U.S. patent application number 10/788374 was filed with the patent office on 2004-10-21 for method for selecting tumours expressing hla-g which are sensitive to anticancer treatment, and uses thereof.
This patent application is currently assigned to COMMISSARIAT A L'ENERGIE ATOMIQUE. Invention is credited to Carosella, Edgardo Delfino, Dausset, Jean, Moreau, Philippe, Paul, Pascale, Rouas-Freiss, Nathalie.
Application Number | 20040209296 10/788374 |
Document ID | / |
Family ID | 26234154 |
Filed Date | 2004-10-21 |
United States Patent
Application |
20040209296 |
Kind Code |
A1 |
Carosella, Edgardo Delfino ;
et al. |
October 21, 2004 |
Method for selecting tumours expressing HLA-G which are sensitive
to anticancer treatment, and uses thereof
Abstract
The invention concerns a method for selecting tumours expressing
HLA-G, sensitive to an anticancer treatment, which inhibits or
prevents the HLA-G activity of said tumours and the uses thereof.
Said method enable to establish either the HLA-G, transcription
profile of a solid tumour or the HLA-G expression profile of a
solid tumour. The method for establishing the HLA-G transcription
profile consists in: (i) drawing a tumoral sample; (ii) extracting
the mRNA; (iii) reverse transcription (RT) of said RNA: (iv)
successive or simultaneous amplification of the cDNA's obtained in
(iii) in the presence of primers specific to each HLA-G isoform and
analysing the resulting amplification products, by electrophoresis
and/or specific hybridisation and(v) establishing said sample HLA-G
transcription profile. The method for establishing the HLA-G
expression profile consists in: (i) drawing a tumoral sample; (ii)
optionally marking said sample cells; (iii) carrying out a lysis of
the cells; (iv) contacting said cells which have been subjected to
lysis with different antibodies directed against the class I HLA-G
antigens, to form, optionally HLA-G isform/antibodies complexes;
and (v) establishing said sample HLA-G expression profile by
detecting the complexes formed in step (iv).
Inventors: |
Carosella, Edgardo Delfino;
(Paris, FR) ; Dausset, Jean; (Paris, FR) ;
Moreau, Philippe; (Viry-Chatillon, FR) ; Paul,
Pascale; (Paris, FR) ; Rouas-Freiss, Nathalie;
(Paris, FR) |
Correspondence
Address: |
OBLON, SPIVAK, MCCLELLAND, MAIER & NEUSTADT, P.C.
1940 DUKE STREET
ALEXANDRIA
VA
22314
US
|
Assignee: |
COMMISSARIAT A L'ENERGIE
ATOMIQUE
31-33 rue de la Federation
PARIS
FR
75752
|
Family ID: |
26234154 |
Appl. No.: |
10/788374 |
Filed: |
March 1, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10788374 |
Mar 1, 2004 |
|
|
|
09622583 |
Oct 13, 2000 |
|
|
|
09622583 |
Oct 13, 2000 |
|
|
|
PCT/FR99/00386 |
Feb 19, 1999 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.12; 435/7.23 |
Current CPC
Class: |
C12Q 1/6886 20130101;
G01N 33/574 20130101; A61P 35/00 20180101; C07K 16/2833 20130101;
C12Q 2600/106 20130101; G01N 2333/70503 20130101; A61K 39/0011
20130101; A61K 2039/5152 20130101; C12Q 2600/156 20130101; C12Q
2600/158 20130101 |
Class at
Publication: |
435/006 ;
435/007.23 |
International
Class: |
C12Q 001/68; G01N
033/574 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 20, 1998 |
FR |
98 02071 |
Jul 24, 1998 |
FR |
98 09470 |
Claims
1-13 (Canceled)
14. A method of treating a solid tumor expressing at least one
HLA-G isoform, comprising administering to a patient in need
thereof, at least one substance selected from the group consisting
of autologous tumor cells expressing at least one HLA-G isoform; a
soluble HLA-G5 antigen; a soluble HLA-G5 fragment; an HLA-G
antibody; a factor which inhibits transcription of HLA-G; and a
factor which inhibits expression of HLA-G.
15. The method of claim 14, wherein the autologous tumor cells are
modified by a hyberbaric treatment or a cholesterol treatment.
16. The method of claim 14, wherein the soluble HLA-G5 antigen or
fragment thereof is coupled with an appropriate protein and
optionally is associated with an adjuvant such as aluminum
hydroxide or calcium phosphate.
17. The method of claim 14, wherein the factor inhibiting the
transcription and/or the expression of HLA-G is at least one member
selected from the group consisting of antagonists for HL-G
activating agents, antisense nucleic acids, and hormonal inhibitors
for the transcription and/or the expression of the HLA-G.
18. The method of claim 14, wherein the antagonists are selected
from the group consisting of interleukin-10 antagonists,
glucocorticoid antagonists, interferon antagonists, stress agent
antagonists, and mixtures thereof.
19. The method of claim 14, wherein the composition is administered
subcutaneously or intradermally.
20. The method of claim 14, wherein the anti-HLA-G antibody is
administered as a combined product with a factor inhibiting the
transcription and/or the expression of HLA-G.
21. The method of claim 20, wherein the combined product is for
simultaneous, separate, or staged use.
22. An anti-tumor vaccine, comprising autlogous tumor cells
expressing at least one HLA-G isoform.
23. The anti-tumor vaccine of claim 22, wherein the autologous
tumor cells are modified by a hyperbaric treatment or a cholesterol
treatment.
24. An anti-tumor vaccine, comprising at least one of a soluble
HLA-G5 antigen or a fragment thereof.
25. The anti-tumor vaccine of claim 24, wherein the soluble HLA-G
antigen or fragment thereof is coupled with an appropriate
protein.
26. The anti-tumor vaccine of claim 25, which further comprise an
adjuvant.
27. The anti-tumor vaccine of claim 26, wherein the adjuvant is
aluminum hydroxide, calcium phosphate, or mixtures thereof.
28. A composition compring an anti-HLA-G antibody and a factor
which inhibits the transcription and/or expression of HLA-G.
29. The composition of claim 28, wherein the factor is selected
from the group consisting of interleukin-10 antagonists,
glucocorticoid antagonists, interferon antagonists, stress agent
antagonists, and mixtures thereof.
Description
[0001] The present invention relates to a method for selecting
solid tumours which are sensitive to anticancer treatment, which
inhibits or prevents the HLA-G activity of said solid tumours, and
to uses thereof.
[0002] Major histocompatibility complex (MHC) antigens are divided
up into several classes, class I antigens (HLA-A, HLA-B and HLA-C)
which exhibit 3 globular domains (.alpha.1, .alpha.2 and .alpha.3)
and whose .alpha.3 domain is associated with .beta.2 microglobulin,
class II antigens (HLA-DP, HLA-DQ and HLA-DR) and class III
antigens (complement).
[0003] Class I antigens comprise, besides the abovementioned
antigens, other antigens, so-called unconventional class I
antigens, and in particular the HLA-E, HLA-F and HLA-G antigens;
the latter, in particular, is expressed by extravillous
trophoblasts of normal human placenta and thymic epithelial
cells.
[0004] The sequence of the HLA-G gene (HLA-6.0 gene) was described
by Geraghty et al. (Proc. Natl. Acad. Sci. USA, 1987, 84,
9145-9149): it comprises 4396 base pairs and exhibits an
intron/exon organization which is homologous to that of the HLA-A,
-B and -C genes. More specifically, this gene comprises 8 exons, 7
introns and a 3' untranslated end; the 8 exons correspond
respectively to: exon 1: signal sequence, exon 2: .alpha.1
extracellular domain, exon 3: .alpha.2 extracellular domain, exon
4: .alpha.3 extracellular domain, exon 5: transmembrane region,
exon 6: cytoplasmic domain I, exon 7: cytoplasmic domain II
(untranslated), exon 8: cytoplasmic domain III (untranslated) and
3' untranslated region (Geraghty et al., mentioned above: Ellis et
al., J. Immunol., 1990, 144, 731-735; Kirszenbaum M. et al.,
Oncogeny of hematopoiesis. Aplastic anemia Eds. E. Gluckman, L.
Coulombel, Colloque INSERM/John Libbey Eurotext Ltd). However, the
HLA-G gene differs from the other class I genes in that the
in-frame translation stop codon is located in the second codon of
exon 6; consequently, the cytoplasmic region of the protein encoded
by this HLA-6.0 gene is considerably shorter than the cytoplasmic
regions of the HLA-A, -B and -C proteins.
[0005] These HLA-G antigens are essentially expressed by the
cytotrophoblastic cells of the placenta and are considered to play
a role in protecting the foetus (absence of rejection by the
mother). In addition, since the HLA-G antigen is monomorphic, it
may also be involved in placental cell growth or function (Kovats
et al., Science, 1990 248, 220-223).
[0006] Other research relating to this unconventional class I
antigen (Ishitani et al., Proc. Natl. Acad. Sci. USA, 1992, 89,
3947-3951) has shown that the primary transcript of the HLA-G gene
can be spliced in several ways, and produces at least 3 distinct
mature mRNAs: the primary transcript of HLA-G provides a 1200-bp
complete copy (G1), a 900-bp fragment (G2) and a 600-bp fragment
(G3).
[0007] The G1 transcript does not comprise exon 7, and corresponds
to the sequence described by Ellis et al. (mentioned above), i.e.
it encodes a protein which comprises a leader sequence, three
external domains, a transmembrane region and a cytoplasmic
sequence. The G2 mRNA does not comprise exon 3, i.e. it encodes a
protein in which the .alpha.1 and .alpha.3 domains are directly
joined; the G3 mRNA contains neither exon 3 nor exon 4, i.e. it
encodes a protein in which the .alpha.1 domain and the
transmembrane sequence are directly joined.
[0008] The splicing which prevails so as to obtain the HLA-G2
antigen leads to the joining of an adenine (A) (originating from
the domain encoding .alpha.1) with an. AC sequence (derived from
the domain encoding .alpha.3), which leads to the creation of an
AAC (asparagine) codon in place of the GAC (aspartic acid) codon
encountered at the start of the sequence encoding the .alpha.3
domain in HLA-G1.
[0009] The splicing generated so as to obtain HLA-G3 does not lead
to the formation of a new codon in the splicing zone.
[0010] The authors of this article also analysed the various
proteins expressed: the 3 mRNAs are translated into protein in the
221-G cell line.
[0011] Some of the inventors have shown the existence of other
spliced forms of HLA-G MRNA: the HLA-G4 transcript which does not
include exon 4; the HLA-G5 transcript which includes intron 4
between exons 4 and 5, thus causing a modification of the reading
frame during the translation of this transcript and in particular
the appearance of a stop codon after amino acid 21 of intron 4; and
the HLA-G6 transcript which possesses intron 4, but has lost exon 3
(Kirszenbaum M. et al., Proc. Natl. Acad. Sci. USA, 1994, 91,
4209-4213; European Application EP 0 677 582; Kirszenbaum M. et
al., Human immunol., 1995, 43, 237-241; Moreau P. et al., Human
Immunol., 1995, 43, 231-236); they have also shown that these
various transcripts are expressed in several types of foetal and
adult human cells, in particular in lymphocytes (Kirszenbaum M. et
al., Human Immunol., 1995, mentioned above; Moreau P. et al., Human
Immunol. 1995, mentioned above).
[0012] Some of the inventors have also shown that NK cells express
no HLA-G transcript (Teyssier M. et al., Nat. Immunol., 1995, 14,
262-270; Moreau P. et al., Human Immunol., 1997, 52, 41-46).
[0013] At least 6 different HLA-G mRNAs thus exist which
potentially encode 6 protein isoforms of HLA-G, of which 4 are
membrane-bound (HLA-G1, G2, G3 and G4) and 2 are soluble (G5 and
G6).
[0014] Although the foetus can be considered to be a
semi-allograft, the foetal cells survive and are not rejected by
the mother; it has become apparent that the HLA-G molecules
expressed at the surface of the trophoblasts protect the foetal
cells against lysis by maternal natural killer (NK) cells from the
uterine decidua and from peripheral blood (Carosella E. D. et al.,
C. R. Acad. Sci., 318, 827-830; Carosella E. D. et al., Immunol.
Today, 1996, 407-409; Rouas-Freiss N. et al., PNAS, 1997, 94,
5249-5254).
[0015] Previous studies have shown that the expression of HLA-G
molecules at the surface of transfected target cells makes it
possible to protect said target cells against the lytic activity of
NK cells from the decidual layer of the maternal endometrium
(Chumbley G. et al., Cell Immunol., 1994, 155, 312-322; Deniz G. et
al., J. Immunol., 1994, 152, 4255-4261; Rouas-Freiss N. et al.,
Proc. Natl. Acad. Sci., 1997, 94, 5249-5254). It should be noted
that these target cells are obtained by transfection with vectors
comprising either HLA-G genomic DNA which potentially generates all
the alternative transcripts, or with vectors containing the HLA-G1
and HLA-G2 cDNAs encoding the HLA-G1 and HLA-G2 protein isoforms
(European Patent Application No. 0 677 582 and Application
PCT/FR98/00333).
[0016] NK cells express receptors for class I MHC molecules (killer
inhibitory receptors or KIR, or NKIR for NK inhibitory receptors)
which are responsible for the inhibition of cytotoxicity when these
HLA molecules, acting as ligands, are recognized by these
receptors; for example, N. Rouas-Freiss et al., (Proc. Natl. Acad.
Sci., 1997, 94, 5249-5254) showed that the expression of HLA-G
protected K562 (human erythroleukaemia cell line) target cells
transfected with the HLA-G1 and G2 isoforms against lysis. These
cells are usually sensitive to NK cells.
[0017] These results testify to the fundamental role of the HLA-G
molecule as an immunotolerance antigen. These results have been
broadened to all of the membrane-bound isoforms. The cDNAs encoding
the HLA-G1, G2, G3 and G4 isoforms which are expressed, after
transfection, in various cell types, in particular transfected K562
cells and M8 tumour cells, inhibit NK and CTL cytotoxic
functions.
[0018] Given the important role that the HLA-G molecule may play,
the inventors, continuing with their work, more particularly
studied tumour cells, and gave themselves in particular the aim of
providing tools for selecting solid tumours which are sensitive to
a treatment which inhibits the HLA-G antigens present in particular
on certain tumours.
[0019] The subject of the present invention is a method for
establishing the HLA-G transcription profile of a solid tumour with
a view to selecting a treatment which is suited to said tumour
and/or with a view to monitoring the evolution of said tumour,
characterized in that it comprises:
[0020] (i) the removal of a tumour sample;
[0021] (ii) the extraction of the MRNA from said sample; a modified
Chomczynski and Sacchi method using the RNA reagent NOW (Ozyme,
France) can in particular be used;
[0022] (iii) the reverse transcription (RT) of said RNA;
[0023] (iv) the successive or simultaneous amplifications of the
cDNAs obtained in (iii), in the presence of primers specific for
each HLA-G isoform, and the analysis of the amplification products
obtained by electrophoresis and/or specific hybridization and
[0024] (v) the establishment of the HLA-G transcription profile of
said sample.
[0025] Preferably, the reverse transcriptions are primed with
oligo-dTs on mRNA which is denatured in advance, for example at
65.degree. C., in the presence of a reverse transcriptase such as
M-MLV reverse transcriptase (Gibco-BRL, Life technologies).
[0026] Also preferably, the cDNA amplification is carried out by
polymerase chain reaction (PCR) using primers specific for the
various HLA-G isoforms, in accordance with the following
tables:
1 Hybridization temperatures Isoforms Primers Nucleotide sequences
(.degree. C.) amplified G.257 5'-GGAAGAGGAGACACGGAACA 61 G1, G2, G3
G3.U 5'-GGCTGGTCTCTGCACAAAGAGA G4, G5, G6 G.526
5'-CCAATGTGGCTGAACAAAGG 61 G1, G4, G5 G3.U
5'-GGCTGGTCTCTGCACAAAGAGA G.-3-4 5'-ACCAGAGCGAGGCCAAGCAG 65 G3 G3.U
5'-GGCTGGTCTCTGCACAAAGAGA G.-3 5'-ACCAGAGCGAGGCCAACCCC 65 G2, G6
G3.U 5'-GGCTGGTCTCTGCACAAAGAGA G.-3 5'-ACCAGAGCGAGGCCAACCCC 61 G6
G.i4b 5'-AAAGGAGGTGAAGGTGAGGG G.526 5'-CCAATGTGGCTGAACAAAGG 61 G5
G.i4b 5'-AAAGGAGGTGAAGGTGAGGG Hybridization temperatures Isoform
Probes Nucelotide sequences (.degree. C.) detected GR
5'-GGTCTGCAGGTTCATTCTGTC 60 HLA-G1, G2, G3, G4, G5, G6 G.647 F
5'-CCACCACCCTGTCTTTGACT 60 HLA-G1, G2, G5, G6 G.I4 F
GAGGCATCATGTCTGTTAGG 55 HLA-G5, G6 G.927 F 5'-ATCATGGGTATCGTTGCTGG
55 HLA-G1, G2, G3, G4, G5 and G6
[0027] The inventors found, surprisingly, that at least some solid
tumours express the HLA-G antigen, and showed that this HLA-G
antigen plays a functional role in protecting tumour cells (solid
tumours) against destruction by NK cells. They also showed the
effective presence of certain HLA-G isoforms at the surface of said
tumour cells.
[0028] However, also surprisingly, depending on the tumour lines,
the HLA-G profile (transcripts and proteins) is different.
[0029] For example, in some melanoma lines, the presence of the
HLA-G2/G4 and G3 isoforms can be observed, which protect these
lines against NK-cell-induced cell lysis, as does the HLA-G1
isoform in other lines.
[0030] In other lines, all of the HLA-G transcripts are detected.
The HLA-G1 protein form is detected by immunofluorescence with an
anti-HLA-G antibody, and inhibits NK lysis.
[0031] The analysis of biopsies from patients with melanomas
reveals a high level of HLA-G transcripts in some tumours (primary
and metastases), associated with a high expression of the HLA-G1
protein which is detectable by immunohistochemistry on frozen
sections using an anti-HLA-G1 antibody.
[0032] This high HLA-G transcription and expression is specific for
tumour tissue and is not detected in healthy tissue.
[0033] In certain melanomas, a dissociation of the transcription of
the soluble (G5) and membrane-bound isoforms is observed. The
analysis of patients reveals 4 HLA-G transcription and expression
profiles.
2 Transcription Membrane-bound forms profiles HLA-G1, G2, G3, G4
Soluble forms Profile 1 - - 2 ++ - 3 - ++ 4 ++ ++
[0034] The expression of the soluble protein is detected by
immunohistochemistry on patients exhibiting profile P4.
[0035] A subject of the present invention is also a method for
establishing the HLA-G expression profile of a solid tumour with a
view to selecting a treatment which is suited to said tumour and/or
with a view to monitoring the evolution of said tumour,
characterized in that it comprises:
[0036] (i) the removal of a tumour sample,
[0037] (ii) the preparation of a histological section from said
sample,
[0038] (iii) the labelling of the cells of the sample obtained in
(ii) with antibodies specific for HLA-G membrane-bound and soluble
isoforms, and
[0039] (iv) the establishment of the HLA-G expression profile of
said sample by detecting the labelled cells.
[0040] A subject of the present invention is also a method for
establishing the HLA-G expression profile of a solid tumour with a
view to selecting a treatment which is suited to said tumour and/or
with a view to monitoring the evolution of said tumour,
characterized in that it comprises:
[0041] (i) the removal of a tumour sample,
[0042] (ii) optionally, the labelling of the cells of said
sample,
[0043] (iii) the lysis of the cells,
[0044] (iv) the bringing of the lysed cells into contact with
various antibodies directed against the class I HLA antigens so as
to possibly form HLA-G isoform/antibody complexes, and
[0045] (v) the establishment of the HLA-G expression profile of
said sample by detecting the complexes formed in step (iv).
[0046] Preferably, in step (iv), immunoprecipitates are obtained
which are separated in step (v) by electrophoresis, transferred
onto membrane and detected.
[0047] In accordance with the invention, said antibodies are
preferably monoclonal antibodies.
[0048] The investigation of an HLA-G expression by certain tumour
cells and/or cells infiltrating the tumour (macrophages, dendritic
cells) makes it possible to better evaluate the potentially
effective type of treatment.
[0049] Specifically, knowledge of the HLA-G expression
transcription profile of a solid tumour is vital for choosing the
best possible treatment and for following the evolution of the
tumour as a function of said treatment.
[0050] A subject of the present invention is also a method for
selecting factors for regulating the transcription and/or the
expression of HLA-Gs by tumour cells (inhibition), this method
being characterized in that it comprises:
[0051] (i) the removal of a tumour sample,
[0052] (ii) the isolation of the tumour cells from said sample,
[0053] (iii) the primary culture of the tumour cells obtained in
(ii),
[0054] (iv) the addition of the substance to be tested,
[0055] (v) the visualization of the effect obtained by establishing
the HLA-G transcription and/or expression profile of said tumour
cells after treatment with said substance to be tested, and
[0056] (vi) the testing in vitro of the effect of the treatment on
the antitumour response (NK and CTL responses).
[0057] Advantageously, the cell lines derived from the biopsies
make it possible to evaluate the sensitivity to a treatment in
vitro, and to determine the agents which are capable of reducing
the HLA-G expression (the screening tool) with the aim of
re-establishing a better antitumour response, in the case of
HLA-G-positive tumour cells.
[0058] Such cells are advantageously used as a model for studying
the transcription and/or the expression of HLA-Gs.
[0059] A subject of the present invention is also a method for
monitoring the evolution of a tumour expressing HLA-G,
characterized in that it comprises assaying the soluble form of
HLA-G in the sera of patients, as a prognostic factor for tumour
dissemination or for the capacity of the tumour to form
metastases.
[0060] Said assaying is preferably carried out by a conventional
immunological method, using anti-soluble HLA-G antibodies.
[0061] A subject of the present invention is also an antitumour
vaccine which can be used for solid tumours expressing at least one
HLA-G isoform, characterized in that it is selected from the group
consisting of autologous tumour cells and a soluble HLA-G5 antigen
or a fragment thereof; such vaccines induce the formation of
tumour-specific cytotoxic T lymphocytes and of anti-HLA-G
antibodies.
[0062] When said vaccine consists of autologous cells (in
particular tumour cells from the individual to be treated which
express at least one HLA-G isoform), said cells are preferably
modified so as to effectively induce the production of anti-HLA-G
antibodies. The cells are, for example, subjected to a cholesterol
treatment or to a hyperbaric treatment.
[0063] Advantageously, said soluble HLA-G antigen, or a fragment
thereof, is coupled to a suitable protein and optionally combined
with an adjuvant such as aluminium hydroxide or calcium
phosphate.
[0064] Said vaccine is preferably administered subcutaneously or
intradermally.
[0065] A subject of the present invention is also an antitumour
composition which can be used for solid tumours expressing at least
one HLA-G isoform, characterized in that it consists essentially of
anti-HLA-G antibodies (passive immunotherapy).
[0066] A subject of the present invention is also an antitumour
composition which can be used for solid tumours expressing at least
one HLA-G isoform, characterized in that it consists essentially of
at least one factor for regulating the transcription and/or the
expression of HLA-Gs.
[0067] According to one advantageous embodiment of said
composition, said regulation factor is selected from the group
consisting of the regulation factors obtained using the method as
defined above, factors which are antagonists of HLA-G activation
agents, which have been identified by the inventors
[interleukin-10, glucocorticoid, interferons, stress action
(radiation, heat shock, heavy metals, oxidative stress)], antisense
nucleic acids and hormonal inhibitors of the transcription and/or
of the expression of said HLA-Gs.
[0068] A subject of the present invention is also products
containing anti-HLA-G antibodies and factors for regulating the
expression of HLA-Gs as combination products for simultaneous or
separate use, or use which is spread out over time, in the
treatment of solid tumours expressing at least one HLA-G
isoform.
[0069] Said regulation factors are as those defined above.
[0070] Besides the preceding arrangements, the invention also
comprises other arrangements which will emerge from the description
which follows, which refers to examples of implementation of the
present invention, as well as to the attached drawings in
which:
[0071] FIG. 1 illustrates:
[0072] (A): the RT-PCR analysis of the HLA-G isoform mRNAs in
melanoma cells. pan-HLA-G primers [primer G.257 (exon 2) and 3G.U
(untranslated 3' end)] are used for the PCR amplification of the
HLA-G transcripts corresponding to the various known HLA-G
isoforms. The cDNA from JEG-3 choriocarcinoma cells and first
trimester trophoblasts (TRO), and peripheral blood mononucleated
cells (PBMC) were used, these cells being used as control cells for
high transcription levels and basal transcription levels of HLA-G,
respectively. IgR, M8, DRAN and M74 correspond to the amplification
of the cDNA of melanoma cell lines. The specific HLA-G bands are
revealed by hybridization with the GR-specific probe, which is
located on exon 2. The bands corresponding to the transcripts
HLA-G1, G2, G3, G4 and G5 are indicated with arrows. The PCR
products which were coamplified during the same reaction using
.beta.-actin primers are detected on the same membrane with the aid
of a .beta.-actin probe;
[0073] (B): this figure corresponds to the RT-PCR detection of
alternative transcripts in melanoma cells. Primer 3 is specific for
the HLA-G2 and soluble HLA-G2 (G6) isoforms which do not possess
exon 3. Primer 3.4 makes it possible to distinguish the HLA-G3 mRNA
transcripts. Primers G.526 and I4b amplify specifically the HLA-G5
transcript, which corresponds to the soluble form. The PCR products
which were coamplified during the same reaction using .beta.-actin
primers are detected on the same membrane with the aid of a
.beta.-actin probe;
[0074] (C): this figure corresponds to the RT-PCR analysis of the
HLA-G mRNA in melanoma cells. pan-HLA-G primers [primer G.257 (exon
2) and 3G.U (untranslated 3' end)] are used for the PCR
amplification of the HLA-G transcripts corresponding to the various
known HLA-G isoforms. The cDNA from JEG-3 choriocarcinoma cells was
used, these cells being used as control cells for high
transcription levels. IgR, M8 and DRAN correspond to the
amplification of the cDNA melanoma cell lines. The specific HLA-G
bands are revealed by hybridization with the GR-specific probe,
which is located on exon 2. The bands corresponding to the
transcripts HLA-G1, G2, G3, G4 and G5 are indicated with arrows.
The PCR products which were coamplified during the same reaction
using .beta.-actin primers are detected on the same membrane with
the aid of a .beta.-actin probe.
[0075] FIG. 2 illustrates the RT-PCR analysis of the HLA-G isoform
mRNAs in the biopsies of melanoma metastases (in vivo and ex vivo
analysis of skin). The pan-HLA-G primers G.257 and 3G.U are used
for the RT-PCR amplification of the HLA-G transcripts from skin
metastases ex vivo (MEL) and from biopsies of healthy skin from the
same patient (HS); JEG-3 cells and first trimester trophoblasts are
used as controls (high level of HLA-G transcription). The HLA-G
specific bands are revealed by hybridization with a GR-specific
probe which is located in exon 2. The bands corresponding to the
transcripts HLA-G1, G2, G3, G4 and G5 are indicated with
arrows.
[0076] FIG. 3 illustrates the detection of the HLA-G1 proteins in
JEG-3 cells but not in IGR and M8 melanoma cells, with the aid of
the monoclonal antibody W6/32: the biotinylated surface proteins of
melanoma and JEG-3 cells are immunoprecipitated using the
monoclonal antibody W6/32; the immunoprecipitates are separated by
SDS-PAGE at 12% and transferred onto cellulose membrane. The class
I surface molecules are detected with streptavidin-conjugated
peroxidase.
[0077] FIG. 4 illustrates the immunoprecipitation of the HLA-G
isoforms of IGR melanoma cells with an antibody directed against
the heavy chain of free HLA-G and with the monoclonal antibodies
4H84 and HCA2. The cells are labelled for 30 min and
immunoprecipitated with the specific antibodies, and the
immunoprecipitates are analysed by SDS-PAGE at 10%. The antibody
4H84, which reacts with the HLA-G heavy chain (39-KDa band in JEG-3
cells), exhibits cross-reactions with the HLA-A, -B and/or -C heavy
chains (45-KDa band in all the cells tested).
[0078] FIG. 5 illustrates:
[0079] (A): the effect of HLA-G expression in the IGR melanoma on
sensitivity to lysis by the clone YT2C2-PR. K562 cells which are
transfected either with the vector alone, or with the HLA-G1 vector
containing the cDNA, or the HLA-G2 vector and the M8, M74, IGR and
DRAN lines are used as target cells (T). The clone YT2C2-PR is used
as an effector cell (E) in an effector cell/target cell (E/T) ratio
of 50/1. The results are expressed as the percentage of lysis
recorded in 4 h in a chromium 51-release assay. Spontaneous release
never exceeds 10% of the maximum release. This experiment is
carried out at least 5 times and, each time, produces the same
results;
[0080] (B): the inhibition of the lysis induced by the clone
YT2C2-PR is due to an "off" signal which is transmitted by the IGR
and DRAN cells. The M8 line is used as a target cell (T) and is
chromium labelled. Clone YT2CT-PR is used as an effector cell (E)
in an E/T ratio of 50:1. IGR and DRAN cells are added as inhibitor
cells in an inhibitor cell/target cell ratio of 100, 50 and 25:1. 0
indicates that no IGR cell was added in the assay;
[0081] (C): the inhibition of the lysis induced by HLA-G-positive
melanoma cells (target cells T). This figure illustrates more
particularly the effect of HLA-G expression by IGR and DRAN
melanoma cells on sensitivity to lysis by the clone YT2C2-PR.
Several cell lines which are B-EBV, HLA-G negative [HOM (A3, B27,
Cw1), BM (A29, B61 Cw2), SPO (A3, B7, Cw7), SWE (A2, B44, Cw5)] are
lysed by the clone YT2C2-PR. This clone is used as an effector cell
(E) in an E/T ratio of 50/1. The results are expressed as the
percentage of lysis recorded in 4 h in a chromium 51-release assay.
Spontaneous release never exceeds 10% of the maximum release;
[0082] (D) and (E): these figures show that the M8 HLA-G-negative
tumour cells which are transfected with the cDNAs encoding the
molecules G1, G2, G3 and G4 inhibit NK lysis (FIG. 5E) and the
cytotoxic T responses (FIG. 5D). FIG. 5D comprises, on the x-axis,
the effector cells (E) (restricted HLA-A2 lines specific for an
influenza peptide)/target cells (T) (transfected M8 lines) ratios
and, on the y-axis, the percentage of specific lysis. The table
below corresponds to the values obtained in this figure.
3 E/T ratio M8-RSV G1 G2 G3 G4 Genomic 15/1 55% 8% 39% 12% 17% 30%
7/1 52% 6% 42% 10% 14% 25% 3/1 29% 2% 30% 6% 12% 23%
[0083] FIG. 5E comprises, on the x-axis, the effector cells (E)
(clone YT2C2-PR)/target cells (T) (transfected M8 lines) ratios
and, on the y-axis, the percentage of-specific lysis.
[0084] FIG. 6 illustrates the detection of HLA-G transcripts in
biopsies of human melanomas. The RT-PCR amplifications are carried
out, using the abovementioned primers G.257 and G.3U, on biopsies
of healthy skin (HS) and on healthy lymph nodes (HLN), on the one
hand, and biopsies of lymph node metastases (LNM1 and LMN2). JEG-3
choriocarcinoma cells are used as control cells for high
transcription levels. Specific HLA-G bands are revealed by
hybridization with the GR-specific probe which is located on exon
2. The bands corresponding to the transcripts HLA-G1, G2, G3, G4
and G5 are indicated with arrows. The PCR products which were
coamplified during the same reaction using the .beta.-actin primers
are detected on the same membrane with the aid of a .beta.-actin
probe.
[0085] FIG. 7 illustrates the RT-PCR analysis of the HLA-G
transcripts in the biopsies of primary melanoma tumours and in the
derived MPP5 primary cell cultures (ex vivo analysis). The
abovementioned pan-HLA-G primers are used for the amplification
from biopsies of healthy skin (HS1), from skin primary tumours
(SPT1) and from tumours in regression (R1) which are obtained from
the same patient, and from derived primary cells obtained from a
skin tumour tissue (MPP5). The MPP5 cells and the SPT1 biopsy
exhibit similar HLA-G transcription levels. JEG-3 cells are used as
controls for high levels of HLA-G transcription. The HLA-G-specific
bands are revealed by hybridization with a GR-specific probe which
is located in exon 2. The bands corresponding to the transcripts
HLA-G1, G2, G3, G4 and G5 are indicated with arrows. The PCR
products which were coamplified during the same reaction using the
.beta.-actin primers are detected on the same membrane with the aid
of a .beta.-actin-specific probe.
[0086] FIG. 8 illustrates:
[0087] (A) the specific detection of HLA-G5 transcripts by RT-PCR
in biopsies of melanomas. The amplification of the HLA-G5
transcript from healthy lymph nodes (HLN), from a skin primary
tumour (SPT1) and from two biopsies of lymph node metastases (LNM1
and LNM2) is carried out with the aid of the primers G.526 and
G.i4b. The band corresponding to the HLA-G5 transcript is detected
by hybridization with an I4F probe which is located in intron 4;
JEG-3 cells are used as controls (high levels of HLA-G5
transcription). The band corresponding to the HLA-G5 transcript is
indicated with arrows. The PCR products which were coamplified in
the same reaction using the .beta.-actin primers are detected on
the same membrane with a .beta.-actin-specific probe;
[0088] (B) the immunohistochemical analysis of the soluble HLA-G
expression in the LNM1 biopsy. Frozen and acetone-fixed sections of
the LNM1 biopsy are positively stained with the anti-melanoma
antibody HMB45 (DAKO) and the anti-soluble HLA-G antibody 16G1,
whereas the negative control gives no staining, using the Envision
anti-mouse, peroxidase system (DAKO) and AEC as substrate.
[0089] It should be fully understood, however, that these examples
are given only by way of illustration of the subject of the
invention, of which they in no way constitute a limitation.
EXAMPLE 1
Analysis of the HLA-G Profiles of Various Tumour Lines and Study of
the Inhibition of Lysis by NK Cells.
[0090] A/ Material and Methods
[0091] 1/ Cell lines
[0092] The K562 human erythroleukaemia cell line (ATCC) and the
immature T cell leukaemia line (clone YT2C2-PR) with NK activity
are maintained in an RPMI 1640 medium supplemented with
heat-inactivated foetal calf serum at 10%, 2 mM L-glutamine, 1
.mu.g/ml of gentamicin and fungizone (Sigma, Saint-Quentin,
France), and cultured at 37.degree. C. in a humidified incubator in
an atmosphere which is enriched with 5% CO.sub.2. The K562
transfectants are selected in a medium containing 1 mg/ml of
geneticin (G418 sulphate, Sigma).
[0093] The HLA-G-positive human choriocarcinoma cell line, named
JEG-3 (ATCC), is cultured in a DMEM medium (Sigma) supplemented
with heat-inactivated foetal calf serum at 10%, antibiotics and 2
mM L-glutamine. The cell lines do not contain mycoplasmas.
[0094] Besides the abovementioned lines, use is made of:
[0095] IGR (HLA-A2, A3, B58/male), M74 (HLA-A1, A2, B8,
B14/female), M8 (HLA-A1, A2, B12 and B40/male) and DRAN (HLA-A2,
A3, B7, B35, CW5, CW7) melanoma lines,
[0096] first trimester trophoblastic tissues, which are obtained
after abortion; these tissues are cut up into thin slices and
immediately used to extract the RNA, and
[0097] peripheral blood mononucleated cells (PBMC), which are
obtained from healthy volunteers and isolated on a Ficoll-Hypaque
1077 density gradient.
[0098] 2/ Monoclonal Antibodies
[0099] The following antibodies are used:
[0100] W6/32: anti-.beta.2-m-associated class I HLA .alpha. chain
IgG2a (Sigma); HCA2: anti-HLA-A and G IgG and anti-HLA-G IgG, 87G,
4H84 and 16G1.
[0101] 3/ RT-PCR
[0102] Total RNA is extracted from 10.sup.7 cells using the NOW RNA
reagent (Biogentex, Inc.) in accordance with the manufacturer's
recommendations. The quantity of the RNA is verified by
electrophoresis on denaturing 1.5% agarose gel. The cDNAs are
prepared from 10 .mu.g of total RNA treated with DNAse I
(Boehringer Mannheim) using an oligo-(dT).sub.12-18 primer and the
M-MLV reverse transcriptase (GIBCO-BRL). The HLA-G-specific RT-PCR
amplifications are carried out using the following primers: G.257
(exon 2) and G3.U (3' UT) (Ishitani A. et al., Proc. Natl. Acad.
Sci., 1992, 89, 3947-3951; Kirszenbaum M. et al., Proc. Natl. Acad.
Sci., 1994, 91, 4209-4213 and Moreau P. et al., C. R. Acad. Sci.,
1995, 318, 837-842) so as to detect all the HLA-G mRNA isoforms. An
amplification specific for each HLA-G mRNA form is carried out
using the following sets of primers:
[0103] G.526 (exon 3) and G3.U (3' UT) for the isoforms G1, G4 and
G5;
[0104] G.526 (exon 3) and G.i4b (intron 4) for the isoform G5;
[0105] G.-3 (partially covering exons 2 and 4) and G3.U (3' UT) for
the isoforms G2 and G6;
[0106] G.3-4 (partially covering exons 2 and 5) and G3.U (3' UT)
for the isoform G3.
[0107] The cDNAs of the conventional class I HLAs are amplified as
described in King et al. (J. Immunol., 1996, 156, 2068-2076), using
a unique 5' primer, HLA-5P2, and 3 3' primers, HLA-3pA, HLA-3pB and
HLA-3pC, which amplify the mRNAs HLA-A, HLA-B and HLA-C,
respectively.
[0108] The DRA specific primers are described in King et al.,
mentioned above.
[0109] A coamplification of the .beta.-actin cDNA is carried out in
each experiment using the Clontech test (16 cycles), so as to
evaluate the comparative amounts of RNA in the samples. The PCR
products are analysed by electrophoresis on 1% agarose gel and
stained with ethidium bromide. The specificity of the PCR products
is confirmed by alkaline blotting of the fragments in 0.4 N NaOH on
nylon membranes (Hybond N+, Amersham, France).
[0110] The specific HLA-G probes are as follows:
[0111] GR, specific for exon 2,
[0112] G.647 F (5'-CCACCACCCTGTCTTTGACT: specific for exon 4),
[0113] G.I4 F (GAGGCATCATGTCTGTTAGG: specific for intron 4),
and
[0114] G.927 F (5'-ATCATGGGTATCGTTGCTGG: specific for exon 5).
[0115] The other probes are as follows:
[0116] HLA-A-specific probe (5'GGAGGACCAGACCCAGGACACG),
[0117] HLA-B-specific probe (5'AGCTCCGATGACCACAACTGC)
[0118] HLA-C-specific probe (5'TGTCCTAGCTGCCTAGGAG) and
[0119] HLA-DRA-specific probe (TGTGATCATCCAGGCCGAG).
[0120] The filters are exposed onto Kodak films (Biomax) with
amplifying screens for 4 to 16 hours at -80.degree. C.
[0121] 4/ Immunoprecipitation of the Surface Biotinylated Proteins
and Western Blot.
[0122] The surface proteins are labelled with biotin. After washing
in PBS, 1.5.times.10.sup.7 cells are incubated in 1 ml of cold PBS
containing 5 ml of NHS-SS-biotin (Pierce, Rockford, Ill) for 15 min
at 4.degree. C. The residual active groups are inhibited in 50 mM
NH.sub.4Cl for 10 min at 4.degree. C. The cells are lysed in 1%
Triton X100/PBS. The proteins which are precipitated with the W6/32
antibody are separated on 12% SDS-PAGE, transferred onto
nitrocellulose membrane and placed together with a horseradish
peroxidase-streptavidin conjugant. After thorough washing of the
membrane, the staining reaction is carried out using the ECL
Western blotting detection reagent (Amersham, France), after which
the membrane is exposed to a Kodak film at room temperature.
[0123] 5/ Cytotoxicity Assays
[0124] The cytolytic activity of peripheral blood mononucleated
cells, of NK cells and of YT2C2-PR cells (effector cells or E)
towards the HLA-G transfectants (target cells or T) is estimated
with the aid of chromium 51 4-hour release assays in which the
effector cells are mixed with 5.times.10.sup.3 target cells which
are labelled with chromium 51 (100 .mu.Ci of sodium
.sup.51Cr-chromate Amersham, UK), at various E/T ratios, in
microtitration plates which have a U-shaped bottom.
[0125] After 4 hours at 37.degree. C. in a humidified incubator
containing 5% CO.sub.2, 100 .mu.1 of supernatant are removed for
liquid phase scintillation counting (Wallac 1450 Microbeta,
Pharmacia, France). The percentage of specific lysis is calculated
as follows:
percentage of specific lysis=[(cpm in the experimental well-cpm of
spontaneous release)/(cpm of maximum release-cpm of spontaneous
release)].times.100.
[0126] The spontaneous release is determined by incubating the
labelled target cells (T) with the medium. The maximum release is
determined by solubilizing the target cells in 0.1 M HCl. In all
the experiments, the spontaneous release is less than 10% with
respect to the maximum release. The results are presented as the
means of three samples. In the experiments in which the monoclonal
antibodies are used to block HLA-G-NK interaction, the target cells
are incubated with the corresponding monoclonal antibody, and then
washed and incubated with a goat anti-mouse F(ab').sub.2 antibody
(Jackson Immunoresearch, USA) in order to avoid antibody-dependent
cell cytotoxicity (ADCC) by interaction of the receptors for the
immunoglobulin Fc fragment, which are expressed on NK cells, with
the primary antibody used. The monoclonal antibody toxicities are
also verified in each assay and are always less than 3%.
[0127] II-Results
[0128] 1/ Identification of the Various HLA-G Transcripts in
Melanoma Cell Lines.
[0129] The HLA-G cDNAs of 4 melanoma cell lines (IGR, M8, M74 and
DRAN) are amplified with the aid of the previously described
primers (A. Ishitani et al., Proc. Natl. Acad. Sci. USA, 1992, 89,
3947-3951; M. Kirszenbaum et al., Proc. Natl. Acad. Sci. USA, 1994,
91, 4209-4213), which are derived from the sequences which are
specific for exon 2 and for the untranslated 3' region (see
Materials and Methods) (FIG. 1).
[0130] The JEG-3 choriocarcinoma line and trophoblastic cells,
which exhibit high levels of HLA-G transcripts, are used as
positive controls and the peripheral blood mononucleated cells
(PBMC) of healthy volunteers are used as negative controls (low
levels of HLA-G transcripts).
[0131] The hybridization of the PCR products made it possible to
identify significant levels of HLA-G MRNA in 2 melanoma cell lines,
namely IGR and M74, whereas no signal can-be detected in the M8
melanoma cell line.
[0132] In the JEG-3 cells and trophoblasts, all the HLA-G
transcripts are detected (FIGS. 1A and 1C).
[0133] In the IGR and DRAN melanoma cells, all the transcripts are
also detected by the pan-HLA-G primers (FIGS. 1A and 1C).
[0134] However, the pan-HLA-G primers do not make it possible to
distinguish between the HLA-G1 and HLA-G5 signals, which are both
present, in a band corresponding to 1000 bp, nor between the HLA-G2
and HLA-G1 signals, which comigrate in the form of a 600-bp
fragment. RT-PCR identification makes it possible to isolate the
isoforms with the aid of specific primers (P. Moreau et al., C. R.
Acad. Sci., 1995, 318, 837-842) (see Materials and Methods).
[0135] The IGR and DRAN cells express all the HLA-G isoforms in the
form of transcripts, HLA-G4 and HLA-G5 being expressed at low
levels (FIG. 1B).
[0136] In the M74 melanoma cell line, the pan-HLA-G primers detect
bands corresponding to HLA-G1 and HLA-G5 (1000 bp) (strong
signals), a signal for HLA-G2 and G4 (600 bp), but no signal for
HLA-G3 (300 bp) (FIG. 1A). The primers for the specific isoforms
reveal that, in these cells, the G1 and G4 isoforms are more
abundant than in the PBMCs, while the level of G5 transcript is
comparable to that observed in the PBMCs.
[0137] Low levels of HLA-G2 and HLA-G6 (soluble form of HLA-G2)
mRNA are detected in these M74 cells, while specific amplification
of the HLA-G3 transcript confirms the absence of HLA-G3 which is
observed with the pan-HLA-G primers in these cells (FIGS. 1A and
1B).
[0138] No HLA-G hybridization signal is observed in M8 cells (FIGS.
1A and 1B).
[0139] 2/ Analysis of the HLA-G Proteins in Melanoma Cells.
[0140] In order to determine whether the HLA-G transcripts which
are detected in the melanomas are translated into HLA-G proteins,
immunoprecipitation studies were carried out with various anti-HLA
class I monoclonal antibodies.
[0141] The comparison is performed in the presence of a positive
control (JEG-3 cell) and a negative control (M8 melanoma
cells).
[0142] The results of immunoprecipitation with the W6/32 monoclonal
antibody are illustrated in FIG. 3.
[0143] With the JEG-3 cells, the W6/32 antibody immunoprecipitated
two proteins of 45 KDa (HLA-C molecule) and of 39 KDa (membrane
bound HLA-G1 isoform).
[0144] In the IGR and M8 cells, only one protein of 45 KDa is
detected.
[0145] Similar results are obtained by immunoprecipitation of
biotinylated surface proteins (FIG. 3).
[0146] These data show that the HLA-G1 protein is not expressed in
the IGR cells, even though the latter express the corresponding
mRNA.
[0147] However, the absence of HLA-G1 protein in the IGR cells does
not exclude the expression of 3 other HLA-G isoforms (HLA-G2, G3
and G4).
[0148] These proteins cannot be revealed by the W6/32 monoclonal
antibody, because of their inability to associate with
.beta.2m.
[0149] To reveal these proteins, immunoprecipitation of
methionine-labelled (.sup.35S-methionine) proteins is carried out
using monoclonal antibodies which recognize free HLA-G, denatured
HLA-G and HLA-A (HCA2 antibodies) and an epitope which is located
in the .alpha.1 domain which is present in all the isoforms of the
HLA-G protein (anti-HLA-G Ig monoclonal antibody).
[0150] The monoclonal antibody reveals the presence of the 39-KDa
HLA-G1 protein in the JEG-3 and DRAN cells, and its absence in the
IGR cells (FIG. 4).
[0151] Additional bands, which migrate at 32 to 34 KDa and at 18
KDa, and which correspond to the size of the HLA-G2 protein and/or
of the HLA-G4 or G3 protein, respectively, are detected in the IGR
cells both with the anti-HLA-G Ig monoclonal antibody and with the
HCA2 antibody (FIG. 4).
[0152] The additional bands, which are specific to the HLA-G
protein, are not observed in the M74 and M8 cells, which do not
exhibit the corresponding HLA-G transcripts (FIG. 4).
[0153] 3/ Protection of the IGR Line against NK Cell-induced
Cytolysis.
[0154] The YT2C2-PR cells are used as NK effector cells.
[0155] The IGR cell line, which expresses the HLA-G2 and/or G4 and
G3 isoforms, and the DRAN line, which expresses HLA-G1, abolish
clone YT2C2-PR-induced lysis (FIG. 5).
[0156] The M74 melanoma cell line, which expresses the conventional
MHC class I antigens, but which exhibits a selective deficiency in
the transcription and expression of the HLA-G2 and HLA-G3 isoforms,
is lysed by the clone YT2CT-PR.
[0157] Lysis is also observed with the M8 cell line, which
expresses the conventional MHC class I antigens, but which
transcribes no HLA-G mRNA (FIGS. 1 and 5).
[0158] In order to show that only the HLA-Gs are involved in this
inhibition of NK cell-induced lysis, several EBV-B cell lines which
express no HLA-G, but which share at least one HLA-A, B or C allele
with the IGR line, are used as target cells.
[0159] All these EBV-B lines are lysed by the clone YT2C2-PR,
showing that the HLA-A, B and C antigens are not involved in
protecting the IGR and DRAN melanomas against the YT2C2-PR lysis
(FIG. 5).
[0160] In order to show that the clone YT2C2-PR-induced lysis, by
the IGR cells, is not due to a signal which is transmitted by this
cell line, but is indeed linked to an intrinsic resistance of these
IGR cells to NK cells, the IGR cells were used as inhibitors in a
cytotoxicity assay in which the target cells (T) are M8 cells and
the YT2C2-PR cells are the effector cells (E).
[0161] FIG. 5B shows that the IGR cells effectively inhibit lysis
of the M8 cells by the clone YT2C2-PR; this inhibition is
proportional to the number of IGR cells used for the competitive
assay.
EXAMPLE 2
Detection of HLA-G Transcripts and Proteins in Melanoma
Biopsies.
[0162] A/ Material and Methods
[0163] 1/ Tumour Samples
[0164] Biopsies are performed on tissue samples from patients.
[0165] Immediately after removal, the samples are frozen in liquid
nitrogen and stored until extraction of the RNA.
[0166] 2/ Immunohistochemistry
[0167] Standard methods are used to carry out the
immunohistochemistry on sections which are prepared from the
melanoma biopsies, fixed with acetone, rinsed in PBS and blocked in
normal rabbit serum (DAKO) in PBS.
[0168] The samples are incubated with the primary antibody for 1 h
at room temperature, and are then incubated with a secondary
antibody (FITC-conjugated rabbit anti-mouse Ig) (DAKO).
[0169] The sections are counterstained with a nuclear dye (DAPI,
Sigma) and prepared in a suitable medium. The fluorescence is
analysed using an Io24 MRC confocal microscope (Bio-Rad). The
following antibodies are used: W6/32:
anti-.beta.2-microglobulin-associated HLA-G class I heavy chain
IgG2a (Sigma) and 87G: anti-HLA-G IgG2b which detects the HLA-G1
isoform.
[0170] The other techniques are identical to those in Example
1.
[0171] B/ Results
[0172] 1/ Analysis of HLA-G Transcription in Melanoma Biopsies Ex
vivo.
[0173] In some melanoma biopsies, all the HLA-G transcripts are
detected at significant levels, whereas only the 1000-bp band is
detected in the healthy human skin (FIGS. 2 and 6). These results
were confirmed on other biopsies and show that the significant
transcription levels observed in the melanoma cells are specific
for the latter and cannot be observed in healthy tissue.
[0174] More precisely, high levels of HLA-G transcription are
detected specifically in primary tumours and in metastases, whereas
basal levels of HLA-G transcripts and an absence of expression of
HLA-G protein are observed in healthy skin or in normal lymph nodes
(FIG. 6A).
[0175] The analysis of the healthy skin (HS1), of the skin primary
tumours (SP1) and of a tumour regression site (R1) in a skin
primary tumour from the same patient enables the detection of a
high level of HLA-G transcripts and of protein expression at the
primary tumour site, whereas both the healthy skin and the tumour
regression site exhibit basal levels of HLA-G transcripts and a
complete absence of the expression of HLA-G1 proteins (FIG. 7).
[0176] The cultured primary cells (MPP5) which are derived from the
primary tumour SP1 also exhibit high levels of HLA-G transcripts
(FIG. 7).
[0177] 2/ Analysis of Soluble HLA-G Transcription in Melanoma
Biopsies Ex vivo
[0178] Specific amplification of the transcripts (mRNA)
corresponding to the HLA-G5 soluble isoform in the melanoma
biopsies shows that high levels of HLA-G5 transcripts are detected
in certain melanoma biopsies which have been shown to exhibit high
levels of transcripts corresponding to the membrane-bound isoforms
of HLA-G (FIG. 8).
[0179] Moreover, in other cases, a dissociation is observed between
the HLA-G5 levels and the levels of the other HLA-G transcripts: in
melanoma biopsies in which high HLA-G1, G2, G3 and G4 levels have
previously been observed, HLA-G5 transcripts are not observed.
[0180] The skin primary tumour SP1 and the corresponding cultured
cells MPP5, as well as the lymph node metastases LNM2, exhibit high
levels of HLA-G transcripts corresponding to membrane-bound HLA-G
isoforms (FIG. 8) whereas HLA-G5 transcripts are not detected in
the same sample.
[0181] 3/ Analysis of the membrane-bound and soluble proteins in
melanoma biopsies
[0182] High levels of HLA-G transcripts are correlated with the
specific detection of the expression of HLA-G protein by an
anti-HLA-G monoclonal antibody (antibody 87G) in melanoma biopsies.
Specifically, the immunohistochemical analysis of the HLA-G
expression in a metastatic lymph node (LNM2) biopsy makes it
possible to observe positive staining of LNM2 both with the
antibody 87G and with the antibody W6/32, whereas the negative
control, which consists of healthy skin from the same patient, is
not stained with the anti-HLA-G antibody.
[0183] In order to refine this study, an antibody which
specifically detects the soluble HLA-G protein, the antibody 16G1
(Lee et al., Immunity, 1995, 3, 591-600), makes it possible to
demonstrate the expression of the soluble HLA-G protein in the
lymph node biopsy of a patient exhibiting high levels of HLA-G5
transcripts (FIG. 8).
[0184] The immunohistochemical analysis enables the staining of
this biopsy, while no detectable expression is observed, using the
same antibody, in a melanoma biopsy of a patient exhibiting high
levels of the other HLA-G isoforms.
[0185] Specifically, the immunohistochemical analysis of the
expression of soluble HLA-G in the LNM2 biopsy shows that
acetone-fixed LNM2 biopsy sections are positively stained with the
anti-melanoma antibody HMB45 (DAKO, Glostrup,; Skelton et al., Am.
J. Dermatopathol., 1991, 13, 543-550) and the anti-soluble HLA-G
antibody 16G1, whereas the negative control is not stained.
[0186] As emerges from the above, the invention is in no way
limited to the modes of implementation, execution and application
which have just been described more explicitly; on the contrary, it
encompasses all the variants thereof which may occur to persons
skilled in the art, without departing from the context or the scope
of the present invention.
Sequence CWU 1
1
23 1 20 DNA Artificial Sequence synthetic DNA 1 ggaagaggag
acacggaaca 20 2 22 DNA Artificial Sequence synthetic DNA 2
ggctggtctc tgcacaaaga ga 22 3 20 DNA Artificial Sequence synthetic
DNA 3 ccaatgtggc tgaacaaagg 20 4 22 DNA Artificial Sequence
synthetic DNA 4 ggctggtctc tgcacaaaga ga 22 5 20 DNA Artificial
Sequence synthetic DNA 5 accagagcga ggccaagcag 20 6 22 DNA
Artificial Sequence synthetic DNA 6 ggctggtctc tgcacaaaga ga 22 7
20 DNA Artificial Sequence synthetic DNA 7 accagagcga ggccaacccc 20
8 22 DNA Artificial Sequence synthetic DNA 8 ggctggtctc tgcacaaaga
ga 22 9 20 DNA Artificial Sequence synthetic DNA 9 accagagcga
ggccaacccc 20 10 20 DNA Artificial Sequence synthetic DNA 10
aaaggaggtg aaggtgaggg 20 11 20 DNA Artificial Sequence synthetic
DNA 11 ccaatgtggc tgaacaaagg 20 12 20 DNA Artificial Sequence
synthetic DNA 12 aaaggaggtg aaggtgaggg 20 13 21 DNA Artificial
Sequence synthetic DNA 13 ggtctgcagg ttcattctgt c 21 14 20 DNA
Artificial Sequence synthetic DNA 14 ccaccaccct gtctttgact 20 15 20
DNA Artificial Sequence synthetic DNA 15 gaggcatcat gtctgttagg 20
16 20 DNA Artificial Sequence synthetic DNA 16 atcatgggta
tcgttgctgg 20 17 20 DNA Artificial Sequence synthetic DNA 17
ccaccaccct gtctttgact 20 18 20 DNA Artificial Sequence synthetic
DNA 18 gaggcatcat gtctgttagg 20 19 20 DNA Artificial Sequence
synthetic DNA 19 atcatgggta tcgttgctgg 20 20 22 DNA Artificial
Sequence synthetic DNA 20 ggaggaccag acccaggaca cg 22 21 21 DNA
Artificial Sequence synthetic DNA 21 agctccgatg accacaactg c 21 22
19 DNA Artificial Sequence synthetic DNA 22 tgtcctagct gcctaggag 19
23 19 DNA Artificial Sequence synthetic DNA 23 tgtgatcatc caggccgag
19
* * * * *