U.S. patent application number 10/475024 was filed with the patent office on 2004-11-04 for methods for identifying small molecules that bind specific rna structural motifs.
Invention is credited to Rando, Robert F., Welch, Eleln.
Application Number | 20040219545 10/475024 |
Document ID | / |
Family ID | 23087914 |
Filed Date | 2004-11-04 |
United States Patent
Application |
20040219545 |
Kind Code |
A1 |
Rando, Robert F. ; et
al. |
November 4, 2004 |
Methods for identifying small molecules that bind specific rna
structural motifs
Abstract
The present invention relates to a method for screening and
identifying test compounds that bind to a preselected target
ribonucleic acid ("RNA"). Direct, non-competitive binding assays
are advantageously used to screen libraries of compounds for those
that selectively bind to a preselected target RNA. Binding of
target RNA molecules to a particular test compound is detected
using any physical method that measures the altered physical
property of the target RNA bound to a test compound. The structure
of the test compound attached to the labeled RNA is also
determined. The methods used will depend, in part, on the nature of
the library screened. The methods of the present invention provide
a simple, sensitive assay for high-throughput screening of
libraries of compounds to identify pharmaceutical leads.
Inventors: |
Rando, Robert F.;
(Annandale, NJ) ; Welch, Eleln; (Califon,
NJ) |
Correspondence
Address: |
JONES DAY
222 EAST 41ST ST
NEW YORK
NY
10017
US
|
Family ID: |
23087914 |
Appl. No.: |
10/475024 |
Filed: |
February 3, 2004 |
PCT Filed: |
April 11, 2002 |
PCT NO: |
PCT/US02/11757 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60283869 |
Apr 13, 2001 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/6.1 |
Current CPC
Class: |
C10M 2201/102 20130101;
C10N 2040/44 20200501; C10M 2201/0863 20130101; C10M 103/06
20130101; C10M 2201/0423 20130101; C10M 2205/14 20130101; C10N
2040/50 20200501; C08K 3/30 20130101; C10M 2201/1053 20130101; C08K
3/04 20130101; C10M 2201/0853 20130101; C10M 2201/042 20130101;
C10M 2201/123 20130101; C10M 2201/0663 20130101; C10M 111/04
20130101; C10M 2201/0653 20130101; C10M 2201/0803 20130101; C10N
2010/04 20130101; C10M 2205/024 20130101; C10N 2040/00 20130101;
C10N 2040/34 20130101; C10M 2201/062 20130101; C10M 2201/066
20130101; C10N 2040/36 20130101; C10N 2040/38 20200501; C10M 107/06
20130101; C10M 2201/0603 20130101; C10M 107/04 20130101; C10M
2201/1033 20130101; C10M 2201/1023 20130101; C10N 2040/42 20200501;
C10M 103/02 20130101; C10M 2205/0245 20130101; C10N 2040/30
20130101; B82Y 30/00 20130101; C10M 2201/1006 20130101; C10N
2040/32 20130101; C10M 2201/041 20130101; C10M 2201/0413 20130101;
C10M 2201/0613 20130101; C10M 2205/022 20130101; C10M 2205/0225
20130101; C10M 2201/0623 20130101; C10M 2201/0873 20130101; C10N
2040/40 20200501; C10M 111/04 20130101; C10M 103/02 20130101; C10M
103/06 20130101; C10M 107/04 20130101; C10M 107/06 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Claims
What is claimed is:
1. A method for identifying a test compound that binds to a target
RNA molecule, comprising the steps of: (a) contacting a detectably
labeled target RNA molecule with a library of test compounds under
conditions that permit direct binding of the labeled target RNA to
a member of the library of test compounds so that a detectably
labeled target RNA:test compound complex is formed; (b) separating
the detectably labeled target RNA:test compound complex formed in
step (a) from uncomplexed target RNA molecules and test compounds;
and (c) determining a structure of the test compound bound to the
RNA in the RNA:test compound complex.
2. The method of claim 1 in which the target RNA molecule contains
an HIV TAR element, internal ribosome entry site, "slippery site",
instability element, or adenylate uridylate-rich element.
3. The method of claim 1 in which the RNA molecule is an element
derived from the mRNA for tumor necrosis factor alpha
("TNF-.alpha."), granulocyte-macrophage colony stimulating factor
("GM-CSF"), interleukin 2 ("IL-2"), interleukin 6 ("IL-6"),
vascular endothelial growth factor ("VEGF"), human immunodeficiency
virus I ("HIV-1"), hepatitis C virus ("HCV"--genotypes 1a &
1b), ribonuclease P RNA ("RNaseP"), X-linked inhibitor of apoptosis
protein ("XIAP"), or survivin.
4. The method of claim 1 in which the detectably labeled RNA is
labeled with a fluorescent dye, phosphorescent dye, ultraviolet
dye, infrared dye, visible dye, radiolabel, enzyme, spectroscopic
colorimetric label, affinity tag, or nanoparticle.
5. The method of claim 1 in which the test compound is selected
from a combinatorial library comprising peptoids; random
bio-oligomers; diversomers such as hydantoins, benzodiazepines and
dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics;
oligocarbamates; peptidyl phosphonates; peptide nucleic acid
libraries; antibody libraries; carbohydrate libraries; or small
organic molecule libraries.
6. The method of claim 5 in which the small organic molecule
libraries are libraries of benzodiazepines, isoprenoids,
thiazolidinones, metathiazanones, pyrrolidines, morpholino
compounds, or diazepindiones.
7. The method of claim 1 in which screening a library of test
compounds comprises contacting the test compound with the target
nucleic acid in the presence of an aqueous solution wherein the
aqueous solution comprises a buffer and a combination of salts.
8. The method of claim 7 wherein the aqueous solution approximates
or mimics physiologic conditions.
9. The method of claim 7 in which the aqueous solution optionally
further comprises non-specific nucleic acids comprising DNA, yeast
tRNA, salmon sperm DNA, homoribopolymers, and nonspecific RNAs.
10. The method of claim 7 in which the aqueous solution further
comprises a buffer, a combination of salts, and optionally, a
detergent or a surfactant.
11. The method of claim 10 in which the aqueous solution further
comprises a combination of salts, from about 0 mM to about 100 mM
KCl, from about 0 mM to about 1 M NaCl, and from about 0 mM to
about 200 MM MgCl.sub.2.
13. The method of claim 11 wherein the combination of salts is
about 100 mM KCl, 500 mM NaCl, and 10 mM MgCl.sub.2.
14. The method of claim 10 wherein the solution optionally
comprises from about 0.01% to about 0.5% (w/v) of a detergent or a
surfactant.
15. The method of claim 1 in which separating the detectably
labeled target RNA:test compound complex formed in step (a) from
uncomplexed target RNA and test compounds is by
electrophoresis.
16. The method of claim 15 in which the electrophoresis is
capillary electrophoresis.
17. The method of claim 1 in which separating the detectably
labeled target RNA:test compound. complex formed in step (a) from
uncomplexed target RNA and test compounds is by fluorescence
spectroscopy, surface plasmon resonance, mass spectrometry,
scintillation, proximity assay, structure-activity relationships
("SAR") by NMR spectroscopy, size exclusion chromatography,
affinity chromatography, or nanoparticle aggregation.
18. The method of claim 1 in which the library of test compounds
are small organic molecule libraries.
19. The method of claim 18 in which the structure of the test
compound is determined by mass spectroscopy, NMR, or vibration
spectroscopy.
Description
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/282,965, filed Apr. 11, 2001, which is
incorporated herein by reference in its entirety.
1. INTRODUCTION
[0002] The present invention relates to a method for screening and
identifying test compounds that bind to a preselected target
ribonucleic acid ("RNA"). Direct, non-competitive binding assays
are advantageously used to screen libraries of compounds for those
that selectively bind to a preselected target RNA. Binding of
target RNA molecules to a particular test compound is detected
using any physical method that measures the altered physical
property of the target RNA bound to a test compound. The methods of
the present invention provide a simple, sensitive assay for
high-throughput screening of libraries of compounds to identify
pharmaceutical leads.
2. BACKGROUND OF THE INVENTION
[0003] Protein-nucleic acid interactions are involved in many
cellular functions, including transcription, RNA splicing, mRNA
decay, and mRNA translation. Readily accessible synthetic molecules
that can bind with high affinity to specific sequences of single-
or double-stranded nucleic acids have the potential to interfere
with these interactions in a controllable way, making them
attractive tools for molecular biology and medicine. Successful
approaches for blocking function of target nucleic acids include
using duplex-forming antisense oligonucleotides (Miller, 1996,
Progress in Nucl. Acid Res. & Mol. Biol. 52:261-291; Ojwang
& Rando, 1999, Achieving antisense inhibition by
oligodeoxynucleotides containing N.sub.7 modified 2'-deoxyguanosine
using tumor necrosis factor receptor type 1, METHODS: A Companion
to Methods in Enzymology 18:244-251) and peptide nucleic acids
("PNA") (Nielsen, 1999, Current Opinion in Biotechnology 10:71-75),
which bind to nucleic acids via Watson-Crick base-pairing.
Triplex-forming anti-gene oligonucleotides can also be designed
(Ping et al., 1997, RNA 3:850-860; Aggarwal et al., 1996, Cancer
Res. 56:5156-5164; U.S. Pat. No. 5,650,316), as well as
pyrrole-imidazole polyamide oligomers (Gottesfeld et al., 1997,
Nature 387:202-205; White et al., 1998, Nature 391:468-471), which
are specific for the major and minor grooves of a double helix,
respectively.
[0004] In addition to synthetic nucleic acids (i.e., antisense,
ribozymes, and triplex-forming molecules), there are examples of
natural products that interfere with deoxyribonucleic acid ("DNA")
or RNA processes such as transcription or translation. For example,
certain carbohydrate-based host cell factors, calicheamicin
oligosaccharides, interfere with the sequence-specific binding of
transcription factors to DNA and inhibit transcription in vivo (Ho
et al., 1994, Proc. Natl. Acad. Sci. USA 91:9203-9207; Liu et al.,
1996, Proc. Natl. Acad. Sci. USA 93:940-944). Certain classes of
known antibiotics have been characterized and were found to
interact with RNA. For example, the antibiotic thiostreptone binds
tightly to a 60-mer from ribosomal RNA (Cundliffe et al., 1990, in
The Ribosome: Structure, Function & Evolution (Schlessinger et
al, eds.) American Society for Microbiology, Washington, D.C. pp.
479-490). Bacterial resistance to various antibiotics often
involves methylation at specific rRNA sites (Cundliffe, 1989, Ann.
Rev. Microbiol. 43:207-233). Aminoglycosidic aminocyclitol
(aminoglycoside) antibiotics and peptide antibiotics are known to
inhibit group I intron splicing by binding to specific regions of
the RNA (von Ahsen et al., 1991, Nature (London) 353:368-370). Some
of these same aminoglycosides have also been found to inhibit
hammerhead ribozyme finction (Stage et al., 1995, RNA 1:95-101). In
addition, certain aminoglycosides and other protein synthesis
inhibitors have been found to interact with specific bases in 16S
rRNA (Woodcock et al., 1991, EMBO J. 10:3099-3103). An
oligonucleotide analog of the 16S rRNA has also been shown to
interact with certain aminoglycosides (Purohit et al., 1994, Nature
370:659-662). A molecular basis for hypersensitivity to
aminoglycosides has been found to be located in a single base
change in mitochondrial rRNA (Hutchin et al., 1993, Nucleic Acids
Res. 21:4174-4179). Aninoglycosides have also been shown to inhibit
the interaction between specific structural RNA motifs and the
corresponding RNA binding protein. Zapp et al. (Cell, 1993,
74:969-978) has demonstrated that the aminoglycosides neomycin B,
lividomycin A, and tobramycin can block the binding of Rev, a viral
regulatory protein required for viral gene expression, to its viral
recognition element in the IIB (or RRE) region of HIV RNA. This
blockage appears to be the result of competitive binding of the
antibiotics directly to the RRE RNA structural motif.
[0005] Single stranded sections of RNA can fold into complex
tertiary structures consisting of local motifs such as loops,
bulges, pseudoknots, guanosine quartets and turns (Chastain &
Tinoco, 1991, Progress in Nucleic Acid Res. & Mol. Biol.
41:131-177; Chow & Bogdan, 1997, Chemical Reviews 97:1489-1514;
Rando & Hogan, 1998, Biologic activity of guanosine quartet
forming oligonucleotides in "Applied Antisense Oligonucleotide
Technology" Stein. & Krieg (eds) John Wiley and Sons, New York,
pages 335-352). Such structures can be critical to the activity of
the nucleic acid and affect functions such as regulation of mRNA
transcription, stability, or translation (Weeks & Crothers,
1993, Science 261:1574-1577). The dependence of these functions on
the native three-dimensional structural motifs of single-stranded
stretches of nucleic acids makes it difficult to identify or design
synthetic agents that bind to these motifs using general,
simple-to-use sequence-specific recognition rules for the formation
of double- and triple-helical nucleic acids used in the design of
antisense and ribozyme type molecules. Approaches to screening
generally involve competitive assays designed to identify compounds
that disrupt the interaction between a target RNA and a
physiological, host cell factor(s) that had been previously
identified to specifically interact with that particular target
RNA. In general, such assays require the identification and
characterization of the host cell factor(s) deemed to be required
for the function of the target RNA. Both the target RNA and its
preselected host cell binding partner are used in a competitive
format to identify compounds that disrupt or interfere with the two
components in the assay.
[0006] Citation or identification of any reference in Section 2 of
this application is not an admission that such reference is
available as prior art to the present invention.
3. SUMMARY OF THE INVENTION
[0007] The present invention relates to methods for identifying
compounds that bind to preselected target elements of nucleic acids
including, but not limited to, specific RNA sequences, RNA
structural motifs, and/or RNA structural elements. The specific
target RNA sequences, RNA structural motifs, and/or RNA structural
elements are used as targets for screening small molecules and
identifying those that directly bind these specific sequences,
motifs, and/or structural elements. For example, methods are
described in which a preselected target RNA having a detectable
label is used to screen a library of test compounds, preferably
under physiologic conditions. Any complexes formed between the
target RNA and a member of the library are identified using
physical methods that detect the altered physical property of the
target RNA bound to a test compound. In particular, the present
invention relates to methods for using a target RNA having a
detectable label to screen a library of test compounds free in
solution, in labeled tubes or microtiter plate, or in a microarray.
Compounds in the library that bind to the labeled target RNA will
form a detectably labeled complex. The detectably labeled complex
can then be identified and removed from the uncomplexed, unlabeled
test compounds in the library, and from uncomplexed, labeled target
RNA, by a variety of methods, including but not limited to, methods
that differentiate changes in the electrophoretic, chromatographic,
or thermostable properties of the complexed target RNA. Such
methods include, but are not limited to, electrophoresis,
fluorescence spectroscopy, surface plasmon resonance, mass
spectrometry, scintillation, proximity assay, structure-activity
relationships ("SAR") by NMR spectroscopy, size exclusion
chromatography, affinity chromatography, and nanoparticle
aggregation. The structure of the test compound attached to the
labeled RNA is then determined. The methods used will depend, in
part, on the nature of the library screened. For example, assays or
microarrays of test compounds, each having an address or
identifier, may be deconvoluted, e.g., by cross-referencing the
positive sample to original compound list that was applied to the
individual test assays. Another method for identifying test
compounds includes de novo structure determination of the test
compounds using mass spectrometry or nuclear magnetic resonance
("NMR"). The test compounds identified are useful for any purpose
to which a binding reaction may be put, for example in assay
methods, diagnostic procedures, cell sorting, as inhibitors of
target molecule function, as probes, as sequestering agents and the
like. In addition, small organic molecules which interact
specifically with target RNA molecules may be useful as lead
compounds for the development of therapeutic agents.
[0008] The methods described herein for the identification of
compounds that directly bind to a particular preselected target RNA
are well suited for high-throughput screening. The direct binding
method of the invention offers advantages over drug screening
systems for competitors that inhibit the formation of
naturally-occurring RNA binding protein:target RNA complexes; i.e.,
competitive assays. The direct binding method of the invention is
rapid and can be set up to be readily performed, e.g., by a
technician, making it amenable to high throughput screening. The
method of the invention also eliminates the bias inherent in the
competitive drug screening systems, which require the use of a
preselected host cell factor that may not have physiological
relevance to the activity of the target RNA. Instead, the methods
of the invention are used to identify any compound that can
directly bind to specific target RNA sequences, RNA structural
motifs, and/or RNA structural elements, preferably under
physiologic conditions. As a result, the compounds so identified
can inhibit the interaction of the target RNA with any one or more
of the native host cell factors (whether known or unknown) required
for activity of the RNA in vivo.
[0009] The present invention may be understood more fully by
reference to the detailed description and examples, which are
intended to illustrate non-limiting embodiments of the
invention.
3.1. Definitions
[0010] As used herein, a "target nucleic acid" refers to RNA, DNA,
or a chemically modified variant thereof. In a preferred
embodiment, the target nucleic acid is RNA. A target nucleic acid
also refers to tertiary structures of the nucleic acids, such as,
but not limited to loops, bulges, pseudoknots, guanosine quartets
and turns. A target nucleic acid also refers to RNA elements such
as, but not limited to, the HIV TAR element, internal ribosome
entry site, "slippery site", instability elements, and adenylate
uridylate-rich elements, which are described in Section 5.1.
Non-limiting examples of target nucleic acids are presented in
Section 5.1 and Section 6.
[0011] As used herein, a "library" refers to a plurality of test
compounds with which a target nucleic acid molecule is contacted. A
library can be a combinatorial library, e.g., a collection of test
compounds synthesized using combinatorial chemistry techniques, or
a collection of unique chemicals of low molecular weight (less than
1000 daltons) that each occupy a unique three-dimensional
space.
[0012] As used herein, a "label" or "detectable label" is a
composition that is detectable, either directly or indirectly, by
spectroscopic, photochemical, biochem cal, immunochemical, or
chemical means. For example, useful labels include radioactive
isotopes (e.g., .sup.32P, .sup.35S, and .sup.3H), dyes, fluorescent
dyes, electron-dense reagents, enzymes and their substrates (e.g.,
as commonly used in enzyme-linked immunoassays, e.g., lkaline
phosphatase and horse radish peroxidase), biotin-streptavidin,
digoxigenin, or haptens and proteins for which antisera or
monoclonal antibodies are available. Moreover, a label or
detectable moiety can include a "affinity tag" that, when coupled
with the target nucleic acid and incubated with a test compound or
compound library, allows for the affinity capture of the target
nucleic acid along with molecules bound to the target nucleic acid.
One skilled in the art will appreciate that a affinity tag bound to
the target nucleic acids has, by definition, a complimentary ligand
coupled to a solid support that allows for its capture. For
example, useful affinity tags and complimentary partners include,
but are not limited to, biotin-streptavidin, complimentary nucleic
acid fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo
dG-oligo dC, oligo G-oligo C), aptaners, or haptens and proteins
for which antisera or monoclonal antibodies are available. The
label or detectable moiety is typically bound, either covalently,
through a linker or chemical bound, or through ionic, van der Waals
or hydrogen bonds to the molecule to be detected.
[0013] As used herein, a "dye" refers to a molecule that, when
exposed to radiation, emits radiation at a level that is detectable
visually or via conventional spectroscopic means. As used herein, a
"visible dye" refers to a molecule having a chromophore that
absorbs radiation in the visible region of the spectrum (i.e.,
having a wavelength of between about 400 nm and about 700 nm) such
that the transmitted radiation is in the visible region and can be
detected either visually or by conventional spectroscopic means. As
used herein, an "ultraviolet dye" refers to a molecule having a
chromophore that absorbs radiation in the ultraviolet region of the
spectrum (i.e., having a wavelength of between about 30 nm and
about 400 nm). As used herein, an "infrared dye" refers to a
molecule having a chromophore that absorbs radiation in the
infrared region of the spectrum (i.e., having a wavelength between
about 700 nm and about 3,000 nm). A "chromophore" is the network of
atoms of the dye that, when exposed to radiation, emits radiation
at a level that is detectable visually or via conventional
spectroscopic means. One of skill in the art will readily
appreciate that although a dye absorbs radiation in one region of
the spectrum, it may emit radiation in another region of the
spectrum. For example, an ultraviolet dye may emit radiation in the
visible region of the spectrum. One of skill in the art will also
readily appreciate that a dye can transmit radiation or can emit
radiation via fluorescence or phosphorescence.
[0014] The phrase "pharmaceutically acceptable salt(s)," as used
herein includes but is not limited to salts of acidic or basic
groups that may be present in test compounds identified using the
methods of the present invention. Test compounds that are basic in
nature are capable of forming a wide variety of salts with various
inorganic and organic acids. The acids that can be used to prepare
pharmaceutically acceptable acid addition salts of such basic
compounds are those that form non-toxic acid addition salts, i.e.,
salts containing pharmacologically acceptable anions, including but
not limited to sulfuric, citric, maleic, acetic, oxalic,
hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate,
bisulfate, phosphate, acid phosphate, isonicotinate, acetate,
lactate, salicylate, citrate, acid citrate, tartrate, oleate,
tannate, pantothenate, bitartrate, ascorbate, succinate, maleate,
gentisinate, fumarate, gluconate, glucaronate, saccharate, formate,
benzoate, glutamate, methanesulfonate, ethanesulfonate,
benzenesulfonate, p-toluenesulfonate and pamoate (i.e.,
1,1'-methylene-bis-(2-hydroxy-3-nap- hthoate)) salts. Test
compounds that include an amino moiety may form pharmaceutically or
cosmetically acceptable s :ts with various amino acids, in addition
to the acids mentioned above. Test compounds that are acidic in
nature are capable of forming base salts with various
pharmacologically or cosmetically acceptable cations. Examples of
such salts include alkali metal or alkaline earth metal salts and,
particularly, calcium, magnesium, sodium lithium, zinc, potassium,
and iron salts.
[0015] By "substantially one type of test compound," as used
herein, is meant that the assay can be performed in such a fashion
that at some point, only one compound need be used in each reaction
so that, if the result is indicative of a binding event occurring
between the target RNA molecule and the test compound, the test
compound can be easily identified.
4. DESCRIPTION OF DRAWINGS
[0016] FIG. 1. Gel retardation analysis to detect peptide-RNA
interactions. In 20 .mu.l reactions containing increasing
concentrations of Tat.sub.47-58 peptide (0.1 .mu.M, 0.2 .mu.M, 0.4
.mu.M, 0.8 .mu.M, 1.6 .mu.M) 50 pmole TAR RNA oligonucleotide was
added in TK buffer. The reaction mixture was then heated at
90.degree. C. for 2 min and allowed to cool slowly to 24.degree. C.
10 ml of 30% glycerol was added to each sample and applied to a 12%
non-denaturing polyacrylamide gel. The gel was electrophoresed
using 1200 volt-hours at 4.degree. C. in TBE Buffer. Following
electrophoresis, the gel was dried and the radioactivity was
quantitated with a phosphorimager. The concentration of peptide
added is indicated above each lane.
[0017] FIG. 2. Gentamicin interacts with an oligonucleotide
corresponding to the 16S rRNA. 20 .mu.l reactions containing
increasing concentrations of gentamicin (1 ng/ml, 10 ng/ml, 100
ng/ml, 1 .mu.g/ml, 10 .mu.g/ml, 50 .mu.g/ml, 500 .mu.g/ml) were
added to 50 pmole RNA oligonucleotide in TKM buffer, heated at
90.degree. C. for 2 min and allowed to cool slowly to 24.degree. C.
Then 10 .mu.l of 30% glycerol was added to each sample and the
samples were applied to a 13.5% non-denaturing polyacrylamide gel.
The gel was electrophoresed using 1200 volt-hours at 4.degree. C.
in TBE Buffer Following electrophoresis, the gel was dried and the
radioactivity was quantitated using a phosphorimager. The
concentration of gentamicin added is indicated above each lane.
[0018] FIG. 3. The presence of 10 pg/ml gentamicin produces a gel
mobility shift in the presence of the 16S rRNA oligonucleotide. 20
.mu.l reactions containing 30 increasing concentrations of
gentamicin (100 ng/ml, 10 ng/ml, 1 ng/ml, 100 pg/ml, and 10 pg/ml)
were added to 50 pmole RNA oligonucleotide in TKM buffer were
treated as described for FIG. 2.
[0019] FIG. 4. Gentamicin binding to the 16S rRNA oligonucleotide
is weak in the absence of MgCl.sub.2. Reaction mixtures containing
gentamicin (1 mg/ml, 100 .mu.g/ml, 10 .mu.g/ml, 1 .mu.g/ml, 0.1
.mu.g/ml, and 10 ng/ml) were treated as described in FIG. 2 except
that the TKM buffer does not contain MgCl.sub.2.
[0020] FIG. 5. Gel retardation analysis to detect peptide-RNA
interactions. In reactions containing increasing concentrations of
Tat.sub.47-58 peptide (0.1 .mu.M, 0.2 .mu.M, 0.4 .mu.M, 0.8 .mu.M,
1.6 .mu.M) 50 pmole TAR RNA oligonucleotide was added in TK buffer.
The reaction mixture was then heated at 90.degree. C. for 2 min and
allowed to cool slowly to 24.degree. C. The reactions were loaded
onto a SCE9610 automated capillary electrophoresis apparatus
(SpectruMedix; State College, Pa.). The peaks correspond to the
amount of free TAR RNA ("TAR") or the Tat-TAR complex ("Tat-TAR").
The concentration of peptide added is indicated below each
lane.
5. DETAILED DESCRIPTION OF THE INVENTION
[0021] The present invention relates to methods for identifying
compounds that bind to preselected target elements of nucleic
acids, in particular, RNAs, including but not limited to
preselected target RNA sequencing structural motifs, or structural
elements. Methods are described in which a preselected target RNA
having a detectable label is used to screen a library of test
compounds. Any complexes formed between the target RNA and a member
of the library are identified using physical methods that detect
the altered physical property of the target RNA bound to a test
compound. Changes in the physical property of the RNA-test compound
complex relative to the target RNA or test compound can be measured
by methods such as, but not limited to, methods that detect a
change in mobility due to a change in mass, change in charge, or a
change in thermostability. Such methods include, but are not
limited to, electrophoresis, fluorescence spectroscopy, surface
plasmon resonance, mass spectrometry, scintillation, proximity
assay, structure-activity relationships ("SAR") by NMR
spectroscopy, size exclusion chromatography, affinity
chromatography, and nanoparticle aggregation. In particular, the
present invention relates to methods for using a target RNA having
a detectable label to screen a library of test compounds free in
solution, in labeled tubes or microtiter plate, or in a microarray.
Compounds in the library that bind to the labeled target RNA will
form a detectably labeled complex. The detectably labeled complex
can then be identified and removed from the unlabeled, uncomplexed
test compounds in the library by a variety of methods capable of
differentiating changes in the physical properties of the complexed
target RNA. The structure of the test compound attached to the
labeled RNA is also determined. The methods used will depend, in
part, on the nature of the library screened. For example, assays or
microarrays of test compounds, each having an address or
identifier, may be deconvoluted, e.g., by cross-referencing the
positive sample to an original compound list that was applied to
the individual test assays. Another method for identifying test
compounds includes de novo structure determination of the test
compounds using mass spectrometry or nuclear magnetic resonance
("NMR").
[0022] Thus, the methods of the present invention provide a simple,
sensitive assay for high-throughput screening of libraries of test
compounds, in which the test compounds of the library that
specifically bind a preselected target nucleic acid are easily
distinguished from non-binding members of the library. The
structures of the binding molecules are deciphered from the input
library by methods depending on the type of library that is used.
The test compounds so identified are useful for any purpose to
which a binding reaction may be put, for example in assay methods,
diagnostic procedures, cell sorting, as inhibitors of target
molecule function, as probes, as sequestering agents and lead
compounds for development of therapeutics, and the like. Small
organic compounds that are identified to interact specifically with
the target RNA molecules are particularly attractive candidates as
lead compounds for the development of therapeutic agents.
[0023] The assay of the invention reduces bias introduced by
competitive binding assays which require the identification and use
of a host cell factor (presumably essential for modulating RNA
function) as a binding partner for the target RNA. The assays of
the present invention are designed to detect any compound or agent
that binds to the target RNA, preferably under physiologic
conditions. Such agents can then be tested for biological activity,
without establishing or guessing which host cell factor or factors
is required for modulating the function and/or activity of the
target RNA.
[0024] Section 5.1 describes examples of protein-RNA interactions
that are important in a variety of cellular functions and several
target RNA elements that can be used to identify test compounds.
Compounds that inhibit these interactions by binding to the RNA and
successfully competing with the natural protein or host cell factor
that endogenously binds to the RNA may be important, e.g., in
treating or preventing a disease or abnormal condition, such as an
infection or unchecked growth. Section 5.2 describes detectable
labels for target nucleic acids that are useful in the methods of
the invention. Section 5.3 describes libraries of test compounds.
Section 5.4 provides conditions for binding a labeled target RNA to
a test compound of a library and detecting RNA binding to a test
compound using the methods of the invention. Section 5.5 provides
methods for separating complexes of target RNAs bound to a test
compound from an unbound RNA. Section 5.6 describes methods for
identifying test compounds that are bound to the target RNA.
Section 5.7 describes a secondary, biological screen of test
compounds identified by the methods of the invention to test the
effect of the test compounds in vivo. Section 5.8 describes the use
of test compounds identified by the methods of the invention for
treating or preventing a disease or abnormal condition in
mammals.
5.1. Biologically Important RNA-Host Cell Factor Interactions
[0025] Nucleic acids, and in particular RNAs, are capable of
folding into complex tertiary structures that include bulges,
loops, triple helices and pseudoknots, which can provide binding
sites for host cell factors, such as proteins and other RNAs.
RNA-protein and RNA-RNA interactions are important in a variety
cellular functions, including transcription, RNA splicing, RNA
stability and translation. Furthermore, the binding of such host
cell factors to RNAs may alter the stability and translational
efficiency of such RNAs, and according affect subsequent
translation. For example, some diseases are associated with protein
overproduction or.decreased protein function. In this case, the
identification of compounds to modulate RNA stability and
translational efficiency will be useful to treat and prevent such
diseases.
[0026] The methods of the present invention are useful for
identifying test compounds that bind to target RNA elements in a
high throughput screening assay of libraries of test compounds in
solution. In particular, the methods of the present invention are
useful for identifying a test compound that binds to a target RNA
elements and inhibits the interaction of that RNA with one or more
host cell factors in vivo. The molecules identified using the
methods of the invention are useful for inhibiting the formation of
a specific bound RNA:host cell factor complexes in vivo.
[0027] In some embodiments, test compounds identified by the
methods of the invention are useful for increasing or decreasing
the translation of messenger RNAs ("mRNAs"), e.g., protein
production, by binding to one or more regulatory elements in the 5'
untranslated region, the 3' untranslated region, or the coding
region of the mRNA. Compounds that bind to mRNA can, inter alia,
increase or decrease the rate of mRNA processing, alter its
transport through the cell, prevent or enhance binding of the mRNA
to ribosomes, suppressor proteins or enhancer proteins, or alter
mRNA stability. Accordingly, compounds that increase or decrease
mRNA translation can be used to treat or prever disease. For
example, diseases associated with protein overproduction, such as
amyloidosis, or with the production of mutant proteins, such as
Ras, can be treated or prevented by decreasing translation of the
mRNA that codes for the overproduced protein, thus inhibiting
production of the protein. Conversely, the symptoms of diseases
associated with decreased protein function, such as hemophelia, may
be treated by increasing translation of mRNA coding for the protein
whose function is decreased, e.g., factor IX in some forms of
hemophilia.
[0028] The methods of the invention can be used to identify
compounds that bind to mRNAs coding for a variety of proteins with
which the progression of diseases in mammals is associated. These
mRNAs include, but are not limited to, those coding for amyloid
protein and amyloid precursor protein; anti-angiogenic proteins
such as angiostatin, endostatin, METH-1 and METH-2; apoptosis
inhibitor proteins such as survivin, clotting factors such as
Factor IX, Factor VIII, and others in the clotting cascade;
collagens; cyclins and cyclin inhibitors, such as cyclin dependent
kinases, cyclin D1, cyclin E, WAF1, cdk4 inhibitor, and MTS1;
cystic fibrosis transmembrane conductance regulator gene (CFTR);
cytokines such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17 and
other interleukins; hematopoetic growth factors such as
erythropoietin (Epo); colony stimulating factors such as G-CSF,
GM-CSF, M-CSF, SCF and thrombopoietin; growth factors such as BNDF,
BMP, GGRP, EGF, FGF, GDNF, GGF, HGF, IGF-1, IGF-2, KGF, myotrophin,
NGF, OSM, PDGF, somatotrophin, TGF-.beta., TGF-.alpha. anc VEGF;
antiviral cytokines such as interferons, antiviral proteins induced
by interferons, TNF-.alpha., and TNF-.beta.; enzymes such as
cathepsin K, cytochrome P-450 and other cytochromes, farnesyl
transferase, glutathione-S transferases, heparanase, HMG CoA
synthctase, N-acetyltransferase, phenylalanine hydroxylase,
phosphodiesterase, ras carboxyl-terminal protease, telomerase and
TNF converting enzyme; glycoproteins such as cadherins, e.g.,
N-cadherin and E-cadherin; cell adhesion molecules; selectins;
transmembrane glycoproteins such as CD40; heat shock proteins;
hormones such as 5-.alpha. reductase, atrial natriuretic factor,
calcitonin, corticotrophin releasing factor, diuretic hormones,
glucagon, gonadotropin, gonadotropin releasing hormone, growth
hormone, growth hormone releasing factor, somatotropin, insulin,
leptin, luteinizing hormone, luteinizing hormone releasing hormone,
parathyroid hormone, thyroid hormone, and thyroid stimulating
hormone; proteins involved in immune responses, including
antibodies, CTLA4, hemagglutinin, MHC proteins, VLA-4, and
kallikrein-kininogen-kinin system; ligands such as CD4; oncogene
products such as sis, hst, protein tyrosine kinase receptors, ras,
abl, mos, myc, fos, jun, H-ras, ki-ras, c-fms, bcl-2, L-myc, c-myc,
gip, gsp, and HER-2; receptors such as bombesin receptor, estrogen
receptor, GABA receptors, growth factor receptors including EGFR,
PDGFR, FGFR, and NGFR, GTP-binding regulatory proteins, interleukin
receptors, ion channel receptors, leukotriene receptor antagonists,
lipoprotein receptors, opioid pain receptors, substance P
receptors, retinoic acid and retinoid receptors, steroid receptors,
T-cell receptors, thyroid hormone receptors, TNF receptors; tissue
plasminogen activator; transmembrane receptors; transmembrane
transporting systems, such as calcium pump, proton pump, Na/Ca
exchanger, MRP1, MRP2, P170, LRP, and cMOAT; transferrin; and tumor
suppressor gene products such as APC, brca1, brca2, DCC, MCC, MTS1,
NF1, NF2, nm23, p53 and Rb. In addition to the eukaryotic genes
listed above, the invention, as described, can be used to define
molecules that interrupt viral, bacterial or fungal transcription
or translation efficiencies and therefore form the basis for a
novel anti-infectious disease therapeutic. Other target genes
include, but are not limited to, those disclosed in Section 5.1 and
Section 6.
[0029] The methods of the invention can be used to identify
mRNA-binding test compounds for increasing or decreasing the
production of a protein, thus treating or preventing a disease
associated with decreasing or increasing the production of said
protein, respectively. The methods of the invention may be useful
for identifying test compounds for treating or preventing a disease
in mammals, including cats, dogs, swine, horses, goats, sheep,
cattle, primates and humans. Such diseases include, but are not
limited to, amyloidosis, hemophilia, Alzheimer's disease,
atherosclerosis, cancer, giantism, dwarfism, hypothyroidism,
hyperthyroidism, inflammation, cystic fibrosis, autoimmune
disorders, diabetes, aging, obesity, neurodegenerative disorders,
and Parkinson's disease. Other diseases include, but are not
limited to, those described in Section 5.1 and diseases caused by
aberrant expression of the genes disclosed in Example 6. In
addition to the eukaryotic genes listed above, the invention, as
described, can be used to define molecules that interrupt viral,
bacterial or fungal transcription or translation efficiencies and
therefore form the basis for a novel anti-infectious disease
therapeutic.
[0030] In other embodiments, test compounds identified by the
methods of the invention are useful for preventing the interaction
of an RNA, such as a transfer RNA ("tRNA"), an enzymatic RNA or a
ribosomal RNA ("rRNA"), with a protein or with another RNA, thus
preventing, e.g., assembly of an in vivo protein-RNA or RNA-RNA
complex that is essential for the viability of a cell. The term
"enzymatic RNA," as used herein, refers to RNA molecules that are
either self-splicing, or that form an enzyme by virtue of their
association with one or more proteins, e.g., as in RNase P,
telomerase or small nuclear ribonuclear protein particles. For
example, inhibition of an interaction between rRNA and one or more
ribosomal proteins may inhibit the assembly of ribosomes, rendering
a cell incapable of synthesizing proteins. In addition, inhibition
of the interaction of precursor rRNA with ribonucleases or
ribonucleoprotein complexes (such as RNase P) that process the
precursor rRNA prevent maturation of the rRNA and its assembly into
ribosomes. Similarly, a tRNA:tRNA synthetase complex may be
inhibited by test compounds identified by the methods of the
invention such that tRNA molecules do not become charged with amino
acids. Such interactions include, but are not limited to, rRNA
interactions with ribosomal proteins, tRNA interactions with tRNA
synthetase, RNase P protein interactions with RNase P RNA, and
telomerase protein interactions with telomerase RNA.
[0031] In other embodiments, test compounds identified by the
methods of the invention are useful for treating or preventing a
viral, bacterial, protozoan or fungal infection. For example,
transcriptional up-regulation of the genes of human
immunodeficiency virus type 1 ("HIV-1") requires binding of the HIV
Tat protein to the HIV trans-activation response region RNA ("TAR
RNA"). HIV TAR RNA is a 59-base stem-loop structure located at the
5'-end of all nascent HIV-1 transcripts (Jones & Peterlin,
1994, Annu. Rev. Biochem. 63:717-43). Tat protein is known to
interact with uracil 23 in the bulge region of the stem of TAR RNA.
Thus, TAR RNA is a potential binding target for test compounds,
such as small peptides and peptide analogs that bind to the bulge
region of TAR RNA and inhibit formation of a Tat-TAR RNA complex
involved in HIV-1 upregulation (see Hwang et al.,1999 Proc. Natl.
Acad. Sci. USA 96:12997-13002). Accordingly, test compounds that
bind to TAR RNA are useful as anti-HIV therapeutics (Hamy et al.,
1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Hamy et al., 1998,
Biochemistry 37:5086-5095; Mei et al., 1998, Biochemistry
37:14204-14212), and therefore, are useful for treating or
preventing AIDS.
[0032] The methods of the invention can be used to identify test
compounds to treat or prevent viral, bacterial, protozoan or fungal
infections in a patient. In some embodiments, the methods of the
invention are useful for identifying compounds that decrease
translation of microbial genes by interacting with mRNA, as
described above, or for identifying compounds that inhibit the
interactions of microbial RNAs with proteins or other ligands that
are essential for viability of the virus or microbe. Examples of
microbial target RNAs useful in the present invention for
identifying antiviral, antibacterial, anti-protozoan and
anti-fungal compounds include, but are not limited to, general
antiviral and anti-inflammatory targets such as mRNAs of
INF.alpha., INF.gamma., RNAse L, RNAse L inhibitor protein, PKR,
tumor necrosis factor, interleukins 1-15, and IMP dehydrogenase;
internal ribosome entry sites; HIV-1 CT rich domain and RNase H
MRNA; HCV internal ribosome entry site (required to direct
translation of HCV mRNA), and the 3'-untranslated tail of HCV
genomes; rotavirus NSP3 binding site, which binds the protein NSP3
that is required for rotavirus mRNA translation; HBV epsilon
domain; Dengue virus 5' and 3' untranslated regions, including
IRES; INF.alpha., INF.beta. and INF.gamma.; plasmodium falciparum
mRNAs; the 16S ribosomal subunit ribosomal RNA and the RNA
component of RNase P of bacteria; and the RNA component of
telomerase in fungi and cancer cells. Other target viral and
bacterial mRNAs include, but are not limited to, those disclosed in
Section 6.
[0033] One of skill in the art will appreciate that, although such
target RNAs are functionally conserved in various species (e.g.,
from yeast to humans), they exhibit nucleotide sequence and
structural diversity. Therefore, inhibition of, for example, yeast
telomerase by an anti-fungal compound identified by the methods of
the invention might not interfere with human telomerase and normal
human cell proliferation.
[0034] Thus, the methods of the invention can be used to identify
test compounds that interfere with one or more target RNA
interactions with host cell factors that are important for cell
growth or viability, or essential in the life cycle of a virus, a
bacterium, a protozoa or a fungus. Such test compounds and/or
congeners that demonstrate desirable biologic and pharmacologic
activity can be administered to a patient in need thereof in order
to treat or prevent a disease caused by viral, bacterial,
protozoan, or fungal infections. Such diseases include, but are not
limited to, HIV infection, AIDS, human T-cell leukemia, SIV
infection, FIV infection, fel.ne leukemia, hepatitis A, hepatitis
B, hepatitis C, Dengue fever, malaria, rotavirus infection, severe
acute gastroenteritis, diarrhea, encephalitis, hemorrhagic fever,
syphilis, legionella, whooping cough, gonorrhea, sepsis, influenza,
pneumonia, tinea infection, candida infection, and meningitis.
[0035] Non-limiting examples of RNA elements involved in the
regulation of gene expression, i.e., mRNA stability, translational
efficiency via translational initiation and ribosome assembly,
etc., include the HIV TAR element, internal ribosome entry site,
"slippery site", instability elements, and adenylate uridylate-rich
elements, as discussed below.
5.1.1. HIV TAR Element
[0036] Transcriptional up-regulation of the genes of human
immunodeficiency virus type 1 ("HIV-1") requires binding of the HIV
Tat protein to the HIV trans-activation response region RNA ("TAR
RNA"), a 59-base stem-loop structure located at the 5' end of all
nascent HIV-1 transcripts (Jones & Peterlin, 1994, Annu. Rev.
Biochem. 63:717-43). Tat protein is known to interact with uracil
23 in the bulge region of the stem of TAR RNA. Thus, TAR RNA is a
useful binding target for test compounds, such as small peptides
and peptide analogs that bind to the bulge region of TAR RNA and
inhibit formation of a Tat-TAR RNA complex involved in HIV-1
up-regulation (see Hwang et al., 1999 Proc. Natl. Acad. Sci. USA
96:12997-13002). Accordingly, test compounds that bind to TAR RNA
can be useful as anti-HIV therapeutics (Harny et al., 1997, Proc.
Natl. Acad. Sci. USA 94:3548-3553; Hamy et al., 1998, Biochemistry
37:5086-5095; Mei et al., 1998, Biochemistry 37:14204-14212), and
therefore, are useful for treating or preventing AIDS.
5.1.2. Internal Ribosome Entry Site ("IRES")
[0037] Internal ribosome entry sites ("IRES") are found in the 5'
untranslated regions ("5' UTR") of several mRNAs, and are thought
to be involved in the regulation of translational efficiency. When
the IRES element is present on an mRNA downstream of a
translational stop codon, it directs ribosomal re-entry (Ghattas et
al., 1991, Mol. Cell. Biol. 11:5848-5959), which permits initiation
of translation at the start of a second open reading frame.
[0038] As reviewed by Jang et al., a large segment of the 5'
nontranslated region, approximately 400 nucleotides in length,
promotes internal entry of ribosomes independent of the non-capped
5' end of picornavirus mRNAs (mammalian plus-strand RNA viruses
whose genomes serve as mRNA). This 400 nucleotide segment (IRES),
maps approximately 200 nt down-stream from the 5' end and is highly
structured. IRES elements of different picornaviruses, although
functionally similar in vitro and in vivo, are not identical in
sequence or structure. However, IRES elements of the genera entero-
and rhinoviruses, on the one hand, and cardio- and aphthoviruses,
on the other hand, reveal similarities corresponding to
phylogenetic kinship. All IRES elements contain a conserved
Yn-Xm-AUG unit (Y, pyrimidine; X, nucleotide) which appears
essential for IRES function. The IRES elements of cardio-, entero-
and aphthoviruses bind a cellular protein, p57. In the case of
cardioviruses, the interaction between a specific stem-loop of the
IREs is essential for translation in vitro. The IRES elements of
entero- and cardioviruses also bind the cellular protein, p52, but
the significance of this interaction remains to be shown. The
function of p57 or p52 in cellular metabolism is unknown. Since
picomaviral IRES elements function in vivo in the absence of any
viral gene products, is speculated that IRES-like elements may also
occur in specific cellular mRNAs releasing them from cap-dependent
translation (Jang et al., 1990, Enzyme 44(1-4):292-309).
5.1.3. "Slippery Site"
[0039] Programmed, or directed, ribosomal frameshifting, when
ribosomes shift from one translation reading frame to another and
synthesize two viral proteins from a single viral mRNA, is directed
by a unique site in viral mRNAs called the "slippery site." The
slippery site directs ribosomal frameshifting in the -1 or +1
direction that causes the ribosome to slip by one base in the 5'
direction thereby placing the ribosome in the new reading frame to
produce a new protein.
[0040] Programmed, or directed, ribosomal frameshifting is of
particular value to viruses that package their plus strands, as it
eliminates the need to splice their mRNAs and reduces the risk of
packaging defective genomes and regulates the ratio of viral
proteins synthesized. Examples of programmed translational
frameshifting (both +1 and -1 shifts) have been identified in ScV
systems (Lopinski et al., 2000, Mol. Cell. Biol. 20(4):1095-103,
retroviruses (Falk et al., 1993, J. Virol. 67:273-6277; Jacks &
Varmus, 1985, Science 230:1237-1242; Morikawa & Bishop, 1992,
Virology 186:389-397; Nam et al., 1993, J. Virol. 67:196-203);
coronaviruses (Brierley et al., 1987, EMBO J. 6:3779-3785; Herold
& Siddell, 1993, Nucleic Acids Res. 21:5838-5842);
giardiaviruses, which are also members of the Totiviridae (Wang et
al., 1993, Proc. Natl. Acad. Sci. USA 90:8595-8599); two bacterial
genes (Blinkowa & Walker, 1990, Nucleic Acids Res., 18:
i725-1729; Craigen & Caskey, 1986, Nature 322:273);
bacteriophage genes (Condron et al., 1991, Nucleic Acids Res.
19:5607-5612); astroviruses (Marczinke et al., 1994, J. Virol.
68:5588-5595); the yeast EST3 gene (Lundblad & Morris, 1997,
Curr. Biol. 7:969-976); and the rat, mouse, Xenopus, and Drosophila
ornithine decarboxylase antizymes (Matsufuji et al., 1995, Cell
80:51-60); and a significant number of cellular genes (Herold &
Siddell, 1993, Nucleic Acids Res. 21:5838-5842).
[0041] Drugs targeted to ribosomal frameshifting minimize the
problem of virus drug resistance because this strategy targets a
host cellular process rather than one introduced into the cell by
the virus, which minimizes the ability of viruses to evolve
drug-resistant mutants. Compounds that target the RNA elements
involved in regulating programmed frameshifting should have several
advantages, including (a) any selective pressure on the host
cellular translational machinery to adapt to the drugs would have
to occur at the host evolutionary time scale, which is on the order
of millions of years, (b) ribosomal frameshifting is not used to
express any host proteins, and (c) altering viral frameshifting
efficiencies by modulating the activity of a host protein
minimizing the likelihood that the virus will acquire resistance to
such inhibition by mutations in its own genome.
5.1.4. Instability Elements
[0042] "Instability elements" may be defined as specific sequence
elements that promote the recognition of unstable mRNAs by cellular
turnover machinery. Instability elements have been found within
mRNA protein coding regions as well as untranslated regions.
[0043] Altering the control of stability of normal mRNAs may lead
to disease. The alteration of mRNA stability has been implicated in
diseases such as, but not limited to, cancer, immune disorders,
heart disease, and fibrotic disorders.
[0044] There are several examples of mutations that delete
instability elements which then result in stabilization of mRNAs
that may be involved in the onset of cancer. In Burkitt's lymphoma,
a portion of the c-myc proto-oncogene is translocated to an Ig
locus, producing a form of the c-myc mRNA that is five times more
stable (see, e.g., Kapstein et al., 1996, J. Biol. Chem.
271(31):18875-84). The highly oncogenic v-fos mRNA lacks the 3' UTR
adenylate uridylate rich element ("ARE") that is found in the more
labile and weakly oncogenic c-fos mRNA (see, e.g., Schiavi et al.,
1992, Biochim Biophys Acta. 1114(2-3):95-106). Differences between
the benign cervical lesions brought about by nonintegrated circular
human papillomavirus type 16 and its integrated form, that lacks
the 3' UTR ARE and correlates with cervical carcinomas, may be a
consequence of stabilizing the E6/E7 transcripts encoding oncogenic
proteins. Integration of the virus results in deletion of the ARE
instability element, resulting in stabilizion of the transcripts
and over-expression of the proteins (see, e.g., Jeon & Lambert,
1995, Proc. Natl. Acad. Sci. USA 92(5):1654-8). Deletion of AREs
from the 3' UTR of the IL-2 and IL-3 genes promotes increased
stabilization of these mRNAs, high expression of these proteins,
and leads to the formation of cancerous cells (see, e.g., Stoecklin
et al., 2000, Mol. Cell. Biol. 20(11):3753-63).
[0045] Mutations in trans-acting factors involved in mRNA turnover
may also promote cancer. In monocytic tumors, the lymphokine GM-CSF
mRNA is specifically stabilized as a consequence of an oncogenic
lesion in a trans-acting factor that controls mRNA turnover rates.
Furthermore, the normally unstable IL-3 transcript is
inappropriately long-lived in mast tumor cells. Similarly, the
labile GM-CSF mRNA is greatly stabilized in bladder carcinoma
cells. See, e.g., Bickel et al., 1990, J. Immunol.
145(3):840-5.
[0046] The immune system is regulated by a large number of
regulatory molecules that either activate or inhibit the immune
response. It has now been clearly demonstrated that stability of
the transcripts encoding these proteins are highly regulated.
Altered regulation of these molecules leads to mis-regulation of
this process and can result in drastic medical consequences. For
example, recent results using transgenic mice have shown that
mis-regulation of the stability of the important modulator
TNF.alpha. mRNA leads to diseases such as, but not limited to,
rheumatoid arthritis and a Crohn's-like liver disease. See, e.g.,
Clark, 2000, Arthritis Res. 2(3):172-4.
[0047] Smooth muscle in the heart is modulated by the
.beta.-adrenergic receptor, which in turn responds to the
sympathetic neurotransmitter norepinephrine and the adrenal hormone
epinephrine. Chronic heart failure is characterized by impairment
of smooth muscle cells, which results, in part, from the more rapid
decay of the .beta.-adrenergic receptor mRNA. See, e.g., Ellis
& Frielle, 1999, Biochem. Biophys. Res. Commun.
258(3):552-8.
[0048] A large number of diseases result from over-expression of
collagen. For example, cirrhosis results from damage to the liver
as a consequence of carcer, viral infection, or alcohol abuse. Such
damage causes mis-regulation of collagen expression, leading to the
formation of large collagen deposits. Recent results indicate that
the sizeable increase in collagen expression is largely
attributable to stabilization of its mRNA. See, e.g., Lindquist et
al., 2000, Am. J. Physiol. Gastrointest. Liver Physiol.
279(3):G471-6.
5.1.5. Adenylate Uridylate-Rich Elements ("ARE")
[0049] Adenylate uridylate-rich elements ("ARE") are found in the
3' untranslated regions ("3' UTR") of several mRNAs, and involved
in the turnover of mrRNAs, such as but not limited to transcription
factors, cytokines, and lymphokines. AREs may function both as
stabilizing and destabilizing elements. ARE mRNAs are classified
into five groups, depending on sequence (Bakheet et al., 2001,
Nucl. Acids Res. 29(1):246-254). An ongoing database at the web
site http://rc.kfshrc.edu.sa/ared contains ARE-containing mRNAs and
their cluster groups, which is incorporated by reference in its
entirety. The ARE motifs are classified as follows:
1 Group I Cluster (AUUUAUUUAUUUAUUUAUUUA) SEQ ID NO: 1 Group II
Cluster (AUUUAUUUAUUUAUUUA) stretch SEQ ID NO: 2 Group III Cluster
(WAUUUAUUUAUUUAW) stretch SEQ ID NO: 3 Group IV Cluster
(WWAUUUAUUUAWW) stretch SEQ ID NO: 4 Group V Cluster
(WWWWAUUUAWWWW) stretch SEQ ID NO: 5
[0050] The ARE-mRNAs were clustered into five groups containing
five, four, three and two pentameric repeats, while the last group
contains only one pentamer within the 13-bp ARE pattern. Functional
categories were assigned whenever possible according to NCBI-COG
functional annotation (Tatusov et al., 2001, Nucleic Acids
Research, 29(1): 22-28), in addition to the categories:
inflammation, immune response, development/differentiation, using
an extensive literature search.
[0051] Group I contains many secreted proteins including GM-CSF,
IL-1, IL-11, IL-12 and Gro-.beta. that affect the growth of
hematopoietic and immune cells (Witsell & Schook, 1992, Proc.
Natl Acad. Sci. USA, 89:4754-4758). Although TNF.alpha. is both a
pro-inflammatory and anti-tumor protein, there is experimental
evidence that it can act as a growth factor in certain leukemias
and lymphomas (Liu et al., 2000, J. Biol. Chem.
275:21086-21093).
[0052] Unlike Group I, Groups II-V contain functionally diverse
gene families comprising immune response, cell cycle and
proliferation, inflammation and coagulation, angiogenesis,
metabolism, energy, DNA binding and transcription, nutrient
transportation and ionic homeostasis, protein synthesis, cellular
biogenesis, signal transduction, and apoptosis (Bakheet et al.,
2001, Nucl. Acids Res. 29(1):246-254).
[0053] Several groups have described ARE-binding proteins that
influence the ARE-mRNA stability. Among the well-characterized
proteins are the mammalian homologs of ELAV (embryonic lethal
abnormal vision) proteins including AUF1, HuR and He1-N2 (Zhang et
al., 1993, Mol. Cell. Biol. 13:7652-7665; Levine et al., 1993, Mol.
Cell. Biol. 13:3494-3504: Ma et al., 1996, J. Biol. Chem. 271
:8144-8151). The zinc-finger protein tristetraprolin has been
identified as another ARE-binding protein with destabilizing
activity on TNF-.alpha., IL-3 and GM-CSF mRNAs (Stoecklin et al.,
2000, Mol. Cell. Biol. 20:3753-3763; Carballo et al., 2000, Blood
95:1891-1899).
[0054] Since ARE-containing genes are clearly important in
biological systems, including but not limited to a number of the
early response genes that regulate cell proliferation and responses
to exogenous agents, the identification of compounds that bind to
one or more of the ARE clusters and potentially modulate the
stability of the target RNA can potentially be of value as a
therapeutic.
5.2. Detectably Labeled Target RNAs
[0055] Target nucleic acids, including but not limited to RNA and
DNA, useful in the methods of the present invention have a label
that is detectable via conventional spectroscopic means or
radiographic means. Preferably, target nucleic acids are labeled
with a covalently attached dye molecule. Useful dye-molecule labels
include, but are not limited to, fluorescent dyes, phosphorescent
dyes, ultraviolet dyes, infrared dyes, and visible dyes.
Preferably, the dye is a visible dye.
[0056] Useful labels in the present invention can include, but are
not limited to, spectroscopic labels such as fluorescent dyes
(e.g., fluorescein and derivatives such as fluorescein
isothiocyanate (FITC) and Oregon Green.TM., rhodamine and
derivatives (e.g., Texas red, tetramethylrhodimine isothiocynate
(TRITC), bora-3a,4a-diaza-s-indacene (BODIPY.RTM.) and derivatives,
etc.), digoxigenin, biotin, phycoerythrin, AMCA, CyDye.TM., and the
like), radiolabels (e.g., .sup.3H, .sup.125I, .sup.35S, .sup.14C,
.sup.32P,.sup.33P, etc.), enzymes (e.g., horse radish peroxidase,
alkaline phosphatase etc.), spectroscopic calorimetric labels such
as colloidal gold or colored glass or plastic (e.g. polystyrene,
polypropylene, latex, etc.) beads, or nanoparticles--nanoclusters
of inorganic ions with defined dimension from 0.1 to 1000 nm.
Useful affinity tags and complimentary partners include, but are
not limited to, biotin-streptavidin, complimentary nucleic acid
fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo dG-oligo
dC, oligo G-oligo C), aptamer-streptavidin, or haptens and proteins
for which antisera or monoclonal antibodies are available. The
label may be coupled directly or indirectly to a component of the
detection assay (e.g., the detection reagent) according to methods
well known in the art. A wide variety of labels may be used, with
the choice of label depending on sensitivity required, ease of
conjugation with the compound, stability requirements, available
instrumentation, and disposal provisions.
[0057] In one embodiment, nucleic acids that are labeled at one or
more specific locations are chemically synthesized using
phosphoramidite or other solution or solid-phase methods. Detailed
descriptions of the chemistry used to form polynucleotides by the
phosphoramidite method are well known (see, e.g., Caruthers et al.,
U.S. Pat. Nos. 4,458,066 and 4,415,732; Caruthers et al., 1982,
Genetic Engineering 4:1-17; Users Manual Model 392 and 394
Polynucleotide Synthesizers, 1990, pages 6-1 through 6-22, Applied
Biosystems, Part No. 901237; Ojwang, et al., 1997, Biochemistry,
36:6033-6045). The phosphoramidite method of polynucleotide
synthesis is the preferred method because of its efficient and
rapid coupling and the stability of the starting materials. The
synthesis is performed with the growing polynucleotide chain
attached to a solid support, such that excess reagents, which are
generally in the liquid phase, can be easily removed by washing,
decanting, and/or filtration, thereby eliminating the need for
purification steps between synthesis cycles.
[0058] The following briefly describes illustrative steps of a
typical polynucleotide synthesis cycle using the phosphoramidite
method. First, a solid support to which is attached a protected
nucleoside monomer at its 3' terminus is treated with acid, e.g.,
trichloroacetic acid, to remove the 5'-hydroxyl protecting group,
freeing the hydroxyl group for a subsequent coupling reaction.
After the coupling reaction is completed an activated intermediate
is formed by contacting the support-bound nucleoside with a
protected nucleoside phosphoramidite monomer and a weak acid, e.g.,
tetrazole. The weak acid protonates the nitrogen atom of the
phosphoramidite forming a reactive intermediate. Nucleoside
addition is generally complete within 30 seconds. Next, a capping
step is performed, which terminates any polynucleotide chains that
did not undergo nucleoside addition. Capping is preferably
performed using acetic anhydride and 1-methylimidazole. The
phosphite group of the internucleotide linkage is then converted to
the more stable phosphotriester by oxidation using iodine as the
preferred oxidizing agent and water as the oxygen donor. After
oxidation, the hydroxyl protecting group of the newly added
nucleoside is removed with a protic acid, e.g., trichloroacetic
acid or dichloroacetic acid, and the cycle is repeated one or more
times until chain elongation is complete. After synthesis, the
polynucleotide chain is cleaved from the support using a base,
e.g., ammonium hydroxide or t-butyl amine. The cleavage reaction
also removes any phosphate protecting groups, e.g., cyanoethyl.
Finally, the protecting groups on the exocyclic amines of the bases
and any protecting groups on the dyes are removed by treating the
polynucleotide solution in base at an elevated temperature, e.g.,
at about 55.degree. C. Preferably the various protecting groups are
removed using ammonium hydroxide or t-butyl amine.
[0059] Any of the nucleoside phosphoramidite monomers can be
labeled using standard phosphoramidite chemistry methods (Hwang et
al., 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002; Ojwang et
aL, 1997, Biochemistry. 36:6033-6045 and references cited therein).
Dye molecules useful for covalently coupling to phosphoramidites
preferably comprise a primary hydroxyl group that is not part of
the dye's chromophore. Illustrative dye molecules include, but are
not limited to, disperse dye CAS 4439-31-0, disperse dye CAS
6054-58-6, disperse dye CAS 4392-69-2 (Sigma-Aldrich, St. Louis,
Mo.), disperse red, and 1-pyrenebutanol (Molecular Probes, Eugene,
Oreg.). Other dyes useful for coupling to phosphoramidites will be
apparent to those of skill in the art, such as fluoroscein, cy3,
and cyS fluorescent dyes, and may be purchased from, e.g.,
Sigma-Aldrich, St. Louis, Mo. or Molecular Probes, Inc., Eugene,
Oreg.
[0060] In another embodiment, dye-labeled target RNA molecules are
synthesized enzymatically using in vitro transcription (Hwang et
al., 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002 and
references cited therein). In this embodiment, a template DNA is
denatured by heating to about 90.degree. C. and an oligonucleotide
primer is annealed to the template DNA, for example by slow-cooling
the mixture of the denatured template and the primer from about
90.degree. C. to room temperature. A mixture of
ribonucleoside-5'-triphosphates capable of supporting
template-directed enzymatic extension of the primed template (e.g.,
a mixture including GTP, ATP, CTP, and UTP), including one or more
dye-labeled ribonucleotides (Sigma-Aldrich, St. Louis, Mo.), is
added to the primed template. Next, a polymerase enzyme is added to
the mixture under conditions where the polymerase enzyme is active,
which are well-known to those skilled in the art. A labeled
polynucleotide is formed by the incorporation of the labeled
ribonucleotides during polymerase-mediated strand synthesis.
[0061] In yet another embodiment of the invention, nucleic acid
molecules are end-labeled after their synthesis. Methods for
labeling the 5'-end of an oligonucleotide include but are by no
means limited to: (i) periodate oxidation of a 5'-to-5'-coupled
ribonucleotide, followed by reaction with an arnine-reactive label
(Heller & Morisson, 1985, in Rapid Detection and Identification
ofInfectious Agents, D. T. Kingsbury and S. Falkow, eds., pp.
245-256, Academic Press); (ii) condensation of ethylenediamine with
5'-phosphorylated polynucleotide, followed by reaction with an
amine reactive label (Morrison, European Patent Application 232
967); (iii) introduction of an aliphatic amine substituent using an
aminohexyl phosphite reagent in solid-phase DNA synthesis, followed
by reaction with an amine reactive label (Cardullo et al., 1988,
Proc. Natl. Acad. Sci. USA 85:8790-8794); and (iv) introduction of
a thiophosphate group on the 5'-end of the nucleic acid, using
phosphatase treatment followed by end-labeling with ATP-?S and
kinase, which reacts specifically and efficiently with
maleimide-labeled fluorescent dyes (Czworkowski et al., 1991,
Biochem. 30:4821-4830).
[0062] A detectable label should not be incorporated into a target
nucleic acid at the specific binding site at which test compounds
are likely to bind, since the presence of a covalently attached
label might interfere sterically or chemically with the binding of
the test compounds at this site. Accordingly, if the region of the
target nucleic acid that binds to a host cell factor is known, a
detectable label is preferably incorporated into the nucleic acid
molecule at one or more positions that are spatially or
sequentially remote from the binding region.
[0063] After synthesis, the labeled target nucleic acid can be
purified using standard techniques known to those skilled in the
art (see Hwang et al., 1999, Proc. Natl. Acad. Sci. USA
96(23):12997-13002 and references cited therein). Depending on the
length of the target nucleic acid and the method of its synthesis,
such purification techniques include, but are not limited to,
reverse-phase high-performance liquid chromatography
("reverse-phase HPLC"), fast performance liquid chromatography
("FPLC"), and gel purification. After purification, the target RNA
is refolded into its native conformation, preferably by heating to
approximately 85-95.degree. C. and slowly cooling to room
temperature in a buffer, e.g., a buffer comprising about 50 mM
Tris-HCl, pH 8 and 100 mM NaCl.
[0064] In another embodiment, the target nucleic acid can also be
radiolabeled. A radiolabel, such as, but not limited to, an isotope
of phosphorus, sulfur, or hydrogen, may be incorporated into a
nucleotide, which is added either after or during the synthesis of
the target nucleic acid. Methods for the synthesis and purification
of radiolabeled nucleic acids are well known to one of skill in the
art. See, e.g., Sambrook et al., 1989, in Molecular Cloning: A
Laboratory Manual, pp 10.2-10.70, Cold Spring Harbor Laboratory
Press, and the references cited therein, which are hereby
incorporated by reference in their entireties.
[0065] In another embodiment, the target nucleic acid can be
attached to an inorganic nanoparticle. A nanoparticle is a cluster
of ions with controlled size from 0.1 to 1000 nm comprised of
metals, metal oxides, or semiconductors including, but not limited
to Ag.sub.2S, ZnS, CdS, CdTe, Au, or TiO.sub.2. Nanoparticles have
unique optical, electronic and catalytic properties relative to
bulk materials which can be adjusted according to the size of the
particle. Methods for the attachment of nucleic acids are well know
to one of skill in the art (see, e.g., Niemeyer, 2001, Angew. Chem.
Int. Ed. 40: 4129-4158, International Patent Publication
WO/0218643, and the references cited therein, the disclosures of
which are hereby incorporated by reference in their
entireties).
5.3. Libraries of Small Molecules
[0066] Libraries screened using the methods of the present
invention can comprise a variety of types of test compounds. In
some embodiments, the test compounds are nucleic acid or peptide
molecules. In a non-limiting example, peptide molecules can exist
in a phage display library. In other embodiments, types of test
compounds include, but are not limited to, peptide analogs
including peptides comprising non-naturally occurring amino acids,
e.g., D-amino acids, phosphorous analogs of amino acids, such as
.alpha.-amino phosphoric acids and .alpha.-amino phosphoric acids,
or amino acids having non-peptide linkages, nucleic acid analogs
such as phosphorothioates and PNAs, hormones, antigens, synthetic
or naturally occurring drugs, opiates, dopamine, serotonin,
catecholamines, thrombin, acetylcholine, prostaglandins, organic
molecules, pheromones, adenosine, sucrose, glucose, lactose and
galactose. Libraries of polypeptides or proteins can also be
used.
[0067] In a preferred embodiment, the combinatorial libraries are
small organic molecule libraries, such as, but not limited to,
benzodiazepines, isoprenoids, thiazolidinones, metathiazanones,
pyrrolidines, morpholino compounds, and diazepindiones. In another
embodiment, the combinatorial libraries comprise peptoids; random
bio-oligomers; diversomers such as hydantoins, benzodiazepines and
dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics;
oligocarbamates; peptidyl phosphonates; peptide nucleic acid
libraries; antibody libraries; or carbohydrate libraries.
Combinatorial libraries are themselves commercially available (see,
e.g., Advanced ChemTech Europe Ltd., Cambridgeshire, UK; ASINEX,
Moscow Russia; BioFocus plc, Sittingbourne, UK; Bionet Research (A
division of Key Organics Limited), Camelford, UK; ChemBridge
Corporation, San Diego, Calif.; ChemDiv Inc, San Diego, Calif.;
ChemRx Advanced Technologies, South San Francisco, Calif.; ComGenex
Inc., Budapest, Hungary; Evotec OAI Ltd, Abingdon, UK; IF LAB Ltd.,
Kiev, Ukraine; Maybridge plc, Cornwall, UK; PharmaCore, Inc., North
Carolina; SIDDCO Inc, Tucson, Ariz.; TimTec Inc, Newark, Delaware;
Tripos Receptor Research Ltd, Bude, UK; Toslab, Ekaterinburg,
Russia).
[0068] In one embodiment, the combinatorial compound library for
the methods of the present invention may be synthesized. There is a
great interest in synthetic methods directed toward the creation of
large collections of small organic compounds, or libraries, which
could be screened for pharmacological, biological or other activity
(Dolle, 2001, J. Comb. Chem. 3:477-517; Hall etal., 2001, J. Comb.
Chem. 3:125-150; Dolle, 2000, J. Comb. Chem. 2:383-433; Dolle,
1999, J. Comb. Chem. 1:235-282). The synthetic methods applied to
create vast combinatorial libraries are performed in solution or in
the solid phase, i.e., on a solid support. Solid-phase synthesis
makes it easier to conduct multi-step reactions and to drive
reactions to completion with high yields because excess reagents
can be easily added and washed away after each reaction step.
Solid-phase combinatorial synthesis also tends to improve
isolation, purification and screening. However, the more
traditional solution phase chemistry supports a wider variety of
organic reactions than solid-phase chemistry. Methods and
strategies for the synthesis of combinatorial libraries can be
found in A Practical Guide to Combinatorial Chemistry, A. W.
Czarnik and S. H. Dewitt, eds., American Chemical Society, 1997;
The Combinatorial Index, B. A. Bunin, Academic Press, 1998; Organic
Synthesis on Solid Phase, F. Z. Dorwald, Wiley-VCH, 2000; and
Solid-Phase Organic Syntheses, Vol. 1, A. W. Czarnik, ed., Wiley
Interscience, 2001.
[0069] Combinatorial compound libraries of the present invention
may be synthesized using apparatuses described in U.S. Pat. No.
6,358,479 to Frisina et al., U.S. Pat. No. 6,190,619 to Kilcoin et
al., U.S. Pat. No. 6,132,686 to Gallup et al., U.S. Pat. No.
6,126,904 to Zuellig et al., U.S. Pat. No. 6,074,613 to Harness et
al., U.S. Pat. No. 6,054,100 to Stanchfield et al., and U.S. Pat.
No. 5,746,982 to Saneii et al. which are hereby incorporated by
reference in their entirety. These patents describe synthesis
apparatuses capable of holding a plurality of reaction vessels for
parallel synthesis of multiple discrete compounds or for
combinatorial libraries of compounds.
[0070] In one embodiment, the combinatorial compound library can be
synthesized in solution. The method disclosed in U.S. Pat. No.
6,194,612 to Boger et al., which is hereby incorporated by
reference in its entirety, features compounds useful as templates
for solution phase synthesis of combinatorial libraries. The
template is designed to permit reaction products to be easily
purified from unreacted reactants using liquid/liquid or
solid/liquid extractions. The compounds produced by combinatorial
synthesis using the template will preferably be small organic
molecules. Some compounds in the library may mimic the effects of
non-peptides or peptides. In contrast to solid phase synthesize of
combinatorial compound libraries, liquid phase synthesis does not
require the use of specialized protocols for monitoring the
individual steps of a multistep solid phase synthesis (Egner et
al., 1995, J. Org. Chem. 60:2652; Anderson et al., 1995, J. Org.
Chem. 60:2650; Fitch et al., 1994, J. Org. Chem. 59:7955; Look et
al., 1994, J. Org. Chem. 49:7588; Metzger et al., 1993, Angew.
Chem., Int. Ed. Engl. 32:894; Youngquist et al., 1994, Rapid
Commun. Mass Spect. 8:77; Chu et al., 1995, J. Am. Chem. Soc.
117:5419; Brummel et al., 1994, Science 264:399; Stevanovic et al.,
1993, Bioorg. Med. Chem. Lett. 3:431).
[0071] Combinatorial compound libraries useful for the methods of
the present invention can be synthesized on solid supports. In one
embodiment, a split synthesis method, a protocol of separating and
mixing solid supports during the synthesis, is used to synthesize a
library of compounds on solid supports (see Lam et al., 1997, Chem.
Rev. 97:41-448; Ohlmeyer et al., 1993, Proc. Natl. Acad. Sci. USA
90:10922-10926 and references cited therein). Each solid support in
the final library has substantially one type of test compound
attached to its surface. Other methods for synthesizing
combinatorial libraries on solid supports, wherein one product is
attached to each support, will be known to those of skill in the
art (see, e.g., Nefzi et al., 1997, Chem. Rev. 97:449-472 and U.S.
Pat. No. 6,087,186 to Cargill et al. which are hereby incorporated
by reference in their entirety).
[0072] As used herein, the term "solid support" is not limited to a
specific type of solid support. Rather a large number of supports
are available and are known to one skilled in the art. Solid
supports include silica gels, resins, derivatized plastic films,
glass beads, cotton, plastic beads, polystyrene beads, alumina
gels, and polysaccharides. A suitable solid support may be selected
on the basis of desired end use and suitability for various
synthetic protocols. For example, for peptide synthesis, a solid
support can be a resin such as p-methylbenzhydrylamine (PMBHA)
resin (Peptides International, Louisville, Ky.), polystyrenes
(e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories,
etc.), including chloromethylpolystyrene, hydroxymethylpolystyrene
and aminomethylpolystyrene, poly (dimethylacrylamide)-grafted
styrene co-divinyl-benzene (e.g, POLYHIPE resin, obtained from
Aminotech, Canada), polyamide resin (obtained from Peninsula
Laboratories), polystyrene resin grafted with polyethylene glycol
(e.g., TENTAGEL or ARGOGEL, Bayer, Tubingen, Germany)
polydimethylacrylamide resin (obtained from Milligen/Biosearch,
California), or Sepharose (Pharmacia, Sweden).
[0073] In one embodiment, the solid phase support is suitable for
in vivo use, i.e., it can serve as a carrier or support for
administration of the test compound to a patient (e.g., TENTAGEL,
Bayer, Tubingen, Germany). In a particular embodiment, the solid
support is palatable and/or orally ingestable.
[0074] In some embodiments of the present invention, compounds can
be attached to solid supports via linkers. Linkers can be integral
and part of the solid support, or they may be nonintegral that are
either synthesized on the solid support or attached thereto after
synthesis. Linkers are useful not only for providing points of test
compound attachment to the solid support, but also for allowing
different groups of molecules to be cleaved from the solid support
under different conditions, depending on the nature of the linker.
For example, linkers can be, inter alia, electrophilically cleaved,
nucleophilically cleaved, photocleavable, enzymatically cleaved,
cleaved by metals, cleaved under reductive conditions or cleaved
under oxidative conditions.
[0075] In another embodiment, the combinatorial compound libraries
can be assembled in situ using dynamic combinatorial chemistry as
described in European Patent Application 1,118,359 Al to Lehn; Huc
& Nguyen, 2001, Comb. Chem. High Throughput. Screen. 4:53-74;
Lehn and Eliseev, 2001, Science 291:2331-2332; Cousins et al. 2000,
Curr. Opin. Chem. Biol. 4: 270-279; and Karan & Miller, 2000,
Drug. Disc. Today 5:67-75 which are incorporated by reference in
their entirety.
[0076] Dynamic combinatorial chemistry uses non-covalent
interaction with a target biomolecule, including but not limited to
a protein, RNA, or DNA, to favor assembly of the most tightly
binding molecule that is a combination of constituent subunits
present as a mixture in the presence of the biomolecule. According
to the laws of thermodynamics, when a collection of molecules is
able to combine and recombine at equilibrium through reversible
chemical reactions in solution, molecules, preferably one molecule,
that bind most tightly to a templating biomolecule will be present
in greater amount than all other possible combinations. The
reversible chemical reactions include, but are not limited to,
imine, acyl-hydrazone, amide, acetal, or ester formation between
carbonyl-containing compounds and amines, hydrazines, or alcohols;
thiol exchange between disulfides; alcohol exchange in borate
esters; Diels-Alder reactions; thermal- or photoinduced sigmatropic
or electrocyclic rearrangements; or Michael reactions.
[0077] In the preferred embodiment of this technique, the
constituent components of the dynamic combinatorial compound
library are allowed to combine and reach equilibrium in the absence
of the target RNA and then incubated in the presence of the target
RNA, preferably at physiological conditions, until a second
equilibrium is reached. The second, perturbed, equilibrium (the
so-called "templated mixture") can, but need not necessarily, be
fixed by a further chemical transformation, including but not
limited to reduction, oxidation, hydrolysis, acidification, or
basification, to prevent restoration of the original equilibrium
when the dynamical combinatorial compound library is separated from
the target RNA.
[0078] In the preferred embodiment of this technique, the
predominant product or products of the templated dynamic
combinatorial library can separated from the minor products and
directly identified. In another embodiment, the identity of the
predominant product or products can be identified by a
deconvolution strategy involving preparation of derivative dynamic
combinatorial libraries, as described in European Patent
Application 1,118,359 A1, which is incorporated by reference in
their entirety, whereby each component of the mixture is,
preferably one-by-one but possibly group-wise, left out of the
mixture and the ability of the derivative library mixture at
chemical equilibrium to bind the target RNA is measured. The
components whose removal most greatly reduces the ability of the
derivative dynamic combinatorial library to bind the target RNA are
likely the components of the predominant product or products in the
original dynamic combinatorial library.
5.4. Library Screening
[0079] After a target nucleic acid, such as but not limited to RNA
or DNA, is labeled and a test compound library is synthesized or
purchased or both, the labeled target nucleic acid is used to
screen the library to identify test compounds that bind to the
nucleic acid. Screening comprises contacting a labeled target
nucleic acid with an individual, or small group, of the components
of the compound library. Preferably, the contacting occurs in an
aqueous solution, and most preferably, under physiologic
conditions. The aqueous solution preferably stabilizes the labeled
target nucleic acid and prevents denaturation or degradation of the
nucleic acid without interfering with binding of the test
compounds. The aqueous solution can be similar to the solution in
which a complex between the target RNA and its corresponding host
cell factor (if known) is formed in vitro. For example, TK buffer,
which is commonly used to form Tat protein-TAR RNA complexes in
vitro, can be used in the methods of the invention as an aqueous
solution to screen a library of test compounds for TAR RNA binding
compounds.
[0080] The methods of the present invention for screening a library
of test compounds preferably comprise contacting a test compound
with a target nucleic acid in the presence of an aqueous solution,
the aqueous solution comprising a buffer and a combination of
salts, preferably approximating or mimicking physiologic
conditions. The aqueous solution optionally further comprises
non-specific nucleic acids, such as, but not limited to, DNA; yeast
tRNA; salmon sperm DNA; homoribopolymers such as, but not limited
to, poly IC, polyA, polyU, and polyC; and non-specific RNA. The
non-specific RNA may be an unlabeled target nucleic acid having a
mutation at the binding site, which renders the unlabeled nucleic
acid incapable of interacting with a test compound at that site.
For example, if dye-labeled TAR RNA is used to screen a library,
unlabeled TAR RNA having a mutation in the uracil 23/cytosine 24
bulge region may also be present in the aqueous solution. Without
being bound by any theory, the addition of unlabeled RNA that is
essentially identical to the dye-labeled target RNA except for a
mutation at the binding site might minimize interactions of other
regions of the dye-labeled target RNA with test compounds or with
the solid support and prevent false positive results.
[0081] The solution further comprises a buffer, a combination of
salts, and optionally, a detergent or a surfactant. The pH of the
solution typically ranges from about 5 to about 8, preferably from
about 6 to about 8, most preferably from about 6.5 to about 8. A
variety of buffers may be used to achieve the desired pH. Suitable
buffers include, but are not limited to, Tris, Mes, Bis-Tris, Ada,
Aces, Pipes, Mopso, Bis-Tris propane, Bes, Mops, Tes, Hepes, Dipso,
Mobs, Tapso, Trizma, Heppso, Popso, TEA, Epps, Tricine, Gly-Gly,
Bicine, and sodium-potassium phosphate. The buffering agent
comprises from about 10 mM to about 100 mM, preferably from about
25 mM to about 75 mM, most preferably from about 40 mM to about 60
mM buffering agent. The pH of the aqeuous solution can be optimized
for different screening reactions, depending on the target RNA used
and the types of test compounds in the library, and therefore, the
type and amount of the buffer used in the solution can vary from
screen to screen. In a preferred embodiment, the aqueous solution
has a pH of about 7.4, which can be achieved using about 50 mM Tris
buffer.
[0082] In addition to an appropriate buffer, the aqueous solution
further comprises a combination of salts, from about 0 mM to about
100 mM KCl, from about 0 mM to about 1 M NaCl, and from about 0 mM
to about 200 mM MgCl.sub.2. In a preferred embodiment, the
combination of salts is about 100 mM KCl, 500 mM NaCl, and 10 mM
MgCl.sub.2. Without being bound by any theory, Applicant has found
that a combination of KCl, NaCl, and MgCl.sub.2 stabilizes the
target RNA such that most of the RNA is not denatured or digested
over the course of the screening reaction. The optional
concentration of each salt used in the aqueous solution is
dependent on the particular target RNA used and can be determined
using routine experimentation.
[0083] The solution optionally comprises from about 0.01% to about
0.5% (w/v) of a detergent or a surfactant. Without being bound by
any theory, a small amount of detergent or surfactant in the
solution might reduce non-specific binding of the target RNA to the
solid support and control aggregation and increase stability of
target RNA molecules. Typical detergents useful in the methods of
the present invention include, but are not limited to, anionic
detergents, such as salts of deoxycholic acid, 1-heptanesulfonic
acid, N-laurylsarcosine, lauryl sulfate, 1-octane sulfonic acid and
taurocholic acid; cationic detergents such as benzalkonium
chloride, cetylpyridinium, methylbenzethonium chloride, and
decamethonium bromide; zwitterionic detergents such as CHAPS,
CHAPSO, alkyl betaines, alkyl amidoalkyl betaines,
N-dodecyl-N,N-dimethyl-3-ammon- io-1-propanesulfonate, and
phosphatidylcholine; and non-ionic detergents such as n-decyl
a-D-glucopyranoside, n-decyl .beta.-D-maltopyranoside, n-dodecyl
.beta.-D-maltoside, n-octyl .beta.-D-glucopyranoside, sorbitan
esters, n-tetradecyl .beta.-D-maltoside, octylphenoxy
polyethoxyethanol (Nonidet P-40), nonylphenoxypolyethoxyethanol
(NP-40), and tritonis. Preferably, the detergent, if present, is a
nonionic detergent. Typical surfactants useful in the methods of
the present invention include, but are not limited to, ammonium
lauryl sulfate, polyethylene glycols, butyl glucoside, decyl
glucoside, Polysorbate 80, lauric acid, myristic acid, palmitic
acid, potassium palmitate, undecanoic acid, lauryl betaine, and
lauryl alcohol. More preferably, the detergent, if present, is
Triton X-100 and present in an amount of about 0.1% (w/v).
[0084] Non-specific binding of a labeled target nucleic acid to
test compounds can be further minimized by treating the binding
reaction with one or more blocking agents. In one embodiment, the
binding reactions are treated with a blocking agent, e.g., bovine
serum albumin ("BSA"), before contacting with to.the labeled target
nucleic acid. In another embodiment, the binding reactions are
treated sequentially with at least two different blocking agents.
This blocking step is preferably performed at room temperature for
from about 0.5 to about 3 hours. In a subsequent step, the reaction
mixture is further treated with unlabeled RNA having a mutation at
the binding site. This blocking step is preferably performed at
about 4.degree. C. for from about 12 hours to about 36 hours before
addition of the dye-labeled target RNA. Preferably, the solution
used in the one or more blocking steps is substantially similar to
the aqueous solution used to screen the library with the
dye-labeled target RNA, e.g., in pH and salt concentration.
[0085] Once contacted, the mixture of labeled target nucleic acid
and the test compound is preferably maintained at 4.degree. C. for
from about 1 day to about 5 days, preferably from about 2 days to
about 3 days with constant agitation. To identify the reactions in
which binding to the labeled target nucleic acid occurred, after
the incubation period, bound from free compounds are determined
using an electrophoretic technique (see Section 5.5.1), or any of
the methods disclosed in Section 5.5 infra. In another embodiment,
the complexed target nucleic acid does not need to be separated
from the free target nucleic acid if a technique (i.e.,
spectrometry) that diferentiates between bound and unbound target
nucleic acids is used.
[0086] The methods for identifying small molecules bound to labeled
nucleic acid will vary with the type of label on the target nucleic
acid. For example, if a target RNA is labeled with a visible of
fluorescent dye, the target RNA complexes are preferably identified
using a chromatographic technique that separates bound from free
target by an electrophoretic or size differential technique using
individual reactions. The reactions corresponding to changes in the
migration of the complexed RNA can be cross-referenced to the small
molecule compound(s) added to said reaction. Alternatively,
complexed target RNA can be screened en masse and then separated
from free target RNA using an electrophoretic or size differential
technique, the resultant complexed target is then analyzed using a
mass spectrometric technique. In this fashion the bound small
molecule can be identified on the basis of its molecular weight. In
this reaction a priori knowledge of the exact molecular weights of
all compounds within the library is known. In another embodiment,
the test compounds bound to the target nucleic acid may not require
separation from the unbound target nucleic acid if a technique such
as, but not limited to, spectrometry is used.
5.5. Separation Methods for Screening Test Compounds
[0087] Any method that detects an altered physical property of a
target nucleic acid complexed to a test compound from the unbound
target nucleic acid may be used for separation of the complexed and
non-complexed target nucleic acids. Methods that can be utilized
for the physical separation of complexed target RNA from unbound
target RNA include, but are not limited to, electrophoresis,
fluorescence spectroscopy, surface plasmon resonance, mass
spectrometry, scintillation, proximity assay, structure-activity
relationships ("SAR") by NMR spectroscopy, size exclusion
chromatography, affinity chromatography, and nanoparticle
aggregation.
5.5.1. Electrophoresis
[0088] Methods for separation of the complex of a target RNA bound
to a test compound from the unbound RNA comprises any method of
electrophoretic separation, including but not limited to,
denaturing and non-denaturing polyacrylamide gel electrophoresis,
urea gel electrophoresis, gel filtration, pulsed field gel
electrophoresis, two dimensional gel electrophoresis, continuous
flow electrophoresis, zone electrophoresis, agarose gel
electrophoresis, and capillary electrophoresis.
[0089] In a preferred embodiment, an automated electrophoretic
system comprising a capillary cartridge having a plurality of
capillary tubes is used for high-throughput screening of test
compounds bound to target RNA. Such an apparatus for performing
automated capillary gel electrophoresis is disclosed in U.S. Pat.
Nos. 5,885,430; 5,916,428; 6,027,627; and 6,063,251, the
disclosures of which are incorporated by reference in their
entireties.
[0090] The device disclosed in U.S. Pat. No. 5,885,430, which is
incorporated by reference in its entirety, allows one to
simultaneously introduce samples into a plurality of capillary
tubes directly from microtiter trays having a standard size. U.S.
Pat. No. 5,885,430 discloses a disposable capillary cartridge which
can be cleaned between electrophoresis runs, the cartridge having a
plurality of capillary tubes. A first end of each capillary tube is
retained in a mounting plate, the first ends collectively forming
an array in the mounting plate. The spacing between the first ends
corresponds to the spacing between the centers of the wells of a
microtiter tray having a standard size. Thus, the first ends of the
capillary tubes can simultaneously be dipped into the samples
present in the tray's wells. The cartridge is provided with a
second mounting plate in which the second ends of the capillary
tubes are retained. The second ends of the capillary tubes are
arranged in an array which corresponds to the wells in the
microtiter tray, which allows for each capillary tube to be
isolated from its neighbors and therefore free from
cross-contamination, as each end is dipped into an individual
well.
[0091] Plate holes may be provided in each mounting plate and the
capillary tubes inserted through these plate holes. In such a case,
the plate holes are sealed airtight so that the side of the
mounting plate having the exposed capillary ends can be
pressurized. Application of a positive pressure in the vicinity of
the capillary openings in this mounting plate allows for the
introduction of air and fluids during electrophoretic operations
and also can be used to force out gel and other materials from the
capillary tubes during reconditioning. The capillary tubes may be
protected from damage using a needle comprising a cannula and/or
plastic tubes, and the like when they are placed in these plate
holes. When metallic cannula or the like are used, they can serve
as electrical contacts for current flow during electrophoresis. In
the presence of a second mounting plate, the second mounting plate
is provided with plate holes through which the second ends of the
capillary tubes project. In this instance, the second mounting
plate serves as a pressure containment member of a pressure cell
and the second ends of the capillary tubes communicate with an
internal cavity of the pressure cell. The pressure cell is also
formed with an inlet and an outlet. Gels, buffer solutions,
cleaning agents, and the like may be introduced into the internal
cavity through the inlet, and each of these can simultaneously
enter the second ends of the capillaries.
[0092] In another preferred embodiment, the automated
electrophoretic system can comprise a chip system consisting of
complex designs of interconnected channels that perform and analyze
enzyme reactions using part of a channel design as a tiny,
continuously operating electrophoresis material, where reactions
with one sample are going on in one area of the chip while
electrophoretic separation of the products of another sample is
taking place in a different part of the chip. Such a system is
disclosed in U.S. Pat. Nos. 5,699,157; 5,842,787; 5,869,004;
5,876,675; 5,942,443; 5,948,227; 6,042,709; 6,042,710; 6,046,056;
6,048,498; 6,086,740; 6,132,685; 6,150,119; 6,150,180; 6,153,073;
6,167,910; 6,171,850; and 6,186,660, the disclosures of which are
incorporated by reference in their entireties.
[0093] The system disclosed in U.S. Pat. No. 5,699,157, which is
hereby incorporated by reference in its entirety, provides for a
microfluidic system for high-speed electrophoretic analysis of
subject materials for applications in the fields of chemistry,
biochemistry, biotechnology, molecular biology and numerous other
areas. The system has a channel in a substrate, a light source and
a photoreceptor. The channel holds subject materials in solution in
an electric field so that the materials move through the channel
and separate into bands according to species. The light source
excites fluorescent light in the species bands and the
photoreceptor is arranged to receive the fluorescent light from the
bands. The system further has a means for masking the channel so
that the photoreceptor can receive the fluorescent light only at
periodically spaced regions along the channel. The system also has
an unit connected to analyze the modulation frequencies of light
intensity received by the photoreceptor so that velocities of the
bands along the channel are determined, which allows the materials
to be analyzed.
[0094] The system disclosed in U.S. Pat. No. 5,699,157 also
provides for a method of performing high-speed electrophoretic
analysis of subject materials, which comprises the steps of holding
the subject materials in solution in a channel of a microfluidic
system; subjecting the materials to an electric field so that the
subject materials move through the channel and separate into
species bands; directing light toward the channel; receiving light
from periodically spaced regions along the channel simultaneously;
and analyzing the frequencies of light intensity of the received
light so that velocities of the bands along the channel can be
determined for analysis of said materials. The determination of the
velocity of a species band determines the electrophoretic mobility
of the species and its identification.
[0095] U.S. Pat. No. 5,842,787, which is hereby incorporated by
reference in its entirety, is generally directed to devices and
systems employ channels having, at least in part, depths that are
varied over those which have been previously described (such as the
device disclosed in U.S. Pat. No. 5,699,157), wherein said channel
depths provide numerous beneficial and unexpected results such as
but not limited to, a reduction in sample perturbation, reduced
non-specific sample mixture by diffusion, and increased
resolution.
[0096] In another embodiment, the electrophoretic method of
separation comprises polyacrylamide gel electrophoresis. In a
preferred embodiment, the polyacrylamide gel electrophoresis is
non-denaturing, so as to differentiate the mobilities of the target
RNA bound to a test compound from free target RNA. If the
polyacrylamide gel electrophoresis is denaturing, then the target
RNA:test compound complex must be cross-linked prior to
electrophoresis to prevent the disassociation of the target RNA
from the test compound during electrophoresis. Such techniques are
well known to one of skill in the art.
[0097] In one embodiment of the method, the binding of test
compounds to target nucleic acid can be detected, preferably in an
automated fashion, by gel electrophoretic analysis of interference
footprinting. RNA can be degraded at specific base sites by
enzymatic methods such as ribonucleases A, U.sub.2, CL.sub.3,
T.sub.1, Phy M, and B. cereus or chemical methods such as
diethylpyrocarbonate, sodium hydroxide, hydrazine, piperidine
formate, dimethyl sulfate, [2,12-dimethyl-3,7,11,17-
-tetraazacyclo[11.3.1]heptadeca-1(17),2,11,13,15-pentaenato]
nickel(II) (NiCR), cobalt(II)chloride, or iron(II)
ethylenediaminetetraacetate (Fe-EDTA) as described for example in
Zheng et al., 1999, Biochem. 37:2207-2214; Latham & Cech, 1989,
Science 245:276-282; and Sambrook et al., 2001, in Molecular
Cloning: A Laboratory Manual, pp 12.61-12.73, Cold Spring Harbor
Laboratory Press, and the references cited therein, which are
hereby incorporated by reference in their entireties. The specific
pattern of cleavage sites is determined by the accessibility of
particular bases to the reagent employed to initiate cleavage and,
as such, is therefore is determined by the three-dimensional
structure of the RNA.
[0098] The interaction of small molecules with a target nucleic
acid can change the accessibility of bases to these cleavage
reagents both by causing conformational changes in the target
nucleic acid or by covering a base at the binding interface. When a
test compound binds to the nucleic acid and changes the
accessibility of bases to cleavage reagents, the observed cleavage
pattern will change. This method can be used to identify and
characterize the binding of small molecules to RNA as described,
for example, by Prudent et al., 1995, J. Am. Chem. Soc.
117:10145-10146 and Mei et al., 1998, Biochem. 37:14204-14212.
[0099] In the preferred embodiment of this technique, the
detectably labeled target nucleic acid is incubated with an
individual test compound and then subjected to treatment with a
cleavage reagent, either enzymatic or chemical. The reaction
mixture can be preferably be examined directly, or treated further
to isolate and concentrate the nucleic acid. The fragments produced
are separated by electrophoresis and the pattern of cleavage can be
compared to a cleavage reaction performed in the absence of test
compound. A change in the cleavage pattern directly indicates that
the test compound binds to the target nucleic acid. Multiple test
compounds can be examined both in parallel and serially.
[0100] Other embodiments of electrophoretic separation include, but
are not limited to urea gel electrophoresis, gel filtration, pulsed
field gel electrophoresis, two dimensional gel electrophoresis,
continuous flow electrophoresis, zone electrophoresis, and agarose
gel electrophoresis.
5.5.2. Fluorescence Spectroscopy
[0101] In a preferred embodiment, fluorescence polarization
spectroscopy, an optical detection method that can differentiate
the proportion of a fluorescent molecule that is either bound or
unbound in solution (e.g., the labeled target nucleic acid of the
present invention), can be used to read reaction results without
electrophoretic separation of the samples. Fluorescence
polarization spectroscopy can be used to read the reaction results
in the chip system disclosed in U.S. Pat. Nos. 5,699,157;
5,842,787; 5,869,004; 5,876,675; 5,942,443; 5,948,227; 6,042,709;
6,042,710; 6,046,056; 6,048,498; 6,086,740; 6,132,685; 6,150,119;
6,150,180; 6,153,073; 6,167,910; 6,171,850; and 6,186,660, the
disclosures of which are incorporated by reference in their
entireties. The application of fluorescence polarization
spectroscopy to the chip system disclosed in the U.S. Patents
listed supra is fast, efficient, and well-adapted for
high-throughput screening.
[0102] In another embodiment, a compound that has an affinity for
the target nucleic acid of interest can be labeled with a
fluorophore to screen for test compounds that bind to the target
nucleic acid. For example, a pyrene-containing aminoglycoside
analog was used to accurately monitor antagonist binding to a
prokaryotic 16S rRNA A site (which comprises the natural target for
arninoglycoside antibiotics) in a screen using a fluorescence
quenching technique in a 96-well plate format (Hamasaki &
Rando, 1998, Anal. Biochem. 261(2):183-90).
[0103] In another embodiment, fluorescence resonance energy
transfer (FRET) can be used to screen for test compounds that bind
to the target nucleic acid. FRET, a characteristic change in
fluorescence, occurs when two fluorophores with overlapping
emission and excitation wavelength bands are held together in close
proximity, such as by a binding event. In the preferred embodiment,
the fluorophore on the target nucleic acid and the fluorophore on
the test compounds will have overlapping excitation and emission
spectra such that one fluorophore (the donor) transfers its
emission energy to excite the other fluorophore (the acceptor). The
acceptor preferably emits light of a different wavelength upon
relaxing to the ground state, or relaxes non-radiatively to quench
fluorescence. FRET is very sensitive to the distance between the
two fluorophores, and allows measurement of molecular distances
less than 10 nm. For example, U.S, Pat. No. 6,337,183 to Arenas et
al., which is incorporated by reference in its entirety, describes
a screen for compounds that bind RNA that uses FRET to measure the
effect of test compounds on the stability of a target RNA molecule
where the target RNA is labeled with both fluorescent acceptor and
donor molecules and the distance between the two fluorophores as
determined by FRET provides a measure of the folded structure of
the RNA. Matsumoto et al. (2000, Bioorg. Med. Chem. Lett.
10:1857-1861) describe a system where a peptide that binds to HIV-1
TAR RNA is labeled on one end with a fluorescein fluorophore and a
tetramethylrhodamine on the other end. The conformational change of
the peptide upon binding to the RNA provided a FRET signal to
screen for compounds that bound to the TAR RNA.
[0104] In the preferred embodiment, both the target nucleic acid
and a compound that has an affinity for the target nucleic acid of
interest are labeled with fluorophores with overlapping emission
and excitation spectra (donor and acceptor), including but not
limited to fluorescein and derivatives, rhodamine and derivatives,
cyanine dyes and derivatives, bora-3a,4a-diaza-s-indacene
(BODIPY.RTM.) and derivatives, pyrene, nanoparticles, or
non-fluorescent quenching molecules. Binding of a labeled test
compound to the target nucleic acid can be identified by the change
in observable fluorescence as a result of FRET.
[0105] If the target nucleic acid is labeled with the donor
fluorophore, then the test compounds is labeled with the acceptor
fluorophore. Conversely, if the target nucleic acid is labeled with
the acceptor fluorophore, then the test compounds is labeled with
the donor fluorophore. A wide variety of labels may be used, with
the choice of label depending on sensitivity required, ease of
conjugation with the compound, stability requirements, available
instrumentation, and disposal provisions. The fluorophore on the
target nucleic acid must be in close proximity to the binding site
of the test compounds, but should not be incorporated into a target
nucleic acid at the specific binding site at which test compounds
are likely to bind, since the presence of a covalently attached
label might interfere sterically or chemically with the binding of
the test compounds at this site.
[0106] In yet another embodiment, homogeneous time-resolved
fluorescence ("HTPF") techniques based on time-resolved energy
transfer from lanthanide ion complexes to a suitable acceptor
species can be adapted for high-throughput screening for inhibitors
of RNA-protein complexes (Hemmil, 1999, J. Biomol. Screening
4:303-107; Mathis, 1999, J. Biomol. Screening 4:309-313). HTRF is
similar to fluorescence resonance energy transfer using
conventional organic dye pairs, but has several advantages, such as
increased sensitivity and efficiency, and background elimination
(Xavier et al., 2000, Trends Biotechnol. 18(8):349-356).
[0107] Fluorescence spectroscopy has traditionally been used to
characterize DNA-protein and protein-protein interactions, but
fluorescence spectroscopy has not been widely used to characterize
RNA-protein interactions because of an interfering absorption of
RNA nucleotides with the intrinsic tryptophan fluorescence of
proteins (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356.).
However, fluorescence spectroscopy has been used in studying the:
single tryptophan residue within the arginine-rich RNA-binding
domain of Rev protein and its interaction with the RRE in a
time-resolved fluorescence study (Kwon & Carson, 1998, Anal.
Biochem. 264:133-140). Thus, in this invention, fluorescence
spectroscopy is less preferred if the test compounds or peptides or
proteins possess intrinsic tryptophan fluorescence. However,
fluorescence spectroscopy can be used for test compounds that do
not possess intrinsic fluorescence.
5.5.3. Surface Plasmon Resonance ("SPR")
[0108] Surface plasmon resonance (SPR) can be used for determining
kinetic rate constants and equilibrium constants for macromolecular
interactions by following the association project in "real time"
(Schuck, 1997, Annu. Rev. Biophys. Biomol. Struct. 26:541-566).
[0109] The principle of SPR is summarized by Xavier et al. (Trends
Biotechnol., 2000, 18(8):349-356) as follows. Total internal
reflection occurs at the boundary between two substances of
different refractive index. The incident light's electromagnetic
field penetrates beyond the interface as an evanescent wave, which
extends a few hundred nanometers beyond the surface into the
medium. Insertion of a thin gold foil at the interace produced SPR
owing to the absorption of the energy from the evanescent wave by
free electron clouds of the metal (plasmons). As a result of this
absorbance, there is a drop in the intensity of the reflected light
at a particular angle of incidence. The evanescent wave profile
depends exquisitely on the refractive index of the medium it
probes. Thus, the angle at which absorption occurs is very
sensitive to the refractive changes in the external medium. All
proteins and nucleic acids are known to change the refractive index
of water by a similar amount per unit mass, irrespective of their
amino acid or nucleotide composition (the refractive index change
is different for proteins and nucleic acids). When the protein or
nucleic acid content of the layer at the sensor changes, the
refractive index also changes. Typically, one member of a complex
is immobilized in a dextran layer and then the other member is
introduced into the solution, either in a flow cell (Biacore AB,
Uppsala, Sweden) or a stirred cuvette (Affinity Sensors, Santa Fe,
N. Mex.). It has been determined that there is a linear correlation
between the surface concentration of protein or nucleic acid and
the shift in resonance angle, which can be used to quantitate
kinetic rate constants and/or the equilibrium constants.
[0110] In the present invention, the target RNA may be immobilized
to the sensor surface through a streptavidin-biotin linkage, the
linkage of which is disclosed by Crouch et al. (Methods Mol. Biol.,
1999, 118:143-160). The RNA is biotinylated either during synthesis
or post-synthetically via the conversion of the 3' terminal
ribonucleoside of the RNA into a reactive free amino group or using
a T7 polymerase incorporated guanosine monophosphorothioate at the
5' end. SPR has been used to determine the stoichiometry and
affinity of the interaction between the HIV Rev protein and the RRE
(Van Ryk & Venkatesan, 1999, J. Biol. Chem. 274:17452-17463)
and the aminoglycoside antibiotics with RRE and a model RNA derived
from the 16S ribosomal A site, respectively (Hendrix et al., 1997,
J. Am. Chem. Soc. 119:3641-3648; Wong et al., 1998, Chem. Biol.
5:397-406).
[0111] In one embodiment of the present invention, the target
nucleic acid can be immobilized to a sensor surface (e.g., by a
streptavidin-biotin linkage) and SPR can be used to (a) determine
whether the target RNA binds a test compound and (b) further
characterize the binding of the target nucleic acids of the present
invention to a test compound.
5.5.4. Mass Spectrometry
[0112] An automated method for analyzing mass spectrometer data
which can analyze complex mixtures containing many thousands of
components and can correct for background noise, multiply charged
peaks and atomic isotope peaks is described in U.S. Pat. No.
6,147,344, which is hereby incorporated by reference in its
entirety. The system disclosed in U.S. Pat. No. 6,147,344 is a
method for analyzing mass spectrometer data in which a control
sample measurement is performed providing a background noise check.
The peak height and width values at each m/z ratio as a finction of
time are stored in a memory. A mass spectrometer operation on a
material to be analyzed is performed and the peak height and width
values at each m/z ratio versus time are stored in a second memory
location. The mass spectrometer operation on the material to be
analyzed is repeated a fixed number of times and the stored control
sample values at each m/z ratio level at each time increment are
subtracted from each corresponding one from the operational runs
thus producing a difference value at each mass ratio for each of
the multiple runs at each time increment. If the MS value minus the
background noise does not exceed a preset value, the m/z ratio data
point is not recorded, thus eliminating background noise, chemical
noise and false positive peaks from the mass spectrometer data. The
stored data for each of the multiple runs is then compared to a
predetermined value at each m/z ratio and the resultant series of
peaks, which are now determined to be above the background, is
stored in the m/z points in which the peaks are of
significance.
[0113] One possibility for the utilization of mass spectrometry in
high throughput screening is the integration of SPR with mass
spectrometry. Approaches that have been tried are direct analysis
of the analyte retained on the sensor chip and mass spectrometry
with the eluted analyte (Sonksen et al., 1998, Anal. Chem.
70:2731-2736; Nelson & Krone, 1999, J. Mol. Recog. 12:77-93).
Further developments, especially in the interfacing of the sensor
chip with the mass spectrometer and in reusing the sensor chip, are
required to make SPR combined with mass spectroscopy a
high-throughput method for biomolecular interaction analysis and
the screening of targets for small molecule inhibitors (Xavier et
al., 2000, Trends Biotechnol. 18(8):349-356).
[0114] In one embodiment of the present invention, the target
nucleic acid complexed to a test compound can be determined by any
of the mass spectrometry processed described supra. Furthermore,
mass spectrometry can also be used to elucidate the structure of
the test compound.
5.5.5. Scintillation Proximity Assay ("SPA")
[0115] Scintillation Proximity Assay ("SPA") is a method that can
be used for screening small molecules that bind to the target RNAs.
SPA would involve radiolabeling either the target RNA or the test
compound and then quantitating its binding to the other member to a
bead or a surface impregnated with a scintillant (Cook, 1996, Drug
Discov. Today 1:287-294). Currently, fluorescence-based techniques
are preferred for high-throughput screening (Pope et al., 1999,
Drug Discov. Today 4:350-362).
[0116] Screening for small molecules that inhibit Tat peptide:TAR
RNA interaction has been performed with SPA, and inhibitors of the
interaction were isolated and characterized (Mei et al., 1997,
Bioorg. Med. Chem. 5:1173-1184; Mei et al., 1998, Biochemistry
37:14204-14212). A similar approach can be used to identify small
molecules that directly bind to a preselected target RNA element in
accordance with the invention can be utilized.
[0117] SPA can be adapted to high throughput screening by the
availability of microplates, wherein the scintillant is directly
incorporated into the plastic of the microtiter wells (Nakayama et
al., 1998, J. Biomol. Screening 3:43-48). Thus, one embodiment of
the present invention comprises (a) labeling of the target nucleic
acid with a radioactive or fluorescent label; (b) contacted the
labeled nucleic acid with test compounds, wherein each test
compound is in a microtiter well coated with scintillant and is
tethered to the microtiter well; and (c) identifying and
quantifying the test compounds bound to the target nucleic acid
with SPA, wherein the test compound is identified by virtue of its
location in the microplate.
5.5.6. Structure-Activity Relationships ("SAR") by NMR
Spectroscopy
[0118] NMR spectroscopy is a valuable technique for identifying
complexed target nucleic acids by qualitatively determining changes
in chemical shift, specifically from distances measured using
relaxation effects, and NMR-based approaches have been used in the
identification of small molecule binders of protein drug targets
(Xavier et al., 2000, Trends Biotechnol. 18(8):349-356). The
determination of structure-activity relationships ("SAR") by NMR is
the first method for NMR described in which small molecules that
bind adjacent subsites are identified by two-dimentional
.sup.1H-.sup.15N spectra of the target protein (Shuker et al.,
1996, Science 274:1531-1534). The signal from the bound molecule is
monitored by employing line broadening, transferred NOEs and pulsed
field gradient diffusion measurements (Moore, 1999, Curr. Opin.
Biotechnol. 10:54-58). A strategy for lead generation by NMR using
a library of small molecules has been recently described (Fejzo et
al., 1999, Chem. Biol. 6:755-769).
[0119] In one embodiment of the present invention, the target
nucleic acid complexed to a test compound can be determined by SAR
by NMR. Furthermore, SAR by NMR can also be used to elucidate the
structure of the test compound.
5.5.7. Size Exclusion Chromatography
[0120] In another embodiment of the present invention,
size-exclusion chromatography is used to purify test compounds that
are bound to a target nucleic from a complex mixture of compounds.
Size-exclusion chromatography separates molecules based on their
size and uses gel-based media comprised of beads with specific size
distributions. When applied to a column, this media settles into a
tightly packed matrix and forms a complex array of pores.
Separation is accomplished by the inclusion or exclusion of
molecules by these pores based on molecular size. Small molecules
are included into the pores and, consequently, their migration
through the matrix is retarded due to the added distance they must
travel before elution. Large molecules are excluded from the pores
and migrate with the void volume when applied to the matrix. In the
present invention, a target nucleic acid is incubated with a
mixture of test compounds while free in solution and allowed to
reach equilibrium. When applied to a size exclusion column, test
compounds free in solution are retained by the column, and test
compounds bound to the target nucleic acid are passed through the
column. In a preferred embodiment, spin columns commonly used for
"desalting" of nucleic acids will be employed to separate bound
from unbound test compounds (e.g., Bio-Spin columns manufactured by
BIO-RAD). In another embodiment, the size exclusion matrix is
packed into multiwell plates to allow high throughput separation of
mixtures (e.g., PLASMID 96-well SEC plates manufactured by
Millipore).
5.5.8. Affinity Chromatography
[0121] In one embodiment of the present invention, affinity capture
is used to purify test compounds that are bound to a target nucleic
acid labeled with an affinity tag from a complex mixture of
compounds. To accomplish this, a target nucleic acid labeled with
an affinity tag is incubated with a mixture of test compounds while
free in solution and then captured to a solid support once
equilibrium has been established; alternatively, target nucleic
acids labeled with an affinity tag can be captured to a solid
support first and then allowed to reach equilibrium with a mixture
of test compounds.
[0122] The solid support is typically comprised of, but not limited
to, cross-linked agarose beads that are coupled with a ligand for
the affinity tag. Alternatively, the solid support may be a glass,
silicon, metal, or carbon, plastic (polystyrene, polypropylene)
surface with or without a self-assembled monolayer (SAM) either
with a covalently attached ligand for the affinity tag, or with
inherent affinity for the tag on the target nucleic acid.
[0123] Once the complex between the target nucleic acid and test
compound has reached equilibrium and has been captured, one skilled
in the art will appreciate that the retention of bound compounds
and removal of unbound compounds is facilitated by washing the
solid support with large excesses of binding reaction buffer.
Furthermore, retention of high affinity compounds and removal of
low affinity compounds can be accomplished by a number of means
that increase the stringency of washing; these means include, but
are not limited to, increasing the number and duration of washes,
raising the salt concentration of the wash buffer, addition of
detergent or surfactant to the wash buffer, and addition of
non-specific competitor to the wash buffer.
[0124] In one embodiment, the test compounds themselves are
detectably labeled with fluorescent dyes, radioactive isotopes, or
nanoparticles. When the test compounds are applied to the captured
target nucleic acid in a spatially addressed fashion (e.g., in
separate wells of a 96-well microplate), binding between the test
compounds and the target nucleic acid can be determined by the
presence of the detectable label on the test compound using
fluorescence.
[0125] Following the removal of unbound compounds, bound compounds
with high affinity for the target nucleic acid can be eluted from
the immobilized target nucleic acids and analyzed. The elution of
test compounds can be accomplished by any means that break the
non-covalent interactions between the target nucleic acid and
compound. Means for elution include, but are not limited to,
hanging the pH, changing the salt concentration, the application of
organic solvents, and the application of molecules that compete
with the bound ligand. In a preferred embodiment, the means
employed for elution will release the compound from the target RNA,
but will not effect the interaction between the affinity tag and
the solid support, thereby achieving selective elution of test
compound. Moreover, a preferred embodiment will employ an elution
buffer that is volatile to allow for subsequent concentration by
lyophilization of the eluted compound (e.g., 0 M to 5 M ammonium
acetate).
5.5.9. Nanoparticle Aggregation
[0126] In one embodiment of the present invention, both the target
nucleic acid and the test compounds are labeled with nanoparticles.
A nanoparticle is a cluster of ions with controlled size from 0.1
to 1000 nm comprised of metals, metal oxides, or semiconductors
including, but not limited to Ag.sub.2S, ZnS, CdS, CdTe, Au, or
TiO.sub.2. Methods for the attachment of nucleic acids and small
molecules to nanoparticles are well know to one of skill in the art
(reviewed in Niemeyer, 2001, Angew. Chem. Int. Ed. 40:4129-4158.
The references cited therein are hereby incorporated by reference
in their entireties). In particular, if multiple copies of the
target nucleic acid are attached to a single nanoparticle and
multiple copies of a test compound are attached to another
nanoparticle, then interaction between the test compound and target
nucleic acid will induce aggregation of nanoparticles as described,
for example, by Mitchel et al. 1999, J. Am. Chem. Soc.
121:8122-8123. The aggregate can be detected by changes in
absorbance or fluorescence spectra and physically separated from
the unbound components through filtration or centrifugation.
5.6. Methods for Identifying or Characterizing the Test Compounds
Bound to the Target Nucleic Acids
[0127] If the library comprises arrays or microarrays of test
compounds, wherein each test compound has an address or identifier,
the test compound can be deconvoluted, e.g., by cross-referencing
the positive sample to original compound list that was applied to
the individual test assays.
[0128] If the library is a peptide or nucleic acid library, the
sequence of the test compound can be determined by direct
sequencing of the peptide or nucleic acid. Such methods are well
known to one of skill in the art.
[0129] A number of physico-chemical techniques can be used for the
de novo characterization of test compounds bound to the target.
5.6.1. Mass Spectrometry
[0130] Mass spectrometry (e.g., electrospray ionization ("ESI") and
matrix-assisted laser desorption-ionization ("MALDI"),
Fourier-transform ion cyclotron resonance ("FT-ICR")) can be used
both for high-throughput screening of test compounds that bind to a
target RNA and elucidating the structure of the test compound.
Thus, one example of mass spectroscopy is that separation of a
bound and unbound complex and test compound structure elucidation
can be carried out in a single step.
[0131] MALDI uses a pulsed laser for desorption of the ions and a
time-of-flight analyzer, and has been used for the detection of
noncovalent tRNA:amino-acyl-tRNA synthetase complexes (Gruic-Sovulj
et al., 1997, J. Biol. Chem. 272:32084-32091). However, covalent
cross-linking between the target nucleic acid and the test compound
is required for detection, since a non-covalently bound complex may
dissociate during the MALDI process.
[0132] ESI mass spectrometry ("ESI-MS") has been of greater utility
for studying non-covalent molecular interactions because, unlike
the MALDI process, ESI-MS generates molecular ions with little to
no fragmentation (Xavier et al., 2000, Trends Biotechnol.
18(8):349-356). ESI-MS has been used to study the complexes formed
by HIV Tat peptide and protein with the TAR RNA (Sannes-Lowery et
al., 1997, Anal. Chem. 69:5130-5135).
[0133] Fourier-transform ion cyclotron resonance ("FT-ICR") mass
spectrometry provides high-resolution spectra, isotope-resolved
precursor ion selection, and accurate mass assignments (Xavier et
al., 2000, Trends Biotechnol. 18(8):349-356). FT-ICR has been used
to study the interaction of aminoglycoside antibiotics with cognate
and non-cognate RNAs (Hofstadler et al., 1999, Anal. Chem.
71:3436-3440; Griffey et al., 1999, Proc. Natl. Acad. Sci. USA
96:10129-10133). As true for all of the mass spectrometry methods
discussed herein, FT-ICR does not require labeling of the target
RNA or a test compound.
[0134] An advantage of mass spectroscopy is not only the
elucidation of the structure of the test compound, but also the
determination of the structure of the test compound bound to the
preselected target RNA. Such information can enable the discovery
of a consensus structure of a test compound that specifically binds
to a preselected target RNA.
5.6.2. NMR Spectroscopy
[0135] As described above, NMR spectroscopy is a technique for
identifying binding sites in target nucleic acids by qualitatively
determining changes in chemical shift, specifically from distances
measured using relaxation effects. Examples of NMR that can be used
for the invention include, but are not limited to, one-dimentional
NMR, two-dimentional NMR, correlation spectroscopy ("COSY"), and
nuclear Overhauser effect ("NOE") spectroscopy. Such methods of
structure determination of test compounds are well known to one of
skill in the art.
[0136] Similar to mass spectroscopy, an advantage of NMR is the not
only the elucidation of the structure of the test compound, but
also the determination of the structure of the test compound bound
to the preselected target RNA. Such information can enable the
discovery of a consensus structure of a test compound that
specifically binds to a preselected target RNA.
5.6.3. Vibrational Spectroscopy
[0137] Vibrational spectroscopy (e.g. infrared (IR) spectroscopy or
Raman spectroscopy) can be used for elucidating the structure of
the test compound on the isolated bead.
[0138] Infrared spectroscopy measures the frequencies of infrared
light (wavelengths from 100 to 10,000 nm) absorbed by the test
compound as a result of excitation of vibrational modes according
to quantum mechanical selection rules which require that absorption
of light cause a change in the electric dipole moment of the
molecule. The infrared spectrum of any molecule is a unique pattern
of absorption wavelengths of varying intensity that can be
considered as a molecular fingerprint to identify any compound.
[0139] Infrared spectra can be measured in a scanning mode by
measuring the absorption of individual frequencies of light,
produced by a grating which separates frequencies from a
mixed-frequency infrared light source, by the test compound
relative to a standard intensity (double-beam instrument) or
pre-measured (`blank`) intensity (single-beam instrument). In a
preferred embodiment, infrared spectra are measured in a pulsed
mode (FT-IR) where a mixed beam, produced by an interferometer, of
all infrared light frequencies is passed through or reflected off
the test compound. The resulting interferogram, which may or may
not be added with the resulting interferograms from subsequent
pulses to increase the signal strength while averaging random noise
in the electronic signal, is mathematically transformed into a
spectrum using Fourier Transform or Fast Fourier Transform
algorithms.
[0140] Raman spectroscopy measures the difference in frequency due
to absorption of infrared frequencies of scattered visible or
ultraviolet light relative to the incident beam. The incident
monochromatic light beam, usually a single laser frequency, is not
truly absorbed by the test compound but interacts with the electric
field transiently. Most of the light scattered off the sample with
be unchanged (Rayleigh scattering) but a portion of the scatter
light will have frequencies that are the sum or difference of the
incident and molecular vibrational frequencies. The selection rules
for Raman (inelastic) scattering require a change in polarizability
of the molecule. While some vibrational transitions are observable
in both infrared and Raman spectrometry, must are observable only
with one or the other technique. The Raman spectrum of any molecule
is a unique pattern of absorption wavelengths of varying intensity
that can be considered as a molecular fingerprint to identify any
compound.
[0141] Raman spectra are measured by submitting monochromatic light
to the sample, either passed through or preferably reflected off,
filtering the Rayleigh scattered light, and detecting the frequency
of the Raman scattered light. An improved Raman spectrometer is
described in U.S. Pat. No. 5,786,893 to Fink et al., which is
hereby incorporated by reference.
[0142] Vibrational microscopy can be measured in a spatially
resolved fashion to address single beads by integration of a
visible microscope and spectrometer. A microscopic infrared
spectrometer is described in U.S. Pat. No. 5,581,085 to Reffner et
al., which is hereby incorporated by reference in its entirety. An
instrument that simultaneously performs a microscopic infrared and
microscopic Raman analysis on a sample is described in U.S. Pat.
No. 5,841,139 to Sostek et al., which is hereby incorporated by
reference in its entirety.
[0143] In the preferred embodiment, test compounds can be
identified by matching the IR or Raman spectra of a test compound
to a dataset of vibrational (IR or Raman) spectra previously
acquired for each compound in the combinatorial library. By this
method, the spectra of compounds with known structure are recorded
so that comparison with these spectra can identify compounds again
when isolated from RNA binding experiments.
5.7. Secondary Biological Screens
[0144] The test compounds identified in the binding assay (for
convenience referred to herein as a "lead" compound) can be tested
for biological activity using host cells containing or engineered
to contain the target RNA element coupled to a functional readout
system. For example, the lead compound can be tested in a host cell
engineered to contain the target RNA element controlling the
expression of a reporter gene. In this example, the lead compounds
are assayed in the presence or absence of the target RNA.
Alternatively, a phenotypic or physiological readout can be used to
assess activity of the target RNA in the presence and absence of
the lead compound.
[0145] In one embodiment, the lead compound can be tested in a host
cell engineered to contain the target RNA element controlling the
expression of a reporter gene, such as, but not limited to,
.beta.-galactosidase, green fluorescent protein, red fluorescent
protein, luciferase, chloramphenicol acetyltransferase, alkaline
phosphatase, and .beta.-lactamase. In a preferred embodiment, a
cDNA encoding the target element is fused upstream to a reporter
gene wherein translation of the reporter gene is repressed upon
binding of the lead compound to the target RNA. In other words, the
steric hindrance caused by the binding of the lead compound to the
target RNA repressed the translation of the reporter gene. This
method, termed the translational repression assay procedure
("TRAP") has been demonstrated in E. coli and S. cerevisiae (Jain
& Belasco, 1996, Cell 87(1):115-25; Huang & Schreiber,
1997, Proc. Natl. Acad. Sci. USA 94:13396-13401).
[0146] In another embodiment, a phenotypic or physiological readout
can be used to assess activity of the target RNA in the presence
and absence of the lead compound. For example, the target RNA may
be overexpressed in a cell in which the target RNA is endogenously
expressed. Where the target RNA controls expression of a gene
product involved in cell growth or viability, the in vivo effect of
the lead compound can be assayed by measuring the cell growth or
viability of the target cell. Alternatively, a reporter gene can
also be fused downstream of the target PNA sequence and the effect
of the lead compound on reporter gene expression can be
assayed.
[0147] Alternatively, the lead compounds identified in the binding
assay can be tested for biological activity using animal models for
a disease, condition, or syndrome of interest. These include
animals engineered to contain the target RNA element coupled to a
functional readout system, such as a transgenic mouse. Animal model
systems can also be used to demonstrate safety and efficacy.
[0148] Compounds displaying the desired biological activity can be
considered to be lead compounds, and will be used in the design of
congeners or analogs possessing useful pharmacological activity and
physiological profiles. Following the identification of a lead
compound, molecular modeling techniques can be employed, which have
proven to be useful in conjunction with synthetic efforts, to
design variants of the lead that can be more effective. These
applications may include, but are lot limited to, Pharmacophore
Modeling (cf. Lamothe, et al. 1997, J. Med. Chem. 40: 3542; Mottola
et al. 1996, J. Med. Chem. 39: 285; Beusen et al. 1995, Biopolymers
36: 181; P. Fossa et al. 1998, Comput. Aided Mol. Des. 12: 361),
QSAR development (cf Siddiqui et al. 1999, J. Med. Chem. 42: 4122;
Barreca et al. 1999 Bioorg. Med. Chem. 7: 2283; Kroemer et al.
1995, J. Med. Chem. 4917; Schaal et al. 2001, J. Med. Chem. 44:
155; Buolamwini & Assefa 2002, J. Mol. Chem. 45: 84), Virtual
docking and screening/scoring (cf Anzini et al. 2001, J. Med. Chem.
44: 1134; Faaland et al. 2000, Biochem. Cell. Biol. 78: 415;
Silvestri et al 2000, Bioorg. Med. Chem. 8: 2305; J. Lee et al
2001, Bioorg. Med. Chem. 9: 19), and Structure Prediction using RNA
structural programs including, but not limited to mFold (as
described by Zuker et al. Algorithms and Thermodynamics for RNA
Secondary Structure Prediction: A Practical Guide in RNA
Biochemistry and Biotechnology pp. 11-43, J. Barciszewski & B.
F. C. Clark, eds. (NATO ASI Series, Kluwer Academic Publishers,
1999) and Mathews et al. 1999 J. Mol. Biol. 288: 911-940); RNAmotif
(Macke et al. 2001, Nucleic Acids Res. 29: 4724-4735; and the
Vienna RNA package (Hofacker et al. 1994, Monatsh. Chem. 125:
167-188).
[0149] Further examples of the application of such techniques can
be found in several review articles, such as Rotivinen et al.,
1988, Acta Pharmaceutical Fennica 97:159-166; Ripka, 1998, New
Scientist 54-57; McKinaly & Rossmann, 1989, Annu. Rev.
Pharmacol. Toxiciol. 29:111-122; Perry & Davies, QSAR:
Quantitative Structure-Activity Relationships in Drug Design pp.
189-193 (Alan R. Liss, Inc. 1989); Lewis & Dean, 1989, Proc. R.
Soc. Lond. 236:125-140 and 141-162; Askew et al., 1989, J. Am.
Chem. Soc. 111: 1082-1090. Molecular modeling tools employed may
include those from Tripos, Inc., St. Louis, Mo. (e.g., Sybyl/UNITY,
CONCORD, DiverseSolutions), Accelerys, San Diego, Calif. (e.g.,
Catalyst, Wisconsin Package {BLAST, etc.}), Schrodinger, Portland,
Oreg. (e.g., QikProp QikFit, Jaguar) or other such vendors as
BioDesign, Inc. (Pasadena, Calif.), Allelix, Inc. (Mississauga,
Ontario, Canada), and Hypercube, Inc. (Cambridge, Ontario, Canada),
and may include privately designed and/or "academic" software (e.g.
RNAMotif, MFOLD). These application suites and programs include
tools for the atomistic construction and analysis of structural
models for drug-like molecules, proteins, and DNA or RNA and their
potential interactions. They also provide for the calculation of
important physical properties, such as solubility estimates,
permeability metrics, and empirical measures of molecular
"druggability" (e.g., Lipinski "Rule of 5" as described by Lipinski
et al. 1997, Adv. Drug Delivery Rev. 23: 3-25). Most importantly,
they provide appropriate metrics and statistical modeling power
(such as the patented CoMFA technology in Sybyl as described in
U.S. Pat. Nos. 6,240,374 and 6,185,506) to develop Quantitative
Structural Activity Relationships (QSARs) which are used to guide
the synthesis of more efficacious clinical development candidates
while improving desirable physical properties, as determined by
results from the aforementioned secondary screening protocols.
5.8. Use of Identified Compounds That Bind RNA to Treat/Prevent
Disease
[0150] Biologically active compounds identified using the methods
of the invention or a pharmaceutically acceptable salt thereof can
be administered to a patient, preferably a mammal, more preferably
a human, suffering from a disease whose progression is associated
with a target RNA:host cell factor interaction in vivo. In certain
embodiments, such compounds or a pharmaceutically acceptable salt
thereof is administered to a patient, preferably a mammal, more
preferably a human, as a preventative measure against a disease
associated with an RNA:host cell factor interaction in vivo.
[0151] In one embodiment, "treatment" or "treating" refers to an
amelioration of a disease, or at least one discernible symptom
thereof. In another embodiment, "treatment" or "treating" refers to
an amelioration of at least one measurable physical parameter, not
necessarily discernible by the patient. In yet another embodiment,
"treatment" or "treating" refers to inhibiting the progression of a
disease, either physically, e.g., stabilization of a discernible
symptom, physiologically, e.g., stabilization of a physical
parameter, or both. In yet another embodiment, "treatment" or
"treating" refers to delaying the onset of a disease.
[0152] In certain embodiments, the compound or a pharmaceutically
acceptable salt thereof is administered to a patient, preferably a
manmial, more preferably a human, as a preventative measure against
a disease associated with an RNA:host cell factor interaction in
vivo. As used herein, "prevention" or "preventing" refers to a
reduction of the risk of acquiring a disease. In one embodiment,
the compound or a pharmaceutically acceptable salt thereof is
administered as a preventative measure to a patient. According to
this embodiment, the patient can have a genetic predisposition to a
disease, such as a family history of the disease, or a non-genetic
predisposition to the disease. Accordingly, the compound and
pharmaceutically acceptable salts thereof can be used for the
treatment of one manifestation of a disease and prevention of
another.
[0153] When administered to a patient, the compound or a
pharmaceutically acceptable salt thereof is preferably administered
as component of a composition that optionally comprises a
pharmaceutically acceptable vehicle. The composition can be
administered orally, or by any other convenient route, for example,
by infusion or bolus injection, by absorption through epithelial or
mucocutaneous linings (e.g., oral mucosa, rectal, and intestinal
mucosa, etc.) and may be administered together with another
biologically active agent. Administration can be systemic or local.
Various delivery systems are known, e.g., encapsulation in
liposomes, microparticles, microcapsules, capsules, etc., and can
be used to administer the compound and pharmaceutically acceptable
salts thereof.
[0154] Methods of administration include but are not limited to
intradermal, intramuscular, intraperitoneal, intravenous,
subcutaneous, intranasal, epidural, oral, sublingual, intranasal,
intracerebral, intravaginal, transdermal, rectally, by inhalation,
or topically, particularly to the ears, nose, eyes, or skin. The
mode of administration is left to the discretion of the
practitioner. In most instances, administration will result in the
release of the compound or a pharmaceutically acceptable salt
thereof into the bloodstream.
[0155] In specific embodiments, it may be desirable to administer
the compound or a pharmaceutically acceptable salt thereof locally.
This may be achieved, for example, and not by way of limitation, by
local infusion during surgery, topical application, e.g., in
conjunction with a wound dressing after surgery, by injection, by
means of a catheter, by means of a suppository, or by means of an
implant, said implant being of a porous, non-porous, or gelatinous
material, including membranes, such as sialastic membranes, or
fibers.
[0156] In certain embodiments, it may be desirable to introduce the
compound or a pharmaceutically acceptable salt thereof into the
central nervous system by any suitable route, including
intraventricular, intrathecal and epidural injection.
Intraventricular injection may be facilitated by an
intraventricular catheter, for example, attached to a reservoir,
such as an Ommaya reservoir.
[0157] Pulmonary administration can also be employed, e.g., by use
of an inhaler or nebulizer, and formulation with an aerosolizing
agent, or via perfusion in a fluorocarbon or synthetic pulmonary
surfactant. In certain embodiments, the compound and
pharmaceutically acceptable salts thereof can be formulated as a
suppository, with traditional binders and vehicles such as
triglycerides.
[0158] In another embodiment, the compound and pharmaceutically
acceptable salts thereof can be delivered in a vesicle, in
particular a liposome (see Langer, 1990, Science 249:1527-1533;
Treat et al., in Liposomes in the Therapy of Infectious Disease and
Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp.
353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally
ibid.).
[0159] In yet another embodiment, the compound and pharmaceutically
acceptable salts thereof can be delivered in a controlled release
system (see, e.g., Goodson, in Medical Applications of Controlled
Release, supra, vol. 2, pp. 115-138 (1984)). Other
controlled-release systems discussed in the review by Langer, 1990,
Science 249:1527-1533) may be used. In one embodiment, a pump may
be used (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed.
Eng. 14:201; Buchwald et al., 1980, Surgery 88:507 Saudek et al,
1989, N. Engl. J. Med. 321:574). In another embodiment, polymeric
materials can be used (see Medical Applications of Controlled
Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla.
(1974); Controlled Drug Bioavailability, Drug Product Design and
Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger
and Peppas, 1983, J. Macromol. Sci. Rev. Macromol. Chem. 23:61; see
also Levy et al., 1985, Science 228:190; During et al., 1989, Ann.
Neurol. 25:351; Howard etal., 1989, J. Neurosurg. 71:105). In yet
another embodiment, a controlled-release system can be placed in
proximity of a target RNA of the compound or a pharmaceutically
acceptable salt thereof, thus requiring only a fraction of the
systemic dose.
[0160] Compositions comprising the compound or a pharmaceutically
acceptable salt thereof ("compound compositions") can additionally
comprise a suitable amount of a pharmaceutically acceptable vehicle
so as to provide the form for proper administration to the
patient.
[0161] In a specific embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, mammals, and
more particularly in humans. The term "vehicle" refers to a
diluent, adjuvant, excipient, or carrier with which a compound of
the invention is administered. Such pharmaceutical vehicles can be
liquids, such as water and oils, including those of petroleum,
animal, vegetable or synthetic origin, such as peanut oil, soybean
oil, mineral oil, sesame oil and the like. The pharmaceutical
vehicles can be saline, gum acacia, gelatin, starch paste, talc,
keratin, colloidal silica, urea, and the like. In addition,
auxiliary, stabilizing, thickening, lubricating and coloring agents
may be used. When administered to a patient, the pharmaceutically
acceptable vehicles are preferably sterile. Water is a preferred
vehicle when the compound of the invention is administered
intravenously. Saline solutions and aqueous dextrose and glycerol
solutions can also be employed as liquid vehicles, particularly for
injectable solutions. Suitable pharmaceutical vehicles also include
excipients such as starch, glucose, lactose, sucrose, gelatin,
malt, rice, flour, chalk, silica gel, sodium stearate, glycerol
monostearate, talc, sodium chloride, dried skim milk, glycerol,
propylene, glycol, water, ethanol and the like. Compound
compositions, if desired, can also contain minor amounts of wetting
or emulsifying agents, or pH buffering agents.
[0162] Compound compositions can take the form of solutions,
suspensions, emulsion, tablets, pills, pellets, capsules, capsules
containing liquids, powders, sustained-release formulations,
suppositories, emulsions, aerosols, sprays, suspensions, or any
other form suitable for use. In one embodiment, the
pharmaceutically acceptable vehicle is a capsule (see e.g., U.S.
Pat. No. 5,698,155). Other examples of suitable pharmaceutical
vehicles are described in Remington's Pharmaceutical Sciences,
Alfonso R. Gennaro, ed., Mack Publishing Co. Easton, Pa., 19th ed.,
1995, pp. 1447 to 1676, incorporated herein by reference.
[0163] In a preferred embodiment, the compound or a
pharmaceutically acceptable salt thereof is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for oral administration to human beings. Compositions for
oral delivery may be in the form of tablets, lozenges, aqueous or
oily suspensions, granules, powders, emulsions, capsules, syrups,
or elixirs, for example. Orally administered compositions may
contain one or more agents, for example, sweetening agents such as
fructose, aspartame or saccharin; flavoring agents such as
peppermint, oil of wintergreen, or cherry; coloring agents; and
preserving agents, to provide a pharmaceutically palatable
preparation. Moreover, where in tablet or pill form, the
compositions can be coated to delay disintegration and absorption
in the gastrointestinal tract thereby providing a sustained action
over an extended period of time. Selectively permeable membranes
surrounding an osmotically active driving compound are also
suitable for orally administered compositions. In these later
platforms, fluid from the environment surrounding the capsule is
imbibed by the driving compound, which swells to displace the agent
or agent composition through an aperture. These delivery platforms
can provide an essentially zero order delivery profile as opposed
to the spiked profiles of immediate release formulations. A time
delay material such as glycerol monostearate or glycerol stearate
may also be used. Oral compositions can include standard vehicles
such as mannitol, lactose, starch, magnesium stearate, sodium
saccharine, cellulose, magnesium carbonate, and the like. Such
vehicles are preferably of pharmaceutical grade. Typically,
compositions for intravenous administration comprise sterile
isotonic aqueous buffer. Where necessary, the compositions may also
include a solubilizing agent.
[0164] In another embodiment, the compound or a pharmaceutically
acceptable salt thereof can be formulated for intravenous
administration. Compositions for intravenous administration may
optionally include a local anesthetic such as lignocaine to lessen
pain at the site of the injection. Generally, the ingredients are
supplied either separately or mix ed together in unit dosage form,
for example, as a dry lyophilized powder or water-free concentrate
in a hermetically sealed container such as an ampoule or sachette
indicating the quantity of active agent. Where the compound or a
pharmaceutically acceptable salt thereof is to be administered by
infusion, it can be dispensed, for example, with an infusion bottle
containing sterile pharmaceutical grade water or saline. Where the
compound or a pharmaceutically acceptable salt thereof is
administered by injection, an ampoule of sterile water for
injection or saline can be provided so that the ingredients may be
mixed prior to administration.
[0165] The amount of a compound or a pharmaceutically acceptable
salt thereof that will be effective in the treatment of a
particular disease will depend on the nature of the disease, and
can be determined by standard clinical techniques. In addition, in
vitro or in vivo assays may optionally be employed to help identify
optimal dosage ranges. The precise dose to be employed will also
depend on the route of administration, and the seriousness of the
disease, and should be decided according to the judgment of the
practitioner and each patient's circumstances. However, suitable
dosage ranges for oral administration are generally about 0.001
milligram to about 200 milligrams of a compound or a
pharmaceutically acceptable salt thereof per kilogram body weight
per day. In specific preferred embodiments of the invention, the
oral dose is about 0.01 milligram to about 100 milligrams per
kilogram body weight per day, more preferably about 0.1 milligram
to about 75 milligrams per kilogram body weight per day, more
preferably about 0.5 milligram to 5 milligrams per kilogram body
weight per day. The dosage amounts described herein refer to total
amounts administered; that is, if more than one compound is
administered, or if a compound is administered with a therapeutic
agent, then the preferred dosages correspond to the total amount
administered. Oral compositions preferably contain about 10% to
about 95% active ingredient by weight.
[0166] Suitable dosage ranges for intravenous (i.v.) administration
are about 0.01 milligram to about 100 milligrams per kilogram body
weight per day, about 0.1 milligram to about 35 milligrams per
kilogram body weight per day, and about 1 milligram to about 10
milligrams per kilogram body weight per day. Suitable dosage ranges
for intranasal administration are generally about 0.01 pg/kg body
weight per day to about 1 mg/kg body weight per day. Suppositories
generally contain about 0.01 milligram to about 50 milligrams of a
compound of the invention per kilogram body weight per day and
comprise active ingredient in the range of about 0.5% to about 10%
by weight.
[0167] Recommended dosages for intradermal, intramuscular,
intraperitoneal, subcutaneous, epidural, sublingual, intracerebral,
intravaginal, transdermal administration or administration by
inhalation are in the range of about 0.001 milligram to about 200
milligrams per kilogram of body weight per day. Suitable doses for
topical administration are in the range of about 0.001 milligram to
about 1 milligram, depending on the area of administration.
Effective doses may be extrapolated from dose-response curves
derived from in vitro or animal model test systems. Such animal
models and systems are well known in the art.
[0168] The compound and pharmaceutically acceptable salts thereof
are preferably assayed in vitro and in vivo, for the desired
therapeutic or prophylactic activity, prior to use in humans. For
example, in vitro assays can be used to determine whether it is
preferable to administer the compound, a pharmaceutically
acceptable salt thereof, and/or another therapeutic agent. Animal
model systems can be used to demonstrate safety and efficacy.
[0169] A variety of compounds can be used for treating or
preventing diseases in mammals. Types of compounds include, but are
not limited to, peptides, peptide analogs including peptides
comprising non-natural amino acids, e.g., D-amino acids,
phosphorous analogs of amino acids, such as a-amino phosphonic
acids and a-amino phosphinic acids, or amino acids having
non-peptide linkages, nucleic acids, nucleic acid analogs such as
phosphorothioates or peptide nucleic acids ("PNAs"), hormones,
antigens, synthetic or naturally occurring drugs, opiates,
dopamine, serotonin, catecholamines, thrombin, acetylcholine,
prostaglandins, organic molecules, pheromones, adenosine, sucrose,
glucose, lactose and galactose.
6. EXAMPLE: THERAPEUTIC TARGETS
[0170] The therapeutic targets presented herein are by way of
example, and the present invention is not to be limited by the
targets described herein. The therapeutic targets presented herein
as DNA sequences are understood by one of skill in the art that the
sequences can be converted to RNA sequences.
6.1. Tumor Necrosis Factor Alpha ("TNF-.alpha.")
[0171] GenBank Accession # X01394:
2 1 gcagaggacc agctaagagg gagagaagca actacagacc ccccctgaaa
acaaccctca (SEQ ID NO: 6) 61 gacgccacat cccctgacaa gctgccaggc
aggttctctt cctctcacat actgacccac 121 ggctccaccc tctctcccct
ggaaaggaca ccatgagcac tgaaagcatg atccgggacg 181 tggagctggc
cgaggaggcg ctccccaaga agacaggggg gccccagggc tccaggcggt 241
gcttgttcct cagcctcttc tccttcctga tcgtggcagg cgccaccacg ctcttctgcc
301 tgctgcactt tggagtgatc ggcccccaga gggaagagtt ccccagggac
ctctctctaa 361 tcagccctct ggcccaggca gtcagatcat cttctcgaac
cccgagtgac aagcctgtag 421 cccatgttgt agcaaaccct caagctgagg
ggcagctcca gtggctgaac cgccgggcca 481 atgccctcct ggccaatggc
gtggagctga gagataacca gctggtggtg ccatcagagg 541 gcctgtacct
catctactcc caggtcctct tcaagggcca aggctgcccc tccacccatg 601
tgctcctcac ccacaccatc agccgcatcg ccgtctccta ccagaccaag gtcaacctcc
661 tctctgccat caagagcccc tgccagaggg agaccccaga gggggctgag
gccaagccct 721 ggtatgagcc catctatctg ggaggggtct tccagctgga
gaagggtgac cgactcagcg 781 ctgagatcaa tcggcccgac tatctcgact
ttgccgagtc tgggcaggtc tactttggga 841 tcattgccct gtgaggagga
cgaacatcca accttcccaa acgcctcccc tgccccaatc 901 cctttattac
cccctccttc agacaccctc aacctcttct ggctcaaaaa gagaattggg 961
ggcttagggt cggaacccaa gcttagaact ttaagcaaca agaccaccac ttcgaaacct
1021 gggattcagg aatgtgtggc ctgcacagtg aattgctggc aaccactaag
aattcaaact 1081 ggggcctcca gaactcactg gggcctacag ctttgatccc
tgacatctgg aatctggaga 1141 ccagggagcc tttggttctg gccagaatgc
tgcaggactt gagaagacct cacctagaaa 1201 ttgacacaag tggaccttag
gccttcctct ctccagatgt ttccagactt ccttgagaca 1261 cggagcccag
ccctccccat ggagccagct ccctctattt atgtttgcac ttgtgattat 1321
ttattattta tttattattt atttatttac agatgaatgt atttatttgg gagaccgggg
1381 tatcctgggg gacccaatgt aggagctgcc ttggctcaga catgttttcc
gtgaaaacgg 1441 agctgaacaa taggctgttc ccatgtagcc ccctggcctc
tgtgccttct tttgattatg 1501 ttttttaaaa tatttatctg attaagttgt
ctaaacaatg ctgatttggt gaccaactgt 1561 cactcattgc tgagcctctg
ctccccaggg gagttgtgtc tgtaatcgcc ctactattca 1621 gtggcgagaa
ataaagtttg ctt
[0172] General Target Regions:
[0173] (1) 5' Untranslated Region--nts 1-152
[0174] (2) 3' Untranslated Region--nts 852-1643
[0175] Initial Specific Target Motif:
3 Group I AU-Rich Element (ARE) Cluster in 3' untranslated region
5' AUUUAUUUAUUUAUUUAUUUA 3' (SEQ ID NO: 1)
6.2. Granulocyte-macrophage Colony Stimulating Factor
("GM-CSF")
[0176] GenBank Accession #NM.sub.--000758:
4 1 gctggaggat gtggctgcag agcctgctgc tcttgggcac tgtggcctgc
agcatctctg (SEQ ID NO: 7) 61 cacccgcccg ctcgcccagc cccagcacgc
agccctggga gcatgtgaat gccatccagg 121 aggcccggcg tctcctgaac
ctgagtagag acactgctgc tgagatgaat gaaacagtag 181 aagtcatctc
agaaatgttt gacctccagg agccgacctg cctacagacc cgcctggagc 241
tgtacaagca gggcctgcgg ggcagcctca ccaagctcaa gggccccttg accatgatgg
301 ccagccacta caagcagcac tgccctccaa ccccggaaac ttcctgtgca
acccagacta 361 tcacctttga aagtttcaaa gagaacctga aggactttct
gcttgtcatc ccctttgact 421 gctgggagcc agtccaggag tgagaccggc
cagatgaggc tggccaagcc ggggagctgc 481 tctctcatga aacaagagct
agaaactcag gatggtcatc ttggagggac caaggggtgg 541 gccacagcca
tggtgggagt ggcctggacc tgccctgggc cacactgacc ctgatacagg 601
catggcagaa gaatgggaat attttatact gacagaaatc agtaatattt atatatttat
661 atttttaaaa tatttattta tttatttatt taagttcata ttccatattt
attcaagatg 721 ttttaccgta ataattatta ttaaaaatat gcttct
[0177] GenBank Accession #XM.sub.--003751:
5 1 tctggaggat gtggctgcag agcctgctgc tcttgggcac tgtggcctgc
agcatctctg (SEQ ID NO: 8) 61 cacccgcccg ctcgcccagc cccagcacgc
agccctggga gcatgtgaat gccatccagg 121 aggcccggcg tctcctgaac
ctgagtagag acactgctgc tgagatgaat gaaacagtag 181 aagtcatctc
agaaatgttt gacctccagg agccgacctg cctacagacc cgcctggagc 241
tgtacaagca gggcctgcgg ggcagcctca ccaagctcaa gggccccttg accatgatgg
301 ccagccacta caagcagcac tgccctccaa ccccggaaac ttcctgtgca
acccagacta 361 tcacctttga aagtttcaaa gagaacctga aggactttct
gcttgtcatc ccctttgact 421 gctgggagcc agtccaggag tgagaccggc
cagatgaggc tggccaagcc ggggagctgc 481 tctctcatga aacaagagct
agaaactcag gatggtcatc ttggagggac caaggggtgg 541 gccacagcca
tggtgggagt ggcctggacc tgccctgggc cacactgacc ctgatacagg 601
catggcagaa gaatgggaat attttatact gacagaaatc agtaatattt atatatttat
661 atttttaaaa tatttattta tttatttatt taagttcata ttccatattt
attcaagatg 721 ttttaccgta ataattatta ttaaaaatat gcttct
[0178] General Target Regions:
[0179] (1) 5' Untranslated Region--nts 1-32
[0180] (2) 3' Untranslated Region--nts 468-789
[0181] Initial Specific Target Motif:
[0182] Group I AU-Rich Element (ARE) Cluster in 3' untranslated
region 5' AUUUAUUUAUUUAUUUAUUUA 3' (SEQ ID NO: 1)
6.3. Interleukin 2 ("IL-2")
[0183] GenBank Accession #U25676:
6 1 atcactctct ttaatcacta ctcacattaa cctcaactcc tgccacaatg
tacaggatgc (SEQ ID NO: 9) 61 aactcctgtc ttgcattgca ctaattcttg
cacttgtcac aaacagtgca cctacttcaa 121 gttcgacaaa gaaaacaaag
aaaacacagc tacaactgga gcatttactg ctggatttac 181 agatgatttt
gaatggaatt aataattaca agaatcccaa actcaccagg atgctcacat 241
ttaagtttta catgcccaag aaggccacag aactgaaaca gcttcagtgt ctagaagaag
301 aactcaaacc tctggaggaa gtgctgaatt tagctcaaag caaaaacttt
cacttaagac 361 ccagggactt aatcagcaat atcaacgtaa tagttctgga
actaaaggga tctgaaacaa 421 cattcatgtg tgaatatgca gatgagacag
caaccattgt agaatttctg aacagatgga 481 ttaccttttg tcaaagcatc
atctcaacac taacttgata attaagtgct tcccacttaa 541 aacatatcag
gccttctatt tatttattta aatatttaaa ttttatattt attgttgaat 601
gtatggttgc tacctattgt aactattatt cttaatctta aaactataaa tatggatctt
661 ttatgattct ttttgtaagc cctaggggct ctaaaatggt ttaccttatt
tatcccaaaa 721 atatttatta ttatgttgaa tgttaaatat agtatctatg
tagattggtt agtaaaacta 781 tttaataaat ttgataaata taaaaaaaaa
aaacaaaaaa aaaaa
[0184] General Target Regions:
[0185] (1) 5' Untranslated Region--nts 1-47
[0186] (2) 3' Untranslated Region--nts 519-825
[0187] Initial Specific Target Motifs:
7 Group III AU-Rich Element (ARE) Cluster in 3' untranslated region
5'NAUUUAUUUAUUUAN 3' (SEQ ID NO: 10)
6.4. Interleukin 6 ("IL-6")
[0188] GenBank Accession #NM.sub.--000600:
8 1 ttctgccctc gagcccaccg ggaacgaaag agaagctcta tctcgcctcc
aggagcccag (SEQ ID NO: 11) 61 ctatgaactc cttctccaca agcgccttcg
gtccagttgc cttctccctg gggctgctcc 121 tggtgttgcc tgctgccttc
cctgccccag tacccccagg agaagattcc aaagatgtag 181 ccgccccaca
cagacagcca ctcacctctt cagaacgaat tgacaaacaa attcggtaca 241
tcctcgacgg catctcagcc ctgagaaagg agacatgtaa caagagtaac atgtgtgaaa
301 gcagcaaaga ggcactggca gaaaacaacc tgaaccttcc aaagatggct
gaaaaagatg 361 gatgcttcca atctggattc aatgaggaga cttgcctggt
gaaaatcatc actggtcttt 421 tggagtttga ggtataccta gagtacctcc
agaacagatt tgagagtagt gaggaacaag 481 ccagagctgt gcagatgagt
acaaaagtcc tgatccagtt cctgcagaaa aaggcaaaga 541 atctagatgc
aataaccacc cctgacccaa ccacaaatgc cagcctgctg acgaagctgc 601
aggcacagaa ccagtggctg caggacatga caactcatct cattctgcgc agctttaagg
661 agttcctgca gtccagcctg agggctcttc ggcaaatgta gcatgggcac
ctcagattgt 721 tgttgttaat gggcattcct tcttctggtc agaaacctgt
ccactgggca cagaacttat 781 gttgttctct atggagaact aaaagtatga
gcgttaggac actattttaa ttatttttaa 841 tttattaata tttaaatatg
tgaagctgag ttaatttatg taagtcatat ttatattttt 901 aagaagtacc
acttgaaaca ttttatgtat tagttttgaa ataataatgg aaagtggcta 961
tgcagtttga atatcctttg tttcagagcc agatcatttc ttggaaagtg taggcttacc
1021 tcaaataaat ggctaactta tacatatttt taaagaaata tttatattgt
atttatataa 1081 tgtataaatg gtttttatac caataaatgg cattttaaaa
aattc
[0189] General Target Regions:
[0190] (1) 5' Untranslated Region--nts 1-62
[0191] (2) 3' Untranslated Region--nts 699-1125
[0192] Initial Specific Target Motifs:
9 Group III AU-Rich Element (ARE) Cluster in 3' untranslated region
5' NAUUUAUUUAUUUAN 3' (SEQ ID NO: 10)
6.5. Vascular Endothelial Growth Factor ("VEGF")
[0193] GenBank Accession #AF022375:
10 1 aagagctcca gagagaagtc gaggaagaga gagacggggt cagagagagc
gcgcgggcgt (SEQ ID NO: 12) 61 gcgagcagcg aaagcgacag gggcaaagtg
agtgacctgc ttttgggggt gaccgccgga 121 gcgcggcgtg agccctcccc
cttgggatcc cgcagctgac cagtcgcgct gacggacaga 181 cagacagaca
ccgcccccag ccccagttac cacctcctcc ccggccggcg gcggacagtg 241
gacgcggcgg cgagccgcgg gcaggggccg gagcccgccc ccggaggcgg ggtggagggg
301 gtcggagctc gcggcgtcgc actgaaactt ttcgtccaac ttctgggctg
ttctcgcttc 361 ggaggagccg tggtccgcgc gggggaagcc gagccgagcg
gagccgcgag aagtgctagc 421 tcgggccggg aggagccgca gccggaggag
ggggaggagg aagaagagaa ggaagaggag 481 agggggccgc agtggcgact
cggcgctcgg aagccgggct catggacggg tgaggcggcg 541 gtgtgcgcag
acagtgctcc agcgcgcgcg ctccccagcc ctggcccggc ctcgggccgg 601
gaggaagagt agctcgccga ggcgccgagg agagcgggcc gccccacagc ccgagccgga
661 gagggacgcg agccgcgcgc cccggtcggg cctccgaaac catgaacttt
ctgctgtctt 721 gggtgcattg gagccttgcc ttgctgctct acctccacca
tgccaagtgg tcccaggctg 781 cacccatggc agaaggagga gggcagaatc
atcacgaagt ggtgaagttc atggatgtct 841 atcagcgcag ctactgccat
ccaatcgaga ccctggtgga catcttccag gagtaccctg 901 atgagatcga
gtacatcttc aagccatcct gtgtgcccct gatgcgatgc gggggctgct 961
ccaatgacga gggcctggag tgtgtgccca ctgaggagtc caacatcacc atgcagatta
1021 tgcggatcaa acctcaccaa ggccagcaca taggagagat gagcttccta
cagcacaaca 1081 aatgtgaatg cagaccaaag aaagatagag caagacaaga
aaatccctgt gggccttgct 1141 cagagcggag aaagcatttg tttgtacaag
atccgcagac gtgtaaatgt tcctgcaaaa 1201 acacacactc gcgttgcaag
gcgaggcagc ttgagttaaa cgaacgtact tgcagatgtg 1261 acaagccgag
gcggtgagcc gggcaggagg aaggagcctc cctcagggtt tcgggaacca 1321
gatctctctc caggaaagac tgatacagaa cgatcgatac agaaaccacg ctgccgccac
1381 cacaccatca ccatcgacag aacagtcctt aatccagaaa cctgaaatga
aggaagagga 1441 gactctgcgc agagcacttt gggtccggag ggcgagactc
cggcggaagc attcccgggc 1501 gggtgaccca gcacggtccc tcttggaatt
ggattcgcca ttttattttt cttgctgcta 1561 aatcaccgag cccggaagat
tagagagttt tatttctggg attcctgtag acacacccac 1621 ccacatacat
acatttatat atatatatat tatatatata taaaaataaa tatctctatt 1681
ttatatatat aaaatatata tattcttttt ttaaattaac agtgctaatg ttattggtgt
1741 cttcactgga tgtatttgac tgctgtggac ttgagttggg aggggaatgt
tcccactcag 1801 atcctgacag ggaagaggag gagatgagag actctggcat
gatctttttt ttgtcccact 1861 tggtggggcc agggtcctct cccctgccca
agaatgtgca aggccagggc atgggggcaa 1921 atatgaccca gttttgggaa
caccgacaaa cccagccctg gcgctgagcc tctctacccc 1981 aggtcagacg
gacagaaaga caaatcacag gttccgggat gaggacaccg gctctgacca 2041
ggagtttggg gagcttcagg acattgctgt gctttgggga ttccctccac atgctgcacg
2101 cgcatctcgc ccccaggggc actgcctgga agattcagga gcctgggcgg
ccttcgctta 2161 ctctcacctg cttctgagtt gcccaggagg ccactggcag
atgtcccggc gaagagaaga 2221 gacacattgt tggaagaagc agcccatgac
agcgcccctt cctgggactc gccctcatcc 2281 tcttcctgct ccccttcctg
gggtgcagcc taaaaggacc tatgtcctca caccattgaa 2341 accactagtt
ctgtcccccc aggaaacctg gttgtgtgtg tgtgagtggt tgaccttcct 2401
ccatcccctg gtccttccct tcccttcccg aggcacagag agacagggca ggatccacgt
2461 gcccattgtg gaggcagaga aaagagaaag tgttttatat acggtactta
tttaatatcc 2521 ctttttaatt agaaattaga acagttaatt taattaaaga
gtagggtttt ttttcagtat 2581 tcttggttaa tatttaattt caactattta
tgagatgtat cttttgctct ctcttgctct 2641 cttatttgta ccggtttttg
tatataaaat tcatgtttcc aatctctctc tccctgatcg 2701 gtgacagtca
ctagcttatc ttgaacagat atttaatttt gctaacactc agctctgccc 2761
tccccgatcc cctggctccc cagcacacat tcctttgaaa gagggtttca atatacatct
2821 acatactata tatatattgg gcaacttgta tttgtgtgta tatatatata
tatatgttta 2881 tgtatatatg tgatcctgaa aaaataaaca tcgctattct
gttttttata tgttcaaacc 2941 aaacaagaaa aaatagagaa ttctacatac
taaatctctc tcctttttta attttaatat 3001 ttgttatcat ttatttattg
gtgctactgt ttatccgtaa taattgtggg gaaaagatat 3061 taacatcacg
tctttgtctc tagtgcagtt tttcgagata ttccgtagta catatttatt 3121
tttaaacaac gacaaagaaa tacagatata tcttaaaaaa aaaaaa
[0194] General Target Regions:
[0195] (1) 5' Untranslated Region--nts 1-701
[0196] (2) 3' Untranslated Region--nts 1275-3166
[0197] Initial Specific Target Motifs:
11 (1) Internal Ribosome Entry Site (IRES) in 5' untranslated
region nts 513-704 5'CCGGGCUCAUGGACGGGUGAGGCGGCGGUGUGCGCAGACAGU
(SEQ ID NO: 13) GCUCCAGCGCGCGCGCUCCCCAGCCCUGGCCCGGCCUCGG- GCCG
GGAGGAAGAGUAGCUCGCCGAGGCGCCGAGGAGAGCGGGCCGC
CCCACAGCCCGAGCCGGAGAGGGACGCGAGCCGCGCGCCCCGGU
CGGGCCUCCGAAACCAUGAACUUUCUGCUGUCUUGGGUGCAUU
GGAGCCUUGCCUUGCUGCUCUACCUCCACCAUG 3' (2) Group III AU-Rich Element
(ARE) Cluster in 3' untranslated region 5' NAUUUAUUUAUUUAN 3' (SEQ
ID NO: 10)
6.6. Human Immunodeficiency Virus I ("HIV-1")
[0198] GenBank Accession #NC.sub.--001802:
12 1 ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta
gggaacccac (SEQ ID NO: 14) 61 tgcttaagcc tcaataaagc ttgccttgag
tgcttcaagt agtgtgtgcc cgtctgttgt 121 gtgactctgg taactagaga
tccctcagac ccttttagtc agtgtggaaa atctctagca 181 gtggcgcccg
aacagggacc tgaaagcgaa agggaaacca gaggagctct ctcgacgcag 241
gactcggctt gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc
301 aaaaattttg actagcggag gctagaagga gagagatggg tgcgagagcg
tcagtattaa 361 gcgggggaga attagatcga tgggaaaaaa ttcggttaag
gccaggggga aagaaaaaat 421 ataaattaaa acatatagta tgggcaagca
gggagctaga acgattcgca gttaatcctg 481 gcctgttaga aacatcagaa
ggctgtagac aaatactggg acagctacaa ccatcccttc 541 agacaggatc
agaagaactt agatcattat ataatacagt agcaaccctc tattgtgtgc 601
atcaaaggat agagataaaa gacaccaagg aagctttaga caagatagag gaagagcaaa
661 acaaaagtaa gaaaaaagca cagcaagcag cagctgacac aggacacagc
aatcaggtca 721 gccaaaatta ccctatagtg cagaacatcc aggggcaaat
ggtacatcag gccatatcac 781 ctagaacttt aaatgcatgg gtaaaagtag
tagaagagaa ggctttaagc ccagaagtga 841 tacccatgtt ttcagcatta
tcagaaggag ccaccccaca agatttaaac accatgctaa 901 acacagtggg
gggacatcaa gcagccatgc aaatgttaaa agagaccatc aatgaggaag 961
ctgcagaatg ggatagagtg catccagtgc atgcagggcc tattgcacca ggccagatga
1021 gagaaccaag gggaagtgac atagcaggaa ctactagtac ccttcaggaa
caaataggat 1081 ggatgacaaa taatccacct atcccagtag gagaaattta
taaaagatgg ataatcctgg 1141 gattaaataa aatagtaaga atgtatagcc
ctaccagcat tctggacata agacaaggac 1201 caaaggaacc ctttagagac
tatgtagacc ggttctataa aactctaaga gccgagcaag 1261 cttcacagga
ggtaaaaaat tggatgacag aaaccttgtt ggtccaaaat gcgaacccag 1321
attgtaagac tattttaaaa gcattgggac cagcggctac actagaagaa atgatgacag
1381 catgtcaggg agtaggagga cccggccata aggcaagagt tttggctgaa
gcaatgagcc 1441 aagtaacaaa ttcagctacc ataatgatgc agagaggcaa
ttttaggaac caaagaaaga 1501 ttgttaagtg tttcaattgt ggcaaagaag
ggcacacagc cagaaattgc agggccccta 1561 ggaaaaaggg ctgttggaaa
tgtggaaagg aaggacacca aatgaaagat tgtactgaga 1621 gacaggctaa
ttttttaggg aagatctggc cttcctacaa gggaaggcca gggaattttc 1681
ttcagagcag accagagcca acagccccac cagaagagag cttcaggtct ggggtagaga
1741 caacaactcc ccctcagaag caggagccga tagacaagga actgtatcct
ttaacttccc 1801 tcaggtcact ctttggcaac gacccctcgt cacaataaag
ataggggggc aactaaagga 1861 agctctatta gatacaggag cagatgatac
agtattagaa gaaatgagtt tgccaggaag 1921 atggaaacca aaaatgatag
ggggaattgg aggttttatc aaagtaagac agtatgatca 1981 gatactcata
gaaatctgtg gacataaagc tataggtaca gtattagtag gacctacacc 2041
tgtcaacata attggaagaa atctgttgac tcagattggt tgcactttaa attttcccat
2101 tagccctatt gagactgtac cagtaaaatt aaagccagga atggatggcc
caaaagttaa 2161 acaatggcca ttgacagaag aaaaaataaa agcattagta
gaaatttgta cagagatgga 2221 aaaggaaggg aaaatttcaa aaattgggcc
tgaaaatcca tacaatactc cagtatttgc 2281 cataaagaaa aaagacagta
ctaaatggag aaaattagta gatttcagag aacttaataa 2341 gagaactcaa
gacttctggg aagttcaatt aggaatacca catcccgcag ggttaaaaaa 2401
gaaaaaatca gtaacagtac tggatgtggg tgatgcatat ttttcagttc ccttagatga
2461 agacttcagg aagtatactg catttaccat acctagtata aacaatgaga
caccagggat 2521 tagatatcag tacaatgtgc ttccacaggg atggaaagga
tcaccagcaa tattccaaag 2581 tagcatgaca aaaatcttag agccttttag
aaaacaaaat ccagacatag ttatctatca 2641 atacatggat gatttgtatg
taggatctga cttagaaata gggcagcata gaacaaaaat 2701 agaggagctg
agacaacatc tgttgaggtg gggacttacc acaccagaca aaaaacatca 2761
gaaagaacct ccattccttt ggatgggtta tgaactccat cctgataaat ggacagtaca
2821 gcctatagtg ctgccagaaa aagacagctg gactgtcaat gacatacaga
agttagtggg 2881 gaaattgaat tgggcaagtc agatttaccc agggattaaa
gtaaggcaat tatgtaaact 2941 ccttagagga accaaagcac taacagaagt
aataccacta acagaagaag cagagctaga 3001 actggcagaa aacagagaga
ttctaaaaga accagtacat ggagtgtatt atgacccatc 3061 aaaagactta
atagcagaaa tacagaagca ggggcaaggc caatggacat atcaaattta 3121
tcaagagcca tttaaaaatc tgaaaacagg aaaatatgca agaatgaggg gtgcccacac
3181 taatgatgta aaacaattaa cagaggcagt gcaaaaaata accacagaaa
gcatagtaat 3241 atggggaaag actcctaaat ttaaactgcc catacaaaag
gaaacatggg aaacatggtg 3301 gacagagtat tggcaagcca cctggattcc
tgagtgggag tttgttaata cccctccctt 3361 agtgaaatta tggtaccagt
tagagaaaga acccatagta ggagcagaaa ccttctatgt 3421 agatggggca
gctaacaggg agactaaatt aggaaaagca ggatatgtta ctaatagagg 3481
aagacaaaaa gttgtcaccc taactgacac aacaaatcag aagactgagt tacaagcaat
3541 ttatctagct ttgcaggatt cgggattaga agtaaacata gtaacagact
cacaatatgc 3601 attaggaatc attcaagcac aaccagatca aagtgaatca
gagttagtca atcaaataat 3661 agagcagtta ataaaaaagg aaaaggtcta
tctggcatgg gtaccagcac acaaaggaat 3721 tggaggaaat gaacaagtag
ataaattagt cagtgctgga atcaggaaag tactattttt 3781 agatggaata
gataaggccc aagatgaaca tgagaaatat cacagtaatt ggagagcaat 3841
ggctagtgat tttaacctgc cacctgtagt agcaaaagaa atagtagcca gctgtgataa
3901 atgtcagcta aaaggagaag ccatgcatgg acaagtagac tgtagtccag
gaatatggca 3961 actagattgt acacatttag aaggaaaagt tatcctggta
gcagttcatg tagccagtgg 4021 atatatagaa gcagaagtta ttccagcaga
aacagggcag gaaacagcat attttctttt 4081 aaaattagca ggaagatggc
cagtaaaaac aatacatact gacaatggca gcaatttcac 4141 cggtgctacg
gttagggccg cctgttggtg ggcgggaatc aagcaggaat ttggaattcc 4201
ctacaatccc caaagtcaag gagtagtaga atctatgaat aaagaattaa agaaaattat
4261 aggacaggta agagatcagg ctgaacatct taagacagca gtacaaatgg
cagtattcat 4321 ccacaatttt aaaagaaaag gggggattgg ggggtacagt
gcaggggaaa gaatagtaga 4381 cataatagca acagacatac aaactaaaga
attacaaaaa caaattacaa aaattcaaaa 4441 ttttcgggtt tattacaggg
acagcagaaa tccactttgg aaaggaccag caaagctcct 4501 ctggaaaggt
gaaggggcag tagtaataca agataatagt gacataaaag tagtgccaag 4561
aagaaaagca aagatcatta gggattatgg aaaacagatg gcaggtgatg attgtgtggc
4621 aagtagacag gatgaggatt agaacatgga aaagtttagt aaaacaccat
atgtatgttt 4681 cagggaaagc taggggatgg ttttatagac atcactatga
aagccctcat ccaagaataa 4741 gttcagaagt acacatccca ctaggggatg
ctagattggt aataacaaca tattggggtc 4801 tgcatacagg agaaagagac
tggcatttgg gtcagggagt ctccatagaa tggaggaaaa 4861 agagatatag
cacacaagta gaccctgaac tagcagacca actaattcat ctgtattact 4921
ttgactgttt ttcagactct gctataagaa aggccttatt aggacacata gttagcccta
4981 ggtgtgaata tcaagcagga cataacaagg taggatctct acaatacttg
gcactagcag 5041 cattaataac accaaaaaag ataaagccac ctttgcctag
tgttacgaaa ctgacagagg 5101 atagatggaa caagccccag aagaccaagg
gccacagagg gagccacaca atgaatggac 5161 actagagctt ttagaggagc
ttaagaatga agctgttaga cattttccta ggatttggct 5221 ccatggctta
gggcaacata tctatgaaac ttatggggat acttgggcag gagtggaagc 5281
cataataaga attctgcaac aactgctgtt tatccatttt cagaattggg tgtcgacata
5341 gcagaatagg cgttactcga cagaggagag caagaaatgg agccagtaga
tcctagacta 5401 gagccctgga agcatccagg aagtcagcct aaaactgctt
gtaccaattg ctattgtaaa 5461 aagtgttgct ttcattgcca agtttgtttc
ataacaaaag ccttaggcat ctcctatggc 5521 aggaagaagc ggagacagcg
acgaagagct catcagaaca gtcagactca tcaagcttct 5581 ctatcaaagc
agtaagtagt acatgtaatg caacctatac caatagtagc aatagtagca 5641
ttagtagtag caataataat agcaatagtt gtgtggtcca tagtaatcat agaatatagg
5701 aaaatattaa gacaaagaaa aatagacagg ttaattgata gactaataga
aagagcagaa 5761 gacagtggca atgagagtga aggagaaata tcagcacttg
tggagatggg ggtggagatg 5821 gggcaccatg ctccttggga tgttgatgat
ctgtagtgct acagaaaaat tgtgggtcac 5881 agtctattat ggggtacctg
tgtggaagga agcaaccacc actctatttt gtgcatcaga 5941 tgctaaagca
tatgatacag aggtacataa tgtttgggcc acacatgcct gtgtacccac 6001
agaccccaac ccacaagaag tagtattggt aaatgtgaca gaaaatttta acatgtggaa
6061 aaatgacatg gtagaacaga tgcatgagga tataatcagt ttatgggatc
aaagcctaaa 6121 gccatgtgta aaattaaccc cactctgtgt tagtttaaag
tgcactgatt tgaagaatga 6181 tactaatacc aatagtagta gcgggagaat
gataatggag aaaggagaga taaaaaactg 6241 ctctttcaat atcagcacaa
gcataagagg taaggtgcag aaagaatatg cattttttta 6301 taaacttgat
ataataccaa tagataatga tactaccagc tataagttga caagttgtaa 6361
cacctcagtc attacacagg cctgtccaaa ggtatccttt gagccaattc ccatacatta
6421 ttgtgccccg gctggttttg cgattctaaa atgtaataat aagacgttca
atggaacagg 6481 accatgtaca aatgtcagca cagtacaatg tacacatgga
attaggccag tagtatcaac 6541 tcaactgctg ttaaatggca gtctagcaga
agaagaggta gtaattagat ctgtcaattt 6601 cacggacaat gctaaaacca
taatagtaca gctgaacaca tctgtagaaa ttaattgtac 6661 aagacccaac
aacaatacaa gaaaaagaat ccgtatccag agaggaccag ggagagcatt 6721
tgttacaata ggaaaaatag gaaatatgag acaagcacat tgtaacatta gtagagcaaa
6781 atggaataac actttaaaac agatagctag caaattaaga gaacaatttg
gaaataataa 6841 aacaataatc tttaagcaat cctcaggagg ggacccagaa
attgtaacgc acagttttaa 6901 ttgtggaggg gaatttttct actgtaattc
aacacaactg tttaatagta cttggtttaa 6961 tagtacttgg agtactgaag
ggtcaaataa cactgaagga agtgacacaa tcaccctccc 7021 atgcagaata
aaacaaatta taaacatgtg gcagaaagta ggaaaagcaa tgtatgcccc 7081
tcccatcagt ggacaaatta gatgttcatc aaatattaca gggctgctat taacaagaga
7141 tggtggtaat agcaacaatg agtccgagat cttcagacct ggaggaggag
atatgaggga 7201 caattggaga agtgaattat ataaatataa agtagtaaaa
attgaaccat taggagtagc 7261 acccaccaag gcaaagagaa gagtggtgca
gagagaaaaa agagcagtgg gaataggagc 7321 tttgttcctt gggttcttgg
gagcagcagg aagcactatg ggcgcagcct caatgacgct 7381 gacggtacag
gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 7441
ggctattgag gcgcaacagc atctgttgca actcacagtc tggggcatca agcagctcca
7501 ggcaagaatc ctggctgtgg aaagatacct aaaggatcaa cagctcctgg
ggatttgggg 7561 ttgctctgga aaactcattt gcaccactgc tgtgccttgg
aatgctagtt ggagtaataa 7621 atctctggaa cagatttgga atcacacgac
ctggatggag tgggacagag aaattaacaa 7681 ttacacaagc ttaatacact
ccttaattga agaatcgcaa aaccagcaag aaaagaatga 7741 acaagaatta
ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 7801
ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat
7861 agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac
cattatcgtt 7921 tcagacccac ctcccaaccc cgaggggacc cgacaggccc
gaaggaatag aagaagaagg 7981 tggagagaga gacagagaca gatccattcg
attagtgaac ggatccttgg cacttatctg 8041 ggacgatctg cggagcctgt
gcctcttcag ctaccaccgc ttgagagact tactcttgat 8101 tgtaacgagg
attgtggaac ttctgggacg cagggggtgg gaagccctca aatattggtg 8161
gaatctccta cagtattgga gtcaggaact aaagaatagt gctgttagct tgctcaatgc
8221 cacagccata gcagtagctg aggggacaga tagggttata gaagtagtac
aaggagcttg 8281 tagagctatt cgccacatac ctagaagaat aagacagggc
ttggaaagga ttttgctata 8341 agatgggtgg caagtggtca aaaagtagtg
tgattggatg gcctactgta agggaaagaa 8401 tgagacgagc tgagccagca
gcagataggg tgggagcagc atctcgagac ctggaaaaac 8461 atggagcaat
cacaagtagc aatacagcag ctaccaatgc tgcttgtgcc tggctagaag 8521
cacaagagga ggaggaggtg ggttttccag tcacacctca ggtaccttta agaccaatga
8581 cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga
ctggaagggc 8641 taattcactc ccaaagaaga caagatatcc ttgatctgtg
gatctaccac acacaaggct 8701 acttccctga ttagcagaac tacacaccag
ggccaggggt cagatatcca ctgacctttg 8761 gatggtgcta caagctagta
ccagttgagc cagataagat agaagaggcc aataaaggag 8821 agaacaccag
cttgttacac cctgtgagcc tgcatgggat ggatgacccg gagagagaag 8881
tgttagagtg gaggtttgac agccgcctag catttcatca cgtggcccga gagctgcatc
8941 cggagtactt caagaactgc tgacatcgag cttgctacaa gggactttcc
gctggggact 9001 ttccagggag gcgtggcctg ggcgggactg gggagtggcg
agccctcaga tcctgcatat 9061 aagcagctgc tttttgcctg tactgggtct
ctctggttag accagatctg agcctgggag 9121 ctctctggct aactagggaa
cccactgctt aagcctcaat aaagcttgcc ttgagtgctt 9181 c
[0199] Initial Specific Target Motifs:
[0200] (1) Trans-activation response region/Tat protein binding
site--TAR RNA--nts 1-60
[0201] "Minimal" TAR RNA element
13 5' GGCAGAUCUGAGCCUGGGAGCUCUCU (SEQ ID NO: 15) GCC 3'
[0202] (2) Gag/Pol Frameshifting Site--"Minimal" frameshifting
element
14 5' UUUUUUAGGGAAGAUCUGGCCUUCCUACAA (SEQ ID NO: 16)
GGGAAGGCCAGGGAAUUUUCUU 3'
6.7. Hepatitis C Virus ("HCV"--Genotypes 1a & 1b)
[0203] GenBank Accession #NC.sub.--001433:
15 1 ttgggggcga cactccacca tagatcactc ccctgtgagg aactactgtc
ttcacgcaga (SEQ ID NO: 17) 61 aagcgtctag ccatggcgtt agtatgagtg
ttgtgcagcc tccaggaccc cccctcccgg 121 gagagccata gtggtctgcg
gaaccggtga gtacaccgga attgccagga cgaccgggtc 181 ctttcttgga
tcaacccgct caatgcctgg agatttgggc gtgcccccgc gagactgcta 241
gccgagtagt gttgggtcgc gaaaggcctt gtggtactgc ctgatagggt gcttgcgagt
301 gccccgggag gtctcgtaga ccgtgcatca tgagcacaaa tcctaaacct
caaagaaaaa 361 ccaaacgtaa caccaaccgc cgcccacagg acgttaagtt
cccgggcggt ggtcagatcg 421 ttggtggagt ttacctgttg ccgcgcaggg
gccccaggtt gggtgtgcgc gcgactagga 481 agacttccga gcggtcgcaa
cctcgtggaa ggcgacaacc tatccccaag gctcgccggc 541 ccgagggtag
gacctgggct cagcccgggt acccttggcc cctctatggc aacgagggta 601
tggggtgggc aggatggctc ctgtcacccc gtggctctcg gcctagttgg ggccccacag
661 acccccggcg taggtcgcgt aatttgggta aggtcatcga tacccttaca
tgcggcttcg 721 ccgacctcat ggggtacatt ccgcttgtcg gcgcccccct
agggggcgct gccagggccc 781 tggcacatgg tgtccgggtt ctggaggacg
gcgtgaacta tgcaacaggg aatctgcccg 841 gttgctcttt ctctatcttc
ctcttagctt tgctgtcttg tttgaccatc ccagcttccg 901 cttacgaggt
gcgcaacgtg tccgggatat accatgtcac gaacgactgc tccaactcaa 961
gtattgtgta tgaggcagcg gacatgatca tgcacacccc cgggtgcgtg ccctgcgtcc
1021 gggagagtaa tttctcccgt tgctgggtag cgctcactcc cacgctcgcg
gccaggaaca 1081 gcagcatccc caccacgaca atacgacgcc acgtcgattt
gctcgttggg gcggctgctc 1141 tctgttccgc tatgtacgtt ggggatctct
gcggatccgt ttttctcgtc tcccagctgt 1201 tcaccttctc acctcgccgg
tatgagacgg tacaagattg caattgctca atctatcccg 1261 gccacgtatc
aggtcaccgc atggcttggg atatgatgat gaactggtca cctacaacgg 1321
ccctagtggt atcgcagcta ctccggatcc cacaagccgt cgtggacatg gtggcggggg
1381 cccactgggg tgtcctagcg ggccttgcct actattccat ggtggggaac
tgggctaagg 1441 tcttgattgt gatgctactc tttgctggcg ttgacgggca
cacccacgtg acagggggaa 1501 gggtagcctc cagcacccag agcctcgtgt
cctggctctc acaaggccca tctcagaaaa 1561 tccaactcgt gaacaccaac
ggcagctggc acatcaacag gaccgctctg aattgcaatg 1621 actccctcca
aactgggttc attgctgcgc tgttctacgc acacaggttc aacgcgtccg 1681
ggtgcccaga gcgcatggct agctgccgcc ccatcgatga gttcgctcag gggtggggtc
1741 ccatcactca tgatatgcct gagagctcgg accagaggcc atattgctgg
cactacgcgc 1801 ctcgaccgtg cgggatcgtg cctgcgtcgc aggtgtgtgg
tccagtgtat tgcttcactc 1861 cgagccctgt tgtagtgggg acgaccgatc
gtttcggcgc tcctacgtat agctgggggg 1921 agaatgagac agacgtgctg
ctacttagca acacgcggcc gcctcaaggc aactggtttg 1981 ggtgcacgtg
gatgaacagc actgggttca ccaagacgtg cgggggccct ccgtgcaaca 2041
tcgggggggt cggcaacaac accttggtct gccccacgga ttgcttccgg aagcaccccg
2101 aggccactta cacaaagtgt ggctcggggc cctggttgac acccaggtgc
atggttgact 2161 acccatacag gctctggcac tacccctgca ctgttaactt
taccgtcttt aaggtcagga 2221 tgtatgtggg gggcgtggag cacaggctca
atgctgcatg caattggact cgaggagagc 2281 gctgtgactt ggaggacagg
gataggtcag aactcagccc gctgctgctg tctacaacag 2341 agtggcagat
actgccctgt tccttcacca ccctaccggc cctgtccact ggcttgatcc 2401
atcttcaccg gaacatcgtg gacgtgcaat acctgtacgg tatagggtcg gcagttgtct
2461 cctttgcaat caaatgggag tatatcctgt tgcttttcct tcttctggcg
gacgcgcgcg 2521 tctgtgcctg cttgtggatg atgctgctga tagcccaggc
tgaggccacc ttagagaacc 2581 tggtggtcct caatgcggcg tctgtggccg
gagcgcatgg ccttctctcc ttcctcgtgt 2641 tcttctgcgc cgcctggtac
atcaaaggca ggctggtccc tggggcggca tatgctctct 2701 atggcgtatg
gccgttgctc ctgctcttgc tggccttacc accacgagct tatgccatgg 2761
accgagagat ggctgcatcg tgcggaggcg cggtttttgt aggtctggta ctcttgacct
2821 tgtcaccata ctataaggtg ttcctcgcta ggctcatatg gtggttacaa
tattttatca 2881 ccagagccga ggcgcacttg caagtgtggg tcccccctct
caatgttcgg ggaggccgcg 2941 atgccatcat cctccttaca tgcgcggtcc
atccagagct aatctttgac atcaccaaac 3001 tcctgctcgc catactcggt
ccgctcatgg tgctccaggc tggcataact agagtgccgt 3061 actttgtacg
cgctcagggg ctcatccgtg catgcatgtt agtgcggaag gtcgctggag 3121
gccactatgt ccaaatggcc ttcatgaagc tggccgcgct gacaggtacg tacgtatatg
3181 accatcttac tccactgcgg gattgggccc acgcgggcct acgagacctt
gcggtggcag 3241 tagagcccgt cgtcttctct gacatggaga ctaaactcat
cacctggggg gcagacaccg 3301 cggcgtgtgg ggacatcatc tcgggtctac
cagtctccgc ccgaaggggg aaggagatac 3361 ttctaggacc ggccgatagt
tttggagagc aggggtggcg gctccttgcg cctatcacgg 3421 cctattccca
acaaacgcgg ggcctgcttg gctgtatcat cactagcctc acaggtcggg 3481
acaagaacca ggtcgatggg gaggttcagg tgctctccac cgcaacgcaa tctttcctgg
3541 cgacctgcgt caatggcgtg tgttggaccg tctaccatgg tgccggctcg
aagaccctgg 3601 ccggcccgaa gggtccaatc acccaaatgt acaccaatgt
agaccaggac ctcgtcggct 3661 ggccggcgcc ccccggggcg cgctccatga
caccgtgcac ctgcggcagc tcggaccttt 3721 acttggtcac gaggcatgct
gatgtcgttc cggtgcgccg gcggggcgac agcaggggga 3781 gcctgctttc
ccccaggccc atctcctacc tgaagggctc ctcgggtgga ccactgcttt 3841
gcccttcggg gcacgttgta ggcatcttcc gggctgctgt gtgcacccgg ggggttgcga
3901 aggcggtgga cttcataccc gttgagtcta tggaaactac catgcggtct
ccggtcttca 3961 cagacaactc atcccctccg gccgtaccgc aaacattcca
agtggcacat ttacacgctc 4021 ccactggcag cggcaagagc accaaagtgc
cggctgcata tgcagcccaa gggtacaagg 4081 tgctcgtcct aaacccgtcc
gttgccgcca cattgggctt tggagcgtat atgtccaagg 4141 cacatggcat
cgagcctaac atcagaactg gggtaaggac catcaccacg ggcggcccca 4201
tcacgtactc cacctattgc aagttccttg ccgacggtgg atgctccggg ggcgcctatg
4261 acatcataat atgtgatgaa tgccactcaa ctgactcgac taccatcttg
ggcatcggca 4321 cagtcctgga tcaggcagag acggctggag cgcggctcgt
cgtgctcgcc accgccacgc 4381 ctccgggatc gatcaccgtg ccacacccca
acatcgagga agtggccctg tccaacactg 4441 gagagattcc cttctatggc
aaagccatcc ccattgaggc catcaagggg ggaaggcatc 4501 tcatcttctg
ccattccaag aagaagtgtg acgagctcgc cgcaaagctg acaggcctcg 4561
gactcaatgc tgtagcgtat taccggggtc tcgatgtgtc cgtcataccg actagcggag
4621 acgtcgttgt cgtggcaaca gacgctctaa tgacgggttt taccggcgac
tttgactcag 4681 tgatcgactg caacacatgt gtcacccaga cagtcgattt
cagcttggat cccaccttca 4741 ccattgagac gacaacgctg ccccaagacg
cggtgtcgcg tgcgcagcgg cgaggtagga 4801 ctggcagggg caggagtggc
atctacaggt ttgtgactcc aggagaacgg ccctcaggca 4861 tgttcgactc
ctcggtcctg tgtgagtgct atgacgcagg ctgcgcttgg tatgagctca 4921
cgcccgctga gacctcggtt aggttgcggg cttacctaaa tacaccaggg ttgcccgtct
4981 gccaggacca cctagagttc tgggagagcg tcttcacagg cctcacccac
atagatgccc 5041 acttcttgtc ccagaccaaa caggcaggag acaacctccc
ctacctggta gcataccaag 5101 ccacagtgtg cgccagggct caggctccac
ctccatcgtg ggaccaaatg tggaagtgtc 5161 tcatacggct aaagcccaca
ctgcatgggc caacgcccct gctgtacagg ctaggagccg 5221 ttcaaaatga
ggtcactctc acacacccca taaccaaata catcatggca tgcatgtcgg 5281
ctgacctgga ggtcgtcact agcacctggg tgctagtagg cggagtcctt gcggctctgg
5341 ccgcgtactg cctgacgaca ggcagcgtgg tcattgtggg caggatcatc
ttgtccggga 5401 ggccagctgt tattcccgac agggaagtcc tctaccagga
gttcgatgag atggaagagt 5461 gtgcttcaca cctcccttac atcgagcaag
gaatgcagct cgccgagcaa ttcaaacaga 5521 aggcgctcgg attgctgcaa
acagccacca agcaagcgga ggctgctgct cccgtggtgg 5581 agtccaagtg
gcgagccctt gaggtcttct gggcgaaaca catgtggaac ttcatcagcg 5641
ggatacagta cttggcaggc ctatccactc tgcctggaaa ccccgcgata gcatcattga
5701 tggcttttac agcctctatc accagcccgc tcaccaccca aaataccctc
ctgtttaaca 5761 tcttgggggg atgggtggct gcccaactcg ctccccccag
cgctgcttcg gctttcgtgg 5821 gcgccggcat tgccggtgcg gccgttggca
gcataggtct cgggaaggta cttgtggaca 5881 ttctggcggg ctatggggcg
ggggtggctg gcgcactcgt ggcctttaag gtcatgagcg 5941 gcgagatgcc
ctccactgag gatctggtta atttactccc tgccatcctt tctcctggcg 6001
ccctggttgt cggggtcgtg tgcgcagcaa tactgcgtcg gcacgtgggc ccgggagagg
6061 gggctgtgca gtggatgaac cggctgatag cgttcgcttc gcggggtaac
cacgtctccc 6121 ccacgcacta tgtgcccgag agcgacgccg cggcgcgtgt
tactcagatc ctctccagcc 6181 ttaccatcac tcagttgctg aagaggcttc
atcagtggat taatgaggac tgctccacgc 6241 cttgttccgg ctcgtggcta
aaggatgttt gggactggat atgcacggtg ttgagtgact 6301 tcaagacttg
gctccagtcc aagctcctgc cgcggttacc gggactccct ttcctgtcat 6361
gccaacgcgg gtacaaggga gtctggcggg gggatggcat catgcaaacc acctgcccat
6421 gtggagcaca gatcaccgga catgtcaaaa atggctccat gaggattgtt
gggccaaaaa 6481 cctgcagcaa cacgtggcat ggaacattcc ccatcaacgc
atacaccacg ggcccctgca 6541 cgccctcccc agcgccgaac tattccaggg
cgctgtggcg ggtggctgct gaggagtacg 6601 tggaggttac gcgggtgggg
gatttccact acgtgacggg catgaccact gacaacgtga 6661 aatgcccatg
ccaggttcca gcccctgaat ttttcacgga ggtggatgga gtacggttgc 6721
acaggtatgc tccagtgtgc aaacctctcc tacgagagga ggtcgtattc caggtcgggc
6781 tcaaccagta cctggtcggg tcacagctcc catgtgagcc cgaaccggat
gtggcagtgc 6841 tcacttccat gctcaccgac ccctctcata ttacagcaga
gacggccaag cgtaggctgg 6901 ccagggggtc tcccccctcc ttggccagct
cttcagctag ccagttgtct gcgccttctt 6961 tgaaggcgac atgtactacc
catcatgact ccccggacgc tgacctcatc gaggccaacc 7021 tcctgtggcg
gcaggagatg ggcgggaaca tcacccgtgt ggagtcagaa aataaggtgg 7081
taatcctgga ctctttcgat ccgattcggg cggtggagga tgagagggaa atatccgtcc
7141 cggcggagat cctgcgaaaa cccaggaagt tccccccagc gttgcccata
tgggcacgcc 7201 cggattacaa ccctccactg ctagagtcct ggaaggaccc
ggactacgtc cccccggtgg 7261 tacacgggtg ccctttgcca tctaccaagg
cccccccaat accacctcca cggaggaaga 7321 ggacggttgt cctgacagag
tccaccgtgt cttctgcctt ggcggagctc gctactaaga 7381 cctttggcag
ctccgggtcg tcggccgttg acagcggcac ggcgactggc cctcccgatc 7441
aggcctccga cgacggcgac aaaggatccg acgttgagtc gtactcctcc atgccccccc
7501 tcgagggaga gccaggggac cccgacctca gcgacgggtc ttggtctacc
gtgagcgggg 7561 aagctggtga ggacgtcgtc tgctgctcaa tgtcctatac
atggacaggt gccttgatca 7621 cgccatgcgc tgcggaggag agcaagttgc
ccatcaatcc gttgagcaac tctttgctgc 7681 gtcaccacag tatggtctac
tccacaacat ctcgcagcgc aagtctgcgg cagaagaagg 7741 tcacctttga
cagactgcaa gtcctggacg accactaccg ggacgtgctc aaggagatga 7801
aggcgaaggc gtccacagtt aaggctaggc ttctatctat agaggaggcc tgcaaactga
7861 cgcccccaca ttcggccaaa tccaaatttg gctacggggc gaaggacgtc
cggagcctat 7921 ccagcagggc cgtcaaccac atccgctccg tgtgggagga
cttgctggaa gacactgaaa 7981 caccaattga taccaccatc atggcaaaaa
atgaggtttt ctgcgtccaa ccagagaaag 8041 gaggccgcaa gccagctcgc
cttatcgtat tcccagacct gggggtacgt gtatgcgaga 8101 agatggccct
ttacgacgtg gtctccaccc ttcctcaggc cgtgatgggc ccctcatacg 8161
gattccagta ctctcctggg cagcgggtcg agttcctggt gaatacctgg aaatcaaaga
8221 aatgccctat gggcttctca tatgacaccc gctgctttga ctcaacggtc
actgagaatg 8281 acatccgtac tgaggaatca atttaccaat gttgtgactt
ggcccccgaa gccaggcagg 8341 ccataaggtc gctcacagag cggctttatg
tcgggggtcc cctgactaat tcgaaggggc 8401 agaactgcgg ttatcgccgg
tgccgcgcaa gtggcgtgct gacgactagc tgcggcaaca 8461 ccctcacatg
ttacttgaag gccactgcgg cctgtcgagc tgcaaagctc caggactgca 8521
cgatgctcgt gaacggagac gaccttgtcg ttatctgtga gagtgcggga acccaggagg
8581 atgcggcggc cctacgagcc ttcacggagg ctatgactag gtattccgcc
ccccccgggg 8641 acccgcccca accagaatac gacttggagc tgataacgtc
atgctcctcc aatgtgtcgg 8701 tcgcgcacga tgcatccggc aaaagggtgt
actacctcac ccgtgacccc accacccccc 8761 tcgcacgggc tgcgtgggag
acagttagac acactccagt caactcctgg ctaggcaata 8821 tcatcatgta
tgcgcccacc ctatgggcga ggatgattct gatgactcat ttcttctcta 8881
tccttctagc tcaggagcaa cttgaaaaag ccctggattg tcagatctac ggggcctgtt
8941 actccattga gccacttgac ctacctcaga tcattgaacg actccatggt
cttagcgcat 9001 tttcactcca cagttactct ccaggtgaga tcaatagggt
ggcttcatgc ctcaggaaac 9061 ttggggtacc gcctttgcga gtctggagac
atcgggccag aagtgtccgc gctaagctac 9121 tgtcccaggg ggggagggct
gccacttgcg gcaagtacct cttcaactgg gcagtaaaga 9181 ccaagcttaa
actcactcca atcccggctg cgtcccagct agacttgtcc ggctggttcg 9241
ttgctggtta caacggggga gacatatatc acagcctgtc tcgtgcccga ccccgttggt
9301 tcatgttgtg cctactccta ctttctgtag gggtaggcat ctacctgctc
cccaaccggt 9361 gaacggggag ctaaccactc caggccaata ggccattccc
tttttttttt ttc
[0204] General Target Region:
[0205] 5' Untranslated Region--nts 1-328 - Internal Ribosome Entry
Site (IRES):
16 5'UUGGGGGCGACACUCCACCAUAGAUCACUCCCCUGUGAGGAACUACUGUCU (SEQ ID
NO: 18) UCACGCAGAAAGCGUCUAGCCAUGGCGUUAGUAUGAGUGUUGUGCAGC- CUC
CAGGACCCCCCCUCCCGGGAGAGCCAUAGUGGUCUGCGGAACCGGUGAGUAC
ACCGGAAUUGCCAGGACGACCGGGUCCUUUCUUGGAUCAACCCGCUCAAUGC
CUGGAGAUUUGGGCGUGCCCCCGCGAGACUGCUAGCCGAGUAGUGUUGGGU
CGCGAAAGGCCUUGUGGUACUGCCUGAUAGGGUGCUUGCGAGUGCCCCGGG
AGGUCUCGUAGACCGUGCAU3'
[0206] Initial Specific Target Motifs:
[0207] (1) Subdomain IIIc within HCV IRES--nts 213-226
17 5'AUUUGGGCGUGCCC3' (SEQ ID NO: 19)
[0208] (2) Subdomain IIId within HCV IRES--nts 241-267
18 5'GCCGAGUAGUGUUGGGUCGCGAAAGGC3' (SEQ ID NO: 20)
6.8. Ribonuclease P RNA ("RNaseP")
[0209] GenBank Accession #s
[0210] X15624 Homo sapiens RNaseP H1 RNA:
19 1 atgggcggag ggaagctcat cagtggggcc acgagctgag tgcgtcctgt
cactccactc (SEQ ID NO: 21) 61 ccatgtccct tgggaaggtc tgagactagg
gccagaggcg gccctaacag ggctctccct 121 gagcttcagg gaggtgagtt
cccagagaac ggggctccgc gcgaggtcag actgggcagg 181 agatgccgtg
gaccccgccc ttcggggagg ggcccggcgg atgcctcctt tgccggagct 241
tggaacagac tcacggccag cgaagtgagt tcaatggctg aggtgaggta ccccgcaggg
301 gacctcataa cccaattcag accactctcc tccgcccatt
[0211] U64885 Staphylococcus aureus RNaseP (rrnB) RNA:
20 1 gaggaaagtc cgggctcaca cagtctgaga tgattgtagt gttcgtgctt
gatgaaacaa (SEQ ID NO: 22) 61 taaatcaagg cattaatttg acggcaatga
aatatcctaa gtctttcgat atggatagag 121 taatttgaaa gtgccacagt
gacgtagctt ttatagaaat ataaaaggtg gaacgcggta 181 aacccctcga
gtgagcaatc caaatttggt aggagcactt gtttaacgga attcaacgta 241
taaacgagac acacttcgcg aaatgaagtg gtgtagacag atggttatca cctgagtacc
301 agtgtgacta gtgcacgtga tgagtacgat ggaacagaac gcggcttat
[0212] M17569 Escherichia coli RNA component (M1 RNA) of
ribonuclease P (mpB) gene:
21 1 gaagctgacc agacagtcgc cgcttcgtcg tcgtcctctt cgggggagac
gggcggaggg (SEQ ID NO: 23) 61 gaggaaagtc cgggctccat agggcagggt
gccaggtaac gcctgggggg gaaacccacg 121 accagtgcaa cagagagcaa
accgccgatg gcccgcgcaa gcgggatcag gtaagggtga 181 aagggtgcgg
taagagcgca ccgcgcggct ggtaacagtc cgtggcacgg taaactccac 241
ccggagcaag gccaaatagg ggttcataag gtacggcccg tactgaaccc gggtaggctg
301 cttgagccag tgagcgattg ctggcctaga tgaatgactg tccacgacag
aacccggctt 361 atcggtcagt ttcacct
[0213] Z70692 Mycobacterium tuberculosis RNaseP (mpB) RNA:
22 1 ccaccggtta cgatcttgcc gaccatggcc ccacaatagg gccggggaga
cccggcgtca (SEQ ID NO: 24) 61 gtggtgggcg gcacggtcag taacgtctgc
gcaacacggg gttgactgac gggcaatatc 121 ggctccatag cgtcggccgc
ggatacagta aaggagcatt ctgtgacgga aaagacgccc 181 gacgacgtct
tcaaacttgc caaggacgag aaggtcgaat atgtcgacgt ccggttctgt 241
gacctgcctg gcatcatgca gcacttcacg attccggctt cggcctttga caagagcgtg
301 tttgacgacg gcttggcctt tgacggctcg tcgattcgcg ggttccagtc
gatccacgaa 361 tccgacatgt tgcttcttcc cgatcccgag acggcgcgca
tcgacccgtt ccgcgcggcc 421 aagacgctga atatcaactt ctttgtgcac
gacccgttca ccctggagcc gtactcccgc 481 gacccgcgca acatcgcccg
caaggccgag aactacctga tcagcactgg catcgccgac 541 accgcatact
tcggcgccga ggccgagttc tacattttcg attcggtgag cttcgactcg 601
cgcgccaacg gctccttcta cgaggtggac gccatctcgg ggtggtggaa caccggcgcg
661 gcgaccgagg ccgacggcag tcccaaccgg ggctacaagg tccgccacaa
gggcgggtat 721 ttcccagtgg cccccaacga ccaatacgtc gacctgcgcg
acaagatgct gaccaacctg 781 atcaactccg gcttcatcct ggagaagggc
caccacgagg tgggcagcgg cggacaggcc 841 gagatcaact accagttcaa
ttcgctgctg cacgccgccg acgacatgca gttgtacaag 901 tacatcatca
agaacaccgc ctggcagaac ggcaaaacgg tcacgttcat gcccaagccg 961
ctgttcggcg acaacgggtc cggcatgcac tgtcatcagt cgctgtggaa ggacggggcc
1021 ccgctgatgt acgacgagac gggttatgcc ggtctgtcgg acacggcccg
tcattacatc 1081 ggcggcctgt tacaccacgc gccgtcgctg ctggccttca
ccaacccgac ggtgaactcc 1141 tacaagcggc tggttcccgg ttacgaggcc
ccgatcaacc tggtctatag ccagcgcaac 1201 cggtcggcat gcgtgcgcat
cccgatcacc ggcagcaacc cgaaggccaa gcggctggag 1261 ttccgaagcc
ccgactcgtc gggcaacccg tatctggcgt tctcggccat gctgatggca 1321
ggcctggacg gtatcaagaa caagatcgag ccgcaggcgc ccgtcgacaa ggatctctac
1381 gagctgccgc cggaagaggc cgcgagtatc ccgcagactc cgacccagct
gtcagatgtg 1441 atcgaccgtc tcgaggccga ccacgaatac ctcaccgaag
gaggggtgtt cacaaacgac 1501 ctgatcgaga cgtggatcag tttcaagcgc
gaaaacgaga tcgagccggt caacatccgg 1561 ccgcatccct acgaattcgc
gctgtactac gacgtttaag gactcttcgc agtccgggtg 1621 tagagggagc
ggcgtgtcgt tgccagggcg ggcgtcgagg tttttcgatg ggtgacggtg 1681
gccggcaacg gcgcgccgac caccgctgcg aagagcccgt ttaagaacgt tcaaggacgt
1741 ttcagccggg tgccacaacc cgcttggcaa tcatctcccg accgccgagc
gggttgtctt 1801 tcacatgcgc cgaaactcaa gccacgtcgt cgcccaggcg
tgtcgtcgcg gccggttcag 1861 gttaagtgtc ggggattcgt cgtgcgggcg
ggcgtccacg ctgaccaacg gggcagtcaa 1921 ctcccgaaca ctttgcgcac
taccgccttt gcccgccgcg tcacccgtag gtagttgtcc 1981 aggaattccc
caccgtcgtc gtttcgccag ccggccgcga ccgcgaccgc attgagctgg 2041
cgcccgggtc ccggcagctg gtcggtgggc ttgccgcgca ccaacaccag cgcgttgcgg
2101 gcccgggtgg cggtcagcca ggcctgacgg agcagctcca cgtcggctgc
gggaaccaga 2161 tcggcggccg cgatgacatc cagggattgc agcgtcgagg
tgttgtgcag ggcgggaacc 2221 tggtgcgcat gctgtagctg cagcaactgc
acggtccatt cgatgtcggc cagtccgccg 2281 cggcccagtt tggtgtgtgt
gttggggtcg gcaccgcgcg gcaaccgctc ggactcgata 2341 cgggccttga
tgcggcgaat ctcgcgcacc gagtcagcgg acacaccgtc gggcggatac 2401
cgcgttttgt cgaccatccg taggaatcgc tgacccaact cggcatcgcc ggcaaccgcg
2461 tgtgcgcgta gcagggcctg gatctcccat ggctgtgccc actgctcgta
gtatgcggcg 2521 taggacccca gggtgcggac cagcggaccg ttgcggccct
cgggtcgcaa attggcgtcg 2581 agctccagcg gcggatcgac gctgggtgtc
cccagcagcg cccgaacccg ctcggcgatc 2641 gatgtcgacc atttcaccgc
ccgtgcatcg tcgacgccgg tggccggctc acagacgaac 2701 atcacgtcgg
catccgaccc gtagcccaac tcggcaccac ccagccgacc catgccgatg 2761
accgcgatgg ccgccggggc gcgatcgtcg tcgggaaggc tggcccggat catgacgtcc
2821 agcgcggcct gcagcaccgc cacccacacc gacgtcaacg cccggcacac
ctcggtgacc 2881 tcgagcaggc cgagcaggtc cgccgaaccg atgcgggcca
gctctcgacg acgcagcgtg 2941 cgcgcgccgg cgatggcccg ctccgggtcg
gggtagcggc tcgccgaggc gatcagcgcc 3001 cgagccacgg cggcgggctc
ggtctcgagc agcttcgggc ccgcaggccc gtcctcgtac 3061 tgctggatga
cccgcggcgc gcgcatcaac agatccggca catacgccga ggtacccaag 3121
acatgcatga gccgcttggc caccgcgggc ttgtcccgca gcgtggccag gtaccagctt
3181 tcggtggcca gcgcctcact gagccgccgg taggccagca gtccgccgtc
gggatcgggg 3241 gcatacgaca tccagtccag cagcctgggc agcagcaccg
actgcacccg tccgcgccgg 3301 ccgctttgat tgaccaacgc cgacatgtgt
ttcaacgcgg tctgcggtcc ctcgtagccc 3361 agcgcggcca gccggcgccc
cgcggcctcc aacgtcatgc cgtgggcgat ctccaacccg 3421 gtcgggccga
tcgattccag cagcggttga tagaagagtt tggtgtgtaa cttcgacacc 3481
cgcacgttct gcttcttgag ttcctcccgc agcaccccgg ccgcatcgtt tcggccatcg
3541 ggccggatgt gggccgcgcg cgccagccag cgcactgcct cctcgtcttc
gggatcggga 3601 agcaggtggg tgcgcttgag ccgctgcaac tgcagtcggt
gctcgagcag cctgaggaac 3661 tcatacgacg cggtcatgtt cgccgcgtcc
tcacgcccga tgtagccgcc ttcgcccaac 3721 gccgccaatg cgtccaccgt
ggacgccacc cgtaacgact cgtcgctacg ggcatgaacc 3781 agctgcagta
gctgtacggc gaactccacg tcgcgcaatc cgccgctgcc gagtttgagc 3841
tcgcggccgc ggacatcggc gggcaccagc tgctccaccc gccgccgcat ggcctgcacc
3901 tcgaccacaa agtcttcgcg ctcgcaggct cgccacacca tcggcatcaa
ggcggtcagg 3961 taacgctcgc caagttccgc gtcgccaacg actggccgtg
ctttcagcaa cgcctgaaac 4021 tcccaggtct tggcccagcg ctggtagtag
gcgatgtgcg actcgagcgt acggaccagc 4081 tccccgttgc gcccctccgg
acgcagggcg gcgtccacct cgaaaaaggc cgccgaggcc 4141 acccgcatca
tctcgctggc cacgcgcgcg ttgcgcgggt cggagcgctc ggcaacgaat 4201
atgacatcga cgtcgctgac gtagttcagt tcgcgcgcac cgcacttgcc catcgcgatg
4261 accgccaggc gcggtggcgg gtgctcgccg cacacgctcg cctcggccac
gcgcagcgcc 4321 gccgccagag cggcgtccgc ggcgtccgcc aggcgtgcgg
ccaccacggt gaatggcagc 4381 accggttcgt cctcgaccgt cgcggccagg
tcgagagcgg ccagcattag cacgtagtcg 4441 cggtactggg ttcgcaatcg
gtgcacgagc gagcccggca taccctccga ttcctcgacg 4501 cactcgacga
acgaccgctg cagctggtca tgggacggca gtgtgacctt gccccgcagc 4561
aatttccagg actgcggatg ggcgaccagg tgatcgccca acgccagcga cgagcccagc
4621 accgagaaca gccgcccgcg cagactgcgt tcgcgcagca gagccgcgtt
gagctcgtcc 4681 catccggtgt ctggattctc cgacagccgg atcaaggcgc
gcagcgcggc atcggcgtcc 4741 ggagcgcgtg acagcgacca cagcaggtcg
acgtgcgcct gatcctcgtg ccgatcccac 4801 cccagctgag ccagacgctc
accagcaggg gggtcaacta atccgagccg gccaacgctg 4861 ggcaacttcg
gccgctgcgt ggcgagtttg gtcacgacca cgacggtagc gcaaagcgcg 4921
tcggcgtcgg atcaaccggt agatctgggc tacagcgaca ggtaggtgcg cagctcgtat
4981 ggcgtgacgt ggctgcggta gttcgcccac tccgtgcgct tgttgcgcaa
gaaaaagtca 5041 aaaacgtgct cccccaaggc ctccgcgacg agttcggagg
cctccatggc gcgcagcgca 5101 ctatccaaac tggacggcaa ttctcggtac
cccatcgctc ggcgttcctc gggtgtgagg 5161 tcccatacgt tgtcctcggc
ctgcgggccc agcacgtaac ccttctctac accccgcaat 5221 cccgcggcca
gcagcacggc gaatgtcaga tagggattgc acgccgaatc agggctgcgt 5281
acttcgaccc gccgcgacga ggtcttgtgc ggcgtgtaca tcggcacccg cactagggcg
5341 gatcggttgg cggcccccca cgacgcggcc gtgggcgctt cgccgccctg
caccagccgc 5401 ttgtaagagt tgacccactg atttgtgacc gcgctgatct
cgcaagcgtg ctccaggatc 5461 ccggcgatga acgatttacc cacttccgac
agctgcagcg gatcatcagc gctgtggaac 5521 gcgttgacat caccctcgaa
caggctcatg tgggtgtgca tcgccgagcc cgggtgctgg 5581 ccgaatggct
tgggcatgaa cgacgcccgg gcgccctctt ccagcgcgac ttctttgatg 5641
acgtagcgga aggtcatcac gttgtcagcc atcgacagag cgtcggcaaa ccgcaggtcg
5701 atctcctgct ggccgggtgc gccttcgtga tggctgaact ccaccgagat
gcccatgaat 5761 tccagggcat cgatcgcgtg gcggcgaaag ttcaaggcgg
agtcgtgcac cgcttggtcg 5821 aaatagccgg cgttgtcgac cgggacgggc
accgacccgt cctcgggtcc gggcttgagc 5881 aggaagaact cgatttcggg
atgcacgtag caggagaagc cgagttcgcc ggccttcgtc 5941 agctgccgcc
gcaacacgtg ccgcgggtcc gcccacgacg gcgagccgtc cggcatggtg 6001
atgtcgcaaa acatccgcgc tgagtggtgg tggccggaac tggtggccca gggcagcacc
6061 tggaaggtcg acgggtccgg gtgcgccacc gtatcggatt ccgagacccg
cgcaaagccc 6121 tcgatcgagg atccgtcgaa gccgatgcct tcctcgaagg
cgccctcgag ttcggctggg 6181 gcgatggcga ccgacttgag gaaaccgagc
acgtctgtga accacagccg gacgaagcgg 6241 atgtcgcgtt cttccagggt
acgaagaacg aattccttct gtcggtccat acctcgaaca 6301 gtatgcactg
tctgttaaaa ccgtgttacc gatgcccggc cagaagcgtt gcggggcggc 6361
ccgcaagggg agtgcgcggt gagttcaggg cgcgcaccgc agactcgtcg gcggcaaggt
6421 cccgtcgaga aaatagtgca tcaccgcaga gtccacacac tggttgccat
cgaacaccgc 6481 agtgtgttgg gtgccgtcga aggtgatcag cggtgcgccc
agctggcggg ccaggtctac 6541 cccggactga tacggagtgg ccgggtcgtg
ggtggtggac accacgacga ccttgccagc 6601 cccggccggc gccgcggggt
gcggcgtcga cgttgccggc accggccaca gcgcgcacag 6661 atcgcggggg
gcggatccgg tgaactgccc gtagctaagg aacggggcga cctgacggat 6721
ccgttggtcg gcggccaccc aggccgctgg atcggccggt gtgggcgcat cgacgcaccg
6781 gaccgcgttg aacgcgtcct ggtcgttgct gtagtgcccg tctgcatccc
ggccgtcata 6841 gtcgtcggca agcaccagca agtcgccggc gtcgctgccg
cgctgcagcc ccagcagacc 6901 actggtcagg tacttccagc gctgagggct
gtacagcgcg ttgatggtgc ccgtcgtcgc 6961 gtcggcgtag ctcaggccac
gtggatccga cgtcttaccc ggcttctgca ccagcgggtc 7021 aaccagggcg
tggtagcggt tgacccactg ggccgagtcg gtgcccagag ggcaggccgg 7081
cgagcgggcg cagtcggcgg cgtagtcatt gaaagcggtc tgaaatcccg ccatttggct
7141 gatgctttcc tcgattgggc taacggctgg atcgatagcg ccgtcgagga
ccatcgcccg 7201 cacatgagta ccgaaccgtt ccaggtaagc ggtgcccaac
tcggtgccgt agctgtatcc 7261 gaggtagttg atctgatcgt cacctaacgc
ttggcgaacc atgtccatgt cccgtgcgac 7321 ggacgcggta ccgatattgg
ccaagaagct gaagcccatc cggtcaacac agtcctgggc 7381 caactgccgg
tagacctgtt cgacgtgggt gacaccggcc ggactgtagt cggccatcgg 7441
atcgcgccgg tacgcgtcga actcggcgtc ggtgcgacac cgcaacgcag gggtcgagtg
7501 gccgacccct ctcgggtcga agcccaccag gtcgaagtgg cggagaatgt
cggtgtcggc 7561 gatcgcgggt gccatagcgg cgaccatgtc gaccgccgac
gccccgggtc ccccaggatt 7621 gaccagcagt gctccgaatc gctgtcccgt
cgcggggacg cggatcaccg ccaacttcgc 7681 ttgtgtccca ccgggttggt
cgtagtcgac ggggacggac accgtcgcgc agcgtgcagt 7741 gcgaatttcg
ctggtgtcgg cgatgaactc gcggcagctg ttccaactct gttgcggcgc 7801
cacgaccggc gcacccgggg tttggccggc gccgggttct tcagtcgcgc cggccaacgg
7861 gggcgctgct aggggcagtc cgccgagcag caacccgaag gacagcagcg
ccgagctcaa 7921 cggtctgcgg cgccacatgg ccgccatcgt ctcaccggcg
aatacctgtg acggcgcgaa 7981 atgatcacac cttcgtttct tcgccccgct
agcacttggc gccgctgggc ggcgtggtgc 8041 cgccgattaa atacgccgtc
acgtactcgt caatgcagct gtcgccctgg aataccaccg 8101 tgtgctgggt
tccgtcgaag gtcagcaacg aaccgcgaag ctggttcgcc aggtcgaccc 8161
cggccttgta cggcgtcgcc gggtcatggg tggtggatac caccaccgtc ggcactaggc
8221 cgggcgccga gacggcatgg ggctgacttg tgggtggcac cggccagaac
gcgcaggtgc 8281 ccagcggcgc atcaccggtg aacttcccgt agctcatgaa
cggtgcgatc tcccgggcgc 8341 ggcggtcttc gtcgatgacc ttgtcgcgat
cggtaaccgg gggctgatcg acgcaattga 8401 tcgccacccg cgcgtcaccg
gaattgttgt agcggccgtg cgagtcccga cgcatgtaca 8461 tgtcggccag
agccagcagg gtgtctccgc gattgtcgac cagctccgac agcccgtcgg 8521
tcaagtgttg ccacagattc ggtgagtaca gcgccataat ggtgcccacg atggcgtcgc
8581 tataactcag cccgcgcgga tccttcgtgc gcgccggcct gctgatcctc
gggttgtccg 8641 ggtcgaccaa cggatcgacc aggctgtggt agacctcgac
ggctttggcc gggtcggcgc 8701 ccagcgggca gcccgcgttc ttggcgcagt
cggcggcata gttgttgaac gcgtcctgga 8761 agcccttggc ctggcgcagc
tccgcctcga tgggatcggc attggggtcg acggcaccgt 8821 cgagaatcat
tgcccgcacc cgctgcggaa attcctcggc atacgcggag ccgatccggg 8881
tgccgtacga gtagcccagg taggtcagct tgtcgtcgcc caacgccgcg cgaatggcat
8941 ccaggtcctt ggcgacgttg accgtcccga catgggccag aaagttcttg
cccatcttgt 9001 ccacacagcg accgacgaat tgcttggtct cgttctcgat
gtgcgccaca ccctcccggc 9061 tgtagtcaac ctgcggctcg gcccgcagcc
ggtcgttgtc ggcatcggag ttgcaccaga 9121 tcgccggccg ggacgacgcc
accccgcggg ggtcgaaccc aaccaggtcg aacctttcgt 9181 gcacccgctt
cggcaatgtc tggaagacgc ccaaggcggc ctcgataccg gattcgccgg 9241
gtccaccggg atttatgacc agcgaaccga tcttgtctcc cgtcgccgga aagcgaatca
9301 gcgccagcgc cgccacgtca ccatcggggc ggtcgtagtc gaccggtaca
gcgagcttgc 9361 cgcataacgc gccgccgggg atctttactt gcgggtttga
cgaccggcac ggtgtccact 9421 ccaccggctg gcccagcttc ggctccgcca
tacgagcgcg tcccccgacc acgcggatgc 9481 agcccacaag aaccaacgcc
acggcggcga gcgcggccca gatcaacagc atgcgcgcga 9541 tcttgtcgcg
gcgagacagc ctcatgccca caatgctgcc agagcagacc cgagatcctg 9601
gccagcggcc accgtcggcc gactaaccgg ccgctgccag cagtcctgcc atcgccgatg
9661 gcgaactcgt cggccatccc ccatacgtcc ggtaacagat ccgggcaaga
caccgacccg 9721 tcgaccggat ccggcacggg cgcgtcggcc tcggcggtgc
acaactgcga catcaggttg 9781 gcgctggcac cccgtccacg ccggcatggt
gcaccttggc catcgcccga gggcgatccc 9841 cgatgccgtc caccccttcg
acgaacccat ctcccacggc ggtcgccggc agcgacgcga 9901 tgtggccgca
gatctccgag agttcggccc gcccgcccgg cgacggcaac ccgatgccgt 9961
gcaagtgacg atcgatgtga ggttcaaggt tcagcgcact gctggcaagc tttttccgaa
10021 accgcggcct cgccttgatc tggagtcaga acgcgtcacg cagccggtca
aaggcgtaac 10031 ccatgctcga gcaaacatgc atgggctgag tggacgtttc
cagacacagc aactggcgtc 10141 caggccactg agccgctgca tgcgcgatgg
tatgccgatg ggggccccgg gcgcgtctga 10201 ggggaagaag tggcagactg
tcagggtccg acgaacccgg ggaccctaac gggccacgag 10261 gatcgacccg
accaccatta gggacagtga tgtctgagca gactatctat ggggccaata 10321
cccccggagg ctccgggccg cggaccaaga tccgcaccca ccacctacag agatggaagg
10381 ccgacggcca caagtgggcc atgctgacgg cctacgacta ttcgacggcc
cggatcttcg 10441 acgaggccgg catcccggtg ctgctggtcg gtgattcggc
ggccaacgtc gtgtacggct 10501 acgacaccac cgtgccgatc tccatcgacg
agctgatccc gctggtccgt ggcgtggtgc 10561 ggggtgcccc gcacgcactg
gtcgtcgccg acctgccgtt cggcagctac gaggcggggc 10621 ccaccgccgc
gttggccgcc gccacccggt tcctcaagga cggcggcgca catgcggtca 10681
agctcgaggg cggtgagcgg gtggccgagc aaatcgcctg tctgaccgcg gcgggcatcc
10741 cggtgatggc acacatcggc ttcaccccgc aaagcgtcaa caccttgggc
ggcttccggg 10801 tgcagggccg cggcgacgcc gccgaacaaa ccatcgccga
cgcgatcgcc gtcgccgaag 10861 ccggagcgtt tgccgtcgtg atggagatgg
tgcccgccga gttggccacc cagatcaccg 10921 gcaagcttac cattccgacg
gtcgggatcg gcgctgggcc caactgcgac ggccaggtcc 10981 tggtatggca
ggacatggcc gggttcagcg gcgccaagac cgcccgcttc gtcaaacggt 11041
atgccgatgt cggtggtgaa ctacgccgtg ctgcaatgca atacgcccaa gaggtggccg
11101 gcggggtatt ccccgctgac gaacacagtt tctgaccaag ccgaatcagc
ccgatgcgcg 11161 ggcattgcgg tggcgccctg gatgccgtcg acgccggatt
gccggcgcgg acgcgccagc 11221 gggacccatc ggcgtcgcgt tcgccggttg
agcccggggt gagcccagac attcgatgtg 11281 cccaacacca tccgccacag
cccaattgat gtggcactct atgcatgcct atccccgacc 11341 aaccaccacc
gcggcgacgc atcatgaccg gaggcgaaga tgccagtaga ggcgcccaga 11401
ccagcgcgcc atctggaggt cgagcgcaag ttcgacgtga tcgagtcgac ggtgtcgccg
11461 tcgttcgagg gcatcgccgc ggtggttcgc gtcgagcagt cgccgaccca
gcagctcgac 11521 gcggtgtact tcgacacacc gtcgcacgac ctggcgcgca
accagatcac cttgcggcgc 11581 cgcaccggcg gcgccgacgc cggctggcat
ctgaagctgc cggccggacc cgacaagcgc 11641 accgagatgc gagcaccgct
gtccgcatca ggcgacgctg tgccggccga gttgttggat 11701 gtggtgctgg
cgatcgtccg cgaccagccg gttcagccgg tcgcgcggat cagcactcac 11761
cgcgaaagcc agatcctgta cggcgccggg ggcgacgcgc tggcggaatt ctgcaacgac
11821 gacgtcaccg catggtcggc cggggcattc cacgccgctg gtgcagcgga
caacggccct 11881 gccgaacagc agtggcgcga atgggaactg gaactggtca
ccacggatgg gaccgccgat 11941 accaagctac tggaccggct agccaaccgg
ctgctcgatg
ccggtgccgc acctgccggc 12001 cacggctcca aactggcgcg ggtgctcggt
gcgacctctc ccggtgagct gcccaacggc 12061 ccgcagccgc cggcggatcc
agtacaccgc gcggtgtccg agcaagtcga gcagctgctg 12121 ctgtgggatc
gggccgtgcg ggccgacgcc tatgacgccg tgcaccagat gcgagtgacg 12181
acccgcaaga tccgcagctt gctgacggat tcccaggagt cgtttggcct gaaggaaagt
12241 gcgtgggtca tcgatgaact gcgtgagctg gccgatgtcc tgggcgtagc
ccgggacgcc 12301 gaggtactcg gtgaccgcta ccagcgcgaa ctggacgcgc
tggcgccgga gctggtacgc 12361 ggccgggtgc gcgagcgcct ggtagacggg
gcgcggcggc gataccagac cgggctgcgg 12421 cgatcactga tcgcattgcg
gtcgcagcgg tacttccgtc tgctcgacgc tctagacgcg 12481 cttgtgtccg
aacgcgccca tgccacttct ggggaggaat cggcaccggt aaccatcgat 12541
gcggcctacc ggcgagtccg caaagccgca aaagccgcaa agaccgccgg cgaccaggcg
12601 ggcgaccacc accgcgacga ggcattgcac ctgatccgca agcgcgcgaa
gcgattacgc 12661 tacaccgcgg cggctactgg ggcggacaat gtgtcacaag
aagccaaggt catccagacg 12721 ttgctaggcg atcatcaaga cagcgtggtc
agccgggaac atctgatcca gcaggccata 12781 gccgcgaaca ccgccggcga
ggacaccttc acctacggtc tgctctacca acaggaagcc 12841 gacttggccg
agcgctgccg ggagcagctt gaagccgcgc tgcgcaaact cgacaaggcg 12901
gtccgcaaag cacgggattg agcccgccag gggcggacga gttggcctgt aagccggatt
12961 ctgttccgcg ccgccacagc caagctaacg gcggcacggc ggcgaccatc
catctggaca 13021 caccgttacc gggtgcctcg agcggcctac ccgcaggctc
gggcgagcaa ccctcaagcg 13081 cctgcgcggc cgcactttcg gtgcggcctt
cttggccttg cttcgggtgg ggtttgccta 13141 gccaccccgg tcacccggaa
tgctggtgcg ctcttaccgc accgtttcac ccttgccacc 13201 acgaggatgg
cggtctgttt tctgtggcac tttcccgcga gtcacctcgg attgccgtta 13261
gcaatcaccc tgctctgtga agtccggact ttcctcgact cgacgctgaa cctcgtgaat
13321 ccacacaagc cctacgcgag ccgcggccgc ccagccaact catccgcgac
gaccacgcta 13381 ccccgctggg cggtgtcgcg gccagtgtga ccgctggacg
acacggctag tcggacagcc 13441 gatccggcgg gcagtcctta tcgtggactg
gtgacacggt gggacaaacg cgtcgactcc 13501 ggcgactggg acgccatcgc
tgccgaggtc agcgagtacg gtggcgcact gctacctcgg 13561 ctgatcaccc
ccggcgaggc cgcccggctg cgcaagctgt acgccgacga cggcctgttt 13621
cgctcgacgg tcgatatggc atccaagcgg tacggcgccg ggcagtatcg atatttccat
13681 gccccctatc ccgagtgatc gagcgtctca agcaggcgct gtatcccaaa
ctgctgccga 13741 tagcgcgcaa ctggtgggcc aaactgggcc gggaggcgcc
ctggccagac agccttgatg 13801 actggttggc gagctgtcat gccgccggcc
aaacccgatc cacagcgctg atgttgaagt 13861 acggcaccaa cgactggaac
gccctacacc aggatctcta cggcgagttg gtgtttccgc 13921 tgcaggtggt
gatcaacctg agcgatccgg aaaccgacta caccggcggc gagttcctgc 13981
ttgtcgaaca gcggcctcgc gcccaatccc ggggtaccgc aatgcaactt ccgcagggac
14041 atggttatgt gttcacgacc cgtgatcggc cggtgcggac tagccgtggc
tggtcggcat 14101 ctccagtgcg ccatgggctt tcgactattc gttccggcga
acgctatgcc atggggctga 14161 tctttcacga cgcagcctga ttgcacgcca
tctatagata gcctgtctga ttcaccaatc 14221 gcaccgacga tgccccatcg
gcgtagaact cggcgatgct cagcgatgcc agatcaagat 14281 gcaaccgata
taggacgccc gacccggcat ccaacgccag ccgcaacaac attttgatcg 14341
gcgtgacatg tgacaccacc agcaccgtcg cgccttcgta gccaacgatg atccgatcac
14401 gtccccgccg aacccgccgc agcacgtcgt cgaagctttc cccacccggg
ggcgtgatgc 14461 tggtgtcctg cagccagcga cggtgcagct cgggatcgcg
ttctgcggcc tccgcgaacg 14521 tcagcccctc ccaggcgccg aagtcggtct
cgaccaggtc gtcatcgacg accacgtcca 14581 gggccagggc tctggcggcg
gtcaccgcgg tgtcgtaagc ccgctgtagc ggcgaggaga 14641 ccaccgcagc
gatcccgccg cgccgcgcca gatacccggc cgccgcacca acctggcgcc 14701
accccacctc gttcaacccc gggttgccgc gccccgaata gcggcgttgc tccgacagct
14761 ccgtctgccc gtggcgcaac aaaagtagtc gggtgggtgt accgcgggcg
ccggtccagc 14821 cgggagatgt cggtgactcg gtcgcaacga ttttggcagg
atccgcatcc gccgcagccg 14881 attgcgcggc ggcgtccatc gcgtcattgg
ccaaccggtc tgcatacgtg ttccgggcac 14941 gcggaaccca ctcgtagttg
atcctgcgaa actgggacgc caacgcctga gcctggacat 15001 agagcttcag
cagatccggg tgcttgacct tccaccgccc ggacatctgc tccaccacca 15061
gcttggagtc catcagcacc gcggcctcgg tggcacctag tttcacggcg tcgtccaaac
15121 cggctatcag gccgcggtat tcggcgacgt tgttcgtcgc ccggccgatc
gcctgcttgg 15181 actcggccag cacggtggag tgatcggcgg tccacaccac
cgcgccgtat ccggccggtc 15241 cgggattgcc ccgcgatccg ccgtcggctt
cgatgacaac tttcactcct caaatccttc 15301 gagccgcaac aagatcgctc
cgcattccgg gcagcgcacc acttcatcct cggcggccgc 15361 cgagatctgg
gccagctcgc cgcggccgat ctcgatccgg caggcaccac atcgatgacc 15421
ttgcaaccgc ccggcccctg gcccgcctcc ggcccgctgt ctttcgtaga gccccgcaag
15481 ctcgggatca agtgtcgccg tcagcatgtc gcgttgcgat gaatgttggt
gccgggcttg 15541 gtcgatttcg gcaagtgcct cgtccaaagc ctgctgggcg
gcggccaggt cggcccgcaa 15601 cgcttggagc gcccgcgact cggcggtctg
ttgagcctgc agctcctcgc ggcgttccag 15661 cacctccagc agggcatctt
ccaaactggc ttgacggcgt tgcaagctgt cgagctcgtg 15721 ctgcagatca
gccaattgct tggcgtccgt tgcacccgaa gtgagcaacg accggtcccg 15781
gtcgccacgc ttacgcaccg catcgatctc cgactcaaaa cgcgacacct ggccgtccaa
15841 gtcctccgcc gcgattcgca gggccgccat cctgtcgttg gcggcgttgt
gctcggcctg 15901 cacctgctgg taagccgccc gctgcggcag atgggtagcc
cgatgcgcga tccgggtcag 15961 ctcagcatcc agcttcgcca attccagtag
cgaccgttgc tgtgccactc cggctttcat 16021 gcctgatctc tcccagtttc
gtgatcgagg ttccacgggt cggtgcagat ggtgcacaca 16081 cgcaccggca
gcgacgcgcc gaaatgagac cgcaacactt cggcggcctg gccgcaccac 16141
gggaattcgc ttgcccaatg cgcgacgtcg atcagggcca cttgcgaagc tcggcaatgc
16201 tcgtcggctg gatgatgtcg cagatcggcc gtaacgtacg cttgcacgtc
cgcggcggcc 16261 acggtggcaa gcaacgagtc cccggcgccg ccgcagaccg
cgacccgcga caccagcagg 16321 tcgggatccc cggcggcgcg cacaccggtc
gcagtcggcg gcaacgcggc ctccagacgg 16381 gcaacaaagg tgcgcagcgg
ttcgggtttt ggcagtctgc caatccggcc taacccgctg 16441 ccgaccggcg
gtggtaccag cgcgaagatg tcgaatgccg gctcctcgta agggtgcgcg 16501
gcgcgcatcg ccgccaacac ctcggcgcgc gctcgtgcgg gtgcgacgac ctcgacccgg
16561 tcctcggcca cccgttcgac ggtaccgacg ctgcctatgg cgggcgacgc
cccgtcgtgc 16621 gccaggaact gcccggtacc cgcgacactc cagctgcagt
gcgagtagtc gccgatatgg 16681 ccggcaccgg cctcaaagac cgctgcccgc
accgcctctg agttctcgcg cggcacatag 16741 atgacccact tgtcgagatc
ggccgctccg ggcaccgggt cgagaacggc gtcgacggtc 16801 agaccaacag
cgtgtgccag cgcgtcggac acacccggcg acgccgagtc ggcgttggtg 16861
tgcgcggtaa acaacgagcg accggtccgg atcaggcggt gcaccagcac accctttggc
16921 gtgttggccg cgaccgtatc gaccccacgc agtaacaacg ggtggtgcac
caatagcagt 16981 ccggcctggg gaacctggtc caccaccgcc ggcgtcgcgt
ccaccgcaac ggtcaccgaa 17041 tccaccacgt cgtcggggtc gccgcacacc
agacccaccg aatcccacga ctgggcaagc 17101 cgcggcgggt aggcctggtc
cagcacgtcg atgacatcgg ccagccgcac actcatcggc 17161 gtcctccacg
ctttgcccac tcggcgatcg ccgccaccag cacgggccac tccgggcgca 17221
ccgccgcccg caggtaccgc gcgtccaggc cgacgaaggt gtcaccgcgg cgcaccgcaa
17281 ttcctttgct ctgcaaatag tttcgtaatc cgtcagcatc ggcgatgttg
aacagtacga 17341 aaggggccgc accatcgacc acctcggcac ccaccgatct
cagtccggcc accatctccg 17401 cgcgcagcgc cgtcaaccgc accgcatcgg
ctgcggcagc ggcgaccgcc cggggggcgc 17461 agcaagcagc gatggccgtc
agttgcaatg ttcccaacgg ccagtgcgct cgctgcacgg 17521 tcaaccgagc
cagcacgtct ggcgagccga gcgcgtagcc cacccgcaat ccggccagcg 17581
accacgtttt cgtcaagcta cggagcacca gcacatcggg cagcgagtca tcggccaacg
17641 attgcggctc gccgggaacc caatcagcga acgcctcgtc gaccaccagg
atgcgtcccg 17701 gccggcgtaa ctcgagcagc tgctcgcgga ggtgcagcac
cgaggtgggg ttggtcggat 17761 tacccacgac gacaaggtcg gcgtcgtcag
gcacgtgcgc ggtgtccagc acgaacggcg 17821 gctttaggac aacatggtgc
gccgtgattc cggcagcgct caaggctatg gccggctcgg 17881 tgaacgcggg
cacgacgatt gctgcccgca ccggacttag gttgtgcagc aatgcgaatc 17941
cctccgccgc cccgacgagc gggagcactt cgtcacgggt tctgccatga cgttcagcga
18001 ccgcgtcttg cgcccggtgc acatcgtcgg tgctcggata gcgggccagc
tccggcagca 18061 gcgcggcgag ctgccggacc aaccattccg ggggccggtc
atggcggacg ttgacggcga 18121 agtccagcac gccgggcgcg acatcctgat
caccgtggta gcgcgccgcg gcaagcgggc 18181 tagtgtctag actcgccaca
gcgtcaaaca gtagtgggcc ggtgtgcggg ccaagaatcc 18241 agagcaccgc
cgacgcgttg tctacgcggc gacaaccgcg acatcacagg cagctaacag 18301
ggcgtcggcg gtgatgatcg tcaggccaag cagctgtgcc tgggcgatga gcacacggtc
18361 gaatggatgt cgatggtgat ccggaagctc tgcggtgcgc agtgtgtgcg
tggtcaactg 18421 acagcggcga cgtgccgcag cggcgcattc gatcgggcac
gtaagaagcc gatggctcgg 18481 gcggcgggag cttgccgagg cggtagttga
tcgcgatctc ccaggcactg gcggccgaca 18541 agagaatgct gttgcggacg
tcctgaacaa tcgcccgtgt ttcgttgacg gcatccgcag 18601 ccaaacgtgg
gtgtcgatga ggtagcgctt caccggtgaa agcgttcgag cacgtcgtct 18661
gacaacggag cgtccaaatc gtcgggcacg cggtacacgc catggtcaat gcctaaccgc
18721 cgagtctcat gaggatgcag cggcacaagc tttgctaccg gctcgccgcg
gcgggcaatc 18781 tcaacctctg cccgccgtag acgagccgca gcagctcgga
caggcgtgtc ttcgcctcgt 18841 gaacgccgac ccgcttcgca ggcgcccaga
ctttcgcgtc gaccacctgc tcaccaaact 18901 tcgcgatcat cgcctgatac
cacagcgcca acgggtagcg gtttgtccaa ccgcttcgtc 18961 aacgacaatg
ggatcgtgac cgacacgacc gcgagcggga ccaattgccc gcctcctcca 19021
cgcgccgccg cacggcgcgc atcgtcgccg ggtgaatcgc cgcagctggt gatcttcgat
19081 ctggacggca cgctgaccga ctcggcgcgc ggaatcgtat ccagcttccg
acacgcgctc 19141 aaccacatcg gtgccccagt acccgaaggc gacctggcca
ctcacatcgt cggcccgccc 19201 atgcatgaga cgctgcgcgc catggggctc
ggcgaatccg ccgaggaggc gatcgtagcc 19261 taccgggccg actacagcgc
ccgcggttgg gcgatgaaca gcttgttcga cgggatcggg 19321 ccgctgctgg
ccgacctgcg caccgccggt gtccggctgg ccgtcgccac ctccaaggca 19381
gagccgaccg cacggcgaat cctgcgccac ttcggaattg agcagcactt cgaggtcatc
19441 gcgggcgcga gcaccgatgg ctcgcgaggc agcaaggtcg acgtgctggc
ccacgcgctc 19501 gcgcagctgc ggccgctacc cgagcggttg gtgatggtcg
gcgaccgcag ccacgacgtc 19561 gacggggcgg ccgcgcacgg catcgacacg
gtggtggtcg gctggggcta cgggcgcgcc 19621 gactttatcg acaagacctc
caccaccgtc gtgacgcatg ccgccacgat tgacgagctg 19681 agggaggcgc
taggtgtctg atccgctgca cgtcacattc gtttgtacgg gcaacatctg 19741
ccggtcgcca atggccgaga agatgttcgc ccaacagctt cgccaccgtg gcctgggtga
19801 cgcggtgcga gtgaccagtg cgggcaccgg gaactggcat gtaggcagtt
gcgccgacga 19861 gcgggcggcc ggggtgttgc gagcccacgg ctaccctacc
gaccaccggg ccgcacaagt 19921 cggcaccgaa cacctggcgg cagacctgtt
ggtggccttg gaccgcaacc acgctcggct 19981 gttgcggcag ctcggcgtcg
aagccgcccg ggtacggatg ctgcggtcat tcgacccacg 20041 ctcgggaacc
catgcgctcg atgtcgagga tccctactat ggcgatcact ccgacttcga 20101
ggaggtcttc gccgtcatcg aatccgccct gcccggcctg cacgactggg tcgacgaacg
20161 tctcgcgcgg aacggaccga gttgatgccc cgcctagcgt tcctgctgcg
gcccggctgg 20221 ctggcgttgg ccctggtcgt ggtcgcgttc acctacctgt
gctttacggt gctcgcgccg 20281 tggcagctgg gcaagaatgc caaaacgtca
cgagagaacc agcagatcag gtattccctc 20341 gacaccccgc cggttccgct
gaaaaccctt ctaccacagc aggattcgtc ggcgccggac 20401 gcgcagtggc
gccgggtgac ggcaaccgga cagtaccttc cggacgtgca ggtgctggcc 20461
cgactgcgcg tggtggaggg ggaccaggcg tttgaggtgt tggccccatt cgtggtcgac
20521 ggcggaccaa ccgtcctggt cgaccgtgga tacgtgcggc cccaggtggg
ctcgcacgta 20581 ccaccgatcc cccgcctgcc ggtgcagacg gtgaccatca
ccgcgcggct gcgtgactcc 20641 gaaccgagcg tggcgggcaa agacccattc
gtcagagacg gcttccagca ggtgtattcg 20701 atcaataccg gacaggtcgc
cgcgctgacc ggagtccagc tggctgggtc ctatctgcag 20761 ttgatcgaag
accaacccgg cgggctcggc gtgctcggcg ttccgcatct agatcccggg 20821
ccgttcctgt cctatggcat ccaatggatc tcgttcggca ttctggcacc gatcggcttg
20881 ggctatttcg cctacgccga gatccgggcg cgccgccggg aaaaagcggg
gtcgccacca 20941 ccggacaagc caatgacggt cgagcagaaa ctcgctgacc
gctacggccg ccggcggtaa 21001 accaacatca cggccaatac cgcagccccc
gcctggacca cccgcgacag caccacggcg 21061 cggcgcagat cggccacctt
gggcgaccgg ccgtcgccca aggtgggccg gatctgcaac 21121 tcatggtggt
accgggtggg cccacccagc cgcacgtcaa gcgccccagc aaacgccgcc 21181
tcgacgacac cggcgttggg gctgggatgg cgggcggcgt cgcgccgcca ggcccgtacc
21241 gcaccgcggg gcgacccacc gaccaccggc gcgcagatca ccaccagcac
cgccgtcgcc 21301 cgtgcgccaa catagttggc ccagtcatcc aatcgtgctg
cagcccaacc gaatcggaga 21361 taacgcggcg agcggtagcc gatcatcgag
tccagggtgt tgatggcacg atatcccagc 21421 accgcaggca cgccgctcga
agccgcccac agcagcggca ccacctgggc gtcggcggtg 21481 ttttcggcca
ccgactccag cgcggcacgc gtcaggcccg ggccgcccag ctgggccggg 21541
tcacgcccgc acagcgacgg cagcagccgt cgcgccgcct cgacatcgtc gcgctccaac
21601 aggtccgata tctggcggcc ggtgcgcgcc agcgaagttc cgcccagcgc
tgcccaggtg 21661 gccgtcgcgg tggccgccac gggccaggac ctgccgggta
gccgctgcag tgccgcgccg 21721 agcaagccca ccgcgccgac cagcaggccg
acgtgtaccg caccggcgac ccggccgtca 21781 cggtaggtga tctgctccag
cttggcggcc gcccgaccga acagggccac cggatgacct 21841 cgtttggggt
cgccgaacac gacgtcgagc aggcagccga tcagcacgcc gacggccctg 21901
gtctgccagg tcgatgcaaa cactccggca gcgtcgcaca cgtggtctac gctcagctat
21961 ttatgacctc atacggcagc tatccacgat gaagcggcca gctacccggg
ttgccgacct 22021 gttgaacccg gcggcaatgt tgttgccggc agcgaatgtc
atcatgcagc tggcagtgcc 22081 gggtgtcggg tatggcgtgc tggaaagccc
ggtggacagc ggcaacgtct acaagcatcc 22141 gttcaagcgg gcccggacca
ccggcaccta cctggcggtg gcgaccatcg ggacggaatc 22201 cgaccgagcg
ctgatccggg gtgccgtgga cgtcgcgcac cggcaggttc ggtcgacggc 22261
ctcgagccca gtgtcctata acgccttcga cccgaagttg cagctgtggg tggcggcgtg
22321 tctgtaccgc tacttcgtgg accagcacga gtttctgtac ggcccactcg
aagatgccac 22381 cgccgacgcc gtctaccaag acgccaaacg gttagggacc
acgctgcagg tgccggaggg 22441 gatgtggccg ccggaccggg tcgcgttcga
cgagtactgg aagcgctcgc ttgatgggct 22501 gcagatcgac gcgccggtgc
gcgagcatct tcgcggggtg gcctcggtag cgtttctccc 22561 gtggccgttg
cgcgcggtgg ccgggccgtt caacctgttt gcgacgacgg gattcttggc 22621
accggagttc cgcgcgatga tgcagctgga gtggtcacag gcccagcagc gtcgcttcga
22681 gtggttactt tccgtgctac ggttagccga ccggctgatt ccgcatcggg
cctggatctt 22741 cgtttaccag ctttacttgt gggacatgcg gtttcgcgcc
cgacacggcc gccgaatcgt 22801 ctgatagagc ccggccgagt gtgagcctga
cagcccgaca ccggcggcgt gtgtcgcgtc 22861 gccaggttca cgctcggcga
tctagagccg ccgaaaacct acttctgggt tgcctcccga 22921 atcaacgtgc
tgatctgctc gagcagctca cgcatatcgg cgcgcatcgc atccaccgcg 22981
gcatacaggt cggccttggt cgccggcagc tggtccgacg tcattggccg caccggcggt
23041 gctgtctgtc gcgccgcgct gtcgctttga aacccaggtc gctcacccac
gaccacgaca 23101 ctgccatatc cggcgccccg ccgacaacga agcacagcta
gccggtgggc gcggacggga 23161 tcgaaccgcc gaccgctggt gtgtaaaacc
agagctctac cgctgagcta cgcgcccatg 23221 accgccgcag gctacacgcc
ttgcggccaa gcacccaaaa ccttaggccg taagcgccgc 23281 cagagcgtcg
gtccacagcc gctgatcgcg aacttcaccc ggctgcttca tctcggcgaa 23341
ccgaatgatc cctgaccgat cgaccacaaa ggtgccccgg ttagcgatgc cggcctgctc
23401 gttgaagacg ccgtaggcct gactgaccgc gccgtgtggc cagaagtccg
acaacagcgg 23461 aaacgtgaat ccgctctgcg tcgcccagat cttgtgagtg
ggtggcgggc ccaccgaaat 23521 cgctagcgcg gcgctgtcgt cgttctcaaa
ctcgggcagg tgatcacgca actggtccag 23581 ctcgccctgg cagatgcccg
tgaacgccaa cggaaagaac accaacagca cgttctttgc 23641 accccggtag
ccgcgcaggg tgacaagctg ctgattctgg tcgcgcaacg tgaagtcagg
23701 ggcggtggct ccgacgttca gcatcagcgc ttgccagccc gcgatttcgg
ctgtaccaat 23761 ctgctggcgc tccagttgcc cagattgacc gacgaggtcg
gcatcagccc agctgtgggc 23821 gccgcctcgg caatctcggc gggcaataca
tggccgggct ggccggtctt gggcgtcacc 23881 acccaaatca caccgtcctc
ggcgagcggg ccgatcgcat ccatcagggt gtccaccaaa 23941 tcgccgtcgc
catcacgcca ccacaacagg acgacatcga tgacctcgtc ggtgtcttca 24001
tcgagcaact ctcccccgca cgcttcttcg atggccgcgc ggatgtcgtc gtcggtgtct
24061 tcgtcccagc cccattcctg gataagttgg tctcgttgga tgcccaattt
gcgggcgtag 24121 ttcgaggcgt gatccgccgc gaccaccgtg gaacctcctt
cagtctccgc gggccatgtg 24181 cacaccgtcg cgatgggcat tatcgtcgca
cagccagaac cggtccaccc gcccgcctca 24241 gaaggcggcc acgcacattg
tcaatgcctt tgtcttggtg tcgttgagcc gatcaacccg 24301 ccggttgaat
tccgctgtcg acgcgtgcgc accgatggca tttgccaccg cgcgggccgc 24361
gtcgacatat gcgttgagcg catcccccag ttgcgcggac agcgcggcgc tcagactgcc
24421 tgagaccgtc gaggcactgt tgttgagcgc gtcgatggcc ggaccttcgg
tcggcccggt 24481 gttgcggccc tgattgaacg cggccacgta ggcgttcacc
ttgtcgatgg cgtccttgct 24541 ggtggccgcc agcgcgtcac acgaggtgcg
aatcgccttg gtcgtcagcg attgttggcg 24601 ctgcgactcc cggatgctcg
acgtcgccgc cgaagccgac accgacgcgg acaccgacga 24661 gcggtaggcc
ggtgcgacgt tggtgtcggg catggccgta ccgtcggtga cagtggtaca 24721
tccgacgatc cccatcagca gcagcgcgat gcagccgagc gccagggcgc ctcgcctggg
24781 gagctccccc ccgtgcctgc gaggcacggc gcgccatccg atgagcacgg
catgtgaggt 24841 tacctggtcg cagcgcgacc gcgctggccg tggtgtgtcg
cgcatccgca gaaccgagcg 24901 gagtgcggct atccgccgcc gacgccggtg
cggcacgata gggggacgac catctaaaca 24961 gcacgcaagc ggaagcccgc
cacctacagg agtagtgcgt tgaccaccga tttcgcccgc 25021 cacgatctgg
cccaaaactc aaacagcgca agcgaacccg accgagttcg ggtgatccgc 25081
gagggtgtgg cgtcgtattt gcccgacatt gatcccgagg agacctcgga gtggctggag
25141 tcctttgaca cgctgctgca acgctgcggc ccgtcgcggg cccgctacct
gatgttgcgg 25201 ctgctagagc gggccggcga gcagcgggtg gccatcccgg
cattgacgtc taccgactat 25261 gtcaacacca tcccgaccga gctggagccg
tggttccccg gcgacgaaga cgtcgaacgt 25321 cgttatcgag cgtggatcag
atggaatgcg gccatcatgg tgcaccgtgc gcaacgaccg 25381 ggtgtgggcg
tgggtggcca tatctcgacc tacgcgtcgt ccgcggcgct ctatgaggtc 25441
ggtttcaacc acttcttccg cggcaagtcg cacccgggcg gcggcgatca ggtgttcatc
25501 cagggccacg cttccccggg aatctacgcg cgcgccttcc tcgaagggcg
gttgaccgcc 25561 gagcaactcg acggattccg ccaggaacac agccatgtcg
gcggcgggtt gccgtcctat 25621 ccgcacccgc ggctcatgcc cgacttctgg
gaattcccca ccgtgtcgat gggtttgggc 25681 ccgctcaacg ccatctacca
ggcacggttc aaccactatc tgcatgaccg cggtatcaaa 25741 gacacctccg
atcaacacgt gtggtgtttt ttgggcgacg gcgagatgga cgaacccgag 25801
agccgtgggc tggcccacgt cggcgcgctg gaaggcttgg acaacttgac cttcgtgatc
25861 aactgcaatc tgcagcgact cgacggcccg gtgcgcggca acggcaagat
catccaggag 25921 ctggagtcgt tcttccgcgg tgccggctgg aacgtcatca
aggtggtgtg gggccgcgaa 25981 tgggatgccc tgctgcacgc cgaccgcgac
ggtgcgctgg tgaatttaat gaatacaaca 26041 cccgatggcg attaccagac
ctataaggcc aacgacggcg gctacgtgcg tgaccacttc 26101 ttcggccgcg
acccacgcac caaggcgctg gtggagaaca tgagcgacca ggatatctgg 26161
aacctcaaac ggggcggcca cgattaccgc aaggtttacg ccgcctaccg cgccgccgtc
26221 gaccacaagg gacagccgac ggtgatcctg gccaagacca tcaaaggcta
cgcgctgggc 26281 aagcatttcg aaggacgcaa tgccacccac cagatgaaaa
aactgaccct ggaagacctt 26341 aaggagtttc gtgacacgca gcggattccg
gtcagcgacg cccagcttga agagaatccg 26401 tacctgccgc cctactacca
ccccggcctc aacgccccgg agattcgtta catgctcgac 26461 cggcgccggg
ccctcggggg ctttgttccc gagcgcagga ccaagtccaa agcgctgacc 26521
ctgccgggtc gcgacatcta cgcgccgctg aaaaagggct ctgggcacca ggaggtggcc
26581 accaccatgg cgacggtgcg cacgttcaaa gaagtgttgc gcgacaagca
gatcgggccg 26641 aggatagtcc cgatcattcc cgacgaggcc cgcaccttcg
ggatggactc ctggttcccg 26701 tcgctaaaga tctataaccg caatggccag
ctgtataccg cggttgacgc cgacctgatg 26761 ctggcctaca aggagagcga
agtcgggcag atcctgcacg agggcatcaa cgaagccggg 26821 tcggtgggct
cgttcatcgc ggccggcacc tcgtatgcga cgcacaacga accgatgatc 26881
cccatttaca tcttctactc gatgttcggc ttccagcgca ccggcgatag cttctgggcc
26941 gcggccgacc agatggctcg agggttcgtg ctcggggcca ccgccgggcg
caccaccctg 27001 accggtgagg gcctgcaaca cgccgacggt cactcgttgc
tgctggccgc caccaacccg 27061 gcggtggttg cctacgaccc ggccttcgcc
tacgaaatcg cctacatcgt ggaaagcgga 27121 ctggccagga tgtgcgggga
gaacccggag aacatcttct tctacatcac cgtctacaac 27181 gagccgtacg
tgcagccgcc ggagccggag aacttcgatc ccgagggcgt gctgcggggt 27241
atctaccgct atcacgcggc caccgagcaa cgcaccaaca aggcgcagat cctggcctcc
27301 ggggtagcga tgcccgcggc gctgcgggca gcacagatgc tggccgccga
gtgggatgtc 27361 gccgccgacg tgtggtcggt gaccagttgg ggcgagctaa
accgcgacgg ggtggccatc 27421 gagaccgaga agctccgcca ccccgatcgg
ccggcgggcg tgccctacgt gacgagagcg 27481 ctggagaatg ctcggggccc
ggtgatcgcg gtgtcggact ggatgcgcgc ggtccccgag 27541 cagatccgac
cgtgggtgcc gggcacatac ctcacgttgg gcaccgacgg gttcggcttt 27601
tccgacactc ggcccgccgc tcgccgctac ttcaacaccg acgccgaatc ccaggtggtc
27661 gcggttttgg aggcgttggc gggcgacggc gagatcgacc catcggtgcc
ggtcgcggcc 27721 gcccgccagt accggatcga cgacgtggcg gctgcgcccg
agcagaccac ggatcccggt 27781 cccggggcct aacgccggcg agccgaccgc
ctttggccga atcttccaga aatctggcgt 27841 agcttttagg agtgaacgac
aatcagttgg ctccagttgc ccgcccgagg tcgccgctcg 27901 aactgctgga
cactgtgccc gattcgctgc tgcggcggtt gaagcagtac tcgggccggc 27961
tggccaccga ggcagtttcg gccatgcaag aacggttgcc gttcttcgcc gacctagaag
28021 cgtcccagcg cgccagcgtg gcgctggtgg tgcagacggc cgtggtcaac
ttcgtcgaat 28081 ggatgcacga cccgcacagt gacgtcggct ataccgcgca
ggcattcgag ctggtgcccc 28141 aggatctgac gcgacggatc gcgctgcgcc
agaccgtgga catggtgcgg gtcaccatgg 28201 agttcttcga agaagtcgtg
cccctgctcg cccgttccga agagcagttg accgccctca 28261 cggtgggcat
tttgaaatac agccgcgacc tggcattcac cgccgccacg gcctacgccg 28321
atgcggccga ggcacgaggc acctgggaca gccggatgga ggccagcgtg gtggacgcgg
28381 tggtacgcgg cgacaccggt cccgagctgc tgtcccgggc ggccgcgctg
aattgggaca 28441 ccaccgcgcc ggcgaccgta ctggtgggaa ctccggcgcc
cggtccaaat ggctccaaca 28501 gcgacggcga cagcgagcgg gccagccagg
atgtccgcga caccgcggct cgccacggcc 28561 gcgctgcgct gaccgacgtg
cacggcacct ggctggtggc gatcgtctcc ggccagctgt 28621 cgccaaccga
gaagttcctc aaagacctgc tggcagcatt cgccgacgcc ccggtggtca 28681
tcggccccac ggcgcccatg ctgaccgcgg cgcaccgcag cgctagcgag gcgatctccg
28741 ggatgaacgc cgtcgccggc tggcgcggag cgccgcggcc cgtgctggct
agggaacttt 28801 tgcccgaacg cgccctgatg ggcgacgcct cggcgatcgt
ggccctgcat accgacgtga 28861 tgcggcccct agccgatgcc ggaccgacgc
tcatcgagac gctagacgca tatctggatt 28921 gtggcggcgc gattgaagct
tgtgccagaa agttgttcgt tcatccaaac acagtgcggt 28981 accggctcaa
gcggatcacc gacttcaccg ggcgcgatcc cacccagcca cgcgatgcct 29041
atgtccttcg ggtggcggcc accgtgggtc aactcaacta tccgacgccg cactgaagca
29101 tcgacagcaa tgccgtgtca tagattccct cgccggtcag agggggtcca
gcaggggccc 29161 cggaaagata ccaggggcgc cgtcggacgg aaagtgatcc
agacaacagg tcgcgggacg 29221 atctcaaaaa catagcttac aggcccgttt
tgttggttat atacaaaaac ctaagacgag 29281 gttcataatc tgttacaccg
cgcaaaaccg tcttcacagt gttctcttag acacgtgatt 29341 gcgttgctcg
cacccggaca gggttcgcaa accgagggaa tgttgtcgcc gtggcttcag 29401
ctgcccggcg cagcggacca gatcgcggcg tggtcgaaag ccgctgatct agatcttgcc
29461 cggctgggca ccaccgcctc gaccgaggag atcaccgaca ccgcggtcgc
ccagccattg 29521 atcgtcgccg cgactctgct ggcccaccag gaactggcgc
gccgatgcgt gctcgccggc 29581 aaggacgtca tcgtggccgg ccactccgtc
ggcgaaatcg cggcctacgc aatcgccggt 29641 gtgatagccg ccgacgacgc
cgtcgcgctg gccgccaccc gcggcgccga gatggccaag 29701 gcctgcgcca
ccgagccgac cggcatgtct gcggtgctcg gcggcgacga gaccgaggtg 29761
ctgagtcgcc tcgagcagct cgacttggtc ccggcaaacc gcaacgccgc cggccagatc
29821 gtcgctgccg gccggctgac cgcgttggag aagctcgccg aagacccgcc
ggccaaggcg 29881 cgggtgcgtg cactgggtgt cgccggagcg ttccacaccg
agttcatggc gcccgcactt 29941 gacggctttg cggcggccgc ggccaacatc
gcaaccgccg accccaccgc cacgctgctg 30001 tccaaccgcg acgggaagcc
ggtgacatcc gcggccgcgg cgatggacac cctggtctcc 30061 cagctcaccc
aaccggtgcg atgggacctg tgcaccgcga cgctgcgcga acacacagtc 30121
acggcgatcg tggagttccc ccccgcgggc acgcttagcg gtatcgccaa acgcgaactt
30181 cggggggttc cggcacgcgc cgtcaagtca cccgcagacc tggacgagct
ggcaaaccta 30241 taaccgcgga ctcggccaga acaaccacat acccgtcagt
tcgatttgta cacaacatat 30301 tacgaaggga agcatgctgt gcctgtcact
caggaagaaa tcattgccgg tatcgccgag 30361 atcatcgaag aggtaaccgg
tatcgagccg tccgagatca ccccggagaa gtcgttcgtc 30421 gacgacctgg
acatcgactc gctgtcgatg gtcgagatcg ccgtgcagac cgaggacaag 30481
tacggcgtca agatccccga cgaggacctc gccggtctgc gtaccgtcgg tgacgttgtc
30541 gcctacatcc agaagctcga ggaagaaaac ccggaggcgg ctcaggcgtt
gcgcgcgaag 30601 attgagtcgg agaaccccga tgccgttgcc aacgttcagg
cgaggcttga ggccgagtcc 30661 aagtgagtca gccttccacc gctaatggcg
gtttccccag cgttgtggtg accgccgtca 30721 cagcgacgac gtcgatctcg
ccggacatcg agagcacgtg gaagggtctg ttggccggcg 30781 agagcggcat
ccacgcactc gaagacgagt tcgtcaccaa gtgggatcta gcggtcaaga 30841
tcggcggtca cctcaaggat ccggtcgaca gccacatggg ccgactcgac atgcgacgca
30901 tgtcgtacgt ccagcggatg ggcaagttgc tgggcggaca gctatgggag
tccgccggca 30961 gcccggaggt cgatccagac cggttcgccg ttgttgtcgg
caccggtcta ggtggagccg 31021 agaggattgt cgagagctac gacctgatga
atgcgggcgg cccccggaag gtgtccccgc 31081 tggccgttca gatgatcatg
cccaacggtg ccgcggcggt gatcggtctg cagcttgggg 31141 cccgcgccgg
ggtgatgacc ccggtgtcgg cctgttcgtc gggctcggaa gcgatcgccc 31201
acgcgtggcg tcagatcgtg atgggcgacg ccgacgtcgc cgtctgcggc ggtgtcgaag
31261 gacccatcga ggcgctgccc atcgcggcgt tctccatgat gcgggccatg
tcgacccgca 31321 acgacgagcc tgagcgggcc tcccggccgt tcgacaagga
ccgcgacggc tttgtgttcg 31381 gcgaggccgg tgcgctgatg ctcatcgaga
cggaggagca cgccaaagcc cgtggcgcca 31441 agccgttggc ccgattgctg
ggtgccggta tcacctcgga cgcctttcat atggtggcgc 31501 ccgcggccga
tggtgttcgt gccggtaggg cgatgactcg ctcgctggag ctggccgggt 31561
tgtcgccggc ggacatcgac cacgtcaacg cgcacggcac ggcgacgcct atcggcgacg
31621 ccgcggaggc caacgccatc cgcgtcgccg gttgtgatca ggccgcggtg
tacgcgccga 31681 agtctgcgct gggccactcg atcggcgcgg tcggtgcgct
cgagtcggtg ctcacggtgc 31741 tgacgctgcg cgacggcgtc atcccgccga
ccctgaacta cgagacaccc gatcccgaga 31801 tcgaccttga cgtcgtcgcc
ggcgaaccgc gctatggcga ttaccgctac gcagtcaaca 31861 actcgttcgg
gttcggcggc cacaatgtgg cgcttgcctt cgggcgttac tgaagcacga 31921
catcgcgggt cgcgaggccc gaggtggggg tccccccgct tgcgggggcg agtcggaccg
31981 atatggaagg aacgttcgca agaccaatga cggagctggt taccgggaaa
gcctttccct 32041 acgtagtcgt caccggcatc gccatgacga ccgcgctcgc
gaccgacgcg gagactacgt 32101 ggaagttgtt gctggaccgc caaagcggga
tccgtacgct cgatgaccca ttcgtcgagg 32161 agttcgacct gccagttcgc
atcggcggac atctgcttga ggaattcgac caccagctga 32221 cgcggatcga
actgcgccgg atgggatacc tgcagcggat gtccaccgtg ctgagccggc 32281
gcctgtggga aaatgccggc tcacccgagg tggacaccaa tcgattgatg gtgtccatcg
32341 gcaccggcct gggttcggcc gaggaactgg tcttcagtta cgacgatatg
cgcgctcgcg 32401 gaatgaaggc ggtctcgccg ctgaccgtgc agaagtacat
gcccaacggg gccgccgcgg 32461 cggtcgggtt ggaacggcac gccaaggccg
gggtgatgac gccggtatcg gcgtgcgcat 32521 ccggcgccga ggccatcgcc
cgtgcgtggc agcagattgt gctgggagag gccgatgccg 32581 ccatctgcgg
cggcgtggag accaggatcg aagcggtgcc catcgccggg ttcgctcaga 32641
tgcgcatcgt gatgtccacc aacaacgacg accccgccgg tgcatgccgc ccattcgaca
32701 gggaccgcga cggctttgtg ttcggcgagg gcggcgccct tctgttgatc
gagaccgagg 32761 agcacgccaa ggcacgtggc gccaacatcc tggcccggat
catgggcgcc agcatcacct 32821 ccgatggctt ccacatggtg gccccggacc
ccaacgggga acgcgccggg catgcgatta 32881 cgcgggcgat tcagctggcg
ggcctcgccc ccggcgacat cgaccacgtc aatgcgcacg 32941 ccaccggcac
ccaggtcggc gacctggccg aaggcagggc catcaacaac gccttgggcg 33001
gcaaccgacc ggcggtgtac gcccccaagt ctgccctcgg ccactcggtg ggcgcggtcg
33061 gcgcggtcga atcgatcttg acggtgctcg cgttgcgcga tcaggtgatc
ccgccgacac 33121 tgaatctggt aaacctcgat cccgagatcg atttggacgt
ggtggcgggt gaaccgcgac 33181 cgggcaatta ccggtatgcg atcaataact
cgttcggatt cggcggccac aacgtggcaa 33241 tcgccttcgg acggtactaa
accccagcgt tacgcgacag gagacctgcg atgacaatca 33301 tggcccccga
ggcggttggc gagtcgctcg acccccgcga tccgctgttg cggctgagca 33361
acttcttcga cgacggcagc gtggaattgc tgcacgagcg tgaccgctcc ggagtgctgg
33421 ccgcggcggg caccgtcaac ggtgtgcgca ccatcgcgtt ctgcaccgac
ggcaccgtga 33481 tgggcggcgc catgggcgtc gaggggtgca cgcacatcgt
caacgcctac gacactgcca 33541 tcgaagacca gagtcccatc gtgggcatct
ggcattcggg tggtgcccgg ctggctgaag 33601 gtgtgcgggc gctgcacgcg
gtaggccagg tgttcgaagc catgatccgc gcgtccggct 33661 acatcccgca
gatctcggtg gtcgtcggtt tcgccgccgg cggcgccgcc tacggaccgg 33721
cgttgaccga cgtcgtcgtc atggcgccgg aaagccgggt gttcgtcacc gggcccgacg
33781 tggtgcgcag cgtcaccggc gaggacgtcg acatggcctc gctcggtggg
ccggagaccc 33841 accacaagaa gtccggggtg tgccacatcg tcgccgacga
cgaactcgat gcctacgacc 33901 gtgggcgccg gttggtcgga ttgttctgcc
agcaggggca tttcgatcgc agcaaggccg 33961 aggccggtga caccgacatc
cacgcgctgc tgccggaatc ctcgcgacgt gcctacgacg 34021 tgcgtccgat
cgtgacggcg atcctcgatg cggacacacc gttcgacgag ttccaggcca 34081
attgggcgcc gtcgatggtg gtcgggctgg gtcggctgtc gggtcgcacg gtgggtgtac
34141 tggccaacaa cccgctacgc ctgggcggct gcctgaactc cgaaagcgca
gagaaggcag 34201 cgcgtttcgt gcggctgtgc gacgcgttcg ggattccgct
ggtggtggtg gtcgatgtgc 34261 cgggctatct gcccggtgtc gaccaggagt
ggggtggcgt ggtgcgccgt ggcgccaagt 34321 tgctgcacgc gttcggcgag
tgcaccgttc cgcgggtcac gctggtcacc cgaaagacct 34381 acggcggggc
atacattgcg atgaactccc ggtcgttgaa cgcgaccaag gtgttcgcct 34441
ggccggacgc cgaggtcgcg gtgatgggcg ctaaggcggc cgtcggcatc ctgcacaaga
34501 agaagttggc cgccgctccg gagcacgaac gcgaagcgct gcacgaccag
ttggccgccg 34561 agcatgagcg catcgccggc ggggtcgaca gtgcgctgga
catcggtgtg gtcgacgaga 34621 agatcgaccc ggcgcatact cgcagcaagc
tcaccgaggc gctggcgcag gctccggcac 34681 ggcgcggccg ccacaagaac
atcccgctgt agttctgacc gcgagcagac gcagaatcgc 34741 acgcgcgagg
tccgcgccgt gcgattctgc gtctgctcgc cagttatccc cagcggtggc 34801
tggtcaacgc gaggcgctcc tcgcatgctc ggacggtgcc taccgacgcg ctaacaattc
34861 tcgagaaggc cggcgggttc gccaccaccg cgcaattgct cacggtcatg
acccgccaac 34921 agctcgacgt ccaagtgaaa aacggcggcc tcgttcgcgt
ttggtacggg gtctacgcgg 34981 cacaagagcc ggacctgttg ggccgcttgg
cggctctcga tgtgttcatg ggggggcacg 35041 ccgtcgcgtg tctgggcacc
gccgccgcgt tgtatggatt cgacacggaa aacaccgtcg 35101 ctatccatat
gctcgatccc ggagtaagga tgcggcccac ggtcggtctg atggtccacc 35161
aacgcgtcgg tgcccggctc caacgggtgt caggtcgtct cgcgaccgcg cccgcatgga
35221 ctgccgtgga ggtcgcacga cagttgcgcc gcccgcgggc gctggccacc
ctcgacgccg 35281 cactacggtc aatgcgctgc gctcgcagtg aaattgaaaa
cgccgttgct gagcagcgag 35341 gccgccgagg catcgtcgcg gcgcgcgaac
tcttaccctt cgccgacgga cgcgcggaat
35401 cggccatgga gagcgaggct cggctcgtca tgatcgacca cgggctgccg
ttgcccgaac 35461 ttcaataccc gatacacggc cacggtggtg aaatgtggcg
agtcgacttc gcctggcccg 35521 acatgcgtct cgcggccgaa tacgaaagca
tcgagtggca cgcgggaccg gcggagatgc 35581 tgcgcgacaa gacacgctgg
gccaagctcc aagagctcgg gtggacgatt gtcccgattg 35641 tcgtcgacga
tgtcagacgc gaacccggcc gcctggcggc ccgcatcgcc cgccacctcg 35701
accgcgcgcg tatggccggc tgaccgctgg tgagcagacg cagagtcgca ctgcggccgg
35761 cgcagtgcga ctctgcgtct gctcgcgctc aacggctgag gaactcctta
gccacggcga 35821 ctacgcgctc gcgatcccgt ggcaccagac cgatccgggt
ccggcggtcg aggatatcgt 35881 ccacatccag cgccccctca tgggtcaccg
cgtattcgaa ctccgcccgg gtcacgtcga 35941 tgccgtcggc gaccggctcg
gtgggccgct cacatgtggc ggcggcagcg acgttggccg 36001 cctcggcccc
gtaccgcgcc accagcgact cgggcaatcc ggcgcccgat ccgggggccg 36061
gcccagggtt cgccggtgcg ccgatcagcg gcaggttgcg agtgcggcac ttcgcggctc
36121 gcaggtgtcg cagcgtgatg gcgcgattca gcacatcctc tgccatgtag
cggtattccg 36181 tcagcttgcc gccgaccaca ctgatcacgc ccgacggcga
ttcaaaaaca gcgtggtcac 36241 gcgaaacgtc ggcggtgcgg ccctggacac
cagcaccgcc ggtgtcgatt agcggccgca 36301 atcccgcata ggcaccgatg
acatccttgg tgccgaccgc cgtccccaat gcggtgttca 36361 ccgtatccag
caggaacgtg atctcttccg aagacggttg tggcacatcg ggaatcgggc 36421
cgggtgcgtc ttcgtcggtc agcccgagat agatccggcc cagctgctcg ggcatggcga
36481 acacgaagcg gttcagctca ccggggatcg gaatggtcag cgcggcagtc
ggattggcaa 36541 acgacttcgc gtcgaagacc agatgtgtgc cgcggctggg
gcgtagcctc agggacgggt 36601 cgatctcacc cgcccacacg cccgccgcgt
tgatgacggc acgcgccgac agcgcgaacg 36661 actgccgggt gcgccggtcg
gtcaactcca ccgaagtgcc ggtgacattc gacgcgccca 36721 cgtaagtgag
gatgcgggcg ccgtgctggg ccgcggtgcg cgcgacggcc atgaccagcc 36781
gggcgtcgtc gatcaattgc ccgtcgtacg cgagcagacc accgtcgagg ccgtcccgcc
36841 gaacggtggg agcaatctcc accacccgtg acgccgggat tcggcgcgat
cggggcaacg 36901 tcgccgccgg cgtacccgct agcacccgca aagcgtcgcc
ggccaggaaa ccggcacgca 36961 ccaacgcccg cttggtgtga cccatcgacg
gcaacaacgg gaccagttgc ggcatggcat 37021 gcacgagatg aggagcgttg
cgtgtcatca ggattccgcg ttcgacggcg ctgcgccggg 37081 cgatgcccac
gttgccgctg gccagatagc gcagaccgcc gtgcaccaac ttcgagctcc 37141
agcggctggt gccgaacgcc agatcatgct tttccaccaa ggccaccgtc agaccgcggg
37201 tggcagcatc taaggcaatg ccaacaccgg taatgccgcc gcctatcacg
atgacgtcga 37261 gtgcgccacc gtcggccagt gcggtcaggt cggcggagcg
acgcgccgcg ttgagtgcag 37321 ccgagtgggg catcagcaca aatatccgtt
cagtgcgtgg gtaagttcgg tggccagcgc 37381 ggcggaatcg aggatcgaat
cgacgatgtc cgcggactgg atggtcgact gggcgatcag 37441 caacaccatg
gtcgccagtc gacgagcgtc gccggagcgc acactgcccg accgctgcgc 37501
cactgtcagc cgggcggcca acccctcgat caggacctgc tggctggtgc cgaggcgctc
37561 ggtgatgtac accctggcca gctccgagtg catgaccgac atgatcagat
cgtcaccccg 37621 caaccggtcg gccaccgcga caatctgctt taccaacgct
tcccggtcgt ccccgtcgag 37681 gggcacctcc cgcagcacgt cggcgatatg
gctggtcagc atggacgcca tgatcgaccg 37741 ggtgtccggc cagcgacggt
atacggtcgg gcggctcacg cccgcgcgcc gggcgatctc 37801 ggcaagtgtc
acccggtcca cgccgtaatc gacgacgcag ctcgccgctg cccgcaggat 37861
acgaccaccg gtatccgcgc ggtcattact cattgacagc atgtgtaata ctgtaacgcg
37921 tgactcaccg cgaggaactc cttccaccga tgaaatggga cgcgtgggga
gatcccgccg 37981 cggccaagcc actttctgat ggcgtccggt cgttgctgaa
gcaggttgtg ggcctagcgg 38041 actcggagca gcccgaactc gaccccgcgc
aggtgcagct gcgcccgtcc gccctgtcgg 38101 gggcagacca
6.9. X-Linked Inhibitor of Apoptosis Protein ("XIAP")
[0214] GenBank Accession #U45880:
23 1 gaaaaggtgg acaagtccta ttttcaagag aagatgactt ttaacagttt
tgaaggatct (SEQ ID NO: 25) 61 aaaacttgtg tacctgcaga catcaataag
gaagaagaat ttgtagaaga gtttaataga 121 ttaaaaactt ttgctaattt
tccaagtggt agtcctgttt cagcatcaac actggcacga 181 gcagggtttc
tttatactgg tgaaggagat accgtgcggt gctttagttg tcatgcagct 241
gtagatagat ggcaatatgg agactcagca gttggaagac acaggaaagt atccccaaat
301 tgcagattta tcaacggctt ttatcttgaa aatagtgcca cgcagtctac
aaattctggt 361 atccagaatg gtcagtacaa agttgaaaac tatctgggaa
gcagagatca ttttgcctta 421 gacaggccat ctgagacaca tgcagactat
cttttgagaa ctgggcaggt tgtagatata 481 tcagacacca tatacccgag
gaaccctgcc atgtattgtg aagaagctag attaaagtcc 541 tttcagaact
ggccagacta tgctcaccta accccaagag agttagcaag tgctggactc 601
tactacacag gtattggtga ccaagtgcag tgcttttgtt gtggtggaaa actgaaaaat
661 tgggaacctt gtgatcgtgc ctggtcagaa cacaggcgac actttcctaa
ttgcttcttt 721 gttttgggcc ggaatcttaa tattcgaagt gaatctgatg
ctgtgagttc tgataggaat 781 ttcccaaatt caacaaatct tccaagaaat
ccatccatgg cagattatga agcacggatc 841 tttacttttg ggacatggat
atactcagtt aacaaggagc agcttgcaag agctggattt 901 tatgctttag
gtgaaggtga taaagtaaag tgctttcact gtggaggagg gctaactgat 961
tggaagccca gtgaagaccc ttgggaacaa catgctaaat ggtatccagg gtgcaaatat
1021 ctgttagaac agaagggaca agaatatata aacaatattc atttaactca
ttcacttgag 1081 gagtgtctgg taagaactac tgagaaaaca ccatcactaa
ctagaagaat tgatgatacc 1141 atcttccaaa atcctatggt acaagaagct
atacgaatgg ggttcagttt caaggacatt 1201 aagaaaataa tggaggaaaa
aattcagata tctgggagca actataaatc acttgaggtt 1261 ctggttgcag
atctagtgaa tgctcagaaa gacagtatgc aagatgagtc aagtcagact 1321
tcattacaga aagagattag tactgaagag cagctaaggc gcctgcaaga ggagaagctt
1381 tgcaaaatct gtatggatag aaatattgct atcgtttttg ttccttgtgg
acatctagtc 1441 acttgtaaac aatgtgctga agcagttgac aagtgtccca
tgtgctacac agtcattact 1501 ttcaagcaaa aaatttttat gtcttaatct
aactctatag taggcatgtt atgttgttct 1561 tattaccctg attgaatgtg
tgatgtgaac tgactttaag taatcaggat tgaattccat 1621 tagcatttgc
taccaagtag gaaaaaaaat gtacatggca gtgttttagt tggcaatata 1681
atctttgaat ttcttgattt ttcagggtat tagctgtatt atccattttt tttactgtta
1741 tttaattgaa accatagact aagaataaga agcatcatac tataactgaa
cacaatgtgt 1801 attcatagta tactgattta atttctaagt gtaagtgaat
taatcatctg gattttttat 1861 tcttttcaga taggcttaac aaatggagct
ttctgtatat aaatgtggag attagagtta 1921 atctccccaa tcacataatt
tgttttgtgt gaaaaaggaa taaattgttc catgctggtg 1981 gaaagataga
gattgttttt agaggttggt tgttgtgttt taggattctg tccattttct 2041
tgtaaaggga taaacacgga cgtgtgcgaa atatgtttgt aaagtgattt gccattgttg
2101 aaagcgtatt taatgataga atactatcga gccaacatgt actgacatgg
aaagatgtca 2161 gagatatgtt aagtgtaaaa tgcaagtggc gggacactat
gtatagtctg agccagatca 2221 aagtatgtat gttgttaata tgcatagaac
gagagatttg gaaagatata caccaaactg 2281 ttaaatgtgg tttctcttcg
gggagggggg gattggggga ggggccccag aggggtttta 2341 gaggggcctt
ttcactttcg acttttttca ttttgttctg ttcggatttt ttataagtat 2401
gtagaccccg aagggtttta tgggaactaa catcagtaac ctaacccccg tgactatcct
2461 gtgctcttcc tagggagctg tgttgtttcc cacccaccac ccttccctct
gaacaaatgc 2521 ctgagtgctg gggcactttg
[0215] General Target Region:
[0216] Internal Ribosome Entry Site (IRES) in 5' untranslated
region:
24 5'AGCUCCUAUAACAAAAGUCUGUUGCUUGUGUUUCACAUUUUGGAUU (SEQ ID NO: 26)
UCCUAAUAUAAUGUUCUCUUUUUAGAAAAGGUGGACAAGUCCUAUUU UCAAGAGAAG3'
[0217] Initial Specific Target Matif:
[0218] RNP core binding site within XIAP IRES
25 5'GGAUUUCCUAAUAUAAUGUUCUCUUUUU3' (SEQ ID NO: 27)
6.10. Survivin
[0219] GenBank Accession #NM.sub.--001168:
26 1 ccgccagatt tgaatcgcgg gacccgttgg cagaggtggc ggcggcggca
tgggtgcccc (SEQ ID NO: 28) 61 gacgttgccc cctgcctggc agccctttct
caaggaccac cgcatctcta cattcaagaa 121 ctggcccttc ttggagggct
gcgcctgcac cccggagcgg atggccgagg ctggcttcat 181 ccactgcccc
actgagaacg agccagactt ggcccagtgt ttcttctgct tcaaggagct 241
ggaaggctgg gagccagatg acgaccccat agaggaacat aaaaagcatt cgtccggttg
301 cgctttcctt tctgtcaaga agcagtttga agaattaacc cttggtgaat
ttttgaaact 361 ggacagagaa agagccaaga acaaaattgc aaaggaaacc
aacaataaga agaaagaatt 421 tgaggaaact gcgaagaaag tgcgccgtgc
catcgagcag ctggctgcca tggattgagg 481 cctctggccg gagctgcctg
gtcccagagt ggctgcacca cttccagggt ttattccctg 541 gtgccaccag
ccttcctgtg ggccccttag caatgtctta ggaaaggaga tcaacatttt 601
caaattagat gtttcaactg tgctcctgtt ttgtcttgaa agtggcacca gaggtgcttc
661 tgcctgtgca gcgggtgctg ctggtaacag tggctgcttc tctctctctc
tctctttttt 721 gggggctcat ttttgctgtt ttgattcccg ggcttaccag
gtgagaagtg agggaggaag 781 aaggcagtgt cccttttgct agagctgaca
gctttgttcg cgtgggcaga gccttccaca 841 gtgaatgtgt ctggacctca
tgttgttgag gctgtcacag tcctgagtgt ggacttggca 901 ggtgcctgtt
gaatctgagc tgcaggttcc ttatctgtca cacctgtgcc tcctcagagg 961
acagtttttt tgttgttgtg tttttttgtt tttttttttt ggtagatgca tgacttgtgt
1021 gtgatgagag aatggagaca gagtccctgg ctcctctact gtttaacaac
atggctttct 1081 tattttgttt gaattgttaa ttcacagaat agcacaaact
acaattaaaa ctaagcacaa 1141 agccattcta agtcattggg gaaacggggt
gaacttcagg tggatgagga gacagaatag 1201 agtgatagga agcgtctggc
agatactcct tttgccactg ctgtgtgatt agacaggccc 1261 agtgagccgc
ggggcacatg ctggccgctc ctccctcaga aaaaggcagt ggcctaaatc 1321
ctttttaaat gacttggctc gatgctgtgg gggactggct gggctgctgc aggccgtgtg
1381 tctgtcagcc caaccttcac atctgtcacg ttctccacac gggggagaga
cgcagtccgc 1441 ccaggtcccc gctttctttg gaggcagcag ctcccgcagg
gctgaagtct ggcgtaagat 1501 gatggatttg attcgccctc ctccctgtca
tagagctgca gggtggattg ttacagcttc 1561 gctggaaacc tctggaggtc
atctcggctg ttcctgagaa ataaaaagcc tgtcatttc
7. EXAMPLE: IDENTIFICATION OF A DYE-LABELED TARGET RNA BOUND TO
SMALL MOLECULAR WEIGHT COMPOUNDS
[0220] The results presented in this Example indicate that gel
mobility shift assays can be used to detect the binding of small
molecules, such as the Tat peptide and gentamicin, to their
respective target RNAs.
7.1. Materials and Methods
7.1.1. Buffers
[0221] Tris-potassium chloride (TK) buffer is composed of 50 mM
Tris-HCl pH 7.4, 20 mM KCl, 0.1% Triton X-100, and 0.5 mM
MgCl.sub.2. Tris-borate-EDTA (TBE) buffer is composed of 45 mM
Tris-borate pH 8.0, and 1 mM EDTA. Tris-Potassium
chloride-magnesium (TKM) buffer is composed of 50 mM Tris-HCl pH
7.4, 20mM KCl, 0.1 % Triton X-100 and 5 mM MgCl.sub.2.
7.1.1. Gel Retardation Analysis
[0222] RNA oligonucleotides were purchased from Dharmacon, Inc,
Lafayette, Colo.). 500 pmole of either a 5' fluorescein labeled
oligonucleotide corresponding to the 16S rRNA A site
(5'-GGCGUCACACCUUCGGGUGAAGUCGCC-3' (SEQ ID NO: 29); Moazed &
Noller, 1987, Nature 327:389-394; Woodcock et al., 1991, EMBO J.
10:3099-3103; Yoshizawa et al., 1998, EMBO J. 17:6437-6448) or a 5'
fluorescein labeled oligonucleotide correspording to the HIV-1 TAR
element TAR RNA (5'-GGCGUCACACCUUCGGGUGAAGUCGCC-3' (SEQ ID NO: 30);
Huq et al., 1999, Nucleic Acids Research. 27:1084-1093; Hwang et
al., 1999, Proc. Natl. Acad. Sci. USA 96:12997-13002) was 3'
labeled with 5'-.sup.32p cytidine 3', 5'-bis(phosphate) (NEN) and
T4 RNA ligase (NEBiolabs) in 10% DMSO as per manufacturer's
instructions. The labeled oligonucleotides were purified using G-25
Sephadex columns (Boehringer Mannheim). For Tat-TAR gel retardation
reactions the method of Huq et al. (Nucleic Acids Research, 1999,
27:1084-1093) was utilized with TK buffer containing 0.5 mM
MgCl.sub.2 and a 12-mer Tat peptide (YGRKKRRQRRRP (SEQ ID NO: 31);
single letter amino acid code). For 16S rRNA-gentamicin reactions,
the method of Huq et al. was used with TKM buffer. In 20 .mu.l
reaction volumes 50 pmoles of .sup.32P cytidine-labeled
oligonucleotide and either gentamicin sulfate (Sigma) or the short
Tat peptide (Tat.sub.47-58) in TK or TKM buffer were heated at
90.degree. C. for 2 minutes and allow to cool to room temperature
(approximately 24.degree. C.) over 2 hours. Then 10 .mu.l of 30%
glycerol was added to each reaction tube and the entire sample was
loaded onto a TBE non-denaturing polyacrylamide gel and
electrophoresed at 1200-1600 volt-hours at 4.degree. C. The gel was
exposed to an intensifying screen and radioactivity was quantitated
using a Typhoon phosporimager (Molecular Dynamics).
7.2. Background
[0223] One method used to demonstrate small molecule interactions
with natural occurring RNA structures such as ribosomes is by a
method called chemical footprinting or toe printing (Moazed &
Noller, 1987, Nature 327:389-394; Woodcock et al., 1991, EMBO J.
10:3099-3103; Yoshizawaetal., 1998, EMBO J. 17:6437-6448). Here the
use of gel mobility shift assays to monitor RNA-small molecule
interactions are described. This approach allows for rapid
visualization of small molecule-RNA interactions based on the
difference between mobility of RNA alone versus RNA in a complex
with a small molecule. To validate this approach, an RNA
oligonucleotide corresponding to the well-characterized gentamicin
binding site on the 16S rRNA (Moazed & Noller, 1987, Nature
327:389-394) and the equally well-characterized HIV-1 TAT protein
binding site on the HIV-1 TAR element (Huq et al., 1999, Nucleic
Acids Res. 27: 1084-1093) were chosen. The purpose of these
experiments is to lay the groundwork for the use of chromatographic
techniques in a high throughput fashion, such as microcapillary
electrophoresis, for drug discovery.
7.3. Results
[0224] A gel retardation assay was performed using the
Tat.sub.47-58 peptide and the TAR RNA oligonucleotide. As shown in
FIG. 1, in the presence of the Tat peptide, a clear shift is
visible when the products are separated on a 12% non-denaturing
polyacrylamide gel. In the reaction that lacks peptide, only the
free RNA is visible. These observations confirm previous reports
made using other Tat peptides (Hamy et al., 1997, Proc. Natl. Acad.
Sci. USA 94:3548-3553; Huq et al., 1999, Nucleic Acids Res. 27:
1084-1093).
[0225] Based on the results of FIG. 1, it was hypothesized that RNA
interactions with small organic molecules could also be visualized
using this method. As shown in FIG. 2, the addition of varying
concentrations of gentamicin to an RNA oligonucleotide
corresponding to the 16S rRNA A site produces a mobility shift.
These results demonstrate that the binding of the small molecule
gentamicin to an RNA oligonucleotide having a defined structure in
solution can be monitored using this approach. In addition, as
shown in FIG. 2, a concentration as low as 10 ng/ml gentamicin
produces the mobility shift.
[0226] To determine whether lower concentrations of gentamicin
would be sufficient to produce a gel shift, similar experiment was
performed, as shown in FIG. 2, except that the concentrations of
gentamicin ranged from 100 ng/ml to 10 pg/ml. As shown in FIG. 3,
gel mobility shifts are produced when the gentamicin concentration
is as low as 10 pg/ml. Further, the results shown in FIG. 3
demonstrate that the shift is specific to the 16S rRNA
oligonucleotide as the use of an unrelated oligonucleotide,
corresponding to the HIV TAR RNA element, does not result in a gel
mobility shift when incubated with 10 .mu.g/ml gentamicin. In
addition, if a concentration as low as 10 pg/ml gentamicin produces
a gel mobility shift then it should be possible to detect changes
to RNA structural motifs when small amounts of compound from a
library of diverse compounds is screened in this fashion.
[0227] Further analysis of the gentamicin-RNA interaction indicates
that the interaction is Mg- and temperature dependent. As shown in
FIG. 4, when MgCl.sub.2 is not present (TK buffer), 1 mg/ml of
gentamicin must be added to the reaction to produce a gel
shift.
[0228] Similarly, the temperature of the reaction when gentamicin
is added is also important. When gentamicin is present in the
reaction during the entire denaturation/renaturation cycle, that
is, when gentamicin is added at 90C.degree. C. or 85 .degree. C., a
gel shift is visualized (data not shown). In contrast, when
gentamicin is added after the renaturation step has proceeded to
75.degree. C., a mobility shift is not produced. These results are
consistent with the notion that gentamicin may recognize and
interact with an RNA structure formed early in the renaturation
process.
8. EXAMPLE: IDENTIFICATION OF A DYE-LABELED TARGET RNA BOUND TO
SMALL MOLECULAR WEIGHT COMPOUNDS BY CAPILLARY ELECTROPHORESIS
[0229] The results presented in this Example indicate that
interactions between a peptide and its target RNA, such as the Tat
peptide and TAR RNA, can be monitored by gel retardation assays in
an automated capillary electrophoresis system.
8.1. Materials and Methods
8.1.1. Buffers
[0230] Tris-potassium chloride (TK) buffer is composed of 50 mM
Tris-HCl pH 7.4, 20 mM KCl, 0.1% Triton X-100, and 0.5 mM
MgCl.sub.2. Tris-borate-EDTA (TBE) buffer is composed of 45 mM
Tris-borate pH 8.0, and 1 mM EDTA. Tris-Potassium
chloride-magnesium (TKM) buffer is composed of 50 mM Tris-HCl pH
7.4, 20 mM KCl, 0.1% Triton X-100 and 5 mM MgCl.sub.2.
8.1.1. Gel Retardation Analysis Using Capillary Electrophoresis
[0231] RNA oligonucleotides were purchased from Dharmacon, Inc.
Lafayette, Colo.). 500 pmole of a 5' fluorescein labeled
oligonucleotide corresponding to the HIV-1 TAR element TAR RNA
(5'-GGCGUCACACCUUCGGGUGAAG- UCGCC-3' (SEQ ID NO: 30); Huq et al.,
1999, Nucleic Acids Research. 27:1084-1093; Hwang et al., 1999,
Proc. Natl. Acad. Sci. USA 96:12997-13002) was used. For Tat-TAR
gel retardation reactions the method of Huq et al. (Nucleic Acids
Research, 1999, 27:1084-1093) was utilized with TK buffer
containing 0.5 mM MgCl.sub.2 and a 12-mer Tat peptide (YGRKKRRQRRRP
(SEQ ID NO: 31); single letter amino acid code). In 20 .mu.l
reaction volumes 50 pmoles of labeled oligonucleotide and the short
Tat peptide (Tat.sub.47-58) in TK or TKM buffer were heated at
90.degree. C. for 2 minutes and allow to cool to room temperature
(approximately 24.degree. C.) over 2 hours. The reactions were
loaded onto a SCE9610 automated capillary electrophoresis apparatus
(SpectruMedix; State College, Pa.).
8.2. Results
[0232] As presented in the previous Example in Section 7,
interactions between a peptide and RNA can be monitored by gel
retardation assays. It was hypothesized that interactions between a
peptide and RNA could be monitored by gel retardation assays by an
automated capillary electrophoresis system. To test this
hypothesis, a gel retardation assay by an automated capillary
electrophoresis system was performed using the Tat.sub.47-58
peptide and the TAR RNA oligonucleotide. As shown in FIG. 5 using
the capillary electrophoresis system, in the presence of the Tat
peptide, a clear shift is visible upon the addition of increasing
concentrations of Tat peptide. In the reaction that lacks peptide,
only a peak corresponding to the free RNA is observed. These
observations confirm previous reports made using other Tat peptides
(Hamy et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Huq et
al., 1999, Nucleic Acids Res. 27: 1084-1093).
[0233] The present invention is not to be limited in scope by the
specific embodiments described herein. Indeed, various
modifications of the invention in addition to those described will
become apparent to those skilled in the art from the foregoing
description and accompanying figures. Such modifications are
intended to fall within the scope of the appended claims.
[0234] Various publications are cited herein, the disclosures of
which are incorporated by reference in their entireties.
[0235] The invention can be ilustrated by the following embodiments
enumerated in the numbered paragraphs that follow:
[0236] 1. A method for identifying a test compound that binds to a
target RNA molecule, comprising the steps of (a) contacting a
detectably labeled target RNA molecule with a library of test
compounds under conditions that permit direct binding of the
labeled target RNA to a member of the library of test compounds so
that a detectably labeled target RNA:test compound complex is
formed; (b) separating the detectably labeled target RNA:test
compound complex formed in step(a) from uncomplexed target RNA
molecules and test compounds; and (c) determining a structure of
the test compound bound to the RNA in the RNA:test compound
complex.
[0237] 2. The method of paragraph 1 in which the target RNA
molecule contains an HIV TAR element, internal ribosome entry site,
"slippery site", instability element, or adenylate uridylate-rich
element.
[0238] 3. The method of paragraph 1 in which the RNA molecule is an
element derived from the mRNA for tumor necrosis factor alpha
("TNF-.alpha."), granulocyte-macrophage colony stimulating factor
("GM-CSF"), interleukin 2 ("IL-2"), interleukin 6 ("IL-6"),
vascular endothelial growth factor ("VEGF"), human immunodeficiency
virus I ("HIV-1"), hepatitis C virus ("HCV"--genotypes 1a &
1b), ribonuclease P RNA ("RNaseP"), X-linked inhibitor of apoptosis
protein ("XIAP"), or survivin.
[0239] 4. The method of paragraph 1 in which the detectably labeled
RNA is labeled with a fluorescent dye, phosphorescent dye,
ultraviolet dye, infrared dye, visible dye, radiolabel, enzyme,
spectroscopic colorimetric label, affinity tag, or
nanoparticle.
[0240] 5. The method of paragraph 1 in which the test compound is
selected from a combinatorial library comprising peptoids; random
bio-oligomers; diversomers such as hydantoins, benzodiazepines and
dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics;
oligocarbamates; peptidyl phosphonates; peptide nucleic acid
libraries; antibody libraries; carbohydrate libraries; and small
organic molecule libraries, including but not limited to, libraries
of benzodiazepines, isoprenoids, thiazolidinones, metathiazanones,
pyrrolidines, morpholino compounds, or diazepindiones.
[0241] 6. The method of paragraph 1 in which screening a library of
test compounds comprises contacting the test compound with the
target nucleic acid in the presence of an aqueous solution, the
aqueous solution comprising a buffer and a combination of salts,
preferably approximating or mimicking physiologic conditions.
[0242] 7. The method of paragraph 6 in which the aqueous solution
optionally further comprises non-specific nucleic acids comprising
DNA, yeast tRNA, salmon sperm DNA, homoribopolymers, and
nonspecific RNAs.
[0243] 8. The method of paragraph 6 in which the aqueous solution
further comprises a buffer, a combination of salts, and optionally,
a detergent or a surfactant. In another embodiment, the aqueous
solution further comprises a combination of salts, from about 0 mM
to about 100 mM KCl, from about 0 mM to about 1 M NaCl, and from
about 0 mM to about 200 mM MgCl.sub.2. In a preferred embodiment,
the combination of salts is about 100 mM KCl, 500 mM NaCl, and 10
mM MgCl.sub.2. In another embodiment, the solution optionally
comprises from about 0.01% to about 0.5% (w/v) of a detergent or a
surfactant.
[0244] 9. Any method that detects an altered physical property of a
target nucleic acid complexed to a test compound from the unbound
target nucleic acid may be used for separation of the complexed and
non-complexed target nucleic acids in the method of paragraph 1. In
a preferred embodiment, elecfrophoresis is used for separation of
the complexed and non-complexed target nucleic acids. In a
preferred embodiment, the electrophoresis is capillary
electrophoresis. In other embodiments, fluorescence spectroscopy,
surface plasmon resonance, mass spectrometry, scintillation,
proximity assay, structure-activity relationships ("SAR") by NMR
spectroscopy, size exclusion chromatography, affinity
chromatography, and nanoparticle aggregation are used for the
separation of the complexed and non-complexed target nucleic
acids.
[0245] 10. The structure of the test compound of the RNA:test
compound complex of paragraph 1 is determined, in part, by the type
of library of test compounds. In a preferred embodiment wherein the
combinatorial libraries are small organic molecule libraries, mass
spectroscopy, NMR, or vibration spectroscopy are used to determine
the structure of the test compounds.
Sequence CWU 1
1
31 1 21 RNA Homo sapiens 1 auuuauuuau uuauuuauuu a 21 2 17 RNA Homo
sapiens 2 auuuauuuau uuauuua 17 3 15 RNA Homo sapiens 3 wauuuauuua
uuuaw 15 4 13 RNA Homo sapiens 4 wwauuuauuu aww 13 5 13 RNA Homo
sapiens 5 wwwwauuuaw www 13 6 1643 DNA Homo sapiens 6 gcagaggacc
agctaagagg gagagaagca actacagacc ccccctgaaa acaaccctca 60
gacgccacat cccctgacaa gctgccaggc aggttctctt cctctcacat actgacccac
120 ggctccaccc tctctcccct ggaaaggaca ccatgagcac tgaaagcatg
atccgggacg 180 tggagctggc cgaggaggcg ctccccaaga agacaggggg
gccccagggc tccaggcggt 240 gcttgttcct cagcctcttc tccttcctga
tcgtggcagg cgccaccacg ctcttctgcc 300 tgctgcactt tggagtgatc
ggcccccaga gggaagagtt ccccagggac ctctctctaa 360 tcagccctct
ggcccaggca gtcagatcat cttctcgaac cccgagtgac aagcctgtag 420
cccatgttgt agcaaaccct caagctgagg ggcagctcca gtggctgaac cgccgggcca
480 atgccctcct ggccaatggc gtggagctga gagataacca gctggtggtg
ccatcagagg 540 gcctgtacct catctactcc caggtcctct tcaagggcca
aggctgcccc tccacccatg 600 tgctcctcac ccacaccatc agccgcatcg
ccgtctccta ccagaccaag gtcaacctcc 660 tctctgccat caagagcccc
tgccagaggg agaccccaga gggggctgag gccaagccct 720 ggtatgagcc
catctatctg ggaggggtct tccagctgga gaagggtgac cgactcagcg 780
ctgagatcaa tcggcccgac tatctcgact ttgccgagtc tgggcaggtc tactttggga
840 tcattgccct gtgaggagga cgaacatcca accttcccaa acgcctcccc
tgccccaatc 900 cctttattac cccctccttc agacaccctc aacctcttct
ggctcaaaaa gagaattggg 960 ggcttagggt cggaacccaa gcttagaact
ttaagcaaca agaccaccac ttcgaaacct 1020 gggattcagg aatgtgtggc
ctgcacagtg aattgctggc aaccactaag aattcaaact 1080 ggggcctcca
gaactcactg gggcctacag ctttgatccc tgacatctgg aatctggaga 1140
ccagggagcc tttggttctg gccagaatgc tgcaggactt gagaagacct cacctagaaa
1200 ttgacacaag tggaccttag gccttcctct ctccagatgt ttccagactt
ccttgagaca 1260 cggagcccag ccctccccat ggagccagct ccctctattt
atgtttgcac ttgtgattat 1320 ttattattta tttattattt atttatttac
agatgaatgt atttatttgg gagaccgggg 1380 tatcctgggg gacccaatgt
aggagctgcc ttggctcaga catgttttcc gtgaaaacgg 1440 agctgaacaa
taggctgttc ccatgtagcc ccctggcctc tgtgccttct tttgattatg 1500
ttttttaaaa tatttatctg attaagttgt ctaaacaatg ctgatttggt gaccaactgt
1560 cactcattgc tgagcctctg ctccccaggg gagttgtgtc tgtaatcgcc
ctactattca 1620 gtggcgagaa ataaagtttg ctt 1643 7 756 DNA Homo
sapiens 7 gctggaggat gtggctgcag agcctgctgc tcttgggcac tgtggcctgc
agcatctctg 60 cacccgcccg ctcgcccagc cccagcacgc agccctggga
gcatgtgaat gccatccagg 120 aggcccggcg tctcctgaac ctgagtagag
acactgctgc tgagatgaat gaaacagtag 180 aagtcatctc agaaatgttt
gacctccagg agccgacctg cctacagacc cgcctggagc 240 tgtacaagca
gggcctgcgg ggcagcctca ccaagctcaa gggccccttg accatgatgg 300
ccagccacta caagcagcac tgccctccaa ccccggaaac ttcctgtgca acccagacta
360 tcacctttga aagtttcaaa gagaacctga aggactttct gcttgtcatc
ccctttgact 420 gctgggagcc agtccaggag tgagaccggc cagatgaggc
tggccaagcc ggggagctgc 480 tctctcatga aacaagagct agaaactcag
gatggtcatc ttggagggac caaggggtgg 540 gccacagcca tggtgggagt
ggcctggacc tgccctgggc cacactgacc ctgatacagg 600 catggcagaa
gaatgggaat attttatact gacagaaatc agtaatattt atatatttat 660
atttttaaaa tatttattta tttatttatt taagttcata ttccatattt attcaagatg
720 ttttaccgta ataattatta ttaaaaatat gcttct 756 8 756 DNA Homo
sapiens 8 tctggaggat gtggctgcag agcctgctgc tcttgggcac tgtggcctgc
agcatctctg 60 cacccgcccg ctcgcccagc cccagcacgc agccctggga
gcatgtgaat gccatccagg 120 aggcccggcg tctcctgaac ctgagtagag
acactgctgc tgagatgaat gaaacagtag 180 aagtcatctc agaaatgttt
gacctccagg agccgacctg cctacagacc cgcctggagc 240 tgtacaagca
gggcctgcgg ggcagcctca ccaagctcaa gggccccttg accatgatgg 300
ccagccacta caagcagcac tgccctccaa ccccggaaac ttcctgtgca acccagacta
360 tcacctttga aagtttcaaa gagaacctga aggactttct gcttgtcatc
ccctttgact 420 gctgggagcc agtccaggag tgagaccggc cagatgaggc
tggccaagcc ggggagctgc 480 tctctcatga aacaagagct agaaactcag
gatggtcatc ttggagggac caaggggtgg 540 gccacagcca tggtgggagt
ggcctggacc tgccctgggc cacactgacc ctgatacagg 600 catggcagaa
gaatgggaat attttatact gacagaaatc agtaatattt atatatttat 660
atttttaaaa tatttattta tttatttatt taagttcata ttccatattt attcaagatg
720 ttttaccgta ataattatta ttaaaaatat gcttct 756 9 825 DNA Homo
sapiens 9 atcactctct ttaatcacta ctcacattaa cctcaactcc tgccacaatg
tacaggatgc 60 aactcctgtc ttgcattgca ctaattcttg cacttgtcac
aaacagtgca cctacttcaa 120 gttcgacaaa gaaaacaaag aaaacacagc
tacaactgga gcatttactg ctggatttac 180 agatgatttt gaatggaatt
aataattaca agaatcccaa actcaccagg atgctcacat 240 ttaagtttta
catgcccaag aaggccacag aactgaaaca gcttcagtgt ctagaagaag 300
aactcaaacc tctggaggaa gtgctgaatt tagctcaaag caaaaacttt cacttaagac
360 ccagggactt aatcagcaat atcaacgtaa tagttctgga actaaaggga
tctgaaacaa 420 cattcatgtg tgaatatgca gatgagacag caaccattgt
agaatttctg aacagatgga 480 ttaccttttg tcaaagcatc atctcaacac
taacttgata attaagtgct tcccacttaa 540 aacatatcag gccttctatt
tatttattta aatatttaaa ttttatattt attgttgaat 600 gtatggttgc
tacctattgt aactattatt cttaatctta aaactataaa tatggatctt 660
ttatgattct ttttgtaagc cctaggggct ctaaaatggt ttaccttatt tatcccaaaa
720 atatttatta ttatgttgaa tgttaaatat agtatctatg tagattggtt
agtaaaacta 780 tttaataaat ttgataaata taaaaaaaaa aaacaaaaaa aaaaa
825 10 15 RNA Homo sapiens misc_feature (1)..(1) N = A, U, G, OR C
10 nauuuauuua uuuan 15 11 1125 DNA Homo sapiens 11 ttctgccctc
gagcccaccg ggaacgaaag agaagctcta tctcgcctcc aggagcccag 60
ctatgaactc cttctccaca agcgccttcg gtccagttgc cttctccctg gggctgctcc
120 tggtgttgcc tgctgccttc cctgccccag tacccccagg agaagattcc
aaagatgtag 180 ccgccccaca cagacagcca ctcacctctt cagaacgaat
tgacaaacaa attcggtaca 240 tcctcgacgg catctcagcc ctgagaaagg
agacatgtaa caagagtaac atgtgtgaaa 300 gcagcaaaga ggcactggca
gaaaacaacc tgaaccttcc aaagatggct gaaaaagatg 360 gatgcttcca
atctggattc aatgaggaga cttgcctggt gaaaatcatc actggtcttt 420
tggagtttga ggtataccta gagtacctcc agaacagatt tgagagtagt gaggaacaag
480 ccagagctgt gcagatgagt acaaaagtcc tgatccagtt cctgcagaaa
aaggcaaaga 540 atctagatgc aataaccacc cctgacccaa ccacaaatgc
cagcctgctg acgaagctgc 600 aggcacagaa ccagtggctg caggacatga
caactcatct cattctgcgc agctttaagg 660 agttcctgca gtccagcctg
agggctcttc ggcaaatgta gcatgggcac ctcagattgt 720 tgttgttaat
gggcattcct tcttctggtc agaaacctgt ccactgggca cagaacttat 780
gttgttctct atggagaact aaaagtatga gcgttaggac actattttaa ttatttttaa
840 tttattaata tttaaatatg tgaagctgag ttaatttatg taagtcatat
ttatattttt 900 aagaagtacc acttgaaaca ttttatgtat tagttttgaa
ataataatgg aaagtggcta 960 tgcagtttga atatcctttg tttcagagcc
agatcatttc ttggaaagtg taggcttacc 1020 tcaaataaat ggctaactta
tacatatttt taaagaaata tttatattgt atttatataa 1080 tgtataaatg
gtttttatac caataaatgg cattttaaaa aattc 1125 12 3166 DNA Homo
sapiens 12 aagagctcca gagagaagtc gaggaagaga gagacggggt cagagagagc
gcgcgggcgt 60 gcgagcagcg aaagcgacag gggcaaagtg agtgacctgc
ttttgggggt gaccgccgga 120 gcgcggcgtg agccctcccc cttgggatcc
cgcagctgac cagtcgcgct gacggacaga 180 cagacagaca ccgcccccag
ccccagttac cacctcctcc ccggccggcg gcggacagtg 240 gacgcggcgg
cgagccgcgg gcaggggccg gagcccgccc ccggaggcgg ggtggagggg 300
gtcggagctc gcggcgtcgc actgaaactt ttcgtccaac ttctgggctg ttctcgcttc
360 ggaggagccg tggtccgcgc gggggaagcc gagccgagcg gagccgcgag
aagtgctagc 420 tcgggccggg aggagccgca gccggaggag ggggaggagg
aagaagagaa ggaagaggag 480 agggggccgc agtggcgact cggcgctcgg
aagccgggct catggacggg tgaggcggcg 540 gtgtgcgcag acagtgctcc
agcgcgcgcg ctccccagcc ctggcccggc ctcgggccgg 600 gaggaagagt
agctcgccga ggcgccgagg agagcgggcc gccccacagc ccgagccgga 660
gagggacgcg agccgcgcgc cccggtcggg cctccgaaac catgaacttt ctgctgtctt
720 gggtgcattg gagccttgcc ttgctgctct acctccacca tgccaagtgg
tcccaggctg 780 cacccatggc agaaggagga gggcagaatc atcacgaagt
ggtgaagttc atggatgtct 840 atcagcgcag ctactgccat ccaatcgaga
ccctggtgga catcttccag gagtaccctg 900 atgagatcga gtacatcttc
aagccatcct gtgtgcccct gatgcgatgc gggggctgct 960 ccaatgacga
gggcctggag tgtgtgccca ctgaggagtc caacatcacc atgcagatta 1020
tgcggatcaa acctcaccaa ggccagcaca taggagagat gagcttccta cagcacaaca
1080 aatgtgaatg cagaccaaag aaagatagag caagacaaga aaatccctgt
gggccttgct 1140 cagagcggag aaagcatttg tttgtacaag atccgcagac
gtgtaaatgt tcctgcaaaa 1200 acacacactc gcgttgcaag gcgaggcagc
ttgagttaaa cgaacgtact tgcagatgtg 1260 acaagccgag gcggtgagcc
gggcaggagg aaggagcctc cctcagggtt tcgggaacca 1320 gatctctctc
caggaaagac tgatacagaa cgatcgatac agaaaccacg ctgccgccac 1380
cacaccatca ccatcgacag aacagtcctt aatccagaaa cctgaaatga aggaagagga
1440 gactctgcgc agagcacttt gggtccggag ggcgagactc cggcggaagc
attcccgggc 1500 gggtgaccca gcacggtccc tcttggaatt ggattcgcca
ttttattttt cttgctgcta 1560 aatcaccgag cccggaagat tagagagttt
tatttctggg attcctgtag acacacccac 1620 ccacatacat acatttatat
atatatatat tatatatata taaaaataaa tatctctatt 1680 ttatatatat
aaaatatata tattcttttt ttaaattaac agtgctaatg ttattggtgt 1740
cttcactgga tgtatttgac tgctgtggac ttgagttggg aggggaatgt tcccactcag
1800 atcctgacag ggaagaggag gagatgagag actctggcat gatctttttt
ttgtcccact 1860 tggtggggcc agggtcctct cccctgccca agaatgtgca
aggccagggc atgggggcaa 1920 atatgaccca gttttgggaa caccgacaaa
cccagccctg gcgctgagcc tctctacccc 1980 aggtcagacg gacagaaaga
caaatcacag gttccgggat gaggacaccg gctctgacca 2040 ggagtttggg
gagcttcagg acattgctgt gctttgggga ttccctccac atgctgcacg 2100
cgcatctcgc ccccaggggc actgcctgga agattcagga gcctgggcgg ccttcgctta
2160 ctctcacctg cttctgagtt gcccaggagg ccactggcag atgtcccggc
gaagagaaga 2220 gacacattgt tggaagaagc agcccatgac agcgcccctt
cctgggactc gccctcatcc 2280 tcttcctgct ccccttcctg gggtgcagcc
taaaaggacc tatgtcctca caccattgaa 2340 accactagtt ctgtcccccc
aggaaacctg gttgtgtgtg tgtgagtggt tgaccttcct 2400 ccatcccctg
gtccttccct tcccttcccg aggcacagag agacagggca ggatccacgt 2460
gcccattgtg gaggcagaga aaagagaaag tgttttatat acggtactta tttaatatcc
2520 ctttttaatt agaaattaga acagttaatt taattaaaga gtagggtttt
ttttcagtat 2580 tcttggttaa tatttaattt caactattta tgagatgtat
cttttgctct ctcttgctct 2640 cttatttgta ccggtttttg tatataaaat
tcatgtttcc aatctctctc tccctgatcg 2700 gtgacagtca ctagcttatc
ttgaacagat atttaatttt gctaacactc agctctgccc 2760 tccccgatcc
cctggctccc cagcacacat tcctttgaaa gagggtttca atatacatct 2820
acatactata tatatattgg gcaacttgta tttgtgtgta tatatatata tatatgttta
2880 tgtatatatg tgatcctgaa aaaataaaca tcgctattct gttttttata
tgttcaaacc 2940 aaacaagaaa aaatagagaa ttctacatac taaatctctc
tcctttttta attttaatat 3000 ttgttatcat ttatttattg gtgctactgt
ttatccgtaa taattgtggg gaaaagatat 3060 taacatcacg tctttgtctc
tagtgcagtt tttcgagata ttccgtagta catatttatt 3120 tttaaacaac
gacaaagaaa tacagatata tcttaaaaaa aaaaaa 3166 13 249 RNA Homo
sapiens 13 ccgggcucau ggacggguga ggcggcggug ugcgcagaca gugcuccagc
gcgcgcgcuc 60 cccagcccug gcccggccuc gggccgggag gaagaguagc
ucgccgaggc gccgaggaga 120 gcgggccgcc ccacagcccg agccggagag
ggacgcgagc cgcgcgcccc ggucgggccu 180 ccgaaaccau gaacuuucug
cugucuuggg ugcauuggag ccuugccuug cugcucuacc 240 uccaccaug 249 14
9181 DNA Homo sapiens 14 ggtctctctg gttagaccag atctgagcct
gggagctctc tggctaacta gggaacccac 60 tgcttaagcc tcaataaagc
ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt 120 gtgactctgg
taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca 180
gtggcgcccg aacagggacc tgaaagcgaa agggaaacca gaggagctct ctcgacgcag
240 gactcggctt gctgaagcgc gcacggcaag aggcgagggg cggcgactgg
tgagtacgcc 300 aaaaattttg actagcggag gctagaagga gagagatggg
tgcgagagcg tcagtattaa 360 gcgggggaga attagatcga tgggaaaaaa
ttcggttaag gccaggggga aagaaaaaat 420 ataaattaaa acatatagta
tgggcaagca gggagctaga acgattcgca gttaatcctg 480 gcctgttaga
aacatcagaa ggctgtagac aaatactggg acagctacaa ccatcccttc 540
agacaggatc agaagaactt agatcattat ataatacagt agcaaccctc tattgtgtgc
600 atcaaaggat agagataaaa gacaccaagg aagctttaga caagatagag
gaagagcaaa 660 acaaaagtaa gaaaaaagca cagcaagcag cagctgacac
aggacacagc aatcaggtca 720 gccaaaatta ccctatagtg cagaacatcc
aggggcaaat ggtacatcag gccatatcac 780 ctagaacttt aaatgcatgg
gtaaaagtag tagaagagaa ggctttcagc ccagaagtga 840 tacccatgtt
ttcagcatta tcagaaggag ccaccccaca agatttaaac accatgctaa 900
acacagtggg gggacatcaa gcagccatgc aaatgttaaa agagaccatc aatgaggaag
960 ctgcagaatg ggatagagtg catccagtgc atgcagggcc tattgcacca
ggccagatga 1020 gagaaccaag gggaagtgac atagcaggaa ctactagtac
ccttcaggaa caaataggat 1080 ggatgacaaa taatccacct atcccagtag
gagaaattta taaaagatgg ataatcctgg 1140 gattaaataa aatagtaaga
atgtatagcc ctaccagcat tctggacata agacaaggac 1200 caaaggaacc
ctttagagac tatgtagacc ggttctataa aactctaaga gccgagcaag 1260
cttcacagga ggtaaaaaat tggatgacag aaaccttgtt ggtccaaaat gcgaacccag
1320 attgtaagac tattttaaaa gcattgggac cagcggctac actagaagaa
atgatgacag 1380 catgtcaggg agtaggagga cccggccata aggcaagagt
tttggctgaa gcaatgagcc 1440 aagtaacaaa ttcagctacc ataatgatgc
agagaggcaa ttttaggaac caaagaaaga 1500 ttgttaagtg tttcaattgt
ggcaaagaag ggcacacagc cagaaattgc agggccccta 1560 ggaaaaaggg
ctgttggaaa tgtggaaagg aaggacacca aatgaaagat tgtactgaga 1620
gacaggctaa ttttttaggg aagatctggc cttcctacaa gggaaggcca gggaattttc
1680 ttcagagcag accagagcca acagccccac cagaagagag cttcaggtct
ggggtagaga 1740 caacaactcc ccctcagaag caggagccga tagacaagga
actgtatcct ttaacttccc 1800 tcaggtcact ctttggcaac gacccctcgt
cacaataaag ataggggggc aactaaagga 1860 agctctatta gatacaggag
cagatgatac agtattagaa gaaatgagtt tgccaggaag 1920 atggaaacca
aaaatgatag ggggaattgg aggttttatc aaagtaagac agtatgatca 1980
gatactcata gaaatctgtg gacataaagc tataggtaca gtattagtag gacctacacc
2040 tgtcaacata attggaagaa atctgttgac tcagattggt tgcactttaa
attttcccat 2100 tagccctatt gagactgtac cagtaaaatt aaagccagga
atggatggcc caaaagttaa 2160 acaatggcca ttgacagaag aaaaaataaa
agcattagta gaaatttgta cagagatgga 2220 aaaggaaggg aaaatttcaa
aaattgggcc tgaaaatcca tacaatactc cagtatttgc 2280 cataaagaaa
aaagacagta ctaaatggag aaaattagta gatttcagag aacttaataa 2340
gagaactcaa gacttctggg aagttcaatt aggaatacca catcccgcag ggttaaaaaa
2400 gaaaaaatca gtaacagtac tggatgtggg tgatgcatat ttttcagttc
ccttagatga 2460 agacttcagg aagtatactg catttaccat acctagtata
aacaatgaga caccagggat 2520 tagatatcag tacaatgtgc ttccacaggg
atggaaagga tcaccagcaa tattccaaag 2580 tagcatgaca aaaatcttag
agccttttag aaaacaaaat ccagacatag ttatctatca 2640 atacatggat
gatttgtatg taggatctga cttagaaata gggcagcata gaacaaaaat 2700
agaggagctg agacaacatc tgttgaggtg gggacttacc acaccagaca aaaaacatca
2760 gaaagaacct ccattccttt ggatgggtta tgaactccat cctgataaat
ggacagtaca 2820 gcctatagtg ctgccagaaa aagacagctg gactgtcaat
gacatacaga agttagtggg 2880 gaaattgaat tgggcaagtc agatttaccc
agggattaaa gtaaggcaat tatgtaaact 2940 ccttagagga accaaagcac
taacagaagt aataccacta acagaagaag cagagctaga 3000 actggcagaa
aacagagaga ttctaaaaga accagtacat ggagtgtatt atgacccatc 3060
aaaagactta atagcagaaa tacagaagca ggggcaaggc caatggacat atcaaattta
3120 tcaagagcca tttaaaaatc tgaaaacagg aaaatatgca agaatgaggg
gtgcccacac 3180 taatgatgta aaacaattaa cagaggcagt gcaaaaaata
accacagaaa gcatagtaat 3240 atggggaaag actcctaaat ttaaactgcc
catacaaaag gaaacatggg aaacatggtg 3300 gacagagtat tggcaagcca
cctggattcc tgagtgggag tttgttaata cccctccctt 3360 agtgaaatta
tggtaccagt tagagaaaga acccatagta ggagcagaaa ccttctatgt 3420
agatggggca gctaacaggg agactaaatt aggaaaagca ggatatgtta ctaatagagg
3480 aagacaaaaa gttgtcaccc taactgacac aacaaatcag aagactgagt
tacaagcaat 3540 ttatctagct ttgcaggatt cgggattaga agtaaacata
gtaacagact cacaatatgc 3600 attaggaatc attcaagcac aaccagatca
aagtgaatca gagttagtca atcaaataat 3660 agagcagtta ataaaaaagg
aaaaggtcta tctggcatgg gtaccagcac acaaaggaat 3720 tggaggaaat
gaacaagtag ataaattagt cagtgctgga atcaggaaag tactattttt 3780
agatggaata gataaggccc aagatgaaca tgagaaatat cacagtaatt ggagagcaat
3840 ggctagtgat tttaacctgc cacctgtagt agcaaaagaa atagtagcca
gctgtgataa 3900 atgtcagcta aaaggagaag ccatgcatgg acaagtagac
tgtagtccag gaatatggca 3960 actagattgt acacatttag aaggaaaagt
tatcctggta gcagttcatg tagccagtgg 4020 atatatagaa gcagaagtta
ttccagcaga aacagggcag gaaacagcat attttctttt 4080 aaaattagca
ggaagatggc cagtaaaaac aatacatact gacaatggca gcaatttcac 4140
cggtgctacg gttagggccg cctgttggtg ggcgggaatc aagcaggaat ttggaattcc
4200 ctacaatccc caaagtcaag gagtagtaga atctatgaat aaagaattaa
agaaaattat 4260 aggacaggta agagatcagg ctgaacatct taagacagca
gtacaaatgg cagtattcat 4320 ccacaatttt aaaagaaaag gggggattgg
ggggtacagt gcaggggaaa gaatagtaga 4380 cataatagca acagacatac
aaactaaaga attacaaaaa caaattacaa aaattcaaaa 4440 ttttcgggtt
tattacaggg acagcagaaa tccactttgg aaaggaccag caaagctcct 4500
ctggaaaggt gaaggggcag tagtaataca agataatagt gacataaaag tagtgccaag
4560 aagaaaagca aagatcatta gggattatgg aaaacagatg gcaggtgatg
attgtgtggc 4620 aagtagacag gatgaggatt agaacatgga aaagtttagt
aaaacaccat atgtatgttt 4680 cagggaaagc taggggatgg ttttatagac
atcactatga aagccctcat ccaagaataa 4740 gttcagaagt acacatccca
ctaggggatg ctagattggt aataacaaca tattggggtc 4800 tgcatacagg
agaaagagac tggcatttgg gtcagggagt ctccatagaa tggaggaaaa 4860
agagatatag cacacaagta gaccctgaac tagcagacca actaattcat ctgtattact
4920 ttgactgttt ttcagactct gctataagaa aggccttatt aggacacata
gttagcccta 4980 ggtgtgaata tcaagcagga cataacaagg taggatctct
acaatacttg gcactagcag 5040 cattaataac accaaaaaag ataaagccac
ctttgcctag tgttacgaaa ctgacagagg 5100 atagatggaa caagccccag
aagaccaagg gccacagagg gagccacaca atgaatggac 5160 actagagctt
ttagaggagc ttaagaatga agctgttaga cattttccta ggatttggct 5220
ccatggctta gggcaacata tctatgaaac ttatggggat acttgggcag gagtggaagc
5280 cataataaga attctgcaac aactgctgtt tatccatttt cagaattggg
tgtcgacata 5340 gcagaatagg cgttactcga cagaggagag caagaaatgg
agccagtaga tcctagacta 5400 gagccctgga agcatccagg aagtcagcct
aaaactgctt gtaccaattg ctattgtaaa 5460 aagtgttgct ttcattgcca
agtttgtttc ataacaaaag ccttaggcat ctcctatggc 5520 aggaagaagc
ggagacagcg acgaagagct catcagaaca gtcagactca tcaagcttct 5580
ctatcaaagc agtaagtagt acatgtaatg caacctatac caatagtagc
aatagtagca 5640 ttagtagtag caataataat agcaatagtt gtgtggtcca
tagtaatcat agaatatagg 5700 aaaatattaa gacaaagaaa aatagacagg
ttaattgata gactaataga aagagcagaa 5760 gacagtggca atgagagtga
aggagaaata tcagcacttg tggagatggg ggtggagatg 5820 gggcaccatg
ctccttggga tgttgatgat ctgtagtgct acagaaaaat tgtgggtcac 5880
agtctattat ggggtacctg tgtggaagga agcaaccacc actctatttt gtgcatcaga
5940 tgctaaagca tatgatacag aggtacataa tgtttgggcc acacatgcct
gtgtacccac 6000 agaccccaac ccacaagaag tagtattggt aaatgtgaca
gaaaatttta acatgtggaa 6060 aaatgacatg gtagaacaga tgcatgagga
tataatcagt ttatgggatc aaagcctaaa 6120 gccatgtgta aaattaaccc
cactctgtgt tagtttaaag tgcactgatt tgaagaatga 6180 tactaatacc
aatagtagta gcgggagaat gataatggag aaaggagaga taaaaaactg 6240
ctctttcaat atcagcacaa gcataagagg taaggtgcag aaagaatatg cattttttta
6300 taaacttgat ataataccaa tagataatga tactaccagc tataagttga
caagttgtaa 6360 cacctcagtc attacacagg cctgtccaaa ggtatccttt
gagccaattc ccatacatta 6420 ttgtgccccg gctggttttg cgattctaaa
atgtaataat aagacgttca atggaacagg 6480 accatgtaca aatgtcagca
cagtacaatg tacacatgga attaggccag tagtatcaac 6540 tcaactgctg
ttaaatggca gtctagcaga agaagaggta gtaattagat ctgtcaattt 6600
cacggacaat gctaaaacca taatagtaca gctgaacaca tctgtagaaa ttaattgtac
6660 aagacccaac aacaatacaa gaaaaagaat ccgtatccag agaggaccag
ggagagcatt 6720 tgttacaata ggaaaaatag gaaatatgag acaagcacat
tgtaacatta gtagagcaaa 6780 atggaataac actttaaaac agatagctag
caaattaaga gaacaatttg gaaataataa 6840 aacaataatc tttaagcaat
cctcaggagg ggacccagaa attgtaacgc acagttttaa 6900 ttgtggaggg
gaatttttct actgtaattc aacacaactg tttaatagta cttggtttaa 6960
tagtacttgg agtactgaag ggtcaaataa cactgaagga agtgacacaa tcaccctccc
7020 atgcagaata aaacaaatta taaacatgtg gcagaaagta ggaaaagcaa
tgtatgcccc 7080 tcccatcagt ggacaaatta gatgttcatc aaatattaca
gggctgctat taacaagaga 7140 tggtggtaat agcaacaatg agtccgagat
cttcagacct ggaggaggag atatgaggga 7200 caattggaga agtgaattat
ataaatataa agtagtaaaa attgaaccat taggagtagc 7260 acccaccaag
gcaaagagaa gagtggtgca gagagaaaaa agagcagtgg gaataggagc 7320
tttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcct caatgacgct
7380 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca
atttgctgag 7440 ggctattgag gcgcaacagc atctgttgca actcacagtc
tggggcatca agcagctcca 7500 ggcaagaatc ctggctgtgg aaagatacct
aaaggatcaa cagctcctgg ggatttgggg 7560 ttgctctgga aaactcattt
gcaccactgc tgtgccttgg aatgctagtt ggagtaataa 7620 atctctggaa
cagatttgga atcacacgac ctggatggag tgggacagag aaattaacaa 7680
ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga
7740 acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta
acataacaaa 7800 ttggctgtgg tatataaaat tattcataat gatagtagga
ggcttggtag gtttaagaat 7860 agtttttgct gtactttcta tagtgaatag
agttaggcag ggatattcac cattatcgtt 7920 tcagacccac ctcccaaccc
cgaggggacc cgacaggccc gaaggaatag aagaagaagg 7980 tggagagaga
gacagagaca gatccattcg attagtgaac ggatccttgg cacttatctg 8040
ggacgatctg cggagcctgt gcctcttcag ctaccaccgc ttgagagact tactcttgat
8100 tgtaacgagg attgtggaac ttctgggacg cagggggtgg gaagccctca
aatattggtg 8160 gaatctccta cagtattgga gtcaggaact aaagaatagt
gctgttagct tgctcaatgc 8220 cacagccata gcagtagctg aggggacaga
tagggttata gaagtagtac aaggagcttg 8280 tagagctatt cgccacatac
ctagaagaat aagacagggc ttggaaagga ttttgctata 8340 agatgggtgg
caagtggtca aaaagtagtg tgattggatg gcctactgta agggaaagaa 8400
tgagacgagc tgagccagca gcagataggg tgggagcagc atctcgagac ctggaaaaac
8460 atggagcaat cacaagtagc aatacagcag ctaccaatgc tgcttgtgcc
tggctagaag 8520 cacaagagga ggaggaggtg ggttttccag tcacacctca
ggtaccttta agaccaatga 8580 cttacaaggc agctgtagat cttagccact
ttttaaaaga aaagggggga ctggaagggc 8640 taattcactc ccaaagaaga
caagatatcc ttgatctgtg gatctaccac acacaaggct 8700 acttccctga
ttagcagaac tacacaccag ggccaggggt cagatatcca ctgacctttg 8760
gatggtgcta caagctagta ccagttgagc cagataagat agaagaggcc aataaaggag
8820 agaacaccag cttgttacac cctgtgagcc tgcatgggat ggatgacccg
gagagagaag 8880 tgttagagtg gaggtttgac agccgcctag catttcatca
cgtggcccga gagctgcatc 8940 cggagtactt caagaactgc tgacatcgag
cttgctacaa gggactttcc gctggggact 9000 ttccagggag gcgtggcctg
ggcgggactg gggagtggcg agccctcaga tcctgcatat 9060 aagcagctgc
tttttgcctg tactgggtct ctctggttag accagatctg agcctgggag 9120
ctctctggct aactagggaa cccactgctt aagcctcaat aaagcttgcc ttgagtgctt
9180 c 9181 15 29 RNA Homo sapiens 15 ggcagaucug agccugggag
cucucugcc 29 16 52 RNA Homo sapiens 16 uuuuuuaggg aagaucuggc
cuuccuacaa gggaaggcca gggaauuuuc uu 52 17 9353 DNA Homo sapiens 17
ttgggggcga cactccacca tagatcactc ccctgtgagg aactactgtc ttcacgcaga
60 aagcgtctag ccatggcgtt agtatgagtg ttgtgcagcc tccaggaccc
cccctcccgg 120 gagagccata gtggtctgcg gaaccggtga gtacaccgga
attgccagga cgaccgggtc 180 ctttcttgga tcaacccgct caatgcctgg
agatttgggc gtgcccccgc gagactgcta 240 gccgagtagt gttgggtcgc
gaaaggcctt gtggtactgc ctgatagggt gcttgcgagt 300 gccccgggag
gtctcgtaga ccgtgcatca tgagcacaaa tcctaaacct caaagaaaaa 360
ccaaacgtaa caccaaccgc cgcccacagg acgttaagtt cccgggcggt ggtcagatcg
420 ttggtggagt ttacctgttg ccgcgcaggg gccccaggtt gggtgtgcgc
gcgactagga 480 agacttccga gcggtcgcaa cctcgtggaa ggcgacaacc
tatccccaag gctcgccggc 540 ccgagggtag gacctgggct cagcccgggt
acccttggcc cctctatggc aacgagggta 600 tggggtgggc aggatggctc
ctgtcacccc gtggctctcg gcctagttgg ggccccacag 660 acccccggcg
taggtcgcgt aatttgggta aggtcatcga tacccttaca tgcggcttcg 720
ccgacctcat ggggtacatt ccgcttgtcg gcgcccccct agggggcgct gccagggccc
780 tggcacatgg tgtccgggtt ctggaggacg gcgtgaacta tgcaacaggg
aatctgcccg 840 gttgctcttt ctctatcttc ctcttagctt tgctgtcttg
tttgaccatc ccagcttccg 900 cttacgaggt gcgcaacgtg tccgggatat
accatgtcac gaacgactgc tccaactcaa 960 gtattgtgta tgaggcagcg
gacatgatca tgcacacccc cgggtgcgtg ccctgcgtcc 1020 gggagagtaa
tttctcccgt tgctgggtag cgctcactcc cacgctcgcg gccaggaaca 1080
gcagcatccc caccacgaca atacgacgcc acgtcgattt gctcgttggg gcggctgctc
1140 tctgttccgc tatgtacgtt ggggatctct gcggatccgt ttttctcgtc
tcccagctgt 1200 tcaccttctc acctcgccgg tatgagacgg tacaagattg
caattgctca atctatcccg 1260 gccacgtatc aggtcaccgc atggcttggg
atatgatgat gaactggtca cctacaacgg 1320 ccctagtggt atcgcagcta
ctccggatcc cacaagccgt cgtggacatg gtggcggggg 1380 cccactgggg
tgtcctagcg ggccttgcct actattccat ggtggggaac tgggctaagg 1440
tcttgattgt gatgctactc tttgctggcg ttgacgggca cacccacgtg acagggggaa
1500 gggtagcctc cagcacccag agcctcgtgt cctggctctc acaaggccca
tctcagaaaa 1560 tccaactcgt gaacaccaac ggcagctggc acatcaacag
gaccgctctg aattgcaatg 1620 actccctcca aactgggttc attgctgcgc
tgttctacgc acacaggttc aacgcgtccg 1680 ggtgcccaga gcgcatggct
agctgccgcc ccatcgatga gttcgctcag gggtggggtc 1740 ccatcactca
tgatatgcct gagagctcgg accagaggcc atattgctgg cactacgcgc 1800
ctcgaccgtg cgggatcgtg cctgcgtcgc aggtgtgtgg tccagtgtat tgcttcactc
1860 cgagccctgt tgtagtgggg acgaccgatc gtttcggcgc tcctacgtat
agctgggggg 1920 agaatgagac agacgtgctg ctacttagca acacgcggcc
gcctcaaggc aactggtttg 1980 ggtgcacgtg gatgaacagc actgggttca
ccaagacgtg cgggggccct ccgtgcaaca 2040 tcgggggggt cggcaacaac
accttggtct gccccacgga ttgcttccgg aagcaccccg 2100 aggccactta
cacaaagtgt ggctcggggc cctggttgac acccaggtgc atggttgact 2160
acccatacag gctctggcac tacccctgca ctgttaactt taccgtcttt aaggtcagga
2220 tgtatgtggg gggcgtggag cacaggctca atgctgcatg caattggact
cgaggagagc 2280 gctgtgactt ggaggacagg gataggtcag aactcagccc
gctgctgctg tctacaacag 2340 agtggcagat actgccctgt tccttcacca
ccctaccggc cctgtccact ggcttgatcc 2400 atcttcaccg gaacatcgtg
gacgtgcaat acctgtacgg tatagggtcg gcagttgtct 2460 cctttgcaat
caaatgggag tatatcctgt tgcttttcct tcttctggcg gacgcgcgcg 2520
tctgtgcctg cttgtggatg atgctgctga tagcccaggc tgaggccacc ttagagaacc
2580 tggtggtcct caatgcggcg tctgtggccg gagcgcatgg ccttctctcc
ttcctcgtgt 2640 tcttctgcgc cgcctggtac atcaaaggca ggctggtccc
tggggcggca tatgctctct 2700 atggcgtatg gccgttgctc ctgctcttgc
tggccttacc accacgagct tatgccatgg 2760 accgagagat ggctgcatcg
tgcggaggcg cggtttttgt aggtctggta ctcttgacct 2820 tgtcaccata
ctataaggtg ttcctcgcta ggctcatatg gtggttacaa tattttatca 2880
ccagagccga ggcgcacttg caagtgtggg tcccccctct caatgttcgg ggaggccgcg
2940 atgccatcat cctccttaca tgcgcggtcc atccagagct aatctttgac
atcaccaaac 3000 tcctgctcgc catactcggt ccgctcatgg tgctccaggc
tggcataact agagtgccgt 3060 actttgtacg cgctcagggg ctcatccgtg
catgcatgtt agtgcggaag gtcgctggag 3120 gccactatgt ccaaatggcc
ttcatgaagc tggccgcgct gacaggtacg tacgtatatg 3180 accatcttac
tccactgcgg gattgggccc acgcgggcct acgagacctt gcggtggcag 3240
tagagcccgt cgtcttctct gacatggaga ctaaactcat cacctggggg gcagacaccg
3300 cggcgtgtgg ggacatcatc tcgggtctac cagtctccgc ccgaaggggg
aaggagatac 3360 ttctaggacc ggccgatagt tttggagagc aggggtggcg
gctccttgcg cctatcacgg 3420 cctattccca acaaacgcgg ggcctgcttg
gctgtatcat cactagcctc acaggtcggg 3480 acaagaacca ggtcgatggg
gaggttcagg tgctctccac cgcaacgcaa tctttcctgg 3540 cgacctgcgt
caatggcgtg tgttggaccg tctaccatgg tgccggctcg aagaccctgg 3600
ccggcccgaa gggtccaatc acccaaatgt acaccaatgt agaccaggac ctcgtcggct
3660 ggccggcgcc ccccggggcg cgctccatga caccgtgcac ctgcggcagc
tcggaccttt 3720 acttggtcac gaggcatgct gatgtcgttc cggtgcgccg
gcggggcgac agcaggggga 3780 gcctgctttc ccccaggccc atctcctacc
tgaagggctc ctcgggtgga ccactgcttt 3840 gcccttcggg gcacgttgta
ggcatcttcc gggctgctgt gtgcacccgg ggggttgcga 3900 aggcggtgga
cttcataccc gttgagtcta tggaaactac catgcggtct ccggtcttca 3960
cagacaactc atcccctccg gccgtaccgc aaacattcca agtggcacat ttacacgctc
4020 ccactggcag cggcaagagc accaaagtgc cggctgcata tgcagcccaa
gggtacaagg 4080 tgctcgtcct aaacccgtcc gttgccgcca cattgggctt
tggagcgtat atgtccaagg 4140 cacatggcat cgagcctaac atcagaactg
gggtaaggac catcaccacg ggcggcccca 4200 tcacgtactc cacctattgc
aagttccttg ccgacggtgg atgctccggg ggcgcctatg 4260 acatcataat
atgtgatgaa tgccactcaa ctgactcgac taccatcttg ggcatcggca 4320
cagtcctgga tcaggcagag acggctggag cgcggctcgt cgtgctcgcc accgccacgc
4380 ctccgggatc gatcaccgtg ccacacccca acatcgagga agtggccctg
tccaacactg 4440 gagagattcc cttctatggc aaagccatcc ccattgaggc
catcaagggg ggaaggcatc 4500 tcatcttctg ccattccaag aagaagtgtg
acgagctcgc cgcaaagctg acaggcctcg 4560 gactcaatgc tgtagcgtat
taccggggtc tcgatgtgtc cgtcataccg actagcggag 4620 acgtcgttgt
cgtggcaaca gacgctctaa tgacgggttt taccggcgac tttgactcag 4680
tgatcgactg caacacatgt gtcacccaga cagtcgattt cagcttggat cccaccttca
4740 ccattgagac gacaacgctg ccccaagacg cggtgtcgcg tgcgcagcgg
cgaggtagga 4800 ctggcagggg caggagtggc atctacaggt ttgtgactcc
aggagaacgg ccctcaggca 4860 tgttcgactc ctcggtcctg tgtgagtgct
atgacgcagg ctgcgcttgg tatgagctca 4920 cgcccgctga gacctcggtt
aggttgcggg cttacctaaa tacaccaggg ttgcccgtct 4980 gccaggacca
cctagagttc tgggagagcg tcttcacagg cctcacccac atagatgccc 5040
acttcttgtc ccagaccaaa caggcaggag acaacctccc ctacctggta gcataccaag
5100 ccacagtgtg cgccagggct caggctccac ctccatcgtg ggaccaaatg
tggaagtgtc 5160 tcatacggct aaagcccaca ctgcatgggc caacgcccct
gctgtacagg ctaggagccg 5220 ttcaaaatga ggtcactctc acacacccca
taaccaaata catcatggca tgcatgtcgg 5280 ctgacctgga ggtcgtcact
agcacctggg tgctagtagg cggagtcctt gcggctctgg 5340 ccgcgtactg
cctgacgaca ggcagcgtgg tcattgtggg caggatcatc ttgtccggga 5400
ggccagctgt tattcccgac agggaagtcc tctaccagga gttcgatgag atggaagagt
5460 gtgcttcaca cctcccttac atcgagcaag gaatgcagct cgccgagcaa
ttcaaacaga 5520 aggcgctcgg attgctgcaa acagccacca agcaagcgga
ggctgctgct cccgtggtgg 5580 agtccaagtg gcgagccctt gaggtcttct
gggcgaaaca catgtggaac ttcatcagcg 5640 ggatacagta cttggcaggc
ctatccactc tgcctggaaa ccccgcgata gcatcattga 5700 tggcttttac
agcctctatc accagcccgc tcaccaccca aaataccctc ctgtttaaca 5760
tcttgggggg atgggtggct gcccaactcg ctccccccag cgctgcttcg gctttcgtgg
5820 gcgccggcat tgccggtgcg gccgttggca gcataggtct cgggaaggta
cttgtggaca 5880 ttctggcggg ctatggggcg ggggtggctg gcgcactcgt
ggcctttaag gtcatgagcg 5940 gcgagatgcc ctccactgag gatctggtta
atttactccc tgccatcctt tctcctggcg 6000 ccctggttgt cggggtcgtg
tgcgcagcaa tactgcgtcg gcacgtgggc ccgggagagg 6060 gggctgtgca
gtggatgaac cggctgatag cgttcgcttc gcggggtaac cacgtctccc 6120
ccacgcacta tgtgcccgag agcgacgccg cggcgcgtgt tactcagatc ctctccagcc
6180 ttaccatcac tcagttgctg aagaggcttc atcagtggat taatgaggac
tgctccacgc 6240 cttgttccgg ctcgtggcta aaggatgttt gggactggat
atgcacggtg ttgagtgact 6300 tcaagacttg gctccagtcc aagctcctgc
cgcggttacc gggactccct ttcctgtcat 6360 gccaacgcgg gtacaaggga
gtctggcggg gggatggcat catgcaaacc acctgcccat 6420 gtggagcaca
gatcaccgga catgtcaaaa atggctccat gaggattgtt gggccaaaaa 6480
cctgcagcaa cacgtggcat ggaacattcc ccatcaacgc atacaccacg ggcccctgca
6540 cgccctcccc agcgccgaac tattccaggg cgctgtggcg ggtggctgct
gaggagtacg 6600 tggaggttac gcgggtgggg gatttccact acgtgacggg
catgaccact gacaacgtga 6660 aatgcccatg ccaggttcca gcccctgaat
ttttcacgga ggtggatgga gtacggttgc 6720 acaggtatgc tccagtgtgc
aaacctctcc tacgagagga ggtcgtattc caggtcgggc 6780 tcaaccagta
cctggtcggg tcacagctcc catgtgagcc cgaaccggat gtggcagtgc 6840
tcacttccat gctcaccgac ccctctcata ttacagcaga gacggccaag cgtaggctgg
6900 ccagggggtc tcccccctcc ttggccagct cttcagctag ccagttgtct
gcgccttctt 6960 tgaaggcgac atgtactacc catcatgact ccccggacgc
tgacctcatc gaggccaacc 7020 tcctgtggcg gcaggagatg ggcgggaaca
tcacccgtgt ggagtcagaa aataaggtgg 7080 taatcctgga ctctttcgat
ccgattcggg cggtggagga tgagagggaa atatccgtcc 7140 cggcggagat
cctgcgaaaa cccaggaagt tccccccagc gttgcccata tgggcacgcc 7200
cggattacaa ccctccactg ctagagtcct ggaaggaccc ggactacgtc cccccggtgg
7260 tacacgggtg ccctttgcca tctaccaagg cccccccaat accacctcca
cggaggaaga 7320 ggacggttgt cctgacagag tccaccgtgt cttctgcctt
ggcggagctc gctactaaga 7380 cctttggcag ctccgggtcg tcggccgttg
acagcggcac ggcgactggc cctcccgatc 7440 aggcctccga cgacggcgac
aaaggatccg acgttgagtc gtactcctcc atgccccccc 7500 tcgagggaga
gccaggggac cccgacctca gcgacgggtc ttggtctacc gtgagcgggg 7560
aagctggtga ggacgtcgtc tgctgctcaa tgtcctatac atggacaggt gccttgatca
7620 cgccatgcgc tgcggaggag agcaagttgc ccatcaatcc gttgagcaac
tctttgctgc 7680 gtcaccacag tatggtctac tccacaacat ctcgcagcgc
aagtctgcgg cagaagaagg 7740 tcacctttga cagactgcaa gtcctggacg
accactaccg ggacgtgctc aaggagatga 7800 aggcgaaggc gtccacagtt
aaggctaggc ttctatctat agaggaggcc tgcaaactga 7860 cgcccccaca
ttcggccaaa tccaaatttg gctacggggc gaaggacgtc cggagcctat 7920
ccagcagggc cgtcaaccac atccgctccg tgtgggagga cttgctggaa gacactgaaa
7980 caccaattga taccaccatc atggcaaaaa atgaggtttt ctgcgtccaa
ccagagaaag 8040 gaggccgcaa gccagctcgc cttatcgtat tcccagacct
gggggtacgt gtatgcgaga 8100 agatggccct ttacgacgtg gtctccaccc
ttcctcaggc cgtgatgggc ccctcatacg 8160 gattccagta ctctcctggg
cagcgggtcg agttcctggt gaatacctgg aaatcaaaga 8220 aatgccctat
gggcttctca tatgacaccc gctgctttga ctcaacggtc actgagaatg 8280
acatccgtac tgaggaatca atttaccaat gttgtgactt ggcccccgaa gccaggcagg
8340 ccataaggtc gctcacagag cggctttatg tcgggggtcc cctgactaat
tcgaaggggc 8400 agaactgcgg ttatcgccgg tgccgcgcaa gtggcgtgct
gacgactagc tgcggcaaca 8460 cgatgctcgt gaacggagac gaccttgtcg
ttatctgtga gagtgcggga acccaggagg 8520 atgcggcggc cctacgagcc
ttcacggagg ctatgactag gtattccgcc ccccccgggg 8580 acccgcccca
accagaatac gacttggagc tgataacgtc atgctcctcc aatgtgtcgg 8640
tcgcgcacga tgcatccggc aaaagggtgt actacctcac ccgtgacccc accacccccc
8700 tcgcacgggc tgcgtgggag acagttagac acactccagt caactcctgg
ctaggcaata 8760 tcatcatgta tgcgcccacc ctatgggcga ggatgattct
gatgactcat ttcttctcta 8820 tccttctagc tcaggagcaa cttgaaaaag
ccctggattg tcagatctac ggggcctgtt 8880 actccattga gccacttgac
ctacctcaga tcattgaacg actccatggt cttagcgcat 8940 tttcactcca
cagttactct ccaggtgaga tcaatagggt ggcttcatgc ctcaggaaac 9000
ttggggtacc gcctttgcga gtctggagac atcgggccag aagtgtccgc gctaagctac
9060 tgtcccaggg ggggagggct gccacttgcg gcaagtacct cttcaactgg
gcagtaaaga 9120 ccaagcttaa actcactcca atcccggctg cgtcccagct
agacttgtcc ggctggttcg 9180 ttgctggtta caacggggga gacatatatc
acagcctgtc tcgtgcccga ccccgttggt 9240 tcatgttgtg cctactccta
ctttctgtag gggtaggcat ctacctgctc cccaaccggt 9300 gaacggggag
ctaaccactc caggccaata ggccattccc tttttttttt ttc 9353 18 328 RNA
Homo sapiens 18 uugggggcga cacuccacca uagaucacuc cccugugagg
aacuacuguc uucacgcaga 60 aagcgucuag ccauggcguu aguaugagug
uugugcagcc uccaggaccc ccccucccgg 120 gagagccaua guggucugcg
gaaccgguga guacaccgga auugccagga cgaccggguc 180 cuuucuugga
ucaacccgcu caaugccugg agauuugggc gugcccccgc gagacugcua 240
gccgaguagu guugggucgc gaaaggccuu gugguacugc cugauagggu gcuugcgagu
300 gccccgggag gucucguaga ccgugcau 328 19 14 RNA Homo sapiens 19
auuugggcgu gccc 14 20 27 RNA Homo sapiens 20 gccgaguagu guugggucgc
gaaaggc 27 21 340 DNA Homo sapiens 21 atgggcggag ggaagctcat
cagtggggcc acgagctgag tgcgtcctgt cactccactc 60 ccatgtccct
tgggaaggtc tgagactagg gccagaggcg gccctaacag ggctctccct 120
gagcttcagg gaggtgagtt cccagagaac ggggctccgc gcgaggtcag actgggcagg
180 agatgccgtg gaccccgccc ttcggggagg ggcccggcgg atgcctcctt
tgccggagct 240 tggaacagac tcacggccag cgaagtgagt tcaatggctg
aggtgaggta ccccgcaggg 300 gacctcataa cccaattcag accactctcc
tccgcccatt 340 22 349 DNA Homo sapiens 22 gaggaaagtc cgggctcaca
cagtctgaga tgattgtagt gttcgtgctt gatgaaacaa 60 taaatcaagg
cattaatttg acggcaatga aatatcctaa gtctttcgat atggatagag 120
taatttgaaa gtgccacagt gacgtagctt ttatagaaat ataaaaggtg gaacgcggta
180 aacccctcga gtgagcaatc caaatttggt aggagcactt gtttaacgga
attcaacgta 240 taaacgagac acacttcgcg aaatgaagtg gtgtagacag
atggttatca cctgagtacc 300 agtgtgacta gtgcacgtga tgagtacgat
ggaacagaac gcggcttat 349 23 377 DNA Homo sapiens 23 gaagctgacc
agacagtcgc cgcttcgtcg tcgtcctctt cgggggagac gggcggaggg 60
gaggaaagtc cgggctccat agggcagggt gccaggtaac gcctgggggg gaaacccacg
120 accagtgcaa cagagagcaa accgccgatg gcccgcgcaa gcgggatcag
gtaagggtga 180 aagggtgcgg taagagcgca ccgcgcggct ggtaacagtc
cgtggcacgg taaactccac 240 ccggagcaag gccaaatagg ggttcataag
gtacggcccg tactgaaccc gggtaggctg 300 cttgagccag tgagcgattg
ctggcctaga tgaatgactg tccacgacag aacccggctt 360 atcggtcagt ttcacct
377 24 38110 DNA Homo sapiens 24 ccaccggtta cgatcttgcc gaccatggcc
ccacaatagg gccggggaga cccggcgtca 60 gtggtgggcg gcacggtcag
taacgtctgc gcaacacggg gttgactgac gggcaatatc 120 ggctccatag
cgtcggccgc ggatacagta aaggagcatt ctgtgacgga aaagacgccc 180
gacgacgtct tcaaacttgc caaggacgag aaggtcgaat atgtcgacgt ccggttctgt
240 gacctgcctg gcatcatgca gcacttcacg attccggctt cggcctttga
caagagcgtg 300 tttgacgacg gcttggcctt tgacggctcg tcgattcgcg
ggttccagtc gatccacgaa 360 tccgacatgt tgcttcttcc cgatcccgag
acggcgcgca tcgacccgtt ccgcgcggcc 420 aagacgctga atatcaactt
ctttgtgcac gacccgttca ccctggagcc gtactcccgc 480 gacccgcgca
acatcgcccg caaggccgag aactacctga tcagcactgg catcgccgac 540
accgcatact tcggcgccga ggccgagttc tacattttcg attcggtgag cttcgactcg
600 cgcgccaacg gctccttcta cgaggtggac gccatctcgg ggtggtggaa
caccggcgcg 660 gcgaccgagg ccgacggcag tcccaaccgg ggctacaagg
tccgccacaa gggcgggtat 720 ttcccagtgg cccccaacga ccaatacgtc
gacctgcgcg acaagatgct gaccaacctg 780 atcaactccg gcttcatcct
ggagaagggc caccacgagg tgggcagcgg cggacaggcc 840 gagatcaact
accagttcaa ttcgctgctg cacgccgccg acgacatgca gttgtacaag 900
tacatcatca agaacaccgc ctggcagaac ggcaaaacgg tcacgttcat gcccaagccg
960 ctgttcggcg acaacgggtc cggcatgcac tgtcatcagt cgctgtggaa
ggacggggcc 1020 ccgctgatgt acgacgagac gggttatgcc ggtctgtcgg
acacggcccg tcattacatc 1080 ggcggcctgt tacaccacgc gccgtcgctg
ctggccttca ccaacccgac ggtgaactcc 1140 tacaagcggc tggttcccgg
ttacgaggcc ccgatcaacc tggtctatag ccagcgcaac 1200 cggtcggcat
gcgtgcgcat cccgatcacc ggcagcaacc cgaaggccaa gcggctggag 1260
ttccgaagcc ccgactcgtc gggcaacccg tatctggcgt tctcggccat gctgatggca
1320 ggcctggacg gtatcaagaa caagatcgag ccgcaggcgc ccgtcgacaa
ggatctctac 1380 gagctgccgc cggaagaggc cgcgagtatc ccgcagactc
cgacccagct gtcagatgtg 1440 atcgaccgtc tcgaggccga ccacgaatac
ctcaccgaag gaggggtgtt cacaaacgac 1500 ctgatcgaga cgtggatcag
tttcaagcgc gaaaacgaga tcgagccggt caacatccgg 1560 ccgcatccct
acgaattcgc gctgtactac gacgtttaag gactcttcgc agtccgggtg 1620
tagagggagc ggcgtgtcgt tgccagggcg ggcgtcgagg tttttcgatg ggtgacggtg
1680 gccggcaacg gcgcgccgac caccgctgcg aagagcccgt ttaagaacgt
tcaaggacgt 1740 ttcagccggg tgccacaacc cgcttggcaa tcatctcccg
accgccgagc gggttgtctt 1800 tcacatgcgc cgaaactcaa gccacgtcgt
cgcccaggcg tgtcgtcgcg gccggttcag 1860 gttaagtgtc ggggattcgt
cgtgcgggcg ggcgtccacg ctgaccaacg gggcagtcaa 1920 ctcccgaaca
ctttgcgcac taccgccttt gcccgccgcg tcacccgtag gtagttgtcc 1980
aggaattccc caccgtcgtc gtttcgccag ccggccgcga ccgcgaccgc attgagctgg
2040 cgcccgggtc ccggcagctg gtcggtgggc ttgccgcgca ccaacaccag
cgcgttgcgg 2100 gcccgggtgg cggtcagcca ggcctgacgg agcagctcca
cgtcggctgc gggaaccaga 2160 tcggcggccg cgatgacatc cagggattgc
agcgtcgagg tgttgtgcag ggcgggaacc 2220 tggtgcgcat gctgtagctg
cagcaactgc acggtccatt cgatgtcggc cagtccgccg 2280 cggcccagtt
tggtgtgtgt gttggggtcg gcaccgcgcg gcaaccgctc ggactcgata 2340
cgggccttga tgcggcgaat ctcgcgcacc gagtcagcgg acacaccgtc gggcggatac
2400 cgcgttttgt cgaccatccg taggaatcgc tgacccaact cggcatcgcc
ggcaaccgcg 2460 tgtgcgcgta gcagggcctg gatctcccat ggctgtgccc
actgctcgta gtatgcggcg 2520 taggacccca gggtgcggac cagcggaccg
ttgcggccct cgggtcgcaa attggcgtcg 2580 agctccagcg gcggatcgac
gctgggtgtc cccagcagcg cccgaacccg ctcggcgatc 2640 gatgtcgacc
atttcaccgc ccgtgcatcg tcgacgccgg tggccggctc acagacgaac 2700
atcacgtcgg catccgaccc gtagcccaac tcggcaccac ccagccgacc catgccgatg
2760 accgcgatgg ccgccggggc gcgatcgtcg tcgggaaggc tggcccggat
catgacgtcc 2820 agcgcggcct gcagcaccgc cacccacacc gacgtcaacg
cccggcacac ctcggtgacc 2880 tcgagcaggc cgagcaggtc cgccgaaccg
atgcgggcca gctctcgacg acgcagcgtg 2940 cgcgcgccgg cgatggcccg
ctccgggtcg gggtagcggc tcgccgaggc gatcagcgcc 3000 cgagccacgg
cggcgggctc ggtctcgagc agcttcgggc ccgcaggccc gtcctcgtac 3060
tgctggatga cccgcggcgc gcgcatcaac agatccggca catacgccga ggtacccaag
3120 acatgcatga gccgcttggc caccgcgggc ttgtcccgca gcgtggccag
gtaccagctt 3180 tcggtggcca gcgcctcact gagccgccgg taggccagca
gtccgccgtc gggatcgggg 3240 gcatacgaca tccagtccag cagcctgggc
agcagcaccg actgcacccg tccgcgccgg 3300 ccgctttgat tgaccaacgc
cgacatgtgt ttcaacgcgg tctgcggtcc ctcgtagccc 3360 agcgcggcca
gccggcgccc cgcggcctcc aacgtcatgc cgtgggcgat ctccaacccg 3420
gtcgggccga tcgattccag cagcggttga tagaagagtt tggtgtgtaa cttcgacacc
3480 cgcacgttct gcttcttgag ttcctcccgc agcaccccgg ccgcatcgtt
tcggccatcg 3540 ggccggatgt gggccgcgcg cgccagccag cgcactgcct
cctcgtcttc gggatcggga 3600 agcaggtggg tgcgcttgag ccgctgcaac
tgcagtcggt gctcgagcag cctgaggaac 3660 tcatacgacg cggtcatgtt
cgccgcgtcc tcacgcccga tgtagccgcc ttcgcccaac 3720 gccgccaatg
cgtccaccgt ggacgccacc cgtaacgact cgtcgctacg ggcatgaacc 3780
agctgcagta gctgtacggc gaactccacg tcgcgcaatc cgccgctgcc gagtttgagc
3840 tcgcggccgc ggacatcggc gggcaccagc tgctccaccc gccgccgcat
ggcctgcacc 3900 tcgaccacaa agtcttcgcg ctcgcaggct cgccacacca
tcggcatcaa ggcggtcagg 3960 taacgctcgc caagttccgc gtcgccaacg
actggccgtg ctttcagcaa cgcctgaaac 4020 tcccaggtct tggcccagcg
ctggtagtag gcgatgtgcg actcgagcgt acggaccagc 4080 tccccgttgc
gcccctccgg acgcagggcg gcgtccacct cgaaaaaggc cgccgaggcc 4140
acccgcatca tctcgctggc cacgcgcgcg ttgcgcgggt cggagcgctc ggcaacgaat
4200 atgacatcga cgtcgctgac gtagttcagt tcgcgcgcac cgcacttgcc
catcgcgatg 4260 accgccaggc gcggtggcgg gtgctcgccg cacacgctcg
cctcggccac gcgcagcgcc 4320 gccgccagag cggcgtccgc ggcgtccgcc
aggcgtgcgg ccaccacggt gaatggcagc 4380 accggttcgt cctcgaccgt
cgcggccagg tcgagagcgg ccagcattag cacgtagtcg 4440 cggtactggg
ttcgcaatcg gtgcacgagc gagcccggca taccctccga ttcctcgacg 4500
cactcgacga acgaccgctg cagctggtca tgggacggca gtgtgacctt gccccgcagc
4560 aatttccagg actgcggatg ggcgaccagg tgatcgccca acgccagcga
cgagcccagc 4620 accgagaaca gccgcccgcg cagactgcgt tcgcgcagca
gagccgcgtt gagctcgtcc 4680 catccggtgt ctggattctc cgacagccgg
atcaaggcgc gcagcgcggc atcggcgtcc 4740 ggagcgcgtg acagcgacca
cagcaggtcg acgtgcgcct gatcctcgtg ccgatcccac 4800 cccagctgag
ccagacgctc accagcaggg gggtcaacta atccgagccg gccaacgctg 4860
ggcaacttcg gccgctgcgt ggcgagtttg gtcacgacca cgacggtagc gcaaagcgcg
4920 tcggcgtcgg atcaaccggt agatctgggc tacagcgaca ggtaggtgcg
cagctcgtat 4980 ggcgtgacgt ggctgcggta gttcgcccac tccgtgcgct
tgttgcgcaa gaaaaagtca 5040 aaaacgtgct cccccaaggc ctccgcgacg
agttcggagg cctccatggc gcgcagcgca 5100 ctatccaaac tggacggcaa
ttctcggtac cccatcgctc ggcgttcctc gggtgtgagg 5160 tcccatacgt
tgtcctcggc ctgcgggccc agcacgtaac ccttctctac accccgcaat 5220
cccgcggcca gcagcacggc gaatgtcaga tagggattgc acgccgaatc agggctgcgt
5280 acttcgaccc gccgcgacga ggtcttgtgc ggcgtgtaca tcggcacccg
cactagggcg 5340 gatcggttgg cggcccccca cgacgcggcc gtgggcgctt
cgccgccctg caccagccgc 5400 ttgtaagagt tgacccactg atttgtgacc
gcgctgatct cgcaagcgtg ctccaggatc 5460 ccggcgatga acgatttacc
cacttccgac agctgcagcg gatcatcagc gctgtggaac 5520 gcgttgacat
caccctcgaa caggctcatg tgggtgtgca tcgccgagcc cgggtgctgg 5580
ccgaatggct tgggcatgaa cgacgcccgg gcgccctctt ccagcgcgac ttctttgatg
5640 acgtagcgga aggtcatcac gttgtcagcc atcgacagag cgtcggcaaa
ccgcaggtcg 5700 atctcctgct ggccgggtgc gccttcgtga tggctgaact
ccaccgagat gcccatgaat 5760 tccagggcat cgatcgcgtg gcggcgaaag
ttcaaggcgg agtcgtgcac cgcttggtcg 5820 aaatagccgg cgttgtcgac
cgggacgggc accgacccgt cctcgggtcc gggcttgagc 5880 aggaagaact
cgatttcggg atgcacgtag caggagaagc cgagttcgcc ggccttcgtc 5940
agctgccgcc gcaacacgtg ccgcgggtcc gcccacgacg gcgagccgtc cggcatggtg
6000 atgtcgcaaa acatccgcgc tgagtggtgg tggccggaac tggtggccca
gggcagcacc 6060 tggaaggtcg acgggtccgg gtgcgccacc gtatcggatt
ccgagacccg cgcaaagccc 6120 tcgatcgagg atccgtcgaa gccgatgcct
tcctcgaagg cgccctcgag ttcggctggg 6180 gcgatggcga ccgacttgag
gaaaccgagc acgtctgtga accacagccg gacgaagcgg 6240 atgtcgcgtt
cttccagggt acgaagaacg aattccttct gtcggtccat acctcgaaca 6300
gtatgcactg tctgttaaaa ccgtgttacc gatgcccggc cagaagcgtt gcggggcggc
6360 ccgcaagggg agtgcgcggt gagttcaggg cgcgcaccgc agactcgtcg
gcggcaaggt 6420 cccgtcgaga aaatagtgca tcaccgcaga gtccacacac
tggttgccat cgaacaccgc 6480 agtgtgttgg gtgccgtcga aggtgatcag
cggtgcgccc agctggcggg ccaggtctac 6540 cccggactga tacggagtgg
ccgggtcgtg ggtggtggac accacgacga ccttgccagc 6600 cccggccggc
gccgcggggt gcggcgtcga cgttgccggc accggccaca gcgcgcacag 6660
atcgcggggg gcggatccgg tgaactgccc gtagctaagg aacggggcga cctgacggat
6720 ccgttggtcg gcggccaccc aggccgctgg atcggccggt gtgggcgcat
cgacgcaccg 6780 gaccgcgttg aacgcgtcct ggtcgttgct gtagtgcccg
tctgcatccc ggccgtcata 6840 gtcgtcggca agcaccagca agtcgccggc
gtcgctgccg cgctgcagcc ccagcagacc 6900 actggtcagg tacttccagc
gctgagggct gtacagcgcg ttgatggtgc ccgtcgtcgc 6960 gtcggcgtag
ctcaggccac gtggatccga cgtcttaccc ggcttctgca ccagcgggtc 7020
aaccagggcg tggtagcggt tgacccactg ggccgagtcg gtgcccagag ggcaggccgg
7080 cgagcgggcg cagtcggcgg cgtagtcatt gaaagcggtc tgaaatcccg
ccatttggct 7140 gatgctttcc tcgattgggc taacggctgg atcgatagcg
ccgtcgagga ccatcgcccg 7200 cacatgagta ccgaaccgtt ccaggtaagc
ggtgcccaac tcggtgccgt agctgtatcc 7260 gaggtagttg atctgatcgt
cacctaacgc ttggcgaacc atgtccatgt cccgtgcgac 7320 ggacgcggta
ccgatattgg ccaagaagct gaagcccatc cggtcaacac agtcctgggc 7380
caactgccgg tagacctgtt cgacgtgggt gacaccggcc ggactgtagt cggccatcgg
7440 atcgcgccgg tacgcgtcga actcggcgtc ggtgcgacac cgcaacgcag
gggtcgagtg 7500 gccgacccct ctcgggtcga agcccaccag gtcgaagtgg
cggagaatgt cggtgtcggc 7560 gatcgcgggt gccatagcgg cgaccatgtc
gaccgccgac gccccgggtc ccccaggatt 7620 gaccagcagt gctccgaatc
gctgtcccgt cgcggggacg cggatcaccg ccaacttcgc 7680 ttgtgtccca
ccgggttggt cgtagtcgac ggggacggac accgtcgcgc agcgtgcagt 7740
gcgaatttcg ctggtgtcgg cgatgaactc gcggcagctg ttccaactct gttgcggcgc
7800 cacgaccggc gcacccgggg tttggccggc gccgggttct tcagtcgcgc
cggccaacgg 7860 gggcgctgct aggggcagtc cgccgagcag caacccgaag
gacagcagcg ccgagctcaa 7920 cggtctgcgg cgccacatgg ccgccatcgt
ctcaccggcg aatacctgtg acggcgcgaa 7980 atgatcacac cttcgtttct
tcgccccgct agcacttggc gccgctgggc ggcgtggtgc 8040 cgccgattaa
atacgccgtc acgtactcgt caatgcagct gtcgccctgg aataccaccg 8100
tgtgctgggt tccgtcgaag gtcagcaacg aaccgcgaag ctggttcgcc aggtcgaccc
8160 cggccttgta cggcgtcgcc gggtcatggg tggtggatac caccaccgtc
ggcactaggc 8220 cgggcgccga gacggcatgg ggctgacttg tgggtggcac
cggccagaac gcgcaggtgc 8280 ccagcggcgc atcaccggtg aacttcccgt
agctcatgaa cggtgcgatc tcccgggcgc 8340 ggcggtcttc gtcgatgacc
ttgtcgcgat cggtaaccgg gggctgatcg acgcaattga 8400 tcgccacccg
cgcgtcaccg gaattgttgt agcggccgtg cgagtcccga cgcatgtaca 8460
tgtcggccag agccagcagg gtgtctccgc gattgtcgac cagctccgac agcccgtcgg
8520 tcaagtgttg ccacagattc ggtgagtaca gcgccataat ggtgcccacg
atggcgtcgc 8580 tataactcag cccgcgcgga tccttcgtgc gcgccggcct
gctgatcctc gggttgtccg 8640 ggtcgaccaa cggatcgacc aggctgtggt
agacctcgac ggctttggcc gggtcggcgc 8700 ccagcgggca gcccgcgttc
ttggcgcagt cggcggcata gttgttgaac gcgtcctgga 8760 agcccttggc
ctggcgcagc tccgcctcga tgggatcggc attggggtcg acggcaccgt 8820
cgagaatcat tgcccgcacc cgctgcggaa attcctcggc atacgcggag ccgatccggg
8880 tgccgtacga gtagcccagg taggtcagct tgtcgtcgcc caacgccgcg
cgaatggcat 8940 ccaggtcctt ggcgacgttg accgtcccga catgggccag
aaagttcttg cccatcttgt 9000 ccacacagcg accgacgaat tgcttggtct
cgttctcgat gtgcgccaca ccctcccggc 9060 tgtagtcaac ctgcggctcg
gcccgcagcc ggtcgttgtc ggcatcggag ttgcaccaga 9120 tcgccggccg
ggacgacgcc accccgcggg ggtcgaaccc aaccaggtcg aacctttcgt 9180
gcacccgctt cggcaatgtc tggaagacgc ccaaggcggc ctcgataccg gattcgccgg
9240 gtccaccggg atttatgacc agcgaaccga tcttgtctcc cgtcgccgga
aagcgaatca 9300 gcgccagcgc cgccacgtca ccatcggggc ggtcgtagtc
gaccggtaca gcgagcttgc 9360 cgcataacgc gccgccgggg atctttactt
gcgggtttga cgaccggcac ggtgtccact 9420 ccaccggctg gcccagcttc
ggctccgcca tacgagcgcg tcccccgacc acgcggatgc 9480 agcccacaag
aaccaacgcc acggcggcga gcgcggccca gatcaacagc atgcgcgcga 9540
tcttgtcgcg gcgagacagc ctcatgccca caatgctgcc agagcagacc cgagatcctg
9600 gccagcggcc accgtcggcc gactaaccgg ccgctgccag cagtcctgcc
atcgccgatg 9660 gcgaactcgt cggccatccc ccatacgtcc ggtaacagat
ccgggcaaga caccgacccg 9720 tcgaccggat ccggcacggg cgcgtcggcc
tcggcggtgc acaactgcga catcaggttg 9780 gcgctggcac cccgtccacg
ccggcatggt gcaccttggc catcgcccga gggcgatccc 9840 cgatgccgtc
caccccttcg acgaacccat ctcccacggc ggtcgccggc agcgacgcga 9900
tgtggccgca gatctccgag agttcggccc gcccgcccgg cgacggcaac ccgatgccgt
9960 gcaagtgacg atcgatgtga ggttcaaggt tcagcgcact gctggcaagc
tttttccgaa 10020 accgcggcct cgccttgatc tggagtcaga acgcgtcacg
cagccggtca aaggcgtaac 10080 ccatgctcga gcaaacatgc atgggctgag
tggacgtttc cagacacagc aactggcgtc 10140 caggccactg agccgctgca
tgcgcgatgg tatgccgatg ggggccccgg gcgcgtctga 10200 ggggaagaag
tggcagactg tcagggtccg acgaacccgg ggaccctaac gggccacgag 10260
gatcgacccg accaccatta gggacagtga tgtctgagca gactatctat ggggccaata
10320 cccccggagg ctccgggccg cggaccaaga tccgcaccca ccacctacag
agatggaagg 10380 ccgacggcca caagtgggcc atgctgacgg cctacgacta
ttcgacggcc cggatcttcg 10440 acgaggccgg catcccggtg ctgctggtcg
gtgattcggc ggccaacgtc gtgtacggct 10500 acgacaccac cgtgccgatc
tccatcgacg agctgatccc gctggtccgt ggcgtggtgc 10560 ggggtgcccc
gcacgcactg gtcgtcgccg acctgccgtt cggcagctac gaggcggggc 10620
ccaccgccgc gttggccgcc gccacccggt tcctcaagga cggcggcgca catgcggtca
10680 agctcgaggg cggtgagcgg gtggccgagc aaatcgcctg tctgaccgcg
gcgggcatcc 10740 cggtgatggc acacatcggc ttcaccccgc aaagcgtcaa
caccttgggc ggcttccggg 10800 tgcagggccg cggcgacgcc gccgaacaaa
ccatcgccga cgcgatcgcc gtcgccgaag 10860 ccggagcgtt tgccgtcgtg
atggagatgg tgcccgccga gttggccacc cagatcaccg 10920 gcaagcttac
cattccgacg gtcgggatcg gcgctgggcc caactgcgac ggccaggtcc 10980
tggtatggca ggacatggcc gggttcagcg gcgccaagac cgcccgcttc gtcaaacggt
11040 atgccgatgt cggtggtgaa ctacgccgtg ctgcaatgca atacgcccaa
gaggtggccg 11100 gcggggtatt ccccgctgac gaacacagtt tctgaccaag
ccgaatcagc ccgatgcgcg 11160 ggcattgcgg tggcgccctg gatgccgtcg
acgccggatt gccggcgcgg acgcgccagc 11220 gggacccatc ggcgtcgcgt
tcgccggttg agcccggggt gagcccagac attcgatgtg 11280 cccaacacca
tccgccacag cccaattgat gtggcactct atgcatgcct atccccgacc 11340
aaccaccacc gcggcgacgc atcatgaccg gaggcgaaga tgccagtaga ggcgcccaga
11400 ccagcgcgcc atctggaggt cgagcgcaag ttcgacgtga tcgagtcgac
ggtgtcgccg 11460 tcgttcgagg gcatcgccgc ggtggttcgc gtcgagcagt
cgccgaccca gcagctcgac 11520 gcggtgtact tcgacacacc gtcgcacgac
ctggcgcgca accagatcac cttgcggcgc 11580 cgcaccggcg gcgccgacgc
cggctggcat ctgaagctgc cggccggacc cgacaagcgc 11640 accgagatgc
gagcaccgct gtccgcatca ggcgacgctg tgccggccga gttgttggat 11700
gtggtgctgg cgatcgtccg cgaccagccg gttcagccgg tcgcgcggat cagcactcac
11760 cgcgaaagcc agatcctgta cggcgccggg ggcgacgcgc tggcggaatt
ctgcaacgac 11820 gacgtcaccg catggtcggc cggggcattc cacgccgctg
gtgcagcgga caacggccct 11880 gccgaacagc agtggcgcga atgggaactg
gaactggtca ccacggatgg gaccgccgat 11940 accaagctac tggaccggct
agccaaccgg ctgctcgatg ccggtgccgc acctgccggc 12000 cacggctcca
aactggcgcg ggtgctcggt gcgacctctc ccggtgagct gcccaacggc 12060
ccgcagccgc cggcggatcc agtacaccgc gcggtgtccg agcaagtcga gcagctgctg
12120 ctgtgggatc gggccgtgcg ggccgacgcc tatgacgccg tgcaccagat
gcgagtgacg 12180 acccgcaaga tccgcagctt gctgacggat tcccaggagt
cgtttggcct gaaggaaagt 12240 gcgtgggtca tcgatgaact gcgtgagctg
gccgatgtcc tgggcgtagc ccgggacgcc 12300 gaggtactcg gtgaccgcta
ccagcgcgaa ctggacgcgc tggcgccgga gctggtacgc 12360 ggccgggtgc
gcgagcgcct ggtagacggg gcgcggcggc gataccagac cgggctgcgg 12420
cgatcactga tcgcattgcg gtcgcagcgg tacttccgtc tgctcgacgc tctagacgcg
12480 cttgtgtccg aacgcgccca tgccacttct ggggaggaat cggcaccggt
aaccatcgat 12540 gcggcctacc ggcgagtccg caaagccgca aaagccgcaa
agaccgccgg cgaccaggcg 12600 ggcgaccacc accgcgacga ggcattgcac
ctgatccgca agcgcgcgaa gcgattacgc 12660 tacaccgcgg cggctactgg
ggcggacaat gtgtcacaag aagccaaggt catccagacg 12720 ttgctaggcg
atcatcaaga cagcgtggtc agccgggaac atctgatcca gcaggccata 12780
gccgcgaaca ccgccggcga ggacaccttc acctacggtc tgctctacca acaggaagcc
12840 gacttggccg agcgctgccg ggagcagctt gaagccgcgc tgcgcaaact
cgacaaggcg 12900 gtccgcaaag cacgggattg agcccgccag gggcggacga
gttggcctgt aagccggatt 12960 ctgttccgcg ccgccacagc caagctaacg
gcggcacggc ggcgaccatc catctggaca 13020 caccgttacc gggtgcctcg
agcggcctac ccgcaggctc gggcgagcaa ccctcaagcg 13080 cctgcgcggc
cgcactttcg gtgcggcctt cttggccttg cttcgggtgg ggtttgccta 13140
gccaccccgg tcacccggaa tgctggtgcg ctcttaccgc accgtttcac ccttgccacc
13200 acgaggatgg cggtctgttt tctgtggcac tttcccgcga gtcacctcgg
attgccgtta 13260 gcaatcaccc tgctctgtga agtccggact ttcctcgact
cgacgctgaa cctcgtgaat 13320 ccacacaagc cctacgcgag ccgcggccgc
ccagccaact catccgcgac gaccacgcta 13380 ccccgctggg cggtgtcgcg
gccagtgtga ccgctggacg acacggctag tcggacagcc 13440 gatccggcgg
gcagtcctta tcgtggactg gtgacacggt gggacaaacg cgtcgactcc 13500
ggcgactggg acgccatcgc tgccgaggtc agcgagtacg gtggcgcact gctacctcgg
13560 ctgatcaccc ccggcgaggc cgcccggctg cgcaagctgt acgccgacga
cggcctgttt 13620 cgctcgacgg tcgatatggc atccaagcgg tacggcgccg
ggcagtatcg atatttccat 13680 gccccctatc ccgagtgatc gagcgtctca
agcaggcgct gtatcccaaa ctgctgccga 13740 tagcgcgcaa ctggtgggcc
aaactgggcc gggaggcgcc ctggccagac agccttgatg 13800 actggttggc
gagctgtcat gccgccggcc aaacccgatc cacagcgctg atgttgaagt 13860
acggcaccaa cgactggaac gccctacacc aggatctcta cggcgagttg gtgtttccgc
13920 tgcaggtggt gatcaacctg agcgatccgg aaaccgacta caccggcggc
gagttcctgc 13980 ttgtcgaaca gcggcctcgc gcccaatccc ggggtaccgc
aatgcaactt ccgcagggac 14040 atggttatgt gttcacgacc cgtgatcggc
cggtgcggac tagccgtggc tggtcggcat 14100 ctccagtgcg ccatgggctt
tcgactattc gttccggcga acgctatgcc atggggctga 14160 tctttcacga
cgcagcctga ttgcacgcca tctatagata gcctgtctga ttcaccaatc 14220
gcaccgacga tgccccatcg gcgtagaact cggcgatgct cagcgatgcc agatcaagat
14280 gcaaccgata taggacgccc gacccggcat ccaacgccag ccgcaacaac
attttgatcg 14340 gcgtgacatg tgacaccacc agcaccgtcg cgccttcgta
gccaacgatg atccgatcac 14400 gtccccgccg aacccgccgc agcacgtcgt
cgaagctttc cccacccggg ggcgtgatgc 14460 tggtgtcctg cagccagcga
cggtgcagct cgggatcgcg ttctgcggcc tccgcgaacg 14520 tcagcccctc
ccaggcgccg aagtcggtct cgaccaggtc gtcatcgacg accacgtcca 14580
gggccagggc tctggcggcg gtcaccgcgg tgtcgtaagc ccgctgtagc ggcgaggaga
14640 ccaccgcagc gatcccgccg cgccgcgcca gatacccggc cgccgcacca
acctggcgcc 14700 accccacctc gttcaacccc gggttgccgc gccccgaata
gcggcgttgc tccgacagct 14760 ccgtctgccc gtggcgcaac aaaagtagtc
gggtgggtgt accgcgggcg ccggtccagc 14820 cgggagatgt cggtgactcg
gtcgcaacga ttttggcagg atccgcatcc gccgcagccg 14880 attgcgcggc
ggcgtccatc gcgtcattgg ccaaccggtc tgcatacgtg ttccgggcac 14940
gcggaaccca ctcgtagttg atcctgcgaa actgggacgc caacgcctga gcctggacat
15000 agagcttcag cagatccggg tgcttgacct tccaccgccc ggacatctgc
tccaccacca 15060 gcttggagtc catcagcacc gcggcctcgg tggcacctag
tttcacggcg tcgtccaaac 15120 cggctatcag gccgcggtat
tcggcgacgt tgttcgtcgc ccggccgatc gcctgcttgg 15180 actcggccag
cacggtggag tgatcggcgg tccacaccac cgcgccgtat ccggccggtc 15240
cgggattgcc ccgcgatccg ccgtcggctt cgatgacaac tttcactcct caaatccttc
15300 gagccgcaac aagatcgctc cgcattccgg gcagcgcacc acttcatcct
cggcggccgc 15360 cgagatctgg gccagctcgc cgcggccgat ctcgatccgg
caggcaccac atcgatgacc 15420 ttgcaaccgc ccggcccctg gcccgcctcc
ggcccgctgt ctttcgtaga gccccgcaag 15480 ctcgggatca agtgtcgccg
tcagcatgtc gcgttgcgat gaatgttggt gccgggcttg 15540 gtcgatttcg
gcaagtgcct cgtccaaagc ctgctgggcg gcggccaggt cggcccgcaa 15600
cgcttggagc gcccgcgact cggcggtctg ttgagcctgc agctcctcgc ggcgttccag
15660 cacctccagc agggcatctt ccaaactggc ttgacggcgt tgcaagctgt
cgagctcgtg 15720 ctgcagatca gccaattgct tggcgtccgt tgcacccgaa
gtgagcaacg accggtcccg 15780 gtcgccacgc ttacgcaccg catcgatctc
cgactcaaaa cgcgacacct ggccgtccaa 15840 gtcctccgcc gcgattcgca
gggccgccat cctgtcgttg gcggcgttgt gctcggcctg 15900 cacctgctgg
taagccgccc gctgcggcag atgggtagcc cgatgcgcga tccgggtcag 15960
ctcagcatcc agcttcgcca attccagtag cgaccgttgc tgtgccactc cggctttcat
16020 gcctgatctc tcccagtttc gtgatcgagg ttccacgggt cggtgcagat
ggtgcacaca 16080 cgcaccggca gcgacgcgcc gaaatgagac cgcaacactt
cggcggcctg gccgcaccac 16140 gggaattcgc ttgcccaatg cgcgacgtcg
atcagggcca cttgcgaagc tcggcaatgc 16200 tcgtcggctg gatgatgtcg
cagatcggcc gtaacgtacg cttgcacgtc cgcggcggcc 16260 acggtggcaa
gcaacgagtc cccggcgccg ccgcagaccg cgacccgcga caccagcagg 16320
tcgggatccc cggcggcgcg cacaccggtc gcagtcggcg gcaacgcggc ctccagacgg
16380 gcaacaaagg tgcgcagcgg ttcgggtttt ggcagtctgc caatccggcc
taacccgctg 16440 ccgaccggcg gtggtaccag cgcgaagatg tcgaatgccg
gctcctcgta agggtgcgcg 16500 gcgcgcatcg ccgccaacac ctcggcgcgc
gctcgtgcgg gtgcgacgac ctcgacccgg 16560 tcctcggcca cccgttcgac
ggtaccgacg ctgcctatgg cgggcgacgc cccgtcgtgc 16620 gccaggaact
gcccggtacc cgcgacactc cagctgcagt gcgagtagtc gccgatatgg 16680
ccggcaccgg cctcaaagac cgctgcccgc accgcctctg agttctcgcg cggcacatag
16740 atgacccact tgtcgagatc ggccgctccg ggcaccgggt cgagaacggc
gtcgacggtc 16800 agaccaacag cgtgtgccag cgcgtcggac acacccggcg
acgccgagtc ggcgttggtg 16860 tgcgcggtaa acaacgagcg accggtccgg
atcaggcggt gcaccagcac accctttggc 16920 gtgttggccg cgaccgtatc
gaccccacgc agtaacaacg ggtggtgcac caatagcagt 16980 ccggcctggg
gaacctggtc caccaccgcc ggcgtcgcgt ccaccgcaac ggtcaccgaa 17040
tccaccacgt cgtcggggtc gccgcacacc agacccaccg aatcccacga ctgggcaagc
17100 cgcggcgggt aggcctggtc cagcacgtcg atgacatcgg ccagccgcac
actcatcggc 17160 gtcctccacg ctttgcccac tcggcgatcg ccgccaccag
cacgggccac tccgggcgca 17220 ccgccgcccg caggtaccgc gcgtccaggc
cgacgaaggt gtcaccgcgg cgcaccgcaa 17280 ttcctttgct ctgcaaatag
tttcgtaatc cgtcagcatc ggcgatgttg aacagtacga 17340 aaggggccgc
accatcgacc acctcggcac ccaccgatct cagtccggcc accatctccg 17400
cgcgcagcgc cgtcaaccgc accgcatcgg ctgcggcagc ggcgaccgcc cggggggcgc
17460 agcaagcagc gatggccgtc agttgcaatg ttcccaacgg ccagtgcgct
cgctgcacgg 17520 tcaaccgagc cagcacgtct ggcgagccga gcgcgtagcc
cacccgcaat ccggccagcg 17580 accacgtttt cgtcaagcta cggagcacca
gcacatcggg cagcgagtca tcggccaacg 17640 attgcggctc gccgggaacc
caatcagcga acgcctcgtc gaccaccagg atgcgtcccg 17700 gccggcgtaa
ctcgagcagc tgctcgcgga ggtgcagcac cgaggtgggg ttggtcggat 17760
tacccacgac gacaaggtcg gcgtcgtcag gcacgtgcgc ggtgtccagc acgaacggcg
17820 gctttaggac aacatggtgc gccgtgattc cggcagcgct caaggctatg
gccggctcgg 17880 tgaacgcggg cacgacgatt gctgcccgca ccggacttag
gttgtgcagc aatgcgaatc 17940 cctccgccgc cccgacgagc gggagcactt
cgtcacgggt tctgccatga cgttcagcga 18000 ccgcgtcttg cgcccggtgc
acatcgtcgg tgctcggata gcgggccagc tccggcagca 18060 gcgcggcgag
ctgccggacc aaccattccg ggggccggtc atggcggacg ttgacggcga 18120
agtccagcac gccgggcgcg acatcctgat caccgtggta gcgcgccgcg gcaagcgggc
18180 tagtgtctag actcgccaca gcgtcaaaca gtagtgggcc ggtgtgcggg
ccaagaatcc 18240 agagcaccgc cgacgcgttg tctacgcggc gacaaccgcg
acatcacagg cagctaacag 18300 ggcgtcggcg gtgatgatcg tcaggccaag
cagctgtgcc tgggcgatga gcacacggtc 18360 gaatggatgt cgatggtgat
ccggaagctc tgcggtgcgc agtgtgtgcg tggtcaactg 18420 acagcggcga
cgtgccgcag cggcgcattc gatcgggcac gtaagaagcc gatggctcgg 18480
gcggcgggag cttgccgagg cggtagttga tcgcgatctc ccaggcactg gcggccgaca
18540 agagaatgct gttgcggacg tcctgaacaa tcgcccgtgt ttcgttgacg
gcatccgcag 18600 ccaaacgtgg gtgtcgatga ggtagcgctt caccggtgaa
agcgttcgag cacgtcgtct 18660 gacaacggag cgtccaaatc gtcgggcacg
cggtacacgc catggtcaat gcctaaccgc 18720 cgagtctcat gaggatgcag
cggcacaagc tttgctaccg gctcgccgcg gcgggcaatc 18780 tcaacctctg
cccgccgtag acgagccgca gcagctcgga caggcgtgtc ttcgcctcgt 18840
gaacgccgac ccgcttcgca ggcgcccaga ctttcgcgtc gaccacctgc tcaccaaact
18900 tcgcgatcat cgcctgatac cacagcgcca acgggtagcg gtttgtccaa
ccgcttcgtc 18960 aacgacaatg ggatcgtgac cgacacgacc gcgagcggga
ccaattgccc gcctcctcca 19020 cgcgccgccg cacggcgcgc atcgtcgccg
ggtgaatcgc cgcagctggt gatcttcgat 19080 ctggacggca cgctgaccga
ctcggcgcgc ggaatcgtat ccagcttccg acacgcgctc 19140 aaccacatcg
gtgccccagt acccgaaggc gacctggcca ctcacatcgt cggcccgccc 19200
atgcatgaga cgctgcgcgc catggggctc ggcgaatccg ccgaggaggc gatcgtagcc
19260 taccgggccg actacagcgc ccgcggttgg gcgatgaaca gcttgttcga
cgggatcggg 19320 ccgctgctgg ccgacctgcg caccgccggt gtccggctgg
ccgtcgccac ctccaaggca 19380 gagccgaccg cacggcgaat cctgcgccac
ttcggaattg agcagcactt cgaggtcatc 19440 gcgggcgcga gcaccgatgg
ctcgcgaggc agcaaggtcg acgtgctggc ccacgcgctc 19500 gcgcagctgc
ggccgctacc cgagcggttg gtgatggtcg gcgaccgcag ccacgacgtc 19560
gacggggcgg ccgcgcacgg catcgacacg gtggtggtcg gctggggcta cgggcgcgcc
19620 gactttatcg acaagacctc caccaccgtc gtgacgcatg ccgccacgat
tgacgagctg 19680 agggaggcgc taggtgtctg atccgctgca cgtcacattc
gtttgtacgg gcaacatctg 19740 ccggtcgcca atggccgaga agatgttcgc
ccaacagctt cgccaccgtg gcctgggtga 19800 cgcggtgcga gtgaccagtg
cgggcaccgg gaactggcat gtaggcagtt gcgccgacga 19860 gcgggcggcc
ggggtgttgc gagcccacgg ctaccctacc gaccaccggg ccgcacaagt 19920
cggcaccgaa cacctggcgg cagacctgtt ggtggccttg gaccgcaacc acgctcggct
19980 gttgcggcag ctcggcgtcg aagccgcccg ggtacggatg ctgcggtcat
tcgacccacg 20040 ctcgggaacc catgcgctcg atgtcgagga tccctactat
ggcgatcact ccgacttcga 20100 ggaggtcttc gccgtcatcg aatccgccct
gcccggcctg cacgactggg tcgacgaacg 20160 tctcgcgcgg aacggaccga
gttgatgccc cgcctagcgt tcctgctgcg gcccggctgg 20220 ctggcgttgg
ccctggtcgt ggtcgcgttc acctacctgt gctttacggt gctcgcgccg 20280
tggcagctgg gcaagaatgc caaaacgtca cgagagaacc agcagatcag gtattccctc
20340 gacaccccgc cggttccgct gaaaaccctt ctaccacagc aggattcgtc
ggcgccggac 20400 gcgcagtggc gccgggtgac ggcaaccgga cagtaccttc
cggacgtgca ggtgctggcc 20460 cgactgcgcg tggtggaggg ggaccaggcg
tttgaggtgt tggccccatt cgtggtcgac 20520 ggcggaccaa ccgtcctggt
cgaccgtgga tacgtgcggc cccaggtggg ctcgcacgta 20580 ccaccgatcc
cccgcctgcc ggtgcagacg gtgaccatca ccgcgcggct gcgtgactcc 20640
gaaccgagcg tggcgggcaa agacccattc gtcagagacg gcttccagca ggtgtattcg
20700 atcaataccg gacaggtcgc cgcgctgacc ggagtccagc tggctgggtc
ctatctgcag 20760 ttgatcgaag accaacccgg cgggctcggc gtgctcggcg
ttccgcatct agatcccggg 20820 ccgttcctgt cctatggcat ccaatggatc
tcgttcggca ttctggcacc gatcggcttg 20880 ggctatttcg cctacgccga
gatccgggcg cgccgccggg aaaaagcggg gtcgccacca 20940 ccggacaagc
caatgacggt cgagcagaaa ctcgctgacc gctacggccg ccggcggtaa 21000
accaacatca cggccaatac cgcagccccc gcctggacca cccgcgacag caccacggcg
21060 cggcgcagat cggccacctt gggcgaccgg ccgtcgccca aggtgggccg
gatctgcaac 21120 tcatggtggt accgggtggg cccacccagc cgcacgtcaa
gcgccccagc aaacgccgcc 21180 tcgacgacac cggcgttggg gctgggatgg
cgggcggcgt cgcgccgcca ggcccgtacc 21240 gcaccgcggg gcgacccacc
gaccaccggc gcgcagatca ccaccagcac cgccgtcgcc 21300 cgtgcgccaa
catagttggc ccagtcatcc aatcgtgctg cagcccaacc gaatcggaga 21360
taacgcggcg agcggtagcc gatcatcgag tccagggtgt tgatggcacg atatcccagc
21420 accgcaggca cgccgctcga agccgcccac agcagcggca ccacctgggc
gtcggcggtg 21480 ttttcggcca ccgactccag cgcggcacgc gtcaggcccg
ggccgcccag ctgggccggg 21540 tcacgcccgc acagcgacgg cagcagccgt
cgcgccgcct cgacatcgtc gcgctccaac 21600 aggtccgata tctggcggcc
ggtgcgcgcc agcgaagttc cgcccagcgc tgcccaggtg 21660 gccgtcgcgg
tggccgccac gggccaggac ctgccgggta gccgctgcag tgccgcgccg 21720
agcaagccca ccgcgccgac cagcaggccg acgtgtaccg caccggcgac ccggccgtca
21780 cggtaggtga tctgctccag cttggcggcc gcccgaccga acagggccac
cggatgacct 21840 cgtttggggt cgccgaacac gacgtcgagc aggcagccga
tcagcacgcc gacggccctg 21900 gtctgccagg tcgatgcaaa cactccggca
gcgtcgcaca cgtggtctac gctcagctat 21960 ttatgacctc atacggcagc
tatccacgat gaagcggcca gctacccggg ttgccgacct 22020 gttgaacccg
gcggcaatgt tgttgccggc agcgaatgtc atcatgcagc tggcagtgcc 22080
gggtgtcggg tatggcgtgc tggaaagccc ggtggacagc ggcaacgtct acaagcatcc
22140 gttcaagcgg gcccggacca ccggcaccta cctggcggtg gcgaccatcg
ggacggaatc 22200 cgaccgagcg ctgatccggg gtgccgtgga cgtcgcgcac
cggcaggttc ggtcgacggc 22260 ctcgagccca gtgtcctata acgccttcga
cccgaagttg cagctgtggg tggcggcgtg 22320 tctgtaccgc tacttcgtgg
accagcacga gtttctgtac ggcccactcg aagatgccac 22380 cgccgacgcc
gtctaccaag acgccaaacg gttagggacc acgctgcagg tgccggaggg 22440
gatgtggccg ccggaccggg tcgcgttcga cgagtactgg aagcgctcgc ttgatgggct
22500 gcagatcgac gcgccggtgc gcgagcatct tcgcggggtg gcctcggtag
cgtttctccc 22560 gtggccgttg cgcgcggtgg ccgggccgtt caacctgttt
gcgacgacgg gattcttggc 22620 accggagttc cgcgcgatga tgcagctgga
gtggtcacag gcccagcagc gtcgcttcga 22680 gtggttactt tccgtgctac
ggttagccga ccggctgatt ccgcatcggg cctggatctt 22740 cgtttaccag
ctttacttgt gggacatgcg gtttcgcgcc cgacacggcc gccgaatcgt 22800
ctgatagagc ccggccgagt gtgagcctga cagcccgaca ccggcggcgt gtgtcgcgtc
22860 gccaggttca cgctcggcga tctagagccg ccgaaaacct acttctgggt
tgcctcccga 22920 atcaacgtgc tgatctgctc gagcagctca cgcatatcgg
cgcgcatcgc atccaccgcg 22980 gcatacaggt cggccttggt cgccggcagc
tggtccgacg tcattggccg caccggcggt 23040 gctgtctgtc gcgccgcgct
gtcgctttga aacccaggtc gctcacccac gaccacgaca 23100 ctgccatatc
cggcgccccg ccgacaacga agcacagcta gccggtgggc gcggacggga 23160
tcgaaccgcc gaccgctggt gtgtaaaacc agagctctac cgctgagcta cgcgcccatg
23220 accgccgcag gctacacgcc ttgcggccaa gcacccaaaa ccttaggccg
taagcgccgc 23280 cagagcgtcg gtccacagcc gctgatcgcg aacttcaccc
ggctgcttca tctcggcgaa 23340 ccgaatgatc cctgaccgat cgaccacaaa
ggtgccccgg ttagcgatgc cggcctgctc 23400 gttgaagacg ccgtaggcct
gactgaccgc gccgtgtggc cagaagtccg acaacagcgg 23460 aaacgtgaat
ccgctctgcg tcgcccagat cttgtgagtg ggtggcgggc ccaccgaaat 23520
cgctagcgcg gcgctgtcgt cgttctcaaa ctcgggcagg tgatcacgca actggtccag
23580 ctcgccctgg cagatgcccg tgaacgccaa cggaaagaac accaacagca
cgttctttgc 23640 accccggtag ccgcgcaggg tgacaagctg ctgattctgg
tcgcgcaacg tgaagtcagg 23700 ggcggtggct ccgacgttca gcatcagcgc
ttgccagccc gcgatttcgg ctgtaccaat 23760 ctgctggcgc tccagttgcc
cagattgacc gacgaggtcg gcatcagccc agctgtgggc 23820 gccgcctcgg
caatctcggc gggcaataca tggccgggct ggccggtctt gggcgtcacc 23880
acccaaatca caccgtcctc ggcgagcggg ccgatcgcat ccatcagggt gtccaccaaa
23940 tcgccgtcgc catcacgcca ccacaacagg acgacatcga tgacctcgtc
ggtgtcttca 24000 tcgagcaact ctcccccgca cgcttcttcg atggccgcgc
ggatgtcgtc gtcggtgtct 24060 tcgtcccagc cccattcctg gataagttgg
tctcgttgga tgcccaattt gcgggcgtag 24120 ttcgaggcgt gatccgccgc
gaccaccgtg gaacctcctt cagtctccgc gggccatgtg 24180 cacaccgtcg
cgatgggcat tatcgtcgca cagccagaac cggtccaccc gcccgcctca 24240
gaaggcggcc acgcacattg tcaatgcctt tgtcttggtg tcgttgagcc gatcaacccg
24300 ccggttgaat tccgctgtcg acgcgtgcgc accgatggca tttgccaccg
cgcgggccgc 24360 gtcgacatat gcgttgagcg catcccccag ttgcgcggac
agcgcggcgc tcagactgcc 24420 tgagaccgtc gaggcactgt tgttgagcgc
gtcgatggcc ggaccttcgg tcggcccggt 24480 gttgcggccc tgattgaacg
cggccacgta ggcgttcacc ttgtcgatgg cgtccttgct 24540 ggtggccgcc
agcgcgtcac acgaggtgcg aatcgccttg gtcgtcagcg attgttggcg 24600
ctgcgactcc cggatgctcg acgtcgccgc cgaagccgac accgacgcgg acaccgacga
24660 gcggtaggcc ggtgcgacgt tggtgtcggg catggccgta ccgtcggtga
cagtggtaca 24720 tccgacgatc cccatcagca gcagcgcgat gcagccgagc
gccagggcgc ctcgcctggg 24780 gagctccccc ccgtgcctgc gaggcacggc
gcgccatccg atgagcacgg catgtgaggt 24840 tacctggtcg cagcgcgacc
gcgctggccg tggtgtgtcg cgcatccgca gaaccgagcg 24900 gagtgcggct
atccgccgcc gacgccggtg cggcacgata gggggacgac catctaaaca 24960
gcacgcaagc ggaagcccgc cacctacagg agtagtgcgt tgaccaccga tttcgcccgc
25020 cacgatctgg cccaaaactc aaacagcgca agcgaacccg accgagttcg
ggtgatccgc 25080 gagggtgtgg cgtcgtattt gcccgacatt gatcccgagg
agacctcgga gtggctggag 25140 tcctttgaca cgctgctgca acgctgcggc
ccgtcgcggg cccgctacct gatgttgcgg 25200 ctgctagagc gggccggcga
gcagcgggtg gccatcccgg cattgacgtc taccgactat 25260 gtcaacacca
tcccgaccga gctggagccg tggttccccg gcgacgaaga cgtcgaacgt 25320
cgttatcgag cgtggatcag atggaatgcg gccatcatgg tgcaccgtgc gcaacgaccg
25380 ggtgtgggcg tgggtggcca tatctcgacc tacgcgtcgt ccgcggcgct
ctatgaggtc 25440 ggtttcaacc acttcttccg cggcaagtcg cacccgggcg
gcggcgatca ggtgttcatc 25500 cagggccacg cttccccggg aatctacgcg
cgcgccttcc tcgaagggcg gttgaccgcc 25560 gagcaactcg acggattccg
ccaggaacac agccatgtcg gcggcgggtt gccgtcctat 25620 ccgcacccgc
ggctcatgcc cgacttctgg gaattcccca ccgtgtcgat gggtttgggc 25680
ccgctcaacg ccatctacca ggcacggttc aaccactatc tgcatgaccg cggtatcaaa
25740 gacacctccg atcaacacgt gtggtgtttt ttgggcgacg gcgagatgga
cgaacccgag 25800 agccgtgggc tggcccacgt cggcgcgctg gaaggcttgg
acaacttgac cttcgtgatc 25860 aactgcaatc tgcagcgact cgacggcccg
gtgcgcggca acggcaagat catccaggag 25920 ctggagtcgt tcttccgcgg
tgccggctgg aacgtcatca aggtggtgtg gggccgcgaa 25980 tgggatgccc
tgctgcacgc cgaccgcgac ggtgcgctgg tgaatttaat gaatacaaca 26040
cccgatggcg attaccagac ctataaggcc aacgacggcg gctacgtgcg tgaccacttc
26100 ttcggccgcg acccacgcac caaggcgctg gtggagaaca tgagcgacca
ggatatctgg 26160 aacctcaaac ggggcggcca cgattaccgc aaggtttacg
ccgcctaccg cgccgccgtc 26220 gaccacaagg gacagccgac ggtgatcctg
gccaagacca tcaaaggcta cgcgctgggc 26280 aagcatttcg aaggacgcaa
tgccacccac cagatgaaaa aactgaccct ggaagacctt 26340 aaggagtttc
gtgacacgca gcggattccg gtcagcgacg cccagcttga agagaatccg 26400
tacctgccgc cctactacca ccccggcctc aacgccccgg agattcgtta catgctcgac
26460 cggcgccggg ccctcggggg ctttgttccc gagcgcagga ccaagtccaa
agcgctgacc 26520 ctgccgggtc gcgacatcta cgcgccgctg aaaaagggct
ctgggcacca ggaggtggcc 26580 accaccatgg cgacggtgcg cacgttcaaa
gaagtgttgc gcgacaagca gatcgggccg 26640 cggatagtcc cgatcattcc
cgacgaggcc cgcaccttcg ggatggactc ctggttcccg 26700 tcgctaaaga
tctataaccg caatggccag ctgtataccg cggttgacgc cgacctgatg 26760
ctggcctaca aggagagcga agtcgggcag atcctgcacg agggcatcaa cgaagccggg
26820 tcggtgggct cgttcatcgc ggccggcacc tcgtatgcga cgcacaacga
accgatgatc 26880 cccatttaca tcttctactc gatgttcggc ttccagcgca
ccggcgatag cttctgggcc 26940 gcggccgacc agatggctcg agggttcgtg
ctcggggcca ccgccgggcg caccaccctg 27000 accggtgagg gcctgcaaca
cgccgacggt cactcgttgc tgctggccgc caccaacccg 27060 gcggtggttg
cctacgaccc ggccttcgcc tacgaaatcg cctacatcgt ggaaagcgga 27120
ctggccagga tgtgcgggga gaacccggag aacatcttct tctacatcac cgtctacaac
27180 gagccgtacg tgcagccgcc ggagccggag aacttcgatc ccgagggcgt
gctgcggggt 27240 atctaccgct atcacgcggc caccgagcaa cgcaccaaca
aggcgcagat cctggcctcc 27300 ggggtagcga tgcccgcggc gctgcgggca
gcacagatgc tggccgccga gtgggatgtc 27360 gccgccgacg tgtggtcggt
gaccagttgg ggcgagctaa accgcgacgg ggtggccatc 27420 gagaccgaga
agctccgcca ccccgatcgg ccggcgggcg tgccctacgt gacgagagcg 27480
ctggagaatg ctcggggccc ggtgatcgcg gtgtcggact ggatgcgcgc ggtccccgag
27540 cagatccgac cgtgggtgcc gggcacatac ctcacgttgg gcaccgacgg
gttcggcttt 27600 tccgacactc ggcccgccgc tcgccgctac ttcaacaccg
acgccgaatc ccaggtggtc 27660 gcggttttgg aggcgttggc gggcgacggc
gagatcgacc catcggtgcc ggtcgcggcc 27720 gcccgccagt accggatcga
cgacgtggcg gctgcgcccg agcagaccac ggatcccggt 27780 cccggggcct
aacgccggcg agccgaccgc ctttggccga atcttccaga aatctggcgt 27840
agcttttagg agtgaacgac aatcagttgg ctccagttgc ccgcccgagg tcgccgctcg
27900 aactgctgga cactgtgccc gattcgctgc tgcggcggtt gaagcagtac
tcgggccggc 27960 tggccaccga ggcagtttcg gccatgcaag aacggttgcc
gttcttcgcc gacctagaag 28020 cgtcccagcg cgccagcgtg gcgctggtgg
tgcagacggc cgtggtcaac ttcgtcgaat 28080 ggatgcacga cccgcacagt
gacgtcggct ataccgcgca ggcattcgag ctggtgcccc 28140 aggatctgac
gcgacggatc gcgctgcgcc agaccgtgga catggtgcgg gtcaccatgg 28200
agttcttcga agaagtcgtg cccctgctcg cccgttccga agagcagttg accgccctca
28260 cggtgggcat tttgaaatac agccgcgacc tggcattcac cgccgccacg
gcctacgccg 28320 atgcggccga ggcacgaggc acctgggaca gccggatgga
ggccagcgtg gtggacgcgg 28380 tggtacgcgg cgacaccggt cccgagctgc
tgtcccgggc ggccgcgctg aattgggaca 28440 ccaccgcgcc ggcgaccgta
ctggtgggaa ctccggcgcc cggtccaaat ggctccaaca 28500 gcgacggcga
cagcgagcgg gccagccagg atgtccgcga caccgcggct cgccacggcc 28560
gcgctgcgct gaccgacgtg cacggcacct ggctggtggc gatcgtctcc ggccagctgt
28620 cgccaaccga gaagttcctc aaagacctgc tggcagcatt cgccgacgcc
ccggtggtca 28680 tcggccccac ggcgcccatg ctgaccgcgg cgcaccgcag
cgctagcgag gcgatctccg 28740 ggatgaacgc cgtcgccggc tggcgcggag
cgccgcggcc cgtgctggct agggaacttt 28800 tgcccgaacg cgccctgatg
ggcgacgcct cggcgatcgt ggccctgcat accgacgtga 28860 tgcggcccct
agccgatgcc ggaccgacgc tcatcgagac gctagacgca tatctggatt 28920
gtggcggcgc gattgaagct tgtgccagaa agttgttcgt tcatccaaac acagtgcggt
28980 accggctcaa gcggatcacc gacttcaccg ggcgcgatcc cacccagcca
cgcgatgcct 29040 atgtccttcg ggtggcggcc accgtgggtc aactcaacta
tccgacgccg cactgaagca 29100 tcgacagcaa tgccgtgtca tagattccct
cgccggtcag agggggtcca gcaggggccc 29160 cggaaagata ccaggggcgc
cgtcggacgg aaagtgatcc agacaacagg tcgcgggacg 29220 atctcaaaaa
catagcttac aggcccgttt tgttggttat atacaaaaac ctaagacgag 29280
gttcataatc tgttacaccg cgcaaaaccg tcttcacagt gttctcttag acacgtgatt
29340 gcgttgctcg cacccggaca gggttcgcaa accgagggaa tgttgtcgcc
gtggcttcag 29400 ctgcccggcg cagcggacca gatcgcggcg tggtcgaaag
ccgctgatct agatcttgcc 29460 cggctgggca ccaccgcctc gaccgaggag
atcaccgaca ccgcggtcgc ccagccattg 29520 atcgtcgccg cgactctgct
ggcccaccag gaactggcgc gccgatgcgt gctcgccggc 29580 aaggacgtca
tcgtggccgg ccactccgtc ggcgaaatcg cggcctacgc aatcgccggt 29640
gtgatagccg ccgacgacgc cgtcgcgctg gccgccaccc gcggcgccga gatggccaag
29700 gcctgcgcca ccgagccgac cggcatgtct gcggtgctcg gcggcgacga
gaccgaggtg 29760 ctgagtcgcc tcgagcagct cgacttggtc ccggcaaacc
gcaacgccgc cggccagatc 29820 gtcgctgccg gccggctgac cgcgttggag
aagctcgccg aagacccgcc ggccaaggcg 29880 cgggtgcgtg cactgggtgt
cgccggagcg ttccacaccg agttcatggc gcccgcactt 29940 gacggctttg
cggcggccgc ggccaacatc gcaaccgccg accccaccgc cacgctgctg 30000
tccaaccgcg acgggaagcc ggtgacatcc gcggccgcgg cgatggacac cctggtctcc
30060 cagctcaccc aaccggtgcg atgggacctg tgcaccgcga cgctgcgcga
acacacagtc 30120 acggcgatcg tggagttccc ccccgcgggc acgcttagcg
gtatcgccaa acgcgaactt 30180 cggggggttc cggcacgcgc
cgtcaagtca cccgcagacc tggacgagct ggcaaaccta 30240 taaccgcgga
ctcggccaga acaaccacat acccgtcagt tcgatttgta cacaacatat 30300
tacgaaggga agcatgctgt gcctgtcact caggaagaaa tcattgccgg tatcgccgag
30360 atcatcgaag aggtaaccgg tatcgagccg tccgagatca ccccggagaa
gtcgttcgtc 30420 gacgacctgg acatcgactc gctgtcgatg gtcgagatcg
ccgtgcagac cgaggacaag 30480 tacggcgtca agatccccga cgaggacctc
gccggtctgc gtaccgtcgg tgacgttgtc 30540 gcctacatcc agaagctcga
ggaagaaaac ccggaggcgg ctcaggcgtt gcgcgcgaag 30600 attgagtcgg
agaaccccga tgccgttgcc aacgttcagg cgaggcttga ggccgagtcc 30660
aagtgagtca gccttccacc gctaatggcg gtttccccag cgttgtggtg accgccgtca
30720 cagcgacgac gtcgatctcg ccggacatcg agagcacgtg gaagggtctg
ttggccggcg 30780 agagcggcat ccacgcactc gaagacgagt tcgtcaccaa
gtgggatcta gcggtcaaga 30840 tcggcggtca cctcaaggat ccggtcgaca
gccacatggg ccgactcgac atgcgacgca 30900 tgtcgtacgt ccagcggatg
ggcaagttgc tgggcggaca gctatgggag tccgccggca 30960 gcccggaggt
cgatccagac cggttcgccg ttgttgtcgg caccggtcta ggtggagccg 31020
agaggattgt cgagagctac gacctgatga atgcgggcgg cccccggaag gtgtccccgc
31080 tggccgttca gatgatcatg cccaacggtg ccgcggcggt gatcggtctg
cagcttgggg 31140 cccgcgccgg ggtgatgacc ccggtgtcgg cctgttcgtc
gggctcggaa gcgatcgccc 31200 acgcgtggcg tcagatcgtg atgggcgacg
ccgacgtcgc cgtctgcggc ggtgtcgaag 31260 gacccatcga ggcgctgccc
atcgcggcgt tctccatgat gcgggccatg tcgacccgca 31320 acgacgagcc
tgagcgggcc tcccggccgt tcgacaagga ccgcgacggc tttgtgttcg 31380
gcgaggccgg tgcgctgatg ctcatcgaga cggaggagca cgccaaagcc cgtggcgcca
31440 agccgttggc ccgattgctg ggtgccggta tcacctcgga cgcctttcat
atggtggcgc 31500 ccgcggccga tggtgttcgt gccggtaggg cgatgactcg
ctcgctggag ctggccgggt 31560 tgtcgccggc ggacatcgac cacgtcaacg
cgcacggcac ggcgacgcct atcggcgacg 31620 ccgcggaggc caacgccatc
cgcgtcgccg gttgtgatca ggccgcggtg tacgcgccga 31680 agtctgcgct
gggccactcg atcggcgcgg tcggtgcgct cgagtcggtg ctcacggtgc 31740
tgacgctgcg cgacggcgtc atcccgccga ccctgaacta cgagacaccc gatcccgaga
31800 tcgaccttga cgtcgtcgcc ggcgaaccgc gctatggcga ttaccgctac
gcagtcaaca 31860 actcgttcgg gttcggcggc cacaatgtgg cgcttgcctt
cgggcgttac tgaagcacga 31920 catcgcgggt cgcgaggccc gaggtggggg
tccccccgct tgcgggggcg agtcggaccg 31980 atatggaagg aacgttcgca
agaccaatga cggagctggt taccgggaaa gcctttccct 32040 acgtagtcgt
caccggcatc gccatgacga ccgcgctcgc gaccgacgcg gagactacgt 32100
ggaagttgtt gctggaccgc caaagcggga tccgtacgct cgatgaccca ttcgtcgagg
32160 agttcgacct gccagttcgc atcggcggac atctgcttga ggaattcgac
caccagctga 32220 cgcggatcga actgcgccgg atgggatacc tgcagcggat
gtccaccgtg ctgagccggc 32280 gcctgtggga aaatgccggc tcacccgagg
tggacaccaa tcgattgatg gtgtccatcg 32340 gcaccggcct gggttcggcc
gaggaactgg tcttcagtta cgacgatatg cgcgctcgcg 32400 gaatgaaggc
ggtctcgccg ctgaccgtgc agaagtacat gcccaacggg gccgccgcgg 32460
cggtcgggtt ggaacggcac gccaaggccg gggtgatgac gccggtatcg gcgtgcgcat
32520 ccggcgccga ggccatcgcc cgtgcgtggc agcagattgt gctgggagag
gccgatgccg 32580 ccatctgcgg cggcgtggag accaggatcg aagcggtgcc
catcgccggg ttcgctcaga 32640 tgcgcatcgt gatgtccacc aacaacgacg
accccgccgg tgcatgccgc ccattcgaca 32700 gggaccgcga cggctttgtg
ttcggcgagg gcggcgccct tctgttgatc gagaccgagg 32760 agcacgccaa
ggcacgtggc gccaacatcc tggcccggat catgggcgcc agcatcacct 32820
ccgatggctt ccacatggtg gccccggacc ccaacgggga acgcgccggg catgcgatta
32880 cgcgggcgat tcagctggcg ggcctcgccc ccggcgacat cgaccacgtc
aatgcgcacg 32940 ccaccggcac ccaggtcggc gacctggccg aaggcagggc
catcaacaac gccttgggcg 33000 gcaaccgacc ggcggtgtac gcccccaagt
ctgccctcgg ccactcggtg ggcgcggtcg 33060 gcgcggtcga atcgatcttg
acggtgctcg cgttgcgcga tcaggtgatc ccgccgacac 33120 tgaatctggt
aaacctcgat cccgagatcg atttggacgt ggtggcgggt gaaccgcgac 33180
cgggcaatta ccggtatgcg atcaataact cgttcggatt cggcggccac aacgtggcaa
33240 tcgccttcgg acggtactaa accccagcgt tacgcgacag gagacctgcg
atgacaatca 33300 tggcccccga ggcggttggc gagtcgctcg acccccgcga
tccgctgttg cggctgagca 33360 acttcttcga cgacggcagc gtggaattgc
tgcacgagcg tgaccgctcc ggagtgctgg 33420 ccgcggcggg caccgtcaac
ggtgtgcgca ccatcgcgtt ctgcaccgac ggcaccgtga 33480 tgggcggcgc
catgggcgtc gaggggtgca cgcacatcgt caacgcctac gacactgcca 33540
tcgaagacca gagtcccatc gtgggcatct ggcattcggg tggtgcccgg ctggctgaag
33600 gtgtgcgggc gctgcacgcg gtaggccagg tgttcgaagc catgatccgc
gcgtccggct 33660 acatcccgca gatctcggtg gtcgtcggtt tcgccgccgg
cggcgccgcc tacggaccgg 33720 cgttgaccga cgtcgtcgtc atggcgccgg
aaagccgggt gttcgtcacc gggcccgacg 33780 tggtgcgcag cgtcaccggc
gaggacgtcg acatggcctc gctcggtggg ccggagaccc 33840 accacaagaa
gtccggggtg tgccacatcg tcgccgacga cgaactcgat gcctacgacc 33900
gtgggcgccg gttggtcgga ttgttctgcc agcaggggca tttcgatcgc agcaaggccg
33960 aggccggtga caccgacatc cacgcgctgc tgccggaatc ctcgcgacgt
gcctacgacg 34020 tgcgtccgat cgtgacggcg atcctcgatg cggacacacc
gttcgacgag ttccaggcca 34080 attgggcgcc gtcgatggtg gtcgggctgg
gtcggctgtc gggtcgcacg gtgggtgtac 34140 tggccaacaa cccgctacgc
ctgggcggct gcctgaactc cgaaagcgca gagaaggcag 34200 cgcgtttcgt
gcggctgtgc gacgcgttcg ggattccgct ggtggtggtg gtcgatgtgc 34260
cgggctatct gcccggtgtc gaccaggagt ggggtggcgt ggtgcgccgt ggcgccaagt
34320 tgctgcacgc gttcggcgag tgcaccgttc cgcgggtcac gctggtcacc
cgaaagacct 34380 acggcggggc atacattgcg atgaactccc ggtcgttgaa
cgcgaccaag gtgttcgcct 34440 ggccggacgc cgaggtcgcg gtgatgggcg
ctaaggcggc cgtcggcatc ctgcacaaga 34500 agaagttggc cgccgctccg
gagcacgaac gcgaagcgct gcacgaccag ttggccgccg 34560 agcatgagcg
catcgccggc ggggtcgaca gtgcgctgga catcggtgtg gtcgacgaga 34620
agatcgaccc ggcgcatact cgcagcaagc tcaccgaggc gctggcgcag gctccggcac
34680 ggcgcggccg ccacaagaac atcccgctgt agttctgacc gcgagcagac
gcagaatcgc 34740 acgcgcgagg tccgcgccgt gcgattctgc gtctgctcgc
cagttatccc cagcggtggc 34800 tggtcaacgc gaggcgctcc tcgcatgctc
ggacggtgcc taccgacgcg ctaacaattc 34860 tcgagaaggc cggcgggttc
gccaccaccg cgcaattgct cacggtcatg acccgccaac 34920 agctcgacgt
ccaagtgaaa aacggcggcc tcgttcgcgt ttggtacggg gtctacgcgg 34980
cacaagagcc ggacctgttg ggccgcttgg cggctctcga tgtgttcatg ggggggcacg
35040 ccgtcgcgtg tctgggcacc gccgccgcgt tgtatggatt cgacacggaa
aacaccgtcg 35100 ctatccatat gctcgatccc ggagtaagga tgcggcccac
ggtcggtctg atggtccacc 35160 aacgcgtcgg tgcccggctc caacgggtgt
caggtcgtct cgcgaccgcg cccgcatgga 35220 ctgccgtgga ggtcgcacga
cagttgcgcc gcccgcgggc gctggccacc ctcgacgccg 35280 cactacggtc
aatgcgctgc gctcgcagtg aaattgaaaa cgccgttgct gagcagcgag 35340
gccgccgagg catcgtcgcg gcgcgcgaac tcttaccctt cgccgacgga cgcgcggaat
35400 cggccatgga gagcgaggct cggctcgtca tgatcgacca cgggctgccg
ttgcccgaac 35460 ttcaataccc gatacacggc cacggtggtg aaatgtggcg
agtcgacttc gcctggcccg 35520 acatgcgtct cgcggccgaa tacgaaagca
tcgagtggca cgcgggaccg gcggagatgc 35580 tgcgcgacaa gacacgctgg
gccaagctcc aagagctcgg gtggacgatt gtcccgattg 35640 tcgtcgacga
tgtcagacgc gaacccggcc gcctggcggc ccgcatcgcc cgccacctcg 35700
accgcgcgcg tatggccggc tgaccgctgg tgagcagacg cagagtcgca ctgcggccgg
35760 cgcagtgcga ctctgcgtct gctcgcgctc aacggctgag gaactcctta
gccacggcga 35820 ctacgcgctc gcgatcccgt ggcaccagac cgatccgggt
ccggcggtcg aggatatcgt 35880 ccacatccag cgccccctca tgggtcaccg
cgtattcgaa ctccgcccgg gtcacgtcga 35940 tgccgtcggc gaccggctcg
gtgggccgct cacatgtggc ggcggcagcg acgttggccg 36000 cctcggcccc
gtaccgcgcc accagcgact cgggcaatcc ggcgcccgat ccgggggccg 36060
gcccagggtt cgccggtgcg ccgatcagcg gcaggttgcg agtgcggcac ttcgcggctc
36120 gcaggtgtcg cagcgtgatg gcgcgattca gcacatcctc tgccatgtag
cggtattccg 36180 tcagcttgcc gccgaccaca ctgatcacgc ccgacggcga
ttcaaaaaca gcgtggtcac 36240 gcgaaacgtc ggcggtgcgg ccctggacac
cagcaccgcc ggtgtcgatt agcggccgca 36300 atcccgcata ggcaccgatg
acatccttgg tgccgaccgc cgtccccaat gcggtgttca 36360 ccgtatccag
caggaacgtg atctcttccg aagacggttg tggcacatcg ggaatcgggc 36420
cgggtgcgtc ttcgtcggtc agcccgagat agatccggcc cagctgctcg ggcatggcga
36480 acacgaagcg gttcagctca ccggggatcg gaatggtcag cgcggcagtc
ggattggcaa 36540 acgacttcgc gtcgaagacc agatgtgtgc cgcggctggg
gcgtagcctc agggacgggt 36600 cgatctcacc cgcccacacg cccgccgcgt
tgatgacggc acgcgccgac agcgcgaacg 36660 actgccgggt gcgccggtcg
gtcaactcca ccgaagtgcc ggtgacattc gacgcgccca 36720 cgtaagtgag
gatgcgggcg ccgtgctggg ccgcggtgcg cgcgacggcc atgaccagcc 36780
gggcgtcgtc gatcaattgc ccgtcgtacg cgagcagacc accgtcgagg ccgtcccgcc
36840 gaacggtggg agcaatctcc accacccgtg acgccgggat tcggcgcgat
cggggcaacg 36900 tcgccgccgg cgtacccgct agcacccgca aagcgtcgcc
ggccaggaaa ccggcacgca 36960 ccaacgcccg cttggtgtga cccatcgacg
gcaacaacgg gaccagttgc ggcatggcat 37020 gcacgagatg aggagcgttg
cgtgtcatca ggattccgcg ttcgacggcg ctgcgccggg 37080 cgatgcccac
gttgccgctg gccagatagc gcagaccgcc gtgcaccaac ttcgagctcc 37140
agcggctggt gccgaacgcc agatcatgct tttccaccaa ggccaccgtc agaccgcggg
37200 tggcagcatc taaggcaatg ccaacaccgg taatgccgcc gcctatcacg
atgacgtcga 37260 gtgcgccacc gtcggccagt gcggtcaggt cggcggagcg
acgcgccgcg ttgagtgcag 37320 ccgagtgggg catcagcaca aatatccgtt
cagtgcgtgg gtaagttcgg tggccagcgc 37380 ggcggaatcg aggatcgaat
cgacgatgtc cgcggactgg atggtcgact gggcgatcag 37440 caacaccatg
gtcgccagtc gacgagcgtc gccggagcgc acactgcccg accgctgcgc 37500
cactgtcagc cgggcggcca acccctcgat caggacctgc tggctggtgc cgaggcgctc
37560 ggtgatgtac accctggcca gctccgagtg catgaccgac atgatcagat
cgtcaccccg 37620 caaccggtcg gccaccgcga caatctgctt taccaacgct
tcccggtcgt ccccgtcgag 37680 gggcacctcc cgcagcacgt cggcgatatg
gctggtcagc atggacgcca tgatcgaccg 37740 ggtgtccggc cagcgacggt
atacggtcgg gcggctcacg cccgcgcgcc gggcgatctc 37800 ggcaagtgtc
acccggtcca cgccgtaatc gacgacgcag ctcgccgctg cccgcaggat 37860
acgaccaccg gtatccgcgc ggtcattact cattgacagc atgtgtaata ctgtaacgcg
37920 tgactcaccg cgaggaactc cttccaccga tgaaatggga cgcgtgggga
gatcccgccg 37980 cggccaagcc actttctgat ggcgtccggt cgttgctgaa
gcaggttgtg ggcctagcgg 38040 actcggagca gcccgaactc gaccccgcgc
aggtgcagct gcgcccgtcc gccctgtcgg 38100 gggcagacca 38110 25 2540 DNA
Homo sapiens 25 gaaaaggtgg acaagtccta ttttcaagag aagatgactt
ttaacagttt tgaaggatct 60 aaaacttgtg tacctgcaga catcaataag
gaagaagaat ttgtagaaga gtttaataga 120 ttaaaaactt ttgctaattt
tccaagtggt agtcctgttt cagcatcaac actggcacga 180 gcagggtttc
tttatactgg tgaaggagat accgtgcggt gctttagttg tcatgcagct 240
gtagatagat ggcaatatgg agactcagca gttggaagac acaggaaagt atccccaaat
300 tgcagattta tcaacggctt ttatcttgaa aatagtgcca cgcagtctac
aaattctggt 360 atccagaatg gtcagtacaa agttgaaaac tatctgggaa
gcagagatca ttttgcctta 420 gacaggccat ctgagacaca tgcagactat
cttttgagaa ctgggcaggt tgtagatata 480 tcagacacca tatacccgag
gaaccctgcc atgtattgtg aagaagctag attaaagtcc 540 tttcagaact
ggccagacta tgctcaccta accccaagag agttagcaag tgctggactc 600
tactacacag gtattggtga ccaagtgcag tgcttttgtt gtggtggaaa actgaaaaat
660 tgggaacctt gtgatcgtgc ctggtcagaa cacaggcgac actttcctaa
ttgcttcttt 720 gttttgggcc ggaatcttaa tattcgaagt gaatctgatg
ctgtgagttc tgataggaat 780 ttcccaaatt caacaaatct tccaagaaat
ccatccatgg cagattatga agcacggatc 840 tttacttttg ggacatggat
atactcagtt aacaaggagc agcttgcaag agctggattt 900 tatgctttag
gtgaaggtga taaagtaaag tgctttcact gtggaggagg gctaactgat 960
tggaagccca gtgaagaccc ttgggaacaa catgctaaat ggtatccagg gtgcaaatat
1020 ctgttagaac agaagggaca agaatatata aacaatattc atttaactca
ttcacttgag 1080 gagtgtctgg taagaactac tgagaaaaca ccatcactaa
ctagaagaat tgatgatacc 1140 atcttccaaa atcctatggt acaagaagct
atacgaatgg ggttcagttt caaggacatt 1200 aagaaaataa tggaggaaaa
aattcagata tctgggagca actataaatc acttgaggtt 1260 ctggttgcag
atctagtgaa tgctcagaaa gacagtatgc aagatgagtc aagtcagact 1320
tcattacaga aagagattag tactgaagag cagctaaggc gcctgcaaga ggagaagctt
1380 tgcaaaatct gtatggatag aaatattgct atcgtttttg ttccttgtgg
acatctagtc 1440 acttgtaaac aatgtgctga agcagttgac aagtgtccca
tgtgctacac agtcattact 1500 ttcaagcaaa aaatttttat gtcttaatct
aactctatag taggcatgtt atgttgttct 1560 tattaccctg attgaatgtg
tgatgtgaac tgactttaag taatcaggat tgaattccat 1620 tagcatttgc
taccaagtag gaaaaaaaat gtacatggca gtgttttagt tggcaatata 1680
atctttgaat ttcttgattt ttcagggtat tagctgtatt atccattttt tttactgtta
1740 tttaattgaa accatagact aagaataaga agcatcatac tataactgaa
cacaatgtgt 1800 attcatagta tactgattta atttctaagt gtaagtgaat
taatcatctg gattttttat 1860 tcttttcaga taggcttaac aaatggagct
ttctgtatat aaatgtggag attagagtta 1920 atctccccaa tcacataatt
tgttttgtgt gaaaaaggaa taaattgttc catgctggtg 1980 gaaagataga
gattgttttt agaggttggt tgttgtgttt taggattctg tccattttct 2040
tgtaaaggga taaacacgga cgtgtgcgaa atatgtttgt aaagtgattt gccattgttg
2100 aaagcgtatt taatgataga atactatcga gccaacatgt actgacatgg
aaagatgtca 2160 gagatatgtt aagtgtaaaa tgcaagtggc gggacactat
gtatagtctg agccagatca 2220 aagtatgtat gttgttaata tgcatagaac
gagagatttg gaaagatata caccaaactg 2280 ttaaatgtgg tttctcttcg
gggagggggg gattggggga ggggccccag aggggtttta 2340 gaggggcctt
ttcactttcg acttttttca ttttgttctg ttcggatttt ttataagtat 2400
gtagaccccg aagggtttta tgggaactaa catcagtaac ctaacccccg tgactatcct
2460 gtgctcttcc tagggagctg tgttgtttcc cacccaccac ccttccctct
gaacaaatgc 2520 ctgagtgctg gggcactttg 2540 26 103 RNA Homo sapiens
26 agcuccuaua acaaaagucu guugcuugug uuucacauuu uggauuuccu
aauauaaugu 60 ucucuuuuua gaaaaggugg acaaguccua uuuucaagag aag 103
27 28 RNA Homo sapiens 27 ggauuuccua auauaauguu cucuuuuu 28 28 1619
DNA Homo sapiens 28 ccgccagatt tgaatcgcgg gacccgttgg cagaggtggc
ggcggcggca tgggtgcccc 60 gacgttgccc cctgcctggc agccctttct
caaggaccac cgcatctcta cattcaagaa 120 ctggcccttc ttggagggct
gcgcctgcac cccggagcgg atggccgagg ctggcttcat 180 ccactgcccc
actgagaacg agccagactt ggcccagtgt ttcttctgct tcaaggagct 240
ggaaggctgg gagccagatg acgaccccat agaggaacat aaaaagcatt cgtccggttg
300 cgctttcctt tctgtcaaga agcagtttga agaattaacc cttggtgaat
ttttgaaact 360 ggacagagaa agagccaaga acaaaattgc aaaggaaacc
aacaataaga agaaagaatt 420 tgaggaaact gcgaagaaag tgcgccgtgc
catcgagcag ctggctgcca tggattgagg 480 cctctggccg gagctgcctg
gtcccagagt ggctgcacca cttccagggt ttattccctg 540 gtgccaccag
ccttcctgtg ggccccttag caatgtctta ggaaaggaga tcaacatttt 600
caaattagat gtttcaactg tgctcctgtt ttgtcttgaa agtggcacca gaggtgcttc
660 tgcctgtgca gcgggtgctg ctggtaacag tggctgcttc tctctctctc
tctctttttt 720 gggggctcat ttttgctgtt ttgattcccg ggcttaccag
gtgagaagtg agggaggaag 780 aaggcagtgt cccttttgct agagctgaca
gctttgttcg cgtgggcaga gccttccaca 840 gtgaatgtgt ctggacctca
tgttgttgag gctgtcacag tcctgagtgt ggacttggca 900 ggtgcctgtt
gaatctgagc tgcaggttcc ttatctgtca cacctgtgcc tcctcagagg 960
acagtttttt tgttgttgtg tttttttgtt tttttttttt ggtagatgca tgacttgtgt
1020 gtgatgagag aatggagaca gagtccctgg ctcctctact gtttaacaac
atggctttct 1080 tattttgttt gaattgttaa ttcacagaat agcacaaact
acaattaaaa ctaagcacaa 1140 agccattcta agtcattggg gaaacggggt
gaacttcagg tggatgagga gacagaatag 1200 agtgatagga agcgtctggc
agatactcct tttgccactg ctgtgtgatt agacaggccc 1260 agtgagccgc
ggggcacatg ctggccgctc ctccctcaga aaaaggcagt ggcctaaatc 1320
ctttttaaat gacttggctc gatgctgtgg gggactggct gggctgctgc aggccgtgtg
1380 tctgtcagcc caaccttcac atctgtcacg ttctccacac gggggagaga
cgcagtccgc 1440 ccaggtcccc gctttctttg gaggcagcag ctcccgcagg
gctgaagtct ggcgtaagat 1500 gatggatttg attcgccctc ctccctgtca
tagagctgca gggtggattg ttacagcttc 1560 gctggaaacc tctggaggtc
atctcggctg ttcctgagaa ataaaaagcc tgtcatttc 1619 29 27 RNA Homo
sapiens 29 ggcgucacac cuucggguga agucgcc 27 30 27 RNA Homo sapiens
30 ggcgucacac cuucggguga agucgcc 27 31 12 PRT Homo sapiens 31 Tyr
Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro 1 5 10
* * * * *
References