Thr Asn Thr Thr Thr
Glu Ser Arg Cys 225 230 235 240 cca aca caa ggg gaa ccc agc cta aat
gaa gag cag gat aaa agg ttc 768 Pro Thr Gln Gly Glu Pro Ser Leu Asn
Glu Glu Gln Asp Lys Arg Phe 245 250 255 gtc tgc aaa cac tcc atg gta
gac aga gga tgg gga aat gga tgt gga 816 Val Cys Lys His Ser Met Val
Asp Arg Gly Trp Gly Asn Gly Cys Gly 260 265 270 tta ttt gga aag gga
ggc att gtg acc tgt gct atg ttc aca tgc aaa 864 Leu Phe Gly Lys Gly
Gly Ile Val Thr Cys Ala Met Phe Thr Cys Lys 275 280 285 aag aac atg
gag gga aaa gtt gtg cag cca gaa aac ttg gaa tac acc 912 Lys Asn Met
Glu Gly Lys Val Val Gln Pro Glu Asn Leu Glu Tyr Thr 290 295 300 att
gtg gta aca ccc cac tca ggg gaa gag cat gcg gtc gga aat gac 960 Ile
Val Val Thr Pro His Ser Gly Glu Glu His Ala Val Gly Asn Asp 305 310
315 320 aca gga aaa cat ggc aag gaa atc aaa gta aca cca cag agt tcc
atc 1008 Thr Gly Lys His Gly Lys Glu Ile Lys Val Thr Pro Gln Ser
Ser Ile 325 330 335 aca gaa gca gaa ttg aca ggt tat ggc act gtc acg
atg gag tgc tct 1056 Thr Glu Ala Glu Leu Thr Gly Tyr Gly Thr Val
Thr Met Glu Cys Ser 340 345 350 ccg aga aca ggc ctc gac ttc aat gag
atg gtg ttg ctg cag atg gaa 1104 Pro Arg Thr Gly Leu Asp Phe Asn
Glu Met Val Leu Leu Gln Met Glu 355 360 365 aat aaa gct tgg ctg gtg
cat agg caa tgg ttc cta gac ctg ccg tta 1152 Asn Lys Ala Trp Leu
Val His Arg Gln Trp Phe Leu Asp Leu Pro Leu 370 375 380 cca tgg ctg
ccc gga gcg gac aca caa ggg tca aat tgg ata caa aaa 1200 Pro Trp
Leu Pro Gly Ala Asp Thr Gln Gly Ser Asn Trp Ile Gln Lys 385 390 395
400 gaa aca ttg gtc act ttc aaa aat cct cat gcg aag aaa cag gat gtt
1248 Glu Thr Leu Val Thr Phe Lys Asn Pro His Ala Lys Lys Gln Asp
Val 405 410 415 gtt gtt tta gga tcc caa gaa ggg gcc atg cac aca gca
ctc aca ggg 1296 Val Val Leu Gly Ser Gln Glu Gly Ala Met His Thr
Ala Leu Thr Gly 420 425 430 gcc aca gaa atc caa atg tca tca gga aac
tta ctc ttc aca gga cat 1344 Ala Thr Glu Ile Gln Met Ser Ser Gly
Asn Leu Leu Phe Thr Gly His 435 440 445 ctc aag tgc agg ctg aga atg
gac aag cta cag ctc aaa gga atg tca 1392 Leu Lys Cys Arg Leu Arg
Met Asp Lys Leu Gln Leu Lys Gly Met Ser 450 455 460 tac tct atg tgc
aca gga aag ttt aaa gtt gtg aag gaa ata gca gaa 1440 Tyr Ser Met
Cys Thr Gly Lys Phe Lys Val Val Lys Glu Ile Ala Glu 465 470 475 480
aca caa cat gga aca ata gtt atc agg gtg cag tat gaa ggg gac ggc
1488 Thr Gln His Gly Thr Ile Val Ile Arg Val Gln Tyr Glu Gly Asp
Gly 485 490 495 tct cca tgt aaa atc cct ttt gag ata atg gat ttg gaa
aaa aga cat 1536 Ser Pro Cys Lys Ile Pro Phe Glu Ile Met Asp Leu
Glu Lys Arg His 500 505 510 gtc tta ggt cgc ctg atc aca gtc aac cca
att gtg aca gaa aaa gat 1584 Val Leu Gly Arg Leu Ile Thr Val Asn
Pro Ile Val Thr Glu Lys Asp 515 520 525 agc cca gtc aac ata gaa gca
gaa cct cca ttc gga gac agc tac atc 1632 Ser Pro Val Asn Ile Glu
Ala Glu Pro Pro Phe Gly Asp Ser Tyr Ile 530 535 540 atc ata gga gta
gag ccg gga caa ctg aag ctc aac tgg ttt aag aaa 1680 Ile Ile Gly
Val Glu Pro Gly Gln Leu Lys Leu Asn Trp Phe Lys Lys 545 550 555 560
gga agt tct atc ggc caa atg ttt gag aca aca atg agg ggg gcg aag
1728 Gly Ser Ser Ile Gly Gln Met Phe Glu Thr Thr Met Arg Gly Ala
Lys 565 570 575 aga atg gcc att ttg ggt gac aca gcc tgg gat ttt gga
tcc ctg gga 1776 Arg Met Ala Ile Leu Gly Asp Thr Ala Trp Asp Phe
Gly Ser Leu Gly 580 585 590 gga gtg ttt aca tct ata gga aaa gcc ctc
cac caa gtc ttt gga gca 1824 Gly Val Phe Thr Ser Ile Gly Lys Ala
Leu His Gln Val Phe Gly Ala 595 600 605 atc tat gga gct gcc ttc agt
ggg gtc tca tgg act atg aaa atc ctc 1872 Ile Tyr Gly Ala Ala Phe
Ser Gly Val Ser Trp Thr Met Lys Ile Leu 610 615 620 ata gga gtc att
atc aca tgg ata gga atg aat tca cgc agc acc tca 1920 Ile Gly Val
Ile Ile Thr Trp Ile Gly Met Asn Ser Arg Ser Thr Ser 625 630 635 640
ctg tct gtg tca cta gta ttg gtg gga gtc gtg acg ctg tat ttg gga
1968 Leu Ser Val Ser Leu Val Leu Val Gly Val Val Thr Leu Tyr Leu
Gly 645 650 655 gtt atg gtg ggc gcc 1983 Val Met Val Gly Ala 660 51
661 PRT Dengue-2 virus 51 Phe His Leu Thr Thr Arg Asn Gly Glu Pro
His Met Ile Val Ser Arg 1 5 10 15 Gln Glu Lys Gly Lys Ser Leu Leu
Phe Lys Thr Glu Asp Gly Val Asn 20 25 30 Met Cys Thr Leu Met Ala
Met Asp Leu Gly Glu Leu Cys Glu Asp Thr 35 40 45 Ile Thr Tyr Lys
Cys Pro Leu Leu Arg Gln Asn Glu Pro Glu Asp Ile 50 55 60 Asp Cys
Trp Cys Asn Ser Thr Ser Thr Trp Val Thr Tyr Gly Thr Cys 65 70 75 80
Thr Thr Thr Gly Glu His Arg Arg Glu Lys Arg Ser Val Ala Leu Val 85
90 95 Pro His Val Gly Met Gly Leu Glu Thr Arg Thr Glu Thr Trp Met
Ser 100 105 110 Ser Glu Gly Ala Trp Lys His Ala Gln Arg Ile Glu Ile
Trp Ile Leu 115 120 125 Arg His Pro Gly Phe Thr Ile Met Ala Ala Ile
Leu Ala Tyr Thr Ile 130 135 140 Gly Thr Thr His Phe Gln Arg Ala Leu
Ile Phe Ile Leu Leu Thr Ala 145 150 155 160 Val Ala Pro Ser Met Thr
Met Arg Cys Ile Gly Ile Ser Asn Arg Asp 165 170 175 Phe Val Glu Gly
Val Ser Gly Gly Ser Trp Val Asp Ile Val Leu Glu 180 185 190 His Gly
Ser Cys Val Thr Thr Met Ala Lys Asn Lys Pro Thr Leu Asp 195 200 205
Phe Glu Leu Ile Lys Thr Glu Ala Lys Gln Pro Ala Thr Leu Arg Lys 210
215 220 Tyr Cys Ile Glu Ala Lys Leu Thr Asn Thr Thr Thr Glu Ser Arg
Cys 225 230 235 240 Pro Thr Gln Gly Glu Pro Ser Leu Asn Glu Glu Gln
Asp Lys Arg Phe 245 250 255 Val Cys Lys His Ser Met Val Asp Arg Gly
Trp Gly Asn Gly Cys Gly 260 265 270 Leu Phe Gly Lys Gly Gly Ile Val
Thr Cys Ala Met Phe Thr Cys Lys 275 280 285 Lys Asn Met Glu Gly Lys
Val Val Gln Pro Glu Asn Leu Glu Tyr Thr 290 295 300 Ile Val Val Thr
Pro His Ser Gly Glu Glu His Ala Val Gly Asn Asp 305 310 315 320 Thr
Gly Lys His Gly Lys Glu Ile Lys Val Thr Pro Gln Ser Ser Ile 325 330
335 Thr Glu Ala Glu Leu Thr Gly Tyr Gly Thr Val Thr Met Glu Cys Ser
340 345 350 Pro Arg Thr Gly Leu Asp Phe Asn Glu Met Val Leu Leu Gln
Met Glu 355 360 365 Asn Lys Ala Trp Leu Val His Arg Gln Trp Phe Leu
Asp Leu Pro Leu 370 375 380 Pro Trp Leu Pro Gly Ala Asp Thr Gln Gly
Ser Asn Trp Ile Gln Lys 385 390 395 400 Glu Thr Leu Val Thr Phe Lys
Asn Pro His Ala Lys Lys Gln Asp Val 405 410 415 Val Val Leu Gly Ser
Gln Glu Gly Ala Met His Thr Ala Leu Thr Gly 420 425 430 Ala Thr Glu
Ile Gln Met Ser Ser Gly Asn Leu Leu Phe Thr Gly His 435 440 445 Leu
Lys Cys Arg Leu Arg Met Asp Lys Leu Gln Leu Lys Gly Met Ser 450 455
460 Tyr Ser Met Cys Thr Gly Lys Phe Lys Val Val Lys Glu Ile Ala Glu
465 470 475 480 Thr Gln His Gly Thr Ile Val Ile Arg Val Gln Tyr Glu
Gly Asp Gly 485 490 495 Ser Pro Cys Lys Ile Pro Phe Glu Ile Met Asp
Leu Glu Lys Arg His 500 505 510 Val Leu Gly Arg Leu Ile Thr Val Asn
Pro Ile Val Thr Glu Lys Asp 515 520 525 Ser Pro Val Asn Ile Glu Ala
Glu Pro Pro Phe Gly Asp Ser Tyr Ile 530
535 540 Ile Ile Gly Val Glu Pro Gly Gln Leu Lys Leu Asn Trp Phe Lys
Lys 545 550 555 560 Gly Ser Ser Ile Gly Gln Met Phe Glu Thr Thr Met
Arg Gly Ala Lys 565 570 575 Arg Met Ala Ile Leu Gly Asp Thr Ala Trp
Asp Phe Gly Ser Leu Gly 580 585 590 Gly Val Phe Thr Ser Ile Gly Lys
Ala Leu His Gln Val Phe Gly Ala 595 600 605 Ile Tyr Gly Ala Ala Phe
Ser Gly Val Ser Trp Thr Met Lys Ile Leu 610 615 620 Ile Gly Val Ile
Ile Thr Trp Ile Gly Met Asn Ser Arg Ser Thr Ser 625 630 635 640 Leu
Ser Val Ser Leu Val Leu Val Gly Val Val Thr Leu Tyr Leu Gly 645 650
655 Val Met Val Gly Ala 660 52 10892 DNA Artificial Sequence
derived from Yellow Fever virus and Japanese Encephalitis virus 52
agtaaatcct gtgtgctaat tgaggtgcat tggtctgcaa atcgagttgc taggcaataa
60 acacatttgg attaatttta atcgttcgtt gagcgattag cagagaactg accagaac
118 atg tct ggt cgt aaa gct cag gga aaa acc ctg ggc gtc aat atg gta
166 Met Ser Gly Arg Lys Ala Gln Gly Lys Thr Leu Gly Val Asn Met Val
1 5 10 15 cga cga gga gtt cgc tcc ttg tca aac aaa ata aaa caa aaa
aca aaa 214 Arg Arg Gly Val Arg Ser Leu Ser Asn Lys Ile Lys Gln Lys
Thr Lys 20 25 30 caa att gga aac aga cct gga cct tca aga ggt gtt
caa gga ttt atc 262 Gln Ile Gly Asn Arg Pro Gly Pro Ser Arg Gly Val
Gln Gly Phe Ile 35 40 45 ttt ttc ttt ttg ttc aac att ttg act gga
aaa aag atc aca gcc cac 310 Phe Phe Phe Leu Phe Asn Ile Leu Thr Gly
Lys Lys Ile Thr Ala His 50 55 60 cta aag agg ttg tgg aaa atg ctg
gac cca aga caa ggc ttg gct gtt 358 Leu Lys Arg Leu Trp Lys Met Leu
Asp Pro Arg Gln Gly Leu Ala Val 65 70 75 80 cta agg aaa gtc aag aga
gtg gtg gcc agt ttg atg aga gga ttg tcc 406 Leu Arg Lys Val Lys Arg
Val Val Ala Ser Leu Met Arg Gly Leu Ser 85 90 95 tca agg aaa cgc
cgt tcc cat gat gtt ctg act gtg caa ttc cta att 454 Ser Arg Lys Arg
Arg Ser His Asp Val Leu Thr Val Gln Phe Leu Ile 100 105 110 ttg gga
atg ctg ttg atg acg ggt gga atg aag ttg tcg aat ttc cag 502 Leu Gly
Met Leu Leu Met Thr Gly Gly Met Lys Leu Ser Asn Phe Gln 115 120 125
ggg aag ctt ttg atg acc atc aac aac acg gac att gca gac gtt atc 550
Gly Lys Leu Leu Met Thr Ile Asn Asn Thr Asp Ile Ala Asp Val Ile 130
135 140 gtg att ccc acc tca aaa gga gag aac aga tgt tgg gtt cgg gca
atc 598 Val Ile Pro Thr Ser Lys Gly Glu Asn Arg Cys Trp Val Arg Ala
Ile 145 150 155 160 gac gtc ggc tac atg tgt gag gac act atc acg tac
gaa tgt cct aag 646 Asp Val Gly Tyr Met Cys Glu Asp Thr Ile Thr Tyr
Glu Cys Pro Lys 165 170 175 ctt acc atg ggc aat gat cca gag gat gtg
gat tgc tgg tgt gac aac 694 Leu Thr Met Gly Asn Asp Pro Glu Asp Val
Asp Cys Trp Cys Asp Asn 180 185 190 caa gaa gtc tac gtc caa tat gga
cgg tgc acg cgg acc agg cat tcc 742 Gln Glu Val Tyr Val Gln Tyr Gly
Arg Cys Thr Arg Thr Arg His Ser 195 200 205 aag cga agc agg aga tcc
gtg tcg gtc caa aca cat ggg gag agt tca 790 Lys Arg Ser Arg Arg Ser
Val Ser Val Gln Thr His Gly Glu Ser Ser 210 215 220 cta gtg aat aaa
aaa gag gct tgg ctg gat tca acg aaa gcc aca cga 838 Leu Val Asn Lys
Lys Glu Ala Trp Leu Asp Ser Thr Lys Ala Thr Arg 225 230 235 240 tat
ctc atg aaa act gag aac tgg atc ata agg aat cct ggc tat gct 886 Tyr
Leu Met Lys Thr Glu Asn Trp Ile Ile Arg Asn Pro Gly Tyr Ala 245 250
255 ttc ctg gcg gcg gta ctt ggc tgg atg ctt ggc agt aac aac ggt caa
934 Phe Leu Ala Ala Val Leu Gly Trp Met Leu Gly Ser Asn Asn Gly Gln
260 265 270 cgc gtg gta ttt acc atc ctc ctg ctg ttg gtc gct ccg gct
tac agt 982 Arg Val Val Phe Thr Ile Leu Leu Leu Leu Val Ala Pro Ala
Tyr Ser 275 280 285 ttt aat tgt ctg gga atg ggc aat cgt gac ttc ata
gaa gga gcc agt 1030 Phe Asn Cys Leu Gly Met Gly Asn Arg Asp Phe
Ile Glu Gly Ala Ser 290 295 300 ggg gcc act tgg gtg gac ttg gtg cta
gaa gga gac agc tgc ttg aca 1078 Gly Ala Thr Trp Val Asp Leu Val
Leu Glu Gly Asp Ser Cys Leu Thr 305 310 315 320 atc atg gca aac gac
aaa cca aca ttg gac gtc cgc atg att aac atc 1126 Ile Met Ala Asn
Asp Lys Pro Thr Leu Asp Val Arg Met Ile Asn Ile 325 330 335 gaa gct
agc caa ctt gct gag gtc aga agt tac tgc tat cat gct tca 1174 Glu
Ala Ser Gln Leu Ala Glu Val Arg Ser Tyr Cys Tyr His Ala Ser 340 345
350 gtc act gac atc tcg acg gtg gct cgg tgc ccc acg act gga gaa gcc
1222 Val Thr Asp Ile Ser Thr Val Ala Arg Cys Pro Thr Thr Gly Glu
Ala 355 360 365 cac aac gag aag cga gct gat agt agc tat gtg tgc aaa
caa ggc ttc 1270 His Asn Glu Lys Arg Ala Asp Ser Ser Tyr Val Cys
Lys Gln Gly Phe 370 375 380 act gac cgt ggg tgg ggc aac gga tgt gga
ttt ttc ggg aag gga agc 1318 Thr Asp Arg Gly Trp Gly Asn Gly Cys
Gly Phe Phe Gly Lys Gly Ser 385 390 395 400 att gac aca tgt gca aaa
ttc tcc tgc acc agt aaa gcg att ggg aga 1366 Ile Asp Thr Cys Ala
Lys Phe Ser Cys Thr Ser Lys Ala Ile Gly Arg 405 410 415 aca atc cag
cca gaa aac atc aaa tac aaa gtt ggc att ttt gtg cat 1414 Thr Ile
Gln Pro Glu Asn Ile Lys Tyr Lys Val Gly Ile Phe Val His 420 425 430
gga acc acc act tcg gaa aac cat ggg aat tat tca gcg caa gtt ggg
1462 Gly Thr Thr Thr Ser Glu Asn His Gly Asn Tyr Ser Ala Gln Val
Gly 435 440 445 gcg tcc cag gcg gca aag ttt aca gta aca ccc aat gct
cct tcg gta 1510 Ala Ser Gln Ala Ala Lys Phe Thr Val Thr Pro Asn
Ala Pro Ser Val 450 455 460 gcc ctc aaa ctt ggt gac tac gga gaa gtc
aca ctg gac tgt gag cca 1558 Ala Leu Lys Leu Gly Asp Tyr Gly Glu
Val Thr Leu Asp Cys Glu Pro 465 470 475 480 agg agt gga ctg aac act
gaa gcg ttt tac gtc atg acc gtg ggg tca 1606 Arg Ser Gly Leu Asn
Thr Glu Ala Phe Tyr Val Met Thr Val Gly Ser 485 490 495 aag tca ttt
ctg gtc cat agg gag tgg ttt cat gac ctc gct ctc ccc 1654 Lys Ser
Phe Leu Val His Arg Glu Trp Phe His Asp Leu Ala Leu Pro 500 505 510
tgg acg tcc cct tcg agc aca gcg tgg aga aac aga gaa ctc ctc atg
1702 Trp Thr Ser Pro Ser Ser Thr Ala Trp Arg Asn Arg Glu Leu Leu
Met 515 520 525 gaa ttt gaa ggg gcg cac gcc aca aaa cag tcc gtt gtt
gct ctt ggg 1750 Glu Phe Glu Gly Ala His Ala Thr Lys Gln Ser Val
Val Ala Leu Gly 530 535 540 tca cag gaa gga ggc ctc cat cat gcg ttg
gca gga gcc atc gtg gtg 1798 Ser Gln Glu Gly Gly Leu His His Ala
Leu Ala Gly Ala Ile Val Val 545 550 555 560 gag tac tca agc tca gtg
atg tta aca tca ggc cac ctg aaa tgt agg 1846 Glu Tyr Ser Ser Ser
Val Met Leu Thr Ser Gly His Leu Lys Cys Arg 565 570 575 ctg aaa atg
gac aaa ctg gct ctg aaa ggc aca acc tat ggc atg tgt 1894 Leu Lys
Met Asp Lys Leu Ala Leu Lys Gly Thr Thr Tyr Gly Met Cys 580 585 590
aca gaa aaa ttc tcg ttc gcg aaa aat ccg gtg gac act ggt cac gga
1942 Thr Glu Lys Phe Ser Phe Ala Lys Asn Pro Val Asp Thr Gly His
Gly 595 600 605 aca gtt gtc att gaa ctc tcc tac tct ggg agt gat ggc
ccc tgc aaa 1990 Thr Val Val Ile Glu Leu Ser Tyr Ser Gly Ser Asp
Gly Pro Cys Lys 610 615 620 att ccg att gtt tcc gtt gcg agc ctc aat
gac atg acc ccc gtt ggg 2038 Ile Pro Ile Val Ser Val Ala Ser Leu
Asn Asp Met Thr Pro Val Gly 625 630 635 640 cgg ctg gtg aca gtg aac
ccc ttc gtc gcg act tcc agt gcc aac tca 2086 Arg Leu Val Thr Val
Asn Pro Phe Val Ala Thr Ser Ser Ala Asn Ser 645 650 655 aag gtg ctg
gtc gag atg gaa ccc ccc ttc gga gac tcc tac atc gta 2134 Lys Val
Leu Val Glu Met Glu Pro Pro Phe Gly Asp Ser Tyr Ile Val 660 665 670
gtt gga agg gga gac aag cag atc aac cac cat tgg cac aaa gct gga
2182 Val Gly Arg Gly Asp Lys Gln Ile Asn His His Trp His Lys Ala
Gly 675 680 685 agc acg ctg ggc aag gcc ttt tca aca act ttg aag gga
gct caa aga 2230 Ser Thr Leu Gly Lys Ala Phe Ser Thr Thr Leu Lys
Gly Ala Gln Arg 690 695 700 ctg gca gcg ttg ggc gac aca gcc tgg gac
ttt ggc tct att gga ggg 2278 Leu Ala Ala Leu Gly Asp Thr Ala Trp
Asp Phe Gly Ser Ile Gly Gly 705 710 715 720 gtc ttc aac tcc ata gga
aga gcc gtt cac caa gtg ttt ggt ggt gcc 2326 Val Phe Asn Ser Ile
Gly Arg Ala Val His Gln Val Phe Gly Gly Ala 725 730 735 ttc aga aca
ctc ttt ggg gga atg tct tgg atc aca caa ggg cta atg 2374 Phe Arg
Thr Leu Phe Gly Gly Met Ser Trp Ile Thr Gln Gly Leu Met 740 745 750
ggt gcc cta ctg ctc tgg atg ggc gtc aac gca cga gac cga tca att
2422 Gly Ala Leu Leu Leu Trp Met Gly Val Asn Ala Arg Asp Arg Ser
Ile 755 760 765 gct ttg gcc ttc tta gcc aca gga ggt gtg ctc gtg ttc
tta gcg acc 2470 Ala Leu Ala Phe Leu Ala Thr Gly Gly Val Leu Val
Phe Leu Ala Thr 770 775 780 aat gtg ggc gcc gat caa gga tgc gcc atc
aac ttt ggc aag aga gag 2518 Asn Val Gly Ala Asp Gln Gly Cys Ala
Ile Asn Phe Gly Lys Arg Glu 785 790 795 800 ctc aag tgc gga gat ggt
atc ttc ata ttt aga gac tct gat gac tgg 2566 Leu Lys Cys Gly Asp
Gly Ile Phe Ile Phe Arg Asp Ser Asp Asp Trp 805 810 815 ctg aac aag
tac tca tac tat cca gaa gat cct gtg aag ctt gca tca 2614 Leu Asn
Lys Tyr Ser Tyr Tyr Pro Glu Asp Pro Val Lys Leu Ala Ser 820 825 830
ata gtg aaa gcc tct ttt gaa gaa ggg aag tgt ggc cta aat tca gtt
2662 Ile Val Lys Ala Ser Phe Glu Glu Gly Lys Cys Gly Leu Asn Ser
Val 835 840 845 gac tcc ctt gag cat gag atg tgg aga agc agg gca gat
gag atc aat 2710 Asp Ser Leu Glu His Glu Met Trp Arg Ser Arg Ala
Asp Glu Ile Asn 850 855 860 gcc att ttt gag gaa aac gag gtg gac att
tct gtt gtc gtg cag gat 2758 Ala Ile Phe Glu Glu Asn Glu Val Asp
Ile Ser Val Val Val Gln Asp 865 870 875 880 cca aag aat gtt tac cag
aga gga act cat cca ttt tcc aga att cgg 2806 Pro Lys Asn Val Tyr
Gln Arg Gly Thr His Pro Phe Ser Arg Ile Arg 885 890 895 gat ggt ctg
cag tat ggt tgg aag act tgg ggt aag aac ctt gtg ttc 2854 Asp Gly
Leu Gln Tyr Gly Trp Lys Thr Trp Gly Lys Asn Leu Val Phe 900 905 910
tcc cca ggg agg aag aat gga agc ttc atc ata gat gga aag tcc agg
2902 Ser Pro Gly Arg Lys Asn Gly Ser Phe Ile Ile Asp Gly Lys Ser
Arg 915 920 925 aaa gaa tgc ccg ttt tca aac cgg gtc tgg aat tct ttc
cag ata gag 2950 Lys Glu Cys Pro Phe Ser Asn Arg Val Trp Asn Ser
Phe Gln Ile Glu 930 935 940 gag ttt ggg acg gga gtg ttc acc aca cgc
gtg tac atg gac gca gtc 2998 Glu Phe Gly Thr Gly Val Phe Thr Thr
Arg Val Tyr Met Asp Ala Val 945 950 955 960 ttt gaa tac acc ata gac
tgc gat gga tct atc ttg ggt gca gcg gtg 3046 Phe Glu Tyr Thr Ile
Asp Cys Asp Gly Ser Ile Leu Gly Ala Ala Val 965 970 975 aac gga aaa
aag agt gcc cat ggc tct cca aca ttt tgg atg gga agt 3094 Asn Gly
Lys Lys Ser Ala His Gly Ser Pro Thr Phe Trp Met Gly Ser 980 985 990
cat gaa gta aat ggg aca tgg atg atc cac acc ttg gag gca tta gat
3142 His Glu Val Asn Gly Thr Trp Met Ile His Thr Leu Glu Ala Leu
Asp 995 1000 1005 tac aag gag tgt gag tgg cca ctg aca cat acg att
gga aca tca gtt 3190 Tyr Lys Glu Cys Glu Trp Pro Leu Thr His Thr
Ile Gly Thr Ser Val 1010 1015 1020 gaa gag agt gaa atg ttc atg ccg
aga tca atc gga ggc cca gtt agc 3238 Glu Glu Ser Glu Met Phe Met
Pro Arg Ser Ile Gly Gly Pro Val Ser 1025 1030 1035 1040 tct cac aat
cat atc cct gga tac aag gtt cag acg aac gga cct tgg 3286 Ser His
Asn His Ile Pro Gly Tyr Lys Val Gln Thr Asn Gly Pro Trp 1045 1050
1055 atg cag gta cca cta gaa gtg aag aga gaa gct tgc cca ggg act
agc 3334 Met Gln Val Pro Leu Glu Val Lys Arg Glu Ala Cys Pro Gly
Thr Ser 1060 1065 1070 gtg atc att gat ggc aac tgt gat gga cgg gga
aaa tca acc aga tcc 3382 Val Ile Ile Asp Gly Asn Cys Asp Gly Arg
Gly Lys Ser Thr Arg Ser 1075 1080 1085 acc acg gat agc ggg aaa gtt
att cct gaa tgg tgt tgc cgc tcc tgc 3430 Thr Thr Asp Ser Gly Lys
Val Ile Pro Glu Trp Cys Cys Arg Ser Cys 1090 1095 1100 aca atg ccg
cct gtg agc ttc cat ggt agt gat ggg tgt tgg tat ccc 3478 Thr Met
Pro Pro Val Ser Phe His Gly Ser Asp Gly Cys Trp Tyr Pro 1105 1110
1115 1120 atg gaa att agg cca agg aaa acg cat gaa agc cat ctg gtg
cgc tcc 3526 Met Glu Ile Arg Pro Arg Lys Thr His Glu Ser His Leu
Val Arg Ser 1125 1130 1135 tgg gtt aca gct gga gaa ata cat gct gtc
cct ttt ggt ttg gtg agc 3574 Trp Val Thr Ala Gly Glu Ile His Ala
Val Pro Phe Gly Leu Val Ser 1140 1145 1150 atg atg ata gca atg gaa
gtg gtc cta agg aaa aga cag gga cca aag 3622 Met Met Ile Ala Met
Glu Val Val Leu Arg Lys Arg Gln Gly Pro Lys 1155 1160 1165 caa atg
ttg gtt gga gga gta gtg ctc ttg gga gca atg ctg gtc ggg 3670 Gln
Met Leu Val Gly Gly Val Val Leu Leu Gly Ala Met Leu Val Gly 1170
1175 1180 caa gta act ctc ctt gat ttg ctg aaa ctc aca gtg gct gtg
gga ttg 3718 Gln Val Thr Leu Leu Asp Leu Leu Lys Leu Thr Val Ala
Val Gly Leu 1185 1190 1195 1200 cat ttc cat gag atg aac aat gga gga
gac gcc atg tat atg gcg ttg 3766 His Phe His Glu Met Asn Asn Gly
Gly Asp Ala Met Tyr Met Ala Leu 1205 1210 1215 att gct gcc ttt tca
atc aga cca ggg ctg ctc atc ggc ttt ggg ctc 3814 Ile Ala Ala Phe
Ser Ile Arg Pro Gly Leu Leu Ile Gly Phe Gly Leu 1220 1225 1230 agg
acc cta tgg agc cct cgg gaa cgc ctt gtg ctg acc cta gga gca 3862
Arg Thr Leu Trp Ser Pro Arg Glu Arg Leu Val Leu Thr Leu Gly Ala
1235 1240 1245 gcc atg gtg gag att gcc ttg ggt ggc gtg atg ggc ggc
ctg tgg aag 3910 Ala Met Val Glu Ile Ala Leu Gly Gly Val Met Gly
Gly Leu Trp Lys 1250 1255 1260 tat cta aat gca gtt tct ctc tgc atc
ctg aca ata aat gct gtt gct 3958 Tyr Leu Asn Ala Val Ser Leu Cys
Ile Leu Thr Ile Asn Ala Val Ala 1265 1270 1275 1280 tct agg aaa gca
tca aat acc atc ttg ccc ctc atg gct ctg ttg aca 4006 Ser Arg Lys
Ala Ser Asn Thr Ile Leu Pro Leu Met Ala Leu Leu Thr 1285 1290 1295
cct gtc act atg gct gag gtg aga ctt gcc gca atg ttc ttt tgt gcc
4054 Pro Val Thr Met Ala Glu Val Arg Leu Ala Ala Met Phe Phe Cys
Ala 1300 1305 1310 atg gtt atc ata ggg gtc ctt cac cag aat ttc aag
gac acc tcc atg 4102 Met Val Ile Ile Gly Val Leu His Gln Asn Phe
Lys Asp Thr Ser Met 1315 1320 1325 cag aag act ata cct ctg gtg gcc
ctc aca ctc aca tct tac ctg ggc 4150 Gln Lys Thr Ile Pro Leu Val
Ala Leu Thr Leu Thr Ser Tyr Leu Gly 1330 1335 1340 ttg aca caa cct
ttt ttg ggc ctg tgt gca ttt ctg gca acc cgc ata 4198 Leu Thr Gln
Pro Phe Leu Gly Leu Cys Ala Phe Leu Ala Thr Arg Ile 1345 1350 1355
1360 ttt ggg cga agg agt atc cca gtg aat gag gca ctc gca gca gct
ggt 4246 Phe Gly Arg Arg Ser Ile Pro Val Asn Glu Ala Leu Ala Ala
Ala Gly 1365 1370 1375 cta gtg gga gtg ctg gca gga ctg gct ttt cag
gag atg gag aac ttc 4294 Leu Val Gly Val Leu Ala Gly Leu Ala Phe
Gln Glu Met Glu Asn Phe 1380 1385 1390 ctt ggt ccg att gca gtt gga
gga ctc ctg atg atg ctg gtt agc gtg 4342 Leu Gly Pro Ile Ala Val
Gly Gly Leu Leu Met Met Leu Val Ser Val 1395 1400 1405 gct ggg agg
gtg gat ggg cta gag ctc aag aag ctt ggt gaa gtt tca 4390 Ala Gly
Arg Val Asp Gly Leu Glu Leu Lys Lys Leu Gly Glu Val Ser 1410
1415 1420 tgg gaa gag gag gcg gag atc agc ggg agt tcc gcc cgc tat
gat gtg 4438 Trp Glu Glu Glu Ala Glu Ile Ser Gly Ser Ser Ala Arg
Tyr Asp Val 1425 1430 1435 1440 gca ctc agt gaa caa ggg gag ttc aag
ctg ctt tct gaa gag aaa gtg 4486 Ala Leu Ser Glu Gln Gly Glu Phe
Lys Leu Leu Ser Glu Glu Lys Val 1445 1450 1455 cca tgg gac cag gtt
gtg atg acc tcg ctg gcc ttg gtt ggg gct gcc 4534 Pro Trp Asp Gln
Val Val Met Thr Ser Leu Ala Leu Val Gly Ala Ala 1460 1465 1470 ctc
cat cca ttt gct ctt ctg ctg gtc ctt gct ggg tgg ctg ttt cat 4582
Leu His Pro Phe Ala Leu Leu Leu Val Leu Ala Gly Trp Leu Phe His
1475 1480 1485 gtc agg gga gct agg aga agt ggg gat gtc ttg tgg gat
att ccc act 4630 Val Arg Gly Ala Arg Arg Ser Gly Asp Val Leu Trp
Asp Ile Pro Thr 1490 1495 1500 cct aag atc atc gag gaa tgt gaa cat
ctg gag gat ggg att tat ggc 4678 Pro Lys Ile Ile Glu Glu Cys Glu
His Leu Glu Asp Gly Ile Tyr Gly 1505 1510 1515 1520 ata ttc cag tca
acc ttc ttg ggg gcc tcc cag cga gga gtg gga gtg 4726 Ile Phe Gln
Ser Thr Phe Leu Gly Ala Ser Gln Arg Gly Val Gly Val 1525 1530 1535
gca cag gga ggg gtg ttc cac aca atg tgg cat gtc aca aga gga gct
4774 Ala Gln Gly Gly Val Phe His Thr Met Trp His Val Thr Arg Gly
Ala 1540 1545 1550 ttc ctt gtc agg aat ggc aag aag ttg att cca tct
tgg gct tca gta 4822 Phe Leu Val Arg Asn Gly Lys Lys Leu Ile Pro
Ser Trp Ala Ser Val 1555 1560 1565 aag gaa gac ctt gtc gcc tat ggt
ggc tca tgg aag ttg gaa ggc aga 4870 Lys Glu Asp Leu Val Ala Tyr
Gly Gly Ser Trp Lys Leu Glu Gly Arg 1570 1575 1580 tgg gat gga gag
gaa gag gtc cag ttg atc gcg gct gtt cca gga aag 4918 Trp Asp Gly
Glu Glu Glu Val Gln Leu Ile Ala Ala Val Pro Gly Lys 1585 1590 1595
1600 aac gtg gtc aac gtc cag aca aaa ccg agc ttg ttc aaa gtg agg
aat 4966 Asn Val Val Asn Val Gln Thr Lys Pro Ser Leu Phe Lys Val
Arg Asn 1605 1610 1615 ggg gga gaa atc ggg gct gtc gct ctt gac tat
ccg agt ggc act tca 5014 Gly Gly Glu Ile Gly Ala Val Ala Leu Asp
Tyr Pro Ser Gly Thr Ser 1620 1625 1630 gga tct cct att gtt aac agg
aac gga gag gtg att ggg ctg tac ggc 5062 Gly Ser Pro Ile Val Asn
Arg Asn Gly Glu Val Ile Gly Leu Tyr Gly 1635 1640 1645 aat ggc atc
ctt gtc ggt gac aac tcc ttc gtg tcc gcc ata tcc cag 5110 Asn Gly
Ile Leu Val Gly Asp Asn Ser Phe Val Ser Ala Ile Ser Gln 1650 1655
1660 act gag gtg aag gaa gaa gga aag gag gag ctc caa gag atc ccg
aca 5158 Thr Glu Val Lys Glu Glu Gly Lys Glu Glu Leu Gln Glu Ile
Pro Thr 1665 1670 1675 1680 atg cta aag aaa gga atg aca act gtc ctt
gat ttt cat cct gga gct 5206 Met Leu Lys Lys Gly Met Thr Thr Val
Leu Asp Phe His Pro Gly Ala 1685 1690 1695 ggg aag aca aga cgt ttc
ctc cca cag atc ttg gcc gag tgc gca cgg 5254 Gly Lys Thr Arg Arg
Phe Leu Pro Gln Ile Leu Ala Glu Cys Ala Arg 1700 1705 1710 aga cgc
ttg cgc act ctt gtg ttg gcc ccc acc agg gtt gtt ctt tct 5302 Arg
Arg Leu Arg Thr Leu Val Leu Ala Pro Thr Arg Val Val Leu Ser 1715
1720 1725 gaa atg aag gag gct ttt cac ggc ctg gac gtg aaa ttc cac
aca cag 5350 Glu Met Lys Glu Ala Phe His Gly Leu Asp Val Lys Phe
His Thr Gln 1730 1735 1740 gct ttt tcc gct cac ggc agc ggg aga gaa
gtc att gat gcc atg tgc 5398 Ala Phe Ser Ala His Gly Ser Gly Arg
Glu Val Ile Asp Ala Met Cys 1745 1750 1755 1760 cat gcc acc cta act
tac agg atg ttg gaa cca act agg gtt gtt aac 5446 His Ala Thr Leu
Thr Tyr Arg Met Leu Glu Pro Thr Arg Val Val Asn 1765 1770 1775 tgg
gaa gtg atc att atg gat gaa gcc cat ttt ttg gat cca gct agc 5494
Trp Glu Val Ile Ile Met Asp Glu Ala His Phe Leu Asp Pro Ala Ser
1780 1785 1790 ata gcc gct aga ggt tgg gca gcg cac aga gct agg gca
aat gaa agt 5542 Ile Ala Ala Arg Gly Trp Ala Ala His Arg Ala Arg
Ala Asn Glu Ser 1795 1800 1805 gca aca atc ttg atg aca gcc aca ccg
cct ggg act agt gat gaa ttt 5590 Ala Thr Ile Leu Met Thr Ala Thr
Pro Pro Gly Thr Ser Asp Glu Phe 1810 1815 1820 cca cat tca aat ggt
gaa ata gaa gat gtt caa acg gac ata ccc agt 5638 Pro His Ser Asn
Gly Glu Ile Glu Asp Val Gln Thr Asp Ile Pro Ser 1825 1830 1835 1840
gag ccc tgg aac aca ggg cat gac tgg atc ctg gct gac aaa agg ccc
5686 Glu Pro Trp Asn Thr Gly His Asp Trp Ile Leu Ala Asp Lys Arg
Pro 1845 1850 1855 acg gca tgg ttc ctt cca tcc atc aga gct gca aat
gtc atg gct gcc 5734 Thr Ala Trp Phe Leu Pro Ser Ile Arg Ala Ala
Asn Val Met Ala Ala 1860 1865 1870 tct ttg cgt aag gct gga aag agt
gtg gtg gtc ctg aac agg aaa acc 5782 Ser Leu Arg Lys Ala Gly Lys
Ser Val Val Val Leu Asn Arg Lys Thr 1875 1880 1885 ttt gag aga gaa
tac ccc acg ata aag cag aag aaa cct gac ttt ata 5830 Phe Glu Arg
Glu Tyr Pro Thr Ile Lys Gln Lys Lys Pro Asp Phe Ile 1890 1895 1900
ttg gcc act gac ata gct gaa atg gga gcc aac ctt tgc gtg gag cga
5878 Leu Ala Thr Asp Ile Ala Glu Met Gly Ala Asn Leu Cys Val Glu
Arg 1905 1910 1915 1920 gtg ctg gat tgc agg acg gct ttt aag cct gtg
ctt gtg gat gaa ggg 5926 Val Leu Asp Cys Arg Thr Ala Phe Lys Pro
Val Leu Val Asp Glu Gly 1925 1930 1935 agg aag gtg gca ata aaa ggg
cca ctt cgt atc tcc gca tcc tct gct 5974 Arg Lys Val Ala Ile Lys
Gly Pro Leu Arg Ile Ser Ala Ser Ser Ala 1940 1945 1950 gct caa agg
agg ggg cgc att ggg aga aat ccc aac aga gat gga gac 6022 Ala Gln
Arg Arg Gly Arg Ile Gly Arg Asn Pro Asn Arg Asp Gly Asp 1955 1960
1965 tca tac tac tat tct gag cct aca agt gaa aat aat gcc cac cac
gtc 6070 Ser Tyr Tyr Tyr Ser Glu Pro Thr Ser Glu Asn Asn Ala His
His Val 1970 1975 1980 tgc tgg ttg gag gcc tca atg ctc ttg gac aac
atg gag gtg agg ggt 6118 Cys Trp Leu Glu Ala Ser Met Leu Leu Asp
Asn Met Glu Val Arg Gly 1985 1990 1995 2000 gga atg gtc gcc cca ctc
tat ggc gtt gaa gga act aaa aca cca gtt 6166 Gly Met Val Ala Pro
Leu Tyr Gly Val Glu Gly Thr Lys Thr Pro Val 2005 2010 2015 tcc cct
ggt gaa atg aga ctg agg gat gac cag agg aaa gtc ttc aga 6214 Ser
Pro Gly Glu Met Arg Leu Arg Asp Asp Gln Arg Lys Val Phe Arg 2020
2025 2030 gaa cta gtg agg aat tgt gac ctg ccc gtt tgg ctt tcg tgg
caa gtg 6262 Glu Leu Val Arg Asn Cys Asp Leu Pro Val Trp Leu Ser
Trp Gln Val 2035 2040 2045 gcc aag gct ggt ttg aag acg aat gat cgt
aag tgg tgt ttt gaa ggc 6310 Ala Lys Ala Gly Leu Lys Thr Asn Asp
Arg Lys Trp Cys Phe Glu Gly 2050 2055 2060 cct gag gaa cat gag atc
ttg aat gac agc ggt gaa aca gtg aag tgc 6358 Pro Glu Glu His Glu
Ile Leu Asn Asp Ser Gly Glu Thr Val Lys Cys 2065 2070 2075 2080 agg
gct cct gga gga gca aag aag cct ctg cgc cca agg tgg tgt gat 6406
Arg Ala Pro Gly Gly Ala Lys Lys Pro Leu Arg Pro Arg Trp Cys Asp
2085 2090 2095 gaa agg gtg tca tct gac cag agt gcg ctg tct gaa ttt
att aag ttt 6454 Glu Arg Val Ser Ser Asp Gln Ser Ala Leu Ser Glu
Phe Ile Lys Phe 2100 2105 2110 gct gaa ggt agg agg gga gct gct gaa
gtg cta gtt gtg ctg agt gaa 6502 Ala Glu Gly Arg Arg Gly Ala Ala
Glu Val Leu Val Val Leu Ser Glu 2115 2120 2125 ctc cct gat ttc ctg
gct aaa aaa ggt gga gag gca atg gat acc atc 6550 Leu Pro Asp Phe
Leu Ala Lys Lys Gly Gly Glu Ala Met Asp Thr Ile 2130 2135 2140 agt
gtg ttc ctc cac tct gag gaa ggc tct agg gct tac cgc aat gca 6598
Ser Val Phe Leu His Ser Glu Glu Gly Ser Arg Ala Tyr Arg Asn Ala
2145 2150 2155 2160 cta tca atg atg cct gag gca atg aca ata gtc atg
ctg ttt ata ctg 6646 Leu Ser Met Met Pro Glu Ala Met Thr Ile Val
Met Leu Phe Ile Leu 2165 2170 2175 gct gga cta ctg aca tcg gga atg
gtc atc ttt ttc atg tct ccc aaa 6694 Ala Gly Leu Leu Thr Ser Gly
Met Val Ile Phe Phe Met Ser Pro Lys 2180 2185 2190 ggc atc agt aga
atg tct atg gcg atg ggc aca atg gcc ggc tgt gga 6742 Gly Ile Ser
Arg Met Ser Met Ala Met Gly Thr Met Ala Gly Cys Gly 2195 2200 2205
tat ctc atg ttc ctt gga ggc gtc aaa ccc act cac atc tcc tat gtc
6790 Tyr Leu Met Phe Leu Gly Gly Val Lys Pro Thr His Ile Ser Tyr
Val 2210 2215 2220 atg ctc ata ttc ttt gtc ctg atg gtg gtt gtg atc
ccc gag cca ggg 6838 Met Leu Ile Phe Phe Val Leu Met Val Val Val
Ile Pro Glu Pro Gly 2225 2230 2235 2240 caa caa agg tcc atc caa gac
aac caa gtg gca tac ctc att att ggc 6886 Gln Gln Arg Ser Ile Gln
Asp Asn Gln Val Ala Tyr Leu Ile Ile Gly 2245 2250 2255 atc ctg acg
ctg gtt tca gcg gtg gca gcc aac gag cta ggc atg ctg 6934 Ile Leu
Thr Leu Val Ser Ala Val Ala Ala Asn Glu Leu Gly Met Leu 2260 2265
2270 gag aaa acc aaa gag gac ctc ttt ggg aag aag aac tta att cca
tct 6982 Glu Lys Thr Lys Glu Asp Leu Phe Gly Lys Lys Asn Leu Ile
Pro Ser 2275 2280 2285 agt gct tca ccc tgg agt tgg ccg gat ctt gac
ctg aag cca gga gct 7030 Ser Ala Ser Pro Trp Ser Trp Pro Asp Leu
Asp Leu Lys Pro Gly Ala 2290 2295 2300 gcc tgg aca gtg tac gtt ggc
att gtt aca atg ctc tct cca atg ttg 7078 Ala Trp Thr Val Tyr Val
Gly Ile Val Thr Met Leu Ser Pro Met Leu 2305 2310 2315 2320 cac cac
tgg atc aaa gtc gaa tat ggc aac ctg tct ctg tct gga ata 7126 His
His Trp Ile Lys Val Glu Tyr Gly Asn Leu Ser Leu Ser Gly Ile 2325
2330 2335 gcc cag tca gcc tca gtc ctt tct ttc atg gac aag ggg ata
cca ttc 7174 Ala Gln Ser Ala Ser Val Leu Ser Phe Met Asp Lys Gly
Ile Pro Phe 2340 2345 2350 atg aag atg aat atc tcg gtc ata atg ctg
ctg gtc agt ggc tgg aat 7222 Met Lys Met Asn Ile Ser Val Ile Met
Leu Leu Val Ser Gly Trp Asn 2355 2360 2365 tca ata aca gtg atg cct
ctg ctc tgt ggc ata ggg tgc gcc atg ctc 7270 Ser Ile Thr Val Met
Pro Leu Leu Cys Gly Ile Gly Cys Ala Met Leu 2370 2375 2380 cac tgg
tct ctc att tta cct gga atc aaa gcg cag cag tca aag ctt 7318 His
Trp Ser Leu Ile Leu Pro Gly Ile Lys Ala Gln Gln Ser Lys Leu 2385
2390 2395 2400 gca cag aga agg gtg ttc cat ggc gtt gcc aag aac cct
gtg gtt gat 7366 Ala Gln Arg Arg Val Phe His Gly Val Ala Lys Asn
Pro Val Val Asp 2405 2410 2415 ggg aat cca aca gtt gac att gag gaa
gct cct gaa atg cct gcc ctt 7414 Gly Asn Pro Thr Val Asp Ile Glu
Glu Ala Pro Glu Met Pro Ala Leu 2420 2425 2430 tat gag aag aaa ctg
gct cta tat ctc ctt ctt gct ctc agc cta gct 7462 Tyr Glu Lys Lys
Leu Ala Leu Tyr Leu Leu Leu Ala Leu Ser Leu Ala 2435 2440 2445 tct
gtt gcc atg tgc aga acg ccc ttt tca ttg gct gaa ggc att gtc 7510
Ser Val Ala Met Cys Arg Thr Pro Phe Ser Leu Ala Glu Gly Ile Val
2450 2455 2460 cta gca tca gct gcc tta ggg ccg ctc ata gag gga aac
acc agc ctt 7558 Leu Ala Ser Ala Ala Leu Gly Pro Leu Ile Glu Gly
Asn Thr Ser Leu 2465 2470 2475 2480 ctt tgg aat gga ccc atg gct gtc
tcc atg aca gga gtc atg agg ggg 7606 Leu Trp Asn Gly Pro Met Ala
Val Ser Met Thr Gly Val Met Arg Gly 2485 2490 2495 aat cac tat gct
ttt gtg gga gtc atg tac aat cta tgg aag atg aaa 7654 Asn His Tyr
Ala Phe Val Gly Val Met Tyr Asn Leu Trp Lys Met Lys 2500 2505 2510
act gga cgc cgg ggg agc gcg aat gga aaa act ttg ggt gaa gtc tgg
7702 Thr Gly Arg Arg Gly Ser Ala Asn Gly Lys Thr Leu Gly Glu Val
Trp 2515 2520 2525 aag agg gaa ctg aat ctg ttg gac aag cga cag ttt
gag ttg tat aaa 7750 Lys Arg Glu Leu Asn Leu Leu Asp Lys Arg Gln
Phe Glu Leu Tyr Lys 2530 2535 2540 agg acc gac att gtg gag gtg gat
cgt gat acg gca cgc agg cat ttg 7798 Arg Thr Asp Ile Val Glu Val
Asp Arg Asp Thr Ala Arg Arg His Leu 2545 2550 2555 2560 gcc gaa ggg
aag gtg gac acc ggg gtg gcg gtc tcc agg ggg acc gca 7846 Ala Glu
Gly Lys Val Asp Thr Gly Val Ala Val Ser Arg Gly Thr Ala 2565 2570
2575 aag tta agg tgg ttc cat gag cgt ggc tat gtc aag ctg gaa ggt
agg 7894 Lys Leu Arg Trp Phe His Glu Arg Gly Tyr Val Lys Leu Glu
Gly Arg 2580 2585 2590 gtg att gac ctg ggg tgt ggc cgc gga ggc tgg
tgt tac tac gct gct 7942 Val Ile Asp Leu Gly Cys Gly Arg Gly Gly
Trp Cys Tyr Tyr Ala Ala 2595 2600 2605 gcg caa aag gaa gtg agt ggg
gtc aaa gga ttt act ctt gga aga gac 7990 Ala Gln Lys Glu Val Ser
Gly Val Lys Gly Phe Thr Leu Gly Arg Asp 2610 2615 2620 ggc cat gag
aaa ccc atg aat gtg caa agt ctg gga tgg aac atc atc 8038 Gly His
Glu Lys Pro Met Asn Val Gln Ser Leu Gly Trp Asn Ile Ile 2625 2630
2635 2640 acc ttc aag gac aaa act gat atc cac cgc cta gaa cca gtg
aaa tgt 8086 Thr Phe Lys Asp Lys Thr Asp Ile His Arg Leu Glu Pro
Val Lys Cys 2645 2650 2655 gac acc ctt ttg tgt gac att gga gag tca
tca tcg tca tcg gtc aca 8134 Asp Thr Leu Leu Cys Asp Ile Gly Glu
Ser Ser Ser Ser Ser Val Thr 2660 2665 2670 gag ggg gaa agg acc gtg
aga gtt ctt gat act gta gaa aaa tgg ctg 8182 Glu Gly Glu Arg Thr
Val Arg Val Leu Asp Thr Val Glu Lys Trp Leu 2675 2680 2685 gct tgt
ggg gtt gac aac ttc tgt gtg aag gtg tta gct cca tac atg 8230 Ala
Cys Gly Val Asp Asn Phe Cys Val Lys Val Leu Ala Pro Tyr Met 2690
2695 2700 cca gat gtt ctt gag aaa ctg gaa ttg ctc caa agg agg ttt
ggc gga 8278 Pro Asp Val Leu Glu Lys Leu Glu Leu Leu Gln Arg Arg
Phe Gly Gly 2705 2710 2715 2720 aca gtg atc agg aac cct ctc tcc agg
aat tcc act cat gaa atg tac 8326 Thr Val Ile Arg Asn Pro Leu Ser
Arg Asn Ser Thr His Glu Met Tyr 2725 2730 2735 tac gtg tct gga gcc
cgc agc aat gtc aca ttt act gtg aac caa aca 8374 Tyr Val Ser Gly
Ala Arg Ser Asn Val Thr Phe Thr Val Asn Gln Thr 2740 2745 2750 tcc
cgc ctc ctg atg agg aga atg agg cgt cca act gga aaa gtg acc 8422
Ser Arg Leu Leu Met Arg Arg Met Arg Arg Pro Thr Gly Lys Val Thr
2755 2760 2765 ctg gag gct gac gtc atc ctc cca att ggg aca cgc agt
gtt gag aca 8470 Leu Glu Ala Asp Val Ile Leu Pro Ile Gly Thr Arg
Ser Val Glu Thr 2770 2775 2780 gac aag gga ccc ctg gac aaa gag gcc
ata gaa gaa agg gtt gag agg 8518 Asp Lys Gly Pro Leu Asp Lys Glu
Ala Ile Glu Glu Arg Val Glu Arg 2785 2790 2795 2800 ata aaa tct gag
tac atg acc tct tgg ttt tat gac aat gac aac ccc 8566 Ile Lys Ser
Glu Tyr Met Thr Ser Trp Phe Tyr Asp Asn Asp Asn Pro 2805 2810 2815
tac agg acc tgg cac tac tgt ggc tcc tat gtc aca aaa acc tcc gga
8614 Tyr Arg Thr Trp His Tyr Cys Gly Ser Tyr Val Thr Lys Thr Ser
Gly 2820 2825 2830 agt gcg gcg agc atg gta aat ggt gtt att aaa att
ctg aca tat cca 8662 Ser Ala Ala Ser Met Val Asn Gly Val Ile Lys
Ile Leu Thr Tyr Pro 2835 2840 2845 tgg gac agg ata gag gag gtc aca
aga atg gca atg act gac aca acc 8710 Trp Asp Arg Ile Glu Glu Val
Thr Arg Met Ala Met Thr Asp Thr Thr 2850 2855 2860 cct ttt gga cag
caa aga gtg ttt aaa gaa aaa gtt gac acc aga gca 8758 Pro Phe Gly
Gln Gln Arg Val Phe Lys Glu Lys Val Asp Thr Arg Ala 2865 2870 2875
2880 aag gat cca cca gcg gga act agg aag atc atg aaa gtt gtc aac
agg 8806 Lys Asp Pro Pro Ala Gly Thr Arg Lys Ile Met Lys Val Val
Asn Arg 2885 2890 2895 tgg ctg ttc cgc cac ctg gcc aga gaa aag aac
ccc aga ctg tgc aca 8854 Trp Leu Phe Arg His Leu Ala Arg Glu Lys
Asn Pro Arg Leu Cys Thr 2900 2905 2910 aag gaa gaa ttt att gca aaa
gtc cga agt cat gca gcc att gga gct 8902 Lys Glu Glu Phe Ile Ala
Lys Val Arg Ser His Ala Ala Ile Gly Ala 2915 2920
2925 tac ctg gaa gaa caa gaa cag tgg aag act gcc aat gag gct gtc
caa 8950 Tyr Leu Glu Glu Gln Glu Gln Trp Lys Thr Ala Asn Glu Ala
Val Gln 2930 2935 2940 gac cca aag ttc tgg gaa ctg gtg gat gaa gaa
agg aag ctg cac caa 8998 Asp Pro Lys Phe Trp Glu Leu Val Asp Glu
Glu Arg Lys Leu His Gln 2945 2950 2955 2960 caa ggc agg tgt cgg act
tgt gtg tac aac atg atg ggg aaa aga gag 9046 Gln Gly Arg Cys Arg
Thr Cys Val Tyr Asn Met Met Gly Lys Arg Glu 2965 2970 2975 aag aag
ctg tca gag ttt ggg aaa gca aag gga agc cgt gcc ata tgg 9094 Lys
Lys Leu Ser Glu Phe Gly Lys Ala Lys Gly Ser Arg Ala Ile Trp 2980
2985 2990 tat atg tgg ctg gga gcg cgg tat ctt gag ttt gag gcc ctg
gga ttc 9142 Tyr Met Trp Leu Gly Ala Arg Tyr Leu Glu Phe Glu Ala
Leu Gly Phe 2995 3000 3005 ctg aat gag gac cat tgg gct tcc agg gaa
aac tca gga gga gga gtg 9190 Leu Asn Glu Asp His Trp Ala Ser Arg
Glu Asn Ser Gly Gly Gly Val 3010 3015 3020 gaa ggc att ggc tta caa
tac cta gga tat gtg atc aga gac ctg gct 9238 Glu Gly Ile Gly Leu
Gln Tyr Leu Gly Tyr Val Ile Arg Asp Leu Ala 3025 3030 3035 3040 gca
atg gat ggt ggt gga ttc tac gcg gat gac acc gct gga tgg gac 9286
Ala Met Asp Gly Gly Gly Phe Tyr Ala Asp Asp Thr Ala Gly Trp Asp
3045 3050 3055 acg cgc atc aca gag gca gac ctt gat gat gaa cag gag
atc ttg aac 9334 Thr Arg Ile Thr Glu Ala Asp Leu Asp Asp Glu Gln
Glu Ile Leu Asn 3060 3065 3070 tac atg agc cca cat cac aaa aaa ctg
gca caa gca gtg atg gaa atg 9382 Tyr Met Ser Pro His His Lys Lys
Leu Ala Gln Ala Val Met Glu Met 3075 3080 3085 aca tac aag aac aaa
gtg gtg aaa gtg ttg aga cca gcc cca gga ggg 9430 Thr Tyr Lys Asn
Lys Val Val Lys Val Leu Arg Pro Ala Pro Gly Gly 3090 3095 3100 aaa
gcc tac atg gat gtc ata agt cga cga gac cag aga gga tcc ggg 9478
Lys Ala Tyr Met Asp Val Ile Ser Arg Arg Asp Gln Arg Gly Ser Gly
3105 3110 3115 3120 cag gta gtg act tat gct ctg aac acc atc acc aac
ttg aaa gtc caa 9526 Gln Val Val Thr Tyr Ala Leu Asn Thr Ile Thr
Asn Leu Lys Val Gln 3125 3130 3135 ttg atc aga atg gca gaa gca gag
atg gtg ata cat cac caa cat gtt 9574 Leu Ile Arg Met Ala Glu Ala
Glu Met Val Ile His His Gln His Val 3140 3145 3150 caa gat tgt gat
gaa tca gtt ctg acc agg ctg gag gca tgg ctc act 9622 Gln Asp Cys
Asp Glu Ser Val Leu Thr Arg Leu Glu Ala Trp Leu Thr 3155 3160 3165
gag cac gga tgt gac aga ctg aag agg atg gcg gtg agt gga gac gac
9670 Glu His Gly Cys Asp Arg Leu Lys Arg Met Ala Val Ser Gly Asp
Asp 3170 3175 3180 tgt gtg gtc cgg ccc atc gat gac agg ttc ggc ctg
gcc ctg tcc cat 9718 Cys Val Val Arg Pro Ile Asp Asp Arg Phe Gly
Leu Ala Leu Ser His 3185 3190 3195 3200 ctc aac gcc atg tcc aag gtt
aga aag gac ata tct gaa tgg cag cca 9766 Leu Asn Ala Met Ser Lys
Val Arg Lys Asp Ile Ser Glu Trp Gln Pro 3205 3210 3215 tca aaa ggg
tgg aat gat tgg gag aat gtg ccc ttc tgt tcc cac cac 9814 Ser Lys
Gly Trp Asn Asp Trp Glu Asn Val Pro Phe Cys Ser His His 3220 3225
3230 ttc cat gaa cta cag ctg aag gat ggc agg agg att gtg gtg cct
tgc 9862 Phe His Glu Leu Gln Leu Lys Asp Gly Arg Arg Ile Val Val
Pro Cys 3235 3240 3245 cga gaa cag gac gag ctc att ggg aga gga agg
gtg tct cca gga aac 9910 Arg Glu Gln Asp Glu Leu Ile Gly Arg Gly
Arg Val Ser Pro Gly Asn 3250 3255 3260 ggc tgg atg atc aag gaa aca
gct tgc ctc agc aaa gcc tat gcc aac 9958 Gly Trp Met Ile Lys Glu
Thr Ala Cys Leu Ser Lys Ala Tyr Ala Asn 3265 3270 3275 3280 atg tgg
tca ctg atg tat ttt cac aaa agg gac atg agg cta ctg tca 10006 Met
Trp Ser Leu Met Tyr Phe His Lys Arg Asp Met Arg Leu Leu Ser 3285
3290 3295 ttg gct gtt tcc tca gct gtt ccc acc tca tgg gtt cca caa
gga cgc 10054 Leu Ala Val Ser Ser Ala Val Pro Thr Ser Trp Val Pro
Gln Gly Arg 3300 3305 3310 aca aca tgg tcg att cat ggg aaa ggg gag
tgg atg acc acg gaa gac 10102 Thr Thr Trp Ser Ile His Gly Lys Gly
Glu Trp Met Thr Thr Glu Asp 3315 3320 3325 atg ctt gag gtg tgg aac
aga gta tgg ata acc aac aac cca cac atg 10150 Met Leu Glu Val Trp
Asn Arg Val Trp Ile Thr Asn Asn Pro His Met 3330 3335 3340 cag gac
aag aca atg gtg aaa aaa tgg aga gat gtc cct tat cta acc 10198 Gln
Asp Lys Thr Met Val Lys Lys Trp Arg Asp Val Pro Tyr Leu Thr 3345
3350 3355 3360 aag aga caa gac aag ctg tgc gga tca ctg att gga atg
acc aat agg 10246 Lys Arg Gln Asp Lys Leu Cys Gly Ser Leu Ile Gly
Met Thr Asn Arg 3365 3370 3375 gcc acc tgg gcc tcc cac atc cat tta
gtc atc cat cgt atc cga acg 10294 Ala Thr Trp Ala Ser His Ile His
Leu Val Ile His Arg Ile Arg Thr 3380 3385 3390 ctg att gga cag gag
aaa tac act gac tac cta aca gtc atg gac agg 10342 Leu Ile Gly Gln
Glu Lys Tyr Thr Asp Tyr Leu Thr Val Met Asp Arg 3395 3400 3405 tat
tct gtg gat gct gac ctg caa ctg ggt gag ctt atc tgaaacacca 10391
Tyr Ser Val Asp Ala Asp Leu Gln Leu Gly Glu Leu Ile 3410 3415 3420
tctaacagga ataaccggga tacaaaccac gggtggagaa ccggactccc cacaacctga
10451 aaccgggata taaaccacgg ctggagaacc gggctccgca cttaaaatga
aacagaaacc 10511 gggataaaaa ctacggatgg agaaccggac tccacacatt
gagacagaag aagttgtcag 10571 cccagaaccc cacacgagtt ttgccactgc
taagctgtga ggcagtgcag gctgggacag 10631 ccgacctcca ggttgcgaaa
aacctggttt ctgggacctc ccaccccaga gtaaaaagaa 10691 cggagcctcc
gctaccaccc tcccacgtgg tggtagaaag acggggtcta gaggttagag 10751
gagaccctcc agggaacaaa tagtgggacc atattgacgc cagggaaaga ccggagtggt
10811 tctctgcttt tcctccagag gtctgtgagc acagtttgct caagaataag
cagacctttg 10871 gatgacaaac acaaaaccac t 10892 53 3421 PRT
Artificial Sequence derived from Yellow Fever virus and Japanese
Encephalitis virus 53 Met Ser Gly Arg Lys Ala Gln Gly Lys Thr Leu
Gly Val Asn Met Val 1 5 10 15 Arg Arg Gly Val Arg Ser Leu Ser Asn
Lys Ile Lys Gln Lys Thr Lys 20 25 30 Gln Ile Gly Asn Arg Pro Gly
Pro Ser Arg Gly Val Gln Gly Phe Ile 35 40 45 Phe Phe Phe Leu Phe
Asn Ile Leu Thr Gly Lys Lys Ile Thr Ala His 50 55 60 Leu Lys Arg
Leu Trp Lys Met Leu Asp Pro Arg Gln Gly Leu Ala Val 65 70 75 80 Leu
Arg Lys Val Lys Arg Val Val Ala Ser Leu Met Arg Gly Leu Ser 85 90
95 Ser Arg Lys Arg Arg Ser His Asp Val Leu Thr Val Gln Phe Leu Ile
100 105 110 Leu Gly Met Leu Leu Met Thr Gly Gly Met Lys Leu Ser Asn
Phe Gln 115 120 125 Gly Lys Leu Leu Met Thr Ile Asn Asn Thr Asp Ile
Ala Asp Val Ile 130 135 140 Val Ile Pro Thr Ser Lys Gly Glu Asn Arg
Cys Trp Val Arg Ala Ile 145 150 155 160 Asp Val Gly Tyr Met Cys Glu
Asp Thr Ile Thr Tyr Glu Cys Pro Lys 165 170 175 Leu Thr Met Gly Asn
Asp Pro Glu Asp Val Asp Cys Trp Cys Asp Asn 180 185 190 Gln Glu Val
Tyr Val Gln Tyr Gly Arg Cys Thr Arg Thr Arg His Ser 195 200 205 Lys
Arg Ser Arg Arg Ser Val Ser Val Gln Thr His Gly Glu Ser Ser 210 215
220 Leu Val Asn Lys Lys Glu Ala Trp Leu Asp Ser Thr Lys Ala Thr Arg
225 230 235 240 Tyr Leu Met Lys Thr Glu Asn Trp Ile Ile Arg Asn Pro
Gly Tyr Ala 245 250 255 Phe Leu Ala Ala Val Leu Gly Trp Met Leu Gly
Ser Asn Asn Gly Gln 260 265 270 Arg Val Val Phe Thr Ile Leu Leu Leu
Leu Val Ala Pro Ala Tyr Ser 275 280 285 Phe Asn Cys Leu Gly Met Gly
Asn Arg Asp Phe Ile Glu Gly Ala Ser 290 295 300 Gly Ala Thr Trp Val
Asp Leu Val Leu Glu Gly Asp Ser Cys Leu Thr 305 310 315 320 Ile Met
Ala Asn Asp Lys Pro Thr Leu Asp Val Arg Met Ile Asn Ile 325 330 335
Glu Ala Ser Gln Leu Ala Glu Val Arg Ser Tyr Cys Tyr His Ala Ser 340
345 350 Val Thr Asp Ile Ser Thr Val Ala Arg Cys Pro Thr Thr Gly Glu
Ala 355 360 365 His Asn Glu Lys Arg Ala Asp Ser Ser Tyr Val Cys Lys
Gln Gly Phe 370 375 380 Thr Asp Arg Gly Trp Gly Asn Gly Cys Gly Phe
Phe Gly Lys Gly Ser 385 390 395 400 Ile Asp Thr Cys Ala Lys Phe Ser
Cys Thr Ser Lys Ala Ile Gly Arg 405 410 415 Thr Ile Gln Pro Glu Asn
Ile Lys Tyr Lys Val Gly Ile Phe Val His 420 425 430 Gly Thr Thr Thr
Ser Glu Asn His Gly Asn Tyr Ser Ala Gln Val Gly 435 440 445 Ala Ser
Gln Ala Ala Lys Phe Thr Val Thr Pro Asn Ala Pro Ser Val 450 455 460
Ala Leu Lys Leu Gly Asp Tyr Gly Glu Val Thr Leu Asp Cys Glu Pro 465
470 475 480 Arg Ser Gly Leu Asn Thr Glu Ala Phe Tyr Val Met Thr Val
Gly Ser 485 490 495 Lys Ser Phe Leu Val His Arg Glu Trp Phe His Asp
Leu Ala Leu Pro 500 505 510 Trp Thr Ser Pro Ser Ser Thr Ala Trp Arg
Asn Arg Glu Leu Leu Met 515 520 525 Glu Phe Glu Gly Ala His Ala Thr
Lys Gln Ser Val Val Ala Leu Gly 530 535 540 Ser Gln Glu Gly Gly Leu
His His Ala Leu Ala Gly Ala Ile Val Val 545 550 555 560 Glu Tyr Ser
Ser Ser Val Met Leu Thr Ser Gly His Leu Lys Cys Arg 565 570 575 Leu
Lys Met Asp Lys Leu Ala Leu Lys Gly Thr Thr Tyr Gly Met Cys 580 585
590 Thr Glu Lys Phe Ser Phe Ala Lys Asn Pro Val Asp Thr Gly His Gly
595 600 605 Thr Val Val Ile Glu Leu Ser Tyr Ser Gly Ser Asp Gly Pro
Cys Lys 610 615 620 Ile Pro Ile Val Ser Val Ala Ser Leu Asn Asp Met
Thr Pro Val Gly 625 630 635 640 Arg Leu Val Thr Val Asn Pro Phe Val
Ala Thr Ser Ser Ala Asn Ser 645 650 655 Lys Val Leu Val Glu Met Glu
Pro Pro Phe Gly Asp Ser Tyr Ile Val 660 665 670 Val Gly Arg Gly Asp
Lys Gln Ile Asn His His Trp His Lys Ala Gly 675 680 685 Ser Thr Leu
Gly Lys Ala Phe Ser Thr Thr Leu Lys Gly Ala Gln Arg 690 695 700 Leu
Ala Ala Leu Gly Asp Thr Ala Trp Asp Phe Gly Ser Ile Gly Gly 705 710
715 720 Val Phe Asn Ser Ile Gly Arg Ala Val His Gln Val Phe Gly Gly
Ala 725 730 735 Phe Arg Thr Leu Phe Gly Gly Met Ser Trp Ile Thr Gln
Gly Leu Met 740 745 750 Gly Ala Leu Leu Leu Trp Met Gly Val Asn Ala
Arg Asp Arg Ser Ile 755 760 765 Ala Leu Ala Phe Leu Ala Thr Gly Gly
Val Leu Val Phe Leu Ala Thr 770 775 780 Asn Val Gly Ala Asp Gln Gly
Cys Ala Ile Asn Phe Gly Lys Arg Glu 785 790 795 800 Leu Lys Cys Gly
Asp Gly Ile Phe Ile Phe Arg Asp Ser Asp Asp Trp 805 810 815 Leu Asn
Lys Tyr Ser Tyr Tyr Pro Glu Asp Pro Val Lys Leu Ala Ser 820 825 830
Ile Val Lys Ala Ser Phe Glu Glu Gly Lys Cys Gly Leu Asn Ser Val 835
840 845 Asp Ser Leu Glu His Glu Met Trp Arg Ser Arg Ala Asp Glu Ile
Asn 850 855 860 Ala Ile Phe Glu Glu Asn Glu Val Asp Ile Ser Val Val
Val Gln Asp 865 870 875 880 Pro Lys Asn Val Tyr Gln Arg Gly Thr His
Pro Phe Ser Arg Ile Arg 885 890 895 Asp Gly Leu Gln Tyr Gly Trp Lys
Thr Trp Gly Lys Asn Leu Val Phe 900 905 910 Ser Pro Gly Arg Lys Asn
Gly Ser Phe Ile Ile Asp Gly Lys Ser Arg 915 920 925 Lys Glu Cys Pro
Phe Ser Asn Arg Val Trp Asn Ser Phe Gln Ile Glu 930 935 940 Glu Phe
Gly Thr Gly Val Phe Thr Thr Arg Val Tyr Met Asp Ala Val 945 950 955
960 Phe Glu Tyr Thr Ile Asp Cys Asp Gly Ser Ile Leu Gly Ala Ala Val
965 970 975 Asn Gly Lys Lys Ser Ala His Gly Ser Pro Thr Phe Trp Met
Gly Ser 980 985 990 His Glu Val Asn Gly Thr Trp Met Ile His Thr Leu
Glu Ala Leu Asp 995 1000 1005 Tyr Lys Glu Cys Glu Trp Pro Leu Thr
His Thr Ile Gly Thr Ser Val 1010 1015 1020 Glu Glu Ser Glu Met Phe
Met Pro Arg Ser Ile Gly Gly Pro Val Ser 1025 1030 1035 1040 Ser His
Asn His Ile Pro Gly Tyr Lys Val Gln Thr Asn Gly Pro Trp 1045 1050
1055 Met Gln Val Pro Leu Glu Val Lys Arg Glu Ala Cys Pro Gly Thr
Ser 1060 1065 1070 Val Ile Ile Asp Gly Asn Cys Asp Gly Arg Gly Lys
Ser Thr Arg Ser 1075 1080 1085 Thr Thr Asp Ser Gly Lys Val Ile Pro
Glu Trp Cys Cys Arg Ser Cys 1090 1095 1100 Thr Met Pro Pro Val Ser
Phe His Gly Ser Asp Gly Cys Trp Tyr Pro 1105 1110 1115 1120 Met Glu
Ile Arg Pro Arg Lys Thr His Glu Ser His Leu Val Arg Ser 1125 1130
1135 Trp Val Thr Ala Gly Glu Ile His Ala Val Pro Phe Gly Leu Val
Ser 1140 1145 1150 Met Met Ile Ala Met Glu Val Val Leu Arg Lys Arg
Gln Gly Pro Lys 1155 1160 1165 Gln Met Leu Val Gly Gly Val Val Leu
Leu Gly Ala Met Leu Val Gly 1170 1175 1180 Gln Val Thr Leu Leu Asp
Leu Leu Lys Leu Thr Val Ala Val Gly Leu 1185 1190 1195 1200 His Phe
His Glu Met Asn Asn Gly Gly Asp Ala Met Tyr Met Ala Leu 1205 1210
1215 Ile Ala Ala Phe Ser Ile Arg Pro Gly Leu Leu Ile Gly Phe Gly
Leu 1220 1225 1230 Arg Thr Leu Trp Ser Pro Arg Glu Arg Leu Val Leu
Thr Leu Gly Ala 1235 1240 1245 Ala Met Val Glu Ile Ala Leu Gly Gly
Val Met Gly Gly Leu Trp Lys 1250 1255 1260 Tyr Leu Asn Ala Val Ser
Leu Cys Ile Leu Thr Ile Asn Ala Val Ala 1265 1270 1275 1280 Ser Arg
Lys Ala Ser Asn Thr Ile Leu Pro Leu Met Ala Leu Leu Thr 1285 1290
1295 Pro Val Thr Met Ala Glu Val Arg Leu Ala Ala Met Phe Phe Cys
Ala 1300 1305 1310 Met Val Ile Ile Gly Val Leu His Gln Asn Phe Lys
Asp Thr Ser Met 1315 1320 1325 Gln Lys Thr Ile Pro Leu Val Ala Leu
Thr Leu Thr Ser Tyr Leu Gly 1330 1335 1340 Leu Thr Gln Pro Phe Leu
Gly Leu Cys Ala Phe Leu Ala Thr Arg Ile 1345 1350 1355 1360 Phe Gly
Arg Arg Ser Ile Pro Val Asn Glu Ala Leu Ala Ala Ala Gly 1365 1370
1375 Leu Val Gly Val Leu Ala Gly Leu Ala Phe Gln Glu Met Glu Asn
Phe 1380 1385 1390 Leu Gly Pro Ile Ala Val Gly Gly Leu Leu Met Met
Leu Val Ser Val 1395 1400 1405 Ala Gly Arg Val Asp Gly Leu Glu Leu
Lys Lys Leu Gly Glu Val Ser 1410 1415 1420 Trp Glu Glu Glu Ala Glu
Ile Ser Gly Ser Ser Ala Arg Tyr Asp Val 1425 1430 1435 1440 Ala Leu
Ser Glu Gln Gly Glu Phe Lys Leu Leu Ser Glu Glu Lys Val 1445 1450
1455 Pro Trp Asp Gln Val Val Met Thr Ser Leu Ala Leu Val Gly Ala
Ala 1460 1465 1470 Leu His Pro Phe Ala Leu Leu Leu Val Leu Ala Gly
Trp Leu Phe His 1475 1480 1485 Val Arg Gly Ala Arg Arg Ser Gly Asp
Val Leu Trp Asp Ile Pro Thr 1490 1495 1500 Pro Lys Ile Ile Glu Glu
Cys Glu His Leu Glu Asp Gly Ile Tyr Gly 1505 1510 1515 1520 Ile Phe
Gln Ser Thr Phe Leu Gly Ala Ser Gln Arg Gly Val Gly Val 1525
1530 1535 Ala Gln Gly Gly Val Phe His Thr Met Trp His Val Thr Arg
Gly Ala 1540 1545 1550 Phe Leu Val Arg Asn Gly Lys Lys Leu Ile Pro
Ser Trp Ala Ser Val 1555 1560 1565 Lys Glu Asp Leu Val Ala Tyr Gly
Gly Ser Trp Lys Leu Glu Gly Arg 1570 1575 1580 Trp Asp Gly Glu Glu
Glu Val Gln Leu Ile Ala Ala Val Pro Gly Lys 1585 1590 1595 1600 Asn
Val Val Asn Val Gln Thr Lys Pro Ser Leu Phe Lys Val Arg Asn 1605
1610 1615 Gly Gly Glu Ile Gly Ala Val Ala Leu Asp Tyr Pro Ser Gly
Thr Ser 1620 1625 1630 Gly Ser Pro Ile Val Asn Arg Asn Gly Glu Val
Ile Gly Leu Tyr Gly 1635 1640 1645 Asn Gly Ile Leu Val Gly Asp Asn
Ser Phe Val Ser Ala Ile Ser Gln 1650 1655 1660 Thr Glu Val Lys Glu
Glu Gly Lys Glu Glu Leu Gln Glu Ile Pro Thr 1665 1670 1675 1680 Met
Leu Lys Lys Gly Met Thr Thr Val Leu Asp Phe His Pro Gly Ala 1685
1690 1695 Gly Lys Thr Arg Arg Phe Leu Pro Gln Ile Leu Ala Glu Cys
Ala Arg 1700 1705 1710 Arg Arg Leu Arg Thr Leu Val Leu Ala Pro Thr
Arg Val Val Leu Ser 1715 1720 1725 Glu Met Lys Glu Ala Phe His Gly
Leu Asp Val Lys Phe His Thr Gln 1730 1735 1740 Ala Phe Ser Ala His
Gly Ser Gly Arg Glu Val Ile Asp Ala Met Cys 1745 1750 1755 1760 His
Ala Thr Leu Thr Tyr Arg Met Leu Glu Pro Thr Arg Val Val Asn 1765
1770 1775 Trp Glu Val Ile Ile Met Asp Glu Ala His Phe Leu Asp Pro
Ala Ser 1780 1785 1790 Ile Ala Ala Arg Gly Trp Ala Ala His Arg Ala
Arg Ala Asn Glu Ser 1795 1800 1805 Ala Thr Ile Leu Met Thr Ala Thr
Pro Pro Gly Thr Ser Asp Glu Phe 1810 1815 1820 Pro His Ser Asn Gly
Glu Ile Glu Asp Val Gln Thr Asp Ile Pro Ser 1825 1830 1835 1840 Glu
Pro Trp Asn Thr Gly His Asp Trp Ile Leu Ala Asp Lys Arg Pro 1845
1850 1855 Thr Ala Trp Phe Leu Pro Ser Ile Arg Ala Ala Asn Val Met
Ala Ala 1860 1865 1870 Ser Leu Arg Lys Ala Gly Lys Ser Val Val Val
Leu Asn Arg Lys Thr 1875 1880 1885 Phe Glu Arg Glu Tyr Pro Thr Ile
Lys Gln Lys Lys Pro Asp Phe Ile 1890 1895 1900 Leu Ala Thr Asp Ile
Ala Glu Met Gly Ala Asn Leu Cys Val Glu Arg 1905 1910 1915 1920 Val
Leu Asp Cys Arg Thr Ala Phe Lys Pro Val Leu Val Asp Glu Gly 1925
1930 1935 Arg Lys Val Ala Ile Lys Gly Pro Leu Arg Ile Ser Ala Ser
Ser Ala 1940 1945 1950 Ala Gln Arg Arg Gly Arg Ile Gly Arg Asn Pro
Asn Arg Asp Gly Asp 1955 1960 1965 Ser Tyr Tyr Tyr Ser Glu Pro Thr
Ser Glu Asn Asn Ala His His Val 1970 1975 1980 Cys Trp Leu Glu Ala
Ser Met Leu Leu Asp Asn Met Glu Val Arg Gly 1985 1990 1995 2000 Gly
Met Val Ala Pro Leu Tyr Gly Val Glu Gly Thr Lys Thr Pro Val 2005
2010 2015 Ser Pro Gly Glu Met Arg Leu Arg Asp Asp Gln Arg Lys Val
Phe Arg 2020 2025 2030 Glu Leu Val Arg Asn Cys Asp Leu Pro Val Trp
Leu Ser Trp Gln Val 2035 2040 2045 Ala Lys Ala Gly Leu Lys Thr Asn
Asp Arg Lys Trp Cys Phe Glu Gly 2050 2055 2060 Pro Glu Glu His Glu
Ile Leu Asn Asp Ser Gly Glu Thr Val Lys Cys 2065 2070 2075 2080 Arg
Ala Pro Gly Gly Ala Lys Lys Pro Leu Arg Pro Arg Trp Cys Asp 2085
2090 2095 Glu Arg Val Ser Ser Asp Gln Ser Ala Leu Ser Glu Phe Ile
Lys Phe 2100 2105 2110 Ala Glu Gly Arg Arg Gly Ala Ala Glu Val Leu
Val Val Leu Ser Glu 2115 2120 2125 Leu Pro Asp Phe Leu Ala Lys Lys
Gly Gly Glu Ala Met Asp Thr Ile 2130 2135 2140 Ser Val Phe Leu His
Ser Glu Glu Gly Ser Arg Ala Tyr Arg Asn Ala 2145 2150 2155 2160 Leu
Ser Met Met Pro Glu Ala Met Thr Ile Val Met Leu Phe Ile Leu 2165
2170 2175 Ala Gly Leu Leu Thr Ser Gly Met Val Ile Phe Phe Met Ser
Pro Lys 2180 2185 2190 Gly Ile Ser Arg Met Ser Met Ala Met Gly Thr
Met Ala Gly Cys Gly 2195 2200 2205 Tyr Leu Met Phe Leu Gly Gly Val
Lys Pro Thr His Ile Ser Tyr Val 2210 2215 2220 Met Leu Ile Phe Phe
Val Leu Met Val Val Val Ile Pro Glu Pro Gly 2225 2230 2235 2240 Gln
Gln Arg Ser Ile Gln Asp Asn Gln Val Ala Tyr Leu Ile Ile Gly 2245
2250 2255 Ile Leu Thr Leu Val Ser Ala Val Ala Ala Asn Glu Leu Gly
Met Leu 2260 2265 2270 Glu Lys Thr Lys Glu Asp Leu Phe Gly Lys Lys
Asn Leu Ile Pro Ser 2275 2280 2285 Ser Ala Ser Pro Trp Ser Trp Pro
Asp Leu Asp Leu Lys Pro Gly Ala 2290 2295 2300 Ala Trp Thr Val Tyr
Val Gly Ile Val Thr Met Leu Ser Pro Met Leu 2305 2310 2315 2320 His
His Trp Ile Lys Val Glu Tyr Gly Asn Leu Ser Leu Ser Gly Ile 2325
2330 2335 Ala Gln Ser Ala Ser Val Leu Ser Phe Met Asp Lys Gly Ile
Pro Phe 2340 2345 2350 Met Lys Met Asn Ile Ser Val Ile Met Leu Leu
Val Ser Gly Trp Asn 2355 2360 2365 Ser Ile Thr Val Met Pro Leu Leu
Cys Gly Ile Gly Cys Ala Met Leu 2370 2375 2380 His Trp Ser Leu Ile
Leu Pro Gly Ile Lys Ala Gln Gln Ser Lys Leu 2385 2390 2395 2400 Ala
Gln Arg Arg Val Phe His Gly Val Ala Lys Asn Pro Val Val Asp 2405
2410 2415 Gly Asn Pro Thr Val Asp Ile Glu Glu Ala Pro Glu Met Pro
Ala Leu 2420 2425 2430 Tyr Glu Lys Lys Leu Ala Leu Tyr Leu Leu Leu
Ala Leu Ser Leu Ala 2435 2440 2445 Ser Val Ala Met Cys Arg Thr Pro
Phe Ser Leu Ala Glu Gly Ile Val 2450 2455 2460 Leu Ala Ser Ala Ala
Leu Gly Pro Leu Ile Glu Gly Asn Thr Ser Leu 2465 2470 2475 2480 Leu
Trp Asn Gly Pro Met Ala Val Ser Met Thr Gly Val Met Arg Gly 2485
2490 2495 Asn His Tyr Ala Phe Val Gly Val Met Tyr Asn Leu Trp Lys
Met Lys 2500 2505 2510 Thr Gly Arg Arg Gly Ser Ala Asn Gly Lys Thr
Leu Gly Glu Val Trp 2515 2520 2525 Lys Arg Glu Leu Asn Leu Leu Asp
Lys Arg Gln Phe Glu Leu Tyr Lys 2530 2535 2540 Arg Thr Asp Ile Val
Glu Val Asp Arg Asp Thr Ala Arg Arg His Leu 2545 2550 2555 2560 Ala
Glu Gly Lys Val Asp Thr Gly Val Ala Val Ser Arg Gly Thr Ala 2565
2570 2575 Lys Leu Arg Trp Phe His Glu Arg Gly Tyr Val Lys Leu Glu
Gly Arg 2580 2585 2590 Val Ile Asp Leu Gly Cys Gly Arg Gly Gly Trp
Cys Tyr Tyr Ala Ala 2595 2600 2605 Ala Gln Lys Glu Val Ser Gly Val
Lys Gly Phe Thr Leu Gly Arg Asp 2610 2615 2620 Gly His Glu Lys Pro
Met Asn Val Gln Ser Leu Gly Trp Asn Ile Ile 2625 2630 2635 2640 Thr
Phe Lys Asp Lys Thr Asp Ile His Arg Leu Glu Pro Val Lys Cys 2645
2650 2655 Asp Thr Leu Leu Cys Asp Ile Gly Glu Ser Ser Ser Ser Ser
Val Thr 2660 2665 2670 Glu Gly Glu Arg Thr Val Arg Val Leu Asp Thr
Val Glu Lys Trp Leu 2675 2680 2685 Ala Cys Gly Val Asp Asn Phe Cys
Val Lys Val Leu Ala Pro Tyr Met 2690 2695 2700 Pro Asp Val Leu Glu
Lys Leu Glu Leu Leu Gln Arg Arg Phe Gly Gly 2705 2710 2715 2720 Thr
Val Ile Arg Asn Pro Leu Ser Arg Asn Ser Thr His Glu Met Tyr 2725
2730 2735 Tyr Val Ser Gly Ala Arg Ser Asn Val Thr Phe Thr Val Asn
Gln Thr 2740 2745 2750 Ser Arg Leu Leu Met Arg Arg Met Arg Arg Pro
Thr Gly Lys Val Thr 2755 2760 2765 Leu Glu Ala Asp Val Ile Leu Pro
Ile Gly Thr Arg Ser Val Glu Thr 2770 2775 2780 Asp Lys Gly Pro Leu
Asp Lys Glu Ala Ile Glu Glu Arg Val Glu Arg 2785 2790 2795 2800 Ile
Lys Ser Glu Tyr Met Thr Ser Trp Phe Tyr Asp Asn Asp Asn Pro 2805
2810 2815 Tyr Arg Thr Trp His Tyr Cys Gly Ser Tyr Val Thr Lys Thr
Ser Gly 2820 2825 2830 Ser Ala Ala Ser Met Val Asn Gly Val Ile Lys
Ile Leu Thr Tyr Pro 2835 2840 2845 Trp Asp Arg Ile Glu Glu Val Thr
Arg Met Ala Met Thr Asp Thr Thr 2850 2855 2860 Pro Phe Gly Gln Gln
Arg Val Phe Lys Glu Lys Val Asp Thr Arg Ala 2865 2870 2875 2880 Lys
Asp Pro Pro Ala Gly Thr Arg Lys Ile Met Lys Val Val Asn Arg 2885
2890 2895 Trp Leu Phe Arg His Leu Ala Arg Glu Lys Asn Pro Arg Leu
Cys Thr 2900 2905 2910 Lys Glu Glu Phe Ile Ala Lys Val Arg Ser His
Ala Ala Ile Gly Ala 2915 2920 2925 Tyr Leu Glu Glu Gln Glu Gln Trp
Lys Thr Ala Asn Glu Ala Val Gln 2930 2935 2940 Asp Pro Lys Phe Trp
Glu Leu Val Asp Glu Glu Arg Lys Leu His Gln 2945 2950 2955 2960 Gln
Gly Arg Cys Arg Thr Cys Val Tyr Asn Met Met Gly Lys Arg Glu 2965
2970 2975 Lys Lys Leu Ser Glu Phe Gly Lys Ala Lys Gly Ser Arg Ala
Ile Trp 2980 2985 2990 Tyr Met Trp Leu Gly Ala Arg Tyr Leu Glu Phe
Glu Ala Leu Gly Phe 2995 3000 3005 Leu Asn Glu Asp His Trp Ala Ser
Arg Glu Asn Ser Gly Gly Gly Val 3010 3015 3020 Glu Gly Ile Gly Leu
Gln Tyr Leu Gly Tyr Val Ile Arg Asp Leu Ala 3025 3030 3035 3040 Ala
Met Asp Gly Gly Gly Phe Tyr Ala Asp Asp Thr Ala Gly Trp Asp 3045
3050 3055 Thr Arg Ile Thr Glu Ala Asp Leu Asp Asp Glu Gln Glu Ile
Leu Asn 3060 3065 3070 Tyr Met Ser Pro His His Lys Lys Leu Ala Gln
Ala Val Met Glu Met 3075 3080 3085 Thr Tyr Lys Asn Lys Val Val Lys
Val Leu Arg Pro Ala Pro Gly Gly 3090 3095 3100 Lys Ala Tyr Met Asp
Val Ile Ser Arg Arg Asp Gln Arg Gly Ser Gly 3105 3110 3115 3120 Gln
Val Val Thr Tyr Ala Leu Asn Thr Ile Thr Asn Leu Lys Val Gln 3125
3130 3135 Leu Ile Arg Met Ala Glu Ala Glu Met Val Ile His His Gln
His Val 3140 3145 3150 Gln Asp Cys Asp Glu Ser Val Leu Thr Arg Leu
Glu Ala Trp Leu Thr 3155 3160 3165 Glu His Gly Cys Asp Arg Leu Lys
Arg Met Ala Val Ser Gly Asp Asp 3170 3175 3180 Cys Val Val Arg Pro
Ile Asp Asp Arg Phe Gly Leu Ala Leu Ser His 3185 3190 3195 3200 Leu
Asn Ala Met Ser Lys Val Arg Lys Asp Ile Ser Glu Trp Gln Pro 3205
3210 3215 Ser Lys Gly Trp Asn Asp Trp Glu Asn Val Pro Phe Cys Ser
His His 3220 3225 3230 Phe His Glu Leu Gln Leu Lys Asp Gly Arg Arg
Ile Val Val Pro Cys 3235 3240 3245 Arg Glu Gln Asp Glu Leu Ile Gly
Arg Gly Arg Val Ser Pro Gly Asn 3250 3255 3260 Gly Trp Met Ile Lys
Glu Thr Ala Cys Leu Ser Lys Ala Tyr Ala Asn 3265 3270 3275 3280 Met
Trp Ser Leu Met Tyr Phe His Lys Arg Asp Met Arg Leu Leu Ser 3285
3290 3295 Leu Ala Val Ser Ser Ala Val Pro Thr Ser Trp Val Pro Gln
Gly Arg 3300 3305 3310 Thr Thr Trp Ser Ile His Gly Lys Gly Glu Trp
Met Thr Thr Glu Asp 3315 3320 3325 Met Leu Glu Val Trp Asn Arg Val
Trp Ile Thr Asn Asn Pro His Met 3330 3335 3340 Gln Asp Lys Thr Met
Val Lys Lys Trp Arg Asp Val Pro Tyr Leu Thr 3345 3350 3355 3360 Lys
Arg Gln Asp Lys Leu Cys Gly Ser Leu Ile Gly Met Thr Asn Arg 3365
3370 3375 Ala Thr Trp Ala Ser His Ile His Leu Val Ile His Arg Ile
Arg Thr 3380 3385 3390 Leu Ile Gly Gln Glu Lys Tyr Thr Asp Tyr Leu
Thr Val Met Asp Arg 3395 3400 3405 Tyr Ser Val Asp Ala Asp Leu Gln
Leu Gly Glu Leu Ile 3410 3415 3420 54 10 PRT Yellow Fever virus 54
Leu Ser Ser Arg Lys Arg Arg Ser His Asp 1 5 10 55 20 PRT Yellow
Fever virus 55 Val Leu Thr Val Gln Phe Leu Ile Leu Gly Met Leu Leu
Met Thr Gly 1 5 10 15 Gly Val Thr Leu 20 56 32 PRT Japanese
Encephalitis virus 56 Gly Arg Lys Gln Asn Lys Arg Gly Gly Asn Glu
Gly Ser Ile Met Trp 1 5 10 15 Leu Ala Ser Leu Ala Val Val Ile Ala
Tyr Ala Gly Ala Met Lys Leu 20 25 30 57 11 PRT Tick-Borne
Encephalitis virus 57 Gln Lys Arg Gly Lys Arg Arg Ser Ala Thr Asp 1
5 10 58 19 PRT Tick-Borne Encephalitis virus 58 Trp Met Ser Trp Leu
Leu Val Ile Thr Leu Leu Gly Met Thr Leu Ala 1 5 10 15 Ala Thr Val
59 11 PRT Murray Valley Encephalitis virus 59 Gly Lys Lys Gln Lys
Lys Arg Gly Gly Ser Glu 1 5 10 60 19 PRT Murray Valley Encephalitis
virus 60 Thr Ser Val Leu Met Val Ile Phe Met Leu Ile Gly Phe Ala
Ala Ala 1 5 10 15 Leu Lys Leu 61 11 PRT Saint Louis Encephalitis
virus 61 Arg Arg Pro Ser Lys Lys Arg Gly Gly Thr Arg 1 5 10 62 15
PRT Saint Louis Encephalitis virus 62 Ser Leu Leu Gly Leu Ala Ala
Leu Ile Gly Leu Ala Ser Ser Leu 1 5 10 15 63 10 PRT Dengue-1 virus
63 Ile Asn Met Arg Arg Lys Arg Ser Val Thr 1 5 10 64 14 PRT
Dengue-1 virus 64 Met Leu Leu Met Leu Leu Pro Thr Ala Leu Ala Phe
His Leu 1 5 10 65 10 PRT Dengue-2 virus 65 Ile Leu Asn Arg Arg Arg
Arg Thr Ala Gly 1 5 10 66 14 PRT Dengue-2 virus 66 Met Ile Ile Met
Leu Ile Pro Thr Val Met Ala Phe His Leu 1 5 10 67 10 PRT Dengue-3
virus 67 Ile Ile Asn Lys Arg Lys Lys Thr Ser Leu 1 5 10 68 14 PRT
Dengue-3 virus 68 Cys Leu Met Met Met Leu Pro Ala Thr Leu Ala Phe
His Leu 1 5 10 69 10 PRT Dengue-4 virus 69 Ile Leu Asn Gly Arg Lys
Arg Ser Thr Ile 1 5 10 70 14 PRT Dengue-4 virus 70 Thr Leu Leu Cys
Leu Ile Pro Thr Val Met Ala Phe Ser Leu 1 5 10 71 24 PRT Dengue-4
virus 71 Ile Leu Asn Gly Arg Lys Arg Ser Thr Ile Thr Leu Leu Cys
Leu Ile 1 5 10 15 Pro Thr Val Met Ala Phe Ser Leu 20 72 30 PRT
Tick-Borne Encephalitis virus 72 Gln Lys Arg Gly Lys Arg Arg Ser
Ala Val Asp Trp Thr Gly Trp Leu 1 5 10 15 Leu Val Val Val Leu Leu
Gly Val Thr Leu Ala Ala Thr Val 20 25 30 73 30 PRT Yellow Fever
virus 73 Leu Ser Ser Arg Lys Arg Arg Ser His Asp Val Leu Thr Val
Gln Phe 1 5 10 15 Leu Ile Leu Gly Met Leu Leu Met Thr Gly Gly Val
Thr Leu 20 25 30 74 24 PRT Dengue-2 virus 74 Ile Leu Asn Arg Arg
Arg Arg Thr Ala Gly Met Ile Ile Met Leu Ile 1 5 10 15 Pro Thr Val
Met Ala Phe His Leu 20 75 30 PRT Yellow Fever virus 75 Leu Ser Ser
Arg Lys Arg Arg Ser His Asp Val Leu Thr Val Gln Phe 1 5 10 15 Leu
Ile Leu Gly Met Leu Leu Met Thr Gly Gly Val Thr Leu 20 25 30 76 7
PRT Dengue-2 virus 76 Ile Leu Asn Arg Arg Arg Arg 1 5 77 17 PRT
Dengue-2 virus 77 Thr Ala Gly Met Ile Ile Met Leu Ile Pro Thr Val
Met Ala Phe His 1 5 10 15 Leu 78 7 PRT Japanese Encephalitis virus
78 Tyr Ala Gly Ala Met Lys
Leu 1 5 79 7 PRT Yellow Fever virus 79 Met Thr Gly Gly Val Thr Leu
1 5 80 7 PRT Artificial Sequence derived from Japanese Encephalitis
virus and Yellow Fever virus 80 Met Thr Gly Gly Met Lys Leu 1 5 81
7 PRT Japanese Encephalitis virus 81 Asn Lys Arg Gly Gly Asn Glu 1
5 82 7 PRT Yellow Fever virus 82 Lys Arg Arg Ser His Asp Val 1 5 83
10 PRT Japanese Encephalitis virus 83 Thr Asn Val His Ala Asp Thr
Gly Cys Ala 1 5 10 84 10 PRT Yellow Fever virus 84 Leu Gly Val Gly
Ala Asp Gln Gly Cys Ala 1 5 10 85 10 PRT Artificial Sequence
derived from Japanese Encephalitis virus and Yellow Fever virus 85
Thr Asn Val Gly Ala Asp Gln Gly Cys Ala 1 5 10
* * * * *