U.S. patent application number 10/759878 was filed with the patent office on 2004-11-04 for compositions and methods for sirna inhibition of icam-1.
This patent application is currently assigned to The Trustees of the University of Pennsylvania. Invention is credited to Reich, Samuel Jotham, Tolentino, Michael J..
Application Number | 20040220129 10/759878 |
Document ID | / |
Family ID | 32771836 |
Filed Date | 2004-11-04 |
United States Patent
Application |
20040220129 |
Kind Code |
A1 |
Reich, Samuel Jotham ; et
al. |
November 4, 2004 |
Compositions and methods for siRNA inhibition of ICAM-1
Abstract
RNA interference using small interfering RNAs which are specific
for the ICAM-1 gene inhibits expression of this gene. Diseases
which involve ICAM-1-mediated cell adhesion, such as inflammatory
and autoimmune diseases, diabetic retinopathy and other
complications arising from type I diabetes, age related macular
degeneration and many types of cancer, can be treated by
administering the small interfering RNAs.
Inventors: |
Reich, Samuel Jotham; (Bala
Cynwyd, PA) ; Tolentino, Michael J.; (Villanova,
PA) |
Correspondence
Address: |
DRINKER BIDDLE & REATH
ONE LOGAN SQUARE
18TH AND CHERRY STREETS
PHILADELPHIA
PA
19103-6996
US
|
Assignee: |
The Trustees of the University of
Pennsylvania
Suite 200, 3160 Chestnut Street
Philadelphi
PA
19104-6283
|
Family ID: |
32771836 |
Appl. No.: |
10/759878 |
Filed: |
January 16, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60440579 |
Jan 16, 2003 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/23.1 |
Current CPC
Class: |
A61P 25/00 20180101;
A61P 27/02 20180101; A61P 1/04 20180101; A61K 38/00 20130101; A61P
11/02 20180101; A61P 19/02 20180101; A61P 17/00 20180101; A61P
17/06 20180101; A61P 35/02 20180101; A61P 29/00 20180101; A61P
37/08 20180101; A61P 17/04 20180101; C12N 2310/14 20130101; A61P
13/12 20180101; A61P 3/10 20180101; A61P 31/04 20180101; A61P 13/08
20180101; A61P 35/04 20180101; A61P 11/06 20180101; A61P 5/14
20180101; A61P 9/00 20180101; A61P 9/08 20180101; A61P 27/14
20180101; A61P 9/10 20180101; C12N 15/1138 20130101; A61P 35/00
20180101; A61P 11/00 20180101; A61P 1/00 20180101; A61P 37/06
20180101; A61P 25/28 20180101; A61P 31/12 20180101; A61P 37/00
20180101 |
Class at
Publication: |
514/044 ;
536/023.1 |
International
Class: |
A61K 048/00; C07H
021/02 |
Claims
We claim:
1. An isolated siRNA comprising a sense RNA strand and an antisense
RNA strand, wherein the sense and an antisense RNA strands form an
RNA duplex, and wherein the sense RNA strand comprises a nucleotide
sequence substantially identical to a target sequence of about 19
to about 25 contiguous nucleotides in human ICAM-1 mRNA (SEQ ID NO:
1), or an alternative splice form, mutant or cognate thereof.
2. The siRNA of claim 1, wherein the cognate of the human ICAM-1
mRNA sequence is mouse ICAM-1 mRNA (SEQ ID NO: 2).
3. The siRNA of claim 1, wherein the sense RNA strand comprises one
RNA molecule, and the antisense RNA strand comprises one RNA
molecule.
4. The siRNA of claim 1, wherein the sense and antisense RNA
strands forming the RNA duplex are covalently linked by a
single-stranded hairpin.
5. The siRNA of claim 1, wherein the siRNA further comprises
non-nucleotide material.
6. The siRNA of claim 1, wherein the siRNA further comprises an
addition, deletion, substitution or alteration of one or more
nucleotides.
7. The siRNA of claim 1, wherein the sense and antisense RNA
strands are stabilized against nuclease degradation.
8. The siRNA of claim 1, further comprising a 3' overhang.
9. The siRNA of claim 8, wherein the 3' overhang comprises from 1
to about 6 nucleotides.
10. The siRNA of claim 8, wherein the 3' overhang comprises about 2
nucleotides.
11. The siRNA of claim 3 wherein the sense RNA strand comprises a
first 3' overhang, and the antisense RNA strand comprises a second
3' overhang.
12. The siRNA of claim 11, wherein the first and second 3'
overhangs separately comprise from 1 to about 6 nucleotides.
13. The siRNA of claim 12, wherein the first 3' overhang comprises
a dinucleotide and the second 3' overhang comprises a
dinucleotide.
14. The siRNA of claim 13, where the dinucleotide comprising the
first and second 3' overhangs is dithymidylic acid (TT) or
diuridylic acid (uu).
15. The siRNA of claim 8, wherein the 3' overhang is stabilized
against nuclease degradation.
16. A retinal endothelial cell comprising the siRNA of claim 1.
17. A recombinant plasmid comprising nucleic acid sequences for
expressing an siRNA comprising a sense RNA strand and an antisense
RNA strand, wherein the sense and an antisense RNA strands form an
RNA duplex, and wherein the sense RNA strand comprises a nucleotide
sequence substantially identical to a target sequence of about 19
to about 25 contiguous nucleotides in human ICAM-1 mRNA, or an
alternative splice form, mutant or cognate thereof.
18. The recombinant plasmid of claim 17, wherein the nucleic acid
sequences for expressing the siRNA comprise an inducible or
regulatable promoter.
19. The recombinant plasmid of claim 17, wherein the nucleic acid
sequences for expressing the siRNA comprise a sense RNA strand
coding sequence in operable connection with a polyT termination
sequence under the control of a human U6 RNA promoter, and an
antisense RNA strand coding sequence in operable connection with a
polyT termination sequence under the control of a human U6 RNA
promoter.
20. The recombinant plasmid of claim 17, wherein the plasmid
comprises a CMV promoter.
21. A recombinant viral vector comprising nucleic acid sequences
for expressing an siRNA comprising a sense RNA strand and an
antisense RNA strand, wherein the sense and an antisense RNA
strands form an RNA duplex, and wherein the sense RNA strand
comprises a nucleotide sequence substantially identical to a target
sequence of about 19 to about 25 contiguous nucleotides in human
ICAM-1 mRNA, or an alternative splice form, mutant or cognate
thereof.
22. The recombinant viral vector of claim 21, wherein the nucleic
acid sequences for expressing the siRNA comprise an inducible or
regulatable promoter.
23. The recombinant viral vector of claim 21, wherein the nucleic
acid sequences for expressing the siRNA comprise a sense RNA strand
coding sequence in operable connection with a polyT termination
sequence under the control of a human U6 RNA promoter, and an
antisense RNA strand coding sequence in operable connection with a
polyT termination sequence under the control of a human U6 RNA
promoter.
24. The recombinant viral vector of claim 21, wherein the
recombinant viral vector is selected from the group consisting of
an adenoviral vector, an adeno-associated viral vector, a
lentiviral vector, a retroviral vector, and a herpes virus
vector.
25. The recombinant viral vector of claim 21, wherein the
recombinant viral vector is pseudotyped with surface proteins from
vesicular stomatitis virus, rabies virus, Ebola virus, or Mokola
virus.
26. The recombinant viral vector of claim 24, wherein the
recombinant viral vector comprises an adeno-associated viral
vector.
27. A pharmaceutical composition comprising an siRNA and a
pharmaceutically acceptable carrier, wherein the siRNA comprises a
sense RNA strand and an antisense RNA strand, wherein the sense and
an antisense RNA strands form an RNA duplex, and wherein the sense
RNA strand comprises a nucleotide sequence substantially identical
to a target sequence of about 19 to about 25 contiguous nucleotides
in human ICAM-1 mRNA, or an alternative splice form, mutant or
cognate thereof.
28. The pharmaceutical composition of claim 27, further comprising
lipofectin, lipofectamine, cellfectin, polycations, or
liposomes.
29. A pharmaceutical composition comprising the plasmid of claim
17, or a physiologically acceptable salt thereof, and a
pharmaceutically acceptable carrier.
30. The pharmaceutical composition of claim 29, further comprising
lipofectin, lipofectamine, cellfectin, polycations, or
liposomes.
31. A pharmaceutical composition comprising the viral vector of
claim 21 and a pharmaceutically acceptable carrier.
32. A method of inhibiting expression of human ICAM-1 mRNA, or an
alternative splice form, mutant or cognate thereof, comprising
administering to a subject an effective amount of an siRNA
comprising a sense RNA strand and an antisense RNA strand, wherein
the sense and an antisense RNA strands form an RNA duplex, and
wherein the sense RNA strand comprises a nucleotide sequence
substantially identical to a target sequence of about 19 to about
25 contiguous nucleotides in human ICAM-1 mRNA, or an alternative
splice form, mutant or cognate thereof, such that the human ICAM-1
mRNA, or an alternative splice form, mutant or cognate thereof, is
degraded.
33. The method of claim 32, wherein the subject is a human
being.
34. The method of claim 32, wherein expression of human ICAM-1
mRNA, or an alternative splice form, mutant or cognate thereof is
inhibited in one or both eyes of the subject.
35. The method of claim 32, wherein expression of human ICAM-1
mRNA, or an alternative splice form, mutant or cognate thereof is
inhibited in retinal pigment epithelial cells of the subject.
36. The method of claim 32, wherein the effective amount of the
siRNA is from about 1 nM to about 100 nM.
37. The method of claim 32, wherein the siRNA is administered in
conjunction with a delivery reagent.
38. The method of claim 37, wherein the delivery agent is selected
from the group consisting of lipofectin, lipofectamine, cellfectin,
polycations, and liposomes.
39. The method of claim 38, wherein the delivery agent is a
liposome.
40. The method claim 39, wherein the liposome comprises a ligand
which targets the liposome to cells expressing ICAM-1.
41. The method of claim 40, wherein the ligand binds to receptors
on endothelial, epithelial, fibroblastic, hematopoietic or tumor
cells.
42. The method of claim 41, wherein the endothelial cells are
retinal vascular epithelial cells.
43. The method of claim 41, wherein the hematopoietic cells are
selected from the group consisting of tissue macrophages,
mitogen-stimulated T lymphocyte blasts, germinal center dendritic
cells in tonsils, germinal center dendritic cells in lymph nodes,
and germinal center dendritic cells in Peyer's patches.
44. The method of claim 41, wherein the ligand comprises a
monoclonal antibody.
45. The method of claim 39, wherein the liposome is modified with
an opsonization-inhibition moiety.
46. The method of claim 45, wherein the opsonization-inhibiting
moiety comprises a PEG, PPG, or derivatives thereof.
47. The method of claim 32, wherein the siRNA is expressed from a
recombinant plasmid.
48. The method of claim 32, wherein the siRNA is expressed from a
recombinant viral vector.
49. The method of claim 48, wherein the recombinant viral vector
comprises an adenoviral vector, an adeno-associated viral vector, a
lentiviral vector, or a herpes virus vector.
50. The method of claim 49, wherein the recombinant viral vector is
a lentiviral vector which is pseudotyped with surface proteins from
vesicular stomatitis virus, rabies virus, Ebola virus, or Mokola
virus.
51. The method of claim 32, wherein the siRNA is administered by an
enteral administration route.
52. The method of claim 51, wherein the enteral administration
route is selected form the group consisting of oral, rectal, and
intranasal.
53. The method of claim 32, wherein the siRNA is administered by a
parenteral administration route.
54. The method of claim 53, wherein the parenteral administration
route is selected from the group consisting of intravascular
administration, peri- and intra-tissue administration, subcutaneous
injection or deposition, subcutaneous infusion, intraocular
administration, and direct application at or near the site of
neovascularization.
55. The method of claim 54, wherein the intravascular
administration is selected from the group consisting of intravenous
bolus injection, intravenous infusion, intra-arterial bolus
injection, intra-arterial infusion and catheter instillation intro
the vasculature.
56. The method of claim 54, wherein the peri- and intra-tissue
injection is selected from the group consisting of peri-tumoral
injection, intra-tumoral injection, intra-retinal injection, and
subretinal injection.
57. The method of claim 54, wherein the intraocular administration
comprises intravitreal, intraretinal, subretinal, subtenon, peri-
and retro-orbital, trans-corneal or trans-scleral
administration.
58. The method of claim 54, wherein the direct application at or
near the site of neovascularization comprises application by
catheter, corneal pellet, eye dropper, suppository, an implant
comprising a porous material, an implant comprising a non-porous
material, or an implant comprising a gelatinous material.
59. The method of claim 58, wherein the site of neovascularization
is in the eye, and the direct application at or near the site of
neovascularization comprises application by eyedropper.
60. A method of inhibiting cell adhesion or cell adhesion-mediated
pathologies in a subject, comprising administering to a subject an
effective amount of an siRNA comprising a sense RNA strand and an
antisense RNA strand, wherein the sense RNA strand comprises a
nucleotide sequence substantially identical to a target sequence of
about 19 to about 25 contiguous nucleotides in human ICAM-1 mRNA,
or an alternative splice form, mutant or cognate thereof.
61. The method of claim 60, wherein the cell adhesion or cell
adhesion-mediated pathologies are selected from the group
consisting of AIDS-related dementia, allergic conjunctivitis,
allergic rhinitis, Alzheimer's disease, angiogenesis, antigen
presentation, asthma, atherosclerosis, toxic nephritis,
immune-based nephritis, contact dermal hypersensitivity,
corneal/limbic injury, type I diabetes, complications arising from
type I diabetes, Graves' disease, inflammatory bowel disease,
inflammatory lung diseases, inflammatory sequelae of viral
infections, inflammatory skin disorders, allograft rejection,
immune cell interactions such as T-cell killing, mixed lymphocyte
reaction, T-cell mediated B-cell differentiation, meningitis,
multiple sclerosis, multiple myeloma, myocarditis, pulmonary
fibrosis, reperfusion injury, restensosis, retinitis, rheumatoid
arthritis, septic arthritis, stroke, tumor metastasis, and
uveititis.
62. The method of claim 61, wherein the inflammatory skin disease
is allergic contact dermatitis, fixed drug eruption, lichen planus,
or psoriasis.
63. The method of claim 61, wherein the allograft is a renal, liver
or bone marrow transplant.
64. The method of claim 62, wherein the angiogenesis is
non-pathogenic and is associated with production of fatty tissues,
cholesterol production, or endometrial neovascularization.
65. A method of treating an angiogenic disease in a subject,
comprising administering to a subject in need of such treatment an
effective amount of an siRNA comprising a sense RNA strand and an
antisense RNA strand, wherein the sense and an antisense RNA
strands form an RNA duplex, and wherein the sense RNA strand
comprises a nucleotide sequence substantially identical to a target
sequence of about 19 to about 25 contiguous nucleotides in human
ICAM-1 mRNA, or an alternative splice form, mutant or cognate
thereof, such that angiogenesis associated with the angiogenic
disease is inhibited.
66. The method of claim 65, wherein the angiogenic disease
comprises a cancer.
67. The method of claim 66, wherein the cancer is selected from the
group consisting of breast cancer, lung cancer, head and neck
cancer, brain cancer, abdominal cancer, colon cancer, colorectal
cancer, esophagus cancer, gastrointestinal cancer, glioma, liver
cancer, tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer,
pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor,
multiple myeloma, skin cancer, lymphoma, and blood cancer.
68. The method of claim 65, wherein the angiogenic disease is
selected from the group consisting of diabetic retinopathy and
age-related macular degeneration.
69. The method of claim 68, wherein the angiogenic disease is
age-related macular degeneration.
70. The method of claim 65, wherein the siRNA is administered in
combination with a pharmaceutical agent for treating the angiogenic
disease, which pharmaceutical agent is different form the
siRNA.
71. The method of claim 70, wherein the angiogenic disease is
cancer, and the pharmaceutical agent comprises a chemotherapeutic
agent.
72. The method of claim 70, wherein the chemotherapeutic agent is
selected from the group consisting of cisplatin, carboplatin,
cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin, and
tamoxifen.
73. The method of claim 65, wherein the siRNA is administered to a
subject in combination with another therapeutic method designed to
treat the angiogenic disease.
74. The method of claim 73, wherein the angiogenic disease is
cancer, and the siRNA is administered in combination with radiation
therapy, chemotherapy or surgery.
75. A method of treating complications arising from type I diabetes
in a subject, comprising administering to a subject in need of such
treatment an effective amount of an siRNA comprising a sense RNA
strand and an antisense RNA strand, wherein the sense and an
antisense RNA strands from an RNA duplex, and wherein the sense RNA
strand comprises a nucleotide sequence substantially identical to a
target sequence of about 19 to about 25 contiguous nucleotides in
human ICAM-1 mRNA, or an alternative splice form, mutant or cognate
thereof.
76. The method of claim 75, wherein the complications arising from
type I diabetes are selected from the group consisting of diabetic
retinopathy, diabetic neuropathy, diabetic nephropathy and
macrovascular disease.
77. The method of claim 76, wherein the macrovascular disease is
coronary artery disease, cerebrovascular disease or peripheral
vascular disease.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. provisional
patent application serial No. 60/440,579, filed on Jan. 16,
2003.
FIELD OF THE INVENTION
[0002] This invention relates to the regulation of ICAM-1 gene
expression by small interfering RNA, in particular for treating
diseases or conditions involving intercellular adhesion.
BACKGROUND OF THE INVENTION
[0003] Many physiological processes require that cells come into
close contact with and adhere to other cells or the extracellular
matrix. Cell-cell and cell-matrix interactions are mediated through
several families of intercellular adhesion molecules or
"ICAMs."
[0004] ICAM-1 is a 110 kilodalton member of the immunoglobulin
superfamily (Simmons et al., 1988, Nature (London) 331: 624-627)
that is expressed on a limited number of cells and at low levels in
the absence of stimulation (Dustin et al., 1986 J. Immunol. 137,
245-254). Upon stimulation with inflammatory mediators, a variety
of cell types in different tissues express high levels of ICAM-1 on
their surface (Springer et. al. supra; Dustin et al., supra; and
Rothlein et al., 1988, J. Immunol. 141: 1665-1669). Cells which can
express ICAM-1 upon stimulation include non-hematopoietic cells
such as vascular endothelial cells, thymic and other epithelial
cells, and fibroblasts; and hematopoietic cells such as tissue
macrophages, mitogen-stimulated T lymphocyte blasts, and germinal
center dendritic cells in tonsils, lymph nodes, and Peyer's
patches. ICAM-1 induction occurs via increased transcription of
ICAM-1 mRNA (Simmons et al., supra), which is detectable at 4 hours
post-induction and peaks at 16-24 hours post-induction.
[0005] In vitro studies have shown that antibodies to ICAM-1 block
adhesion of leukocytes to cytokine-activated endothelial cells
(Boyd et al., 1988, Proc. Natl. Acad. Sci. USA 85: 3095-3099;
Dustin and Springer, 1988, J. Cell Biol. 107: 321-331). Thus,
ICAM-1 expression appears to be required for the extravasation of
immune cells to sites of inflammation. Antibodies to ICAM-1 also
block T cell killing, mixed lymphocyte reactions, and T
cell-mediated B cell differentiation, indicating that ICAM-1 is
required for these cognate cell interactions (Boyd et al., supra).
The involvement of ICAM-1 in antigen presentation is shown by the
inability of ICAM-1 defective murine B cell mutants to stimulate
antigen-dependent T cell proliferation (Dang et al., 1990, J.
Immunol. 144: 4082-4091). Conversely, murine L cells require
transfection with human ICAM-1 in addition to HLA-DR in order to
present antigen to human T cells (Altmann et al., 1989, Nature
(London) 338: 512-514). Thus, blocking ICAM-1 function can prevent
immune cell recognition and activity during transplant rejection,
and can be effective in treating animal models of rheumatoid
arthritis, asthma and reperfusion injury.
[0006] Expression of ICAM-1 has also been associated with a variety
of inflammatory skin disorders such as allergic contact dermatitis,
fixed drug eruption, lichen planus, and psoriasis (Ho et al., 1990,
J. Am. Acad. Dermatol., 22: 64-68; Griffiths and Nickoloff, 1989,
Am. J. Pathology 135: 1045-1053; Lisby et al., 1989, Br. J.
Dermatol. 120: 479-484; Shiohara et al., 1989, Arch. Dermatol. 125:
1371-1376). In addition, ICAM-1 expression has been detected in the
synovium of patients with rheumatoid arthritis (Hale et al., 1989,
Arth. Rheum., 32: 22-30), in the pancreatic B-cells of diabetics
(Campbell et al., 1989, P.N.A.S. USA 86: 4282-4286); in thyroid
follicular cells of patients with Graves' disease (Weetman et al.,
1989, J. Endocrinol. 122: 185-191); in renal and liver allograft
rejection (Faull and Russ, 1989, Transplantation 48: 226-230; Adams
et al., 1989, Lancet 1122-1125); and in inflammatory bowel disease
(IBD) tissue (Springer T, 1990, Nature 346: 425-34).
[0007] ICAM-1 expression is also implicated in angiogenesis, which
is the formation of new blood vessels from the endothelial cells of
preexisting blood vessels. Angiogenesis is a complex process which
involves a changing profile of endothelial cell gene expression
associated with cell migration, proliferation, and differentiation,
which begins with localized breakdown of the basement membrane of
the parent vessel. The endothelial cells then migrate away from the
parent vessel into the interstitial extracellular matrix (ECM) to
form a capillary sprout, which elongates due to continued migration
and proliferation of endothelial cells in the ECM. The interactions
of the endothelial cells with the ECM during angiogenesis require
alterations of cell-matrix contacts which are caused, in part, by
an increase in ICAM-1 expression.
[0008] Aberrant angiogenesis, or the pathogenic growth of new blood
vessels, is implicated in a number of conditions. Among these
conditions are diabetic retinopathy, psoriasis, exudative or "wet"
age-related macular degeneration ("AMD"), rheumatoid arthritis and
other inflammatory diseases, and most cancers. AMD in particular is
a clinically important angiogenic disease. This condition is
characterized by choroidal neovascularization in one or both eyes
in aging individuals, and is the major cause of blindness in
industrialized countries.
[0009] Several complications commonly seen in type I diabetes also
involve expression of ICAM-1. For example, ICAM-1-mediated adhesion
of leukocytes to capillary endothelium (also called "leukostasis")
can cause microvascular ischemia in certain tissues of diabetics,
such as the retina, peripheral nerves, and kidney. This results in
capillary non-perfusion of these tissues, which in turn leads to
diabetic retinopathy (Miyamoto K et al. (2000), Am. J. Pathol. 156:
1733-1739; Miyamoto K et al. (1999), P.N.A.S USA 96:10836-1084),
neuropathy (Jude E B et al. (1998), Diabetologia 41:330-6) or
nephropathy. Miyamoto et al. (1999, P.N.A.S USA 96: 10836-10841)
suggest that inhibition of ICAM-1-mediated leukostasis can prevent
retinal abnormalities associated with diabetes. However, at least
one study reported that the development of diabetic nephropathy in
the "Wistar fatty" rat model of diabetes does not appear to involve
ICAM-1 expression in glomeruli (Matsui H et al. (1996), Diabetes
Res. Clin. Pract. 32:1-9).
[0010] ICAM-1 has also been implicated in the onset of
macrovascular disease (e.g., coronary artery disease,
cerebrovascular disease, and peripheral vascular disease) in type I
diabetes, which results in part from accelerated atherosclerosis
and increased thrombosis. For example, ICAM-1 has been found in
atherosclerotic plaques and is likely involved in the initiation
and development of atherosclerosis in diabetics. (Jude E B et al.
(2002), Eur. J. Intern. Med. 13:185-189).
[0011] ICAM-1 therefore plays an essential role in both normal and
pathophysiological processes (Springer et al., 1987, Ann. Rev.
Immunol. 5: 223-252). Strategies have therefore been developed to
mediate cell adhesion by blocking ICAM-1 function or expression.
Such strategies typically employ anti-ICAM-1 antibodies, ligands
which competitively block ICAM-1 binding, or antisense nucleic acid
molecules directed against ICAM-1 mRNA. However, the agents used in
such therapies produce only a stoichiometric reduction in ICAM-1,
and are typically overwhelmed by the abnormally high production of
ICAM-1 by the diseased or activated cells. The results achieved
with these strategies have therefore been unsatisfactory.
[0012] RNA interference (hereinafter "RNAi") is a method of
post-transcriptional gene regulation that is conserved throughout
many eukaryotic organisms. RNAi is induced by short (i.e., <30
nucleotide) double stranded RNA ("dsRNA") molecules which are
present in the cell (Fire A et al. (1998), Nature 391: 806-811).
These short dsRNA molecules, called "short interfering RNA" or
"siRNA," cause the destruction of messenger RNAs ("mRNAs") which
share sequence homology with the siRNA to within one nucleotide
resolution (Elbashir S M et al. (2001), Genes Dev, 15: 188-200). It
is believed that the siRNA and the targeted mRNA bind to an
"RNA-induced silencing complex" or "RISC", which cleaves the
targeted mRNA. The siRNA is apparently recycled much like a
multiple-turnover enzyme, with 1 siRNA molecule capable of inducing
cleavage of approximately 1000 mRNA molecules. siRNA-mediated RNAi
degradation of an mRNA is therefore more effective than currently
available technologies for inhibiting expression of a target
gene.
[0013] Elbashir S M et al. (2001), supra, have shown that synthetic
siRNA of 21 and 22 nucleotides in length, and which have short 3'
overhangs, are able to induce RNAi of target mRNA in a Drosophila
cell lysate. Cultured mammalian cells also exhibit RNAi degradation
with synthetic siRNA (Elbashir S M et al. (2001) Nature, 411:
494-498), and RNAi degradation induced by synthetic siRNA has
recently been shown in living mice (McCaffrey A P et al. (2002),
Nature, 418: 38-39; Xia H et al. (2002), Nat. Biotech. 20:
1006-1010). The therapeutic potential of siRNA-induced RNAi
degradation has been demonstrated in several recent in vitro
studies, including the siRNA-directed inhibition of HIV-1 infection
(Novina C D et al. (2002), Nat. Med. 8: 681-686) and reduction of
neurotoxic polyglutamine disease protein expression (Xia H et al.
(2002), supra).
[0014] What is needed, therefore, are agents in catalytic or
sub-stoichiometric amounts which selectively inhibit expression of
ICAM-1, in order to effectively decrease or block ICAM-1-mediated
cell adhesion.
SUMMARY OF THE INVENTION
[0015] The present invention is directed to siRNA which
specifically target and cause RNAi-induced degradation of mRNA from
ICAM-1 genes. The siRNA compounds and compositions of the invention
are used to treat cell adhesion and cell adhesion-mediated
pathologies. In particular, the siRNA of the invention are useful
for inhibiting angiogenesis, for example in the treatment of
cancerous tumors, age-related macular degeneration, and other
angiogenic diseases.
[0016] Thus, the invention provides an isolated siRNA which targets
human ICAM-1 mRNA, or an alternative splice form, mutant or cognate
thereof. The siRNA comprises a sense RNA strand and an antisense
RNA strand which form an RNA duplex. The sense RNA strand comprises
a nucleotide sequence substantially identical to a target sequence
of about 19 to about 25 contiguous nucleotides in the target
mRNA.
[0017] The invention also provides recombinant plasmids and viral
vectors which express the siRNA of the invention, as well as
pharmaceutical compositions comprising the siRNA of the invention
and a pharmaceutically acceptable carrier.
[0018] The invention further provides a method of inhibiting
expression of human ICAM-1 mRNA, or an alternative splice form,
mutant or cognate thereof, comprising administering to a subject an
effective amount of the siRNA of the invention such that the target
mRNA is degraded.
[0019] The invention further provides a method of treating cell
adhesion or cell adhesion-mediated pathologies, comprising
administering to a subject in need of such treatment an effective
amount of an siRNA targeted to human ICAM-1 mRNA, or an alternative
splice form, mutant or cognate thereof.
[0020] The invention further provides a method of inhibiting
angiogenesis in a subject, comprising administering to a subject an
effective amount of an siRNA targeted to human ICAM-1 mRNA, or an
alternative splice form, mutant or cognate thereof.
[0021] The invention still further provides a method of treating
complications arising from type I diabetes in a subject, comprising
administering to a subject in need of such treatment an effective
amount of an siRNA targeted to human ICAM-1 mRNA, or an alternative
splice form, mutant or cognate thereof.
BRIEF DESCRIPTION OF THE FIGURES
[0022] FIG. 1 is a histogram of human ICAM-1 protein concentration,
as measured by ELISA at OD.sub.450 nanometers, in lysates of
untreated HEK-293 cells ("no treatment"), or of HEK-293 cells
treated with tumor necrosis factor alpha ("TNF-.alpha.") at 1, 10,
50, and 100 ng/ml; interferon gamma ("IFN-.gamma.") at 1, 10, 100,
1000 ng/ml; or desferrioxamine ("DFX") at 100, 200, and 300 uM for
one or two days.
[0023] FIG. 2 is a histogram of human ICAM-1 protein concentration,
as measured by ELISA at OD.sub.450 nanometers, in lysates of
untreated HEK-293 cells ("-") or HEK-293 cells treated with 100
ng/ml TNF-alpha ("+"). The cells were transfected with no siRNA
("no"), non-specific siRNA ("EGFP") or ten separate siRNAs
targeting human ICAM-1 mRNA ("hICAM1#1-10").
[0024] FIG. 3 is a histogram showing cytotoxicity of untreated
HEK-293 cells ("-") or HEK-293 cells treated with 100 ng/ml
TNF-alpha ("+"). The cells were transfected with no siRNA ("no"),
non-specific siRNA ("EGFP") or ten separate siRNAs targeting human
ICAM-1 mRNA ("hICAM1#1-10").
DETAILED DESCRIPTION OF THE INVENTION
[0025] Unless otherwise indicated, all nucleic acid sequences
herein are given in the 5' to 3' direction. Also, all
deoxyribonucleotides in a nucleic acid sequence are represented by
capital letters (e.g., deoxythymidine is "T"), and ribonucleotides
in a nucleic acid sequence are represented by lower case letters
(e.g., uridine is "u").
[0026] Compositions and methods comprising siRNA targeted to ICAM-1
mRNA are advantageously used in the inhibition or prevention of
cell adhesion and cell-adhesion mediated pathologies. As used
herein, "cell adhesion and cell-adhesion mediated pathologies"
refer to any disease or condition in which ICAM-1-mediated adhesion
of one cell to another, or to the extracellular matrix, is required
for initiation and/or maintenance of the disease or condition. One
skilled in the art is familiar with such diseases and conditions;
for example, angiogenesis requires the ICAM-1-mediated adhesion of
endothelial cells to the extracellular matrix. Also, the
extravasation of immune cells to sites of inflammation requires
ICAM-1-mediated adhesion of leukocytes to cytokine-activated
endothelial cells. Other cell adhesion and cell-adhesion mediated
pathologies include AIDS-related dementia, allergic conjunctivitis,
allergic rhinitis, Alzheimer's disease, angiogenesis (including
both pathologic and non-pathologic angiogenesis), antigen
presentation, asthma, atherosclerosis, certain types of toxic and
immune-based nephritis, contact dermal hypersensitivity,
corneal/limbic injury, type I diabetes and complications arising
from type I diabetes, such as diabetic retinopathy, diabetic
neuropathy, diabetic nephropathy, and macrovascular disease,
Graves' disease, inflammatory bowel disease (including ulcerative
colitis and Crohn's disease), inflammatory lung diseases,
inflammatory sequelae of viral infections, inflammatory skin
disorders (e.g., allergic contact dermatitis, fixed drug eruption,
lichen planus, and psoriasis), immune cell recognition and activity
during transplant (allograft) rejection, including rejection of
renal, liver and bone marrow transplants, immune cell interactions
(such as T-cell killing, mixed lymphocyte reactions, and T-cell
mediated B-cell differentiation), meningitis, multiple sclerosis,
multiple myeloma, myocarditis, pulmonary fibrosis, reperfusion
injury, restenosis, retinitis, rheumatoid arthritis, septic
arthritis, stroke, tumor growth and metastasis, and uveititis.
[0027] The siRNA of the invention cause the RNAi-mediated
degradation of ICAM-1 mRNA, so that the protein product of the
ICAM-1 gene is not produced or is produced in reduced amounts.
Because the ICAM-1 gene product is required for certain
intercellular or cell-ECM adhesion events, the siRNA-mediated
degradation of ICAM-1 mRNA inhibits intercellular or cell-ECM
adhesion. Cell adhesion or cell-mediated adhesion pathologies can
thus be treated by inducing RNAi degradation of ICAM-1 mRNA with
the siRNA of the invention.
[0028] The invention therefore provides isolated siRNA comprising
short double-stranded RNA from about 17 nucleotides to about 29
nucleotides in length, preferably from about 19 to about 25
nucleotides in length, that are targeted to the target mRNA. The
siRNA comprise a sense RNA strand and a complementary antisense RNA
strand annealed together by standard Watson-Crick base-pairing
interactions (hereinafter "base-paired"). As is described in more
detail below, the sense strand comprises a nucleic acid sequence
which is substantially identical to a target sequence contained
within the target mRNA.
[0029] As used herein, a nucleic acid sequence "substantially
identical" to a target sequence contained within the target mRNA is
a nucleic acid sequence which is identical to the target sequence,
or which differs from the target sequence by one or more
nucleotides. Sense strands of the invention which comprise nucleic
acid sequences substantially identical to a target sequence are
characterized in that siRNA comprising such sense strands induce
RNAi-mediated degradation of mRNA containing the target sequence.
For example, an siRNA of the invention can comprise a sense strand
comprise nucleic acid sequences which differ from a target sequence
by one, two or three or more nucleotides, as long as RNAi-mediated
degradation of the target mRNA is induced by the siRNA.
[0030] The sense and antisense strands of the present siRNA can
comprise two complementary, single-stranded RNA molecules or can
comprise a single molecule in which two complementary portions are
base-paired and are covalently linked by a single-stranded
"hairpin" area. Without wishing to be bound by any theory, it is
believed that the hairpin area of the latter type of siRNA molecule
is cleaved intracellularly by the "Dicer" protein (or its
equivalent) to form a siRNA of two individual base-paired RNA
molecules (see Tuschl, T. (2002), supra).
[0031] As used herein, "isolated" means synthetic, or altered or
removed from the natural state through human intervention. For
example, an siRNA naturally present in a living animal is not
"isolated," but a synthetic siRNA, or an siRNA partially or
completely separated from the coexisting materials of its natural
state is "isolated." An isolated siRNA can exist in substantially
purified form, or can exist in a non-native environment such as,
for example, a cell into which the siRNA has been delivered. By way
of example, siRNA which are produced inside a cell by natural
processes, but which are produced from an "isolated" precursor
molecule, are "isolated" molecules. Thus, an isolated dsRNA or
protein can be introduced into a target cell, where it is processed
by the Dicer protein (or its equivalent) into isolated siRNA.
[0032] As used herein, "target mRNA" means human ICAM-1 mRNA,
mutant or alternative splice forms of human ICAM-1 mRNA, or mRNA
from cognate ICAM-1 genes. The human ICAM-1 mRNA sequence is given
in SEQ ID NO: 1 as the cDNA equivalent. One skilled in the art
would understand that the cDNA sequence is equivalent to the mRNA
sequence, and can be used for the same purpose herein; i.e., the
generation of siRNA for inhibiting expression of ICAM-1.
[0033] As used herein, a gene or mRNA which is "cognate" to human
ICAM-1 is a gene or mRNA from another mammalian species which is
homologous to human ICAM-1. For example, the cognate ICAM-1 mRNA
from the mouse is given in SEQ ID NO: 2 as the cDNA equivalent.
[0034] The mRNA transcribed from the human ICAM-1 gene can be
analyzed for alternative splice forms using techniques well-known
in the art. Such techniques include reverse
transcription-polymerase chain reaction (RT-PCR), northern blotting
and in-situ hybridization. Techniques for analyzing mRNA sequences
are described, for example, in Busting S A (2000), J. Mol.
Endocrinol. 25: 169-193, the entire disclosure of which is herein
incorporated by reference. Representative techniques for
identifying alternatively spliced mRNAs are also described
below.
[0035] For example, databases that contain nucleotide sequences
related to a given disease gene can be used to identify
alternatively spliced mRNA. Such databases include GenBank, Embase,
and the Cancer Genome Anatomy Project (CGAP) database. The CGAP
database, for example, contains expressed sequence tags (ESTs) from
various types of human cancers. An mRNA or gene sequence from the
ICAM-1 gene can be used to query such a database to determine
whether ESTs representing alternatively spliced mRNAs have been
found.
[0036] A technique called "RNAse protection" can also be used to
identify alternatively spliced ICAM-1 mRNAs. RNAse protection
involves translation of a gene sequence into synthetic RNA, which
is hybridized to RNA derived from other cells; for example, cells
which are induced to express ICAM-1. The hybridized RNA is then
incubated with enzymes that recognize RNA:RNA hybrid mismatches.
Smaller than expected fragments indicate the presence of
alternatively spliced mRNAs. The putative alternatively spliced
mRNAs can be cloned and sequenced by methods well known to those
skilled in the art.
[0037] RT-PCR can also be used to identify alternatively spliced
ICAM-1 mRNAs. In RT-PCR, mRNA from activated leukocytes, cells from
inflammatory bowel disease tissue, or cells from other tissue known
to express ICAM-1 is converted into cDNA by the enzyme reverse
transcriptase, using methods well-known to those of ordinary skill
in the art. The entire coding sequence of the cDNA is then
amplified via PCR using a forward primer located in the 3'
untranslated region, and a reverse primer located in the 5'
untranslated region. The amplified products can be analyzed for
alternative splice forms, for example by comparing the size of the
amplified products with the size of the expected product from
normally spliced mRNA, e.g., by agarose gel electrophoresis. Any
change in the size of the amplified product can indicate
alternative splicing.
[0038] The mRNA produced from mutant ICAM-1 genes can also be
readily identified with the techniques described above for
identifying ICAM-1 alternative splice forms. As used herein,
"mutant" ICAM-1 genes or mRNA include human ICAM-1 genes or mRNA
which differ in sequence from the ICAM-1 sequences set forth
herein. Thus, allelic forms of the ICAM-1 gene, and the mRNA
produced from them, are considered "mutants" for purposes of this
invention.
[0039] It is understood that human ICAM-1 mRNA may contain target
sequences in common with its respective alternative splice forms,
cognates or mutants. A single siRNA comprising such a common
targeting sequence can therefore induce RNAi-mediated degradation
of those different mRNAs which contain the common targeting
sequence.
[0040] The siRNA of the invention can comprise partially purified
RNA, substantially pure RNA, synthetic RNA, or recombinantly
produced RNA, as well as altered RNA that differs from
naturally-occurring RNA by the addition, deletion, substitution
and/or alteration of one or more nucleotides. Such alterations can
include addition of non-nucleotide material, such as to the end(s)
of the siRNA or to one or more internal nucleotides of the siRNA;
modifications that make the siRNA resistant to nuclease digestion
(e.g., the use of 2'-substituted ribonucleotides or modifications
to the sugar-phosphate backbone); or the substitution of one or
more nucleotides in the siRNA with deoxyribonucleotides. siRNA
which are exposed to serum, lachrymal fluid or other nuclease-rich
environments, or which are delivered topically (e.g., by
eyedropper), are preferably altered to increase their resistance to
nuclease degradation. For example, siRNA which are administered
intravascularly or topically to the eye can comprise one or more
phosphorothioate linkages.
[0041] One or both strands of the siRNA of the invention can also
comprise a 3' overhang. As used herein, a "3' overhang" refers to
at least one unpaired nucleotide extending from the 3'-end of an
RNA strand.
[0042] Thus in one embodiment, the siRNA of the invention comprises
at least one 3' overhang of from 1 to about 6 nucleotides (which
includes ribonucleotides or deoxynucleotides) in length, preferably
from 1 to about 5 nucleotides in length, more preferably from 1 to
about 4 nucleotides in length, and particularly preferably from
about 2 to about 4 nucleotides in length.
[0043] In the embodiment in which both strands of the siRNA
molecule comprise a 3' overhang, the length of the overhangs can be
the same or different for each strand. In a most preferred
embodiment, the 3' overhang is present on both strands of the
siRNA, and is 2 nucleotides in length. For example, each strand of
the siRNA of the invention can comprise 3' overhangs of
dithymidylic acid ("TT") or diuridylic acid ("uu").
[0044] In order to enhance the stability of the present siRNA, the
3' overhangs can be also stabilized against degradation. In one
embodiment, the overhangs are stabilized by including purine
nucleotides, such as adenosine or guanosine nucleotides.
Alternatively, substitution of pyrimidine nucleotides by modified
analogues, e.g., substitution of uridine nucleotides in the 3'
overhangs with 2'-deoxythymidine, is tolerated and does not affect
the efficiency of RNAi degradation. In particular, the absence of a
2' hydroxyl in the 2'-deoxythymidine significantly enhances the
nuclease resistance of the 3' overhang in tissue culture
medium.
[0045] In certain embodiments, the siRNA of the invention comprises
the sequence AA(N19)TT or NA(N21), where N is any nucleotide. These
siRNA comprise approximately 30-70% GC, and preferably comprise
approximately 50% G/C. The sequence of the sense siRNA strand
corresponds to (N19)TT or N21 (i.e., positions 3 to 23),
respectively. In the latter case, the 3' end of the sense siRNA is
converted to TT. The rationale for this sequence conversion is to
generate a symmetric duplex with respect to the sequence
composition of the sense and antisense strand 3' overhangs. The
antisense RNA strand is then synthesized as the complement to
positions 1 to 21 of the sense strand.
[0046] Because position 1 of the 23-nt sense strand in these
embodiments is not recognized in a sequence-specific manner by the
antisense strand, the 3'-most nucleotide residue of the antisense
strand can be chosen deliberately. However, the penultimate
nucleotide of the antisense strand (complementary to position 2 of
the 23-nt sense strand in either embodiment) is generally
complementary to the targeted sequence.
[0047] In another embodiment, the siRNA of the invention comprises
the sequence NAR(N17)YNN, where R is a purine (e.g., A or G) and Y
is a pyrimidine (e.g., C or U/T). The respective 21-nt sense and
antisense RNA strands of this embodiment therefore generally begin
with a purine nucleotide. Such siRNA can be expressed from pol III
expression vectors without a change in targeting site, as
expression of RNAs from pol III promoters is only believed to be
efficient when the first transcribed nucleotide is a purine.
[0048] The siRNA of the invention can be targeted to any stretch of
approximately 19-25 contiguous nucleotides in any of the target
mRNA sequences (the "target sequence"). Techniques for selecting
target sequences for siRNA are given, for example, in Tuschl T et
al., "The siRNA User Guide," revised Oct. 11, 2002, the entire
disclosure of which is herein incorporated by reference. "The siRNA
User Guide" is available on the world wide web at a website
maintained by Dr. Thomas Tuschl, Department of Cellular
Biochemistry, A G 105, Max-Planck-Institute for Biophysical
Chemistry, 37077 Gottingen, Germany, and can be found by accessing
the website of the Max Planck Institute and searching with the
keyword "siRNA." Thus, the sense strand of the present siRNA
comprises a nucleotide sequence substantially identical to any
contiguous stretch of about 19 to about 25 nucleotides in the
target mRNA.
[0049] Generally, a target sequence on the target mRNA can be
selected from a given cDNA sequence corresponding to the target
mRNA, preferably beginning 50 to 100 nt downstream (i.e., in the 3'
direction) from the start codon. The target sequence can, however,
be located in the 5' or 3' untranslated regions, or in the region
nearby the start codon. For example, a suitable target sequence in
the ICAM-1 cDNA sequence is:
[0050] GTTGTTGGGCATAGAGACC (SEQ ID NO: 3)
[0051] Thus, an siRNA of the invention targeting this sequence, and
which has 3' uu overhangs on each strand (overhangs shown in bold),
is: 1 5 ' - guuguugggcauagagaccuu - 3 ' ( SEQ ID NO : 4 ) 3 ' -
uucaacaacccguaucucugg - 5 ' ( SEQ ID NO : 5 )
[0052] An siRNA of the invention targeting SEQ ID NO: 3, but having
3' TT overhangs on each strand (overhangs shown in bold) is: 2 5 '
- guuguugggcauagagaccTT - 3 ' ( SEQ ID NO : 6 ) 3 ' -
TTcaacaacccguaucucugg - 5 ' ( SEQ ID NO : 7 )
[0053] Other ICAM-1 target sequences from which siRNA of the
invention can be derived include those given in Table 1, and those
given as SEQ ID NOS 20-94. It is understood that the target
sequences given herein are with reference to the human ICAM-1 cDNA,
and thus these sequences contain deoxythimidines represented by
"T." One skilled in the art would understand that, in the actual
target sequence of the ICAM-1 mRNA, the doexythymidines would be
replaced by uridines ("u"). Likewise, a target sequence contained
within an siRNA of the invention would also contain uridines in
place of deoxythymidines.
1TABLE 1 ICAM-1 Target Sequences target sequence SEQ ID NO:
GGAGTTGCTCCTGCCTGGG 8 CCGGAAGGTGTATGAACTG 9 CTGAGCAATGTGCAAGAAG 10
TGTGCTATTCAAACTGCCC 11 CCTTCCTCACCGTGTACTG 12 CGGGTGGAACTGGCACCCC
13 CCTTACCCTACGCTGCCAG 14 CCTCACCGTGGTGCTGCTC 15
CGGGAGCCAGCTGTGGGGG 16 TTTCTCGTGCCGCACTGAA 17 CTGGACCTGCGGCCCCAAG
18 GGCCTCAGTCAGTGTGACC 19
[0054] The siRNA of the invention can be obtained using a number of
techniques known to those of skill in the art. For example, the
siRNA can be chemically synthesized or recombinantly produced using
methods known in the art, such as the Drosophila in vitro system
described in U.S. published application 2002/0086356 of Tuschl et
al., the entire disclosure of which is herein incorporated by
reference.
[0055] Preferably, the siRNA of the invention are chemically
synthesized using appropriately protected ribonucleoside
phosphoramidites and a conventional DNA/RNA synthesizer. The siRNA
can be synthesized as two separate, complementary RNA molecules, or
as a single RNA molecule with two complementary regions. Commercial
suppliers of synthetic RNA molecules or synthesis reagents include
Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo.,
USA), Pierce Chemical (part of Perbio Science, Rockford, Ill.,
USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland,
Mass., USA) and Cruachem (Glasgow, UK).
[0056] Alternatively, siRNA can also be expressed from recombinant
circular or linear DNA plasmids using any suitable promoter.
Suitable promoters for expressing siRNA of the invention from a
plasmid include, for example, the U6 or H1 RNA pol III promoter
sequences and the cytomegalovirus promoter. Selection of other
suitable promoters is within the skill in the art. The recombinant
plasmids of the invention can also comprise inducible or
regulatable promoters for expression of the siRNA in a particular
tissue or in a particular intracellular environment.
[0057] The siRNA expressed from recombinant plasmids can either be
isolated from cultured cell expression systems by standard
techniques, or can be expressed intracellularly. The use of
recombinant plasmids to deliver siRNA of the invention to cells in
vivo is discussed in more detail below.
[0058] siRNA of the invention can be expressed from a recombinant
plasmid either as two separate, complementary RNA molecules, or as
a single RNA molecule with two complementary regions.
[0059] Selection of plasmids suitable for expressing siRNA of the
invention, methods for inserting nucleic acid sequences for
expressing the siRNA into the plasmid, and methods of delivering
the recombinant plasmid to the cells of interest are within the
skill in the art. See, for example Tuschl, T. (2002), Nat.
Biotechnol, 20: 446-448; Brummelkamp T R et al. (2002), Science
296: 550-553; Miyagishi M et al. (2002), Nat. Biotechnol. 20:
497-500; Paddison P J et al. (2002), Genes Dev. 16: 948-958; Lee N
S et al. (2002), Nat. Biotechnol. 20: 500-505; and Paul C P et al.
(2002), Nat. Biotechnol. 20: 505-508, the entire disclosures of
which are herein incorporated by reference.
[0060] In one embodiment, a plasmid expressing an siRNA of the
invention comprises a sense RNA strand coding sequence in operable
connection with a polyT termination sequence under the control of a
human U6 RNA promoter, and an antisense RNA strand coding sequence
in operable connection with a polyT termination sequence under the
control of a human U6 RNA promoter. Such a plasmid can be used in
producing an recombinant adeno-associated viral vector for
expressing an siRNA of the invention.
[0061] As used herein, "in operable connection with a polyT
termination sequence" means that the nucleic acid sequences
encoding the sense or antisense strands are immediately adjacent to
the polyT termination signal in the 5' direction. During
transcription of the sense or antisense sequences from the plasmid,
the polyT termination signals act to terminate transcription.
[0062] As used herein, "under the control" of a promoter means that
the nucleic acid sequences encoding the sense or antisense strands
are located 3' of the promoter, so that the promoter can initiate
transcription of the sense or antisense coding sequences.
[0063] The siRNA of the invention can also be expressed from
recombinant viral vectors intracellularly in vivo. The recombinant
viral vectors of the invention comprise sequences encoding the
siRNA of the invention and any suitable promoter for expressing the
siRNA sequences. Suitable promoters include, for example, the U6 or
H1 RNA pol III promoter sequences and the cytomegalovirus promoter.
Selection of other suitable promoters is within the skill in the
art. The recombinant viral vectors of the invention can also
comprise inducible or regulatable promoters for expression of the
siRNA in a particular tissue or in a particular intracellular
environment. The use of recombinant viral vectors to deliver siRNA
of the invention to cells in vivo is discussed in more detail
below.
[0064] siRNA of the invention can be expressed from a recombinant
viral vector either as two separate, complementary RNA molecules,
or as a single RNA molecule with two complementary regions.
[0065] Any viral vector capable of accepting the coding sequences
for the siRNA molecule(s) to be expressed can be used, for example
vectors derived from adenovirus (AV); adeno-associated virus (AAV);
retroviruses (e.g, lentiviruses (LV), Rhabdoviruses, murine
leukemia virus); herpes virus, and the like. The tropism of the
viral vectors can be modified by pseudotyping the vectors with
envelope proteins or other surface antigens from other viruses, or
by substituting different viral capsid proteins, as
appropriate.
[0066] For example, lentiviral vectors of the invention can be
pseudotyped with surface proteins from vesicular stomatitis virus
(VSV), rabies, Ebola, Mokola, and the like. AAV vectors of the
invention can be made to target different cells by engineering the
vectors to express different capsid protein serotypes. For example,
an AAV vector expressing a serotype 2 capsid on a serotype 2 genome
is called AAV 2/2. This serotype 2 capsid gene in the AAV 2/2
vector can be replaced by a serotype 5 capsid gene to produce an
AAV 2/5 vector. Techniques for constructing AAV vectors which
express different capsid protein serotypes are within the skill in
the art; see, e.g., Rabinowitz J E et al. (2002), J Virol
76:791-801, the entire disclosure of which is herein incorporated
by reference.
[0067] Selection of recombinant viral vectors suitable for use in
the invention, methods for inserting nucleic acid sequences for
expressing the siRNA into the vector, and methods of delivering the
viral vector to the cells of interest are within the skill in the
art. See, for example, Dornburg R (1995), Gene Therap. 2: 301-310;
Eglitis M A (1988), Biotechniques 6: 608-614; Miller A D (1990),
Hum Gene Therap. 1: 5-14; and Anderson W F (1998), Nature 392:
25-30, the entire disclosures of which are herein incorporated by
reference.
[0068] Preferred viral vectors are those derived from lentivirus,
AV or AAV. In a particularly preferred embodiment, the siRNA of the
invention is expressed as two separate, complementary
single-stranded RNA molecules from a recombinant AAV vector
comprising, for example, either the U6 or H1 RNA promoters, or the
cytomegalovirus (CMV) promoter.
[0069] A suitable AV vector for expressing the siRNA of the
invention, a method for constructing the recombinant AV vector, and
a method for delivering the vector into target cells, are described
in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.
[0070] Suitable AAV vectors for expressing the siRNA of the
invention, methods for constructing the recombinant AV vector, and
methods for delivering the vectors into target cells are described
in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher K J et
al. (1996), J. Virol., 70: 520-532; Samulski R et al. (1989), J.
Virol. 63: 3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No.
5,139,941; International Patent Application No. WO 94/13788; and
International Patent Application No. WO 93/24641, the entire
disclosures of which are herein incorporated by reference.
[0071] The ability of an siRNA containing a given target sequence
to cause RNAi-mediated degradation of the target mRNA can be
evaluated using standard techniques for measuring the levels of RNA
or protein in cells. For example, siRNA of the invention can be
delivered to cultured cells, and the levels of target mRNA can be
measured by Northern blot or dot blotting techniques, or by
quantitative RT-PCR. Alternatively, the levels of ICAM-1 protein in
the cultured cells can be measured by ELISA or Western blot.
[0072] For example, cells which naturally express ICAM-1, or which
are induced to express ICAM-1, are grown to confluence in 96 well
microtiter plates. For cells which naturally express ICAM-1, the
cells can be stimulated with either interleukin-1 or tumor necrosis
factor for 8 to 24 hours to stimulate ICAM-1 expression. siRNA of
the invention can be administered to one group of ICAM-1 expressing
cells. A non-specific siRNA (or no siRNA) can be administered to a
second group of ICAM-1 expressing cells as a control. The cells are
washed and directly fixed to the microtiter plate wells with 1 to
2% paraformaldehyde. Nonspecific binding sites on the microtiter
plate are blocked with 2% bovine serum albumin, and the cells
incubated with an ICAM-1 specific monoclonal antibody. Bound ICAM-1
antibody can be detected, for example, by incubation with a 1:1000
dilution of biotinylated goat anti-mouse IgG (Bethesda Research
Laboratories, Gaithersberg, Md.) for 1 hour at 37.degree. C. and
with a 1:1000 dilution of streptavidin conjugated to
beta-galactosidase (Bethesda Research Laboratories) for 1 hour at
37.degree. C. The amount of beta-galactosidase bound to the ICAM-1
specific monoclonal antibody is determined, for example, by
developing the microtiter plate in a solution of 3.3 mM
chlorophenolred-beta-D-galac- topyranoside, 50 mM sodium phosphate,
1.5 mM MgCl.sub.2; pH 7.2 for 2 to 15 minutes at 37.degree. C., and
measuring the concentration of bound antibody at 575 nm in an ELISA
microtiter plate reader.
[0073] The ability of the present siRNA to down-regulate ICAM-1
expression can also be evaluated in vitro by measuring neurite
outgrowth, adhesion between endothelial cells, adhesion between
epithelial cells (e.g., normal rat kidney cells and/or human skin),
or adhesion between cancer cells by techniques which are within the
skill in the art.
[0074] A suitable neurite outgrowth assay comprises culturing
neurons on a monolayer of cells that express ICAM-1 naturally or
which are induced to express ICAM-1. Neurons grown on ICAM-1
expressing cells extend longer neurites than neurons cultured on
cells that do not express ICAM-1. For example, neurons can be
cultured on monolayers of 3T3 cells transfected with cDNA encoding
ICAM-1 essentially as described by Doherty and Walsh, 1994, Curr.
Op. Neurobiol. 4: 49-55 and Safell et al., 1997, Neuron 18:
231-242, the entire disclosures of which are herein incorporated by
reference. Briefly, monolayers of control 3T3 fibroblasts and 3T3
fibroblasts that express ICAM-1 can be established by overnight
culture of 80,000 cells in individual wells of an 8-well tissue
culture dish. Three thousand cerebellar neurons isolated from
post-natal day 3 mouse brains can be cultured for 18 hours on the
various monolayers. The cultures can then be fixed and stained with
neuron-specific antibodies (e.g., GAP43) using standard techniques.
The neurite lengths of control cells and cells treated with the
siRNA of the invention can be measured by computer assisted
morphometry. siRNA-induced RNAi degradation of ICAM-1 mRNA in test
cells is indicated by an increase in mean neurite length by at
least 50% as compared to the control cells.
[0075] RNAi degradation of ICAM-1 by the present siRNA can also be
evaluated by detecting the disruption of cell adhesion. For
example, cells which express ICAM-1 naturally or which are induced
to express ICAM-1 can be plated under standard conditions that
permit cell adhesion. Disruption of cell adhesion upon
administration of an siRNA of the invention can be determined
visually within 24 hours, by observing retraction of the cells from
one another. A suitable assay for detecting disruption of cell
adhesion is as follows. Bovine pulmonary artery endothelial cells
can be harvested by sterile ablation and digestion in 0.1%
collagenase (type II; Worthington Enzymes, Freehold, N.J.). The
harvested cells are maintained in Dulbecco's minimum essential
medium (DMEM) supplemented with 10% fetal calf serum (FCS) and 1%
antibiotic-antimycotic at 37.degree. C. and 7% CO.sub.2 in air. The
cultures are passaged weekly in trypsin-EDTA and seeded onto tissue
culture plastic at 20,000 cells/cm.sup.2. After one week in
culture, which is approximately 3 days after culture confluency is
established, the cells are treated (e.g., for 30 minutes) with an
siRNA of the invention or a control non-specific siRNA. The cells
can be fixed with 1% paraformaldehyde within 24 hours after
administration of the siRNA, and the degree of disruption of cell
adhesion determined visually by observing retraction of the cells
from one another.
[0076] RNAi-mediated degradation of target mRNA by an siRNA of the
invention can also be evaluated with animal models of
neovascularization, such as the retinopathy of prematurity ("ROP")
mouse model, the choroidal neovascularization ("CNV") mouse and rat
models. For example, areas of neovascularization in a CNV rat can
be measured before and after administration of the present siRNA,
as in Example 2 below. A reduction in the areas of
neovascularization upon administration of the siRNA indicates the
down-regulation of ICAM-1 mRNA and a disruption of cell adhesion.
Down-regulation of ICAM-1 mRNA and a disruption of cell adhesion is
also demonstrated below in the streptozotocin-induced diabetic
retinopathy rat model (Example 3), a rat model of VEGF-induced
retinal vascular permeability and leukostasis (Example 4), and a
rat model of ocular neovascularization induced by corneal/limbal
injury (Example 5).
[0077] As discussed above, the siRNA of the invention target and
cause the RNAi-mediated degradation of human ICAM-1 mRNA, or
alternative splice forms, mutants or cognates thereof. Degradation
of the target mRNA by the present siRNA reduces the production of a
functional gene product from the ICAM-1 gene. Thus, the invention
provides a method of inhibiting expression of ICAM-1 in a subject,
comprising administering an effective amount of an siRNA of the
invention to the subject, such that the target mRNA is
degraded.
[0078] As the products of the ICAM-1 gene are required for
intercellular adhesion or adhesion of cells to the ECM, the
invention also provides a method of inhibiting cell adhesion in a
subject suffering from cell adhesion or cell adhesion-mediated
pathologies. In one embodiment, because ICAM-1-mediated cell
adhesion is required for initiating and maintaining angiogenesis,
the invention provides a method of inhibiting angiogenesis in a
subject by the RNAi-mediated degradation of the target mRNA by the
present siRNA. In another embodiment, the invention provides a
method of treating a subject for complications arising from type I
diabetes, by the RNAi-mediated degradation of the target mRNA by
the present siRNA. Preferably, the complications arising from type
I diabetes to be treated by the present method are diabetic
retinopathy, diabetic neuropathy, diabetic nephropathy, and
macrovascular disease (including coronary artery disease,
cerebrovascular disease, and peripheral vascular disease).
[0079] As used herein, a "subject" includes a human being or
non-human animal. Preferably, the subject is a human being.
[0080] As used herein, an "effective amount" of the siRNA is an
amount sufficient to cause RNAi-mediated degradation of the target
mRNA, or an amount sufficient to inhibit the initiation or
progression of cell adhesion or cell adhesion-mediated pathologies
in a subject.
[0081] RNAi-mediated degradation of the target mRNA can be detected
by measuring levels of the target mRNA or protein in the cells of a
subject, using standard techniques for isolating and quantifying
mRNA or protein as described above.
[0082] Inhibition of cell adhesion or cell adhesion-mediated
pathologies can also be evaluated by measuring the progression of
the pathology in the subject, for example by detecting the extent
of inflammation, retinopathy, neuropathy, nephropathy or other
symptoms characteristic of the disease or disorder for which the
subject is being treated.
[0083] For example, inhibition of angiogenesis can be evaluated by
directly measuring the progress of pathogenic or nonpathogenic
angiogenesis in a subject, such as by observing the size of a
neovascularized area before and after treatment with the siRNA of
the invention. An inhibition of angiogenesis is indicated if the
size of the neovascularized area stays the same or is reduced.
Techniques for observing and measuring the size of neovascularized
areas in a subject are within the skill in the art; for example,
areas of choroid neovascularization can be observed by
ophthalmoscopy.
[0084] Inhibition of angiogenesis can also be inferred through
observing a change or reversal in a pathogenic condition associated
with the angiogenesis. For example, in AMD, a slowing, halting or
reversal of vision loss indicates an inhibition of angiogenesis in
the choroid. For tumors, a slowing, halting or reversal of tumor
growth, or a slowing or halting of tumor metastasis, indicates an
inhibition of angiogenesis at or near the tumor site. Inhibition of
non-pathogenic angiogenesis can also be inferred from, for example,
fat loss or a reduction in cholesterol levels upon administration
of the siRNA of the invention.
[0085] The present methods can be used to inhibit angiogenesis
which is non-pathogenic; i.e., angiogenesis which results from
normal processes in the subject. Examples of non-pathogenic
angiogenesis include endometrial neovascularization, and processes
involved in the production of fatty tissues or cholesterol. Thus,
the invention also provides a method for inhibiting non-pathogenic
angiogenesis, e.g., for controlling weight or promoting fat loss,
for reducing cholesterol levels, or as an abortifacient.
[0086] The present methods can also inhibit angiogenesis which is
associated with an angiogenic disease; i.e., a disease in which
pathogenicity is associated with inappropriate or uncontrolled
angiogenesis. For example, most cancerous solid tumors generate an
adequate blood supply for themselves by inducing angiogenesis in
and around the tumor site. This tumor-induced angiogenesis is often
required for tumor growth, and also allows metastatic cells to
enter the bloodstream.
[0087] Other angiogenic diseases include diabetic retinopathy and
age-related macular degeneration (AMD). These diseases are
characterized by the destruction of normal tissue by newly formed
blood vessels in the area of neovascularization. For example, in
AMD, the choroid is invaded and destroyed by capillaries. The
angiogenesis-driven destruction of the choroid in AMD eventually
leads to partial or full blindness.
[0088] Preferably, an siRNA of the invention is used to inhibit the
growth or metastasis of solid tumors associated with cancers; for
example breast cancer, lung cancer, head and neck cancer, brain
cancer, abdominal cancer, colon cancer, colorectal cancer,
esophagus cancer, gastrointestinal cancer, glioma, liver cancer,
tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer,
pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor,
multiple myeloma; skin cancer (e.g., melanoma), lymphomas and blood
cancer.
[0089] More preferably, an siRNA of the invention is used to
inhibit choroidal neovascularization in age-related macular
degeneration.
[0090] Particularly preferably, an siRNA of the invention is used
to treat complications arising from type I diabetes, such as
diabetic retinopathy, diabetic neuropathy, diabetic nephropathy and
macrovascular disease.
[0091] For treating cell adhesion or cell adhesion mediated
pathologies, in particular for treating angiogenic diseases and
complications arising from type I diabetes, the siRNA of the
invention can be administered to a subject in combination with a
pharmaceutical agent which is different from the present siRNA.
Alternatively, the siRNA of the invention can be administered to a
subject in combination with another therapeutic method designed to
treat the pathology. For example, the siRNA of the invention can be
administered in combination with therapeutic methods currently
employed for treating cancer or preventing tumor metastasis (e.g.,
radiation therapy, chemotherapy, and surgery). For treating tumors,
the siRNA of the invention is preferably administered to a subject
in combination with radiation therapy, or in combination with
chemotherapeutic agents such as cisplatin, carboplatin,
cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or
tamoxifen.
[0092] It is understood that the siRNA of the invention can mediate
RNA interference (and thus inhibit cell adhesion) in
substoichiometric amounts. Without wishing to be bound by any
theory, it is believed that the siRNA of the invention induces the
RISC to degrade the target mRNA in a catalytic manner. Thus,
compared to standard therapies for cell adhesion or cell adhesion
mediated pathologies, significantly less siRNA needs to be
administered to the subject to have a therapeutic effect.
[0093] One skilled in the art can readily determine an effective
amount of the siRNA of the invention to be administered to a given
subject, by taking into account factors such as the size and weight
of the subject; the extent of disease penetration; the age, health
and sex of the subject; the route of administration; and whether
the administration is regional or systemic. Generally, an effective
amount of the siRNA of the invention comprises an intercellular
concentration at the site where intercellular or cell-matrix
adhesion is to be inhibited of from about 1 nanomolar (nM) to about
100 nM, preferably from about 2 nM to about 50 nM, more preferably
from about 2.5 nM to about 10 nM. It is contemplated that greater
or lesser amounts of siRNA can be administered.
[0094] In the present methods, the present siRNA can be
administered to the subject either as naked siRNA, in conjunction
with a delivery reagent, or as a recombinant plasmid or viral
vector which expresses the siRNA.
[0095] Suitable delivery reagents for administration in conjunction
with the present siRNA include the Mirus Transit TKO lipophilic
reagent; lipofectin; lipofectamine; cellfectin; or polycations
(e.g., polylysine), or liposomes. A preferred delivery reagent is a
liposome.
[0096] Liposomes can aid in the delivery of the siRNA to a
particular tissue, such as retinal or tumor tissue, and can also
increase the blood half-life of the siRNA. Liposomes suitable for
use in the invention are formed from standard vesicle-forming
lipids, which generally include neutral or negatively charged
phospholipids and a sterol, such as cholesterol. The selection of
lipids is generally guided by consideration of factors such as the
desired liposome size and half-life of the liposomes in the blood
stream. A variety of methods are known for preparing liposomes, for
example as described in Szoka et al. (1980), Ann. Rev. Biophys.
Bioeng. 9: 467; and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028,
and 5,019,369, the entire disclosures of which are herein
incorporated by reference.
[0097] Preferably, liposomes encapsulating the present siRNA
comprise a ligand molecule that can target the liposome to cells
expressing ICAM-1 at or near the site of angiogenesis or other
physiological process involving ICAM-1-mediated cell adhesion, such
as a tumor. Cells which express ICAM-1 include endothelial,
epithelial, fibroblastic, hematopoietic and tumor cells. Ligands
which bind to receptors prevalent in tumor or endothelial cells,
such as monoclonal antibodies that bind to tumor antigens or
endothelial cell surface antigens, are preferred.
[0098] Particularly preferably, the liposomes encapsulating the
present siRNA are modified so as to avoid clearance by the
mononuclear macrophage and reticuloendothelial systems, for example
by having opsonization-inhibition moieties bound to the surface of
the structure. In one embodiment, a liposome of the invention can
comprise both opsonization-inhibition moieties and a ligand.
[0099] Opsonization-inhibiting moieties for use in preparing the
liposomes of the invention are typically large hydrophilic polymers
that are bound to the liposome membrane. As used herein, an
opsonization inhibiting moiety is "bound" to a liposome membrane
when it is chemically or physically attached to the membrane, e.g.,
by the intercalation of a lipid-soluble anchor into the membrane
itself, or by binding directly to active groups of membrane lipids.
These opsonization-inhibiting hydrophilic polymers form a
protective surface layer which significantly decreases the uptake
of the liposomes by the macrophage-monocyte system ("MMS") and
reticuloendothelial system ("RES"); e.g., as described in U.S. Pat.
No. 4,920,016, the entire disclosure of which is herein
incorporated by reference. Liposomes modified with
opsonization-inhibition moieties thus remain in the circulation
much longer than unmodified liposomes. For this reason, such
liposomes are sometimes called "stealth" liposomes.
[0100] Stealth liposomes are known to accumulate in tissues fed by
porous or "leaky" microvasculature. Thus, tissue characterized by
such microvasculature defects, for example solid tumors, will
efficiently accumulate these liposomes; see Gabizon, et al. (1988),
P.N.A.S., USA, 18: 6949-53. In addition, the reduced uptake by the
RES lowers the toxicity of stealth liposomes by preventing
significant accumulation in the liver and spleen. Thus, liposomes
of the invention that are modified with opsonization-inhibition
moieties are particularly suited to deliver the present siRNA to
tumor cells.
[0101] Opsonization inhibiting moieties suitable for modifying
liposomes are preferably water-soluble polymers with a number
average molecular weight from about 500 to about 40,000 daltons,
and more preferably from about 2,000 to about 20,000 daltons. Such
polymers include polyethylene glycol (PEG) or polypropylene glycol
(PPG) derivatives; e.g., methoxy PEG or PPG, and PEG or PPG
stearate; synthetic polymers such as polyacrylamide or poly N-vinyl
pyrrolidone; linear, branched, or dendrimeric polyamidoamines;
polyacrylic acids; polyalcohols, e.g., polyvinylalcohol and
polyxylitol to which carboxylic or amino groups are chemically
linked, as well as gangliosides, such as ganglioside GM.sub.1.
Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives
thereof, are also suitable. In addition, the opsonization
inhibiting polymer can include a block copolymer of PEG and either
a polyamino acid, polysaccharide, polyamidoamine,
polyethyleneamine, or polynucleotide. The opsonization inhibiting
polymers can also include natural polysaccharides containing amino
acids or carboxylic acids, e.g., galacturonic acid, glucuronic
acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic
acid, alginic acid, carrageenan; aminated polysaccharides or
oligosaccharides (linear or branched); or carboxylated
polysaccharides or oligosaccharides, e.g., reacted with derivatives
of carbonic acids with resultant linking of carboxylic groups.
[0102] Preferably, the opsonization-inhibiting moiety is a PEG,
PPG, or derivatives thereof. Liposomes modified with PEG or
PEG-derivatives are sometimes called "PEGylated liposomes."
[0103] The opsonization inhibiting moiety can be bound to the
liposome membrane by any one of numerous well-known techniques. For
example, an N-hydroxysuccinimide ester of PEG can be bound to a
phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a
membrane. Similarly, a dextran polymer can be derivatized with a
stearylamine lipid-soluble anchor via reductive amination using
Na(CN)BH.sub.3 and a solvent mixture such as tetrahydrofuran and
water in a 30:12 ratio at 60.degree. C.
[0104] Recombinant plasmids which express siRNA of the invention
are discussed above. Such recombinant plasmids can also be
administered directly or in conjunction with a suitable delivery
reagent, including the Mirus Transit LT1 lipophilic reagent;
lipofectin; lipofectamine; cellfectin; polycations (e.g.,
polylysine) or liposomes. Recombinant viral vectors which express
siRNA of the invention are also discussed above, and methods for
delivering such vectors to cells of a subject which are expressing
ICAM-1 are within the skill in the art.
[0105] The siRNA of the invention can be administered to the
subject by any means suitable for delivering the siRNA to cells
which express ICAM-1. Cells which express ICAM-1 include
non-hematopoietic cells such as vascular endothelial cells, thymic
and other epithelial cells, and fibroblasts; and hematopoietic
cells such as tissue macrophages, mitogen-stimulated T lymphocyte
blasts, and germinal center dendritic cells in tonsils, lymph
nodes, and Peyer's patches. One skilled in the art understands that
certain cells express ICAM-1 in certain conditions; for example,
ICAM-1 is expressed by retinal vascular endothelial cells in ocular
neovascular diseases such as diabetic retinopathy or AMD.
[0106] Suitable techniques for delivering the siRNA of the
invention to ICAM-1-expressing cells include administration of the
siRNA to a subject by gene gun, electroporation, nanoparticles,
micro-encapsulation, and the like, or by parenteral and enteral
administration routes.
[0107] Suitable enteral administration routes include oral, rectal,
or intranasal delivery.
[0108] Suitable parenteral administration routes include
intravascular administration (e.g. intravenous bolus injection,
intravenous infusion, intra-arterial bolus injection,
intra-arterial infusion and catheter instillation into the
vasculature); peri- and intra-tissue administration (e.g.,
peri-tumoral and intra-tumoral injection, intra-retinal injection
or subretinal injection); subcutaneous injection or deposition
including subcutaneous infusion (such as by osmotic pumps); direct
(e.g., topical) application to the area at or near the site of
neovascularization, for example by a catheter or other placement
device (e.g., a corneal pellet or a suppository, eye-dropper, or an
implant comprising a porous, non-porous, or gelatinous material);
and inhalation. Suitable placement devices include the ocular
implants described in U.S. Pat. Nos. 5,902,598 and 6,375,972, and
the biodegradable ocular implants described in U.S. Pat. No
6,331,313, the entire disclosures of which are herein incorporated
by reference. Such ocular implants are available from Control
Delivery Systems, Inc. (Watertown, Mass.) and Oculex
Pharmaceuticals, Inc. (Sunnyvale, Calif.).
[0109] In a preferred embodiment, injections or infusions of the
siRNA are given at or near the site of neovascularization. For
example, the siRNA of the invention can be delivered to retinal
pigment epithelial cells in the eye. Preferably, the siRNA is
administered topically to the eye, e.g. in liquid or gel form to
the lower eye lid or conjunctival cul-de-sac, as is within the
skill in the art (see, e.g., Acheampong A A et al, 2002, Drug
Metabol. and Disposition 30: 421-429, the entire disclosure of
which is herein incorporated by reference).
[0110] Typically, the siRNA of the invention is administered
topically to the eye in volumes of from about 5 microliters to
about 75 microliters, for example from about 7 microliters to about
50 microliters, preferably from about 10 microliters to about 30
microliters. The siRNA of the invention is highly soluble in
aqueous solutions, and it is understood that topical instillation
in the eye of siRNA in volumes greater than 75 microliters can
result in loss of siRNA from the eye through spillage and drainage.
Thus, it is preferable to administer a high concentration of siRNA
(e.g., about 10 to about 200 mg/ml, or about 100 to about 1000 nM)
by topical instillation to the eye in volumes of from about 5
microliters to about 75 microliters.
[0111] A particularly preferred parenteral administration route is
intraocular administration. It is understood that intraocular
administration of the present siRNA can be accomplished by
injection or direct (e.g., topical) administration to the eye, as
long as the administration route allows the siRNA to enter the eye.
In addition to the topical routes of administration to the eye
described above, suitable intraocular routes of administration
include intravitreal, intraretinal, subretinal, subtenon, peri- and
retro-orbital, trans-corneal and trans-scleral administration. Such
intraocular administration routes are within the skill in the art;
see, e.g., and Acheampong A A et al, 2002, supra; and Bennett et
al. (1996), Hum. Gene Ther. 7: 1763-1769 and Ambati J et al., 2002,
Progress in Retinal and Eye Res. 21: 145-151, the entire
disclosures of which are herein incorporated by reference.
[0112] The siRNA of the invention can be administered in a single
dose or in multiple doses. Where the administration of the siRNA of
the invention is by infusion, the infusion can be a single
sustained dose or can be delivered by multiple infusions. Injection
of the siRNA directly into the tissue is at or near the site of
neovascularization preferred. Multiple injections of the siRNA into
the tissue at or near the site of neovascularization are
particularly preferred.
[0113] One skilled in the art can also readily determine an
appropriate dosage regimen for administering the siRNA of the
invention to a given subject. For example, the siRNA can be
administered to the subject once, such as by a single injection or
deposition at or near the neovascularization site. Alternatively,
the siRNA can be administered to a subject multiple times daily or
weekly. For example, the siRNA can be administered to a subject
once weekly for a period of from about three to about twenty-eight
weeks, more preferably from about seven to about ten weeks. In a
preferred dosage regimen, the siRNA is injected at or near the site
of neovascularization (e.g., intravitreally) once a week for seven
weeks. It is understood that periodic administrations of the siRNA
of the invention for an indefinite length of time may be necessary
for subjects suffering from a chronic neovascularization disease,
such as wet AMD or diabetic retinopathy.
[0114] Where a dosage regimen comprises multiple administrations,
it is understood that the effective amount of siRNA administered to
the subject can comprise the total amount of siRNA administered
over the entire dosage regimen.
[0115] The siRNA of the invention are preferably formulated as
pharmaceutical compositions prior to administering to a subject,
according to techniques known in the art. Pharmaceutical
compositions of the present invention are characterized as being at
least sterile and pyrogen-free. As used herein, "pharmaceutical
formulations" include formulations for human and veterinary use.
Methods for preparing pharmaceutical compositions of the invention
are within the skill in the art, for example as described in
Remington's Pharmaceutical Science, 17th ed., Mack Publishing
Company, Easton, Pa. (1985), the entire disclosure of which is
herein incorporated by reference.
[0116] The present pharmaceutical formulations comprise an siRNA of
the invention (e.g., 0.1 to 90% by weight), or a physiologically
acceptable salt thereof, mixed with a physiologically acceptable
carrier medium. Preferred physiologically acceptable carrier media
are water, buffered water, saline solutions (e.g., normal saline or
balanced saline solutions such as Hank's or Earle's balanced salt
solutions), 0.4% saline, 0.3% glycine, hyaluronic acid and the
like.
[0117] Pharmaceutical compositions of the invention can also
comprise conventional pharmaceutical excipients and/or additives.
Suitable pharmaceutical excipients include stabilizers,
antioxidants, osmolality adjusting agents, buffers, and pH
adjusting agents. Suitable additives include physiologically
biocompatible buffers (e.g., tromethamine hydrochloride), additions
of chelants (such as, for example, DTPA or DTPA-bisamide) or
calcium chelate complexes (as for example calcium DTPA,
CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium
salts (for example, calcium chloride, calcium ascorbate, calcium
gluconate or calcium lactate). Pharmaceutical compositions of the
invention can be packaged for use in liquid form, or can be
lyophilized.
[0118] For topical administration to the eye, conventional
intraocular delivery reagents can be used. For example,
pharmaceutical compositions of the invention for topical
intraocular delivery can comprise saline solutions as described
above, corneal penetration enhancers, insoluble particles,
petrolatum or other gel-based ointments, polymers which undergo a
viscosity increase upon instillation in the eye, or mucoadhesive
polymers. Preferably, the intraocular delivery reagent increases
corneal penetration, or prolongs preocular retention of the siRNA
through viscosity effects or by establishing physicochemical
interactions with the mucin layer covering the corneal
epithelium.
[0119] Suitable insoluble particles for topical intraocular
delivery include the calcium phosphate particles described in U.S.
Pat. No. 6,355,271 of Bell et al., the entire disclosure of which
is herein incorporated by reference. Suitable polymers which
undergo a viscosity increase upon instillation in the eye include
polyethylenepolyoxypropylen- e block copolymers such as poloxamer
407 (e.g., at a concentration of 25%), cellulose acetophthalate
(e.g., at a concentration of 30%), or a low-acetyl gellan gum such
as Gelrite.RTM. (available from C P Kelco, Wilmington, Del.).
Suitable mucoadhesive polymers include hydrocolloids with multiple
hydrophilic functional groups such as carboxyl, hydroxyl, amide
and/or sulfate groups; for example, hydroxypropylcellulose,
polyacrylic acid, high-molecular weight polyethylene glycols (e.g.,
>200,000 number average molecular weight), dextrans, hyaluronic
acid, polygalacturonic acid, and xylocan. Suitable corneal
penetration enhancers include cyclodextrins, benzalkonium chloride,
polyoxyethylene glycol lauryl ether (e.g., Brij.RTM. 35),
polyoxyethylene glycol stearyl ether (e.g., Brij.RTM. 78),
polyoxyethylene glycol oleyl ether (e.g., Brij.RTM. 98), ethylene
diamine tetraacetic acid (EDTA), digitonin, sodium taurocholate,
saponins and polyoxyethylated castor oil such as Cremaphor E L.
[0120] For solid compositions, conventional nontoxic solid carriers
can be used; for example, pharmaceutical grades of mannitol,
lactose, starch, magnesium stearate, sodium saccharin, talcum,
cellulose, glucose, sucrose, magnesium carbonate, and the like.
[0121] For example, a solid pharmaceutical composition for oral
administration can comprise any of the carriers and excipients
listed above and 10-95%, preferably 25%-75%, of one or more siRNA
of the invention. A pharmaceutical composition for aerosol
(inhalational) administration can comprise 0.01-20% by weight,
preferably 1%-10% by weight, of one or more siRNA of the invention
encapsulated in a liposome as described above, and propellant. A
carrier can also be included as desired; e.g., lecithin for
intranasal delivery.
[0122] The invention will now be illustrated with the following
non-limiting examples.
EXAMPLE 1
Inhibition of Human ICAM-1 Expression with siRNAs Targeted to Human
ICAM-1 mRNA
[0123] Stimulation of ICAM-1 Production in HEK-293 Cells with
Cytokines or Hypoxia
[0124] The ability of hypoxia or the cytokines tumor necrosis
factor alpha (TNF-alpha) and interferon gamma (IFN-gamma) to
stimulate production of ICAM-1 in from human embryonic kidney
(HEK)-293 cells was evaluated.
[0125] HEK-293 cells were cultured in standard growth medium
overnight in 24 well plates, at 37.degree. C. with 5% CO.sub.2. The
cells were then treated separately with 1, 10, 100 or 1000 ng of
TNF-alpha or IFN-gamma (R & D Systems, Minneapolis, Minn.), or
were made hypoxic by treatment with 100, 200 or 300 micromolar
desferrioxamine (Sigma, St. Louis, Mo.). After one or two days
treatment with the cytokines or desferrioxamine, the cells were
lysed with M-PER Mammalian Protein Extraction reagent (Pierce,
Rockford, Ill.). A human ICAM-1 ELISA (R & D systems,
Minneapolis, Minn.) was performed on the cell lysates as described
in the Quantikine human "sICAM1" ELISA protocol, and the ELISA
results were read on an AD340 plate reader (Beckman Coulter).
[0126] As shown in FIG. 1, the only conditions which increased the
level of human ICAM-1 protein in HEK-293 cells were treatment of
the cells with 100 ng/ml TNF-alpha for two days.
[0127] Treatment of Stimulated HEK-293 Cells with siRNAs Targeted
to Human ICAM-1 mRNA
[0128] HEK-293 cells were cultured overnight as in Example 1.
Transfections were performed the following day on experimental and
control cells, when the cells were approximately 50% confluent. The
experimental cells were transfected with 25 nM human ICAM-1 siRNA
mixed in calcium phosphate transfection reagent. Control cells were
treated with calcium phosphate transfection reagent lacking siRNA,
or with 25 nM nonspecific siRNA (EGFP siRNA) in calcium phosphate
transfection reagent.
[0129] For the experimental cells, ten siRNAs targeted to different
locations along the human ICAM-1 mRNA were tested. These siRNAs
target the sequences listed in Table 2, and all siRNAs contained 3'
TT overhangs on each strand.
2TABLE 2 Target Sequences for siRNAs Tested in HEK-293 Cells Target
Sequence SEQ ID NO: siRNA AATGCCCAGACATCTGTGTCC 20 hICAM1#1
AACAACCGGAAGGTGTATGAA 29 hICAM1#2 AACCGGAAGGTGTATGAACTG 30 hICAM1#3
AACCTTACCCTACGCTGCCAG 47 hICAM1#4 AACGACTCCTTCTCGGCCAAG 58 hICAM1#5
AACGTGATTCTGACGAAGCCA 62 hICAM1#6 AAGTGTGAGGCCCACCCTAGA 65 hICAM1#7
AACTGGACGTGGCCAGAAAAT 74 hICAM1#8 AAGTGTCTAAAGGATGGCACT 80 hICAM1#9
AACCGCCAGCGGAAGATCAAG 87 hICAM1#10
[0130] Four hours after transfection, production of ICAM-1 was
stimulated in the HEK-293 cells by treatment with was TNF-alpha at
a final concentration of 100 ng/ml. Forty-eight hours
post-transfection, the supernatant was removed from all wells. One
group of experimental and control cells were lysed with M-PER
Mammalian Protein Extraction reagent (Pierce, Rockford, Ill.). A
human ICAM-1 ELISA (R & D systems, Minneapolis, Minn.) was
performed on the cell lysates as in Example 1. As shown in FIG. 2,
the level of ICAM-1 protein induced in HEK-293 treated -with the
hICAM1#2, hICAM1#3, hICAM1#7, hICAM1#9 and hICAM1#10 siRNAs was
decreased as compared to cells transfected with no siRNA or with a
non-specific siRNA.
[0131] A cytotoxicity assay was performed on a second group of
experimental and control cells. After removal of the supernatant 48
hours post-transfection as described above, complete growth medium
containing 10% AlamarBlue (Biosource, Camarillo, Calif.) was added
back to the control and experimental cells, which were incubated at
37.degree. C. with 5% CO.sub.2 for 3 hours. Cell proliferation was
measured by detecting the color change of medium resulting from
cell metabolic activity. This color change was detected on an AD340
plate reader (Beckman Coulter), and the results are given in FIG.
3. As can be seen from FIG. 3, hICAM1#1-9 did not show significant
cytotoxicity in the HEK-293 cells. hICAM1#10 produce a slight
reduction in HEK-293 cell proliferation as compared to the control
cells.
[0132] After the cytotoxicity assay was performed, the growth
medium containing AlamarBlue was completely removed, and RNA was
extracted from the HEK-293 cells with the RNAqueous RNA isolation
kit (Ambion, Austin, Tex.) according to the manufacturer's
instructions. The levels of human ICAM-1 mRNA in the cells was
measured by quantitative reverse transcription-polymerase chain
reaction (RT-PCR), using the level of human
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA as an
internal standard. The RT-PCR study showed that the production of
ICAM-1 induced by TNF-alpha was suppressed by the human ICAM-1
siRNAs at the transcriptional level, as compared to cells
transfected with no siRNA or with a non-specific siRNA.
EXAMPLE 2
Treatment of Streptozotocin-Induced Diabetic Retinopathy with siRNA
Targeted to ICAM-1
[0133] Vascular leakage and non-perfusion in the retinas of
individuals with diabetic retinopathy is spatially and temporally
associated with leukocyte stasis. See, e.g., Miyamoto K et al.
(1999), Proc. Nat. Acad. Sci. USA 96(19):10836-41, the entire
disclosure of which is herein incorporated by reference. It is
expected that intravitreal injection of siRNA targeted to ICAM-1
will decrease leukocyte stasis, and therefore reduce retinal
vascular permeability, in diabetic rats.
[0134] Long-Evans rats (approximately 200 g) will be injected with
streptozotocin in citrate buffer intravenously after an overnight
fast to induce diabetes, as described in Miyamoto K et al. (1999),
supra. Long-Evans rats (approximately 200 g) will be injected with
citrate buffer alone after an overnight fast as a control. The
serum blood sugar will be measured and blood pressure will be
recorded daily. Elevated levels of serum blood sugar as compared to
control animals are considered diabetic.
[0135] Intravitreal injections of siRNA targeted to ICAM-1 will be
performed OD in each rat. Non-specific siRNA will be injected as a
control OS. The overall group scheme will be as shown in Table
3.
3TABLE 3 Overall Group Scheme OD (ICAM-1 siRNA) OS (non-specific
siRNA) Diabetic Rat (STZ) Experimental group Control Non-diabetic
Rat Control Control
[0136] At day 7 post treatment, the rats will be subjected to
Acridine Orange Leukocyte Fluorography (AOLF), as described in
Miyamoto K et al (1999), supra. Briefly, the rats will be
anaesthetized, and their pupils dilated with tropicamide. The rats
will then be injected intravenously with acridine orange suspended
in sterile saline. The fundus of each eye will be observed and
imaged with a scanning laser ophthalmoscope (argon blue laser as a
light source) for leukocyte stasis. The rats will then be perfused
with fluorescein dextran and the eyes will be further imaged. The
density of leukocyte stasis will be calculated as a percentage of
bright pixels in a 10 disk diameter radius. The density of
leukocyte stasis will be used as an endpoint.
[0137] Also on day 7, the rats will undergo an isotope dilution
technique to quantify vascular leakage, as described in Miyamoto K
et al (1999), supra. Briefly, the rats will be injected
intravenously with I.sup.125 in BSA at one time point, and with
I.sup.131 at a second time point. The rats will be sacrificed
minutes after the second injection, the retinas will be isolated,
and arterial samples will be taken. The retinas and the arterial
samples will be analyzed using .gamma.-spectroscopy after
correcting for activity in the retinas using a quantitative index
of iodine clearance. The measurements will then be normalized for
exact dose given, body weight and tissue weight. The corrected
quantity of .gamma. activity will be used as a marker of vascular
leakage in the retina (second endpoint). It is expected that the
.gamma. activity will be decreased in the retinas of the
experimental animals, indicating decreased vascular leakage.
EXAMPLE 3
Treatment of VEGF-Induced Vascular Permeability and Leukostasis
with siRNA Targeted to ICAM-1
[0138] The presence of VEGF in the eye causes retinal leukostasis
that corresponds with increased vascular permeability and capillary
non-perfusion in the retina. See, e.g., Miyamoto K et al. (2000),
Am. J. Pathol. 156(5):1733-9, the entire disclosure of which is
herein incorporated by reference. It is expected that intravitreal
injection of siRNA targeted to ICAM-1 will decrease the
permeability and leukostasis created by intravitreal injection of
VEGF in rats.
[0139] Long-Evans rats (approximately 200 g) will be anaesthetized
and injected intravitreally with VEGF in buffer OU. siRNA targeted
to ICAM-1 will be simultaneously delivered OD to each rat by
intravitreal injection. Non-specific siRNA will be injected
intravitreally as a control OS. Additional controls will include
rats injected with buffer alone (no VEGF). The overall group scheme
will be as shown in Table 4.
4TABLE 4 Overall Group Scheme OD (ICAM-1 siRNA) OS (Non-specific
siRNA) VEGF Experimental group Control Buffer Control Control
[0140] At 24 hours post injection the rats are subjected to AOLF
and an isotope dilution technique as described in Example 1.
EXAMPLE 4
Treatment of Neovascularization in Eyes Subjected to Corneal/Limbal
Injury with siRNA Targeted to ICAM-1
[0141] Injury to the ocular surface can cause the destruction of
corneal limbal stem cells. Destruction of these cells induces a
VEGF-dependent corneal neovascularization, which can lead to
blindness. The VEGF which drives the neovascularization is supplied
by neutrophils and monocytes that infiltrate the cornea after
injury to the ocular surface. See, e.g., Moromizato Y et al.
(2000), Am. J. Pathol. 157(4):1277-81, the entire disclosure of
which is herein incorporated by reference in its entirety. It is
expected that siRNA targeted to ICAM-1 applied to the cornea after
limbal injury will decrease the resultant area of
neovascularization of the cornea in mice. The area of
neovascularization can be measured directly. Alternatively, a
reduction in corneal neovascularization can be inferred from a
decrease in the number of VEGF-producing polymorphonuclear cells in
the cornea.
[0142] Corneal neovascularization will be induced in C57B1/6 by
damaging the limbus, as described in Moromizato Y et al., supra.
Briefly, the mice will be anaesthetized and sodium hydroxide will
be applied to the cornea. The corneal and limbal epithelia will be
debrided using a corneal knife OU. siRNA targeted to ICAM-1 will be
applied to the corneal surface OD immediately after removal, and 3
times a day for the duration of the study (7 days). Non-specific
siRNA will be administered OS with the same dosing regimen as a
control.
[0143] On days 2, 4 and 7 after debridement of the corneal and
limbal epithelia, mice will be evaluated for the degree of corneal
neovascularization as described in Moromizato Y et al., supra.
Briefly, endothelial-specific, fluorescein-conjugated lectin will
be injected intravenously. Thirty minutes after injection, mice
will be sacrificed, and the eyes will be harvested and fixed in
formalin for 24 hours. Flat mounts of the corneas will be made, and
pictures of the corneal flat mounts will be taken under fluorescent
microscopy and imported into Openlab software for analysis. Using
the Openlab software, threshold level of fluorescence will be set,
above which only vessels are seen. The area of fluorescent vessels
and the area of the cornea (demarcated by the limbal arcade) will
be calculated. The area of vessels will be divided by the total
corneal area, and this value will equal the percent neovascular
area. The percent neovascular area of the treatment and control
groups will be compared.
[0144] On days 2, 4 and 7 after debridement of the corneal and
limbal epithelia, additional mice will be sacrificed for
quantification of corneal polymorphonuclear cells (PMNs) as
described in Moromizato Y et al., supra. Briefly, mice will be
sacrificed, and the eyes will be harvested and fixed in formalin
for 24 hours. After formalin fixation, the enucleated eyes will be
embedded in paraffin and sectioned. One paraffin section from each
eye which correlates to the corneal anatomical center will be
chosen and used for microscopy. The PMNs (identified as
multilobulated cells) will be counted on this one section, and the
number of PMNs in the sections from the treatment and control
groups will be compared.
EXAMPLE 5
Treatment of Laser-Induced Choroidal Neovascularization with siRNA
Targeted to ICAM-1
[0145] Laser photocoagulation that ruptures Bruch's membrane will
induce choroidal neovascularization (CNV) similar to that seen in
wet macular degeneration. It is expected that intravitreal
injection of siRNA targeted to ICAM-1 will decrease the area of
laser-induced CNV in mice.
[0146] CNV will be induced in mice by the procedure described in
Sakurai E et al. (2003), Invest. Ophthalmol. & Visual Sci.
44(6):2743-9, the entire disclosure of which is herein incorporated
by reference. Briefly, C57B1/6 mice will be anaesthetized, and
their pupils will be dilated with tropicamide. The retinas of the
mice will be laser photocoagulated with one laser spot at the 9,
12, and 3 o'clock positions of each retinal OU. Immediately
following laser photocoagulation, inject siRNA targeted to ICAM-1
will be injected intravitreally OD. Non-specific siRNA will be
injected intravitreally OS as a control.
[0147] Fourteen days after laser photocoagulation, the mice will be
sacrificed and retinal flat mounts will be prepared for CNV area
quantification as described in Sakurai E et al. (2003), supra.
Briefly, the mice will be anaesthetized, the chest will be opened,
and the descending aorta will be cross-clamped. The right atrium
will then be clipped and fluorescein-labeled dextran will be
injected slowly into the left ventricle.
[0148] After injection of the fluorescein-labeled dextran, the eyes
will be enucleated and fixed in paraformaldehyde for 24 hours. The
anterior chamber and retina will then be removed, and a flat mount
of each choroid will be prepared for analysis. Choroidal flat
mounts will be analyzed by taking a picture of each under
fluorescent microscopy, and importing the picture into Openlab
software. Using the Openlab software, the area of
neovascularization will be outlined and quantified, being sure
known laser location is compared to the fluorescent tuft. The
neovascular area of the treatment animals will be compared to that
of the control animals.
Sequence CWU 1
1
94 1 2900 DNA Homo sapiens 1 gcgccccagt cgacgctgag ctcctctgct
actcagagtt gcaacctcag cctcgctatg 60 gctcccagca gcccccggcc
cgcgctgccc gcactcctgg tcctgctcgg ggctctgttc 120 ccaggacctg
gcaatgccca gacatctgtg tccccctcaa aagtcatcct gccccgggga 180
ggctccgtgc tggtgacatg cagcacctcc tgtgaccagc ccaagttgtt gggcatagag
240 accccgttgc ctaaaaagga gttgctcctg cctgggaaca accggaaggt
gtatgaactg 300 agcaatgtgc aagaagatag ccaaccaatg tgctattcaa
actgccctga tgggcagtca 360 acagctaaaa ccttcctcac cgtgtactgg
actccagaac gggtggaact ggcacccctc 420 ccctcttggc agccagtggg
caagaacctt accctacgct gccaggtgga gggtggggca 480 ccccgggcca
acctcaccgt ggtgctgctc cgtggggaga aggagctgaa acgggagcca 540
gctgtggggg agcccgctga ggtcacgacc acggtgctgg tgaggagaga tcaccatgga
600 gccaatttct cgtgccgcac tgaactggac ctgcggcccc aagggctgga
gctgtttgag 660 aacacctcgg ccccctacca gctccagacc tttgtcctgc
cagcgactcc cccacaactt 720 gtcagccccc gggtcctaga ggtggacacg
caggggaccg tggtctgttc cctggacggg 780 ctgttcccag tctcggaggc
ccaggtccac ctggcactgg gggaccagag gttgaacccc 840 acagtcacct
atggcaacga ctccttctcg gccaaggcct cagtcagtgt gaccgcagag 900
gacgagggca cccagcggct gacgtgtgca gtaatactgg ggaaccagag ccaggagaca
960 ctgcagacag tgaccatcta cagctttccg gcgcccaacg tgattctgac
gaagccagag 1020 gtctcagaag ggaccgaggt gacagtgaag tgtgaggccc
accctagagc caaggtgacg 1080 ctgaatgggg ttccagccca gccactgggc
ccgagggccc agctcctgct gaaggccacc 1140 ccagaggaca acgggcgcag
cttctcctgc tctgcaaccc tggaggtggc cggccagctt 1200 atacacaaga
accagacccg ggagcttcgt gtcctgtatg gcccccgact ggacgagagg 1260
gattgtccgg gaaactggac gtggccagaa aattcccagc agactccaat gtgccaggct
1320 tgggggaacc cattgcccga gctcaagtgt ctaaaggatg gcactttccc
actgcccatc 1380 ggggaatcag tgactgtcac tcgagatctt gagggcacct
acctctgtcg ggccaggagc 1440 actcaagggg aggtcacccg caaggtgacc
gtgaatgtgc tctccccccg gtatgagatt 1500 gtcatcatca ctgtggtagc
agccgcagtc ataatgggca ctgcaggcct cagcacgtac 1560 ctctataacc
gccagcggaa gatcaagaaa tacagactac aacaggccca aaaagggacc 1620
cccatgaaac cgaacacaca agccacgcct ccctgaacct atcccgggac agggcctctt
1680 cctcggcctt cccatattgg tggcagtggt gccacactga acagagtgga
agacatatgc 1740 catgcagcta cacctaccgg ccctgggacg ccggaggaca
gggcattgtc ctcagtcaga 1800 tacaacagca tttggggccc atctgatctg
tagtcacatg actaagccaa gaggaaggag 1860 caagactcaa gacatgattg
atggatgtta aagtctagcc tgatgagagg ggaagtggtg 1920 ggggagacat
agccccacca tgaggacata caactgggaa atactgaaac ttgctgccta 1980
ttgggtatgc tgaggcccca cagacttaca gaagaagtgg ccctccatag acatggcact
2040 gctgtctact gaccccaacc cttgatgata tgtatttatt catttgttat
tttaccagct 2100 atttattgag tgtcttttat gtaggctaaa tgaacatagg
tctctggcct cacggagctc 2160 ccagtcctaa tcacattcaa ggtcaccagg
tacagttgta caggttgtac actgcaggag 2220 agtgcctggc aaaaagatca
aatggggctg ggacttctca ttggccaacc tgcctttccc 2280 cagaaggagt
gatttttcta tcggcacaaa agcactatat ggactggtaa tggttacagg 2340
ttcagagatt acccagtgag gccttattcc tcccttcccc ccaaaactga cacctttgtt
2400 agccacctcc ccacccacat acatttctgc cagtgttcac aatgacactc
agcggtcatg 2460 tctggacatg agtgcccagg gaatatgccc aagctatgcc
ttgtcctctt gtcctgtttg 2520 catttcactg ggagcttgca ctatgcagct
ccagtttcct gcagtgatca gggtcctgca 2580 agcagtgggg aagggggcca
aggtattgga ggactccctc ccagctttgg aagcctcatc 2640 cgcgtgtgtg
tgtgtgtgta tgtgtagaca agctctcgct ctgtcaccca ggctggagtg 2700
cagtggtgca atcatggttc actgcagtct tgaccttttg ggctcaagtg atcctcccac
2760 ctcagcctcc tgagtagctg ggaccatagg ctcacaacac cacacctggc
aaatttgatt 2820 tttttttttt ttccagagac ggggtctcgc aacattgccc
agacttcctt tgtgttagtt 2880 aataaagctt tctcaactgc 2900 2 1614 DNA
Mus musculus 2 atggcttcaa cccgtgccaa gcccacgcta cctctgctcc
tggccctggt caccgttgtg 60 atccctgggc ctggtgatgc tcaggtatcc
atccatccca gagaagcctt cctgccccag 120 ggtgggtccg tgcaggtgaa
ctgttcttcc tcatgcaagg aggacctcag cctgggcttg 180 gagactcagt
ggctgaaaga tgagctcgag agtggaccca actggaagct gtttgagctg 240
agcgagatcg gggaggacag cagtccgctg tgctttgaga actgtggcac cgtgcagtcg
300 tccgcttccg ctaccatcac cgtgtattcg tttccggaga gtgtggagct
gagacctctg 360 ccagcctggc agcaagtagg caaggacctc accctgcgct
gccacgtgga tggtggagca 420 ccgcggaccc agctctcagc agtgctgctc
cgtggggagg agatactgag ccgccagcca 480 gtgggtgggc accccaagga
ccccaaggag atcacattca cggtgctggc tagcagaggg 540 gaccacggag
ccaatttctc atgccgcaca gaactggatc tcaggccgca agggctggca 600
ttgttctcta atgtctccga ggccaggagc ctccggactt tcgatcttcc agctaccatc
660 ccaaagctcg acacccctga cctcctggag gtgggcaccc agcagaagtt
gttttgctcc 720 ctggaaggcc tgtttcctgc ctctgaagct cggatatacc
tggagctggg aggccagatg 780 ccgacccagg agagcacaaa cagcagtgac
tctgtgtcag ccactgcctt ggtagaggtg 840 actgaggagt tcgacagaac
cctgccgctg cgctgcgttt tggagctagc ggaccagatc 900 ctggagacgc
agaggacctt aacagtctac aacttttcag ctccggtcct gaccctgagc 960
cagctggagg tctcggaagg gagccaagta actgtgaagt gtgaagccca cagtgggtcg
1020 aaggtggttc ttctgagcgg cgtcgagcct aggccaccca ccccgcaggt
ccaattcaca 1080 ctgaatgcca gctcggagga tcacaaacga agcttctttt
gctctgccgc tctggaggtg 1140 gcgggaaagt tcctgtttaa aaaccagacc
ctggaactgc acgtgctgta tggtcctcgg 1200 ctggacgaga cggactgctt
ggggaactgg acctggcaag aggggtctca gcagactctg 1260 aaatgccagg
cctgggggaa cccatctcct aagatgacct gcagacggaa ggcagatggt 1320
gccctgctgc ccatcggggt ggtgaagtct gtcaaacagg agatgaatgg tacatacgtg
1380 tgccatgcct ttagctccca tgggaatgtc accaggaatg tgtacctgac
agtactgtac 1440 cactctcaaa ataactggac tataatcatt ctggtgccag
tactgctggt cattgtgggc 1500 ctcgtgatgg cagcctctta tgtttataac
cgccagagaa agatcaggat atacaagtta 1560 cagaaggctc aggaggaggc
cataaaactc aagggacaag ccccacctcc ctga 1614 3 19 DNA Artificial
Sequence target sequence 3 gttgttgggc atagagacc 19 4 21 RNA
Artificial Sequence siRNA sense strand 4 guuguugggc auagagaccu u 21
5 21 RNA Artificial Sequence siRNA antisense strand 5 ggucucuaug
cccaacaacu u 21 6 21 DNA Artificial Sequence siRNA sense strand 6
guuguugggc auagagacct t 21 7 21 DNA Artificial Sequence siRNA
antisense strand 7 ggucucuaug cccaacaact t 21 8 19 DNA Artificial
Sequence target sequence 8 ggagttgctc ctgcctggg 19 9 19 DNA
Artificial Sequence target sequence 9 ccggaaggtg tatgaactg 19 10 19
DNA Artificial Sequence target sequence 10 ctgagcaatg tgcaagaag 19
11 19 DNA Artificial Sequence target sequence 11 tgtgctattc
aaactgccc 19 12 19 DNA Artificial Sequence target sequence 12
ccttcctcac cgtgtactg 19 13 19 DNA Artificial Sequence target
sequence 13 cgggtggaac tggcacccc 19 14 19 DNA Artificial Sequence
target sequence 14 ccttacccta cgctgccag 19 15 19 DNA Artificial
Sequence target sequence 15 cctcaccgtg gtgctgctc 19 16 19 DNA
Artificial Sequence target sequence 16 cgggagccag ctgtggggg 19 17
19 DNA Artificial Sequence target sequence 17 tttctcgtgc cgcactgaa
19 18 19 DNA Artificial Sequence target sequence 18 ctggacctgc
ggccccaag 19 19 19 DNA Artificial Sequence target sequence 19
ggcctcagtc agtgtgacc 19 20 21 DNA Artificial Sequence target
sequence 20 aatgcccaga catctgtgtc c 21 21 21 DNA Artificial
Sequence target sequence 21 aaaagtcatc ctgccccggg g 21 22 21 DNA
Artificial Sequence target sequence 22 aaagtcatcc tgccccgggg a 21
23 21 DNA Artificial Sequence target sequence 23 aagtcatcct
gccccgggga g 21 24 21 DNA Artificial Sequence target sequence 24
aagttgttgg gcatagagac c 21 25 21 DNA Artificial Sequence target
sequence 25 aaaaaggagt tgctcctgcc t 21 26 21 DNA Artificial
Sequence target sequence 26 aaaaggagtt gctcctgcct g 21 27 21 DNA
Artificial Sequence target sequence 27 aaaggagttg ctcctgcctg g 21
28 21 DNA Artificial Sequence target sequence 28 aaggagttgc
tcctgcctgg g 21 29 21 DNA Artificial Sequence target sequence 29
aacaaccgga aggtgtatga a 21 30 21 DNA Artificial Sequence target
sequence 30 aaccggaagg tgtatgaact g 21 31 21 DNA Artificial
Sequence target sequence 31 aaggtgtatg aactgagcaa t 21 32 21 DNA
Artificial Sequence target sequence 32 aactgagcaa tgtgcaagaa g 21
33 21 DNA Artificial Sequence target sequence 33 aatgtgcaag
aagatagcca a 21 34 21 DNA Artificial Sequence target sequence 34
aagaagatag ccaaccaatg t 21 35 21 DNA Artificial Sequence target
sequence 35 aagatagcca accaatgtgc t 21 36 21 DNA Artificial
Sequence target sequence 36 aaccaatgtg ctattcaaac t 21 37 21 DNA
Artificial Sequence target sequence 37 aatgtgctat tcaaactgcc c 21
38 21 DNA Artificial Sequence target sequence 38 aaactgccct
gatgggcagt c 21 39 21 DNA Artificial Sequence target sequence 39
aactgccctg atgggcagtc a 21 40 21 DNA Artificial Sequence target
sequence 40 aacagctaaa accttcctca c 21 41 21 DNA Artificial
Sequence target sequence 41 aaaaccttcc tcaccgtgta c 21 42 21 DNA
Artificial Sequence target sequence 42 aaaccttcct caccgtgtac t 21
43 21 DNA Artificial Sequence target sequence 43 aaccttcctc
accgtgtact g 21 44 21 DNA Artificial Sequence target sequence 44
aacgggtgga actggcaccc c 21 45 21 DNA Artificial Sequence target
sequence 45 aactggcacc cctcccctct t 21 46 21 DNA Artificial
Sequence target sequence 46 aagaacctta ccctacgctg c 21 47 21 DNA
Artificial Sequence target sequence 47 aaccttaccc tacgctgcca g 21
48 21 DNA Artificial Sequence target sequence 48 aacctcaccg
tggtgctgct c 21 49 21 DNA Artificial Sequence target sequence 49
aaggagctga aacgggagcc a 21 50 21 DNA Artificial Sequence target
sequence 50 aaacgggagc cagctgtggg g 21 51 21 DNA Artificial
Sequence target sequence 51 aacgggagcc agctgtgggg g 21 52 21 DNA
Artificial Sequence target sequence 52 aatttctcgt gccgcactga a 21
53 21 DNA Artificial Sequence target sequence 53 aactggacct
gcggccccaa g 21 54 21 DNA Artificial Sequence target sequence 54
aagggctgga gctgtttgag a 21 55 21 DNA Artificial Sequence target
sequence 55 aacacctcgg ccccctacca g 21 56 21 DNA Artificial
Sequence target sequence 56 aacttgtcag cccccgggtc c 21 57 21 DNA
Artificial Sequence target sequence 57 aaccccacag tcacctatgg c 21
58 21 DNA Artificial Sequence target sequence 58 aacgactcct
tctcggccaa g 21 59 21 DNA Artificial Sequence target sequence 59
aaggcctcag tcagtgtgac c 21 60 21 DNA Artificial Sequence target
sequence 60 aatactgggg aaccagagcc a 21 61 21 DNA Artificial
Sequence target sequence 61 aaccagagcc aggagacact g 21 62 21 DNA
Artificial Sequence target sequence 62 aacgtgattc tgacgaagcc a 21
63 21 DNA Artificial Sequence target sequence 63 aagccagagg
tctcagaagg g 21 64 21 DNA Artificial Sequence target sequence 64
aagggaccga ggtgacagtg a 21 65 21 DNA Artificial Sequence target
sequence 65 aagtgtgagg cccaccctag a 21 66 21 DNA Artificial
Sequence target sequence 66 aaggtgacgc tgaatggggt t 21 67 21 DNA
Artificial Sequence target sequence 67 aatggggttc cagcccagcc a 21
68 21 DNA Artificial Sequence target sequence 68 aaggccaccc
cagaggacaa c 21 69 21 DNA Artificial Sequence target sequence 69
aacgggcgca gcttctcctg c 21 70 21 DNA Artificial Sequence target
sequence 70 aaccctggag gtggccggcc a 21 71 21 DNA Artificial
Sequence target sequence 71 aagaaccaga cccgggagct t 21 72 21 DNA
Artificial Sequence target sequence 72 aaccagaccc gggagcttcg t 21
73 21 DNA Artificial Sequence target sequence 73 aaactggacg
tggccagaaa a 21 74 21 DNA Artificial Sequence target sequence 74
aactggacgt ggccagaaaa t 21 75 21 DNA Artificial Sequence target
sequence 75 aaaattccca gcagactcca a 21 76 21 DNA Artificial
Sequence target sequence 76 aaattcccag cagactccaa t 21 77 21 DNA
Artificial Sequence target sequence 77 aattcccagc agactccaat g 21
78 21 DNA Artificial Sequence target sequence 78 aatgtgccag
gcttggggga a 21 79 21 DNA Artificial Sequence target sequence 79
aacccattgc ccgagctcaa g 21 80 21 DNA Artificial Sequence target
sequence 80 aagtgtctaa aggatggcac t 21 81 21 DNA Artificial
Sequence target sequence 81 aaaggatggc actttcccac t 21 82 21 DNA
Artificial Sequence target sequence 82 aaggatggca ctttcccact g 21
83 21 DNA Artificial Sequence target sequence 83 aatcagtgac
tgtcactcga g 21 84 21 DNA Artificial Sequence target sequence 84
aaggggaggt cacccgcgag g 21 85 21 DNA Artificial Sequence target
sequence 85 aatgtgctct ccccccggta t 21 86 21 DNA Artificial
Sequence target sequence 86 aatgggcact gcaggcctca g 21 87 21 DNA
Artificial Sequence target sequence 87 aaccgccagc ggaagatcaa g 21
88 21 DNA Artificial Sequence target sequence 88 aagatcaaga
aatacagact a 21 89 21 DNA Artificial Sequence target sequence 89
aagaaataca gactacaaca g 21 90 21 DNA Artificial Sequence target
sequence 90 aaatacagac tacaacaggc c 21 91 21 DNA Artificial
Sequence target sequence 91 aatacagact acaacaggcc c 21 92 21 DNA
Artificial Sequence target sequence 92 aacaggccca aaaagggacc c 21
93 21 DNA Artificial Sequence target sequence 93 aaaaagggac
ccccatgaaa c 21 94 21 DNA Artificial Sequence target sequence 94
aaaagggacc cccatgaaac c 21
* * * * *