U.S. patent application number 10/658093 was filed with the patent office on 2004-10-21 for constructs for gene expression analysis.
This patent application is currently assigned to Gene Stream Pty Ltd. Invention is credited to Daly, John.
Application Number | 20040209274 10/658093 |
Document ID | / |
Family ID | 23049549 |
Filed Date | 2004-10-21 |
United States Patent
Application |
20040209274 |
Kind Code |
A2 |
Daly, John |
October 21, 2004 |
Constructs for Gene Expression Analysis
Abstract
The present invention relates generally to constructs and their
use in gene expression or gene regulation assays. More
particularly, the present invention provides expression vectors
and/or reporter vectors providing kinetics of protein expression
with improved temporal correlation to promoter activity. Even more
particularly, the invention provides expression vectors comprising
a transcribable polynucleotide which comprises a sequence of
nucleotides encoding a RNA element that modulates the stability of
a transcript corresponding to the transcribable polynucleotide. The
present invention provides, inter alia, novel vectors, useful for
identifying and analysing cis- and trans-acting regulatory
sequences/factors as well as vectors and genetically modified cell
lines or organisms that are particularly useful for drug screening
and drug discovery.
Inventors: |
Daly, John; (City Beach,
AU) |
Correspondence
Address: |
KNOBBE MARTENS OLSON & BEAR LLP
2040 MAIN STREET
FOURTEENTH FLOOR
IRVINE
CA
92614
US
|
Assignee: |
Gene Stream Pty Ltd
96 Chipping Road
City Beach
AU
6015
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 0115704 A1 |
June 17, 2004 |
|
|
Family ID: |
23049549 |
Appl. No.: |
10/658093 |
Filed: |
September 9, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10658093 |
Sep 9, 2003 |
|
|
|
PCT/AU02/00351 |
Mar 8, 2002 |
|
|
|
60/274,770 |
Mar 9, 2001 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
435/7.2 |
Current CPC
Class: |
A01H 6/00 20180501; C12Q
1/68 20130101; C12N 15/79 20130101; A01K 67/027 20130101 |
Class at
Publication: |
435/006 ;
435/007.2 |
International
Class: |
C12Q 001/68; G01N
033/53; G01N 033/567 |
Claims
What is Claimed is:
1. A method for assaying the activity of a transcriptional control
element, the method comprising: expressing from the transcriptional
control element a polynucleotide that encodes a polypeptide wherein
said polynucleotide is operably connected to a nucleic acid
sequence that encodes a RNA element that modulates the stability of
a transcript encoded by the polynucleotide; and measuring the level
or functional activity of the polypeptide produced from the
expression.
2. A method according to claim 1, wherein the RNA element is a
destabilising element which reduces the stability of the
transcript.
3. A method according to claim 1, wherein the polynucleotide and
the nucleic acid sequence are heterologous to each other.
4. A method according to claim 1, wherein the polypeptide has an
intracellular half-life of less than about 3 hours.
5. A method according to claim 1, wherein the polypeptide comprises
a protein-destabilising element.
6. A method according to claim 5, wherein the protein-destabilising
element is selected from the group consisting of: a PEST sequence,
an N-terminal destabilising amino acid, an ubiquitin, a
biologically active fragment thereof, a variant, and a derivative
of these.
7. A method according to claim 1, wherein the polypeptide is a
reporter protein.
8. A method according to claim 7, wherein the reporter protein is
selected from an enzymatic protein or a protein associated with the
emission of light.
9. A method according to claim 7, wherein the reporter protein is a
fluorescent protein or a luminescent protein.
10. A method according to claim 1, wherein the expression of the
polynucleotide is carried out in the presence of a test agent.
11. A method according to claim 10, wherein the method further
comprises: comparing the level or functional activity of the
polypeptide produced in the presence to the level or functional
activity of the polypeptide produced in the absence of the test
agent.
12. A method according to claim 10, wherein the expression of the
polynucleotide is carried out in a first cell type or condition and
in a second cell type or condition, wherein a difference in the
level or functional activity of the polypeptide in the presence of
the test agent between the cell types or conditions provides
information on the effect of the test agent on the cell types or
conditions.
13. A method for assaying the activity of a transcriptional control
element, the method comprising: expressing from the first
transcriptional control element in a first construct a first
polynucleotide that encodes a first polypeptide and that is
operably connected to a nucleic acid sequence that encodes a RNA
element that modulates the stability of a transcript encoded by the
first polynucleotide; measuring the level or functional activity of
the first polypeptide produced from the first construct; expressing
from a second transcriptional control element in a second construct
a second polynucleotide that encodes a second polypeptide and
wherein said second polynucleotide is operably connected to a
nucleic acid sequence that encodes a RNA element that modulates the
stability of a transcript encoded by the second polynucleotide,
wherein the expression of the second polynucleotide is carried out
in the presence or absence of the test agent, and wherein the
second transcriptional control element is different than the first
transcriptional control element; measuring the level or functional
activity of the second polypeptide produced from the second
construct; and comparing the level or functional activity of the
second polypeptide with the level or functional activity of the
first polypeptide in the presence or absence of the test agent.
14. A method according to claim 13, wherein the first construct and
the second construct are both present on a single vector.
15. A method according to claim 13, wherein the first construct and
the second construct are present on different vectors.
16. A method according to claim 13, wherein the first polypeptide
and the second polypeptide are detectably distinguishable.
17. A method according to claim 13, wherein the first construct and
the second construct are contained within a single cell.
18. A method according to claim 13, wherein the first construct and
the second construct are contained within different cells.
19. A method according to claim 13, wherein at least one of the
first and second polypeptides has an intracellular half-life of
less than about 3 hours.
20. A method according to claim 13, wherein both the first and
second polypeptides have an intracellular half-life of less than
about 3 hours.
21. A method according to claim 1, wherein the activity of the
transcriptional control element is a measure of a cellular
event.
22. A method according to claim 21, wherein the cellular event is
selected from cell cycle progression, apoptosis, immune function,
modulation of a signal transduction pathway, modulation of a
regulatory pathway, modulation of a biosynthetic pathway, toxic
response, cell differentiation and cell proliferation.
23. A construct for assaying the activity of a gene
expression-modulating element or for identifying elements of this
type or agents that modulate their activity, the construct
comprising in operable linkage: a polynucleotide that encodes a
polypeptide and a nucleic acid sequence that encodes a RNA element
that modulates the stability of a transcript encoded by the
polynucleotide, and a site for introducing, the gene
expression-modulating element in operable connection with the
polynucleotide and the nucleic acid sequence.
24. A construct according to claim 23, wherein the RNA element is a
destabilising element which reduces the stability of the
transcript.
25. A construct according to claim 23, wherein the polynucleotide
and the nucleic acid sequence are heterologous to each other.
26. A construct according to claim 23, wherein the polypeptide has
an intracellular half-life of less than about 3 hours.
27. A construct according to claim 23, wherein the polypeptide
comprises a protein-destabilising element.
28. A construct according to claim 27, wherein the
protein-destabilising element is selected from the group consisting
of: a PEST sequence, an N-terminal destabilising amino acid, an
ubiquitin, a biologically active fragment thereof, a variant, and a
derivative of these.
29. A construct according to claim 23, wherein the RNA element is a
stabilising element which increases the stability of the
transcript.
30. A construct according to claim 23, wherein the polypeptide is a
reporter protein.
31. A construct according to claim 30, wherein the reporter protein
is selected from an enzymatic protein or a protein associated with
the emission of light.
32. A construct according to claim 30, wherein the reporter protein
is a fluorescent protein or a luminescent protein.
33. A construct according to claim 23, further comprising a cloning
site for introducing a sequence of nucleotides.
34. A construct according to claim 33, wherein the cloning site is
a multiple cloning site.
35. A construct according to claim 23, further comprising a
polyadenylation sequence.
36. A construct according to claim 23, further comprising a
selectable marker.
37. A construct according to claim 23, further comprising an origin
of replication.
38. A construct according to claim 23, further comprising a
translational enhancer.
39. A construct according to claim 23, which is a vector.
40. A construct according to claim 23, further comprising one or
more members selected from the group consisting of: (i) a multiple
cloning site for introducing a sequence of nucleotides; (ii) a
reporter gene; (iii) a transcriptional enhancer for enhancing
transcription of the polynucleotide; (iv) a translational enhancer
for enhancing translation of the transcript encoded by the
polynucleotide; (v) a polyadenylation sequence; (vi) a selectable
marker gene; (vii) an origin of replication; (viii) an intron; and
(ix) a mRNA nuclear export signal 41. A construct according to
claim 33 or claim 40, comprising at least one site which is
cleavable enzymatically, chemically or otherwise to provide a
linearised vector into which PCR amplification products are
clonable directly.
41. 42. A construct according to claim 24, wherein the nucleic acid
sequence is a gene selected from the group consisting of: c-fos,
c-jun, c-myc, GM-CSF, IL-3, TNF-alpha, IL-2, IL-6, IL-8, IL-10,
Urokinase, bcl-2, SGLT1 (Na(+)-coupled glucose transporter), Cox-2
(cyclooxygenase 2), IL-8, PAI-2 (plasminogen activator inhibitor
type 2), beta1-adrenergic receptor, and GAP43.
42. 43. A construct according to claim 29, wherein the nucleic acid
sequence is a gene selected from the group consisting of: alpha2
globin, alpha1 globin, beta globin, growth hormone, erythropoietin,
ribonucleotide reductase R1 and m1 muscarinic acetylcholine.
43. 44. A construct according to claim 24, wherein the nucleic acid
sequence is selected from any one of SEQ ID NOS: 1 to 57,
biologically active fragments thereof, variants and derivatives of
these.
44. 45. A construct according to claim 24, wherein the nucleic acid
sequence is selected from SEQ ID NOS:1, 13, 19, 49, biologically
active fragments thereof, variants and derivatives of these.
45. 46. A construct according to claim 30, wherein the reporter
protein is selected from the group consisting of: Luciferase, Green
Fluorescent Protein, Red Fluorescent Protein, SEAP, CAT,
biologically active fragments thereof, variants, and derivatives of
these.
46. 47. A construct according to claim 23, wherein the polypeptide
is a protein having at least a light-emitting activity and a
selection marker activity.
47. 48. A construct according to claim 47, wherein the polypeptide
is encoded by a chimeric gene comprising a coding sequence from a
gene encoding a light-emitting protein and a coding sequence from a
gene encoding a selectable marker protein.
48. 49. A construct according to claim 47, wherein the polypeptide
is encoded by a chimeric gene comprising a coding sequence from a
gene encoding: a light-emitting protein selected from the group
consisting of: Green Fluorescent Protein, Luciferase, their
biologically active fragments, variants and derivatives; and a
coding sequence from a gene encoding a selectable marker protein
selected from the group consisting of: kanamycin kinase, neomycin
phosphotransferase, aminoglycoside phosphotransferase, puromycin
N-acetyl transferase, puromycin resistance protein, their
biologically active fragments, variants and derivatives.
49. 50. A construct according to claim 23, wherein the gene
expression modulating element is a transcriptional control
element.
50. 51. A construct according to claim 50, wherein the
transcriptional control element is a promoter.
51. 52. A construct according to claim 23, wherein the gene
expression modulating element is a cis-acting regulatory
element.
52. 53. A construct according to claim 52, wherein the cis-acting
regulatory element is selected from the group consisting of: an
enhancer of transcription, an enhancer of translation, an enhancer
of mRNA splicing, an enhancer of mRNA export, an enhancer of mRNA
degradation, a repressor of transcription, a repressor of
translation, a repressor of mRNA splicing, a repressor of mRNA
export and a repressor of mRNA degradation.
53. 54. A cell comprising a construct according to claim 23.
54. 55. A cell according to claim 54, wherein the cell is a
eukaryotic cell.
55. 56. A cell according to claim 54, wherein the cell is a
mammalian cell.
56. 57. A cell according to claim 54, wherein the cell is a human
cell.
57. 58. A cell according to claim 54, wherein the cell is a plant
cell.
58. 59. A genetically modified non-human organism comprising one or
more constructs according to claim 23.
59. 60. A method for identifying an agent that modulates the
activity of a gene expression-modulating element, the method
comprising: expressing under the control of the gene
expression-modulating element a polynucleotide that encodes a
polypeptide operably linked to a nucleic acid sequence that encodes
a RNA element that modulates the stability of a transcript encoded
by the polynucleotide in the presence and absence of a test agent;
measuring and comparing the level or functional activity of the
polypeptide in the presence and absence of the test agent, wherein
a difference between the level or functional activity of the
polypeptide in the presence and absence of the test agent indicates
that the test agent modulates the activity of the gene
expression-modulating element.
60. 61. A method for assaying the activity of a
post-transcriptional control element, the method comprising:
expressing from a transcriptional control element a polynucleotide
that encodes a polypeptide having intracellular half-life of less
than about 3 hours wherein said polynucleotide is operably linked
to: a nucleic acid sequence that encodes the post-transcriptional
control element; and measuring the level or functional activity of
the polypeptide produced from the expression.
61. 62. A method for assaying the activity of a
post-transcriptional control element, the method comprising:
expressing from a transcriptional control element a polynucleotide
that encodes a polypeptide comprising a protein-destabilising
element wherein said polynucleotide is operably linked to: a
nucleic acid sequence that encodes the post-transcriptional control
element; and measuring the level or functional activity of the
polypeptide produced from the expression.
62. 63. A method for identifying a nucleotide sequence that encodes
a post-transcriptional control element that modulates the
expression of a RNA transcript from a first polynucleotide that
encodes a polypeptide, the method comprising: expressing from a
first transcriptional control element in a first construct the
first polynucleotide, which is operably connected to a test
nucleotide sequence suspected of encoding the post-transcriptional
control element; expressing from a second transcriptional control
element in a second construct a second polynucleotide, which
encodes a second polypeptide, but which is not operably connected
to the test nucleotide sequence, wherein the second polypeptide is
the same as, or different than, the first polypeptide and wherein
the second transcriptional control element is the same as, or
different than, the first transcriptional control element; and
comparing the level or functional activity of the polypeptides from
the first and second constructs, wherein a difference between the
level or functional activity of the first polypeptide and the level
or functional activity of the second polypeptide indicates that the
test nucleotide sequence encodes a post-transcriptional control
element.
63. 64. A method for identifying an agent that modulates the
activity of a post-transcriptional control element wherein said
post-transcriptional control element modulates the expression of a
RNA transcript from a polynucleotide that encodes a polypeptide,
the method comprising:expressing from a transcriptional control
element the polynucleotide, which is operably connected to a
nucleic acid sequence that encodes the post-transcriptional control
element, wherein the expression of the polynucleotide is carried
out in the presence and absence of a test agent; andmeasuring and
comparing the level or functional activity of the polypeptide in
the presence and absence of the test agent, wherein a difference
between the level or functional activity of the polypeptide in the
presence and absence of the test agent indicates that the test
agent modulates the activity of the post-transcriptional control
element.
64. 65. A method for assaying the activity of a transcriptional
control element, the method comprising: - expressing from the
transcriptional control element a polynucleotide which encodes a
polypeptide comprising a protein-destabilising element and which is
operably connected to a nucleic acid sequence which encodes a RNA
element that modulates the stability of a transcript encoded by the
polynucleotide; and - measuring the level and/or functional
activity of the polypeptide produced from the construct.
65. 66. A method for identifying a cis-acting regulatory element
that modulates the activity of a transcriptional control element,
the method comprising: subjecting a construct to conditions
sufficient for RNA and protein synthesis to occur, wherein the
construct comprises in operable linkage: a nucleotide sequence
suspected of having cis-acting regulatory activity; the
transcriptional control element; a polynucleotide that encodes a
polypeptide and a nucleic acid sequence that encodes a RNA element
that modulates the stability of a transcript encoded by the
polynucleotide; and detecting production of the polypeptide from
the construct.
66. 67. A construct comprising in operable linkage: a
polynucleotide that encodes a polypeptide comprising a
protein-destabilising element, and a nucleic acid sequence that
encodes a RNA element that modulates the stability of a transcript
encoded by the polynucleotide.
67. 68. A construct comprising in operable linkage: a
polynucleotide that encodes a polypeptide having a half-life of
less than about 3 hours, and a nucleic acid sequence that encodes a
RNA element that modulates the stability of a transcript encoded by
the polynucleotide.
68. 69. A construct for identifying or assaying the activity of a
post-transcriptional control element that modulates the expression
of a transcript, the construct comprising a transcriptional control
element that is operably connected to: a polynucleotide from which
the transcript is transcribed and which encodes a polypeptide
having an intracellular half-life of less than about 3 hours; and a
nucleotide sequence that encodes, or is suspected to encode, the
post-transcriptional control element or a site for introducing the
nucleotide sequence.
69. 70. A construct for identifying or assaying the activity of a
cis-acting regulatory element other than a post-transcriptional
control element, the construct comprising a transcriptional control
element in operable linkage with: a polynucleotide that encodes a
polypeptide and a nucleic acid sequence that encodes a RNA element
that modulates the stability of a transcript encoded by the
polynucleotide, wherein the construct further comprises a
cis-acting regulatory element or a nucleotide sequence suspecting
of being a cis-acting regulatory element or a site for introducing
the cis-acting regulatory element or the nucleotide sequence in
said operable linkage.
70. 71. A construct for assaying the activity of a transcriptional
control element or for identifying agents that modulate the
activity of the transcriptional control element, the construct
comprising the transcriptional control element in operable linkage
with: a polynucleotide that encodes a polypeptide having an
intracellular half-life of less than about 3 hours; and a nucleic
acid sequence that encodes a RNA element that modulates the
stability of a transcript encoded by the polynucleotide.
71. 72. A construct for assaying the activity of a transcriptional
control element or for identifying agents that modulate the
activity of the transcriptional control element, the construct
comprising the transcriptional control element in operable linkage
with: a polynucleotide that encodes a polypeptide that comprises a
protein-destabilising element; and a nucleic acid sequence that
encodes a RNA element that modulates the stability of a transcript
encoded by the polynucleotide.
72. 73. A method according to claim 1, wherein the RNA element
destabilises the transcript and comprises an AU-rich element.
73. 74. A method according to claim 73, wherein the AU-rich element
comprises the sequence set forth in SEQ ID NO:1.
74. 75. A method according to claim 1, wherein the polypeptide is a
reporter protein comprising a PEST sequence.
75. 76. A method according to claim 75, wherein the reporter
protein comprises Luciferase.
76. 77. A method according to claim 75, wherein the reporter
protein comprises firefly luciferase.
77. 78. A method according to claim 75, wherein the reporter
protein comprises Renilla luciferase.
78. 79. A method according to claim 1, wherein the RNA element
destabilises the transcript and comprises an AU-rich element and
wherein the polypeptide is a reporter protein comprising firefly
luciferase and a PEST sequence.
79. 80. A method according to claim 1, wherein the RNA element
destabilises the transcript and comprises an AU-rich element and
wherein the polypeptide is a reporter protein comprising Renilla
luciferase and a PEST sequence.
80. 81. A method for assaying the activity of a transcriptional
control element, the method comprising: expressing from the
transcriptional control element a polynucleotide that encodes a
reporter protein and that is operably connected to a nucleic acid
sequence that encodes a RNA element that destabilises a transcript
encoded by the polynucleotide, wherein the reporter protein
comprises firefly luciferase and a PEST sequence and wherein the
RNA element comprises an AU-rich element; and measuring the level
or functional activity of the reporter protein produced from the
expression.
81. 82. A method according to claim 81, wherein the AU-rich element
comprises the sequence set forth in SEQ ID NO:1.
82. 83. A method for assaying the activity of a transcriptional
control element, the method comprising: expressing from the
transcriptional control element a polynucleotide that encodes a
reporter protein and that is operably connected to a nucleic acid
sequence that encodes a RNA element that destabilises a transcript
encoded by the polynucleotide, wherein the reporter protein
comprises Renilla luciferase and a PEST sequence and wherein the
RNA element comprises an AU-rich element; and measuring the level
or functional activity of the reporter protein produced from the
expression.
83. 84. A method according to claim 83, wherein the AU-rich element
comprises the sequence set forth in SEQ ID NO:1.
84. 85. A construct according to claim 23, wherein the RNA element
destabilises the transcript and comprises an AU-rich element.
85. 86. A construct according to claim 85, wherein the AU-rich
element comprises the sequence set forth in SEQ ID NO:1.
86. 87. A construct according to claim 23, wherein the polypeptide
is a reporter protein comprising a PEST sequence.
87. 88. A construct according to claim 87, wherein the reporter
protein comprises Luciferase.
88. 89. A construct according to claim 87, wherein the reporter
protein comprises firefly luciferase.
89. 90. A construct according to claim 87, wherein the reporter
protein comprises Renilla luciferase.
90. 91. A construct according to claim 23, wherein the RNA element
destabilises the transcript and comprises an AU-rich element and
wherein the polypeptide is a reporter protein that comprises
firefly luciferase and a PEST sequence.
91. 92. A construct according to claim 23, wherein the RNA element
destabilises the transcript and comprises an AU-rich element and
wherein the polypeptide is a reporter protein that comprises
Renilla luciferase and a PEST sequence.
92. 93. A construct for assaying the activity of a gene
expression-modulating element or for identifying elements of this
type or agents that modulate their activity, the construct
comprising in operable linkage: a polynucleotide that encodes a
reporter protein and a nucleic acid sequence that encodes a RNA
element that destabilises a transcript encoded by the
polynucleotide, wherein the reporter protein comprises firefly
luciferase and a PEST sequence, wherein the RNA element comprises
an AU-rich element and wherein the construct comprises a site for
introducing the gene expression-modulating element in operable
connection with the polynucleotide and the nucleic acid
sequence.
93. 94. A construct for assaying the activity of a gene
expression-modulating element or for identifying elements of this
type or agents that modulate their activity, the construct
comprising in operable linkage: a polynucleotide that encodes a
reporter protein and a nucleic acid sequence that encodes a RNA
element that destabilises a transcript encoded by the
polynucleotide, wherein the reporter protein comprises Renilla
luciferase and a PEST sequence, wherein the RNA element comprises
an AU-rich element and wherein the construct comprises a site for
introducing the gene expression-modulating element in operable
connection with the polynucleotide and the nucleic acid
sequence.
94. 95. A construct according to claim 93 or claim 94, wherein the
AU-rich element comprises the sequence set forth in SEQ ID
NO:1.
95. 96. A construct according to claim 93 or claim 94, wherein the
construct further comprises a multiple cloning site for introducing
the gene expression-modulating element.
96. 97. A construct according to claim 93 or claim 94, wherein the
construct further comprises a polyadenylation sequence.
97. 98. A construct according to claim 97, wherein the
polyadenylation sequence is a SV40 polyadenylation sequence.
98. 99. A construct according to claim 93 or claim 94, wherein the
construct further comprises a selectable marker gene.
99. 100. A construct according to claim 99, wherein the selectable
marker gene is an ampicillin resistance gene.
100. 101. A construct according to claim 93 or claim 94, wherein
the construct further comprises an origin of replication.
101. 102. A cell comprising a construct according to claim 93 or
claim 94.
102. 103. A method for identifying an agent that modulates the
activity of a gene expression-modulating element, the method
comprising: expressing under the control of the gene
expression-modulating element a polynucleotide that encodes a
reporter protein and a nucleic acid sequence that encodes a RNA
element that destabilises a transcript encoded by the
polynucleotide in the presence and absence of a test agent, wherein
the reporter protein comprises firefly luciferase and a PEST
sequence and wherein the RNA element comprises an AU-rich element;
measuring and comparing the level or functional activity of the
reporter protein in the presence and absence of the test agent,
wherein a difference between the level or functional activity of
the reporter protein in the presence and absence of the test agent
indicates that the test agent modulates the activity of the gene
expression-modulating element.
103. 104. A method according to claim 103, wherein the AU-rich
element comprises the sequence set forth in SEQ ID NO:1.
104. 105. A method for identifying an agent that modulates the
activity of a gene expression-modulating element, the method
comprising: expressing under the control of the gene
expression-modulating element a polynucleotide that encodes a
reporter protein and a nucleic acid sequence that encodes a RNA
element that destabilises a transcript encoded by the
polynucleotide in the presence and absence of a test agent, wherein
the reporter protein comprises Renilla luciferase and a PEST
sequence and wherein the RNA element comprises an AU-rich element;
measuring and comparing the level or functional activity of the
reporter protein in the presence and absence of the test agent,
wherein a difference between the level or functional activity of
the reporter protein in the presence and absence of the test agent
indicates that the test agent modulates the activity of the gene
expression-modulating element.
105. 106. A method according to claim 105, wherein the AU-rich
element comprises the sequence set forth in SEQ ID NO:1.
Description
Detailed Description of the Invention
Cross Reference to Related Applications
[0001] This application is a continuation-in-part application of
co-pending International Patent Application No. PCT/AU02/00351
filed March 8, 2002, which designates the United States, and which
claims priority to United States Provisional Patent Application
Serial No. 60/274770 filed March 9, 2001.
Background of Invention
[0002] This invention relates generally to constructs and their use
in gene expression or gene regulation assays. More particularly,
the present invention provides expression vectors and/or reporter
vectors providing kinetics of protein expression with improved
temporal correlation to promoter activity. The present invention
provides, inter alia, novel vectors and cell lines useful for
modulating gene expression, identifying and analysing regulatory
sequences, new targets and reagents for therapeutic intervention in
human diseases and for drug-screening.
[0003] Bibliographic details of the publications referred to by
author in this specification are collected at the end of the
description.
[0004] The rapidly increasing sophistication of recombinant DNA
technology is greatly facilitating research and development in the
medical and allied health fields. A particularly important area of
research is the use of expression vectors to study gene expression.
However, until now, a real-time analysis of gene expression has
been limited by the lack of suitably designed vectors.
[0005] Reporter assays permit an understanding of what controls the
expression of a gene of interest e.g., DNA sequences, transcription
factors, RNA sequences, RNA-binding proteins, signal transduction
pathways and specific stimuli.
[0006] Furthermore, reporter assays can be used to identify aspects
of gene regulation that serve as new targets for therapeutic
intervention in human disease. Reporter assays can potentially be
used to screen drugs for their ability to modify gene expression.
However, the cost and time required for current reporter assay
systems, together with the inaccuracies caused by the lengthy
response times, has limited this application.
[0007] Genomic sequences have promoter sequences, generally
upstream of the coding region, which dictate the cell specificity
and inducibility of transcription and thereby affect the level of
expression of protein products.
[0008] Specific sequence elements, typically rich in the nucleotide
bases A and U and often located in the 3'-UTR of a gene, affect the
stability of the mRNA and thereby affect the level of expression of
the protein product. RNA-binding proteins bind certain mRNA
sequences and thereby regulate mRNA stability and protein
expression. Other sequences and trans-acting proteins modulate
other post-transcriptional pathways such as translational
efficiency, mRNA splicing and mRNA export into the cytoplasm.
[0009] A common application of gene reporter assays is the study of
DNA sequences that regulate transcription. Typically, these
sequences are located in the promoter region, 5' of the
transcription start site. Such DNA elements are tested by cloning
them into a similar site within a reporter plasmid, such that they
drive and/or regulate transcription and therefore, expression of
reporter protein. The reporter protein should be distinguishable
from endogenous proteins and easily quantified. Various reporter
proteins are used, the most common being luciferase,
chloramphenicol transferase (CAT) and galactosidase (-gal).
[0010] The reporter protein is quantified in an appropriate assay
and often expressed relative to the level of a control reporter
driven by a ubiquitous promoter such as for example the promoter
SV40. The control reporter must be distinguishable from the test
reporter and is contained on a separate vector that is
co-transfected with the test vector and used to control for
transfection efficiency. Such assays are based on the premise that
cells take up proportionally equal amounts of both vectors.
Transient transfections of plasmid vectors are most commonly
used.
[0011] The assays described above are used to identify a promoter
region or the specific elements within a promoter. Alternatively,
they are used to study the response to various stimuli of a
promoter or regulatory element. In some applications, the reporter
constructs, or the transfected cells, are placed into an organism
to study promoter function in vivo.
[0012] Another application of these reporter assays is the study or
measurement of signal transduction pathways upstream of a specific
promoter. For example, a promoter dependent on mitogen activated
protein kinase (MAPK) for transcription can be linked to a reporter
construct and used to measure the level of MAPK activation (or
MAPK-dependent transcription) in cells. This technique can be
utilized with a variety of informative promoters or enhancers and
can be applied to cells or living organisms such as transgenic
mice. For example, a photon camera can be used to measure
luciferase reporter activity in whole mice containing a luciferase
reporter linked to a promoter of interest (Contag, et al,
1997).
[0013] Luciferase is the most commonly used reporter assay for in
vitro systems. The Dual Luciferase assay (DLA; Promega, Madison,
WI, USA), is an improvement over other luciferase based systems in
that both test and control reporter can essentially be measured in
the same assay. As an example of current use, a typical DLA
protocol is provided as follows:The putative promoter element is
cloned upstream of a firefly luciferase reporter gene such that it
drives its expression. This plasmid is transiently transfected into
a cell line, along with a control plasmid containing the Renilla
luciferase gene driven by the SV40 promoter. ~2-50% of cells take
up plasmid and express the reporters for ~3 days. The kinetics of
expression involve an increase during the first ~24 h as luciferase
protein accumulates, followed by a decrease from ~48 h as the
number of plasmids maintained within the cells declines. 24-48 h
after transfection, cells are harvested and lysed. Cell lysates are
incubated with substrates specific to firefly luciferase and
activity (light emission) is measured using a luminometer (96 well
plate or individual samples). Additional substrates are then added,
which inactivate firefly luciferase but allow Renilla luciferase to
generate light. Renilla luciferase activity can then be
measured.
[0014] The level of firefly luciferase activity is dependent, not
only on promoter activity, but also on transfection efficiency.
This varies greatly, depending on the amount of DNA, the quality of
the DNA preparation and the condition of the cells. The
co-transfected control plasmid (Renilla luciferase driven by the
SV40 promoter) is used to correct for these variables, based on the
premise that Renilla luciferase activity is proportional to the
amount of firefly luciferase plasmid taken up by the cells. Data
are expressed as firefly luciferase activity / Renilla luciferase
activity.
[0015] The disadvantages of the Dual Luciferase assay are as
follows:(i) Reagents are expensive and perishable and must be
freshly prepared.
[0016] (ii) Generally this assay involves the preparation of cell
lysates, which is time consuming and adds inaccuracy. e.g., loss of
cells during lysis, pipetting errors, residual buffer/medium
altering volumes.
[0017] (iii) Each sample yields only one datum point being the
total activity of the cell population. No information is gained
concerning the percentage of cells that express the reporter, nor
the amount of expression per cell.
[0018] (iv) The transfection control (Renilla) does not always
correct for huge variation in transfection efficiencies because:(a)
Certain DNA preparations transfect/express poorly (perhaps due to
reduced proportion of supercoiled DNA), but do not cause a
corresponding decrease in the amount of co-transfected control
plasmid.
[0019] (b) There is evidence of cross-talk between the promoters of
the two plasmids, such that control reporter activity is dependent
on the construct with which it is co-transfected, e.g., expression
of Renilla luciferase seems highest when co-transfected with a
plasmid containing a strong promoter. Interference between
promoters has also limited, if not prevented, the use of single
plasmids expressing both test and control reporters.
[0020] (c) A common application of both transcriptional and
post-transcriptional studies is to measure activation/suppression
by various stimuli (e.g., PMA, EGF, hormones). Unfortunately, SV40,
RSV, TK and probably many other ubiquitously expressed promoters
are activated by a variety of stimuli. Since these promoters are
used to drive expression of the transfection control reporter
(Renilla), these reporters do not give a true reflection of
transfection efficiency following such treatments. (Ibrahim et al.
2000).
[0021] (d) Differences in the half-lives of firefly vs Renilla
luciferase proteins and perhaps mRNAs make the whole system very
time-sensitive.
[0022] (e) Rapidly diminishing light emission, particularly for
Renilla luciferase, require absolute precision in the timing of
measurement.
[0023] (f) The relatively long half-lives of luciferase proteins
and mRNAs effectively mask temporal changes in transcription (e.g.,
following various stimuli or treatments).
[0024] In existing post-transcriptional/mRNA stability reporter
assays, candidate elements, thought to affect mRNA stability are
cloned into the corresponding region of a reporter vector (e.g.,
firefly luciferase) driven by a constitutive promoter such as SV40
or RSV. Changes in expression relative to the empty vector (same
vector without element of interest) are assumed to be the result of
altered mRNA stability or translational efficiency. More complex
assays are required to distinguish the two possibilities. As with
the preliminary described transfection assays, a transfection
control plasmid (e.g., Renilla luciferase driven by a constitutive
promoter such as SV40 or RSV) is co-transfected to allow correction
for transfection efficiency. These assays suffer from the following
additional disadvantages: (1) Existing vectors were not designed
for post-transcriptional studies and have no means for switching
off transcription.
[0025] (2) The purpose of these protocols is to study the
post-transcriptional effects of candidate mRNA elements. However,
these elements can also affect transcription of the reporter at the
level of DNA. Furthermore, since the endogenous promoter of the
gene of interest is not used, any transcriptional effects seen may
have little physiological relevance.
[0026] Other systems for studying mRNA stability exist but involve
direct measurement of the mRNA rather than a protein reporter. Due
to the labour-intensive nature of protocols for quantifying mRNA,
such systems are far more time consuming.
[0027] One system, for example, utilizes the c-fos promoter, which
responds to serum induction with a brief burst of transcription.
Putative instability elements are cloned into the 3-UTR of a Beta
Globin (BBB) construct, which expresses the very stable beta globin
mRNA under the control of a serum-inducible (c-fos) promoter.
Transfected cells (generally NIH 3T3 cells) are first serum starved
and then exposed to medium containing serum. The brief nature of
the transcriptional response allows the kinetics of reporter mRNA
degradation to be followed in a time course. This assay suffers
from the following disadvantages:(i) Quantifying mRNA rather than
reporter protein is very time consuming and is therefore not
applicable to rapid screening.
[0028] (ii) Can only be used in cells that support serum
inducibility of the c-fos promoter. For example, many tumour cell
lines maintain c-fos promoter activity in the absence of serum.
[0029] (iii) In cells such as NIH 3T3 cells, which do have the
desired serum response, serum deprivation causes a cell cycle block
and subsequent addition of serum, releases the cells from this
block in a synchronous manner. Therefore, mRNA stability can only
be measured in specific stages of the cell cycle.
[0030] (iv) In addition to activating the c-fos promoter, serum
activates a multitude of other pathways, which introduce unwanted
variables and prevent the study of more specific stimuli.
[0031] In another assay, cells are treated with drugs, such as
Actinomycin D that inhibit transcription from all genes. The mRNA
levels are measured in a time course to determine mRNA degradation
rates. This system is used to study endogenous genes and suffers
from the following disadvantages:(i) Transcriptional inhibitors are
extremely toxic at doses required such that mRNA stability is often
being measured in stressed or dying cells.
[0032] (ii) Transcription inhibitors possess numerous unwanted
activities including stabilization of certain mRNAs.
[0033] (iii) The process blocks transcription from all genes such
that many signal transduction cascades are blocked, whereas others
are activated. Therefore, results may not be physiologically
relevant.
[0034] (iv) The technique is extremely labour intensive.
[0035] (v) The technique is highly variable within and between
assays.
[0036] (vi) The technique is often not sensitive enough for
transient transfection reporter assays, particularly in cells with
low transfection efficiency.
[0037] There is a need therefore to develop improved vectors and
systems for conducting gene expression assays and in particular
post-transcriptional assays as well as assays that permit a more
real-time determination of changes in gene expression.
Summary of Invention
[0038] The present invention is predicated in part on the
development of a novel series of constructs and methods which
permit inter alia modulation and determination of transcript
stability and/or improved real-time determination of gene
expression.
[0039] Accordingly, in one aspect of the present invention
constructs are provided for assaying the activity of gene
expression-modulating elements (e.g., transcriptional control
elements and cis-acting regulatory elements) or for identifying
elements of this type or agents that modulate their activity. These
constructs generally comprise in operable linkage: a polynucleotide
that encodes a polypeptide and a nucleic acid sequence that encodes
a RNA element that modulates the stability of a transcript encoded
by the polynucleotide. In some embodiments, the polypeptide has an
intracellular half-life of less than about 1, 2 or 3 hours.
[0040] In some embodiments, the RNA element is a destabilising
element that reduces the stability of the transcript. Suitably, in
these embodiments, the nucleic acid sequence is, or is derived
from, a gene selected from c-fos, c-jun, c-myc, GM-CSF, IL-3,
TNF-alpha, IL-2, IL-6, IL-8, IL-10, Urokinase, bcl-2, SGLT1
(Na(+)-coupled glucose transporter), Cox-2 (cyclooxygenase 2),
IL-8, PAI-2 (plasminogen activator inhibitor type 2),
beta1-adrenergic receptor or GAP43. Illustrative examples of such
nucleic acid sequences include, but are not limited to, the
nucleotide sequences set forth in SEQ ID NOS 1 to 23, especially in
SEQ ID NO:1, 13, 19 or 49, or biologically active fragments
thereof, or variants or derivatives of these.
[0041] In other embodiments, the RNA element is a stabilising
element that increases the stability of the transcript. Suitably,
in these embodiments, the nucleic acid sequence is, or is derived
from, a gene selected from alpha2 globin, alpha1 globin, beta
globin, growth hormone, erythropoietin, ribonucleotide reductase R1
or m1 muscarinic acetylcholine.In some embodiments, the
polynucleotide and the nucleic acid sequence are heterologous to
each other.
[0042] In some embodiments, the polypeptide comprises a
protein-destabilising element, which is suitably selected from a
PEST sequence, an ubiquitin, a biologically active fragment of an
ubiquitin, or variant or derivative of these.
[0043] In some embodiments, the polypeptide is a reporter protein,
which is suitably selected from an enzymatic protein or a protein
associated with the emission of light (e.g., a fluorescent or
luminescent protein). Illustrative examples of suitable reporter
proteins include, but are not limited to, Luciferase, GFP, SEAP,
CAT, or biologically active fragments thereof, or variants or
derivatives of these. In other embodiments, the polypeptide is a
protein having at least a light-emitting activity and a selection
marker activity. In these embodiments, the polypeptide is suitably
encoded by a chimeric gene which includes a coding sequence from a
gene encoding a light-emitting protein and a coding sequence from a
gene encoding a selectable marker protein. In certain embodiments,
the light-emitting protein is selected from Green Fluorescent
Protein, Luciferase and their biologically active fragments,
variants and derivatives and the selectable marker protein is
selected from kanamycin kinase, neomycin phosphotransferase,
aminoglycoside phosphotransferase, puromycin N-acetyl transferase,
puromycin resistance protein and their biologically active
fragments, variants and derivatives.
[0044] In some embodiments, the constructs further comprise one or
more of the following: a transcriptional control element for
regulating expression of the polynucleotide and of the nucleic acid
sequence; a cis-acting regulatory element (e.g., a transcriptional
enhancer) for modulating the activity of the transcriptional
control element; areporter gene; at least one cloning site for
introducing a sequence of nucleotides; a polyadenylation sequence;
a selectable marker; an origin of replication; a translation
modulating element (e.g., a translational enhancer) for modulating
translation of a transcript encoded by the polynucleotide and an
intron or other post-transcriptional regulatory element (e.g.,
woodchuck post-transcriptional regulatory element from woodchuck
hepatitis virus, which is an example of a mRNA nuclear export
signal) for modulating other aspects of post-transcriptional gene
regulation. In certain illustrative examples, the constructs
comprise in operable linkage: a polynucleotide that encodes a
polypeptide and a nucleic acid sequence that encodes a RNA element
that modulates the stability of a transcript encoded by the
polynucleotide, wherein the construct lacks, but comprises a site
for introducing, a gene expression-modulating element in operable
connection with the polynucleotide and the nucleic acid sequence.
In other illustrative examples, the constructs comprise a gene
expression-modulating element in operable linkage with a
polynucleotide that encodes a polypeptide and with a nucleic acid
sequence that encodes a RNA element that modulates the stability of
a transcript encoded by the polynucleotide, wherein the construct
further comprises a site for introducing a post-transcriptional
control element. In these examples, the polypeptide desirably has
an intracellular half-life of less than about 1, 2 or 3 hours and
more desirably comprises a protein-destabilising element.
[0045] In embodiments in which a construct comprises a cloning
site, the cloning site is suitably selected from a multiple cloning
site or a site that is cleavable enzymatically, chemically or
otherwise to provide a linearised vector into which PCR
amplification products are clonable directly.
[0046] The constructs are typically in the form of a vector. In
some embodiments, the constructs are suitable for assaying the
activity of a transcriptional control element or the activity of a
cis-acting regulatory element or both.
[0047] In a related aspect, the present invention provides
constructs for assaying the activity of gene expression-modulating
elements (e.g., transcriptional control elements and cis-acting
regulatory elements) or for identifying elements of this type or
agents that modulate their activity. These constructs generally
comprise in operable linkage: a polynucleotide that encodes a
polypeptide comprising a protein-destabilising element, and a
nucleic acid sequence that encodes a RNA element that modulates the
stability of a transcript encoded by the polynucleotide. In some
embodiments, the polypeptide is a reporter protein.
[0048] In another aspect, the present invention provides a cell
comprising one or more constructs as broadly described above.
Typically, the cell is selected from prokaryotic (e.g., bacterial)
or eukaryotic cells (e.g., mammalian including human cells).
[0049] In yet another aspect, the present invention provides a
genetically modified non-human organism comprising one or more
constructs as broadly described above.
[0050] Still another aspect of the present invention provides
methods for assaying the activity of a transcriptional control
element. These methods generally comprise: (1) expressing from the
transcriptional control element a polynucleotide that encodes a
polypeptide and that is operably connected to a nucleic acid
sequence that encodes a RNA element that modulates the stability of
a transcript encoded by the polynucleotide; and (2) measuring the
level or functional activity of the polypeptide produced from the
expression. In some embodiments, the expression of the
polynucleotide is carried out in the presence and absence of a test
agent. In these embodiments, the methods further comprise comparing
the level or functional activity of the polypeptide produced in the
presence and absence of the test agent. Suitably, the expression of
the polynucleotide is carried out in a first cell type or condition
and in a second cell type or condition, wherein a difference in the
level or functional activity of the polypeptide in the presence of
the test agent between the cell types or conditions provides
information on the effect of the test agent on those cell types or
conditions (e.g., mode of action or specificity). In some
embodiments, the activity of the transcriptional control element is
a measure of a cellular event, which includes but is not limited to
cell cycle progression, apoptosis, immune function, modulation of a
signal transduction pathway, modulation of a regulatory pathway,
modulation of a biosynthetic pathway, toxic response, cell
differentiation and cell proliferation.
[0051] In some embodiments, the methods comprise: (1) expressing
from a first transcriptional control element in a first construct a
first polynucleotide that encodes a first polypeptide and that is
operably connected to a nucleic acid sequence that encodes a RNA
element that modulates the stability of a transcript encoded by the
first polynucleotide; (2) measuring the level or functional
activity of the first polypeptide produced from the first
construct; (3) expressing from a second transcriptional control
element in a second construct a second polynucleotide that encodes
a second polypeptide and that is operably connected to a nucleic
acid sequence that encodes a RNA element that modulates the
stability of a transcript encoded by the second polynucleotide,
wherein the expression of the second polynucleotide is carried out
in the presence or absence of the test agent, and wherein the
second transcriptional control element is different than the first
transcriptional control element; (4) measuring the level or
functional activity of the second polypeptide produced from the
second construct; and (5) comparing the level or functional
activity of the second polypeptide with the level or functional
activity of the first polypeptide in the presence or absence of the
test agent. The first construct and the second construct may be in
the form of separate constructs or a single chimeric construct. For
example, the first and second constructs may be present on the same
vector or on separate vectors. Desirably, the first polypeptide and
the second polypeptide are detectably distinguishable. The first
construct and the second construct may be contained within a single
cell or within different cells. In some embodiments, at least one
of the first and second polypeptides has an intracellular half-life
of less than about 1, 2 or 3 hours.
[0052] Still another aspect of the present invention provides
methods for identifying an agent that modulates the activity of a
gene expression-modulating element (e.g., transcriptional control
elements and cis-acting regulatory elements). These methods
generally comprise: (a) expressing under the control of the gene
expression-modulating element a polynucleotide that encodes a
polypeptide and a nucleic acid sequence that encodes a RNA element
that modulates the stability of a transcript encoded by the
polynucleotide in the presence and absence of a test agent; (b)
measuring the level or functional activity of the polypeptide in
the presence and absence of the test agent; and (c) comparing those
levels or functional activities, wherein a difference between the
level or functional activity of the polypeptide in the presence and
absence of the test agent indicates that the test agent modulates
the activity of the gene expression-modulating element. In some
embodiments, the polypeptide comprises a protein-destabilising
element. Suitably, the polypeptide has an intracellular half-life
of less than about 1, 2 or 3 hours. In some embodiments, the
polypeptide is a reporter protein.
[0053] In yet another aspect, the present invention provides
constructs for identifying or assaying the activity of a cis-acting
regulatory element. These constructs generally comprise a
transcriptional control element in operable linkage with: a
polynucleotide that encodes a polypeptide and a nucleic acid
sequence that encodes a RNA element that modulates the stability of
a transcript encoded by the polynucleotide, wherein the constructs
further comprise a site for introducing cis-acting regulatory
element or a nucleotide sequence suspecting of being a cis-acting
regulatory element in operable linkage with the transcriptional
control element. In illustrative examples, the constructs lack, but
comprise a site for introducing, a cis-acting regulatory element in
said operable linkage. In some embodiments, the transcriptional
control element is a minimal promoter. In some embodiments of this
type, the polypeptide comprises a protein-destabilising element.
Suitably, the polypeptide has an intracellular half-life of less
than about 1, 2 or 3 hours. In some embodiments, the polypeptide is
a reporter protein. In some embodiments, the activity of the
cis-acting regulatory element is a measure of a cellular event,
which includes but is not limited to cell cycle progression,
apoptosis, immune function, modulation of a signal transduction
pathway, modulation of a regulatory pathway, modulation of a
biosynthetic pathway, toxic response, cell differentiation and cell
proliferation.
[0054] A further aspect of the present invention provides methods
for assaying the activity of a post-transcriptional control
element. These methods generally comprise: (1) expressing from a
transcriptional control element a polynucleotide that encodes a
polypeptide and that is operably linked to: a nucleic acid sequence
that encodes the post-transcriptional control element; and (2)
measuring the level or functional activity of the polypeptide
produced from the expression. In some embodiments, the polypeptide
comprises a protein-destabilising element. Suitably, the
polypeptide has an intracellular half-life of less than about 1, 2
or 3 hours. In some embodiments, the polypeptide is a reporter
protein. In some embodiments, the expression of the polynucleotide
is carried out in the presence and absence of a test agent. In
these embodiments, the methods desirably further comprise comparing
the level or functional activity of the polypeptide produced in the
presence and absence of the test agent. In some of these
embodiments, the expression of the polynucleotide is carried out in
a first cell type or condition and in a second cell type or
condition, wherein a difference in the level or functional activity
of the polypeptide in the presence of the test agent between the
cell types or conditions provides information on the effect of the
test agent on those cell types or conditions (e.g., mode of action
or specificity). In some embodiments, the activity of the
post-transcriptional control element is a measure of a cellular
event, which includes but is not limited to cell cycle progression,
apoptosis, immune function, modulation of a signal transduction
pathway, modulation of a regulatory pathway, modulation of a
biosynthetic pathway, toxic response, cell differentiation and cell
proliferation.
[0055] In some embodiments, the methods comprise: (a) expressing
from a first transcriptional control element in a first construct a
first polynucleotide that encodes a first polypeptide and that is
operably linked to: a nucleic acid sequence that encodes the
post-transcriptional control element, wherein the expression of the
first polynucleotide is optionally carried out in the presence or
absence of a test agent; (b) measuring the level or functional
activity of the first polypeptide produced from the first
construct; (c) expressing from a second transcriptional control
element in a second construct a second polynucleotide, which
encodes a second polypeptide but which is not operably linked to
the nucleic acid sequence that encodes the post-transcriptional
control element, wherein the second polypeptide is the same as, or
different than, the first polypeptide, wherein the second
transcriptional control element is the same as, or different than,
the first transcriptional control element and wherein the
expression of the second polynucleotide is optionally carried out
in the presence or absence of the test agent; (d) measuring the
level or functional activity of the second polypeptide produced
from the second construct; and (e) comparing the level or
functional activity of the second polypeptide with the level or
functional activity of the first polypeptide optionally in the
presence or absence of the test agent. In these embodiments, the
first construct and the second construct may be in the form of
separate constructs or a single chimeric construct. For example,
the first and second constructs may be present on the same vector
or on separate vectors. The first and second constructs may be
contained within a single cell or within different cells. In
certain embodiments, the first polypeptide and the second
polypeptide are detectably distinguishable. Suitably, at least one
of the first and second polypeptides has an intracellular half-life
of less than about 1, 2 or 3 hours. In some embodiments of this
type, one or both of the first and second polypeptides comprise(s)
a protein-destabilising element. In some embodiments, the
transcriptional control element is modulatable, including inducible
or repressible promoters. In these embodiments, the methods
desirably further comprise (1) inducing or repressing the first or
second transcriptional control element; and (2) measuring changes
in the level or functional activity of the first or second
polypeptide over time.
[0056] In still a further aspect, the present invention provides
methods for identifying a nucleotide sequence that encodes a
post-transcriptional control element that modulates the expression
of a RNA transcript from a first polynucleotide that encodes a
polypeptide. These methods generally comprise: (i) expressing from
a first transcriptional control element in a first construct the
first polynucleotide, which is operably connected to a test
nucleotide sequence suspected of encoding the post-transcriptional
control element; (ii) expressing from a second transcriptional
control element in a second construct a second polynucleotide,
which encodes a second polypeptide, but which is not operably
connected to the test nucleotide sequence, wherein the second
polypeptide is the same as, or different than, the first
polypeptide and wherein the second transcriptional control element
is the same as, or different than, the first transcriptional
control element; and (iii) comparing the level or functional
activity of the polypeptides from the first and second constructs,
wherein a difference between the level or functional activity of
the first polypeptide and the level or functional activity of the
second polypeptide indicates that the test nucleotide sequence
encodes a post-transcriptional control element. In some
embodiments, at least one of the first and second polypeptides has
an intracellular half-life of less than about 1, 2 or 3 hours. In
some embodiments, at least one of the first and second polypeptides
comprises a protein-destabilising element. In some embodiments, the
first and second polypeptides are reporter proteins. In some
embodiments, the transcriptional control element is modulatable,
including inducible or repressible promoters. In these embodiments,
the methods desirably further comprise (1) inducing or repressing
the first or second transcriptional control element; and (2)
measuring changes in the level or functional activity of the first
or second polypeptide over time.
[0057] In still another aspect, the present invention provides
methods for identifying an agent that modulates the activity of a
post-transcriptional control element that modulates the expression
of a RNA transcript from a polynucleotide that encodes a
polypeptide. These methods generally comprise: (a) expressing from
a transcriptional control element the polynucleotide, which is
operably connected to a nucleic acid sequence that encodes the
post-transcriptional control element, wherein the expression of the
polynucleotide is carried out in the presence and absence of a test
agent; (b) measuring the level or functional activity of the
polypeptide in the presence and absence of the test agent; and (c)
comparing those levels or functional activities, wherein a
difference between the level or functional activity of the
polypeptide in the presence and absence of the test agent indicates
that the test agent modulates the activity of the
post-transcriptional control element. In some embodiments, the
expression of the polynucleotide is carried out in a first cell
type or condition and in a second cell type or condition, wherein a
difference in the level or functional activity of the polypeptide
in the presence of the test agent between the cell types or
conditions provides information on the effect of the test agent on
those cell types or conditions (e.g., mode of action or
specificity). In some embodiments, the polypeptide comprises a
protein-destabilising element. Suitably, the polypeptide has an
intracellular half-life of less than about 1, 2 or 3 hours. In some
embodiments, the polypeptide is a reporter protein. In some
embodiments, the transcriptional control element is modulatable,
including inducible or repressible promoters. In these embodiments,
the methods desirably further comprise (1) inducing or repressing
the first or second transcriptional control element; and (2)
measuring changes in the level or functional activity of the first
or second polypeptide over time.
[0058] In some embodiments, these methods comprise (i) expressing
from a first transcriptional control element a first
polynucleotide, which encodes a first polypeptide and which is
operably connected to a nucleic acid sequence that encodes the
post-transcriptional control element, wherein the expression of the
first polynucleotide is carried out in the presence and absence of
a test agent; (ii) measuring the level or functional activity of
the polypeptide in the presence and absence of the test agent;
(iii) expressing from a second transcriptional control element in a
second construct a second polynucleotide, which encodes a second
polypeptide, but which is not operably connected to the nucleic
acid sequence, wherein the second polypeptide is the same as, or
different than, the first polypeptide, wherein the second
transcriptional control element is the same as, or different than,
the first transcriptional control element and wherein the
expression of the second polynucleotide is carried out in the
presence or absence of the test agent; (iv) measuring the level or
functional activity of the second polypeptide from the second
construct in the presence or absence of the test agent; and (v)
comparing the level or functional activity of the second
polypeptide with the level or functional activity of the first
polypeptide in the presence or absence of the test agent. In these
embodiments, the first construct and the second construct may be in
the form of separate constructs or a single chimeric construct. For
example, the first and second constructs may be present on the same
vector or on separate vectors. The first and second constructs may
be contained within a single cell or within different cells. In
some embodiments, at least one of the first and second polypeptides
comprises a protein-destabilising element. Suitably, one or both of
the first and second polypeptides has/have an intracellular
half-life of less than about 1, 2 or 3 hours. Typically, the first
polypeptide and the second polypeptide are detectably
distinguishable. In some embodiments, the first and second
polynucleotides are transcribed from the same transcriptional
control element, illustrative examples of which include a
bi-directional promoter.
[0059] In some embodiments, the transcriptional control element is
modulatable. For example, the transcriptional control element may
be repressible (e.g., a TRE or derivative thereof) or inducible. In
these embodiments, the methods further comprise (A) inducing or
repressing the first transcriptional control element; and (B)
measuring a change in the level or functional activity of the
polypeptide over time.
[0060] Still another aspect of the present invention provides
constructs for identifying or assaying the activity of a
post-transcriptional control element that modulates the expression
of a transcript. These constructs generally comprise a
transcriptional control element that is operably connected to: a
polynucleotide from which the transcript is transcribed and which
encodes a polypeptide having an intracellular half-life of less
than about 3 hours; and a cloning site for introducing a nucleotide
sequence that encodes, or is suspected to encode, the
post-transcriptional control element. Suitably, the polypeptide has
an intracellular half-life of less than about 1 or 2 hours. In some
embodiments of this type, the polypeptide comprises a
protein-destabilising element. In some embodiments, the polypeptide
is a reporter protein.
[0061] Yet another aspect of the present invention provides
constructs for identifying or assaying the activity of a
post-transcriptional control element that modulates the expression
of a transcript. These constructs generally comprise a
transcriptional control element that is operably connected to: a
polynucleotide from which the transcript is transcribed and which
encodes a polypeptide comprising a protein-destabilising element;
and a cloning site for introducing a nucleotide sequence that
encodes, or is suspected to encode, the post-transcriptional
control element. Suitably, the polypeptide has an intracellular
half-life of less than about 1, 2 or 3 hours. In some embodiments,
the polypeptide is a reporter protein.
[0062] Another aspect of the present invention provides methods for
identifying a transcriptional control element. These methods
generally comprise: (1) subjecting a construct to conditions
sufficient for RNA and protein synthesis to occur, wherein the
construct comprises in operable linkage: a nucleotide sequence
suspected of having transcriptional control activity; a
polynucleotide that encodes a polypeptide and a nucleic acid
sequence that encodes a RNA element that modulates the stability of
a transcript encoded by the polynucleotide; and (2) detecting the
polypeptide produced from the construct. In some embodiments, the
polypeptide comprises a protein-destabilising element. Suitably,
the polypeptide has an intracellular half-life of less than about
1, 2 or 3 hours.
[0063] Yet another aspect of the present invention provides methods
for identifying a cis-acting regulatory element that modulates the
activity of a transcriptional control element. These methods
generally comprise: (1) subjecting a construct to conditions
sufficient for RNA and protein synthesis to occur, wherein the
construct comprises in operable linkage: a nucleotide sequence
suspected of having cis-acting regulatory activity; the
transcriptional control element; a polynucleotide that encodes a
polypeptide and a nucleic acid sequence that encodes a RNA element
that modulates the stability of a transcript encoded by the
polynucleotide; and (2) detecting the polypeptide produced from the
construct. In some embodiments, the polypeptide comprises a
protein-destabilising element. Suitably, the polypeptide has an
intracellular half-life of less than about 1, 2 or 3 hours. In some
embodiments, the polypeptide is a reporter protein.
[0064] In a further aspect, the present invention provides methods
for assaying the activity of a transcriptional control element.
These methods generally comprise: (i) expressing from the
transcriptional control element a polynucleotide that encodes a
polypeptide comprising a protein-destabilising element and that is
operably connected to a nucleic acid sequence that encodes a RNA
element that modulates the stability of a transcript encoded by the
polynucleotide; and (ii) measuring the level or functional activity
of the polypeptide produced from the construct.
Brief Description of Drawings
[0065] Figure 1 is a schematic representation of expression vectors
encoding a destabilising mRNA.
[0066] Figure 2 is a schematic representation of transcription
reporter vectors; Figure 2a shows vector series 2; Figure 2b shows
vector series 3 and Figure 2c shows vector series 4.
[0067] Figure 3 is a schematic representation of Bi-directional
transcription reporter vectors; Figure 3a shows vector series 5 and
Figure 3b shows vector series 6.
[0068] Figure 4 is a schematic representation of reporter vectors
for studying post-transcriptional regulation; Figure 4a shows
vector series 7 and Figure 4b shows vector series 8.
[0069] Figure 5 is a graphical representation showing reporter
activity as a function of the amount of DNA transfected. A single
DNA preparation of a plasmid encoding firefly luciferase was mixed
at a 30:1 ratio with a separate plasmid encoding Renilla
luciferase. Both DNA preparations appeared normal in
spectrophotometry (OD260/280) and on ethidium bromide stained
agarose gels (data not shown). Different volumes of this mixture
were transfected into cells such that the total quantity of DNA was
1, 2 or 3 micrograms but the ratio of firefly to Renilla plasmids
remained the same. Specifically, Figure 5A shows that Renilla
luciferase activity was dependent on the amount of DNA transfected.
However, firefly luciferase activity (as shown in Figure 5B) did
not increase with increasing amounts of DNA, perhaps because the
firefly DNA preparation was of poor quality. Consequently, the
firefly/Renilla ratio (as shown in Figure 5C), which would
typically be used as a measure of the firefly promoter activity,
varied considerably depending on the amount of DNA used. These data
demonstrate that co-transfections with Renilla plasmids do not
adequately control for the transfection efficiency of the firefly
plasmid.
[0070] Figure 6 is a graphical representation showing reporter
activity for various promoter systems using the Dual Luciferase
Assay. Six different promoter fragments (numbered 1-6) were cloned
into pGL3 firefly luciferase plasmids. One microgram of each clone
was co-transfected with 30ng of Renilla (transfection control)
plasmid, driven by an SV40 promoter. Firefly and Renilla luciferase
activities were measured using the Dual Luciferase Assay (Promega,
Madison, WI, USA). Results are expressed as Renilla luciferase
activity (A), Firefly luciferase activity (B) and firefly divided
by Renilla activity (C). Similar results were seen in multiple
experiments using at least 2 different preparations of each
construct. Renilla luciferase activity (as shown in Figure 6A) is
intended as a transfection control and analysis of this result
alone would suggest an unusually high variation in transfection
efficiency. For example, Renilla luciferase activity is 3.5 fold
higher when co-transfected with construct 4 compared to
co-transfection with construct 3. Variations in DNA quality or
errors in the quantification of DNA seem unlikely as sources of
error since the same pattern was seen with a separate set of DNA
preparations (data not shown). Firefly luciferase activity (as
shown in Figure 6B) is influenced by both transfection efficiency
and differences between promoters 1-6. The pattern of differences
is similar to that seen with Renilla (Figure 6A). For example, 3
and 6 are low whilst 4 and 5 are high. However these differences
between constructs are more marked with firefly (e.g., construct 4
is 12 fold higher than construct 3), suggesting that the activity
of promoters 1-6 is somehow affecting expression of Renilla (or
vice versa). Firefly/Renilla (Figure 6C) is considered to be a
measure of true firefly promoter activity (1-6) after correction
for transfection efficiency (Renilla). Again a similar pattern is
seen, suggesting that indeed 3 and 6 are the weakest promoters
whilst 4 and 5 are the strongest. Whilst it is possible that
promoter activity (Figure 6C) coincidentally correlated with
transfection efficiency (Figure 6A), this possibility seems
extremely unlikely given that similar results were obtained with
numerous different constructs and multiple different preparations
of the same construct. It seems more likely that the level of
expression of Renilla luciferase is affected by the strength of the
promoter construct with which it is co-transfected. Consequently,
apparent differences between promoters 1-6 are likely to be an
underestimation of the true differences.
[0071] Figure 7 is a graphical representation showing different
reporter levels for BTL, BTG2, BTG1 and BTG1N4 expression vectors
on a time course after blocking transcription. Tet-Off HeLa cells
were transfected with the following reporter plasmids, each
containing a TRE promoter linked to a reporter gene; BTL
(luciferase), BTG2 (d2EGFP), BTG1 (d1EGFP) and BTG1N4 (same as BTG1
but with 4 copies of the nonamer UUAUUUAUU [SEQ ID NO:1] present in
the 3'-UTR-encoding region). Ten hrs after transfection, each flask
of cells was split into multiple small plates. Doxycycline (1 g/mL)
was added at 24 hrs after transfection (time zero) to block
transcription of the reporter genes. Reporter levels (fluorescence
or luminescence) were measured at this and subsequent time points,
as described in Example 14, and presented as the percentage of time
zero. No decrease in luciferase activity (BTL) was seen during the
10 hr time-course. The 2 hr half-life EGFP construct (BTG2) showed
a moderate response to the doxycycline-induced block in
transcription and a faster response was seen with the 1 hr
half-life EGFP (BTG1). The construct containing the nonamers
(BTG1N4), however, showed by far the fastest response to this block
in transcription.
[0072] Figure 8 is a graphical representation showing the data used
for Figure 7 displayed on a linear scale. The doxycycline-induced
block in transcription is detectable as a 50% block in reporter
levels after approximately 6.5 hrs with BTG1. However, this is
reduced to less than 3 hrs by inclusion of the nonamers
(BTG1N4).
[0073] Figure 9 is a graphical representation showing the effect of
different numbers (1, 2 or 4) of nonamer RNA destabilising
elements. A time-course was performed as described in Figure 7,
except with time zero defined as 4 hrs after addition of
doxycycline to eliminate the effect of the delay in the action of
this drug. The presence of a single nonamer (BTG1N1) was sufficient
to increase the "effective rate of decay," whereas progressively
stronger effects were seen with 2 nonamers (BTG1N2) and 4 nonamers
(BTG1N4). The latter construct showed an "effective half-life" of
~1 hr 20 mins, which is little more than the 1 hr half-life of the
protein alone.
[0074] Figure 10 is a graphical representation showing changing
reporter levels over time in the absence of a transcriptional
block. A time-course was performed as described in Figure 7.
However, the data presented represent samples not treated with
doxycycline and measured at 24 hrs after transfection (start) or 34
hrs after transfection (finish). Consistent expression levels were
seen only with BTG1N4.
[0075] Figure 11 is a graphical representation showing changes in
reporter levels over time in the absence of a transcriptional
block. A time-course was performed as described in Figure 7.
BTG1fos contains the c-fos ARE. These data demonstrate that
different types of mRNA destabilising elements can be used to
achieve the same effect.
[0076] Figure 12 is a graphical representation showing that RNA
destabilising elements are useful in determining expression when a
Luciferase reporter protein is used. A further enhancement would be
expected using a luciferase reporter protein with
protein-destabilising elements. A time-course was performed as
described in Figure 7, using two luciferase-expressing constructs.
BTL contains the standard Firefly luciferase-coding region and
3'-UTR (derived from pGL3-Basic; Promega), whereas BTLN6 contains 6
copies of the nonamer UUAUUUAUU [SEQ ID NO:1] in the 3'-UTR.
[0077] Figure 13 is a graphical representation showing reporter
levels over time using DsRed destabilised by RNA destabilising
elements and protein-destabilising elements. A time course was
performed as described in Figure 7 and Example 14. The constructs
used were DsRed2 (BTR), DsRed-MODC (BTR1) and DsRed-MODC containing
4 UUAUUUAUU [SEQ ID NO:1] nonamers in the 3'-UTR (BTR1N4). After
blocking transcription with doxycycline, red fluorescence continues
to increase with all constructs. This is substantially reduced by
the protein-destabilising element and further reduced by the mRNA
destabilising element.
[0078] Figure 14 is a graphical representation showing a
time-course was performed as described in Figure 7. All of the mRNA
destabilising elements tested were very effective at increasing the
rate of decay compared to controls (BTG1). These data show that the
c-myc ARE is an effective destabilising element (BTG1myc) and that
a modest increase in destabilising activity can be obtained by
combining the myc ARE with 4 nonamers (BTG1N4myc). Six nonamers
(BTG1N6) also appeared to destabilise somewhat more than 4 nonamers
(BTG1N4).
[0079] Figure 15 is a graphical representation showing a
time-course similar to that described in Figure 7. Five micrograms
of each plasmid was transfected into Tet-Off HeLa cells (Clontech)
using Lipofectamine 2000 (Gibco BRL). Six to eight hours later, the
contents of each flask (transfection) was split into multiple
dishes. Twenty four hrs after transfection, a drug (doxycycline)
known to inhibit transcription from the TRE promoter contained in
each vector was added to a final concentration of one microgram per
mL and the cells were harvested at the time-points shown. Reporter
levels (luminescence) were measured using the Dual Luciferase Assay
kit (Promega) and a luminometer (Wallac) and expressed as a % of
time zero. Each plasmid was constructed using the pGL3-Basic vector
backbone (initial B in plasmid name), with the TRE promoter (T in
plasmid name) placed upstream of the Renilla luciferase coding
sequence (Rn in plasmid name). Thus, BTRn contains the standard
Renilla luciferase reporter. In BTRn1, the mutant MODC
protein-destabilising sequence (identical to that in the d1EGFP
vector (Clontech) was fused, in frame, to the 3' end of the Renilla
luciferase sequence and is denoted by the number 1 immediately
after the reporter (Rn) symbol. In BTRnN4, 4 copies of the mRNA
destabilising nonamer TTATTTATT (denoted by N4 in the plasmid name)
were placed into the 3'-UTR-encoding region. In BTRn1N4, both the
protein (1)- and mRNA (N4)-destabilising sequences were
incorporated. The standard Renilla luciferase reporter decayed very
slowly, reaching 50% of initial values after 18 hrs. Modified
reporter vectors incorporating either the protein-destabilising
element (BTRn1) or the mRNA-destabilising element (BTRnN4) decayed
more rapidly, reaching 50% values at 9-11 hrs. However, the vector
containing both protein- and mRNA-destabilising elements, showed,
by far, the most rapid response and reached 50% in about 3.5
hrs.
[0080] Figure 16 is a graphical representation showing a
time-course similar to that described in Figure 15, except using
plasmids containing the Firefly luciferase reporter (L in plasmid
name). As seen with Renilla luciferase, the standard Firefly
luciferase (BTL) decays slowly, taking 18 hrs to reach 50%.
Modified reporter vectors incorporating either the
protein-destabilising element (BTL1) or the mRNA-destabilising
element (BTLN4) decayed more rapidly. However, the vector
containing both protein- and mRNA-destabilising elements, showed,
by far, the most rapid response and reached 50% in about 3.5
hrs.
[0081] Figure 17 is a graphical representation showing a
time-course similar to that described in Figure 15, except using
plasmids containing the enhanced green fluorescent protein (EGFP)
reporter (G in plasmid name). Reporter levels were measured by flow
cytometry and analysed using FlowJo software. Briefly, the
percentage of positive cells was determined at time zero and used
to assign a "percentile" corresponding to the median of the
positive cells. The fluorescence of that percentile was then
measured at all time points and expressed as a percentage of the
time zero value. As seen with the luciferase vectors, the standard
EGFP (BTG) decays slowly, taking ~20 hrs to reach 50%. Using
Clontech's destabilised, d2EGFP reporter, with a reported protein
half-life of 2hrs (BTG2), the time to 50% was reduced to ~10 hrs
and this was further reduced to ~6.3 hrs by substituting in the
stronger protein-destabilising motif from d1EGFP (BTG1). However,
the vector further containing the mRNA-destabilising element
(BTG1N4), showed, by far, the most rapid response and reached 50%
in ~3.3 hrs.
[0082] Figure 18 is a graphical representation showing a
time-course similar to that described in Figure 15, except using
plasmids containing the enhanced yellow fluorescent protein (EYFP)
reporter (Y in plasmid name). As seen with other standard reporter
vectors, the standard EYFP (BTY) decays slowly, taking >24 hrs
to reach 50%. Using Clontech's destabilised, d2EYFP reporter, with
a reported protein half-life of 2hrs, the time to 50% was reduced
to ~20.5 hrs (BTY2) and this was further reduced to ~12 hrs by
substituting in the stronger protein-destabilising motif from
d1EGFP (BTY1). However, the vector further containing the
mRNA-destabilising element (BTY1N4) showed, by far, the most rapid
response and reached 50% in ~4 hrs.
[0083] Figure 19 is a graphical representation showing a
time-course similar to that described in Figure 15, except using
plasmids containing the enhanced cyan fluorescent protein (ECFP)
reporter (C in plasmid name). As seen with other standard reporter
vectors, the standard ECFP (BTC) decays slowly, taking >24 hrs
to reach 50%. Using Clontech's destabilised, d2ECFP reporter, with
a reported protein half-life of 2hrs, the time to 50% was reduced
to ~16.5 hrs (BTC2) and this was further reduced to ~12 hrs by
substituting in the stronger protein-destabilising motif from
d1EGFP (BTC1). However, the vector further containing the
mRNA-destabilising element (BTC1N4) showed, by far, the most rapid
response and reached 50% in ~4.3 hrs.
[0084] Figure 20 is a graphical representation showing a
time-course similar to that described in Figure 15, except using
plasmids containing the HcRed red fluorescent protein (Clontech)
reporter (H in plasmid name). As seen with other standard reporter
vectors, the standard HcRed (BTH) decays slowly, taking >24 hrs
to reach 50%. Fusing this reporter gene to the MODC fragment from
d2EGFP reduced this time to ~22.5 hrs (BTH2) and this was further
reduced to ~17 hrs by substituting in the stronger
protein-destabilising motif from d1EGFP (BTH1). However, the vector
further containing the mRNA-destabilising element (BTH1N4) showed,
by far, the most rapid response and reached 50% in ~7.3 hrs (4-7
hrs in repeat experiments).
[0085] Figure 21 is a graphical representation showing a
time-course similar to that described in Figure 15, except using
plasmids containing the beta-galactosidase reporter (B in plasmid
name) from pSV-beta galactosidase (Promega). The standard
beta-galactosidase reporter (BTB) showed little, if any decay in
activity over 32 hrs. Fusing this reporter gene to the MODC
fragment from d1EGFP (BTB1) caused a slight increase in decay rate
but a faster decay was seen with the vectors further containing the
mRNA-destabilising element (BTB1N4) or containing the
mRNA-destabilising element alone (BTBN4). These latter 2 vectors
were further modified (BTuB1N4 and BTuBN4 respectively) to
incorporate a ubiquitin sequence (u in reporter name), at the 5'
end of the protein-coding sequence, such that upon cleavage of the
ubiquitin, the remaining (modified) beta galactosidase protein
contains an N-terminal amino acid sequence beginning with arginine
and shown to destabilise proteins via the N-end rule. These
ubiquitin-fusion vectors showed more rapid decay but the fastest
decay was achieved with BTmuB1N4, which contains a mutant
(non-cleavable) ubiquitin sequence at the 5' coding sequence (mu in
reporter name), the MODC fragment at the 3' coding sequence and the
four nonamers in the 3'-UTR sequence.
[0086] Figure 22 is a graphical representation showing a
time-course similar to that described in Figure 15. BTY1N4
represents the EYFP reporter, with both protein- and
mRNA-destabilising elements as described in Figure 18. BTpuroY1N4
was constructed by inserting the puromycin coding sequence, in
frame, at the 5' end of the coding sequence in BTY1N4, such that
the reporter protein produced is a fusion of the
puromycin-resistance protein, EYFP and the MODC destabilising
sequence. As seen in Figure 18, reporter levels from BTY1N4 decay
rapidly after doxycycline (drug). A similar rate of decay was seen
with the puromycin-fusion reporter, either when expressed
transiently (BTpuroY1N4) or stably (BTpuroY1N4 stable cell line).
The fact that we were able to select a stable cell line in
puromycin shows that the puromycin resistance gene is active in
this fusion protein and the detectable levels of fluorescence show
that the EYFP component maintains fluorescent activity. The decay
curves demonstrate that rapid decay of our destabilised reporters
is reproducible in stably transfected cells and is not compromised
with the fusion protein. Similarly, the neomycin-EYFP-MODC fusion
protein (BTneoY1N4) also conferred antibiotic resistance (not
shown) and expressed detectable levels of fluorescence that decayed
rapidly after drug. Figure 22B shows a similar but separate
experiment utilising the same BTY1N4 and BTpuroY1N4 constructs. The
wild-type ubiquitin sequence, followed by an arginine was cloned in
frame and upstream of the coding sequence in these vectors to
create BTuY1N4 and BTupuroY1N4 respectively. Upon translation of
these reporters, the ubiquitin polypeptide is cleaved, to create a
reporter protein with an N-terminal arginine and associated leader
sequence that directs decay via the N-end rule. In particular,
BTuY1N4 decayed extremely fast, reaching 50% of initial values
after only ~1.7 hrs. This demonstrates that enhanced decay can be
achieved by incorporating 2 different protein degradation
signals.
[0087] Figure 23 is a graphical representation showing a
time-course following activation of transcription via addition of a
drug. In this experiment, the drug was PMA (50ng/mL) and the
vectors contained the TRE promoter followed by the firefly
luciferase coding sequence, either without (BTL) or with (BTL1N4)
the protein- and mRNA-destabilising elements. Two separate
experiments were performed (Figures 23A and 23B) and both show a
4-5 fold increase in levels of the destabilised reporter (BTL1N4)
following PMA. In contrast, the standard, stable reporter shows
little detectable change after PMA. These data show that a moderate
increase in transcription is easily detectable with BTL1N4 but is
virtually undetectable with the standard reporter (BTL).
[0088] Figure 24 is a graphical representation showing a
time-course following activation of transcription via addition of a
drug. As in Figure 23, the drug was PMA (50ng/mL). However, the
vectors in this series contained the Renilla luciferase coding
sequence, either without (BNRn) or with (BNRn1N4) the protein- and
mRNA-destabilising elements. Moreover, the promoter was comprised
of 4 copies of the NFkB binding sequence (N in vector name) in
place of the TRE promoter. Compared to the TRE, NF-B is more
strongly activated by PMA. Two separate experiments were performed
(Figures 24A and 24B) and both show an ~8-10 fold increase in
levels of the destabilised reporter (BNRn1N4) following PMA. In
contrast, the standard, stable reporter (BNRn) shows only a ~2 fold
increase after PMA. These data, together with the decay data (e.g.
Figures 15-22) confirm that both activation and inhibition of
transcription are more easily detected and accurately quantified
using the destabilised reporter vectors, compared to standard
reporter vectors.
[0089] Figure 25 is a graphical representation of an experiment
designed to mimic a high-throughput drug-screening assay that
utilises either the mRNA- and protein-destabilised (Figure 25A) or
standard (Figure 25B) Renilla luciferase reporters. Cells were
transfected with the indicated plasmids as described in Figure 15,
except that 6-8 hrs after transfection, the cells were trypsinised,
counted and then seeded into the wells of a 96-well plate at a
density of ~20,000 cells/well. At 24, 26 and 28 hrs
post-transfection, PMA (or carrier control; ethanol) was added to 2
wells to create duplicate samples representing 2, 4 and 6 hrs drug
treatment plus controls. At 30 hrs, the media was removed, the
cells lysed within their wells using Passive Lysis Buffer
(Promega), and reporter activity quantified as described in Figure
15. The raw data (without indication of the drug-treated samples)
were transferred to another scientist, who plotted the data and
attempted to identify the samples containing active drug. This
proved very easy with the destabilised vector (BNRn1N4), even for
the shortest drug treatment. With the standard vector (BNRn),
however, only the longest drug treatments could be identified and
these showed only a modest 50% increase, compared to 600-700% with
the destabilised vector. The identities of the drug treated samples
were cross-checked and are indicated by symbols in Figure 25A
(BNRn1N4) and Figure 25B (BNRn).
[0090] Figure 26 is a graphical representation of an experiment
that is essentially identical to that shown in Figure 25, except
that the reporter was firefly luciferase and only two different
drug treatments (2 hr and 4 hr) were performed. As seen with
Renilla luciferase, the performance of firefly luciferase was also
substantially improved by destabilising the mRNA and protein
(BNL1N4; Figure 26A) as compared to the standard vector (BNL;
Figure 26B). This is evidenced by the faster and more pronounced
change in reporter levels following drug treatment.
[0091] Figure 27 is a graphical representation of an experiment
that is essentially identical to that shown in Figure 25, except
utilising the TRE as the promoter and doxycycline as the drug so as
to mimic a screen for drugs that inhibit, rather than activate a
pathway leading to transcription. Although the inhibition of
reporter transcription (the desired effect) was presumably
identical with both vectors, the percentage change in reporter
levels (the measurable effect) was greatly enhanced with the mRNA-
and protein-destabilised Renilla luciferase (BTRn1N4; Figure 27A)
as compared to the standard Renilla vector (BTRn; Figure 27B).
[0092] Figure 28 is a graphical representation of an experiment
similar to that described in Figure 7, except using dual-colour
vectors based on the example shown in Figure 4B. A single TRE
promoter drives transcription of destabilised HcRed in one
direction (BTH1N4) and destabilised EGFP in the other. (BTG1N4).
The 5'-UTR of the EGFP transcript was altered in each construct to
contain a synthetic (artificial) UTR, the Hsp70 5'UTR, the beta
globin 5'-UTR or the 5'-UTR from standard Promega and Invitrogen
reporter vectors. In puro-GFP, the actual EGFP-coding region (from
BTG1N4) was fused with the coding region from the puromycin
resistance gene to create BTpuroG1N4. Figure 28A shows the ratio of
green fluorescence to red fluorescence (in the absence of drug),
expressed relative to the ratio with Promega 5'-UTR construct. The
poor level of translation with the synthetic 5'-UTR, as well as the
translational enhancer activities of Hsp70 and beta-globin 5'-UTRs
are clearly evident. Interestingly, the puro-green construct
appears to express at even higher levels. Figure 28B shows that
following a block in transcription, EGFP fluorescence decays at a
similar rate with all constructs. This demonstrates that the
different "steady state" expression levels seen in Figure 28A are
not caused by an effect of the 5'-UTR on mRNA (or protein)
stability.
Detailed Description
[0093]
1. Definitions and abbreviations
[0094] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by those
of ordinary skill in the art to which the invention belongs.
Although any methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present invention, preferred methods and materials are described.
For the purposes of the present invention, the following terms are
defined below.
[0095] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e. to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0096] By "5'-UTR" is meant the 5' (upstream) untranslated region
of a gene. Also used to refer to the DNA region encoding the 5'-UTR
of the mRNA.
[0097] By "3'-UTR" is meant the region of a polynucleotide
downstream of the termination codon of a protein-encoding region of
that polynucleotide, which is not translated to produce
protein.
[0098] By "about" is meant a quantity, level, value, dimension,
size, or amount that varies by as much as 30%, preferably by as
much as 20%, and more preferably by as much as 10% to a reference
quantity, level, value, dimension, size, or amount.
[0099] By "ARE" is meant an AU-rich element in mRNA i.e., a
sequence that contains a high proportion of adenine and uracil
nucleotides. Also used to refer to the DNA region encoding such a
mRNA element.
[0100] By "biologically active fragment" is meant a fragment of a
full-length reference polynucleotide or polypeptide which fragment
retains the activity of the reference polynucleotide or
polypeptide, respectively.
[0101] By "CAT" is meant chloramphenicol acetyltransferase.
[0102] As used herein, the term "cis-acting sequence," "cis-acting
regulatory element," "cis-regulatory region," "regulatory region"
and the like shall be taken to mean any sequence of nucleotides,
which when positioned appropriately relative to a transcriptional
control element or to a transcribable sequence, is capable of
modulating, at least in part, the activity of the transcriptional
control element or the expression of the transcribable sequence.
Those skilled in the art will be aware that a cis-acting regulatory
element may be capable of activating, silencing, enhancing,
repressing or otherwise altering the level of expression and/or
cell-type-specificity and/or developmental specificity of a gene
sequence at the transcriptional or post-transcriptional level. In
some embodiments of the present invention, the cis-acting
regulatory element is an activator sequence that enhances or
stimulates the activity of a transcriptional control element or the
expression of a transcribable sequence. In other embodiments, the
cis-acting regulatory element modulates mRNA stability, mRNA
processing and export or translation.
[0103] By "d1EGFP" is meant a variant of EGFP that is fused to a
mutated PEST sequence and consequently has a half-life of only
about 1 hour. Similarly, d1ECFP and d1EYFP are also available. A
destabilised variant of DsRed could be made in the same way.
Henceforth referred to as d1DsRed.
[0104] By "d2EGFP" is meant a mutant form of EGFP variants that is
fused to a PEST sequence and consequently has a half-life of only 2
hours. Similarly, d2ECFP (cyan) and d2EYFP (yellow) are also
available. A destabilised variant of DsRed could possibly be made
in the same way. Henceforth referred to as d2DsRed.
[0105] By "dEGFP" is meant a general term for all destabilised
variants of EGFP (including all colours) formed. (Li et al).
[0106] By "derivative" is meant a polynucleotide or polypeptide
that has been derived from a reference polynucleotide or
polypeptide, respectively, for example by conjugation or complexing
with other chemical moieties or by post-transcriptional or
post-translational modification techniques as would be understood
in the art.
[0107] By "DNA" is meant deoxyribonucleic acid.
[0108] By "DsRed" is meant the red fluorescent protein isolated
from the IndoPacific sea anemone relative Discosoma species.
[0109] By "ECFP" is meant the mutant form of EGFP with altered
excitation/emission spectra that fluoresces cyan coloured
light.
[0110] By "EGF" is meant epidermal growth factorBy "EGFP" is meant
the enhanced green fluorescent protein. A mutant form of GFP with
enhanced fluorescence. (Cormack et al).
[0111] By "ErbB2" is meant the second member of the epidermal
growth factor receptor family. Also known as HER-2.
[0112] By "exon" is meant the sequences of a RNA primary transcript
that are part of a messenger RNA molecule, or the DNA that encodes
such sequences. In the primary transcript neighbouring exons are
separated by introns.
[0113] By "expression vector" is meant a vector that permits the
expression of a polynucleotide inside a cell. Expression of a
polynucleotide includes transcriptional and/or post-transcriptional
eventsBy "EYFP" is meant a mutant form of EGFP with altered
excitation/emission spectra that fluoresces yellow coloured
light.
[0114] By "firefly luciferase" is meant the enzyme derived from the
luc gene of the firefly, which catalyses a reaction using
D-luciferin and ATP in the presence of oxygen and Mg.sup.++
resulting in light emission.
[0115] By "flow cytometry" is meant a method, in which live or
fixed cell suspensions are applied to a flow cytometer that
individually measures an activity or property of a detectable label
associated with the cells of the suspension. Labelling of cells can
occur, for example, via fluorescent compounds or by antibodies
covalently attached to a specific fluorescent compound. Several
different excitation/emission wavelengths can be tested
simultaneously to measure different types of fluorescence.
Sub-populations of cells with desired characteristics
(fluorescence, cell size) can be gated such that further
statistical analyses apply only to the gated cells. Flow cytometers
equipped with a cell sorting option can physically separate cells
with the desired fluorescence and retrieve those (live) cells in a
tube separate from the remainder of the initial cell population.
Also referred to as FACS (fluorescence activated cell sorting).
[0116] The term "gene" as used herein refers to any and all
discrete coding regions of a host genome, or regions that code for
a functional RNA only (e.g., tRNA, rRNA, regulatory RNAs such as
ribozymes etc) as well as associated non-coding regions and
optionally regulatory regions. In certain embodiments, the term
"gene" includes within its scope the open reading frame encoding
specific polypeptides, introns, and adjacent 5' and 3' non-coding
nucleotide sequences involved in the regulation of expression. In
this regard, the gene may further comprise control signals such as
promoters, enhancers, termination and/or polyadenylation signals
that are naturally associated with a given gene, or heterologous
control signals. The gene sequences may be cDNA or genomic DNA or a
fragment thereof. The gene may be introduced into an appropriate
vector for extrachromosomal maintenance or for integration into the
host.
[0117] By "GFP" is meant a fluorescent protein (Tsien et al), which
is isolatable from the jellyfish Aequoria victoria, and which can
be used as a reporter protein. DNA constructs encoding GFP can be
expressed in mammalian cells and cause the cells to fluoresce green
light when excited with specific wavelengths. The term "GFP" is
used herein to refer to all homologues and analogues, including
colour variants and fluorescent proteins derived from organisms
other than Aequoria victoria (e.g., DSRed and HcRed, Clonetech;
hrGFP, Stratagene).
[0118] By "half-life" is meant the time taken for half of the
activity, amount or number of molecules to be eliminated. Thus, the
"mRNA half-life" is the time taken for half of the existing mRNA
molecules to decay. mRNA half-life can be measured by blocking
transcription (e.g. with Actinomycin D) and measuring the rate of
decay of the mRNA in the absence of any new mRNA being formed.
Alternatively, the intracellular half-life of a polypeptide refers
to the time taken for half of the activity, amount or number of
polypeptide molecules in a cell or population of cells to decay.
Polypeptide half-life can be measured by blocking translation (e.g.
with cyclohexamide) and measuring the rate of decay of the
polypeptide (or its functional activity) in the absence of any new
polypeptide being formed. However, the use of polypeptide levels or
activities as a measure of gene expression at earlier stages such
as transcription, suffers from long time delays between the actual
effect (altered transcription) and the measurable effect (altered
protein levels). A major cause of this delay is the relatively slow
decay of both the mRNA and the protein. The effects of this delay
include: minor or transient changes in transcription are difficult
to detect; kinetic assays are highly inaccurate; and assays require
long incubation times. Accordingly, the true measure of the time
delay between altered transcription and altered protein levels
would be the rate of decay of the polypeptide after a block in
transcription, which would incorporate the combined effects of
protein stability and mRNA stability. This measurement is referred
to herein as the "effective half-life" of a polypeptide.
[0119] By "intron" is meant a non-coding sequence within a gene, or
its primary transcript, that is removed from the primary transcript
and is not present in a corresponding messenger RNA molecule.
[0120] By "luciferase" is meant any reporter enzyme that catalyses
a reaction, which leads to light emission. Exogenous substrates are
added and the reaction is quantified using a luminometer. The
substrate requirements for firefly and Renilla luciferases are
different, allowing the two to be distinguished in the Dual
Luciferase Assay (Promega, Madison, WI, USA).
[0121] By "MAPK" is meant a mitogen activated protein kinase.
Includes several different kinases involved in intracellular signal
transduction pathways that lead to growth or apoptosis (cell
death). The term "MAPK" is sometimes used in reference to two
specific MAPKs, Erk1 and Erk2 (extracellular regulated kinases 1
and 2).
[0122] By "mCMV" is meant a minimal CMV promoter. In some
embodiments, a minimal mCMV promoter does not activate
transcription on its own but can be linked to a TRE to provide
tetracycline (and doxycycline)-dependent transcription or linked to
other enhancer elements to provide transcription that is dependent
on the activity of that enhancer.
[0123] By "MCS" is meant a multiple cloning site, which is a region
of a nucleic acid molecule comprising a plurality of sites
cleavable by different enzymes or chemicals for inserting
polynucleotides into the nucleic acid molecule. Typically, a MCS
refers to a region of a DNA vector that contains unique restriction
enzyme recognition sites into which a DNA fragment can be inserted.
The term "MCS" as used herein, also includes any other site that
assists the insertion of DNA fragments into the vector. For
example, a T overhang (Promega, Madison, WI, USA), which allows
direct insertion of fragments generated by polymerase chain
reaction (PCR).
[0124] By "mRNA" is meant messenger RNA, which is a "transcript"
produced in a cell using DNA as a template, which itself encodes a
protein. mRNA is typically comprised of a 5'-UTR, a protein
encoding (i.e., coding) region and a 3'-UTR. mRNA has a limited
half-life in cells, which is determined, in part, by stability
elements, particularly within the 3'-UTR but also in the 5'-UTR and
protein encoding region.
[0125] By "MODC" is meant mouse ornithine decarboxylase or a
portion, variant or derivative thereof containing a PEST
sequence.
[0126] By "modulating" is meant increasing or decreasing, either
directly or indirectly, the stability or activity of a molecule of
interest.
[0127] By "operably connected" or "operably linked" and the like is
meant a linkage of polynucleotide elements in a functional
relationship. A nucleic acid is "operably linked" when it is placed
into a functional relationship with another nucleic acid sequence.
For instance, a promoter or enhancer is operably linked to a coding
sequence if it affects the transcription of the coding sequence.
Operably linked means that the nucleic acid sequences being linked
are typically contiguous and, where necessary to join two protein
coding regions, contiguous and in reading frame. A coding sequence
is "operably linked to" another coding sequence when RNA polymerase
will transcribe the two coding sequences into a single mRNA, which
is then translated into a single polypeptide having amino acids
derived from both coding sequences. The coding sequences need not
be contiguous to one another so long as the expressed sequences are
ultimately processed to produce the desired protein. "Operably
connecting" a promoter to a transcribable polynucleotide is meant
placing the transcribable polynucleotide (e.g., protein encoding
polynucleotide or other transcript) under the regulatory control of
a promoter, which then controls the transcription and optionally
translation of that polynucleotide. In the construction of
heterologous promoter/structural gene combinations, it is generally
preferred to position a promoter or variant thereof at a distance
from the transcription start site of the transcribable
polynucleotide, which is approximately the same as the distance
between that promoter and the gene it controls in its natural
setting; i.e.: the gene from which the promoter is derived. As is
known in the art, some variation in this distance can be
accommodated without loss of function. Similarly, the preferred
positioning of a regulatory sequence element (e.g., an operator,
enhancer etc) with respect to a transcribable polynucleotide to be
placed under its control is defined by the positioning of the
element in its natural setting; i.e. the genes from which it is
derived.
[0128] The term "pA" as used herein refers to a polyadenylation
site, which is a DNA sequence that serves as the site to cleave and
add to the immature mRNA, a polyA tail. Various pA sequences from
SV40 virus genes or the galactosidase gene or other sources,
including synthetic polyadenylation sites can be used in expression
vectors for this purpose.
[0129] The term "PEST" refers to an amino acid sequence that is
enriched with the amino acids proline (P), glutamic acid (E),
serine (S) and threonine (T). Proteins containing PEST sequences
have shortened half-lives.
[0130] By "plasmid" is meant a circular DNA vector. Plasmids
contain an origin of replication that allows many copies of the
plasmid to be produced in a bacterial (or sometimes eukaryotic)
cell without integration of the plasmid into the host cell DNA.
[0131] By "PMA" is meant phorbol myristoloic acid.
[0132] By "polynucleotide" or "nucleic acid" is meant linear
sequences of nucleotides, including DNA or RNA, which may be
double-stranded or single-stranded.
[0133] By "polypeptide," "peptide" or "protein" is meant a polymer
of amino acids joined by peptide bonds in a specific sequence.
[0134] By "promoter" is meant a region of DNA, generally upstream
(5') of a coding region, which controls at least in part the
initiation and level of transcription. Reference herein to a
"promoter" is to be taken in its broadest context and includes the
transcriptional regulatory sequences of a classical genomic gene,
including a TATA box and CCAAT box sequences, as well as additional
regulatory elements (i.e., activating sequences, enhancers and
silencers) that alter gene expression in response to developmental
and/or environmental stimuli, or in a tissue-specific or
cell-type-specific manner. A promoter is usually, but not
necessarily, positioned upstream or 5', of a structural gene, the
expression of which it regulates. Furthermore, the regulatory
elements comprising a promoter are usually positioned within 2 kb
of the start site of transcription of the gene. Promoters according
to the invention may contain additional specific regulatory
elements, located more distal to the start site to further enhance
expression in a cell, and/or to alter the timing or inducibility of
expression of a structural gene to which it is operably connected.
The term "promoter" also includes within its scope inducible,
repressible and constitutive promoters as well as minimal
promoters. Minimal promoters typically refer to minimal expression
control elements that are capable of initiating transcription of a
selected DNA sequence to which they are operably linked. In some
examples, a minimal promoter is not capable of initiating
transcription in the absence of additional regulatory elements
(e.g., enhancers or other cis-acting regulatory elements) above
basal levels. A minimal promoter frequently consists of a TATA box
or TATA-like box. Numerous minimal promoter sequences are known in
the literature. For example, minimal promoters may be selected from
a wide variety of known sequences, including promoter regions from
fos, CMV, SV40 and IL-2, among many others. Illustrative examples
are provided which use a minimal CMV promoter or a minimal IL2 gene
promoter (-72 to +45 with respect to the start site; Siebenlist,
1986).
[0135] By "Renilla luciferase" is meant a polypeptide, which is
derivable from sea pansy (Renilla reniformis), and which utilizes
oxygen and coelenterate luciferin (coelenterazine) to generate
light emission.
[0136] By "reporter vector" is meant an expression vector
containing a "reporter gene" that encodes a polypeptide (or mRNA)
that can be easily assayed. Typically, the reporter gene is linked
to regulatory sequences, the function or activity of which, is
being tested.
[0137] By "reporter" is meant a molecule, typically a protein or
polypeptide, which is encoded by a reporter gene and measured in a
reporter assay. Current systems generally utilize an enzymatic
reporter and measure reporter activity.
[0138] By "RNA" is meant ribonucleic acid.
[0139] By "rtTA" is meant reverse tTA (see below), which binds the
TRE and activates transcription only in the presence of
tetracycline or doxycycline.
[0140] By "SEAP" is meant secreted alkaline phosphatase reporter
gene.
[0141] By "SKBR3" is meant the human breast cancer cell line that
overexpresses ErbB2.
[0142] By "stringent conditions" is meant temperature and ionic
conditions under which only nucleotide sequences having a high
frequency of complementary bases will hybridise. The stringency
required is nucleotide sequence dependent and depends upon the
various components present during hybridisation and subsequent
washes, and the time allowed for these processes. Generally, in
order to maximise the hybridisation rate, non-stringent
hybridisation conditions are selected; about 20 to 25.degree. C
lower than the thermal melting point (T.sub.m). The T.sub.m is the
temperature at which 50% of specific target sequence hybridises to
a perfectly complementary probe in solution at a defined ionic
strength and pH. Generally, in order to require at least about 85%
nucleotide complementarity of hybridised sequences, highly
stringent washing conditions are selected to be about 5 to
15.degree. C lower than the T.sub.m. In order to require at least
about 70% nucleotide complementarity of hybridised sequences,
moderately stringent washing conditions are selected to be about 15
to 30.degree. C lower than the T.sub.m. Highly permissive (low
stringency) washing conditions may be as low as 50.degree. C below
the T.sub.m, allowing a high level of mis-matching between
hybridised sequences. Those skilled in the art will recognise that
other physical and chemical parameters in the hybridisation and
wash stages can also be altered to affect the outcome of a
detectable hybridisation signal from a specific level of homology
between target and probe sequences.
[0143] The term "SV40/CMV/RSV" is used herein to refer to promoter
elements derived from simian virus, cytomegalovirus and Rous
sarcoma virus respectively. Generally, these promoters are thought
to be constitutively active in mammalian cells.
[0144] By "TetO" is meant the Tet operator DNA sequence derived
from the E. coli tetracycline-resistance operon.
[0145] By "Tet-Off Cell Lines" is meant cell lines stably
expressing tTA such that tetracycline or doxycycline will shut off
transcription from TRE promoters.
[0146] By "Tet-On Cell Lines" is meant cell lines stably expressing
rtTA such that tetracycline or doxycycline will turn on
transcription from TRE promoters.
[0147] By "transcription" is meant the process of synthesizing a
RNA molecule complementary to the DNA template.
[0148] By "transfection" is meant the process during which a
plasmid or DNA fragment is inserted into a eukaryotic cell.
Typically, 2-50% of cells take up the plasmid and express the
protein product for ~3 days without incorporating the plasmid DNA
into the cell's chromosomes (= transient transfection). A small
proportion of these cells will eventually incorporate the plasmid
DNA into their genome and permanently express the protein product
(= stable transfection).
[0149] As used herein the term "transgenic" refers to a genetically
modified animal in which the endogenous genome is supplemented or
modified by the random or site-directed integration of a foreign
gene or sequence.
[0150] The "transgenic animals" of the invention are suitably
produced by experimental manipulation of the genome of the germline
of the animal. These genetically engineered animals may be produced
by several methods including the introduction of a "transgene"
comprising nucleic acid (usually DNA) into an embryonal target cell
or integration into a chromosome of the somatic and/or germ line
cells of an animal by way of human intervention. A transgenic
animal is an animal whose genome has been altered by the
introduction of a transgene.
[0151] By "translation" is meant the process whereby a mRNA
molecule is used as a template for protein synthesis.
[0152] By "TRE" is meant any tetracycline responsive element
(Gossen et al), generally combined with a minimal promoter such
that transcription occurs only via the binding of exogenous factors
(e.g., tTA or rtTA) to the TRE. Preferred embodiments of this
invention utilize a TRE comprised of 7 repeats of the tetO sequence
linked to a minimal CMV promoter (mCMV) (Clontech Laboratories
Inc., Palo Alto, CA, USA).
[0153] By "tTA" is meant tetracycline-controlled transactivator,
which is comprised of the Tet repressor protein (TetR) and the VP16
activation domain, such that it binds the TRE and activates
transcription, only in the absence of tetracycline or
doxycycline.
[0154] By "TS" is meant thromboxane synthase promoter.
[0155] By "variant" is meant a polynucleotide or polypeptide
displaying substantial sequence identity with a reference
polynucleotide or polypeptide, respectively. Variant
polynucleotides also include polynucleotides that hybridise with a
reference sequence under stringent conditions. These terms also
encompasses polynucleotides which differ from a reference
polynucleotide by the addition, deletion or substitution of at
least one nucleotide. In this regard, it is well understood in the
art that certain alterations inclusive of mutations, additions,
deletions and substitutions can be made to a reference
polynucleotide whereby the altered polynucleotide retains the
biological function or activity of the reference polynucleotide.
The terms "polynucleotide variant"and "variant" also include
naturally occurring allelic variants. With regard to variant
polypeptides, it is well understood in the art for example that
some amino acids may be changed to others with broadly similar
properties without changing the nature of the activity of the
polypeptide (conservative substitutions).
[0156] By "vector" is meant a vehicle for inserting a foreign DNA
sequence into a host cell and/or amplifying the DNA sequence in
cells that support replication of the vector. Most commonly a
plasmid but can also be a phagemid, bacteriophage, adenovirus or
retrovirus.
[0157] By "vEGFP," "EGFP I" or "variant of EGFP" is meant different
colour variants and/or different half-life variants of EGFP.
[0158] By "vGFP" is meant all variants of GFP; including homologues
and analogues such as DsRed, also EGFP variants or destabilised GFP
variants.
2. Constructs and methods of the present invention
[0159] The present invention provides inter alia expression
constructs which modulate the stability of transcripts and
consequently, the amount or activity of polypeptide produced by the
constructs. Although constructs which increase the stability of a
transcript are clearly encompassed by the present invention,
certain embodiments focus on destabilising transcripts. Here
transcript stability can be reduced by the addition of one or more
destabilising elements to, or by the removal of one or more
stability elements (e.g., a poly A tail) from, a transcribable
polynucleotide. Compared to existing expression constructs, the
construct of the present invention provides kinetics of protein
expression with improved temporal correlation to the promoter
activity, e.g., by reducing the time lag between decreased promoter
activity and decreased levels of a corresponding expression product
or by reducing the steady state level of the expression product
such that increased promoter activity results in a larger and/or
faster increase in levels of the expression product relative to
that present before the increase in promoter activity.
[0160] Accordingly, one aspect of the present invention is directed
to a construct comprising in operable linkage: a polynucleotide
that encodes a polypeptide and a nucleic acid sequence that encodes
a RNA element that modulates the stability of a transcript encoded
by the polynucleotide.
[0161] The term "modulates" in the context of transcript stability
refers to increasing or decreasing the stability of a transcript
and optimal amounts of modulation depends upon the particular
application. Without limiting the present invention to any one
particular theory or mode of operation, where the RNA element is a
sequence of nucleotides which destabilises the transcript, it is
envisaged that the element directly or indirectly targets the
transcript for degradation.
[0162] As used herein the term "destabilising element" refers to a
sequence of amino acids or nucleotides which reduces the half-life
of a protein or transcript, respectively, inside a cell.
Accordingly, a "RNA destabilising element" comprises a sequence of
nucleotides which reduces the intracellular half-life of a RNA
transcript and a "protein-destabilising element" comprises a
sequence of amino acids which reduces the intracellular half-life
of a protein. mRNA destabilising elements improve the temporal
correlation between altered promoter activity (or mRNA processing
events) and altered cytoplasmic mRNA levels. Protein destabilising
elements improve the temporal correlation between altered
cytoplasmic mRNA levels and altered reporter levels or activity.
The extent of the reduction sought at each level depends upon the
particular application. In certain embodiments the combination of
RNA destabilisation and protein destabilisation significantly
improves the temporal correlation between promoter activity (or
mRNA processing) and reporter levels or activity in expression
constructs compared to constructs without destabilisation elements
or with only one type of destabilising element. In other
embodiments, the protein destabilising elements improve the
temporal correlation between altered mRNA stability, processing or
translation and altered reporter levels or activity. In relation to
increasing transcript stability, optimum levels of stability will
again depend upon the application.
[0163] A "RNA stabilising element" is a sequence of nucleotides
which increases the intracellular half-life of a RNA molecule which
is suitably, but not exclusively selected from mRNA, heterogenous
nuclear RNA (hnRNA), small nuclear RNA (snRNA), small nucleolar RNA
(snoRNA), small cytoplasmic RNA (scRNA), ribosomal RNA (rRNA),
translational control RNA (tcRNA), transfer RNA (tRNA), eRNA,
messenger-RNA-interfering complementary RNA (micRNA) or
interference RNA (iRNA) and mitochondrial RNA (mtRNA). In certain
embodiments the RNA molecules are mRNA molecules.
[0164] In the context of reducing the intracellular half-life of a
molecule selected from a RNA transcript or an encoded protein of
interest, (a) one or more destabilising elements are typically
added and/or (b) one or more stabilising elements are typically
removed in order to confer a level of enhanced degradation on the
molecule, which thereby reduce(s) the intracellular half-life of
the molecule to a half-life that is suitably less than about 24, 10
or 5 hours, desirably less than about 3, 2 or 1 hour(s), or even
less than about 30, 15, 10, 5 or 3 minutes. The half-life of a RNA
transcript or an encoded protein of interest advantageously
corresponds to the lowest half-life that provides a steady-state
expression level of at least about 10-fold the minimum detectable
level of the transcript or encoded protein.
[0165] The intracellular or intracellular-like conditions are
typically physiological for the cell type. The temperature of the
intracellular or intracellular-like conditions is usually
physiological for the cell type. Exemplary temperatures for
mammalian cells range generally from about 30.degree.to about
42.degree.C, and typically from about 35.degree.C to about
37.degree.C.
[0166] At a minimum, enhanced ribonucleic or proteolytic
degradation of a RNA transcript or polypeptide, respectively,
refers to a level of ribonucleic or proteolytic degradation that is
at least about 5, 10, 20, 40, 50, 60, 70, 80, 90, 100, 150, 200,
400, 600, 1,000, 2,000, 4,000, 6,000, 8,000, 10,000, 12,000%
greater than that of the RNA transcript or polypeptide in the
absence of the destabilising element(s) or in the presence of a
stabilising element(s) as the case may be. Assays for measuring RNA
degradation are known to those of skill in the art. For example,
RNA degradation can be measured using a range of assays disclosed
for example by Ross, J (1995) or by Liu, J et al. (JBC 2000), which
are based on the use of transcriptional inhibitors (Actinomycin D,
DRB, cordycepin, alpha-amanitin), pulse labelling (radioactive
nucleosides), cell-free decay methods (polysomes, cytosol or
reticulocytes), or short-term promoter activation (fos promoter,
see below). Assays for measuring degradation of proteins are also
known to persons of skill in the art. For example, proteolytic
degradation may be measured in vitro using a mammalian cell lysate
assay including, but not restricted to, the reticulocyte lysate
assay of Bachmair et al in U.S. Patent Serial No. 5,646,017.
Alternatively, proteolytic degradation may be measured in vivo
using cyclohexamide or pulse-chase protocols as for example
disclosed by Vazhappilly, R and Sucher, N (2002) or by Saito, T et
al. (1998). In certain embodiments, intracellular half-lives of
polypeptides are determined using blockers of translation (e.g.,
cyclohexamide).
[0167] The RNA destabilising elements can be derived from any
source and in particular the 3'-UTR or 5'-UTR regions of
short-lived mRNAs often contain destabilising sequences. As used
herein, the term "derived from" shall be taken to indicate that a
particular integer or group of integers has originated from the
species specified, but has not necessarily been obtained directly
from the specified source. For example, RNA destabilising sequences
may be cloned from short-lived RNAs such as but not limited to RNAs
from the c-fos, c-jun, c-myc, GM-CSF, IL-3, TNF-alpha, IL-2, IL-6,
IL-8, IL-10, Urokinase, bcl-2, SGLT1 (Na(+)-coupled glucose
transporter), Cox-2 (cyclooxygenase 2), IL8, PAI-2 (plasminogen
activator inhibitor type 2), beta1-adrenergic receptor and GAP43
(5'-UTR and 3'-UTR) genes. Alternatively, RNA destabilising
sequences may be selected from AU-rich elements (AREs) and/or
U-rich elements (UREs), including but not limited to single, tandem
or multiple or overlapping copies of the nonamer UUAUUUA(U/A)(U/A)
[SEQ ID NO:2] (where U/A is either an A or a U) (Lagnado et al
1994) and/or the pentamer AUUUA [SEQ ID NO:3] (Xu et al 997) and/or
the tetramer AUUU [SEQ ID NO:4] (Zubiaga et al. 1995). The term
"tandem copies" allows for both duplication and/or non-duplication
of one or more of the outer nucleotides. For example, tandem copies
of the pentamer AUUUA [SEQ ID NO:3] , includes sequences such as
AUUUAUUUAUUUA [SEQ ID NO:5] as well as AUUUAAUUUAAUUUA [SEQ ID
NO:6] . RNA destabilising elements have also been described for
example from phosphoenolpyruvate carboxy kinase mRNA (PEPCK), the
Drosophila Bicoid gene, the human thioredoxin gene, heat stable
antigen gene and soybean 10A5 gene.
[0168] Iron responsive elements and iron regulatory protein binding
sites may also be advantageously incorporated into the instant
constructs to modulate RNA stability or translational efficiency
experimentally or in response to stimuli. Histone RNAs,
particularly their 3'-UTRs, are especially useful for modulating
RNA stability in a cell-cycle dependent fashion.
[0169] Also contemplated are modifications to or permutations of
the elements listed above. Accordingly, biologically active
fragments as well as variants and derivatives of the destabilising
elements referred to above are encompassed by the present
invention. For example, RNA destabilising elements may be
identified and/or modifications made thereto using a computational
approach and database analysis (Dandekar T et al).
[0170] In a related embodiment the present invention contemplates a
construct comprising in operable linkage: a polynucleotide which
encodes a polypeptide and a nucleic acid sequence which encodes a
stabilising RNA element that enhances the stability of a transcript
encoded by polynucleotide. In illustrative examples the nucleic
acid sequence is, or is derived from, a gene selected fromalpha2
globin, alpha1 globin, beta globin, or growth hormone, which are
examples of long-lived mRNAs. As used herein, underscoring or
italicising the name of a gene shall indicate the gene, in contrast
to its protein product, which is indicated by the name of the gene
in the absence of any underscoring or italicising. For example,
"alpha2 globin" shall mean the alpha2 globin gene, whereas "alpha2
globin" shall indicate the protein product of the "alpha2 globin"
gene.
[0171] The ability to destabilise a transcript and to reduce the
amount of protein produced by a cell will clearly be useful for a
wide range of applications, including methods for assaying the
activity of gene expression-modulating elements (e.g.,
transcriptional control elements and cis-acting regulatory
elements) or for identifying elements of this type or agents that
modulate their activity. Thus, another aspect of the present
invention contemplates a construct comprising in operable linkage a
polynucleotide which encodes a polypeptide and a nucleic acid
sequence which encodes a RNA destabilising element that reduces the
stability of a transcript encoded by the polynucleotide. In
illustrative examples, the nucleic acid sequence is, or is derived
from,a gene selected from c-fos, c-jun, c-myc, GM-CSF, IL-3,
TNF-alpha, IL-2, IL-6, IL-8, IL-10, Urokinase, bcl-2, SGLT1
(Na(+)-coupled glucose transporter), Cox-2 (cyclooxygenase 2),
IL-8, PAI-2 (plasminogen activator inhibitor type 2),
beta1-adrenergic receptor or GAP43. In certain embodiments, the
nucleic acid sequence is selected from any one of SEQ ID NOS 1 to
23, especially from SEQ ID NO:1, 13, 19 or 49, or biologically
active fragments thereof, or variants or derivatives of these.
[0172] In certain embodiments, the nucleic acid sequence encoding
the RNA destabilising element is linked to a sequence encoding a
protein of interest, which in turn is linked to a promoter of
interest that is optionally modulatable (i.e., inducible or
repressible) such that expression is turned on and then turned off.
In this application, the RNA destabilising elements typically serve
to shorten the period of expression of a functional mRNA or
protein. This may be applied in vitro or in vivo. For example, a
cell cycle-specific promoter could be combined with the RNA
destabilising elements to express a protein of interest,
exclusively in certain stages of the cell cycle. The protein of
interest may be a functional protein or a reporter protein. In the
latter example, reporter levels can be used as an indicator of
cell-cycle stage or cell proliferation. Similarly, the reporter
levels may be used to give a measure of other cellular events
relating to the activity of the promoter of interest. Such events
include, but are not limited to, apoptosis, immune function,
modulation of a signal transduction pathway, modulation of a
regulatory pathway, modulation of a biosynthetic pathway, toxic
response and cell differentiation. In certain embodiments in which
the activity of a cis-acting regulatory element (e.g., an enhancer
or post-transcriptional control element) is of interest, the
reporter levels may also give a measure of cellular events (as
discussed for the promoter of interest) relating to the activity of
that cis-acting regulatory element. By extension, reporter levels
may be used as an indirect measure of action of a compound or
treatment on a cellular event.
[0173] One particular application is in the area of determining
gene expression. Specifically, by reducing the time lag between
altered transcription and altered levels of the resultant
polypeptide in a cell, it is possible to more accurately determine
promoter or enhancer activity. In this application a reporter gene,
whose expression is modulated by regulatory elements within the
construct, is used to determine promoter or enhancer activity.
Thus, another aspect of the present invention contemplates a
construct comprising in operable linkage: a polynucleotide which
encodes a reporter polypeptide and a nucleic acid sequence which
encodes a RNA destabilising element that reduces the stability of a
transcript encoded by the polynucleotide.
[0174] In some embodiments the RNA destabilising sequences are
incorporated into the region encoding the 3'-UTR of the reporter
mRNA. Alternatively or in addition, destabilising elements are
incorporated into the 5'-UTR and/or protein coding region, which is
suitably not essential to, or does not interfere with, the selected
activity of the encoded protein.
[0175] In a related embodiment the RNA destabilising sequences are
used to alter the kinetics of expression of a polypeptide from a
gene of interest when for example there is a need to accurately
monitor, limit or reduce its expression. Typically for this
application, RNA destabilising elements are used in conjunction
with protein-destabilising elements.
[0176] The constructs of the present invention have applications in
a variety of gene expression systems where it is desirable to have
a brief period of mRNA or protein expression or to minimise the
time lag between changes in promoter activity and the resultant
changes in mRNA/protein levels.
[0177] In certain embodiments, the constructs are designed for use
in eukaryotic cell systems. It should be noted however that the RNA
destabilising elements may be used in a wide range of eukaryotic
(e.g., mammals and plants) systems including cells, tissues or
whole organisms defined as yeast, insect, nematode, fish, bird or
mammal. For use in plants, different promoters and possibly
different reporters and RNA destabilising elements (e.g., DST
sequences) may be used.
[0178] In some embodiments, the polynucleotide whose transcript is
stabilised or destabilised by the RNA element encodes a reporter
molecule or a destabilised variant thereof. Reporter molecules are
well known in the art. Suitably, the reporter molecules are
reporter proteins illustrative examples of which include, but are
not limited to, Luciferase, Green Fluorescent Protein, Red
Fluorescent Protein, SEAP, CAT, or biologically active fragments
thereof, or variants or derivatives of these.
[0179] In other embodiments, the polynucleotide whose transcript is
stabilised or destabilised by the RNA element encodes a protein
having at least a light-emitting activity and a selection marker
activity. Suitably, the polynucleotide comprises a chimeric gene,
which includes a coding sequence from a gene encoding a
light-emitting protein and a coding sequence from a gene encoding a
selectable marker protein. Illustrative examples of light-emitting
proteins include fluorescent proteins (e.g., Green Fluorescent
Protein, Red Fluorescent Protein and their variants and
derivatives) and luminescent proteins (e.g., Luciferases such as
Renilla luciferase and Photinus Luciferase and their variants and
derivatives). Illustrative examples of selectable marker proteins
are positive selectable marker proteins including, but not limited
to, proteins encoded by antibiotic resistance genes (e.g.,
hygromycin resistance genes, neomycin resistance genes,
tetracycline resistance genes, ampicillin resistance genes,
kanamycin resistance genes, phleomycin resistance genes, bleomycin
resistance genes, geneticin resistance genes, carbenicillin
resistance genes, chloramphenicol resistance genes, puromycin
resistance genes, blasticidin-S-deaminase genes), heavy metal
resistance genes, hisD genes, hypoxanthine phosphoribosyl
transferase (HPRT) genes and guanine phosphoribosyl transferase
(Gpt) genes. In certain embodiments, the light-emitting protein is
selected from Green Fluorescent Protein, Luciferase or biologically
active fragments thereof, or variants or derivatives of these and
the selectable marker protein is selected from kanamycin kinase,
neomycin phosphotransferase, aminoglycoside phosphotransferase,
puromycin N-acetyl transferase, puromycin resistance protein or
biologically active fragments thereof, or variants or derivatives.
Chimeric genes of this type can be constructed using standard
recombinant or synthetic techniques, as described for example in
U.S. Patent Application Publication No. 2002/0150912 and in
European Patent Application No. 1 262 553.
[0180] Another aspect of the present invention contemplates the
combination of a protein-destabilising element (e.g., a DNA/RNA
sequence encoding an intracellular protein degradation signal or
degron which may be selected from a destabilising amino acid at the
amino-terminus of a polypeptide of interest, a PEST region or a
ubiquitin) and a RNA destabilising element (e.g., multiple copies
of the nonamer UUAUUUAUU [SEQ ID NO: 1]), such that both RNA and
protein are destabilised. For example, one such embodiment
incorporates into a construct a PEST sequence immediately upstream
of the translation stop codon and 4 nonamers located downstream of
the stop codon (suitably 20 nt or more from stop codon). In this
way, reporter protein may be destabilised both at the protein level
and the RNA (especially mRNA) level.
[0181] The destabilised reporter protein may be any suitable
protein. For example, destabilised GFP proteins are suitable, such
as for example d1EGFP, d1EYFP and d1ECFP comprising the d1 mutant
of MODC.The destabilised luciferase protein has been described by
Leclerc G. et al. The MODC from d1EGFP is also contemplated.
[0182] Any method of destabilising a polypeptide of interest is
contemplated by the present invention. For example, a polypeptide
of interest can be modified to include a destabilising amino acid
at its amino-terminus so that the protein so modified is subject to
the N-end rule pathway as disclosed, for example, by Bachmair et al
in U.S. Patent Serial No. 5,093,242 and by Varshavsky et al. in
U.S. Patent Serial No. 5,122,463. In some embodiments, the
destabilising amino acid is selected from isoleucine and glutamic
acid, especially from histidine tyrosine and glutamine, and more
especially from aspartic acid, asparagine, phenylalanine, leucine,
tryptophan and lysine. In certain embodiments, the destabilising
amino acid is arginine. In some proteins, the amino-terminal end is
obscured as a result of the protein's conformation (i.e., its
tertiary or quaternary structure). In these cases, more extensive
alteration of the amino-terminus may be necessary to make the
protein subject to the N-end rule pathway. For example, where
simple addition or replacement of the single amino-terminal residue
is insufficient because of an inaccessible amino-terminus, several
amino acids (including lysine, the site of ubiquitin joining to
substrate proteins) may be added to the original amino-terminus to
increase the accessibility and/or segmental mobility of the
engineered amino terminus.
[0183] Modification or design of the amino-terminus of a protein
can be accomplished at the genetic level. Conventional techniques
of site-directed mutagenesis for addition or substitution of
appropriate codons to the 5' end of an isolated or synthesised
antigen-encoding polynucleotide can be employed to provide a
desired amino-terminal structure for the encoded protein. For
example, so that the protein expressed has the desired amino acid
at its amino-terminus the appropriate codon for a destabilising
amino acid can be inserted or built into the amino-terminus of the
protein-encoding sequence. Where necessary, a nucleic acid sequence
encoding the amino-terminal region of a protein can be modified to
introduce a lysine residue in an appropriate context. This can be
achieved most conveniently by employing DNA constructs encoding
"universal destabilising segments". A universal destabilising
segment comprises a nucleic acid construct which encodes a
polypeptide structure, preferably segmentally mobile, containing
one or more lysine residues, the codons for lysine residues being
positioned within the construct such that when the construct is
inserted into the coding sequence of the protein-encoding
polynucleotide, the lysine residues are sufficiently spatially
proximate to the amino-terminus of the encoded protein to serve as
the second determinant of the complete amino-terminal degradation
signal. The insertion of such constructs into the 5' portion of a
protein-encoding polynucleotide would provide the encoded protein
with a lysine residue (or residues) in an appropriate context for
destabilisation.
[0184] In other embodiments, the polypeptide of interest is
modified to contain a PEST region, which is rich in an amino acid
selected from proline, glutamic acid, serine and threonine, which
region is optionally flanked by amino acids comprising
electropositive side chains. In this regard, it is known that amino
acid sequences of proteins with intracellular half-lives less than
about 2 hours contain one or more regions rich in proline (P),
glutamic acid (E), serine (S), and threonine (T) as for example
shown by Rogers et al. (1986, Science 234 (4774): 364-368).
[0185] In still other embodiments, the polypeptide of interest is
conjugated to a ubiquitin or a biologically active fragment
thereof, to produce a modified polypeptide whose rate of
intracellular proteolytic degradation is increased, enhanced or
otherwise elevated relative to the unmodified polypeptide.
[0186] The constructs of the present invention, which contain RNA
and/or protein-destabilising sequences, are particular useful for
assaying the activity of gene expression-modulating elements
(GEMEs) including, but not limited to, transcriptional control
elements and cis-acting regulatory elements. These assays provide a
more "real-time' analysis of GEME activity than provided by
existing assays and typically comprise: (1) expressing at least in
part from a GEME of interest a reporter polynucleotide operably
linked to a RNA destabilising element in a test construct and (2)
measuring the level or functional activity of the reporter
polypeptide produced from the test construct. Generally, control
assays are also performed using a control construct comprising a
GEME that is different than the GEME of interest. In these
embodiments, it is desirable that the reporter polypeptide produced
from the test construct is detectably distinguishable from the
reporter polypeptide produced from the control construct. The test
construct and the control construct may be in the form of separate
constructs or a single chimeric construct. They may also be
contained within a single cell or within different cells.
[0187] The constructs of the present invention are also useful in
screening for drugs or treatments that alter the activity of gene
expression-modulating elements including transcriptional control
elements (e.g., promoters) and cis-acting regulatory elements
(e.g., enhancers). Compared to existing constructs, a near
"real-time" measurement of drug action can be obtained.
Accordingly, yet another aspect of the present invention
contemplates methods for identifying an agent that modulates the
activity of a GEME of interest. These methods generally comprise
expressing at least partly under the control of the GEME of
interest in a test construct a reporter polynucleotide operably
linked to a RNA stability modulating element in the presence and
absence of a test agent. The level or functional activity of the
reporter polypeptide in the presence and absence of the test agent
is then measured and compared. A difference between the level or
functional activity of the reporter polypeptide in the presence and
absence of the test agent indicates that the test agent modulates
the activity of the GEME of interest. Generally, control constructs
are also used in these assays, which comprise a GEME that is
different than the GEME of interest. In these embodiments, the
reporter polypeptide produced from the test construct is suitably
detectably distinguishable from the reporter polypeptide produced
from the control construct. The test construct and the control
construct may be in the form of separate constructs or a single
chimeric construct. They may also be contained within a single cell
or within different cells. In some of these embodiments, the test
construct may be contained within a first cell type or exposed to a
first condition and within a second cell type or exposed to a
second condition, wherein a difference in the level or functional
activity of the polypeptide in the presence of the test agent
between the cell types or conditions provides information on the
effect of the test agent on those cell types or conditions (e.g.,
mode of action or specificity).
[0188] In some embodiments, the constructs of the present invention
comprise one or more elements in any order selected from the group
consisting of:(i) a multiple cloning site for introducing a
sequence of nucleotides, which site is suitably cleavable
enzymatically or otherwise biochemically to provide a linearised
vector into which PCR amplification products are clonable directly
(e.g., an Ec1HK1 site);(ii) areporter gene;(iii) a promoter and/or
enhancer for regulating expression of a transcribable
polynucleotide (e.g., the polynucleotide that encodes the
polypeptide);(iv) a polyadenylation sequence;(v) a selectable
marker gene; and (vi) an origin of replication.
[0189] In certain embodiments, the constructs of the present
invention are in the form of vectors or sets of vectors,
particularly but not exclusively plasmids, with applications in the
study or measurement or monitoring of gene expression (e.g.,
promoter or enhancer activity). The vectors are suitably in the
form of prokaryotic or eukaryotic vectors. Many other vectors could
also be used such as for example viruses, artificial chromosomes
and other non-plasmid vectors.
[0190] In some embodiments, pairs or sets of plasmids are provided,
each containing one or more of the RNA destabilising sequences
described above in operable linkage with a polynucleotide encoding
a destabilised reporter protein such as, for example, d1EGFP,
d1EYFP, d1ECFP or d1HcRed. One plasmid (the control) from each pair
or set contains a promoter 5' of the reporter encoding region. The
promoter comprises one or more elements which are modulatable
(i.e., inducible or repressible) by exogenous treatments (e.g., the
TRE combined with a minimal promoter such as mCMV; see Figure 2c).
Alternatively, a constitutively active promoter such as TS, SV40,
CMV, TK or RSV is used (see Figure 2b). In plant systems the
Top-ten promoter could replace TRE, and the 35S promoter of
cauliflower mosaic virus can replace SV40 etc. Agrobacterium
tumefaciens can be used in plants to facilitate gene transfer. The
other plasmid(s) in the pair or set are identical to the control
plasmid, except that a cloning site (MCS) replaces the promoter,
and the reporter encoding region encodes a reporter similar to but
distinguishable from the control reporter (see Figure 2a). In some
embodiments, the control plasmid encodes a destabilised variant of
EGFP (e.g., d1EGFP, d1EYFP or d1ECFP) and the other vectors (test
vectors) each encode a different colour variant from the same list
or d1HcRed or other destabilised fluorescent protein (same protein
half-life). In other embodiments, a control and one of the test
reporters are incorporated into a single vector, such as for
example a bi-directional plasmid (see Figure 3).
[0191] In the above embodiments, both control and test plasmids
encode a destabilised mRNA, which in turn encodes a destabilised
protein. Thus the time lag between decreased promoter activity and
decreased reporter protein levels is significantly reduced compared
to the time lag with existing constructs. Similarly, increased
promoter activity is more readily and quickly detectable due to the
reduced levels of pre-existing mRNA and protein. Other differences
between the control and test constructs, which can lead to errors,
are minimised by using fluorescent proteins that differ from each
other by only a few small mutations. Compared to luciferase or
other enzyme based assays, the fluorescent reporters described
here, offer several other advantages including:
[0192] .cndot. Several different reporters can be measured in the
same cells/samples.
[0193] .cndot. Live cells can be measured, allowing multiple time
points of the same samples or further manipulation post-measurement
e.g., measurement of the same cells before and after treatment with
a drug.
[0194] .cndot. Successfully transfected cells can be visualised by
fluorescent microscopy. Therefore poor transfections can be
identified simply by looking at the cells under a microscope,
without further investment of resources.
[0195] .cndot. No substrates are required, therefore the method is
less technically demanding, faster, less expensive and more
accurate.
[0196] .cndot. Both control and test reporter expression can be
measured simultaneously by flow cytometry (see advantages of flow
cytometry below).
[0197] .cndot. Embodiments utilising TREs as the control promoter
can only be used in Tet-On or Tet-Off cell lines, but as compared
to other control promoters, exhibit less interference from or to
the test promoter and are less affected by various stimuli used to
examine inducibility of the test promoter. Thus, they provide a
more accurate measurement of transfection efficiency and relative
test promoter activity. Control reporter expression can be switched
on or off as required and used to confirm the lack of promoter
cross-talk or compensate for it if present.
[0198] .cndot. In other embodiments, the control and one of the
test reporters described above are both incorporated into a single
vector, preferably a bi-directional plasmid. Interference between
the two promoters, which is a major drawback of previous dual
promoter vectors, is minimised by using TREs in the control
promoter and/or insulator DNA (U.S. Patent 5,610,053). Such a
single vector system reduces the inaccuracies of co-transfection
studies.
[0199] The invention also provides constructs in which informative
promoters or enhancers or their fragments are placed upstream of a
reporter polynucleotide. Informative promoters include, but are not
restricted to, cell cycle-dependent promoters (e.g., cyclin A, B,
or D1, histone or topoisomerase I promoters), promoters activated
by apoptotic (cell death) pathways and promoters/fragments linked
to mitogenic signals (Table 1). Examples of informative enhancers
that can be used include any of those used in Clontech's Mercury
Pathway Profiling Systems. Clontech's Mercury In Vivo Kinase Assay
Kits represent another example of how the present invention can be
used. In this example the promoter element is a TRE that is
combined in cells with a chimeric TetR-transactivator protein that
permits transcription from the TRE only when a specific kinase is
active and can phosphorylate the transactivator domain of the
fusion protein. Thus, the present invention can be used to provide
a more real-time measurement of specific kinase activity.
[0200] Even still another aspect of the present invention
contemplates a cell transfected or transduced with a construct or
vector as described herein.
[0201] In some embodiments, the constructs or construct-containing
cells are introduced into an organism to allow measurement of
reporter activity in vivo. Methods for introducing foreign nucleic
acid into the nucleome of an organism or for introducing cells into
an organism are known to those of skill in the art. In some
embodiments of this type, destabilised luciferase rather than
destabilised EGFP variants may be the preferred reporter. For
example, transgenic mice expressing destabilised luciferase under
the control of an informative promoter, can be used to measure the
activity of that promoter in the tissues of a live mouse, using a
photon camera (photon camera analysis is described by Contag, et
al, 1997). The RNA destabilising sequences serve to improve the
temporal correlation between promoter activity and reporter levels,
thus providing a significant improvement to applications such as
drug screening, which benefit from a near real-time measurement of
promoter activity.
[0202] In some applications it is desirable to express, either in
vitro in cell-based systems or in vivo in mammalian systems, both a
reporter molecule and a functional gene product. This may involve
two separate mRNAs, each containing a mRNA destabilising element.
Alternatively, mRNA destabilising elements may be incorporated into
a single destabilised transcript that gives rise to two separate
proteins (e.g., using an internal ribosome entry site; IRES) or a
fusion protein comprised of the reporter and the functional gene
product.
[0203] The invention also provides cell lines stably expressing the
constructs of the invention (with or without a control). Such cells
have applications in areas such as drug screening. For example,
cells containing a MAPK-dependent reporter vector provide a rapid
and inexpensive method for testing the efficacy of drugs designed
to inhibit MAPK or any pathway upstream of MAPK-dependent
transcription in those cells. In SKBR3 human breast cancer cells,
for example, MAPK activity is dependent on signalling from the
overexpressed ErbB2 protein. Therefore, drugs that inhibit ErbB2,
would cause a decrease in the fluorescence of SKBR3 cells
containing such a construct but not in cells lacking ErbB2.
Alternatively, cells could be tested .+-.drug and .+-. a specific
ligand or treatment that leads to MAPK activation via a different
pathway, in order to monitor inhibition of that pathway. Cell lines
(or organisms) stably expressing a vector linked to a
cell-cycle-regulated promoter can be used as very fast, simple and
inexpensive means for measuring cell-cycle progression or cell
proliferation. Such cell lines have obvious utility in drug
screening and are contemplated in the present invention. Examples
of cell-cycle regulated promoters are readily available, for
example, (Lee, H et al. 1995), (Stein, J et al. 1996) and (Huet, X
et al. 1996).
[0204] Other embodiments of the present invention are directed to
constructs for the study of post-transcriptional regulation,
particularly mRNA stability. These constructs typically comprise a
reporter polynucleotide operably linked to a transcriptional
control element. In illustrative examples of these constructs, the
reporter polynucleotide encodes a destabilised reporter protein,
such as but not limited to a destabilised variant of EGFP (e.g.,
d1EGFP, d1EYFP, d1ECFP), with a different colour variant in each
separate vector. The TRE (linked to a minimal promoter such as
mCMV) is 5' of the reporter encoding region and drives
transcription in a tetracycline (or doxycycline) dependent fashion.
Other inducible promoter systems can also be used.
[0205] Typically the constructs for studying post-transcriptional
regulation comprise sites for inserting known or suspected
post-transcriptional control elements. In some embodiments, the RNA
destabilising elements described above are not included and in
their place, MCSs are located, primarily in the 3'-UTR (see Figure
4a) but also in the 5'-UTR and/or coding region. In some
embodiments, sequences thought to affect mRNA stability can be
tested by cloning them into the appropriate cloning site of a
construct containing one colour variant and measuring the rate of
decrease in reporter levels after blocking transcription with
tetracycline or doxycycline (see Figure 7). If desired, the rate of
decay can be compared between the "test construct" and the "control
construct," (which suitably encodes a different colour reporter
protein and does not contain the sequence being tested) in the same
cells. The MCS may usefully comprise or work in conjunction with
restriction endonuclease sites which allow direct cloning of PCR
products having overhangs (see below).
[0206] In related embodiments, the invention provides methods for
assaying the activity of a post-transcriptional control element or
for identifying a post-transcriptional control element or for
identifying an agent that modulates elements of this type. These
methods generally comprise: (1) expressing from a transcriptional
control element in a test construct a reporter polynucleotide that
is operably linked to a nucleic acid sequence that encodes, or is
suspected to encode, a post-transcriptional control element; and
(2) measuring the level or functional activity of the reporter
polypeptide produced from the test construct. Often these methods
will include the use of control constructs, which do not comprise
the nucleic acid sequence that encodes, or is suspected to encode,
the post-transcriptional control element. The control constructs
may comprise the same or different transcriptional control element
as the test construct. In these embodiments, the reporter
polypeptide produced from the test construct is suitably detectably
distinguishable from the reporter polypeptide produced from the
control construct. The test construct and the control construct may
be in the form of separate constructs or a single chimeric
construct. They may also be contained within a single cell or
within different cells. In some embodiments, the transcriptional
control element is modulatable, including inducible or repressible
promoters. In these embodiments, the methods desirably further
comprise (1) inducing or repressing the transcriptional control
element of the test construct, and optionally of the control
construct; and (2) measuring changes in the level or functional
activity of the reporter polypeptide produced from the test
construct, and optionally from the test construct, over time.
[0207] In certain embodiments, which are directed to identifying
agents that modulate a post-transcriptional control element of
interest, the expression of the reporter polynucleotide is carried
out in the presence and absence of a test agent and the levels or
functional activities of the reporter polypeptide produced in the
presence and absence of the test agent are compared. A difference
between the level or functional activity of the reporter
polypeptide in the presence and absence of the test agent indicates
that the test agent modulates the activity of the
post-transcriptional control element. In some of these embodiments,
the test construct may be contained within a first cell type or
exposed to a first condition and within a second cell type or
exposed to a second condition, wherein a difference in the level or
functional activity of the polypeptide in the presence of the test
agent between the cell types or conditions provides information on
the effect of the test agent on those cell types or conditions
(e.g., mode of action or specificity).
[0208] In other related embodiments, one or more RNA destabilising
element(s) are included to assist scientists specifically searching
for RNA stabilising elements. RNA stabilising elements are useful
for increasing levels of expressed protein for example during
protein purification where high levels or protein are required or
when a promoter is weak. Similarly, other embodiments include RNA
stabilising element(s) to assist scientists specifically searching
for RNA destabilising elements.
[0209] In still other embodiments, the control and one of the test
reporters are both incorporated into a single vector, desirably a
bi-directional plasmid (see Figure 4b). Interference between the
two promoters and moreover, transcription effects of the element or
various stimuli tested, is circumvented by using a TRE or similar
element to drive both reporters and by measuring reporter levels
after addition of doxycycline (or tetracycline), which shuts off
transcription from the vector.
[0210] A related aspect of the present invention extends to a
genetically modified non-human organism comprising a construct as
broadly described above. Accordingly, the present invention is
directed towards genetically modified animals that contain one or
more constructs of the invention in their nucleomes, and especially
in their genomes. The genetic modification is generally in the form
of a transgene and thus the genetically modified animal of the
present invention is a transgenic animal that comprises at least
one transgene in its cells, which includes a construct as broadly
described above. The transgene is suitably contained within somatic
cells of the animal, although it may also be contained within its
germ cells. Usually, the transgenic animal is a mammal, which is
suitably selected from the order Rodentia. In some embodiments, the
transgenic mammal is a mouse, although rats are also of particular
utility. However, it will be understood that the present invention
is not restricted to these species. For example, the transgenic
animal may be a goat, cow, sheep, dog, guinea pig or chicken.
[0211] The genetically modified animals of the present invention
may be prepared by any number of means. In one method, a nucleic
acid targeting construct or vector is prepared comprising two
regions flanking the transgene wherein the regions are sufficiently
homologous with portions of the genome of an animal to undergo
homologous recombination with those portions. Alternatively,
constructs for random integration need not include regions of
homology to mediate recombination. Conveniently, markers for
positive and negative selection are included in the constructs to
permit selection of recombinant host cells. The targeting DNA
construct is generally introduced into an embryonic stem (ES) cell
or ES cell line. Methods for generating cells having gene
modifications through homologous recombination are known in the
art.
[0212] In order that the invention may be readily understood and
put into practical effect, particular preferred embodiments will
now be described by way of the following non-limiting example.
EXAMPLE1 - Cloning DNA Elements into Vectors
[0213] Cloning is carried out according to existing methods, using
restriction enzyme sites in the MCS or direct ligation of PCR
products in the case of vectors with a "T overhang" in the MCS.
With respect to post-transcriptional reporter vectors, however, the
inclusion of a MCS in the 3'-UTR or other regions is a significant
improvement over current vectors, which were designed for
transcriptional or other studies and do not contain convenient
cloning sites in these locations.
EXAMPLE2 - Transfection
[0214] Co-transfection of control and test vectors is performed as
per existing methods (e.g., Fugene [Boehringer Mannheim, Mannheim,
Germany] or electroporation), except in the case of the single
(e.g., bi-directional) vector systems described above, which
require only one vector and thus eliminate inaccuracies associated
with co-transfection
EXAMPLE 3 - Measurement of Reporter Expression
[0215] An immediate advantage of the vGFP system is that reporter
expression can be visualized directly in living cells, simply by
viewing the tissue culture plate or flask under a fluorescent
microscope. Therefore, poor transfections can be identified and
discarded before any additional time is wasted. Quantitative
measurement can be performed using a fluorometer (e.g., 96 well
plate format) and since live cells can be measured, the same
samples can be measured repeatedly e.g., in a time course.
[0216] A further advantage compared to luciferase and other enzyme
based assays is that flow cytometry can also be used to measure
reporter levels.
EXAMPLE 4 - Advantages of Using Flow Cytometry to Measure Reporter
Levels
[0217] (i) Two or more reporters (control and test) as well as
additional parameters, can be measured individually in every cell
at a rate of >2,000 cells per second. Therefore, in this
application, the method yields thousands to hundreds of thousands
of data points per sample versus one datum point for existing
luciferase assays.
[0218] (ii) Accurate measurement of transfection efficiency: This
is useful for optimising transfection protocols. In addition to
allowing comparison of different methods, it is also possible to
measure both expression per cell and the proportion of cells
expressing. This helps the investigator to determine the cause of
any problems.
[0219] (iii) Identification of co-transfection errors:
Co-transfection studies are based on the premise that cells will
take up and express an amount of control reporters, which is
proportional to the amount of test plasmid taken up by the same
cells. This is not always the case. By using the flow cytometry
method described here, it is possible to correlate test versus
control expression levels in different cells of the same sample.
Invalid samples can be identified by the lack of a good linear
relationship between test and control reporter levels. Such errors
go unnoticed in current methods.
[0220] (iv) Simultaneous measurement of additional parameters:
Fluorescent labelled antibodies can be used to quantify specific
proteins on a cell by cell basis and this can be correlated with
reporter levels to determine whether that protein affects gene
expression via the element cloned into the reporter construct.
Alternatively, the protein of interest can be expressed as a
vGFP-fusion protein (the protein of interest fused to a GFP
variant) via transfection of an appropriate expression vector
(inducible or non-inducible). Levels of the specific protein can
then be correlated with the expression of a different GFP variant
linked to a regulatory element of interest (co-transfected or
transfected at a different time). In a third application, the vGFP
reporter is linked to regulatory elements (e.g., promoters) thought
to be cell cycle specific. Transfected cells are stained with a
fluorescent DNA dye such as propidium iodide to measure DNA
content, which is then correlated with reporter expression. In
principle, several of the DNA constructs described herein, each
containing a different vGFP, could be co-expressed and
independently measured. Furthermore, other fluorescent markers
could be used in conjunction with these vectors (singly or in
multiples).
[0221] (v) Cell Sorting: Using a cell sorter, it is possible to
isolate viable vGFP expressing cells from the non-expressors. This
technique can be used to select stably expressing cells or to
remove non-expressors prior to assay initiation. Similarly, it is
possible to remove cells expressing very low and/or very high
levels of vGFP. This can be used to generate a more homogeneous
population and/or to remove cells expressing levels so high that
they may not be physiological relevant or may perturb normal
cellular function and/or may otherwise adversely affect the data
obtained from the DNA vectors described herein.
[0222] It is important to note that transient and stable
transfections of expression vectors result in a cell population
with very heterogeneous levels of expression. In general a thousand
fold difference between the highest and lowest expressor is not
unusual. The present invention not only offers a method for
selecting homogeneous populations when required (see v above), but
can also utilise heterogeneity to the benefit of the scientist. For
example, identifying co-transfection errors. Another example of
this relates to (iv) above. To determine whether protein X affects
transcription from promoter Y, then cells are transfected with a
reporter construct expressing d1EGFP under the control of promoter
Y. If required, cell sorting can be used to isolate cells
transiently or stably expressing appropriate levels of d1EGFP.
These cells are in turn transiently transfected with a vector
expressing a protein X-EYFP fusion protein. During flow cytometry,
EGFP is plotted on one axis and EYFP on the other. A positive
correlation would indicate that protein X increases transcription
from promoter Y and a negative correlation would indicate that
protein X inhibits transcription from promoter Y.
[0223] Currently, scientists attempting to establish such a
correlation would select several different clones of high versus
low expressors of protein X. Each clone would then be separately
transfected with a promoter Y-luciferase construct and the
luciferase activities measured. The use of cell clones requires
months of preparation and introduces many variables including
pre-existing heterogeneity amongst the host cells and variable
sites of vector integration (vector DNA may interfere with a
specific gene at the integration site and this site is different
for every clone). Furthermore, such a method yields very few data
points, with each datum point obtained from a different
transfection of a different clone. Thus, the new system is not only
more versatile but is quicker and more accurate than existing
methods.
EXAMPLE 5 - Laser Scanning Cytometry (LSC)
[0224] Unlike flow cytometry, LSC measures multi-colour
fluorescence and light scatter of cells on slides, and records the
position and time of measurement for each cell analysed. This
technique provides data equivalent to flow cytometry but has the
advantage of being microscope slide based (Darzynkiewicz et al.,
1999; Kamentsky et al., 1997). Owing to the fluorescence of GFP and
its variants, the techniques described for flow cytometry are also
applicable to LSC.
EXAMPLE 6 - Specific Methods For Post-Transcriptional Assays
[0225] These are best summarised by using the example of a study
aimed at determining whether a specific 3'-UTR fragment affects
mRNA stability. Although this example is one of transient
expression, stable transfection could also be used.
[0226] (i) The 3'-UTR fragment is ligated into the 3'-UTR cloning
site of the test vector and co-transfected with the control vector
into a Tet-Off cell line. In the case of the bi-directional vector,
no control vector is required. Indeed, the typical application does
not require a control reporter or vector since rate of decay can be
measured in samples from within the same transfection. 5'-UTR
fragments can be tested by inserting them into vectors with a
5'-UTR cloning site.
[0227] (ii) The cells are grown in the absence of doxycycline (or
tetracycline) for 6-48 h to allow expression of both vectors.
Alternatively, cells are grown with low doses of doxycycline (or
tetracycline), for 6-48 h to block transcription and then switched
to medium without doxycycline (or tetracycline) for 2-12 h to
provide a brief burst of transcription.
[0228] (iii) High doses of doxycycline (or tetracycline) are then
applied to shut off transcription from both vectors.
[0229] (iv) The fluorescence of both reporters is measured (by flow
cytometry, fluorometry or LSC) in a time course following addition
of doxycycline (or tetracycline).
[0230] If the cloned element confers mRNA instability, a more rapid
decrease in "test" fluorescence will be seen compared to "control"
fluorescence of the same cells or sample. Similar studies can be
used to test a mRNA element's response to certain stimuli or its
effect in different cells or cells expressing different amounts of
a specific protein, such as a RNA-binding protein. Applying the
stimulus after doxycycline will determine whether pre-existing
transcripts are affected by the stimulus. Inserting the element in
different locations (e.g., 5'-UTR, 3'-UTR) will determine whether
its function is dependent on position. Inserting a
protein/polypeptide coding sequence (in frame) within the
reporter-coding region of the vector, can be used to determine the
effect of that sequence on mRNA and protein stability.
[0231] RNA can be extracted from transfected cells and used to
measure reporter mRNA directly.
EXAMPLE 7 - Transcription Reporter Vectors
[0232] The vectors are plasmids suitable for expansion in E. coli
and expression of a fluorescent reporter in eukaryotic cells. The
plasmids may be used in sets. Each set is comprised of one or more
"control" vectors and one or more "test" vectors. Every vector
within a set expresses a similarly destabilised mRNA and a
similarly destabilised fluorescent reporter protein. In addition to
the standard features of such plasmids (ampicillin resistance,
origin of replication etc.), each plasmid contains the following
construct (see also Figures 2 and 3):5'----
MCS/promoter----transcription start site---5'-UTR---ATG--vEGFP
encoding region --stop codon3'-UTR with mRNA destabilising
element---polyadenylation signal.
Where
[0233] MCS/promoter denotes either a multiple cloning site (test
vectors; see Figure 2a) or a constitutively active promoter such as
SV40 (control vectors; see Figure 2b) or an inducible promoter such
as TRE-mCMV (control vector; see Figure 2c).
[0234] ATG denotes a translation start codon.
[0235] Stop codon denotes a translation stop codon.
[0236] 5'-UTR denotes a 5' untranslated region.
[0237] 3'-UTR with mRNA destabilising element denotes a 3'
untranslated region containing one or more of the mRNA
destabilising elements outlined.
[0238] vEGFP denotes a destabilised variant of EGFP. One set of
plasmids is provided for each type of destabilising modification
(e.g., 1 hr half-life, 2 hr half-life). Within each set of
plasmids, one vector is provided for each different colour variant.
For example, one set contains vectors expressing d1EGFP, d1EYFP,
d1ECFP whereas another set expresses the d2 variants.
[0239] In other examples, the control and one of the test reporters
described above are both incorporated into a single vector,
preferably a bi-directional plasmid (see Figure 3).
EXAMPLE 8 - Post-Transcription Reporter Vectors
[0240] Similar to the transcription reporter "control" vectors that
contain a TRE-mCMV promoter , except that the mRNA destabilising
element in the 3'-UTR is replaced with a MCS (see Figure 4a). In
some embodiments, MCS are also located in the 5' UTR and/or coding
region.
[0241] Such a construct can be used as a "test" or a "control"
vector for the post-transcriptional assays outlined herein.
[0242] In other examples, the control and one of the test reporters
described above are both incorporated into a single vector,
preferably a bi-directional plasmid (see Figure 4b).
EXAMPLE9 - Reporter Vectors For Assaying Specific Pathways
[0243] Vectors similar to those described herein, into which a
regulatory element has been inserted into the MCS for the purpose
of studying or measuring the function of said regulatory element.
For example, plasmids similar to the transcription reporter
plasmids outlined herein, except that they contain within the MCS,
a promoter or promoter element(s) or enhancer(s) that are
responsive to pathways such as those referred to in Table 1 and/or
contain any of the following cis-acting enhancer elements as
described in Clontech's Mercury Pathway Profiling Systems: AP1,
CRE, E2F, GRE, HSE, ISRE, Myc, NFAT, NFB, p53, Rb, SRE. The
reporter is preferably a destabilised version of GFP, luciferase or
SEAP.
[0244] Cell lines and Mice for Assaying Specific Pathways
[0245] Cell lines or genetically modified mice stably expressing
one or more of the vectors described herein.
EXAMPLE10 - Method of Use
[0246] The vectors described in this invention are used for
experimentation in essentially the same manner as the existing
vectors that they replace, with the exception of the new methods
described herein.
Method of Construction
[0247] The vectors and DNA constructs outlined here are assembled
using standard cloning techniques. The SV40 and TRE-mCMV promoters
described here as well as the more standard components of plasmid
vectors (e.g., origin of replication, antibiotic resistance or
another selection gene) are readily available in a variety of
common vectors. DNA sequences encoding the destabilised variants of
EGFP (e.g., d1EGFP, d1EYFP, d1ECFP and d2EGFP, d2EYFP, d2ECFP) are
available from Clontech (Clontech Laboratories Inc., Palo Alto, CA,
USA). DNA sequences encoding destabilised DsRed variants are
constructed by fusing to the 3' end of the DsRed encoding region,
sequences encoding the degradation domains (or mutants thereof)
from short-lived proteins. For example, amino acids 422-461 from
mouse ornithine decarboxylase, which contains a PEST sequence. Such
sequences could potentially be derived from existing dEGFP
variants.
EXAMPLE 11 - Summary
[0248] In summary the present vectors and methods are now
available:
[0249] .cndot. Expression vectors or parts thereof that incorporate
one or more mRNA instability elements in order to provide a
relatively short-lived mRNA. Compared to existing expression
vectors, the vectors claimed here provide kinetics of protein
expression that correlate more closely with promoter activity. For
example, the time lag between decreased promoter activity and
decreased mRNA and protein levels is substantially reduced.
[0250] .cndot. Expression vectors or parts thereof encoding a
destabilised mRNA that in turn, encodes a destabilised protein.
Compared to existing vectors, the vectors claimed here provide
kinetics of protein expression that correlate more closely with
promoter activity.
[0251] .cndot. Expression vectors or parts thereof in which the
mRNA destabilising elements are comprised of sequences cloned from
short-lived mRNAs such as c-fos, examples of short-lived mRNAs
include;c-fos, c-myc, GM-CSF, IL-3, TNF-alpha, IL-2, IL-6, IL-8,
Urokinase, bcl-2, SGLT1 (Na(+)-coupled glucose transporter), Cox-2
(cyclooxygenase 2), IL8, PAI-2 (plasminogen activator inhibitor
type 2), beta1-adrenergic receptor, GAP43 (5'-UTR and 3'-UTR)
AU-rich elements (AREs) and/or U-rich elements, including but not
limited to single, tandem or multiple or overlapping copies of the
nonamer UUAUUUA(U/A)(U/A) [SEQ ID NO:2] (where U/A is either an A
or a U) (Lagnado et al 1994) and/or the pentamer AUUUA [SEQ ID
NO:3] (Xu et al 997) and/or the tetramer AUUU [SEQ ID NO:4]
(Zubiaga et al. 1995). Also included are minor modifications to or
permutations of the elements listed above. The term "tandem
copies," allows for both duplication and/or non-duplication of one
or more of the outer nucleotides. For example, tandem copies of the
pentamer AUUUA [SEQ ID NO:3], includes sequences such as
AUUUAUUUAUUUA [SEQ ID NO:5] as well as AUUUAAUUUAAUUUA [SEQ ID
NO:6]. The 3'-UTR or 5'-UTR regions of short-lived mRNAs often
contain destabilising sequences.
[0252] .cndot. Expression vectors or parts thereof in which the
mRNA destabilising elements were identified or validated using the
vectors described herein, which provide substantially improved
methods for identifying such elements.
[0253] .cndot. Expression vectors or parts thereof, in which the
destabilised mRNA encodes a short-lived reporter protein such as a
destabilised variant of EGFP or luciferase. Compared to existing
reporter vectors, the vectors claimed here provide kinetics of
reporter expression that correlate more closely with promoter
activity. For example, the time lag between decreased promoter
activity and decreased mRNA and protein levels is substantially
reduced.
[0254] .cndot. Sets of reporter vectors or parts thereof that
encode similarly destabilised mRNAs (similar to other vectors in
the same set), which in turn, encode similarly (similar to other
vectors in the same set) destabilised variants of EGFP or DsRed or
other fluorescent markers. One or more vectors (control vectors)
within each set contain a constitutive promoter (e.g., SV40, CMV,
RSV, TK, TS; see Figure 2b) or an inducible promoter (e.g.,
TRE-mCMV; see Figure 2c), whereas the other vectors (test vectors)
within each set contain a cloning site (e.g., MCS) in place of the
promoter (e.g., see Figure 2a). Applications of these vectors
include but are not limited to the study or measurement of promoter
activity. For example, a promoter element of interest can be cloned
into the MCS of a test vector encoding d1EGFP and reporter
expression measured relative to that of a control vector expressing
d1EYFP. Also claimed is each individual vector described well as
bi-directional vectors or other single vector systems that
incorporate one test and one control reporter construct within the
same vector (e.g., Figure 3a and Figure 3b). Compared to existing
sets of reporter vectors, the vector sets claimed here offer the
following advantages:(a) A measurement of promoter activity that is
closer to real-time.
[0255] (b) Decreased errors due to the closer similarity between
control and test constructs.
[0256] (c) Decreased errors resulting from cross talk between test
promoters and the control promoters. By utilising inducible
promoters in the control vectors, such cross talk is minimised
and/or identified and corrected for via measurement with and
without induction.
[0257] (d) Can be used in conjunction with the flow cytometry/LSC
methods described.
[0258] .cndot. Reporter vectors or sets of reporter vectors or
parts thereof that utilise an inducible promoter, preferably but
not exclusively the tetracycline responsive element (TRE), to drive
expression of a destabilised fluorescent reporter protein
(preferably but not exclusively destabilised EGFP variants). Such
vectors contain cloning sites in the 3'-UTR (e.g., Figure 4a)
and/or 5'-UTR and/or reporter coding region, such that regulatory
elements or putative regulatory elements can be cloned into a
vector expressing one color fluorescent reporter and, if required,
compared to a control vector which expresses a different color
reporter and does not contain the element of interest. Such vectors
have applications in the study or measurement of
post-transcriptional regulation, since transcription can be shut
off as desired via the inducible promoter. The advantages offered
by these vectors include those listed in b-d, the ability to
separate post-transcriptional effects from transcriptional effects
and also:
[0259] (a) incorporation of convenient cloning sites, not present
in other vectors; and
[0260] (b) the technique is more rapid than any existing
method.
[0261] .cndot. Single vector systems that essentially link one test
and one control construct and described (e.g., Figure 4b). Both
test and control reporters are driven by an inducible promoter and
the cloning sites allow ligation of regulatory elements into the
test construct only. In addition to the advantages of vectors
outlined, the single vector systems eliminate problems and
inaccuracies associated with co-transfection of separate test and
control vectors.
[0262] .cndot. The use of flow cytometry or LSC to measure the
levels of 2 or more fluorescent reporters expressed via the vectors
outlined. In this application, the method yields thousands to
hundreds of thousands of data points per sample versus one datum
point for existing enzyme-based assays. Two or more reporters
(control and test) as well as additional parameters (e.g., DNA
content, levels of other proteins) can be measured individually in
every cell. Also encompassed is the use of flow cytometry to
correlate the levels of 2 or more reporters in multiple cells
within the same sample and the utilisation of such data to optimise
transfection protocols and/or identify problems associated with
co-transfection. For example, invalid samples can be identified by
the lack of a good linear relationship between test and control
reporter levels. Such errors go unnoticed in current methods.
[0263] .cndot. Methods for utilising the post-transcriptional
reporter vectors claimed. These methods are best summarised by
using the example of a study aimed at determining whether a
specific 3'-UTR fragment affects mRNA stability. Although this
example is one of transient expression, stable transfection could
also be used.
[0264] (i) The 3'-UTR fragment is ligated into the 3'-UTR cloning
site of the test vector and co-transfected with the control vector
into a Tet-Off cell line. In the case of the single vector system,
no control vector is required. 5'-UTR fragments can be tested by
inserting them into vectors with a 5'-UTR cloning site.
[0265] (ii) The cells are grown in the absence of doxycycline (or
tetracycline) for 6-48 h to allow expression of both vectors.
Alternatively, cells are grown with low doses of doxycycline (or
tetracycline), for 6-48 h to block transcription and then switched
to medium without doxycycline (or tetracycline) for 2-12 h to
provide a brief burst of transcription.
[0266] (iii) High doses of doxycycline (or tetracycline) are then
applied to shut off transcription from both vectors.
[0267] (iv) The fluorescence of both reporters is measured (by flow
cytometry, fluorometry or LSC) in a time course following addition
of doxycycline (or tetracycline).
[0268] If the cloned element confers mRNA instability, a more rapid
decrease in "test" fluorescence will be seen compared to "control"
fluorescence of the same cells or sample. Similar studies can be
used to test a mRNA element's response to certain stimuli or its
effect in different cells or cells expressing different amounts of
a specific protein, such as a RNA-binding protein. Applying the
stimulus after doxycycline will determine whether pre-existing
transcripts are affected by the stimulus. Inserting the element in
different locations (e.g., 5'-UTR, 3'-UTR) will determine whether
its function is dependent on position. Inserting a
protein/polypeptide coding sequence (in frame) within the reporter
protein-coding region of the vector can be used to determine the
effect of that sequence on mRNA and protein stability.
[0269] RNA can be extracted from transfected cells and used to
measure reporter mRNA directly.
[0270] .cndot. Cell lines transiently or stably expressing one or
more of the expression constructs or parts thereof claimed.
[0271] .cndot. Cell lines transiently or stably expressing one or
more of the expression constructs or parts thereof claimed, wherein
the expression construct contains a regulatory element that serves
as a marker for the activation of signal transduction pathways
associated with human disease and/or response to drug treatment.
Such pathways include, but are not restricted to the list in Table
1 and those indicated elsewhere in this document (e.g., CRE, SRE,
AP1, cyclin A, B and D1 promoters).
[0272] .cndot. Transgenic mice, knock-in mice or other genetically
modified mice expressing one or more of the expression constructs
or parts thereof claimed.
[0273] .cndot. Transgenic mice, knock-in mice or other genetically
modified mice expressing one or more of the expression constructs
or parts thereof claimed, wherein the expression construct contains
a regulatory element that serves as a marker for the activation of
signal transduction pathways associated with human disease and/or
response to drug treatment. Such pathways include, but are not
restricted to the list in Table 1.
[0274] .cndot. Destabilised variants of DsRed or the mutant
DsRed1-E5. These can be constructed by fusing to the C-terminus of
DsRed, degradation domains (or mutants thereof) from various
unstable proteins. For example, amino acids 422-461 of mouse
ornithine decarboxylase, which contains a PEST sequence (Li et al.
1998). Additional destabilising elements can also be added. Also
contemplated are DNA constructs encoding destabilised variants of
DsRed.
[0275] .cndot. Vectors encoding destabilised variants of DsRed
outlined, including such vectors also containing the mRNA
instability elements outlined.
[0276] .cndot. The following method for creating Tet-Off or Tet-On
cell lines:
[0277] The tTA or rtTA expression vector, preferably a retrovirus,
adenovirus or plasmid, is stably expressed in the cell line of
interest using standard techniques and expressing cells are
isolated via a drug resistance marker. These cells are then
transiently transfected with a TRE-vGFP construct and subjected to
several rounds of cell sorting by flow cytometry. For example, good
Tet-Off cells would show no fluorescence in the presence of
doxycycline and are sorted as such. After a further 5-48 hr without
doxycycline, green cells are sorted. Finally, the cells are grown
for a week or more without doxycycline and sorted a final time to
eliminate stably transfected (green) cells.
EXAMPLE 12 - Vectors Incorporating mRNA and Protein-Destabilising
Elements
[0278] The coding region of interest (e.g., a reporter such as EGFP
or luciferase) could include combined sequence of a
protein-destabilising element (e.g., d1 mutant of MODC; Clontech,
but also including other PEST sequences or other
protein-destabilising elements such as ubiquitination sites) and a
mRNA destabilising element (e.g., AU-rich element).
[0279] For example, the stop codon of luciferase and DsRed is
replaced with a Hind3 site (AAGCTT [SEQ ID NO:7]) to allow the
addition of the sequence:
AAGCTTAGCCATGGCTTCCCGCCGGCGGTGGCGGCGCAGGATGATGGCACGCTGCCCATGTCT-
TGTGCCCAGGAGAGCGGGATGGACCGTCACCCTGCAGCCTGTGCTTCTGCTAGGATCAATGTGTAG[SEQ
ID NO:8] which is Clontech's d1 mutant of MODC that confers a 1-hr
half life to EGFP. This is followed by a linker (which becomes part
of the 3'-UTR and then: UUAUUUAUU GGCGG UUAUUUAUU CGGCG UUAUUUAUU
GCGCG UUAUUUAUU ACUAG[SEQ ID NO:9] which contains 4 nonamers and
connects to the Xba1 site of the parent vector (pGL3; Promega) also
in the 3'-UTR but further downstream.
EXAMPLE 13 - Direct Ligation of PCR Products
[0280] Inclusion into the MCS of a vector of two separate but
nearby RE recognition sites, which, when cut with that/those RE(s),
leave a 3' overhang of a single T nucleotide at both ends of the
remaining vector. For example, the recognition sequence for EclHK1
is GACNNN, NNGTC [SEQ ID NO:10] (cuts between 3.sup.rd and 4.sup.th
N from 5' leaving a 3' overhang of a single N at each end). Two of
these sites are incorporating into the MCS, such that the short
region between them is released by digestion with EclHK1, leaving a
linearised vector with a 3' overhang of a single N at each end. In
this example, the upstream recognition sequence should be
5'GACNNTNNGTC3' [SEQ ID NO:11] and the downstream sequence
5'GACNNANNGTC3' [SEQ ID NO:12] . After cutting with EclHK1, the
large vector fragment will contain a single 3' T overhang at both
ends (similar to Promega's pGEM-T Easy vector). This facilitates
the direct ligation of PCR products that are produced with a
polymerase such as Taq, that yields a 5' A overhang. This
constitutes a significant improvement over standard MCSs, which do
not support direct ligation of PCR products without inclusion of RE
sites into PCR primers and subsequent digestion of PCR product.
This is also a significant improvement over the pGEM-T Easy vector,
which cannot be amplified (supplied as linear) and is useful only
for subcloning (i.e., PCR products are typically ligated into
pGEM-T Easy, amplified and then removed by RE digestion and
subsequently cloned into the expression vector of interest). Thus,
the present MCS permits direct ligation of PCR products without the
need for digesting them with a RE (which is often problematic) or
subcloning them into an intermediate vector.
EXAMPLE 14 - Destabilised Reporter Model Shows Improved Real-Time
Analysis
[0281] Plasmid reporter vectors were assembled in a pGL3-Basic
(Promega) backbone (ampicillin resistance gene etc.) using standard
cloning techniques. A tetracycline-responsive element (TRE),
derived from Clontech's pTRE-d2EGFP vector was inserted into the
MCS. In some constructs the luciferase-coding region was replaced
with the d1EGFP- or d2EGFP- coding sequence (including Kozak
sequence) as defined by Clontech. This was achieved by PCR using
appropriate primers with convenient 5' flanking RE sites. In some
constructs, specific examples of mRNA destabilising elements were
cloned into the 3'-UTR-encoding region. Typically, these sequences
were prepared by synthesising and then hybridising the sense and
antisense sequences. Flanking sequences provided overhanging
"sticky ends" that are compatible with those generated when the
3'-UTR-encoding region is cut with specific restriction enzymes.
Following digestion of the vector with these enzymes and subsequent
purification, the hybridised oligomers were ligated into the vector
using standard techniques. PCR of genomic DNA or cDNA from an
appropriate source was used as an alternative method for obtaining
the larger destabilising elements such as c-myc-ARE. Very small
elements (e.g., 1 or 2 nonamers) were incorporated into a reverse
PCR primer that contained a 5' flanking RE site and a 3' flanking
region complementary to the pre-existing 3'-UTR in the vector
template. Following PCR with an appropriate forward primer
(complementary to the protein-coding region and overlapping an
endogenous RE site), the PCR product was digested with the
appropriate RE sites and ligated into the original vector.
Nomenclature
[0282] B = Vector backbone derived from Promega's pGL3-Basic;
[0283] T = Tetracycline-responsive element (TRE), derived
fromClontech's pTRE-d2EGFP vector and used as a promoter to drive
transcription of the reporter;
[0284] G1 = GFP with 1 hr half-life used as reporter i.e., d1EGFP
protein encoding sequence as defined by Clontech;
[0285] G2 = GFP with 2 hr half-life used as reporter i.e., d2EGFP
protein encoding sequence as defined by Clontech;
[0286] L = Luciferase used as reporter i.e., The Firefly luciferase
encoding sequence from pGL3-Basic (Promega);
[0287] R = DsRed2 used as the reporter;
[0288] R1 = DsRed fused at the carboxy-end to the same MODC mutant
as present in d1EGFP;N6 = 6 copies of the nonamer TTATTTATT [SEQ ID
NO:13] inserted into the 3'-UTR-encoding region.
[0289] N4 = 4 copies of the nonamer TTATTTATT [SEQ ID NO:13]
inserted into the 3'-UTR-encoding region;
[0290] N2 = 2 copies of the nonamer TTATTTATT [SEQ ID NO:13]
inserted into the 3'-UTR-encoding region;
[0291] N1 = 1 copy of the nonamer TTATTTATT [SEQ ID NO:13] inserted
into the 3'-UTR-encoding region;
[0292] fos = The c-fos ARE as defined by Shyu et al (1989) inserted
into the 3'-UTR-encoding region i.e.,
5'AAAACGTTTTATTGTGTTTTTAATTTATTTATTAA
GATGGATTCTCAGATATTTATATTTTTATTTTATTTTTTT3' [SEQ ID NO:14];
[0293] myc = the myc ARE defined as follows
5'ATGCATGATCAAATGCAACCTCACA
ACCTTGGCTGAGTCTTGAGACTGAAAGATTTAGCCATAATGTAAACTGCCTCAAATTGGACTTTGGGCATAAA-
AGAACTTTTTTATGCTTACCATCTTTTTTTTTTCTTTAACAGATTTGTATTTAAGAATTGTTTTTAAAAAATTT-
TAAGATTTACACAATGTTTCTCTGTAAATATTGCCATTAAATGTAAATAACTTT3'[SEQ ID
NO:15].
Method
[0294] Five micrograms of maxiprep quality DNA was transfected into
~50% confluent 10cm flasks of HeLa Tet-Off cells (Clontech) using
Fugene reagent (Roche). ~Ten hours later, the flasks of cells were
each split into ~12 small (6cm) dishes and then incubated overnight
(~12-14 hrs). At this time point (typically designated time zero or
T.sub.0), doxycycline was added to the culture media of most plates
at a final concentration of 1 microgram per ml. Cells were
trypsinised and collected at this and subsequent time points. For
constructs expressing GFP, these samples were analysed by flow
cytometry using standard FITC filters. Total GFP fluorescence was
measured by gating out non-transfected cells (background
fluorescence only) and then multiplying the mean fluorescence per
cell (with background fluorescence subtracted) by the number of
positive cells. RFP fluorescence (DsRed) was measured similarly
using appropriate filters. Cells transfected with
luciferase-encoding vectors were lysed and measured in a
luminometer using Promega's Dual Luciferase Assay methods and
reagents.
[0295] Data are typically expressed as the percentage of reporter
(fluorescence or luminescence) remaining, relative to time
zero.
[0296] Since the doxycycline added at time zero causes a block in
transcription of the reporter, the rate of decrease in reporter
levels indicates the time lag between altered transcription and
altered reporter/protein levels. A prime purpose of the invention
is to reduce this time lag and Figs 7, 8, 9 and 11-14 demonstrate
that this is achieved.
[0297] As an example of the utility of this invention, a
pharmaceutical company may wish to screen for drugs that reduce
transcription of a gene involved in disease. The
tetracycline/doxycycline-induced block in transcription from the
TRE promoter is a model of such a system. Figs 7 and 8 show that
with the standard luciferase reporter vectors, even a total block
in transcription (with doxycycline) is not detectable as a decrease
in luciferase activity within 10 hrs. The destabilised EGFP mutants
represent an improvement in that the total block in transcription
is detectable as a 50% decrease in EGFP fluorescence within 11 hrs
(d2EGFP; BTG2) or 7 hrs (d1EGFP; BTG1). However, when the latter
reporter is combined with a mRNA destabilising element such as 4
copies of the nonamer UUAUUUAUU [SEQ ID NO:1] (BTG1N4), a 50%
decrease in reporter levels is detectable within 3 hrs. It follows
that an increase in a transcription would also be detected sooner
with constructs containing the destabilising elements (Roth,
1995).
[0298] Of course the action of doxycycline is not immediate so that
part of the time lag is due to the time required for this drug to
induce a 100% transcriptional block. Therefore, the "Effective rate
of decay" was measured by plotting data points subsequent to and
relative to the time point at 4 hrs after addition of doxycycline
(Figure 9). The effective rate of decay therefore excludes the
delay in drug action and is a combined effect of protein and mRNA
half-lives. Figure 9 shows the effective rate of decay with
constructs containing 1, 2 or 4 nonamers. These data show that 4
nonamers are more efficient than 2, which is more efficient than 1.
Furthermore, these data show that by combining a 1 hr half-life
protein (d1EGFP) with 4 nonamers, an effective rate of decay of
approximately 1 hr 20 mins can be achieved. This is very close to
the 1 hr half-life of the protein and demonstrates an extremely
short mRNA half-life. Further reduction could be achieved by
combining 2 or more different mRNA instability elements(Figure 13).
However, this is unlikely to be required for most applications.
Applications that require a more moderate destabilising effect
could utilise 1 or 2 nonamers, rather than 4.
[0299] With the standard luciferase reporter, luminescence actually
increased after the addition of doxycycline. This is most apparent
when the data is expressed on a linear scale (Figure 8) and can be
explained, in part, by the delay in the action of doxycycline.
However, even from 4 hrs onwards, no decay is evident,
demonstrating the inadequacy of this reporter for measuring changes
in transcription over time. A further problem of this vector is
revealed in Figure 10. These data relate to changes in reporter
levels over time (24-34 hrs post transfection), in the absence of
any treatment or drug. Reporter levels generally increase during
the first 24 hrs post transfection as the plasmids enter the cells
and begin to be expressed. A decrease is generally seen from about
48 hrs as the plasmids are expelled from the cells. Therefore,
measurements are typically taken between 24 and 48 hrs. In the
absence of drugs or treatment, the new vector (BTG1N4), containing
the instability elements, shows excellent stability of reporter
levels. In contrast, the luciferase vector is clearly still ramping
up expression levels. Constructs with moderate stability (e.g.,
BTG1) showed intermediate results. Clearly reporters with longer
mRNA and protein half-lives will undergo a more lengthy ramping up
phase as indicated in Figure 10. The more stable expression levels
seen with the new construct during the critical period of 24-34 hrs
will facilitate accurate measurement and represent another
advantage of the invention.
[0300] The rate of decrease in reporter levels can be compared
between two or more constructs, which differ in their reporter mRNA
sequence (e.g., in 3'-UTR) but encode the same protein or different
proteins with the same half-life (e.g., d2EGFP, d2EYFP). In this
context, differences in the rate of decay indicate an effect of the
altered mRNA sequence on mRNA stability. For example, the presence
of 4 UUAUUUAUU [SEQ ID NO:1] nonamers as DNA TTATTTATT [SEQ ID
NO:13] (Figures 7-9) or the c-fos ARE (Figure 11)[SEQ ID NO:14],
within the 3'-UTR significantly increased the rate of mRNA decay.
In addition to demonstrating the effectiveness of these elements,
the methods and vectors used also represent a substantially
improved system for detecting other cis-acting mRNA
stability/instability elements and this process is also encompassed
herein.
[0301] As shown in Figures 12 to 14 mRNA destabilising elements
work with Luciferase, GFP and DsRed not withstanding the low level
of homology between these reporters. DsRed has only 23% homology
with EGFP. As shown in Figure 14 myc ARE (SEQ ID NO: 21) are
effective and are also effective in combination with different
destabilising elements.
EXAMPLE 15 - mRNA Destabilising Elements
[0302] RNA destabilising elements in accordance with the present
invention can be derived inter alia from the 3'-UTR of the
following genes. In most cases, the full-length 3'-UTR can be used.
However, the U-rich and/or AU-rich elements can often be used
alone.
[0303] (a) Phosphoenolpyruvate carboxykinase (PEPCK) mRNA
destabilising elements described by Laterza OF et al. Regions
within 3' half of 3'-UTR referred to as JW6 and JW7 i.e.,
GTATGTTTAAATTATTTTTATACACTGCC
CTTTCTTACCTTTCTTTACATAATTGAAATAGGTATCCTGACCA [SEQ ID NO:16].
[0304] (b) The Bicoid gene from Drosophila melanogaster comprises a
mRNA destabilising element in first 43 nt of 3'-UTR (Surdej P. et
al) such an element can be used inter alia to destabilise mRNA in
insect cells.
[0305] (c) The Human Thioredoxin reductase gene (Gasdaska, JR et
al). The entire 3'-UTR. Nucleotide 1933-3690 (contains 6 AU-rich
elements). Segment containing 3 upstream AU repeats (nucleotide
1975-3360). There is also as Non-AU-rich destabilising element at
nt 1933-2014.
[0306] (d) Heat Stable Antigen (HSA) Gene described in Zhou, Q et
al. For example, nucleotides 1465-1625 in the 3'-UTR.
[0307] (e) Granulocyte-macrophage colony stimulating factor
(GM-CSF) ARE described by Chyi-Ying, A et al.
AGUAAUAUUUAUAUAUUUAUAUUUUUAA AAUAUUUAUUUAUUUAUUUAUUUAA [SEQ ID
NO:17]i.e., as DNA:
AGTAATATTTATATATTTATATTTTTAAAATATTTATTTATTTATTTA TTTAA [SEQ ID
NO:18].
[0308] (f) c-fos full length 3'-UTR or part thereof or ARE as
defined by Shyu et al 5'AA
AACGTTTTATTGTGTTTTTAATTTATTTATTAAGATGGATTCTCAGATATTTATATT-
TTTATTTTATTTTTTT3' [SEQ ID NO:19] or by Peng, S et al.
5'TTTTATTGTGTTTTTAATTTATTTATTAAGATGGATTCTCAGATATTTATATTTTTATTTTATTTTTTTT3-
' [SEQ ID NO:20].
[0309] (g) c-jun ARE as described by Peng, S et al.
5'UUUCGUUAACUGUGUAUGUA
CAUAUAUAUAUUUUUUAAUUUGAUUAAAGCUGAUUACUGUGAAUAAACAG-
CUUCAUGCCUUUGUAAGUU3' [SEQ ID NO:21] Sequence as DNA:
5'TTTCGTTAACTGTGTATGTACATATATATATTTTTTAATTTGA
TTAAAGCTGATTACTGTGAATAAACAG- CTTCATGCCTTTGTAAGTT3' [SEQ ID NO:22]
or the mutant thereof which does not contain a polyadenylation
(AAUAAA [SEQ ID NO:23]) signal i.e.,
5'UUUCGUUAACUGUGUAUGUACAUAUAUAUAUUUUUUAAUUUGAUUAAAGCUGAUUACUGUGgAUccACAGC-
UUCAUGCCUUUGUAAGUU3' [SEQ ID NO:24] or as DNA
5'TTTCGTTAACTGTGTATGTACA
TATATATATTTTTTAATTTGATTAAAGCTGATTACTGTGgATccACAGCTTCATGCCTTTGTAAGTT3'
[SEQ ID NO:25].
[0310] Sequences from the following genes, that include their
respective ARE components as described by Henics, T. et al.:(h)
IFN-ARE:5'UCUAUUUAUUAAUAUUUAACAUUAUUUAUAUAU GGG3' [SEQ ID NO:26] or
as DNA 5'TCTATTTATTAATATTTAAC ATTATTTATATATGGG3' [SEQ ID
NO:27].
[0311] (i) IL-2 ARE: 5'CUCUAUUUAUUUAAAUAUUUAACUUUAAUUUAUUU
UUGGAUGUAUUGUUUACUAACUUUUAGUGCUUCCCACUUAAAACAUAUCAGGCUUCUAUUUAUUUAAAUAUUU-
AAAUUUUAUAUUUA UU3' [SEQ ID NO:28] or as DNA
5'CTCTATTTATTTAAATATTTAACT
TTAATTTATTTTTGGATGTATTGTTTACTAACTTTTAGTGCTTCCCACTTAAAACATATCAGGCTTCTATTTA-
TTTAAATATTTAAATTTTATATTTATT3' [SEQ ID NO:29].
[0312] (j) c-myc ARE (see also SEQ ID NO:49): 5'AUAAACCCUAAUUUUUUU
UAUUUAAGUACAUUUUGCUUUUAAAGUU3' [SEQ ID NO:30] or as DNA
5'ATAAACCCTAATTTTTTTTATTTAAGTACATTTTGCTTTTAAA GTT3' [SEQ ID
NO:31].
[0313] (k) IL-10: 5'UAGAAUAUUUAUUACCUCUGAUACCUCAACCCCCAUUU
CUAUUUAUUUACUGAGCUUCUCUGUGAACGAUUUAGAAAGAAGCCCAAUAUUAUAAUUUUUUUCAAUAUUUAU-
UAUUUUCA3' [SEQ ID NO:32] or as DNA
5'TAGAATATTTATTACCTCTGATACCTCAACCCCCA
TTTCTATTTATTTACTGAGCTTCTCTGTGAACGATTTAGAAAGAAGCCCAATATTATAATTTTTTTCAATATT-
TATTATTTTCA3' [SEQ ID NO:33].(l) bcl-2: Sequences from the bcl-2
3'-UTR that include all or part of the bcl-2 ARE as defined by
Schiavone, N et al. 5'UCAGCUAUUUACUGCC
AAAGGGAAAUAUCAUUUAUUUUUUACAUUAUUAAGAAAAAAGAUUUAUUU-
AUUUAAGACAGUCCCAUCAAAACUCCGUCUUUGGAAAUC3' [SEQ ID NO:34] (M13994
from nt 2371-2475) or as DNA
5'TCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATTATTAA-
GAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCGTCTTTGGAAATC3' [SEQ ID
NO:35].
[0314] (m) TNF ARE: as described by Xu, N et al. 5'-AUUAUUUAUUA
UUUAUUUAUUAUUUAUUUAUUUA3' [SEQ ID NO:36] or as DNA 5'ATTATTTATT
ATTTATTTATTATTTATTT ATTTA-3' [SEQ ID NO:37].
[0315] (n) IL-3 ARE: as described by Xu, N et al. 5'UAUUUUAUUCCAUU
AAGGCUAUUUAUUUAUGUAUUUAUGUAUUUAUUUAUUUAUU3' [SEQ ID NO:38] or as
DNA 5'-TATTTTATTCCATTAAGGCTATTTAT TTATGTATTTATGTATTTATTTATTTATT-3'
[SEQ ID NO:39].
[0316] (o) The nonamer UUAUUUAUU [SEQ ID NO:1] as DNA TTATTTATT
[SEQ ID NO:13], as described by Zubiaga, A et al. (p) The nonamer
UUAUUUA(U/A)(U/A) [SEQ ID NO:2] as DNA TTATTTA(T/A)(T/A) [SEQ ID
NO:40] as described by Lagnado, C et al. (q) The pentamer AUUUA
[SEQ ID NO:3] as described by Xu, N et al. or as DNA ATTTA [SEQ ID
NO:41] .(r) The tetramer AUUU [SEQ ID NO:4] or as DNA ATTT [SEQ ID
NO:42].
[0317] AU-rich elements (AREs) in general of both class I and class
II as described by Chen, C and Shyu, A.
[0318] (s) Plants have DST (downstream sequences) which act as
destabilising elements. DST sequence are defined in: Newnan, T et
al. A proposed consensus DST sequence is:
GGAgN.sub.2-9cATAGATTaN.sub.3-8(A/C)(- T/A)(A/T)TttGTA(T/C) [SEQ ID
NO:43].
[0319] This is based on comparison of 9 different DST
sequences.
[0320] Bold = conserved in 9/9 genes.
[0321] Capital = conserved in at least 7/9 genesN2-9 = variable
length region of 2-9 nucleotides; average = 5.
[0322] N3-8 = variable length region of 3-8 nucleotides; average =
6.
[0323] Distance from stop codon = 19-83 nt.
[0324] Further examples of DST sequences include the:Soybean 10A5
gene; 5'GGAGN.sub.5CATAGATTAN.sub.8AAATTTGTAC3' [SEQ ID NO:44].
[0325] Arabidopsis SAURAC1 gene:
5'GGAAN9CATAGATCGN.sub.8CAATGCGTAT3' [SEQ ID NO:45].
[0326] DST sequences are an alternative to AU-rich elements for use
in plants. Both AU-rich elements and DST sequences destabilise
transcripts in plants.(t) Iron Responsive Element (IRE):as
described for example by Thomson, A et al. 1999.
[0327] IREs contain consensus CAGUG in a hairpin-loop.
[0328] Examples:Ferritin IRE: GUUCUUGCUUCAACAGUGUUUGAACGGAAC [SEQ
ID NO:46] or as DNA GTTCTTGCTTCAACAGTGTTTGAACGGAAC [SEQ ID
NO:47].
[0329] Transferrin Receptor IRE: GAUUAUCGGGAGCAGUGUCUUCCAUAAUC [SEQ
ID NO:48]or as DNA GATTATCGGGAGCAGTGTCTTCCATAATC [SEQ ID
NO:49].
[0330] Iron Regulatory Proteins (IRPs; e.g., IRP1 and 2) bind IREs
in an iron-dependent fashion. Binding is also modulated by various
other stimuli and treatments (e.g., oxidative stress, nitric oxide,
erythropoietin, thyroid hormone or phosphorylation by PKCs.
[0331] IREs can modulate both translational efficiency and mRNA
stability. For example, the 5'-UTR IRE in Ferritin mRNA blocks
translation only when bound to an IRP. The IREs in the 3'-UTR of
Transferrin receptor mRNA inhibit mRNA decay when bound by an IRP.
Therefore, IREs can be inserted into 5'-UTR or 3'-UTR of expression
vectors to provide expression that can be controlled by modulating
iron levels or other stimuli.
[0332] Destabilising elements can be used with Clontech's Mercury
Pathway Profiling vectors and in vivo kinase assay kits. Clontech
produce 3 different protein-destabilising elements, all containing
a PEST sequence and all derived from the MODC gene. Different
mutant MODCs placed at the carboxy-end of EGFP provide protein
half-lives of 1 hr, 2 hr and 4 hr. mRNA destabilising elements in
accordance with the present invention can be used in conjunction
with these and any other protein-destabilising element (e.g.,
ubiquitination signals).
[0333] (u) c-myc ARE may also be defined as:
5'ATGCATGATCAAATGCAACCTCAC
AACCTTGGCTGAGTCTTGAGACTGAAAGATTTAGCCATAATGTAAACTGCCTCAAATTGGACTTTGGGCATAA-
AAGAACTTTTTTATGCTTACCATCTTTTTTTTTTCTTTAACAGATTTGTATTTAAGAATTGTTTTTAAAAAATT-
TTAAGATTTACACAATGTTTCTCTGTAAATATTGCCATTAAATGTAAATAACTTT3' [SEQ ID
NO:50].
[0334] (v) Another useful mRNA element can be obtained from histone
mRNA, Specifically, 3'-UTR sequences including a consensus stem
loop structure are described by Gallie, D et al.:
UGA-N.sub.20-40-CCAAAGGYYYUUYUN ARRRCCACCCA [SEQ ID NO:51], where
Y=pyrimidine, R=purine, N= any nucleotide or as DNA
TGA-N.sub.20-40-CCAAAGGYYYTTYTNARRRCCACCCA [SEQ ID NO:52].
[0335] Such sequences can increase translational efficiency.
Moreover, they are capable of directing mRNA decay specifically
outside of S phase. Reporter constructs containing a
cell-cycle-specific promoter, together with mRNA destabilising
elements are contemplated in this invention as a tool for directing
cell-cycle specific expression (e.g., of a reporter). The histone
3'-UTR element offers an alternative for use with an S-phase or
late G1 specific promoter, since it will direct increased mRNA
decay in G2 relative to S-phase, thus further restricting protein
expression to S phase.
[0336] Yet another use of 3'-UTR elements in expression vectors is
for the purpose of specifically localising the chimeric mRNA. For
example, the utrophin 3'-UTR is capable of directing reporter mRNA
to the cytoskeletal-bound polysomes. mRNA stabilising elements are
also contained in this 3'-UTR (Gramolini, A, et al.).
EXAMPLE 16 - mRNA Stabilising Elements and Expression Vectors
encoding a stabilised mRNA
[0337] Stabilising sequences may contain CT-rich elements and/or
sequences derived from long-lived mRNAs (particularly 3'-UTR
regions)CT-rich elements may contain
(C/U)CCAN.sub.xCCC(U/A)Py.sub.xUC(C/U)CC [SEQ ID NO:53] as
described by Holcik and Liebhaber, 1997.
[0338] CT-rich elements may contain the following element
CCTCCTGCCCGCTGGGCCTCCCAACGGGCCCTCCTCCCCTCCTTGC [SEQ ID NO:54] or
parts thereof, including CCTCC [SEQ ID NO:55], CCTCCTGCC [SEQ ID
NO:56] or CCCTCCTCCCCTGG [SEQ ID NO:57].
[0339] A 14-nt pyrimidine-rich region from the 3'-UTR of human
beta-globin described by Yu and Russell is also contemplated for
use as a stabilising element.
[0340] Examples of long-lived mRNAs from which stabilising elements
may be derived include;Alpha2 globin, Alpha1 globin, beta globin.
From human, mouse, rabbit or other species, bovine growth hormone
3'-UTR.
[0341] The mRNA instability elements described herein generally act
in a dominant-fashion to destabilise chimeric genes. It follows,
therefore that mRNA stabilising elements are often
recessive-acting. For example, insertion of a c-fos ARE into the
rabbit beta-globin gene, results in a destabilised transcript
despite the continued presence of mRNA stability elements (Shyu, A
et al. 1989). Both alpha- and beta-globin mRNAs contain stability
elements that have been mapped to their respective 3'-UTRs, whereas
zeta-globin mRNA lacks these elements and is less stable. Replacing
the zeta-globin 3'-UTR with that of alpha globin mRNA nearly
doubles mRNA stability (Russell, J et al. 1998). However, such
elements do not stabilise all transcripts. Therefore, the
requirements for generating an expression vector that expresses a
stable mRNA differ, dependent on the original mRNA that is to be
stabilised. To create such a vector it is generally preferable to
include large segments from a stable gene such as alpha- or
beta-globin. With these examples, such segments should preferably
include the entire globin 3'-UTR, replacing the endogenous 3'-UTR.
As exemplified with zeta-globin, this is sometimes sufficient.
However, the further incorporation of protein-coding and/or 5'-UTR
sequences is often required. Generally, it is preferable to replace
any endogenous AU- or U-rich regions, which may act as dominant
destabilising elements (these can be identified using the
techniques described herein). Such regions in the 5'-UTR or 3'-UTR
are simply replaced with alpha- or beta-globin sequences from the
same relative position. Instability elements from the coding region
can be rendered non-functional by mutation to synonymous codons.
The globin protein-coding region can be incorporated into the
coding region of the gene of interest to create an N- or C-terminal
fusion protein. However this is often not desirable and it is
generally sufficient to localise the globin protein-coding region
(and 3'-UTR) into the 3'-UTR of the chimeric gene. This allows
expression of the desired protein from a more stable transcript,
thus markedly increasing levels of the protein. When the desired
protein is a reporter or is fused to a reporter or can be easily
distinguished from endogenous protein, the TRE vector system
described herein (see Figure 7) greatly facilitates the testing of
chimeric constructs for mRNA stability.
EXAMPLE 17 - Further Evidence of the Versatility and Effectiveness
of the System
[0342] To further demonstrate the applicability of the
destabilising system to a number of different reporters and
applications, the inventor constructed a wide range of reporter
vectors, with and without a mRNA destabilising element (N4; 4
copies of the nonamer TTATTTATT [SEQ ID NO:13]), and with or
without a protein-destabilising element (MODC PEST sequences at
carboxy-end and/or ubiquitin sequences at the N-end). The TRE
promoter was utilised, which is repressed in response to
doxycycline and slightly enhanced by PMA or a synthetic promoter
comprised of 4 copies of the NF-B-binding sequence, which is more
strongly enhanced by PMA. The inventor also utilised the following
reporter proteins; EGFP, EYFP, ECFP, HcRed, firefly luciferase,
Renilla luciferase and beta galactosidase.
[0343] Reporter constructs were assembled in the pGL3 vector
backbone using standard cloning techniques. Essentially, the
reporter genes comprised: Sac1promoter and
5'-UTRBgl2-Age1-Kozak-STARTreporter protein
encodingHind3---MODC-PEST-encodingSTOP-Xba1N4SV40pASal1; for the
destabilised variants and:Sac1promoter and
5'-UTRAge1-Kozak-STARTreporter protein encodingSTOP-Xba1SV40
pASal1; for the standard reporter genes.
[0344] Reporter protein-encoding sequences were typically obtained
by PCR of standard commercial vectors and cloned into the
abovementioned vectors by utilising a forward primer containing an
Age1 site and a Kozak sequence and a reverse primer containing
either a Hind3 site (but no STOP codon) to create the destabilised
reporter protein or an Xba1 site (downstream of the STOP codon) for
the stable (standard) reporter protein. The N4 mRNA destabilising
sequence was conveniently included or excluded from specific
vectors by substituting the Xba1-Sal1 fragments shown above that
either contain or do not contain N4. In some specific vectors,
N-terminal fusions were created by inserting in frame and into the
Age1 site; a human ubiquitin sequence, preceded by a Kozak sequence
and followed by a short N-terminal destabilising element (generated
by PCR of human genomic DNA) and/or the puromycin-resistance gene
(without stop codon; generated by PCR of pBabe-puro). The Quick
Change method (Invitrogen) was used to make small mutations
including conversion of the wild-type ubiquitin sequence to a
non-cleavable mutant (Gly-Val substitution in last amino acid
residue of ubiquitin).
[0345] Nomenclature (additive to that shown in Example 14):
[0346] B (at start of name of all vectors)= Vector backbone derived
from Promega's pGL3-Basic.
Promoters
[0347] T = Tetracycline-responsive element (TRE), including the
minimal CMV promoter/5'-UTR sequence, derived fromClontech's
pTRE-d2EGFP vector.
[0348] N (following B) = 4 tandem copies of the NFkB-binding site
followed by the minimal CMV promoter/5'-UTR.
N-terminal fusion sequence
[0349] u = ubiquitin coding sequence followed by arginine and
destabilising N-terminal peptide.
[0350] mu = mutant (non-cleavable ubiquitin).
[0351] puro = sequence encoding puromycin-resistance.
[0352] neo = sequence encoding neomycin-resistance.
Parental reporter sequences
[0353] G = EGFP coding (alone or as fusion).
[0354] Y = EYFP coding (alone or as fusion).
[0355] C = ECFP coding (alone or as fusion).
[0356] H = HcRed coding (alone or as fusion).
[0357] R = DsRed2 used as the reporter.
[0358] L = Firefly luciferase coding sequence (alone or as
fusion).
[0359] Rn = Renilla luciferase coding sequence (alone or as
fusion).
[0360] B (in middle of name) = beta-galactosidase coding sequence
(alone or as fusion).
C-terminal fusion sequences
[0361] 1 = the mutated, MODC-derived, PEST sequence as present in
d1EGFP-N1 (Clontech).
[0362] 2 = the mutated, MODC-derived, PEST sequence as in
pTRE-d2EGFP (Clontech).
3'-UTR additions
[0363] N4 = 4 copies of the nonamer TTATTTATT [SEQ ID NO:13]
inserted into the 3'-UTR-encoding region.
[0364] Each TRE-containing plasmid was evaluated for its rate of
response (in reporter levels) to an inhibition of transcription.
Briefly, each vector in a series was transfected into Tet-Off HeLa
cells, then split into multiple dishes. Reporter levels were
measured during a time-course after addition of doxycycline (which
inhibits transcription from TRE), as described in the legends to
Figures 15 and 17. For convenience, Figures 15-24 all show the
standard vectors as open squares on a thin line and the fully
destabilised vector as closed triangles on a bold line.
[0365] In all cases, both mRNA- and protein-destabilising elements
were shown to improve the rate of response to drug (effective decay
after doxycycline). In particular, the combination of the d1 MODC
protein degradation signal plus the N4 mRNA-degradation signal
(i.e., vectors ending in 1N4) resulted in a very rapidly responding
Renilla luciferase (Figure 15), firefly luciferase (Figure 16),
EGFP (Figure 17), EYFP (Figure 18), ECFP (Figure 19) and HcRed
(Figure 20). The further addition of an N-terminal ubiquitin
sequence resulted in further destabilisation of EYFP (Figure 22B)
and beta galactosidase (Figure 21).
[0366] In theory, a more rapidly degrading reporter system such as
that described herein, should not only produce faster decay after
inhibition but should produce a more rapid accumulation after
activation. Indeed, given that most drugs and biological systems
involve a transient rather than permanent increase or decrease in
expression, the more rapid response of unstable reporters should
also lead to a larger maximum effect in such systems. Figure 24
shows that the destabilised Renilla luciferase does indeed show a
much larger as well as more rapid increase in reporter levels
following activation by PMA. The inventor has also used kinetic
models to quantify this effect and showed that the accurate
detection of minor or transient changes is virtually impossible
with many standard reporters such as luciferases, beta
galactosidase and CAT. This theoretical evidence was demonstrated
in practice through the experiment depicted in Figure 23., which
shows virtually no change in standard luciferase reporter levels
after a small to moderate induction of transcription, whereas a 4-5
fold increase was seen with the destabilised counterpart.
EXAMPLE 18 - Dual- reporter vectors for studying or measuring gene
regulation
[0367] Dual-reporter bidirectional vectors based on the example
shown in Figure 4B were constructed using standard techniques and
using BTH1N4 and BTG1N4 as starting material. In these dual-colour
vectors, a single TRE promoter drives transcription of destabilised
HcRed in one direction (BTH1N4) and destabilised EGFP in the other
(BTG1N4). Convenient unique cloning sites were introduced on the
EGFP side at the transcription start site and immediately upstream
of the Kozak sequence. Using these cloning sites, a variety of
different 5'-UTRs were cloned into the BTG1N4 mRNA encoding region,
with the BTH1N4 mRNA encoding region remaining unchanged. As such,
red fluorescence serves as an internal control for transfection
efficiency, cellular conditions etc. In an additional construct,
the EGFP-coding region (from BTG1N4) was fused with the coding
region from the puromycin resistance gene to create a puro-GFP
fusion protein construct (BTpuroG1N4).
[0368] Each construct was transfected into Tet-Off HeLa cells and
24 hrs later, green and red fluorescence was measured
simultaneously by flow cytometry and analysed using FlowJo
software. When fluorescence was expressed as the relative ratio of
green:red fluorescence (Figure 28A), the effect of these different
5'-UTRs (or puro-GFP fusion protein) on expression levels of GFP
could be easily seen. The higher relative expression of GFP in
constructs containing the Hsp70 and beta-globin 5'-UTRs is
consistent with reports of these UTRs containing translational
enhancer sequences. The synthetic 5'-UTR sequence showed an
apparently low translational efficiency. The puro-GFP construct
appeared to be very efficiently translated and this shows how the
vector system can be used to assay the effect on expression levels
of protein-coding sequences as well as UTR sequences.
[0369] Increased expression caused by a 5'-UTR (or other sequence)
could derive not only from increased translational efficiency but
also from increased mRNA stability or enhancement of transcription.
An important feature of the embodiment exemplified here is the
ability to distinguish these possibilities. A transcriptional
enhancer, by definition, acts independently of orientation and if
present in a sample 5'-UTR, would enhance transcription from the
TRE in both directions and thus increase both red and green
fluorescence. A co-transfected control vector would assist in
identifying such transcriptional enhancers, which would not be
expected to alter the green:red ratio in the manner shown in Figure
28A. An effect on mRNA stability is a likely consequence of altered
5'-UTR sequence and with standard reporter systems this mRNA
stability effect cannot be distinguished from a translational
effect. However, Figure 28B shows that all 6 constructs have
similar rates of decay in GFP fluorescence after doxycycline was
added to the cells expressing these constructs, in order to block
transcription from the TRE promoter. Therefore, it can be inferred
that the different 5'-UTR sequences did not affect mRNA stability
and instead must have altered translational efficiency.
[0370] Those skilled in the art will be aware that the invention
described herein is subject to variations and modifications other
than those specifically described. It is to be understood that the
invention described herein includes all such variations and
modifications. The invention also includes all such steps,
features, compositions and compounds referred to or indicated in
this specification, individually or collectively, and any and all
combinations of any two or more of said steps or features.
[0371] The disclosure of every patent, patent application, and
publication cited herein is hereby incorporated herein by reference
in its entirety.
[0372] The citation of any reference herein should not be construed
as an admission that such reference is available as "Prior Art" to
the instant application.
[0373] Throughout the specification the aim has been to describe
the preferred embodiments of the invention without limiting the
invention to any one embodiment or specific collection of features.
Those of skill in the art will therefore appreciate that, in light
of the instant disclosure, various modifications and changes can be
made in the particular embodiments exemplified without departing
from the scope of the present invention. All such modifications and
changes are intended to be included within the scope of the
appended claims.
TABLE 1
[0374] Signal transducers that could be used in the present
invention.
1 Signal transducer AKT (also called PKB) Fas L/BID JAK 7 Stat
MKK-47/JNK MTOR/p70 s6 kinase NF.kappa.B p38 PKA/Rap1 B-raf Ras/Raf
Wnt/GSK3 Erk 1&2
[0375]
BIBLIOGRAPHY
[0376] Chen, C and Shyu, A. Trends Biochem. Sci. 1995: vol 20
465-470.
[0377] Chyi-Ying, A et al. MCB 1995: vol 15 (10) 5777-5788.
[0378] Contag, et al. Non-invasive localization of a light-emitting
conjugate in a mammal United States Patent 5,650,135. July 22,
1997.
[0379] Cormack, et al. FACS-optimized mutants of the green
fluorescent protein (GFP) United States Patent 5,804,387. September
8, 1998.
[0380] Dandekar T et al Bioinformation 1998: 14(3):271-278.
[0381] Darzynkiewicz. Laser-scanning cytometry: A new
instrumentation with many applications. Exp Cell Res
1999;249:1-12.
[0382] Gallie, D et al. Nucleic Acids Res. 1996: vol24 (10);
1954-1962.
[0383] Gasdaska, JR et al. JBC 1999:vol 274 (36); 25379-25385.
[0384] Gossen, et al. Tight control of gene expression in
eucaryotic cells by tetracycline-responsive promoters. United
States Patent 5,464,758. November 7, 1995.
[0385] Gramolini, A, et al. JBC 2001: vol 154 (6) 1173-1183.
[0386] Henics, T. et al JBC 1999: vol 274 (24) 17318-17324.
[0387] Holcik and Liebhaber, 1997, PNAS vol 94 pp2410-2414.
[0388] Huet, X et al. Mol Cell Biol. 1996; vol 16 (7):
3789-3798.
[0389] Ibrahim, et al. Pitfall of an internal control plasmid:
Response of Renilla luciferase (pRL-TK) plasmid to
dihydrotestosterone and dexamethasone. Biotechniques
2000;29:682-684.
[0390] Kamentsky et al. Slide-based laser scanning cytometry. Acta
Cytol 1997;41:123-43.
[0391] Li, et al. Generation of destabilised green fluorescent
protein as a transcription reporter. J Biol Chem
1998;273:34970-34975.
[0392] Lagnado C et al, MCB, 14:7984-7995, 1994.
[0393] Laterza, OF et al Am J Physiol Renal Physiol. 2000: vol
279(5) F866-F873.
[0394] Leclerc G et al, Biotechniques 2000, 29(3) 590-595.
[0395] Lee, H et al. Gene Expr 1995; vol 4(3): 95-109.
[0396] Li, et al. Rapidly degrading GFP-fusion proteins. United
States Patent 6,130,313 October 10, 2000.
[0397] Liu, J et al. JBC 2000; vol 275 (16): 11846-11851.
[0398] Newnan, T et al. The Plant Cell 1993: vol 5; 701-714.
[0399] Peng, S et al. MCB 1996: vol 6 (4) 1490-1499.
[0400] Ross, J. Microbiological Reviews. 1995: vol 59
(3):423-450.
[0401] Saito, T et al. Biochem Biophys Res Commun. 1998; vol 252
(3): 775-778.
[0402] Schiavone, N et al. FASEB J. 2000: vol 14 174-184.
[0403] Shyu et al 1989:Genes & Dev. Vol 3, pp60-72.
[0404] Siebenlist et al., MCB 1986 vol 6 3042-3049, Stein, J et al.
Int J Obes Relat Metab Disord. 1996 Mar;20 Suppl 3: S84-90.
[0405] Surdej, P and Jacobs-Lorena, M. MCB 1998 vol 18 (5)
2892-2900.
[0406] Thomson, A et al. Int. J Biochem Cell Biol. 1999: vol 31;
1139-1152.
[0407] Tsien, et al. Modified green fluorescent proteins. United
States Patent 5,625,048. April 29, 1997.
[0408] Tsien, et al. Modified green fluorescent proteins United
States Patent 5,777,079. July 7, 1998.
[0409] Vazhappilly, R and Sucher, N. Neurosci Lett. 2002; vol 318
(3): 153-157.
[0410] Xu W et al, MCB, 17(8):4611-4621, 1997.
[0411] Yu and Russell MCB Sept 2001 5879-88.
[0412] Zhou, Q et al. MCB 1998: vol 18 (2) 815-826.
[0413] Zubiaga et al. MCB 1995;15:2219-30.
* * * * *