U.S. patent application number 10/478453 was filed with the patent office on 2004-10-21 for thermal cycling system and method of use.
Invention is credited to Ririe, Kirk.
Application Number | 20040209331 10/478453 |
Document ID | / |
Family ID | 23181628 |
Filed Date | 2004-10-21 |
United States Patent
Application |
20040209331 |
Kind Code |
A1 |
Ririe, Kirk |
October 21, 2004 |
Thermal cycling system and method of use
Abstract
A temperature cycling system (10, 110) is provided for
repeatedly heating and cooling a reaction mixture (16). The system
(10, 110) includes a first heater (27) and a second heater (28)
each movable between a first orientation in which the first or
second heater (27, 28) affects the temperature of the reaction
mixture (16) and a second orientation in which the first or second
heater (27, 28) does not substantially affect the temperature of
the reaction mixture (16). During temperature cycling, the second
heater (28) is in the second orientation when the first heater (27)
is in the first orientation, and the second heater (28) is in the
first orientation when the first heater (27) is in the second
orientation.
Inventors: |
Ririe, Kirk; (Salt Lake
City, UT) |
Correspondence
Address: |
BARNES & THORNBURG
11 SOUTH MERIDIAN
INDIANAPOLIS
IN
46204
|
Family ID: |
23181628 |
Appl. No.: |
10/478453 |
Filed: |
November 21, 2003 |
PCT Filed: |
July 16, 2002 |
PCT NO: |
PCT/US02/22543 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60305632 |
Jul 16, 2001 |
|
|
|
Current U.S.
Class: |
435/91.2 ;
435/286.1; 435/303.1; 435/6.11 |
Current CPC
Class: |
B01L 7/52 20130101; C12Q
1/686 20130101; B01L 2300/1822 20130101; B01L 2300/0654 20130101;
B01L 2300/1827 20130101; B01L 2400/0481 20130101; B01L 3/502
20130101; B01L 7/525 20130101; B01L 3/505 20130101; B01L 7/5255
20130101 |
Class at
Publication: |
435/091.2 ;
435/006; 435/286.1; 435/303.1 |
International
Class: |
C12M 001/38; C12Q
001/68 |
Claims
1. A temperature cycling apparatus for repeatedly heating and
cooling a reaction mixture, the system comprising: a first heater
movable between a first orientation in which the first heater
affects the temperature of the reaction mixture and a second
orientation in which the first heater does not substantially affect
the temperature of the reaction mixture, and a first prime mover
for moving the first heater between the first heater's first and
second orientations, a second heater adjacent the first heater, the
second heater movable between a first orientation in which the
second heater affects the temperature of the reaction mixture and a
second orientation in which the second heater does not
substantially affect the temperature of the reaction mixture, and a
second prime mover for moving the second heater between the second
heater's first and second orientations, the second heater being in
the second orientation when the first heater is in the first
orientation, and the second heater being in the first orientation
when the first heater is in the second orientation during
temperature cycling.
2. The apparatus of claim 1, wherein the first prime mover includes
a first stepper motor coupled to the first heater to move the first
heater between the first heater's first and second orientations,
and the second prime mover includes a second stepper motor coupled
to the second heater to move the second heater between the second
heater's first and second orientations.
3. The apparatus of claim 1, wherein the first heater includes a
first heater element and a second heater element spaced apart from
the first heater element and coupled to the first prime mover, and
wherein the second heater includes a first heater element and a
second heater element spaced apart from the first heater element
and coupled to the second prime mover.
4. The apparatus of claim 3, wherein the first prime mover includes
a first stepper motor and the second prime mover includes a second
stepper motor.
5. The apparatus of claim 3, wherein the first and second stepper
motors operate to move the respective second heater elements at a
rate in the range of approximately 5.0 mm/s to 0.01 mm/s.
6. The apparatus of claim 3, wherein the first prime mover includes
a first bladder and the second prime mover includes a second
bladder.
7. The apparatus of claim 6, wherein the first and second bladders
are coupled to a pressurized gas chamber.
8. The apparatus of claim 6, wherein the first and second heater
elements are circuit-board based heaters having copper wires etched
thereon.
9. The apparatus of claim 7, further including a manifold system
coupled to the pressurized chamber and to each of the first and
second bladders.
10. The apparatus of claim 6, wherein the first and second bladders
are movable in a rocking motion to tilt the respective first and
second heaters back and forth.
11. The apparatus of claim 3, wherein the first heater element of
the first heater is spaced apart from the second heater element of
the first heater a distance in the range of approximately 0.1 mm to
2.0 mm when the first heater is in the first orientation.
12. The apparatus of claim 11, wherein the first heater element of
the first heater is spaced apart from the second heater element of
the second heater a distance in the range of approximately 0.1 mm
to 0.15 mm when the first heater is in the second orientation.
13. A temperature cycling system for repeatedly heating and cooling
a reaction mixture, the system comprising: a flexible reaction
vessel configured to contain the reaction mixture therein, the
reaction vessel including a body having first and second portions
coupled together, a first heater movable between a first
orientation in which the first heater affects the temperature of
the first portion and a second orientation in which the first
heater does not substantially affect the temperature of the first
portion, a second heater movable between a first orientation in
which the second heater affects the temperature of reaction mixture
in the second portion and a second orientation in which the second
heater does not substantially affect the temperature of reaction
mixture in the second portion.
14. The system of claim 13, wherein the vessel further includes a
cap coupled to the body and a sample area within the cap normally
separated from the body by a seal.
15. The system of claim 13, wherein the first heater includes two
heater elements and the second heater includes two heater elements,
and wherein the vessel is positioned between the heater elements of
each heater.
16. The system of claim 15, wherein one of the heater elements of
each of the first and second heaters is stationary and the other
heater element of each of the first and second heaters is
movable.
17. The system of claim 16, further including a first inflatable
bladder coupled to the movable heater element of the first heater,
a second inflatable coupled to the movable heater element of the
second heater, and a gas chamber coupled to the first bladder and
the second bladder.
18. The system of claim 16, further including a first motor coupled
the movable heater element of the first heater and a second motor
coupled to the movable heater element of the second heater.
19. The system of claim 18, wherein each of the first and second
motors are stepper motors.
20. The system of claim 15, wherein each heater element includes a
temperature sensor.
21. The system of claim 13, further including a first prime mover
for moving the first heater between the first heater's first and
second orientations and a second prime mover for moving the second
heater between the second heater's first and second
orientations.
22. The system of claim 21, wherein the first and second prime
movers each include a stepper motor.
23. The system of claim 22, wherein the first heater includes a
stationary heater element and a movable heater element spaced-apart
from the stationary heater element and coupled to the first prime
mover, and wherein the second heater includes a stationary heater
element and a movable heater element spaced-apart from the
stationary heater element and coupled to the second prime
mover.
24. The system of claim 13, wherein the first heater is configured
such that when the first heater is moved from the first orientation
to the second orientation, the first heater forces the reaction
mixture into the second portion of the reaction vessel, and wherein
the second heater is configured such that when the second heater is
moved from the first orientation to the second orientation, the
second heater forces the reaction mixture into the first portion of
the reaction vessel.
25. A method for thermal cycling a fluid sample, the sample
provided in a flexible reaction vessel comprising a first region
and a second region adjacent to and in fluid communication with the
first region, comprising: a. compressing the second region to force
the sample into the first region and into contact with a first pair
of heaters at a first temperature, and b. subsequently compressing
the first region to force the sample into the second region and
into contact with a second pair of heaters at a second temperature,
the second temperature being different from the first
temperature.
26. The method of claim 25 further comprising repeating steps a and
b throughout a plurality of temperature cycles.
27. A method for amplifying a nucleic acid in a biological sample
comprising: a. placing the biological sample into a flexible
reaction vessel comprising a first region and a second region
adjacent to and in fluid communication with the first region, b.
compressing the first region to force the sample into the second
region and into contact with a pair of denaturation heaters at a
denaturation temperature, c. compressing the second region to force
the sample into the first region and into contact with a pair of
annealing heaters at an annealing temperature, and d. repeating
steps b and c for a plurality of amplification cycles.
28. The method of claim 27 wherein the nucleic acid is amplified by
PCR and the sample vessel further comprises therein reagents for
performing PCR.
29. The method of claim 28 wherein the reagents include a
polymerase and primers.
30. The method of claim 31 wherein the reaction vessel further
comprises a fluorescent entity therein, the fluorescent entity
capable of providing a fluorescent signal related to the quantity
of the nucleic acid.
31. The method of claim 30 further comprising monitoring the
fluorescent signal during each of the amplification cycles.
32. The method of claim 31 wherein the vessel further comprises an
end adjacent to the second region and the monitoring step further
comprises measuring the fluorescent signal at a plurality of points
along the end to obtain a plurality of data points for each
amplification cycle.
33. The method of claim 32 further comprising obtaining the median
value of the data points for each amplification cycle.
34. The method of claim 33 wherein the median value is obtained by
ignoring erroneous values.
35. The method of claim 33 further comprising using the median
value for each of the data points to call a positive or negative
result.
36. The method of claim 35 further comprising comparing the
positive or negative result to a second result obtained for a
second sample and outputting the result only if the result and the
second result are in agreement.
37. The method of claim 35 further comprising obtaining an
additional result for a positive or negative control and outputting
the result for the sample only if the additional result is correct
for the positive or negative control.
38. A method for repeatedly heating and cooling a reaction mixture
contained within a flexible reaction vessel comprising: placing the
reaction vessel adjacent a first heater and a second heater,
heating the first heater to a first temperature, heating the second
heater to a second temperature, alternately opening and closing the
first and second heaters so that the reaction mixture is in thermal
contact with the respective heater when the heater is in the opened
position and the reaction mixture is not in thermal contact with
the respective heater when the heater is in the closed
position.
39. The method of claim 38, wherein opening and closing includes
moving the first heater to a closed position to move substantially
all of the reaction mixture to a position adjacent the second
heater, heating the reaction mixture to the second temperature,
moving the first pair of heaters to an opened position and moving
the second pair of heaters to a closed position to move
substantially all of the reaction mixture to a position adjacent
the first pair of heaters, and heating the reaction mixture to the
first temperature.
40. A method for heating a reaction mixture heating and cooling a
reaction mixture contained within a flexible reaction vessel
comprising: heating a first pair of heaters positioned in a first
zone to a first temperature, heating a second pair of heaters
positioned in a second zone to a second temperature, placing the
reaction vessel between each of the first and second pair of
heaters so that the first heater engages a first portion of the
reaction vessel and the second heater engages a second portion of
the reaction vessel, and moving the reaction mixture between the
first zone in thermal contact with the first pair of heaters and
the second zone in thermal contact with the second pair of heaters
by alternately opening and closing the first and second pairs of
heaters around the reaction vessel.
41. A device for thermal cycling a sample provided in a flexible
vessel, comprising a first heating element for heating the sample
to a first temperature, the first heating element repeatably
movable between an open position and a closed position, the first
heating element defining a first gap for receiving a first portion
of the flexible vessel, a second heating element for heating the
sample to a second temperature, the second heating element
repeatably movable between an open position and a closed position,
the second heating element defining a second gap contiguous with
the first gap, the second gap for receiving a second portion of the
flexible vessel, wherein when the first heating element is in the
closed position, the sample is forced from the first portion of the
flexible vessel, and when the second heating element is in the
closed position, the sample is forced from the second portion of
the flexible vessel.
42. The device of claim 41, wherein during thermal cycling when the
first heating element is in the closed position, the second heating
element is in the open position and the sample is forced into the
second portion of the sample vessel and when the second portion of
the sample vessel and when the second heating element is in the
closed position, the first heating element is in the open position
and the sample is forced into the first portion of the sample
vessel.
43. The device of claim 41, further comprising a third heating
element for heating the ample to a third temperature, the third
heating element repeatably movable between an open position and a
closed position, the third heating element defining a third gap for
receiving a third portion of the flexible vessel, wherein when the
third heating element is in the closed position, the sample is
forced from the third portion of the flexible vessel.
44. The device of claim 41, further comprising a fluorimeter
positioned to measure fluorescence in the reaction vessel.
45. The device of claim 44, wherein the fluorimeter is positioned
to measure fluorescence in the second portion of the flexible
vessel and wherein the first temperature is higher than the second
temperature.
46. The device of claim 41, wherein the first and second gaps are
configured for receiving a plurality of flexible vessels, each of
the plurality of flexible vessels having a first portion and a
second portion.
47. The device of claim 46, wherein the plurality of reaction
vessels received within the first and second gaps are in a parallel
arrangement.
48. The device of claim 47, further comprising a fluorimeter, the
fluorimeter movable between a plurality of positions, each position
located for measuring fluorescence from a respective reaction
vessel.
49. The device of claim 48, further comprising a stepper motor for
moving the fluorimeter.
50. The device of claim 41, wherein the first heating element
comprises a first stationary heating element, a first movable
heating element, and a means for moving the first movable heating
element from the open position toward the first stationary heating
element and to the closed position.
51. The device of claim 50, wherein the second heating element
comprises a second stationary heating element, a second movable
heating element, and a means for moving the second movable heating
element, from the open position toward the second stationary
heating element and to the closed position.
52. The device of claim 41, further comprising a pneumatic system,
and wherein the first heating element comprises a first stationary
heating element and a first movable heating element coupled to the
pneumatic system to move the first movable heating element toward
the first stationary heating element, and wherein the second
heating element comprises a second stationary heating element and a
second movable heating element coupled to the pneumatic system to
move the second movable heating element toward the second
stationary heating element.
53. The device of claim 52, wherein the pneumatic system includes a
pressurized gas chamber, a manifold system coupled to the gas
chamber, a first inflatable bladder coupled to the manifold system
and to the first movable heater, and a second inflatable bladder
coupled to the manifold system and to the second movable heater.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to a thermal cycling device
and method that facilitates rapid, uniform temperature cycling of
samples. Illustratively, the invention is designed to perform DNA
amplification and detection of amplified products within a reaction
vessel.
BACKGROUND
[0002] Amplification of DNA by polymerase chain reaction (PCR)
requires reaction mixtures be subjected to repeated rounds of
heating and cooling. All commercially available instruments for PCR
operate by changing the temperature of the environment of a
reaction vessel, either by heating and cooling the environment, or
by robotically moving the samples between environments. The most
common instruments for temperature cycling use a metal block to
heat and cool reaction mixtures. Thermal mass of the metal block is
typically large, meaning temperature transitions are relatively
slow and require a large amount of energy to cycle the temperature.
The reaction mixture is typically held in microcentrifuge tubes or
microtiter plates consisting of rigid injection molded plastic
vessels. These vessels need to be in uniform contact with the metal
block for efficient heat transfer to occur. Maintaining temperature
uniformity across a large heat block has also been a challenge.
[0003] Novel techniques have been devised to overcome the
challenges of using instruments with metal blocks for heating and
cooling samples. Airflow can be used to thermocycle samples in
plastic reaction tubes (U.S. Pat. No. 5,187,084), as well as in
capillary reaction tubes (Wittwer, et al, "Minimizing the time
required for DNA amplification by efficient heat transfer to small
samples", Anal Biochem 1990, 186:328-331 and U.S. Pat. No.
5,455,175). Capillary tubes provide a higher surface area to volume
ratio than other vessels. Using air as the thermal medium allows
rapid and uniform temperature transitions when small sample volumes
are used.
[0004] Further, the capillary tubes themselves can be physically
moved back and forth across different temperature zones (Corbett,
et al., U.S. Pat. No. 5,270,183, Kopp et al., 1998, and Haff et
al., U.S. Pat. No. 5,827,480), or the sample can be moved within a
stationary capillary (Hunicke-Smith, U.S. Pat. No. 5,985,651 and
Haff, et al., U.S. Pat. No. 6,033,880). With the latter technique,
contamination from sample to sample is a potential problem because
different samples are sequentially passed through the winding
capillary tube. Additionally, tracking the physical position of the
sample is technically challenging.
[0005] The use of sample vessels formed in thin plastic sheets has
also been described. Schober et al. describe methods for forming
shallow concave wells on plastic sheets in an array format similar
to a microtiter plate (Schober et al, "Multichannel PCR and serial
transfer machine as a future tool in evolutionary biotechnology",
Biotechniques 1995, 18:652-661). After samples are placed in the
pre-formed well, a second sheet is placed over the top, and the
vessel is heat-sealed. The accompanying thermal cycling apparatus
physically moves a tray of samples between different temperature
zones (Schober et al. and Bigen et al., U.S. Pat. No. 5,430,957).
The use of multiple heating blocks for the temperature zones makes
this machine large and cumbersome.
[0006] Another system using reaction chambers formed between two
thin sheets of plastic has been described where the vessel has
multiple individual compartments containing various reaction
reagents (Findlay et al, "Automated closed-vessel system for in
vitro diagnostics based on polymerase chain reaction", Clin Chem
1993, 39:1927-1933, and Schnipelsky, et al., U.S. Pat. No.
5,229,297). The compartments are connected through small channels
that are sealed at the beginning of the process. One apparatus has
a moving roller that squeezes the vessel while traveling from one
end of the vessel to another. The pressure from the roller breaks
the seal of the channels and brings the sample into contact with
reagents. Temperature is controlled by a heater attached to the
roller mechanism (DeVaney, Jr., et al., U.S. Pat. No. 5,089,233). A
second apparatus uses pistons to apply pressure to the compartments
and move the fluid (DeVaney, Jr., U.S. Pat. No. 5,098,660). The
temperature of one of the pistons can be altered while in contact
with the vessel to accomplish thermal cycling. In both of these
examples, the temperature of a single heating element is being
cycled. Changing the temperature of the heating element is a
relatively slow process.
[0007] Another system uses a planar plastic envelope (Corless et
al. W09809728A1). The sample remains stationary and heating is
provided by an infrared source, a gas laser.
[0008] Real-time monitoring of PCR is enabled using reaction
chemistries that produce fluorescence as product accumulates in
combination with instruments capable of monitoring the
fluorescence. Real-time systems greatly reduce the amount of sample
transfer required between amplification reaction and observation of
results. Additionally, in some systems, quantitative data can also
be collected.
[0009] A number of commercially available real-time PCR instruments
exist that couple a thermal cycling device with a fluorescence
monitoring system. Of these real-time instruments, thermal cycling
in the Perkin-Elmer 5700 and 7700 and the Bio-Rad iCycler
instruments are based on metal heat blocks. The Roche LightCycler,
the Idaho Technology Ruggedized Advanced Pathogen Identification
system (or R.A.P.I.D.) and the Corbett RotoGene all use air to
thermocycle the reactions. The Cepheid SmartCycler uses ceramic
heater plates that directly contact the sample vessel.
SUMMARY
[0010] The present invention provides a cycling system for use in
various temperature-controlled processes, including but not limited
to the polymerase chain reaction. The present invention also
provides a new thermal cycling system capable of generally
automatically and simultaneously varying the temperature of one or
more samples. The present invention further provides a new thermal
cycling system that allows a rapid and almost instantaneous change
of temperatures between a plurality of temperatures by moving
samples between temperature zones within each reaction vessel.
Additionally the present invention provides a thermal cycling
system for the detection and analysis of a reaction in real-time by
monitoring cycle-dependent and/or temperature-dependent
fluorescence.
[0011] In an illustrated embodiment, a reaction mixture is placed
in a soft-sided flexible vessel that is in thermal contact with a
plurality of temperature zones comprising a plurality of movable
heating or heater elements. When pressure is applied to the vessel
by closing all except one set of the heater elements, the reaction
mixture inside the vessel moves to the heater element that is left
open. The reaction mixture can be moved between different portions
of the vessel and can be exposed to different temperature zones by
selective opening and closing of the heater elements. Temperature
change of the reaction mixture occurs rapidly and almost
instantaneously. The vessel can be of any shape, illustratively
elongated, and made of a flexible material, such as thin plastic
film, foil, or soft composite material, provided that the material
can hold the reaction mixture and can withstand temperature
cycling. Exemplary plastic films include, but are not limited to,
polyester, polyethylene terephthalate (PET), polycarbonate,
polypropylene, polymethylmethacrylate, and alloys thereof and can
be made by any process as known in the art including coextrusion,
plasma deposition, and lamination. Plastics with aluminum
lamination, or the like, may also be used.
[0012] A single vessel can be used for temperature cycling.
Alternatively, for simultaneous temperature cycling, multiple
vessels may be used simultaneously. The multiple vessels can be
stacked together, as parallel channels in sheet format, or adjacent
each other in a circle to form a disk. The heater elements can be
made of, for example, thin-film metal heaters, ceramic
semiconductor elements, peltier devices, or circuit boards etched
with metallic (e.g. copper) wires, or a combination of the above,
with optional metal plates for uniform heat dispersion. Thick metal
heaters are also an option if the device need not be small. Other
heaters known in the art may be used.
[0013] The heater elements are held at, or around, a set of
characteristic temperatures for a particular chemical process, such
as PCR. When the chemical process is PCR, at least two temperature
zones are required: one at a temperature that is effective for
denaturation of the nucleic acid sample, the other at a temperature
that allows primer annealing and extension. As illustrated,
reaction vessels are inserted in the apparatus when the heater
elements for both temperature zones are in an open position. To
temperature cycle for PCR, the heater element of one temperature
zone is brought to the closed position, pushing the reaction
mixture toward the open temperature zone at the other end of the
vessel. In the open temperature zone, the heater element is in
thermal contact with the vessel wall. Following an appropriate
incubation time, the element of the zone heater is brought to the
closed position, while the element of the other zone is opened.
This action forces the reaction mixture to move to the other
temperature zone. This process of opening and closing temperature
zones is repeated as many times as required for nucleic acid
amplification. It is understood that additional heater elements may
be used for processes requiring more than two temperatures. For
example, PCR reactions often use a denaturation temperature, an
annealing temperature, and an extension temperature.
[0014] The foregoing and many other aspects of the present
invention will become more apparent when the following detailed
description of the preferred embodiments is read in conjunction
with the various figures.
BRIEF DESCRIPTION OF DRAWINGS
[0015] FIGS. 1A to 1E are cross-sectional diagrammatic views of a
reaction vessel containing a reaction mixture positioned between
heater elements of the present disclosure.
[0016] FIG. 1A is a diagrammatic view of the vessel positioned
between at least three pairs of heater elements showing each
element spaced-apart from the vessel.
[0017] FIG. 1B is a diagrammatic view similar to FIG. 1A of the
vessel positioned between two pairs of heater elements and showing
a top pair of the elements in a closed position and a bottom pair
of the elements in an opened position so that generally all of the
reaction mixture is positioned between and heated by the bottom
pair of elements.
[0018] FIG. 1C is a diagrammatic view similar to FIGS. 1A and 1B
showing the bottom pair of elements in the closed position and the
top pair of elements in the opened position so that generally all
of the reaction mixture is positioned between and heated by the top
pair of elements at a different temperature than the bottom pair of
elements.
[0019] FIG. 1D is a diagrammatic view similar to FIG. 1B showing
the bottom pair of elements in the opened position and the top pair
of elements in the closed position and further showing a heat sink
adjacent but spaced-apart from each of the bottom pair of
elements.
[0020] FIG. 1E is a diagrammatic view similar to FIG. 1D showing
the bottom pair of elements in the closed position and the top pair
of elements in the opened position and further showing each of the
heat sinks having engaged the respective element to cool the bottom
pair of elements.
[0021] FIG. 2A is a perspective view of the reaction vessel showing
a receptacle coupled to a flexible body of the vessel.
[0022] FIG. 2B is a perspective view of an array of reaction
vessels coupled to each other to form a single row.
[0023] FIG. 3 is a perspective view of an illustrative
thermocycling subassembly for use with a real-time PCR apparatus of
the present disclosure (shown in FIGS. 5 and 6) showing a first and
a second stepper motor of the subassembly, top and bottom pairs of
heater elements, and the row of reaction vessels positioned between
the pairs of elements.
[0024] FIGS. 4A to 4C are side views of the thermocycling
subassembly shown in FIG. 3 showing thermocycling of the reaction
mixture contained within the vessels.
[0025] FIG. 4A is a side view thermocycling subassembly showing the
top and bottom pairs of elements in the opened position prior to
heating the reaction mixture within the vessels.
[0026] FIG. 4B is a side view of the thermocycling subassembly
showing the bottom pair of elements in the closed position so that
the reaction mixture is in thermal contact with the top pair of
elements.
[0027] FIG. 4C is a side view of the thermocycling subassembly
showing the top pair of elements in the closed position and the
bottom pair of elements in the opened position so that so that the
reaction mixture is in thermal contact with the bottom of
elements.
[0028] FIG. 5 is a perspective view of the thermocycling
subassembly integrated into the real-time PCR apparatus including
the thermocycling subassembly and a fluorimeter subassembly.
[0029] FIG. 6 is a side view of the real-time PCR apparatus shown
in FIG. 5.
[0030] FIG. 7 is a graph showing the results of real-time
monitoring of PCR in which DNA amplification is detected by the
increase in relative fluorescence in the annealing temperature
zone. (.DELTA., O, .circle-solid., .quadrature. are negative
controls; .gradient., , .diamond-solid., + are positive
samples)
[0031] FIG. 8 is a perspective view of an alternative real-time PCR
apparatus showing a body of the apparatus including a slot for
placing sample vessels therein and a pressurized gas chamber
adjacent the slot, and showing the apparatus further including a
lid hinged to the body and including a computer having a PC
interface and display monitor.
[0032] FIG. 9 is a part schematic, part diagrammatic sectional view
of the components located within the body of the PCR apparatus
shown in FIG. 8 showing an alternative thermocycling subassembly
having pneumatic bladders and the fluorimeter subassembly
positioned below the thermocycling subassembly.
DETAILED DESCRIPTION OF THE DRAWINGS
[0033] A real-time thermal cycling apparatus or system 10 is
provided, as shown in FIGS. 5 and 6, for use in temperature
controlled processes such as amplification of DNA by PCR or
cycle-sequencing, for example, and optionally for use in detecting
and analyzing a reaction by monitoring fluorescence.
Illustratively, system 10 is used as a biological agent
identification system for specifically identifying organisms by
their unique genetic makeup. System 10 includes a thermocycling
subassembly 12 and a fluorimeter subassembly 38. In general,
thermocycling subassembly 12 subjects a reaction mixture or sample
16 (shown in FIGS. 1A-1E) including a nucleic acid sample to
temperature cycling, or repeated rounds of heating and cooling,
illustratively, for denaturation of the nucleic acid sample and for
primer annealing and elongation. The samples 16 are sealed inside
flexible plastic film vessels 18 and actuators of subassembly 12
squeeze the vessels 18 back and forth so that samples 16 are moved
between two or more temperature zones. Subassembly 38 detects and
analyzes the reaction in real-time by monitoring cycle dependent
and/or temperature-dependent fluorescence. System 10 further
includes a vertical support structure shown as mechanical
breadboard 36 and a base 46 coupled to support structure 36. As is
shown in FIG. 5, each subassembly 12, 38 is mounted on structure
36. Each of the subassemblies 12, 38 is discussed in greater detail
below.
[0034] As mentioned above, reaction mixture 16 includes a nucleic
acid sample, for example, and is contained within a single,
soft-sided reaction vessel 18, as shown in FIG. 2A. Vessel 18 is
used in system 10 and includes a reaction vessel body 19 and a
receptacle 24 for receiving the nucleic acid sample 16. The
reaction vessel body 19 is formed between two planar faces of
plastic sheeting sealed together to form sealed sides 22.
Individual vessels 18, therefore are separated from neighboring
vessels 18 by sealed sides 22. Liquid can be loaded into the
receptacle 24 and moved to the reaction vessel body 19, that is
initially squeezed flat, by means such as gravity or a vacuum
applied to the outer walls of the vessel 18. Once samples 16 are
loaded into the reaction vessel body 19, the vessel 18 can be
sealed to create seal 21 by heat-sealing, clamping, or through the
use of adhesives, for example.
[0035] Alternatively, the receptacle 24 can be fitted with a
plastic fitment (not shown) manufactured from polypropylene, for
example. Each vessel body 19 may be tapered at the top to a point
(not shown) with the plastic fitment coupled thereto so that
through use of either a pipette or a syringe-like plug, samples 16
could be forced into the reaction vessel body 19. Each plastic
fitment attaches to the top of a respective vessel body 19 and
includes an injection port into the respective vessel body. Liquid
reagents, therefore, may be injected into body 19 using a pipette,
for example. Excess air may then be squeezed out of body 19 prior
to loading the vessels 18 into the thermocycling subassembly 12 for
heat-sealing and thermal cycling, as is described in greater detail
below.
[0036] Additionally, an illustrative polypropylene fitting or
plastic cap 23 (shown in FIGS. 2A and 2B) may be used to provide a
secondary closure of the vessels 18. The plastic caps 23 may also
be used to seal the vessel body 19 at the fitment, thereby
obviating the need to seal body 19 at sealing area 21. It is within
the scope of this disclosure for such a plastic cap 23 to be
threadably attached to vessel body 19, snap-fit onto or within
vessel body 19, and/or melted into body 19, etc.
[0037] In yet another alternative embodiment, a larger plastic
fitting or fitment (not shown) may also be used to allow sample 16
to be freeze-dried inside a plurality of openings in the fitting,
for example, twelve openings. A single injection port is connected
to several of the reaction vessels 18, and when a prepared DNA
sample is inserted into the port, the sample 16 is drawn into the
body 19 of each vessel 18 automatically by the force of the vacuum.
This automatic distribution of samples 16 may be used for testing
sample 16 for multiple pathogens or multiple genes from a single
source. A syringe plunger is inserted into the top of the fitting
and is pressed down automatically at the end of the freeze-drying
process, thus sealing the reagent pellet in vacuum. The body 19 is
then vacuum sealed inside a protective bag for long-term stability.
See U.S. Provisional Application No. 60/374,730, filed Apr. 23,
2002, herein incorporated by reference.
[0038] Vessel body 19 is made of a flexible material. Such flexible
materials include but are not limited to thin plastic films, foil,
or soft composite materials, provided that they can hold the
reaction mixture 16, and can withstand repeated exposure to
temperatures used in the reaction without deformation, crazing,
cracking, or melting. Plastic films of polyester, (PET),
polycarbonate, polypropylene, polymethylmethacrylate, and alloys
thereof made by coextrusion, plasma deposition, lamination or the
like are preferred. Plastics with aluminum lamination, or the like,
are also preferred. Further, vessel body 19 has a coefficient of
heat transfer approximately in the range of 0.02-20 W/m*degK.
Because vessel body 19 is thin, it does not effectively transfer
heat between portions of vessel body 19 in contact with different
heaters at different temperatures, as is discussed below.
[0039] If fluorescence monitoring of the reaction is desired,
through the use of subassembly 38, for example, plastic films that
are adequately low in absorbance and auto-fluorescence at the
operative wavelengths are preferred. Such material could be found
by trying different plastics, different plastisizers and composite
ratios, as well as different thickness of the film. For plastics
with aluminum or other foil lamination, the portion of the vessel
18 that is to be read by the fluorescence detection device 38 can
be left without the foil. In the example of PCR, film laminates
composed of polyester (Mylar, Dupont, Wilmington Del.) of about
0.0048 inch (0.1219 mm) thick and polypropylene films of
0.001-0.003 inch (0.025-0.076 mm) thick perform well.
Illustratively, vessel body 19 is made of a clear material so that
the vessel body 19 is capable of transmitting approximately 80%-90%
of incident light.
[0040] To perform simultaneous reactions of multiple samples, the
vessels 18 are illustratively arranged to form an array or row 20
of reaction vessels 18, as shown in FIG. 2B. In the illustrated
embodiments, the vessels 18 are arranged with 9 mm or 6 mm spacing
to mimic the spacing found on standard 96-well or 384-well
microtiter plates. However, it is within the scope of this
disclosure to include a row 20 of vessels 18 having other suitable
spacing. FIG. 2B illustrates the row or array 20 of vessels 18 to
includes twelve reaction vessels 18. It is within the scope of this
disclosure, however, to include other configurations having other
numbers of vessels 18 for use with system 10 of the present
disclosure. When used with fluroescence, for example, for real-time
monitoring, a bottom edge 14 of sealed sides 22 may be blackened to
reduce bleed-over of fluroescent light from one sample vessel 18 to
the next.
[0041] As mentioned above, vessels 18 (or row 20 of vessels 18) are
used with thermocycling subassembly 12, shown in FIGS. 3-5.
Illustratively, as shown in FIG. 3, thermocycling subassembly 12
includes a mounting support 32 having a first wall 48 and a second
wall 50 spaced apart from first wall 48 and coupled to first wall
48 by spacers 30. Illustratively, there are four spacers 30 coupled
to each of the first and second walls 48, 50 of support 32.
Mounting support 32 further includes mounts 51 coupled to first
wall 48 so that mounting support 32 may be coupled to support
structure 36, as shown in FIG. 6, for example.
[0042] Illustratively, thermocycler subassembly 12 further includes
four heaters: a first heater 25, a second heater 26, a third heater
27, and a fourth heater 28, as shown in FIG. 3 and as shown
diagrammatically in FIGS. 1A-1E. Each heater 25, 26, 27, 28
includes a head 54 having a first surface 56 facing the one or more
vessels 18, as is discussed below, and an opposite surface 58.
Illustratively, each head 54 is generally rectangular in shape, as
shown in FIG. 3. However, it is within the scope of this disclosure
to include a head having any suitable shape for thermally
contacting vessels 18.
[0043] Each heater 25, 26, 27, 28 further includes a heater element
60 coupled to the contact surface 56 of each heater 25, 26, 27, 28.
Heater element 60 illustratively may be a thin-film metal heater or
one or more circuit-board based heaters, or a combination of the
two. Metallic (e.g. copper) wires or traces may be etched into the
circuit-board based heaters. Each heater head 56 is illustratively
a metal plate so that heat produced by heater elements 60 may be
uniformly dispersed or distributed. Each head or metal plate 56,
however, is an optional component of the heaters 25, 26, 27, 28.
Circuit-board based heater elements provide heating by controlling
the voltage across the metallic traces and provide temperature
sensing by measuring the resistance of the metallic traces. It is
within the scope of this disclosure, however, to include other
types of temperature sensors. A microprocessor can be used to read
the calibrated temperature of the circuit-board and control the
voltage to achieve the desired temperature. It is also within the
scope of this disclosure to include an outer un-etched copper layer
of each heater element 60 to increase temperature uniformity. Thick
metal heaters and Peltier devices are also an option if the device
need not be small. Optional active heating can be performed at the
higher temperature zone(s) by applying heat purges, or the like,
prior to or during sample contact. Optional active cooling could be
used at the lower temperature zone(s) by use of heat sinks 52 or
the like, which are to be in contact with the heating elements
(shown in FIGS. 1D and 1E) for appropriate durations of time, as is
discussed below.
[0044] As shown in FIG. 3, and diagrammatically in FIGS. 1A-1E,
each of the first and second heaters 25, 26 is rigidly coupled to
first wall 48 of mounting support 32 by a shaft 33. Each shaft 33
is rigidly coupled to first wall 48 so that first and second
heaters 25, 26 remain stationary throughout the temperature cycling
process, as is described below. Each of the second and third
heaters 27, 28 are movably coupled to second wall 50 of mounting
support 32 by a shaft or linear bearing 34. As shown in FIGS.
4A-4C, each shaft 34 is rigidly coupled to respective heaters 27,
28 so that heaters 27, 28 are urged to move with each respective
shaft 34 relative to wall 50.
[0045] Further, second and third heaters 26, 27 create a first,
upper temperature zone 66 and first and fourth heaters 25, 28
create a second, lower temperature zone 68. Illustratively, the
upper zone 66 is provided for denaturation of the sample 16 while
the lower zone 68 is provided for primer annealing and extension.
The heaters of each zone 66, 68 are programmed to maintain a
certain predefined temperature for the heating and cooling of
mixture 16 within each vessel 18. As such, zone 66 (including
second and third heaters 26, 27) is maintained at a different
temperature than zone 68 (including first and fourth heaters 25,
28). The upper and lower zones 66, 68 of heaters are
diagrammatically shown in FIGS. 1A-1E, for example, and are
discussed in greater detail below. Further, it is within the scope
of this disclosure to include a thermocycling subassembly 12 having
additional temperature zones (and thus more heaters) than upper and
lower zones 66, 68 described herein. For example, third and fourth
temperature zones 70, 72 are illustratively shown in FIG. 1A.
[0046] Thermocycler subassembly 12 further includes a first stepper
motor 29 and a second stepper motor 31, as shown in FIG. 3. First
stepper motor 29 is coupled to and controls third heater 27
positioned in the first, upper zone 66. Second stepper motor 31 is
coupled to and controls fourth heater 28 positioned in the second,
lower zone 68. Each stepper motor 29, 31 is provided to move the
respective heaters 27, 28 in a linear path along an axis lying
along the length of shafts 34. Although stepper motors 29, 31 are
shown, it is within the scope of this disclosure to include any
suitable type of electromechanical mover or actuator such as servo
motors, geared motors, solenoids, piezoelectric devices, etc., for
example.
[0047] FIG. 1A diagrammatically illustrates a single soft-sided
reaction vessel 18 sandwiched between heaters 25, 26, 27, 28 for
use with system 10, and specifically with subassembly 12, of the
present disclosure. As mentioned above, the heaters create two or
more temperature zones: first, upper zone 66 and second, lower zone
68. Each of the third and fourth heaters 27, 28 is movable between
an opened and a closed position because of respective stepper
motors 29, 31. As shown in FIG. 1A, all sets of heaters are
illustratively in an open position for ease in loading vessels 18
therein. As described below and shown in FIGS. 1B-1E, the reaction
mixture 16 inside the reaction vessel 18 is incubated in a
particular temperature zone when the particular heater within that
temperature zone is held in the opened position while all other
heaters within other zones are in the closed position. FIG. 1B
illustrates an exemplary two-temperature cycling system in which
the third heater 27, within upper temperature zone 66, is in the
closed position. As shown in FIG. 1B, the portion of vessel 18
within zone 66 has been pressed together to squeeze substantially
all of reaction mixture 16 into the portion of vessel 18 within
zone 68 (where heater 28 is in the opened position). Therefore, the
reaction mixture 16 is in full thermal contact with first and
fourth heaters 25, 28 within zone 68 to be heated and/or cooled to
the temperature at which first and fourth heaters 25, 28 have been
set. Conversely, since reaction mixture 16 has been squeezed from
zone 66 into zone 68, little, if any, reaction mixture 16 remains
at the temperature of zone 66.
[0048] After an appropriate duration, heater 27 is moved to the
open position so that zone 66 is opened and heater 28 is moved to
the closed position so that zone 68 is closed, thus moving the
reaction mixture 16 into the upper portion of vessel 18 and into
full thermal contact with second and third heaters 26, 27 of upper
zone 66, as shown in FIG. 1C. Thermal cycling is accomplished by
repeating these steps. It is within the scope of this disclosure
for approximately 90% or more of the reaction mixture 16 to be
transferred between upper and lower temperature zones 66, 68.
However, it is within the scope of this disclosure for subassembly
12 to achieve other suitable amounts of mass transfers of mixture
16 during the thermal cycling process. For a two-temperature
cycling system, as that shown in FIGS. 1B-1E, the volume of
reaction mixture 16 to be placed within each vessel 18 is
approximately less than half the maximum volume of the reaction
vessel body 19 at any time so that all or substantially all of
reaction mixture 16 can be moved between the two temperature zones
66, 68.
[0049] FIGS. 1D and 1E illustrate the use of optional heat sinks 52
to aid with the active cooling of the heaters 25, 28 in the lower
temperature zone 68. Illustratively, heat sinks 52 are provided for
use with heaters 25, 28 of the lower temperature zone 68 for active
cooling of heaters 25, 28 during the denaturation phase of the PCR
process, as shown in FIG. 1E. Alternatively, heat sinks 52 are used
for active cooling of heaters 25, 28 during the annealing/extension
phase (not shown), or are used continuously by being affixed
directly to heaters 25, 28 (not shown). Illustratively, heat sinks
52 are aluminum or copper. However, it is within the scope of this
disclosure to include other heat sinks made of other suitable
materials. The lower temperature zone 68 is actively cooled by
bringing heat sinks 52 into contact with the back-side or surface
58 of heaters 25, 28. During the denaturation phase, the top
portions of heaters 25, 28 in the lower temperature zone 68 may
have a higher temperature than the remaining portions due to
proximity to the higher temperature zone 66 and due to contact with
the lower end of the heated fluid sample 16 through the vessel
material. Unevenness in temperature along the length of heaters 25,
28 can lead to inefficient and uneven cooling of the sample 16 when
the sample 16 is transferred into the lower temperature zone 68 for
annealing/extension. When heat sinks 52 are used during the
denaturation phase, they generally circumvent this problem by
preventing the occurrence of non-uniform temperature in the lower
temperature zone 68. When heat sinks 52 are used during the
annealing/extension phase, they aid in regaining temperature
uniformity in the lower temperature zone 68 and allow for a more
rapid cool down of the denatured sample when it is transferred into
the lower temperature zone 68. When heat sinks 52 are affixed to
heaters 25, 28, they help maintain temperature uniformity of the
heaters, and allow for rapid cool down of the denatured sample. By
selecting the appropriate thermal mass for the affixed heat sinks
52, it is also possible to minimize power consumption by heaters
25, 28.
[0050] Illustratively, subassembly 12 features an active area
between the heaters 110 mm wide and 50 mm high. This is large
enough to accommodate twelve reaction vessels 18 (such as array 20)
of 100 .mu.l, or 9 mm of spacing. However, it is within the scope
of this disclosure to include a device having another suitably
sized active area for vessels 18.
[0051] FIG. 3 illustrates an exemplary subassembly 12 of the system
10 of the present disclosure. The parallel array or row 20 of
reaction vessels 18 is shown and positioned between first and
second heaters 25, 26 and third and fourth heaters 27, 28. For
illustrative PCR applications, second and third heaters 26, 27 are
maintained at a first temperature high enough to denature
double-stranded DNA, typically 90 to 96 degrees Celsius. First and
fourth heaters 25, 28 are maintained at a second temperature,
between 50 and 72 degrees Celsius, to allow annealing of probe, and
extension by a thermostable DNA polymerase. It is within the scope
of this disclosure for both of these temperatures to be
predetermined, or to be dynamically determined through fluorescence
feedback if fluorescence monitoring is performed in real-time using
dye systems that discriminate double strand from single strand DNA.
See U.S. Pat. No. 6,174,670, for example.
[0052] As shown in FIG. 4A, the mobile or movable third and fourth
heaters 27, 28 are each mounted on respective shaft 34. The stepper
motor 29 acts to adjust the distance between the third heater 27
and the stationary second heater 26 by propelling the mobile third
heater 27 with the shaft 34 in a direction toward stationary heater
26. In the same manner, the distance between the heaters in the
lower zone 68 (defined by first, stationary heater 25 and fourth,
movable heater 28) is controlled by second stepper motor 31. Means
to control the opening and closing of temperature zones 66, 68 do
not have to be limited to stepper motors. For instance, the use of
pneumatic bladders, as shown in FIG. 9, to move the third and
fourth heaters 27, 28 is also a viable method. It is, therefore,
within the scope of this disclosure to include other suitable means
of moving heaters 25, 26, 27, 28 toward and away from each other.
Further, it is within the scope of this disclosure to move both
sets of heaters within a particular zone. Furthermore, as best seen
in FIG. 3, each heater 25, 26, 27, 28 is elongated and shaped for
contacting the entire row 20 of reaction vessels 18. However, it is
within the scope of this disclosure to provide the movable heaters
27, 28 of each pair of heaters (or all four heaters) in a segmented
format for contacting individual reaction vessels 18 independently.
Each subsection may be controlled by a separate means for
moving.
[0053] In the operation of the two-temperature thermal cycling
system 10 illustrated, a strip or row 20 of reaction vessels 18 is
loaded into the active area of subassembly 12, as shown in FIG. 4A,
such that row 20 extends between the upper and lower pairs of
heaters 29. To thermal cycle the reaction mixtures 16, the fourth
heater 28 is moved to the closed position toward first, stationary
heater 25, as shown in FIG. 4B. Moving heater 28 to the closed
position causes heater 28 and heater 25 to impinge on the outer
walls of the reaction vessels 18 positioned therebetween, thus
squeezing substantially all of the reaction mixture 16 to the upper
portion of the respective reaction vessel 18. The width of a vessel
receptacle gap 35 between second heater 26 and third heater 27, in
the opened position, is large enough to allow the mixture 16 to
flow into the upper half of the reaction vessel body 19 while still
maintaining direct contact with the outer walls of the reaction
vessel 18. As shown in FIG. 4C, the width of a vessel receptacle
gap 37 between heaters 25 and 28, in the closed position (shown in
FIG. 4B), has been opened by moving fourth heater 28 to the opened
position in a direction away from first heater 25 while the
receptacle gap 35 between heaters 26 and 27 is closed by generally
simultaneously moving third heater 27 to the closed position toward
second heater 25.
[0054] While the illustrated embodiment of the thermocycling
subassembly 12 shown in FIGS. 3 and 4A-4C uses the first and fourth
heaters 25, 28 positioned within lower zone 68 as the annealing
site, those skilled in the art could envision other arrangements.
For example, the upper heaters 26, 27 may be used to anneal and the
lower heaters 25, 28 may be used to denature the DNA within the
reaction mixture 16. Further, as mentioned above, it is within the
scope of this disclosure to include a subassembly 12 having more
than two sets or zones of heaters for cycling between more than two
temperatures. For example, three sets of heaters could produce
typical three-temperature PCR profiles with different temperatures
used for denaturation, annealing, and extension. An arrangement
where the temperature zones are arranged horizontally rather than
standing vertically is also envisioned.
[0055] One way to accomplish rapid uniform heating and cooling of
the reaction mixture 16 is to maintain a small distance between
heaters 25 and 28 and between heaters 26 and 27 (or, vessel
receptacle gap 35) in the active temperature zone. However, it is
also conceivable that rapid temperature uniformity of the reaction
mixture 16 can be achieved by agitation of the system 10.
Illustratively, for temperature transitions used in two-temperature
PCR systems, a vessel receptacle gap 35 of about 0.1 mm to about 2
mm is preferred, with 0.25 to 1 mm being the most preferred, for
the active temperature zone when respective heaters are in the
opened position for effective heating or cooling of the reaction
mixture. When respective heaters are in the closed position,
illustratively a vessel receptacle gap 37 is brought as close as
possible to the thickness of the fully collapsed sample vessel,
illustratively approximately 0.1 to 0.15 mm. Furthermore,
illustratively, the speed of closing and opening of the heaters 29
within each respective zone is relatively fast. Again, in the case
of two-temperature PCR systems, a closing and opening speed of 5
mm/s to 0.01 mm/s is preferred, with about 1 mm/s being the most
preferred. However, it is within the scope of this disclosure for
heaters 27, 28 to open and close at other suitable speeds. Further,
it is understood that in some applications, slower temperature
transitions may be preferred, with concomitant slower closing and
opening speeds.
[0056] FIGS. 5 and 6 show the integration of the thermocycling
subassembly 12 into the real-time PCR detection system 10. As
mentioned above, thermocycling subassembly 12 is mounted on support
36 coupled to base 46. Fluorimeter subassembly 38 is mounted below
the thermocycling subassembly 12. The fluorimeter subassembly 38
can be moved along a fluorimeter linear bearing 40 by a fluorimeter
drive shaft 42. Further, a stepper motor 44 is provided and is
computer controlled to turn the fluorimeter drive shaft 42 to move
the fluorimeter subassembly 38. FIG. 6 shows the cross section of
the composite apparatus. When the lower vessel receptacle gap 35 is
open, the fluorimeter subassembly 38 can measure the fluorescence
of the reaction mixture 16 within one of the reaction vessels 18.
Moving the fluorimeter subassembly 38, as described above, allows
monitoring of the individual reaction vessels 18 in a row or strip
20.
[0057] FIG. 7 illustrates an example of PCR in which a DNA fragment
was amplified using the real-time system described in FIGS. 5 and
6. A 110 base pair fragment of the human beta-globin gene was
amplified using DNA primers 5'ACACAACTGTGTTCACTAGC (SEQ ID NO. 1)
and 5' CAACTTCATCCACGTTCACC (SEQ ID NO. 2) at 0.5 .mu.M each,
1.times.SYBR Green I dye (Molecular Probes, Eugene Oreg., 1:30,000
dilution), 200 .mu.M dNTPs, 0.04 U/.mu.l Taq polymerase with
TaqStart Antibody (Roche Molecular Biochemicals, IN), and PCR
buffer (Idaho Technology, UT). Approximately fifteen thousand
copies of human genome DNA were included in one hundred microliter
reaction mixtures. The reaction mixtures 16 were placed in reaction
vessels 18 and were temperature-cycled for 50 cycles with the
following temperature profiles: 95.degree. C., 4 seconds,
60.degree. C., 2 seconds. In FIG. 7, amplification of material was
confirmed in eight reaction mixtures indicated by the increase in
fluorescence after 37 cycles. The identity of the amplified
material was confirmed as the beta-globin fragment by comparing its
melting temperature with that of a reference material using the
LightCycler system (Roche Molecular Biochemicals). In one
illustrated embodiment, the PCR reagents could be lyophilized in
the reaction vessel and reconstituted by adding sample dissolved in
water.
[0058] Looking now to FIGS. 8 and 9, an alternative PCR apparatus
110 is provided. Apparatus 110 is similar to apparatus 10 and,
therefore, like reference numbers have been used to identify like
components. Apparatus 110 also performs the same functions as
apparatus 10 such as temperature cycling and detection and analysis
of a reaction mixture. Apparatus 110 performs these functions
through the use of a thermocycling subassembly 112 and a
fluorimeter subassembly 114. One difference between apparatus 10
and apparatus 110 is that the movable heaters 27, 28 of apparatus
110 are operated by two sets of pneumatic bladders 129, 131.
Although illustrative pneumatic bladders are disclosed, it is
within the scope of this disclosure to move heaters 27, 28 through
the use of any suitable pressure-based actuator such as hydraulics,
spring arrays, etc., for example.
[0059] The first, upper set 129 of bladders includes upper bladders
144, 146 coupled to movable heater 27 and the second, lower set 131
of bladders includes lower bladders 148, 150 coupled to movable
heater 28. Bladders 144, 146, 148, 150 are each illustratively
manufactured by heat-sealing a polyethylene/polypropylene laminate
film onto a pneumatic fitting 128. The seals are arranged such that
rounded, rectangular areas are created and positioned adjacent the
heaters. Illustratively, each bladder 144, 146, 148, 150 (and each
respective heater 25, 26, 27, 28 coupled thereto) generally runs
the length of apparatus 110 so that each bladder 144, 146, 148, 150
affects all vessels 18 within the array 20 of vessels 18. Further
each bladder 144, 146, 148, 150 is illustratively coupled to two
pneumatic fittings 128, although only one fitting 128 is shown in
cross-section in FIG. 9.
[0060] In operation, air is forced into the fittings 128 to inflate
each plastic film bladder 144, 146, 148, 150 thus forcing the
heater elements 60 coupled to each movable heater 27, 28 into
contact with vessels 18 and respective heater elements 60 of
stationary heaters 25, 26 to force the liquid sample 16 within each
vessel 18 into the other heating zone. Apparatus 110 may include a
rigid mechanical support 126 coupled to each set 129, 131 of
bladders and an insulator 133 coupled to each support 126.
Illustratively, mechanical support 126 is made of a metal or carbon
fiber composite strips, however, it is within the scope of this
disclosure for support 126 to be made of any suitable material. As
shown, one insulator 133 is coupled to heater 27 and another
insulator 133 is coupled to heater 28. Each insulator 133 is made
of an insulating material so that the temperature of each
respective heater 27, 28 may be more consistently maintained.
[0061] As shown in FIG. 9, each movable heater 27, 28 is coupled to
two bladders. Illustratively, heater 27 is coupled to the first,
upper set 129 of bladders 144, 146 and heater 28 is coupled to the
second, lower set 131 of bladders 148, 150. The use of two bladders
for each movable heater 27, 28 allows for active mixing of the
samples 16 within each of the upper and lower heat zones 66, 68.
Agitation of the samples 16 is accomplished by cyclically
pressurizing bladders 144 and 146 (of upper set 129) within upper
zone 66, for example, or by cyclically pressurizing bladders 148
and 150 (of lower set 131) within lower zone 68. Subminiature
valves (not shown) under control of a microprocessor 162 (shown
diagrammatically in FIG. 9) may be used to switch the high pressure
between the two heat zones 66, 68 thus forcing the sample 16 back
and forth between the upper and lower temperature zones 66, 68.
Illustratively, all pneumatic bladders 144, 146, 148, 150 are
controlled by microprocessor 160. Further, illustratively, a
separate microprocessor is used to control temperature sensing, the
heating of the heater elements 60, etc.
[0062] As shown in FIG. 9, apparatus 110 further includes a sealing
mechanism 142 driven by another bladder 152. Sealing mechanism 142
includes a spring-retracted seal bar 156 coupled to bladder 152. To
seal the samples 16 into the vessels 18, bladder 152 is inflated to
actuate spring-retracted seal bar 156 to press seal bar 156 into
contact with the array 20 of vessels 18 and between a mating
surface 158 of seal bar 156 and an opposite surface 160 of
apparatus 110. Mating surface 158 of seal bar 156 is illustratively
fitted with a nichrome wire (not shown), which can be heated by
passing current therethrough. The wire is heated for enough time to
melt an inner layer of the reaction vessel body 19, fusing it
together and locking the sample 16 into the receptacle. While
sealing mechanism 142 is provided integrally in apparatus 110, it
is understood that sealing mechanism 142 is optional, and that the
vessels 18 may be sealed by any number of ways, as is known in the
art.
[0063] A controller board (not shown) is also provided and includes
a heater board retraction spring, MAC valves, and receptacles for
fittings 128. Apparatus 110 is illustratively battery operated and
includes an internal pneumatic system, described above, including
first and second sets 129, 131 bladders 144, 146 and 148, 150.
Illustratively, first set 129 of bladders 144, 146 acts as a first
mover or actuator of the system and second set 131 of bladders 144,
146 acts as a second mover or actuator of the system. A disposable
twenty-five gram carbon dioxide cylinder 132 is illustratively used
to drive the pneumatic system. While FIGS. 8 and 9 illustrate a
portable, battery operated unit, it is understood that apparatus
110 may be configured to run off of a standard electrical source.
Furthermore, while a carbon dioxide cylinder 132 is illustrated, it
is understood that other compressed fluid sources may be used
within the scope of this disclosure.
[0064] As shown in FIG. 8, apparatus 110 includes a transport box
111 having a body 116 and a lid 118 illustratively coupled to the
body 116 by hinges (not shown) so that lid 118 pivots between an
opened position, as shown, and a closed position. Illustratively,
box 111 is made of sturdy anodized aluminum, however, it is within
the scope of this disclosure to include a transport box made of
other suitable materials. Latches 120 are coupled to a front
surface 122 of body 116 so that lid 118 may be locked in the closed
position and the transport box may be easily carried. Lid 118
illustratively includes a 386 DOS computer 124, however, any
suitable computer or microprocessor may be used. A PC interface 130
is provided so that computer 124 may be connected to a user's PC to
download information gathered from the apparatus 110 to the PC. An
interface 134, illustratively a soft key interface, is provided
including keys for inputting information and variables such as
temperatures, cycle times, etc. Illustratively, a 2.times.20 mm
character display 136 is also provided. Display 136 may be an LED,
LCD, or other such display, for example. Further as shown in FIG.
8, body 116 of box 111 includes a top surface 138 having a slot 140
formed therein for receiving array 20 of vessels 18. It is
understood that other microprocessors may be used within the scope
of this invention. It is further understood that the microprocessor
need not be provided as an integral component of the apparatus 110,
and, depending upon the application, that a microprocessor may not
be needed at all.
[0065] Illustrative automatic calling software may be provided to
analyze the samples by a multi-test analysis method described in
U.S. patent application Ser. Nos. 10/074,178 and 10/117,948, herein
incorporated by reference, with the following modifications and
additions. Multiple points (for example, 10, 20, 30, or 50 points)
are interrogated across a bottom 15 of each individual sample
vessel 18 to acquire multiple fluorecence values, and the median of
those fluorescence values for each time point is used as input to
the algorithm. Data points from portions of the sample vessel 18
that are close to seal 22 are preferably not used due to edge
effects in fluorescence. Prior to taking the median, the software
also compares the individual fluorescence values with data acquired
from the cycle preceding the present acquisition, and ignores those
values that are significantly different in value. This allows the
software to ignore portions of the sample vessel 18 which further
generate erroneous fluorescence signal due to the appearance, or
drift, of air bubbles and other interfering particles in the
reaction. It is understood that other numerical methods besides
taking a median value may be sued to reduce the many measurements
taken across the bottom to a single fluorescence value for each
sample. These include fourier transformation, averaging, fitting to
known functions, and stored standards. Finally, in an illustrated
embodiment, the classification of a sample (i.e. "positive" or
"negative" for the presence of an analyte) is reported to the user
only if the automated calls have registered the expected results in
the positive and negative controls, and optionally, only if
duplicate reactions or alternative gene loci provide concordant
results with the sample. Illustratively, if the automated calls are
inconsistent with the expected calls in the positive and/or
negative controls, then the software will report to the user that
the reaction needs to be repeated. If the result of the duplicate
reaction, or the alternative gene loci, is inconsistent with the
sample, the software will report the inconsistency and will not
call the sample "positive" or "negative". Apparatus 110 displays
the result in the display screen 136 and allows users to look
deeper at the specific reactions if they choose.
[0066] As mentioned above, apparatus 110 further includes gas
chamber 132 for providing compressed gas to the first and second
sets 129, 131 of pneumatic bladders 144, 146, 148, 150. As shown in
FIG. 8, cylinder 132 is positioned near slot 140 so that a portion
of chamber 132 protrudes above top surface 138 of body 116. Chamber
132 is removable from body 116 of transport box 111 so that a user
may refill the chamber 132 as needed. Although chamber 132 is
illustratively cylindrical in shape, it is within the scope of this
disclosure to include a gas chamber having any suitable shape for
feeding compressed air to bladders 129, 131. Similar to apparatus
10, apparatus 110 includes thermocycling subassembly 112 and
fluorimeter subassembly 114, each positioned within body 116 of
transport box 111. Computer 124 of apparatus 110 may control
certain functions of both subassemblies 112, 114. It is also within
the scope of this disclosure, however, to include other computers
or microprocessors for separately controlling the subassemblies
112, 114.
[0067] Looking now to FIG. 9, thermocycling subassembly 112
includes heaters 25, 26, 27, 28 to create upper and lower
temperature zones 66, 68. Further, heaters 25 and 26 are stationary
heaters and heaters 27 and 28 are movable heaters. As mentioned
before, first, upper set 129 of pneumatic bladders 144, 146 is
coupled to heater 27 and second, lower set 131 of pneumatic
bladders 148, 150 is coupled to heater 28. Although it is shown
that two bladders are coupled to each heater, it is within the
scope of this disclosure to couple a heater to any suitable number
of pneumatic bladders. Each bladder 144, 146, 148, 150 is coupled
to the carbon dioxide chamber 132. Microprocessor 160 controls the
inflation and deflation of each set 129, 131 of bladders 144, 146,
148, 150 as is required for the temperature cycling process
described above with respect to apparatus 10. Pneumatic bladders
144, 146, 148, 150 provide high, uniform actuation forces on
respective heaters 27, 28. Further, illustrative bladders 144, 146,
148, 150 are relatively light and occupy little space allowing for
apparatus 110 to be small, compact, and portable.
[0068] Subassembly 112 also includes an eleven-valve manifold
coupled to the bladders 144, 146, 148, 150 to regulate the carbon
dioxide gas into and out of each bladder 144, 146, 148, 150.
Although an eleven-valve manifold is disclosed herein, it is within
the scope of this disclosure to include a manifold having another
suitable number of valves to operate bladders 144, 146, 148, 150.
The carbon dioxide gas within gas chamber 132 is regulated to 30
psi and is switched through the manifold to minimize electrical
losses from the valves. First set 129 of pneumatic bladders 144,
146 forces movable heater 27 toward stationary heater 25 while
second set 131 of pneumatic bladders 148, 150 forces movable heater
28 toward stationary heater 26 in order to force samples 16 within
each vessel 18 between lower and upper temperature zones 66,
68.
[0069] In operation, the illustrative sets 129, 130 of bladders
144, 146 and 148, 150 are able to produce a rocking motion on
respective movable heaters 27 and 28 to allow mechanical mixing of
the samples 16 within each temperature zone 66, 68. Mixing the
samples 16 by the rocking motion of the heaters 27, 28 increases
temperature uniformity within each sample 16 and aids in
positioning each sample 16 for optimal fluorescence measurement at
the bottom of each respective vessel body 19.
[0070] Subassembly 112 further includes a sealing mechanism 142,
shown in FIG. 9 and described above, positioned above heaters 26,
27. Array 20 of vessels 18 are inserted into slot 140 of body 116
and between mating surface 158 of seal bar 156 and surface 160.
Seal bar 156 is urged to move toward surface 160 by pneumatic
bladder 152 to lock and seal the array 20 of vessels 18
therebetween, as described above. Illustratively, seal bar 156
operates to heat seal an upper portion of the vessel body 19 of
each vessel 18 together to form a seal. However, it is within the
scope of this disclosure for seal bar 156 to simply clamp or secure
array 20 of vessels 18 between stationary heaters 25, 26 and
movable heaters 27, 28.
[0071] The foregoing description of the invention has been
presented for purposes of illustration and description. It is not
intended to be exhaustive or to limit the invention to the precise
forms described, and obviously many other modifications are
possible in light of the above teaching. The embodiments were
chosen in order to explain most clearly the principles of the
invention and its practical applications, thereby to enable others
in the art to utilize most effectively the invention in various
other embodiments and with various other modifications as may be
suited to the particular use contemplated.
Sequence CWU 1
1
2 1 20 DNA Homo sapiens 1 acacaactgt gttcactagc 20 2 20 DNA Homo
sapiens 2 caacttcatc cacgttcacc 20
* * * * *