U.S. patent application number 10/740869 was filed with the patent office on 2004-10-14 for method for treating retroviral infections.
This patent application is currently assigned to UNIROYAL CHEMICAL COMPANY, INC., a corporation of the State of Delaware. Invention is credited to Lacadie, John A., Pierce, James B..
Application Number | 20040204451 10/740869 |
Document ID | / |
Family ID | 21804307 |
Filed Date | 2004-10-14 |
United States Patent
Application |
20040204451 |
Kind Code |
A1 |
Lacadie, John A. ; et
al. |
October 14, 2004 |
Method for treating retroviral infections
Abstract
Compositions and methods of treating a retroviral infection in
an afflicted host and/or inhibiting replication of a retrovirus
involve administering a therapeutically effective amount of the
following compound of formula I: A--L--B (I) wherein A is a
substituted or unsubstituted aryl compound, substituted or
unsubstituted piperidyl, or substituted or unsubstituted
thiopheneyl; L is sulfonyl, sulfinyl or thio; and B is a
substituted or unsubstituted aromatic nitrogen containing
heteroaryl compound; or pharmacologically acceptable acid-addition
and base-addition salts thereof.
Inventors: |
Lacadie, John A.; (Woodbury,
CT) ; Pierce, James B.; (Southbury, CT) |
Correspondence
Address: |
CROMPTON CORPORATION
Benson Road
Middlebury
CT
06749
US
|
Assignee: |
UNIROYAL CHEMICAL COMPANY, INC., a
corporation of the State of Delaware
|
Family ID: |
21804307 |
Appl. No.: |
10/740869 |
Filed: |
December 19, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10740869 |
Dec 19, 2003 |
|
|
|
10021453 |
Oct 29, 2001 |
|
|
|
Current U.S.
Class: |
514/316 ;
514/318; 514/326; 514/422; 514/444 |
Current CPC
Class: |
A61K 31/4402 20130101;
A61K 31/4412 20130101; A61P 31/18 20180101; A61K 31/47 20130101;
A61P 31/14 20180101 |
Class at
Publication: |
514/316 ;
514/318; 514/326; 514/422; 514/444 |
International
Class: |
A61K 031/4545; A61K
031/454; A61K 031/381; A61K 031/4025 |
Claims
What is claimed is:
1. A pharmaceutical composition useful for treating a retroviral
infection by a retovirus selected from the group consisting of HIV,
HCMV and HHV, in an afflicted host, comprising a therapeutically
effective amount of the following compound: A--L--B or a
pharmaceutically acceptable acid-addition and base-addition salt
thereof; wherein: component A is a substituted or unsubstituted
aryl functional group, substituted or unsubstituted piperidyl, or
substituted or unsubstituted thiopheneyl; component L is sulfonyl,
sulfinyl or thio; and, component B is a substituted or
unsubstituted aromatic nitrogen containing heteroaryl functional
group; and a pharmaceutically acceptable carrier.
2. The composition of claim 1 wherein the substituted or
unsubstituted aryl functional group component A is of the following
formula: 23wherein Z is H, Cl, cyano, alkyl having from 1 to 15
carbon atoms, alkoxyalkyl having 2 or 3 carbon atoms; Y is H or a
double bond to a carbon which is attached to R; and R is phenyl,
biphenyl, benzyl, polycycloaryl, heteroaryl or phenyl substituted
with 1 to 5 substituents which may be the same or different, the
substituents being selected from the group consisting of lower
alkyl having from 1 to 5 carbon atoms, halogen, nitro, methoxy,
ethoxy, benzyloxy, methylenedioxy, 2,2-dichlorocyclopropyl,
trifluoromethyl, methylsulfonyl, cyano and phenoxy.
3. The composition of claim 1 wherein the substituted or
unsubstituted aromatic nitrogen containing heteroaryl functional
group component B is 4-methylquinolyl, 8-ethyl-4-methylquinolyl or
a structure of the following formula: 24wherein n is 0 or 1,
R.sub.1 and R.sub.2 may be the same or different and are H,
halogen, lower alkyl having from 1 to 4 carbon atoms, hydroxy, or
nitro.
4. The composition of claim 1 wherein the compound is selected from
the group consisting of 2-(phenylmethylsulfonyl) pyridine-N-oxide,
2-[1-(2,5-dimethylphenyl) octylsulfonyl] pyridine-N-oxide,
2-[(2,5-dimethylphenyl)methylsulfonyl] pyridine-N-oxide,
2-[[1-(2,5-dimethylphenyl)ethyl]sulfonyl]-3-methylpyridine-N-oxide,
2-[[1-(2,5-dimethylphenyl)chloromethyl]sulfonyl]-4-methylpyridine-N-oxide-
, 2-[1-(2,5-dimethylphenyl)chloromethyl]sulfonyl] pyridine,
2-[1-(2,5-dimethylphenyl)methylthio]-3-chloropyridine-N-oxide,
2-[phenylmethyl]thio-3-hydroxypyridine, 2-[(2,5-dimethylphenyl)
methylthio] pyridine,
2-[(2,3,4,5,6-pentachlorophenyl)methylsulfonyl] pyridine N-oxide,
2[1-(phenylethyl)sulfonyl]-8-ethyl-4-methylquinoline,
2-[(3,4-dichlorophenyl)methylsulfonyl] pyridine-N-oxide,
2-[(4-(2,2-dichlorocyclopropyl)phenyl)methylsulfonyl]
pyridine-N-oxide, 2-[(2,4,6-trimethylphenyl)methylsulfinyl]
pyridine-N-oxide, 2-[(3-nitro-4-chlorophenyl) methylsulfonyl]
pyridine-N-oxide, 2-[phenylmethylsulfinyl] pyridine-N-oxide,
2-[[1-(2,5-dimethylphenyl)prop-
yl]sulfonyl]-3-methylpyridine-N-oxide,
2-[(9-anthryl)methylsulfonyl] pyridine-N-oxide, 2-[4-((1,1
dimethyl)propyl) phenyl)methylsulfonyl] pyridine-N-oxide,
2-[1-(2,5-dimethylphenyl)ethylthio]-4-methylquinoline,
2-[[(2,5dimethylphenyl)methyl]sulfonyl]-3-methylpyridine-N-oxide
and pharmaceutically acceptable acid-addition and base-addition
salts thereof.
Description
[0001] This application is a division of U.S. patent application
Ser. No. 10/021,453, filed on Oct. 29, 2001.
FIELD OF THE INVENTION
[0002] This invention relates to methods for treating retroviral
infections. More particularly, this invention relates to a method
for the prevention or treatment of infection of a patient with
HIV-1, HIV-2, human cytomegalovirus (HCMV) and human herpes virus
type 6 (HHV-6) by administering an effective amount of pyridine or
quinoline derivatives which inhibit replication of these
retroviruses.
BACKGROUND OF THE INVENTION
[0003] There are currently about seven nucleoside reverse
transcriptase (RT) inhibitors (NRTIs), about three nonnucleoside RT
inhibitors (NNRTI) and about six protease inhibitors (PI)
officially approved for the treatment of HIV-infected individuals.
Reverse transcriptase and protease are virus-encoded enzymes. The
clinical efficacy of the individual drugs varies depending on the
nature and the molecular target of the drugs.
[0004] U.S. Pat. No. 5,268,389 describes certain thiocarboxylate
ester compounds that are said to inhibit the replication of HIV. It
is alleged that the selectivity of these compounds for HIV-1 is due
to a highly specific interaction with HIV-1 RT.
[0005] U.S. Pat. No. 5,696,151 is directed to certain
carbothioamides which inhibit replication of HIV-1 and reverse
transcriptase mutants thereof.
[0006] The rapid emergence of HIV-1 strains resistant to several
HIV-1-specific RT inhibitors in cell culture and in AIDS patients
has caused concern for further development of these inhibitors in
the clinic. See, e.g., Balzarini et al, J. Virology 67(9):
5353-5359 (1993) ("Balzarini I") and Balzarini et al, Virology 192:
246-253 (1993) ("Balzarini II").
[0007] Failure of long-term efficacy of known drugs can be
associated with the appearance of dose-limiting and/or long-term
side-effects, or more importantly, with the emergence of
drug-resistant virus strains. Both RT inhibitors and protease
inhibitors tend to select for virus strains that show a reduced
susceptibility for the particular drugs. Moreover, a considerable
cross-resistance exists between drugs that act against the same
target.
[0008] Attempts have been made to combine various HIV-1 RT
inhibitors to eliminate virus resistance. See, e.g., Balzarini I,
supra. However, there is still a need for new compounds for the
treatment of HIV, HCMV, HHV-6, and other retroviruses.
[0009] It is a purpose of this invention to provide compositions
and methods of preventing or treating HIV-1, HIV-2, HCMV, or HHV-6
infections.
SUMMARY OF THE INVENTION
[0010] This invention relates to a method for treating a retroviral
infection in an afflicted host which comprises administering to the
host a therapeutically effective amount of the following compound
of formula I:
A--L--B (I)
[0011] wherein component A is a substituted or unsubstituted aryl
functional group, substituted or unsubstituted piperidyl, or
substituted or unsubstituted thiopheneyl; component L is sulfonyl,
sulfinyl or thio; and component B is a substituted or unsubstituted
aromatic nitrogen containing heteroaryl functional group; as well
as all pharmacologically acceptable acid-addition and base-addition
salts thereof.
[0012] Examples of substituted or unsubstituted aryl functional
groups suitable as component A would include those structures
having formula II: 1
[0013] wherein Z is H, Cl, cyano, alkyl having from 1 to 15 carbon
atoms, or alkoxyalkyl having 2 or 3 carbon atoms, Y is H or a
double bond to a carbon which is attached to R, and R is phenyl,
biphenyl, benzyl, polycycloaryl, heteroaryl or phenyl substituted
with 1 to 5 substituents which may be the same or different
selected from lower alkyl having from 1 to 5 carbon atoms, halogen,
nitro, methoxy, ethoxy, benzyloxy, methylenedioxy,
2,2-dichlorocyclopropyl, trifluoromethyl, methylsulfonyl, cyano and
phenoxy.
[0014] Examples of substituted or unsubstituted aromatic nitrogen
containing heteroaryl functional groups suitable as component B
include 4-methylquinolyl, 8-ethyl-4-methylquinolyl and those
structures having formula III: 2
[0015] wherein n is 0 or 1, and R.sub.1 and R.sub.2 may be the same
or different and are H, halogen, lower alkyl having from 1 to 4
carbon atoms, hydroxy, or nitro.
[0016] The compounds of this invention are useful for the
inhibition of replication of retroviruses, e.g., HIV-1, HIV-2,
HCMV, and HHV-6. The compounds of this invention are also useful
for treating hosts infected with retroviruses, e.g., HIV-1, HIV-2,
HCMV and HHV-6 in vitro and in vivo. The method is also useful in
the therapeutic or prophylactic treatment of diseases caused by
these retroviruses such as acquired immune deficiency syndrome
(AIDS).
[0017] This invention additionally relates to a pharmaceutical
composition comprising a therapeutically effective amount of a
compound of formula I or a pharmacologically acceptable
acid-addition or base-addition salt thereof and a pharmacologically
acceptable carrier.
[0018] This invention also relates to a method of treating HIV,
HCMV, and HHV-6 infection in an afflicted host which comprises
administering to the host a therapeutically effective amount of the
compound of Formula I.
DESCRIPTION OF THE INVENTION
[0019] Unless otherwise defined, the terms listed below are defined
as follows:
[0020] "Alkyl" means straight, branched, or cyclic alkyl chains of
1 to 15 carbon atoms.
[0021] "Lower alkyl" means straight or branched alkyl chains of 1
to 5 carbon atoms.
[0022] "Halogenated alkyl" or "haloalkyl" means alkyl having 1 or
more halo atoms, e.g., trifluoro-methyl, 2,2-dichloro cyclopropyl,
etc.
[0023] "Heterocycloalkyl" means cyclic alkyl chain comprised of
from 1 to 12 carbon atoms and 1 or more heteroatoms independently
selected from the group consisting of N, O and S.
[0024] "Aryl" means an organic radical derived from an aromatic
hydrocarbon by removal of one hydrogen, e.g., phenyl, biphenyl, and
benzyl.
[0025] "Polycycloaryl" means an organic radical derived from an
aromatic fused ring hydrocarbon by removal of one hydrogen, e.g.,
naphthyl and anthranyl.
[0026] "Heteroaryl" means a single ring or benzofused
heteroaromatic group of 5 to 10 atoms comprised of 1 to 9 carbon
atoms and 1 or more heteroatoms independently selected from the
group consisting of N, O and S. N-oxides of the ring nitrogens are
also included. Examples of single-ring heteroaryl groups are
pyridyl, and thienyl. Examples of benzofused heteroaryl groups are
quinolyl and isoquinolyl.
[0027] "Alkoxy" means an alkyl radical attached by an oxygen, i.e.,
alkoxy groups having 1 to 4 carbon atoms.
[0028] "Phenoxy" means a phenyl radical attached by an oxygen.
[0029] "Piperidyl" means an organic radical derived from piperidine
by the removal of one hydrogen.
[0030] "Thiopheneyl" means an organic radical derived from
thiophene by the removal of one hydrogen.
[0031] "Halogen", "halogenated" or "halo" refers to fluorine,
chlorine, bromine or iodine radicals.
[0032] The compounds disclosed herein provide activity against
retroviruses such as HIV, HCMV, and HHV-6. The use of such
compounds, either alone or in combination with other
pharmacologically active agents, provides highly desired new
modalities for the treatment or prevention of HIV, HCMV and/or
HHV-6.
[0033] This invention relates to a compound of the following
formula I:
A--L--B (I)
[0034] wherein component A is a substituted or unsubstituted aryl
functional group, substituted or unsubstituted piperidyl, or
substituted or unsubstituted thiopheneyl; component L is sulfonyl,
sulfinyl or thio; and component B is a substituted or unsubstituted
aromatic nitrogen containing heteroaryl functional group; as well
as all pharmacologically acceptable acid-addition and base-addition
salts thereof.
[0035] Examples of substituted or unsubstituted aryl functional
groups suitable as component A include those structures having the
following formula II: 3
[0036] wherein Z is H, Cl, cyano, alkyl having from 1 to 15 carbon
atoms, or alkoxyalkyl having 2 or 3 carbon atoms; Y is H or a
double bond to a carbon which is attached to R; and R is phenyl,
biphenyl, benzyl, polycycloaryl, heteroaryl or phenyl substituted
with 1 to 5 substituents which may be the same or different, the
substituents being selected from the group consisting of lower
alkyl having from 1 to 5 carbon atoms, halogen, nitro, methoxy,
ethoxy, benzyloxy, methylenedioxy, 2,2-dichlorocyclopropyl,
trifluoromethyl, methylsulfonyl, cyano and phenoxy.
[0037] Examples of substituted or unsubstituted aromatic nitrogen
containing heteroaryl functional groups suitable as component B
include 4-methylquinolyl, 8-ethyl-4-methylquinolyl and those
structures having the following formula III: 4
[0038] wherein n is 0 or 1, and R.sub.1 and R.sub.2 may be the same
or different and are H, halogen, lower alkyl having from 1 to 4
carbon atoms, hydroxy, or nitro.
[0039] Compounds of the invention may have at least one
asymmetrical carbon atom and therefore all isomers, including
diastereomers and rotational isomers are contemplated as being part
of this invention. The invention includes (+)- and (-)-isomers in
both pure form and in admixture, including racemic mixtures.
Isomers can be prepared using conventional techniques, either by
reacting optically pure or optically enriched starting materials or
by separating isomers of a compound of formula I. Those skilled in
the art will appreciate that for some compounds of formula I, one
isomer may show greater pharmacological activity than other
isomers.
[0040] Compounds of formula I can exist in unsolvated and solvated
forms, including hydrated forms. In general, the solvated forms,
with pharmaceutically acceptable solvents such as water, ethanol
and the like, are equivalent to the unsolvated forms for purposes
of this invention.
[0041] Compounds of the invention with a basic group can form
pharmaceutically acceptable salts with organic and inorganic acids.
Examples of suitable acids for salt formation are hydrochloric,
sulfuric, phosphoric, acetic, citric, oxalic, malonic, salicylic,
malic, fumaric, succinic, ascorbic, maleic, methanesulfonic and
other mineral and carboxylic acids well known to those in the art.
The salt is prepared by contacting the free base form with a
sufficient amount of the desired acid to produce a salt. The free
base form may be regenerated by treating the salt with a suitable
dilute aqueous base solution such as dilute aqueous sodium
bicarbonate. The free base form differs from its respective salt
form somewhat in certain physical properties, such as solubility in
polar solvents, but the salt is otherwise equivalent to its
respective free base forms for purposes of the invention.
[0042] Certain compounds of the invention are acidic (e.g.,
compounds containing a carboxyl group). Acidic compounds according
to the present invention can form pharmaceutically acceptable salts
with inorganic and organic bases. Examples of such salts are the
sodium, potassium, calcium, aluminum, lithium, gold and silver
salts. Also included are salts formed with pharmaceutically
acceptable amines such as ammonia, alkyl amines,
hydroxyalkylamines, N-methylglucamine, and the like.
[0043] By way of non-limiting example, Table I below sets forth a
number of antiretroviral compounds of the above formula I useful
herein. The compounds of Table I are linked by the linkage group
"L" at the substituted alkyl of "A" and the number 2 carbon of the
heteroaryl functional group "B".
1TABLE 1 Compound No. A L B 1 1-(5-amino-2-methylphenyl)ethyl
2-sulfonyl Pyridine-N-oxide 3 1-(2,5-dimethylphenyl)methyl
2-sulfinyl Pyridine-N-oxide 4 Phenylmethyl 2-thio Pyridine-N-oxide
5 Phenylmethyl 2-sulfinyl Pyridine-N-oxide 6 Phenylmethyl
2-sulfonyl Pyridine-N-oxide 7 1-(2,5-dimethylphenyl)octyl
2-sulfonyl pyridine-N-oxide 8 2-methyl-thiopheneyl 2-sulfonyl
pyridine-N-oxide 9 1-(2,5-dimethylphenyl)ethyl 2-sulfonyl
pyridine-N-oxide 10 1-(2,5-dimethylphenyl)methyl 2-sulfonyl
pyridine-N-oxide 11 1-(4-methylphenyl)methyl 2-sulfonyl
pyridine-N-oxide 12 1-(4-chlorophenyl)methyl 2-sulfonyl
pyridine-N-oxide 13 1-naphthylmethyl 2-sulfonyl pyridine-N-oxide 14
1-(4-nitrophenyl)methyl 2-sulfonyl pyridine-N-oxide 15
1-(2-chloropheny)lmethyl 2-sulfonyl pyridine-N-oxide 16
1-(2-methylphenyl)methyl 2-sulfonyl pyridine-N-oxide 17
1-(2,6-dichlorophenylmethyl 2-sulfonyl pyridine-N-oxide 18
1-(2,4-dichlorophenyl)methyl 2-sulfonyl pyridine-N-oxide 19
1-(4-methoxyphenyl)methyl 2-sulfonyl pyridine-N-oxide 20
1-(2-methoxy-5-nitrophenyl)methyl 2-sulfonyl pyridine-N-oxide 21
1-(2-chloro-4,5-dioxymethylenephenyl)methyl 2-sulfonyl
pyridine-N-oxide 22 1-(2-fluorophenyl)methyl 2-sulfonyl
pyridine-N-oxide 23 1-((4-methylsulfonyl-2'-pyridine-N- 2-sulfonyl
pyridine-N-oxide oxide)phenyl)methyl 24 1-(2-cyanophenyl)methyl
2-sulfonyl pyridine-N-oxide 25
1-[((2,5-dimethyl)-4-methylsulfonyl-2'-pyridin- e- 2-sulfonyl
pyridine-N-oxide N-oxide]phenyl)methyl 27 1-(3-methyphenyl)methyl
2-sulfonyl pyridine-N-oxide 28 1-(3-fluorophenyl)methyl 2-sulfonyl
pyridine-N-oxide 29 1-(4-fluorophenyl)methyl 2-sulfonyl
pyridine-N-oxide 30 1-(2-methoxy-5-methylphenyl)methyl 2-sulfonyl
pyridine-N-oxide 31 1-(2-bromo-5-methoxyphenyl)methyl 2-sulfonyl
pyridine-N-oxide 32 1-(2,3,4,5,6-pentachlorophenyl)methyl
2-sulfonyl pyridine-N-oxide 33 1-(2,3,6-trichlorophenyl)methyl
2-sulfonyl pyridine-N-oxide 34 1-(4-cyanophenyl)methyl 2-sulfonyl
pyridine-N-oxide 35 1-(2,5-bis-1'-methylethylphenyl)methyl
2-sulfonyl pyridine-N-oxide 37 1-(3,4-dichlorophenyl)methyl
2-sulfonyl pyridine-N-oxide 38 1-(3-bromophenyl)methyl 2-sulfonyl
pyridine-N-oxide 39 1-(3,4-dioxymethylenephenyl)methyl 2-sulfonyl
pyridine-N-oxide 40 1-(4-(2'-methylbutyl)phenyl)methyl 2-sulfonyl
pyridine-N-oxide 41 1-(2,3,6-trimethylphenyl)methyl 2-sulfonyl
pyridine-N-oxide 42 1-(2-nitrophenyl)methyl 2-sulfonyl
pyridine-N-oxide 43 1-(2-methylnaphthyl)methyl 2-sulfonyl
pyridine-N-oxide 44 1-(2-iodophenyl)methyl 2-sulfonyl
pyridine-N-oxide 45 1-(4-(2'-2'-dichlorocyclopropyl)phenyl)methyl
2-sulfonyl pyridine-N-oxide 46 1-(3,4-dimethoxyphenyl)methyl
2-sulfonyl pyridine-N-oxide 47 1-(2,5-dimethoxyphenyl)methyl
2-sulfonyl pyridine-N-oxide 48 1-(2-ethoxyphenyl)methyl 2-sulfonyl
pyridine-N-oxide 49 1-(2,3,5,6-tetrachloro-4-methylphenyl)methyl
2-sulfonyl pyridine-N-oxide 50 1-(3,4,5-trimethoxyphenyl)methyl
2-sulfonyl pyridine-N-oxide 51 1-(9-anthryl)methyl 2-sulfonyl
pyridine-N-oxide 52 1-(2,4-dimethylphenyl)methyl 2-sulfonyl
pyridine-N-oxide 53 2-naphthylmethyl 2-sulfonyl pyridine-N-oxide 54
1-1'-biphenyl-4yl-methyl 2-sulfonyl pyridine-N-oxide 55
1-(4-(2'-methylpropyl)phenyl)methyl 2-sulfonyl pyridine-N-oxide 56
1-(2-phenoxyphenyl)methyl 2-sulfonyl pyridine-N-oxide 58
1-(4-(2'-methylethyl)phenyl)methyl 2-sulfonyl pyridine-N-oxide 59
1-(4-ethylphenyl)methyl 2-sulfonyl pyridine-N-oxide 60
ethyl-1-((4-carbonyl carbamate)phenyl)methyl 2-sulfonyl
pyridine-N-oxide 61 1-((3-methoxy-4- 2-sulfonyl pyridine-N-oxide
methoxyphenyl)phenyl)methyl 62 1-(2-nitro-5-methylphenyl)methyl
2-sulfonyl pyridine-N-oxide 63 1-(2,5-bis(1'-methylethyl)-4-
2-sulfonyl pyridine-N-oxide bromophenyl)methyl 64
1-(3-nitro-4-chlorophenyl)methyl 2-sulfonyl pyridine-N-oxide 65
1-(3,5-dinitrophenyl)methyl 2-sulfonyl pyridine-N-oxide 66
1-(3-methyl-4-nitrophenyl)methyl 2-sulfonyl pyridine-N-oxide 67
1-(3-nitro-4-methylphenyl)methyl 2-sulfonyl pyridine-N-oxide 69
1-(2-chloro-4-nitrophenyl)methyl 2-sulfonyl pyridine-N-oxide 70
1-(2,5-dimethylphenyl)methyl 2-sulfinyl 3-methylpyridine-N-oxide 71
1-(2,5-dimethylphenyl)ethyl 2-sulfonyl 3-methylpyridine-N-oxide 72
1-(2,5-dimethylphenyl)methyl 2-sulfonyl 6-methylpyridine-N-oxide 73
1-(2,5-dimethylphenyl)chloromethyl 2-sulfonyl
6-methylpyridine-N-oxid- e 74 1-(2,5-dimethylphenyl)chloromethyl
2-sulfonyl 4-methylpyridine-N-oxide 76 1-(2,5-dimethylphenyl)ethyl
2-sulfonyl 6-chloropyridine-N-oxide 77 1-(2,5-dimethylphenyl)methyl
2-sulfonyl 6-chloropyridine-N-oxide 78 1-(2,4-dimethylphenyl)ethyl
2-sulfonyl 3-methylpyridine-N-oxide 79 1-(2,5-dimethylphenyl)propy-
l 2-sulfonyl 3-methylpyridine-N-oxide 80 Phenylmethyl 2-sulfonyl
3-methylpyridine-N-oxide 81 1-(2,5-dimethylphenyl)ethyl 2-sulfonyl
4,6-dimethylpyridine-N-oxide 82 1-(2-methylphenyl)methyl 2-sulfonyl
3-methylpyridine-N-oxide 83 1-(2,4-dimethylphenyl)methy- l
2-sulfonyl 3-methylpyridine-N-oxide 85 1-(3-trifluromethylphenyl)-
methyl 2-sulfinyl pyridine-N-oxide 86 1-(4-methoxyphenyl)methyl
2-sulfinyl pyridine-N-oxide 88 1-(2,4,6-trimethylphenyl)methyl
2-sulfinyl pyridine-N-oxide 89 1-(3,4-dimethylphenyl)methyl
2-sulfinyl pyridine-N-oxide 90 1-(2-methylphenyl)methyl 2-sulfinyl
pyridine-N-oxide 91 1-(4-methylphenyl)methyl 2-sulfinyl
pyridine-N-oxide 92 1-(4-fluorophenyl)methyl 2-sulfinyl
pyridine-N-oxide 93 1-(2-methoxy-5-methylphenyl)methyl 2-thio
pyridine-N-oxide 94 1-(2,5-dimethylphenyl)methyl 2-sulfonyl
5-chloropyridine-N-oxide 95 1-(2,5-bis-2'-methylethylphenyl)methyl
2-sulfinyl pyridine-N-oxide 96 1-(3,4-dioxymethylenephenyl)methyl
2-sulfinyl pyridine-N-oxide 97 1-(2,3,6-trimethylphenyl)methyl
2-sulfinyl pyridine-N-oxide 98 1-(3,4-dimethoxyphenyl)methyl
2-sulfinyl pyridine-N-oxide 102 1-phenylethyl 2-sulfinyl
pyridine-N-oxide 103 1-(2,5-dimethylphenyl)ethyl 2-sulfinyl
pyridine-N-oxide 104 1-(2-methylphenyl)ethyl 2-sulfonyl
pyridine-N-oxide 105 1-chloromethylphenyl 2-sulfonyl
pyridine-N-oxide 106 1-(2,5-dimethylphenyl)chloromethyl 2-sulfonyl
pyridine 107 1-phenylethyl 2-sulfonyl 8-ethyl-4-methylquinolyl 108
1-(2,5-dimethylphenyl)ethyl 2-sulfonyl 4-methylpyridine-N-oxide 110
1-(2,5-dimethylphenyl)ethyl 2-sulfonyl 5-methylpyridine-N-oxide 114
1-chloromethylphenyl 2-sulfonyl 5-chloropyridine-N-oxide 115
1-phenylethyl 2-sulfonyl 3-methylpyridine-N-oxide 117
1-(2-chlorophenyl)methyl 2-sulfonyl 3-methylpyridine-N-oxide 118
1-(2-methyl-4-nitrophenyl)methyl 2-sulfonyl
3-methylpyridine-N-oxide 120 1-(2-chlorophenyl)ethyl 2-sulfonyl
3-methylpyridine-N-oxide 121
3-methyl-(1-2-methyl-3-nitrophenyl)ethyl 2-sulfonyl
3-methylpyridine-N-oxide 123 1-(2,5-dimethylphenyl)methoxyethyl
2-sulfonyl pyridine 124 1-(2,5-dimethylphenyl)ethyl 2-sulfonyl
3-chloropyridine-N-oxide 125 1-(2,5-dimethylphenyl)chloromethyl
2-sulfonyl 3-chloropyridine-N-oxide 128 1-(4-chlorophenyl)methyl
2-sulfinyl 4-methylpyridine-N-oxide 129 1-(4-chlorophenyl)methyl
2-sulfonyl 4-methylpyridine-N-oxide 132 Phenylmethyl 2-thio
3-chloropyridine-N-oxide 133 1-(2,5-dimethylphenyl)methyl 2-thio
3-chloropyridine-N-oxide 134 1-(4-methoxyphenyl)methyl 2-thio
4-(2'-methylpropyl)pyridine-N- oxide 135 1-(4-methoxyphenyl)methyl
2-sulfonyl 4-(2'-methylpropyl)pyridine-N- oxide 136 Phenylmethyl
2-sulfinyl 3-chloropyridine-N-oxide 137
1-(2,6-dichlorophenyl)methyl 2-thio 3-methylpyridine-N-oxide 138
1-(2,6-dichlorophenyl)methyl 2-sulfinyl 3-methylpyridine-N-oxide
139 1-(2,6-dichlorophenyl)methyl 2-sulfonyl
3-methylpyridine-N-oxide 140 Phenylmethyl 2-thio 3-hydroxypyridine
142 1-(3-methylphenyl)methyl 2-thio N-methylpyridine hydrochloride
143 Phenylmethyl 2-sulfonyl pyridine 146 Phenylmethyl 2-thio
3-nitropyridine-N-oxide 148 1-(2,5-dimethylphenyl)methyl 2-thio
pyridine 149 Phenylmethyl 2-thio 6-chloropyridine-N-oxide 150
1-(2,5-dimethylphenyl)methyl 2-sulfonyl pyridine 151 Phenylmethyl
2-thio 5-chloropyridine-N-oxide 153 1-(2,5-dimethylphenyl)methyl
2-sulfinyl 5-chloropyridine-N-oxide 156 2-methyl-N-methylpiperidyl
2-thio pyridine-N-oxide 157 1-(2,5-dimethylphenyl)methyl 2-thio
pyridine hydrochloride 158 1-phenyl-b-cyanoethylene 2-thio
pyridine-N-oxide 159 1-(4-methoxyphenyl)-b-cyanoethylene 2-thio
pyridine-N-oxide 160 1-(3,4,5-trimethoxyphenyl)-b-cyanoethylene
2-thio pyridine-N-oxide 161 1-(2,5-dimethylphenyl)ethyl 2-sulfonyl
pyridine 162 1-(2,5-dimethylphenyl)ethyl 2-thio 4-methylquinolyl
163 1-(2,5-dimethylphenyl)ethyl 2-sulfinyl pyridine 164 1-(2,5
dimethyl phenyl)methyl 2-thio 3-methylpyridine-N-oxide 165 1-(2,5
dimethyl phenyl)methyl 2-sulfonyl 3-methylpyridine-N-oxide
[0044] Compounds of formula I such as those listed above may be
prepared by a variety of methods known to those skilled in the art.
For example, U.S. Pat. Nos. 3,960,542, 4,019,893, 4,050,921, and
4,294,970 the contents of each being incorporated herein by
reference describe methods of preparing 2-thio-, 2-sulfinyl-,
and/or 2-sulfonyl-pyridine N-derivatives. The parent 2-thiopyridine
N-oxides may be prepared, e.g., by two procedures: (1) the reaction
of 2-chloropyridine N-oxide with the appropriate mercaptan in the
presence of an acid acceptor such as an alkaline earth hydroxide;
(2) reaction of the sodium salt of 2-mercaptopyridine N-oxide with
a suitable halide preferably of, but not limited to, the benzyl
type. The yields of the two procedures are comparable.
[0045] An alternate and useful synthetic route involves the
oxidation of an arylalkylthiopyridine prepared by methods well
known to those skilled in the art. The oxidation involves the
conversion of both the sulfur and nitrogen to their higher
oxidative states in a single preparative step. In this case the
products are sulfones as the sequence of oxidation proceeds from
sulfide.fwdarw.sulfoxide.fwdarw.sulfone.fwdarw.sulfone N-oxide. The
oxidant most generally employed, but not limited to, is 30-50%
hydrogen peroxide in glacial acetic acid. In excess of three
equivalents of peroxide is necessary.
[0046] The conversion of the
aryl(heteroaryl)alkylthiopyridine-N-oxide to analogous sulfinyl or
sulfonyl compound may be accomplished by employing one or two
equivalents of an oxidizing agent selected from, but not
necessarily limited to, hydrogen peroxide, peracetic acid, and the
aromatic peroxy acids. The ratio of peroxide to substrate varies
with the desired product.
[0047] The solvents employed may vary with the oxidant as described
in the literature (Katritsky and Lagowski, Chemistry of the
Heterocyclic N-Oxides, Academic Press, 1971). Glacial acetic acid
and water are preferred when hydrogen peroxide is used and a
nonpolar solvent such as chloroform is preferred for use with the
aromatic peroxy acids. When water is employed as a solvent, a
catalyst of the nature of a tungsten, vanadium, zirconium or
molybdenum salt (U.S. Pat. Nos. 3,005,852, 3,006,962, and 3,006,963
and British Pat. No. 1,335,626; the contents of each being
incorporated by reference herein) is generally used. Temperature
and time are a function of the sulfide employed with the range
varying from about 50.degree. C. to reflux in the case of water and
acetic acid to about 0.degree. to about 60.degree. C. with
chloroform.
[0048] The synthesis of 2-(alpha-aryl-alpha-chloromethyl sulfonyl)
pyridine-N-oxides is also known and described in U.S. Pat. No.
4,360,677 the contents of which are incorporated by reference
herein. The types of starting materials generally employed in the
preparation of these compounds are known to those skilled in the
art. For example, these parent 2-aryl
methylsulfonylpyridine-N-oxides may be prepared by methods
described in U.S. Pat. No. 3,960,542. Their subsequent conversion
to (alphachloromethylsulfonyl)pyridine-N-oxides may be carried out
using a modification of a known procedure. (C. Y. Meyers, et al.,
J. Org. Chem., 91,7510 (1969); C. Y. Meyers, et al., Tetrahedron
Lett., 1105 (1974); the contents of each being incorporated by
reference herein.) The solvent, N,N-dimethylformamide, is used
without drying. Sodium hydroxide (97-98%) is freshly ground to a
powder before use, care being taken to avoid prolonged exposure to
moisture. Temperature may generally be maintained from about
-5.degree. to about +5.degree. C., with reaction times between
about 25 and about 35 min.
[0049] The synthesis of substituted pyridine N-oxide compounds is
described, e.g., in U.S. Pat. No. 4,394,155 and foreign patent
publication EP 36388, the contents of each being incorporated by
reference herein. The substituted pyridine N-oxide compounds are
generally prepared, e.g., by first preparing the appropriate thio
compound. An essentially equimolar amount of an alkali metal
alkoxide is added with stirring at room temperature under an
atmosphere of nitrogen to the substituted or non-substituted
benzylmercaptan dissolved in a suitable solvent (such as a C.sub.1
to C.sub.4 aliphatic alcohol, preferably methanol). The resulting
solution is added slowly to a solution of a substituted pyridine
N-oxide hydrochloride, which has been treated with an essentially
equimolar amount of alkali metal alkoxide. The molar ratio of
mercaptide anion to pyridine N-oxide is maintained at about 1, and
stirring, nitrogen atmosphere and reaction at room temperature are
also maintained throughout the complete reaction. After all the
reactants have been combined, the reaction mixture is refluxed from
about one to about six hours. The thio product which precipitates
when the reaction mixture is poured into a large excess of ice
water is filtered, washed several times with water, air dried and
recrystallized from an alcohol such as wet ethanol.
[0050] The thio compound may be oxidized to the desired sulfinyl or
sulfonyl compound by known means, e.g. the thio compound dissolved
in excess chloroform is stirred into a chloroform solution of
m-chloroperbenzoic acid at about -10.degree. C. to about 10.degree.
C. The reaction stoppered and kept at about 0.degree. C. for about
24 hr. The by-product, m-chlorobenzoic acid, is removed by
filtration and the remaining chloroform solution washed thoroughly
with aqueous sodium bicarbonate solution, then water. The
chloroform solution is dried (e.g. with anhydrous magnesium
sulfate) and the solvent evaporated. The final product may be
recrystallized from a suitable solvent (e.g. lower alcohol).
[0051] The following Table 2 identifies certain compounds useful in
the practice of the invention herein that have been described
previously. All patents listed in Table 2 are incorporated herein
by reference. All the patents listed below are U.S. Patents with
the exception of EP 36638 and Japanese Patent 57181059.
2TABLE 2 Compound No. Described in Patent No. See 3 3960542 Example
29 4 4050921 Example 2 5 4050921 Example 61 6 4050921 Example 4 7
4294970 Example III 8 4050921 Example 188 9 3960542 Example 6 10
3960542 Example 1 11 4050921 Example 7 12 4050921 Example 8 13
3960542 Example 21 14 4050921 Example 15 15 3960542 Example 22 16
3960542 Example 11 17 3960542 Example 14 18 3960542 Example 34 19
4019893 Example 35 20 3960542 Example 25 21 3960542 Example 26 22
3960542 Example 27 24 4050921 Example 54 27 4050921 Example 64 28
4050921 Example 71 29 4050921 Example 73 30 3960542 Example 35 31
3960542 Example 36 32 3960542 Example 37 33 3960542 Example 15 34
4019893 Example 72 35 4019893 Example 74 37 3960542 Example 42 38
4050921 Example 124 39 3960542 Example 46 41 3960542 Example 18 42
3960542 Example 48 43 3960542 Example 50 44 3960542 Example 52 45
4050921 Example 149 46 3960542 Example 58 47 3960542 Example 60 48
4050921 Example 163 49 4050921 Example 171 50 4050921 Example 184
52 4360677 Starting material for Ex. 14 53 3960542 Example 7 54
4360677 Reactant in example 4 55 4360677 Starting material for Ex.
27 56 4360677 Starting material for Ex. 31 58 4360677 Starting
material for Ex. 34 59 4360677 Starting material for Ex. 35 70
4394155 Example 3 71 4394155 Example 4 72 EP36638 Example 14 74
4394155 Example 19 78 4394155 Example 13 79 4394155 Example 28 80
4394155 Example 21 82 4394155 Example 24 83 4394155 Example 12 85
4050921 Example 59 86 4050921 Example 60 88 3960542 Example 30 89
3960542 Example 32 90 3960542 Example 33 91 4050921 Example 70 92
4050921 Example 72 93 3960542 Precursor of compound in 4120692 Ex.
88 94 4394155 Example 25
[0052] The present invention also relates to a pharmaceutical
composition comprising a compound of formula I of this invention
and a pharmaceutically acceptable carrier. The compounds of formula
I can be administered in any conventional dosage form known to
those skilled in the art. Pharmaceutical compositions containing
the compounds of formula I can be prepared using conventional
pharmaceutically acceptable excipients and additives and
conventional techniques. Such pharmaceutically acceptable
excipients and additives include non-toxic compatible fillers,
binders, disintegrants, buffers, preservatives, anti-oxidants,
lubricants, flavorings, thickeners, coloring agents, emulsifiers
and the like. All routes of administration are contemplated
including, but not limited to, parenteral, transdermal,
subcutaneous, intramuscular, nasal, sublingual, transmucosal,
inhalation, rectal and topical.
[0053] Thus, appropriate unit forms of administration include oral
forms such as tablets, capsules, powders, cachets, granules and
solutions or suspensions, sublingual and buccal forms of
administration, aerosols, implants, subcutaneous, intramuscular,
intravenous, intranasal, intraoccular or rectal forms of
administration.
[0054] When a solid composition is prepared in the form of tablets,
e.g., a wetting agent such as sodium lauryl sulfate can be added to
micronized or non-micronized compounds of formula I and mixed with
a pharmaceutical vehicle such as silica, gelatine starch, lactose,
magnesium stearate, talc, gum arabic or the like. The tablets can
be coated with sucrose, various polymers, or other appropriate
substances. Tablets can be treated so as to have a prolonged or
delayed activity and so as to release a predetermined amount of
active compound continuously or at predetermined intervals, e.g.,
by using ionic resins and the like.
[0055] A preparation in the form of gelatin capsules may be
obtained, e.g., by mixing the active principle with a diluent, such
as a glycol or a glycerol ester, and incorporating the resulting
mixture into soft or hard gelatin capsules.
[0056] A preparation in the form of a syrup or elixir can contain
the active principle together, e.g., with a sweetener,
methylparaben and propylparaben as antiseptics, flavoring agents
and an appropriate color.
[0057] Water-dispersible powders or granules can contain the active
principle mixed, e.g., with dispersants, wetting agents or
suspending agents, such as polyvinylpyrrolidone, as well as with
sweeteners and/or other flavoring agents.
[0058] Rectal administration may be provided by using suppositories
which may be prepared, e.g., with binders melting at the rectal
temperature, for example cocoa butter or polyethylene glycols.
[0059] Parenteral, intranasal or intraocular administration may be
provided by using, e.g., aqueous suspensions, isotonic saline
solutions or sterile and injectable solutions containing
pharmacologically compatible dispersants and/or solubilizers, for
example, propylene glycol or polyethylene glycol.
[0060] Thus, to prepare an aqueous solution for intravenous
injection, it is possible to use a co-solvent, e.g., an alcohol
such as ethanol, or a glycol such as polyethylene glycol or
propylene glycol, and a hydrophilic surfactant such as Tween.RTM.
80. An oily solution injectable intramuscularly can be prepared,
e.g., by solubilizing the active principle with a triglyceride or a
glycerol ester.
[0061] Topical administration can be provided by using, e.g.,
creams, ointments or gels.
[0062] Transdermal administration can be provided by using patches
in the form of a multilaminate, or with a reservoir, containing the
active principle and an appropriate solvent.
[0063] Administration by inhalation can be provided by using, e.g.,
an aerosol containing sorbitan trioleate or oleic acid, for
example, together with trichlorofluoromethane,
dichlorofluoromethane, dichlorotetrafluoroethane or any other
biologically compatible propellant gas; it is also possible to use
a system containing the active principle, by itself or associated
with an excipient, in powder form.
[0064] The active principle can also be formulated as microcapsules
or microspheres, e.g., liposomes, optionally with one or more
carriers or additives.
[0065] Implants are among the prolonged release forms which can be
used in the case of chronic treatments. They can be prepared in the
form of an oily suspension or in the form of a suspension of
microspheres in an isotonic medium.
[0066] The daily dose of a compound of formula I for treatment of a
disease or condition cited above is typically about 0.001 to about
100 mg/kg of body weight per day, preferably about 0.001 to about
10 mg/kg. For an average body weight of 70 kg, the dosage level may
therefore range from about 0.1 to about 700 mg of drug per day,
given in a single dose or 2-4 divided doses. It is contemplated
that any range of the aforementioned doses may be administered at
intervals greater than daily, e.g., one to four times per week over
a period of several weeks or for greater periods. The exact dose,
however, is determined by the attending clinician and is dependent
on the potency of the compound administered, the age, weight,
condition and response of the patient.
[0067] The therapeutically effective amount of the compounds of
this invention that can be combined with the pharmacologically
acceptable carrier to produce a single dosage form will vary
depending upon the age and condition of the host treated and the
particular mode of administration. In general, the compounds of
this invention are most desirably administered at a concentration
level that will generally afford antiretrovirally effective results
without causing any medically unaccceptable harmful or deleterious
side effects.
[0068] While the compounds of this invention can be administered as
the sole active pharmaceutical agents, the compounds can also be
used in combination with one or more other pharmaceutical agents
which are not deleterious to the activity of the compounds of this
invention or whose combination with the compounds will not have a
deleterious effect on the host treated. Indeed, it is also
contemplated that compounds of this invention may be combined with
other antiviral agents or other agents useful in the treatment of
conditions resulting from viral infection.
[0069] The following examples are provided to illustrate synthesis
of certain compounds according to the present invention. These
examples are included for purposes of illustration and are not
intended to limit the invention herein in any way whatsoever.
EXAMPLE 1
Preparation of 2-[1-(2,5-Dimethylphenyl)octyl sulfonyl] pyridine
N-oxide (Compound 7)
[0070] To a solution of 34.3 gm (0.1 mol) 2-[1-(2,5-dimethylphenyl)
octylthio] pyridine N-oxide and 10.7 gm (0.26 mol) acetonitrile in
400 ml of methanol was added sufficient NaOH solution (6 N to
minimize water) to adjust the pH in the operating range of 9.0 to
9.5 (true), approximately 11-12 (meter). 17 gm (0.26 mol) of 50%
hydrogen peroxide was added in increments.
[0071] The reaction mixture was stirred in excess of 4 hours after
peroxide addition. Quenching, filtering and washing yielded 27 gm
of product melting at 134-136.degree. C.
EXAMPLE 2
Preparation of 2-(1-[2,5-Dimethylphenyl]ethylsulfonyl)pyridine
N-oxide (Compound 9)
[0072] The intermediate
2-(1-[2,5-dimethylphenyl]-ethylthio)pyridine N-oxide is prepared
from 1-(2,5-dimethylphenyl)ethyl chloride and 2-mercaptopyridine
N-oxide, sodium salt by the procedure described in U.S. Pat. No.
3,960,542, Example 2. Melting point 118-120.degree. C. Structure
confirmed by IR and NMR.
[0073] The thio compound (0.05 mole) is oxidized with MCPBA (0.1
mole) and isolated in the manner described in U.S. Pat. No.
3,960,542, Example 2. Yield 83% theory. Melting point
160.degree.-163.degree. C. (IR NO 1275 cm.sup.-1, SO.sub.2 1315,
1145 cm.sup.-1).
EXAMPLE 3
Preparation of 2-(2,5-Dimethylphenylmethylsulfonyl) pyridine
N-oxide (Compound 10)
[0074] To a stirred solution of 792 gms (2.2 mole) (40% aqueous
solution) 2-mercaptopyridine N-oxide, sodium salt in 1400 ml of
ethanol is added 344 gms (2.2 mole) 2,5-dimethylbenzylchloride over
a period of 15 minutes. The mixture is brought to reflux for 15
minutes, filtered hot, and treated with 5 liters of cold water. The
product is filtered off and oven dried to 533 gms of
2-(2,5-dimethylphenylmethylthio)pyridine N-oxide. Yield 97%.
Melting point 140-142.degree. C.
[0075] To a vigorously stirred solution of 74 gms (0.3 mole) of the
thio compound in 250 ml of glacial acetic acid at
45.degree.-50.degree. C. is added 75 ml of 30% hydrogen peroxide
over a period of 15 minutes. The temperature is raised to
70.degree. C. and after 30 minutes increased again to
80.degree.-90.degree. and held for 3 hours. The reaction mixture is
lowered to ambient temperature and added slowly to two to three
times its volume of vigorously agitated cold water. The pale yellow
solid separates and is filtered off. Recrystallization from ethanol
yields 74.5 gms of fine crystals melting at 156-158.degree. C. (IR
NO 1275 cm.sup.-1, SO.sub.21140, 1315 cm.sup.-1). Yield 89%
theory.
[0076] Analysis: Calc. For C.sub.15NO.sub.3S. C, 60.63; H, 5.45; N,
5.05; S, 11.54. Found: C, 60.66; H, 5.56; N, 5.18; S, 11.81.
[0077] To a heated (80.degree.-90.degree. C.) vigorously stirred
slurry of 30 gms (0.12 mole of thio compound in 150 ml of water
containing 10 gms of acetic acid and 0.2 gms of sodium tungstate
dihydrate is slowly added 26 ml of 30% hydrogen peroxide. The
addition is exothermic and the temperature is maintained at
80.degree.-90.degree. C. for the first 14 ml then allowing it to
rise to the 95.degree.-105.degree. C. range for the remaining 12
ml.
[0078] The initial slurry becomes quite thin at the sulfoxide stage
and again separating at the sulfone stage. Overall reaction time is
about one hour. The reaction mixture is filtered, washed with water
and air dried. Melting point (m.p.) 156.degree.-158.degree. C.
Mixed m.p. with authentic sample shows no depression. Yield 32.8
gms (quantitative).
EXAMPLE 4
Preparation of 2-(2-Methylphenylmethylsulfonyl)-pyridine N-oxide
(Compound 16)
[0079] The intermediate 2-(2-methylphenylmethylthio)-pyridine
N-oxide is prepared by the procedure described in U.S. Pat. No.
3,960,542, Example 2 from .alpha.-chloro o-xylene and
2-mercaptopyridine N-oxide sodium salt. Melting point
134.degree.-136.degree. C. Yield 85% theory. Structure confirmed by
IR and NMR.
[0080] A slurry of 14 gms (0.06 mole) thio compound, 100 ml water,
0.5 gms sodium tungstate dihydrate, and 4 ml of glacial acetic acid
is heated to 75.degree. C. Twelve ml hydrogen peroxide (30%) (0.12
mole) is added portionwise and with only a slight exotherm until 6
ml is consumed. The remaining 6 ml is added at steam bath
temperature in three 2 ml portions at a rate controlled by testing
the mixture with potassium iodide-starch paper to assure
consumption of the previous peroxide. The final temperature was
97.degree. C. after one hour. Cool, filter and wash cake with water
and a small amount of cold ethanol. After drying the product 15.4
gms (99% theory) is obtained. Melting point
159.degree.-160.5.degree- . C. Structure confirmed by IR.
[0081] Analysis: Calc. For C.sub.13H.sub.13NO.sub.3S. C, 59.31; H,
4.98; N, 5.32. Found C, 59.30; H, 5.21; N, 5.31.
EXAMPLE 5
Preparation of 2-(2,6-Dichlorophenylmethylsulfonyl)pyridine N-oxide
(Compound 17)
[0082] A mixture of 37 gms (0.1 mole) of (40% solution)
2-mercaptopyridine N-oxide, sodium salt and 19.5 gms (0.1 mole)
2,6-dichlorobenzylchloride in 200 ml ethanol is warmed to
65.degree. C. for thirty minutes, cooled and filtered. The filter
cake is washed thoroughly with water and finally with 40 ml of
acetone. Vacuum drying of the cake yields 25.3 gms (92% theory) of
product, 2-(2,6-dichlorophenylmethylthio) pyridine N-oxide. Melting
point 240.degree.-241.degree. C. Structure confirmed by IR.
[0083] A slurry of 29 gms (0.1 mole) of the thio compound in 300 ml
of chloroform at 10.degree. C. is treated slowly with 40 gms (0.2
mole) MCPBA (85%) in 450 ml of chloroform. The mixture is permitted
to rise to ambient temperature resulting in a clear solution that
is held sixteen hours. The solution is washed with saturated sodium
bicarbonate solution, dried over magnesium sulfate and evaporated
to dryness. The residue is slurried in 400 ml of boiling methanol,
cooled and filtered to yield 28 gms (89% theory) of product.
Melting point 214.degree.-215.degree. C.
[0084] Analysis: Calc. For C.sub.12H.sub.9Cl.sub.2NO.sub.3S. C,
45.32; H, 2.83; N, 4.40. Found C, 45.67; H, 2.89; N, 4.55.
EXAMPLE 6
Preparation of
2-[2,5-Dimethylphenyl)methylsulfinyl]-3-methylpyridine N-oxide
(Compound 70)
[0085] The thio compound described in U.S. Pat. No. 4,394,155,
Example 2 (0.03 mol) is oxidized with MCPBA (0.03 mol) in 100 mL
chloroform. After 24 hours at room temperature the chloroform
solution is treated as described in U.S. Pat. No. 4,394,155,
Example 1, yielding 5.5 g (66.6% yield) of a white solid m.p.
143.degree.-145.degree. C. from ethyl acetate. I.R. NO 1230
cm.sup.-1, SO 1055 cm.sup.-1.
3 Elemental analysis: C.sub.15H.sub.17NO.sub.2S C H N S Calculated:
65.42 6.22 5.09 11.62 Found: 65.32 6.13 5.08 11.94
EXAMPLE 7
Preparation of
2-[1-(2,5-Dimethylphenyl)ethylsulfonyl]-3-methylpyridine N-oxide
(Compound 71)
[0086] To a stirred suspension of 3 g (0.01 mol) of sulfone
(described in U.S. Pat. No. 4,394,155, Example 2) in 15 mL of dry
dimethylformamide cooled in an ice bath, is added 0.5 g sodium
hydroxide powder. To this mixture is slowly added 0.75 mL methyl
iodide. The reaction mixture is warmed to room temperature and
stirred for 2 hours. 100 mL ice-water is slowly added with
stirring. After filtration the white solid is recrystallized from
toluene. Melting point: 146.degree.-147.degree. C. Structure
confirmed by NMR. I.R. NO 1250 cm.sup.-1, SO.sub.2 1350,1140
cm.sup.-1.
EXAMPLE 8
Preparation of 2-(2,3,6-Trimethylphenylmethylsulfinyl)pyridine
N-oxide (Compound 97)
[0087] The intermediate 2-(2,3,6-trimethylphenylmethylthio)pyridine
N-oxide is prepared from .alpha.-2-bromoprehnitene with
2-mercaptopyridine N-oxide, sodium salt by a procedure similar to
that described in U.S. Pat. No. 3,960,542, Example 2 for the
preparation of the 2,4,6-trimethylphenyl isomer. Yield 50% theory.
Melting point 108.degree.-110.degree. C. Structure confirmed by IR
and NMR.
[0088] The thio compound (0.03 mole) is oxidized with MCPBA (0.03
mole) and isolated in the manner described in U.S. Pat. No.
3,960,542, Example 2. Yield 50% theory. Melting point
72.degree.-75.degree. C. (IR N.fwdarw.O 1250 cm.sup.-1, SO 1050
cm.sup.-1).
EXAMPLE 9
Preparation of 2-(1-Phenylethylsulfinyl)pyridine N-oxide (Compound
102)
[0089] To a mixture of 23.2 g (0.1 mole) of
2-(1-phenylethylthio)pyridine N-oxide, 0.2 g of sodium tungstate,
and 60 ml of glacial acetic acid were added 10 ml (0.1 mole) of 30%
hydrogen peroxide over approximately 0.5 hours. The mixture
exothermed somewhat to about 65.degree. C. After completion of the
reaction, the reaction mixture was poured slowly into 800 ml of
vigorously stirred cold water. A solid separated out and was
filtered off and washed with 15 ml of cold ethanol. The solid was
air dried, melting point 130-130.5.degree. C. Yield 14.5 g or 59%.
An infrared spectrum confirmed the structure.
EXAMPLE 10
Preparation of 2-(alpha-phenyl-alpha-chloromethylsulfonyl)
pyridine-N-oxide (Compound 105)
[0090] Carbon tetrachloride (3.1 g, 20 mmol) and freshly ground
sodium hydroxide (1.0 g, 25 mmol) were placed in 25 ml of
dimethylformamide. The mixture was cooled to 0.degree. C. using an
acetone-ice bath and while vigorously stirring,
2-(phenylmethylsulfonyl) pyridine-N-oxide (5.00 g, 20 mmol) was
added in one portion. After 20 min, the mixture was poured into 300
ml of well-stirred water, resulting in a suspension of light tan
precipitate.
[0091] The precipitate was filtered off, washed with excess water
and air-dried to give 4.9 g of crude product (via NMR, 86% yield).
Recrystallization from ethanol afforded a tan solid, m.p.
149-150.degree. C. (decomposed).
[0092] Analysis: Calc. For C.sub.12H.sub.10ClNO.sub.3S: C: 50.79;
H: 3.53; N: 4.94. Found: C: 50.77;H: 3.53; N: 4.82.
EXAMPLE 11
Preparation of
2-((2,5-dimethylphenyl)chloromethylsulphonyl)pyridine (Compound
106)
[0093] A mixture of 2.0 g (0.0064 mole) of 2-[[2,5-dimethylphenyl]
chloromethylsulphonyl] pyridine-1-oxide (U.S. Pat. No. 4,360,677,
Example 2), 3.5 g (0.026 mole) of phosphorus trichloride, and 15 ml
of chloroform is refluxed for one-hour. Ethanol is then added to
destroy excess phosphorus trichloride. The solvents were evaporated
to give 2.6 g of crude product. One recrystallization of the crude
product from ethanol gave 1.5 g of pure material m.p.
117-119.degree. C. The material was identified as
2-((2,5-dimethylphenyl)chloromethylsulfonyl)pyridine by IR and NMR.
Calculated for C.sub.14H.sub.14ClNO.sub.2S: C:56.85, H:4.77, N:
4.74. Found: C:56.67; H:4.78; N:4.81.
EXAMPLE 12
Preparation of
2-[1-(2,5-Dimethylphenyl)ethylsulfonyl]-4-methylpyridine N-oxide
(Compound 108)
[0094] The intermediate
2-[1-(2,5-dimethylphenyl)ethylthio]-4-methylpyridi- ne N-oxide is
prepared from 2-(ethyl-1-thiol)-1,4-dimethylbenzene and
2-bromo-4-methylpyridine N-oxide hydrochloride by the procedure
described in U.S. Pat. No. 4,394,155, Example 1. m.p.
130.degree.-132.degree. C. Structure is confirmed by analysis and
I.R. Yield 98%.
[0095] The thio compound (0.07 mol) is oxidized in the manner
described in U.S. Pat. No. 4,394,155, Example 1. Yield 79%. Melting
point 204-205.degree. C. (I.R. NO 1240 cm.sup.-1, SO.sub.2 1140,
1370cm.sup.-1).
4 Elemental analysis: C.sub.16H.sub.19NO.sub.3S C H N S Calculated:
62.92 6.27 4.58 10.50 Found: 61.79 6.20 4.51 10.19
EXAMPLE 13
Preparation of
2-[1-(2,5-Dimethylphenyl)ethylsulfonyl]-5-methylpyridine N-oxide
(Compound 110)
[0096] Under a constant flow of nitrogen 3.32 g (0.02 mol)
2-(ethyl-1-thiol)-1,4-dimethylbenzene dissolved in 75 mL methanol
is treated with 4.8 g (0.022 mol) 25% sodium methoxide in 75 mL
methanol. To this stirred mixture is added 4.4 g (0.02 mol)
2-bromo-5-methylpyridine N-oxide hydrochloride which has previously
been treated with 4.8 g (0.022 mol) sodium methoxide (25% in
methanol). The reaction mixture is allowed to reflux for 1 hour,
cooled and poured into 200 mL ice water. The white product is
filtered off and air dried; yield 4.5 g (83%). Recrystallization
from ethanol produces 2-[1-(2,5-dimethylphenyl)ethylthi-
o]-5-methylpyridine N-oxide, m.p. 146.degree.-148.degree. C.
Structure is confirmed by analysis and I.R.
[0097] To a stirred solution of 2.85 g (0.01 mol) of the sulfide
compound in 50 mL chloroform at 5.degree.-10.degree. C. is added,
with stirring, 4.6 g (0.024 mol) MCPBA in 175 mL chloroform. Upon
completion of the addition, the reaction mixture is stirred at room
temperature for two days then washed thoroughly with 150 mL
saturated aqueous sodium bicarbonate, and dried over anhydrous
magnesium sulfate. Evaporation of the chloroform, and
crystallization of the solid residue from ethanol yields 2.6 g (82%
of theory) of product. m.p. 143.degree.-146.degree. C. (I.R. NO
1280 cm.sup.-1, SO.sub.2 1140, 1310 cm.sup.-1).
5 Elemental analysis: C.sub.16H.sub.19NO.sub.3S C H N S Calculated:
62.92 6.27 4.58 10.50 Found: 62.56 6.09 4.52 10.25
EXAMPLE 14
Preparation of 2-(Phenylchloromethylsulfonyl)-5-chloropyridine
N-oxide (Compound 114)
[0098] As described in U.S. Pat. No. 4,394,155, Example 1,
2-(phenylmethylthio)-5-chloropyridine N-oxide is prepared from
5-chloropyridine N-oxide and benzylmercaptan. To a well stirred
solution of 2.5 g (9.01 mol) of the thio compound in 25 mL
chloroform is added 4 g (0.02 mol) of MCPBA in 50 mL
chloroform.
[0099] The sulfone is dissolved in DMF (20 mL) containing 0.25 g
powdered sodium hydroxide and 1.5 g carbon tetrachloride at
0.degree. C. The mixture is maintained at 0.degree. C. for 20
minutes then poured in 200 mL water. The solid was filtered and
dried. The product (0.55 g) m.p. 178-179.degree. C. (decomposed) is
identified by I.R., NMR and mass spectographic analysis.
6 Elemental analysis: C.sub.12H.sub.11NO.sub.3ClS C H N Calculated:
45.30 2.85 4.40 Found: 44.08 2.87 4.39
EXAMPLE 15
Preparation of
3-Chloro-2-[[(2,5-dimethylphenyl)methyl]thio]pyridine 1-oxide
(Compound 133)
[0100] 5
[0101] 2,3-Dichloropyridine N-oxide (4.3 g, 0.026 mole) (prepared
according to U.S. Pat. No. 3,850,939) and sodium sulfide (3.4 g,
0.026 mole) were mixed with 25 mL of water then heated to
70.degree. C. for two hours. The resulting mixture was cooled to
room temperature and treated with 2,5-dimethylbenzyl chloride (4.3
g, 0.026 mole) drop wise. After the addition, the mixture was
heated to 70.degree. C. for four hours, then cooled in an ice bath.
The precipitated solid was filtered and washed with cold toluene
leaving 3.5 g of product. Recrystallization from toluene afforded
pure product of m.p. 77-80.degree. C. The compound was identified
by its NMR spectrum.
[0102] NMR data (CDC13): 2.3 (s, 6H); 4.5 (s, 2H); 7.1-8.0 (m, 6
H)
EXAMPLE 16
Preparation of
2-[(4-Methoxyphenyl)methylsulfonyl)]-4-(1,1-dimethylethyl)p-
yridine N-oxide (Compound 135)
[0103] Under nitrogen blanket 0.02 mol 4-methoxybenzylmercaptan is
dissolved in 50 mL methanol and is treated with 0.022 mol sodium
methoxide (25% in methanol). 2-Bromo-4-t-butylpyridine N-oxide
hydrochloride (0.022 mol, previously treated with 0.22 mol sodium
methoxide (25% in methanol)) is added with stirring. After ca. 1.5
hours at reflux, the reaction mixture is cooled and poured into 250
mL ice water.
[0104] After filtration, the product,
2-[(4-methoxyphenylmethylthio]-4-(1,- 1-dimethylethyl)pyridine
N-oxide, is recrystallized from ethanol. This product is converted
to the corresponding sulfonyl compound following essentially the
procedure of U.S. Pat. No. 4,394,155, Example 3.
EXAMPLE 17
Preparation of 2-[(Phenylmethyl)thio]-3-pyridinol (Compound
140)
[0105] To a mixture of 10.0 g of 2-mercapto-3-pyridinol, 11.0 g of
potassium carbonate and 100 mL of 2-butanone was added dropwise
with stirring, 13.3 g of benzyl bromide. After stirring at
22.degree. C. for two hours, the mixture was heated to reflux for
thirty minutes. The reaction mixture was concentrated under reduced
pressure, the residue treated with water, and the mixture brought
to pH 6 by the addition of acetic acid. The crude product was
filtered and recrystallized from toluene to give 11.1 g of the
title compound as a grey crystalline solid, mp 103-104.degree. C.
The structure of the product was confirmed by its .sup.1H nmr and
mass spectra.
EXAMPLE 18
Preparation of 2-((2,5-dimethylphenyl)methylthio) pyridine
(Compound 148)
[0106] 6
[0107] A mixture of 5.6 g (0.05 mole) of 2-mercaptopyridine, 3.3 g
(0.05 mole) of potassium hydroxide (85% pellets), 35 ml of ethanol
and 5 ml of water was prepared. To this mixture was added 7.8 g
(0.05 mole) of 2,5-dimethyl-benzylchloride, while maintaining good
stirring. The mixture was stirred and heated to 40.degree. C. for
45 minutes, cooled to room temperature, and then added to 150 ml of
water. The aqueous mixture was extracted with 150 ml of diethyl
ether; the ether phase washed with 150 ml of water. Finally, the
ether phase was dried with anhydrous sodium sulfate. Removal of the
ether left a green oil.
[0108] An infrared spectrum was consistent with the structure of
2-((2,5-dimethylphenyl)methylthio) pyridine.
EXAMPLE 19
Preparation of
2-(((4-(1,1-dimethyl)propyl)phenyl)methylsulfonyl)pyridine--
N-oxide (Compound 40)
[0109] 7
[0110] A mixture of 2.9 g (0.01 mole) of
2-(((4-(1,1dimethyl)propyl)phenyl- )-methylthio)pyridine-N-oxide
with 50 ml of chloroform and 80 ml of pH 7.5 phosphate buffer was
maintained at 40.degree. C. while 4 g (0.02 mole) of 85%
metachloroperbenzoic acid (MCPBA) dissolved in 50 ml of chloroform
was added. The mixture was stirred overnight, and the chloroform
phase was then separated, washed with sodium bicarbonate, decanted
and dried over anhydrous Na.sub.2SO.sub.4. The chloroform was
filtered from the Na.sub.2SO.sub.4 and evaporated to leave 2.5 g of
an oil which did not crystallize. An infrared spectrum was
consistent with the structure.
EXAMPLE 20
Preparation of 2 [1(9-anthryl)methylsulfonyl]pyridine-N-oxide
(Compound 51)
[0111] 8
[0112] A mixture of 14.27 g (0.045 mole) of
2[1(9-anthryl)methylthio]-pyri- dine-N-oxide in 250 ml of
chloroform was cooled to 10.degree. C. and stirred. Then, 18 g
(0.09 mole) of metachloroperbenzoic acid dissolved in 250 ml of
chloroform was added slowly, and the reaction mixture was allowed
to warm to room temperature and held at that temperature overnight.
The reaction mixture was washed with NaHCO.sub.3 solution in water,
the chloroform layer was separated, and then dried with anhydrous
sodium sulfate. The chloroform solution was filtered and the
solvent removed. The residue was recrystallized from ethanol to
give 10 g (66%) of a solid, melting point 213-215.degree. C.
Calculated for C.sub.20H.sub.15N.sub.3S: C=68.76; H=4.33; N=4.01.
Found: C=67.32; H=4.25; N=3.89.
EXAMPLE 21
Preparation of
2-[[(4-chloro-3-nitrophenyl)methyl]sulfonyl]-pyridine-1-oxi- de
(Compound 64)
[0113] 9
[0114] To a mixture of 14.0 g (0.0426 mole) of
2-[[(4-chloro-3-nitrophenyl- )methyl] sulfinyl]-pyridine-N-oxide in
35 ml of acetic acid was added 10.1 g of peracetic acid (40% in
acetic acid) dropwise over one hour. The temperature of the
reaction mixture rose to 27.degree. C before a water bath was
placed on the flask to hold the temperature at 25.degree. C. After
addition, the mixture was heated to 70.degree. C. for five hours.
The mixture was cooled, and 20 ml additional acetic acid and solid
sodium bisulfate and water were added to destroy the excess
peracetic acid. The aqueous mixture was neutralized with potassium
carbonate and chilled in an ice bath to precipitate an almost white
solid. The precipitate was filtered off, washed with water, dried
under vacuum overnight, and found to have a melting point of
162-164.degree. C. Infrared and NMR spectra were both consistent
with the proposed structure. The product was recrystallized from
ethanol to give needle-like white crystals, melting point
168-170.degree. C. C,H,N calculated for
C.sub.12H.sub.9ClN.sub.2O.s- ub.5S: C=43.85%; H=2.76%; N=8.52%.
Found: C=43.27%; H=2.65%; N=8.21%.
EXAMPLE 22
Preparation of
8-ethyl-4-methyl-2-[(1-phenylethyl)sulfonyl]-quinoline (Compound
107)
[0115] 10
[0116] To a mixture of 4.5 g of
8-ethyl-4-methyl-2-[(1-phenylethyl)thio]-q- uinoline in 40 ml of
acetic acid were added slowly 17.3 g of 40% peracetic acid in
acetic acid. The mixture was stirred for three hours in an ice
bath, brought to room temperature, and then stirred at room
temperature overnight. A white precipitate formed, which was
filtered off and recrystallized from ethanol, having a melting
point of 146.5-147.5.degree. C. Yield 2.7 g. NMR supported the
structure. C,H,N,S calculated for C.sub.22H.sub.25NO.sub.2S:
Theoretical: C=71.91; H=6.86; N=3.81; S=8.73; Found: C=71.73;
H=7.00; N=3.53; S=6.46.
EXAMPLE 23
Preparation of
2-[[1-(2,5dimethylphenyl)ethyl]thio]-4-methyl-Quinoline (Compound
162)
[0117] 11
[0118] a) Preparation of 2-thiol-4-methylquinoline(Starting
Material)
[0119] A mixture of 15.9 g of 2-hydroxy-4-methylquinoline and 24.4
g of P.sub.2S.sub.5 were heated together in an oil bath at
150.degree. C. to give a homogeneous melt. The melt was cooled and
then 100 ml of hydrochloric acid (90 ml of concentrated HCl and 10
ml of 10% HCl) were added and the mixture was refluxed for two
hours. The mixture was then filtered hot through a large buchner
funnel using coarse filter paper. The yellow/orange solid was dried
in a vacuum oven, having a melting point of 250-253.degree. C. NMR
indicated that it was the desired thiol.
[0120] b) Preparation of
2-[[1-(2,5dimethylphenyl)ethyljthio]-4-methyl-Qui- noline
[0121] Sodium (1.2 g) was dissolved in 50 ml of ethanol and then
9.5 g of 2-thiol-4-methylquinoline (prepared in accordance with
step (a) above), and 11.6 g of
2,5-dimethylphenyl(2-bromoethyl)benzene were added while stirring.
An additional 50 ml of ethanol were then added and the reaction
mixture was heated on a steam bath for five minutes, and was then
filtered hot to remove some light brown precipitate. A reddish
precipitate deposited in the cooled filtrate. This was filtered off
and then taken up in carbon tetrachloride and water to remove
sodium bromide. There was some material that was insoluble in both
the organic and the water layer, and this was removed by
filtration. The layers were separated and the carbon tetrachloride
removed from the organic layer. The residue was crystallized from
ethanol and then recrystallized from isopropanol, melting point
84-85.degree. C. NMR was in agreement with the proposed structure.
C,H,N calculated for C.sub.20H.sub.2,NS: % C=78.14; % H=6.89; %
N=4.56; Found: % C=78.13; % H=6.85; % N=4.46.
EXAMPLE 24
Preparation of
2-[((2,5-dimethylphenyl)methyl)sulfonyl]-3-methylpyridine-1- -oxide
(Compound 165)
[0122] 12
[0123] To a stirred solution of 4.0 g of
2-[((2,5-dimethylphenyl)methyl)th- io]-3-methylpyridine-1-oxide in
50 mL of methanol, cooled to 3.degree. C., was added a solution of
14.1 g of Oxone.RTM. in 50 mL of water over a period of 50 minutes.
The reaction mixture was stirred at 24.degree. C. overnight and
then diluted with 200 mL of water. The product was extracted into
chloroform and dried over magnesium sulfate. Evaporation of solvent
under reduced pressure gave 4.1 g of 2-[((2,5-dimethylphenyl)m-
ethyl)sulfonyl]-3-methylpyridine-1-oxide as a white crystalline
solid, having a melting point of 171-173.degree. C. The .sup.1H NMR
spectrum (CDCl.sub.3) was in agreement with the expected
structure.
EXAMPLE 25
Preparation of 2-(Benzylsulfinyl)-pyridine-N-oxide (Compound 5)
[0124] 13
[0125] A mixture of 10.6 g (0.053 mole) of
2-(benzylthio)-pyridine-N-oxide and 50 ml of chloroform was cooled
to less than 10.degree. C. with stirring. A mixture of 10.6 g (0.05
mole) of metachloroperbenzoric acid (85%) in 50 ml of chloroform
was then added dropwise to the above mixture. Stirring was
continued for 6.5 hours at which time a TLC showed only one spot.
Additional chloroform was added until the precipitate--had all
dissolved. The chloroform solution was then washed with sodium
bicarbonate, the layers separated, and the CHCl.sub.3 layer dried
with N.sub.a2SO.sub.4. The dried CHCl.sub.3 solution was evaporated
to leave an oil which crystallized upon the addition of a little
ethanol. The crystalline material was recrystallized from ethyl
acetate, melting point 119-122.degree. C., yield 7.6 g. An infrared
spectrum supported the proposed structure.
EXAMPLE 26
Preparation of 2-(Benzylsulfonyl)-pyridine-N-oxide (Compound 6)
[0126] 14
[0127] A mixture of 2.2 g (0.01 mole) of
2-(benzylthio)-pyridine-N-oxide, 50 ml of chloroform and 4 g of 40%
peracetic acid in acetic acid was made and stirred at room
temperature for 2.5 days. After this time, TLC indicated that the
reaction was incomplete so the mixture was heated at 65.degree. C.
for two more days. TLC indicated the reaction to still be
incomplete, so 2 ml of additional peracetic acid was added and
heating continued for two more hours at which time a TLC showed
only one spot. The mixture was cooled, washed with 50 ml of
saturated K.sub.2CO.sub.3 solution, and the chloroform layer was
dried over Na.sub.2SO.sub.4. The chloroform was removed to leave an
oil which crystallized, melting point 127-128.degree. C., yield 2.3
g. An infrared spectrum supported the proposed structure. See also
Ann 695, 77 (1966).
EXAMPLE 27
Preparation of 2-(Pentachlorobenzylsulfonyl)-pyridine-N-oxide
(Compound 32)
[0128] 15
[0129] A solution of 8 g (0.04 mole) of metachloroperbenzoic acid
(MCPBA), 85% purity, dissolved in 50 ml of chloroform was added to
a stirred mixture of 2-(pentachlorobenzylthio)pyridine-N-oxide in
50 ml of chloroform while holding the mixture at 10.degree. C. The
mixture was stirred overnight at room temperature, and then washed
with sodium bicarbonate solution. The chloroform layer was dried
with sodium sulfate, filtered, and the chloroform removed. The
residue was crystallized from ethanol, melting point
235-238.degree. C., yield 7.1 g. An infrared supported the
structure.
EXAMPLE 28
Preparation of
2-(4-(2,2-dichlorocyclopropyl)phenyl)methylsulfonyl)-pyridi-
ne-N-oxide (Compound 45)
[0130] 16
[0131] To a mixture of 9.8 g (0.03 mole) of
2-(4-(2,2-dichlorocyclopropyl)-
phenyl)-methylthio)-pyridine-N-oxide in 50 ml of chloroform were
added with stirring at less than 10.degree. C. a mixture of 12 g
(0.06 mole) of metachloroperbenzoic acid (85%) in 75 ml of
chloroform. The mixture was stirred overnight at room temperature.
The mixture was then washed with saturated sodium bicarbonate
solution and the chloroform layer was separated and then dried over
sodium sulfate. The sodium sulfate was filtered off and the
chloroform solution evaporated to leave an oily residue, yield 9.5
g. An infrared spectrum supported the proposed structure.
EXAMPLE 29
Preparation of
2-[(2,5-dimethylphenyl)chloromethylsulfonyl]4-methylpyridin-
e-1-oxide (Compound 74)
[0132] a) Preparation of
2-[(2,5-dimethylphenyl)methylthio]-4-methylpyridi- ne-1-oxide
17
[0133] A mixture of 1.34 g (0.006 mole) of 2-bromo-4-methylpyridine
hydrochloride, 1.06 g (0.007 mole) of 2,5-dimethylbenzylmercaptan
and 0.56 g (0.014 mole) of powdered sodium hydroxide were stirred
together at room temperature in 15 ml of DMF for 15 minutes. The
reaction mixture was poured into water and the precipitate filtered
off and washed with water.
[0134] Yield 1.47 g or 95%.
[0135] b) Preparation of
2-[(2,5-dimethylphenyl)methylsulfonyl]-4-methylpy- ridine-1-oxide
18
[0136] The sulfide isolated in step (a) above was dissolved in 20
ml of glacial acetic acid and 1.5 ml of 30% hydrogen peroxide was
added along with 100 mg of sodium tungstate. The reaction mixture
was heated at 40.degree. C. for one hour, cooled, and poured into
water to percipitate the product. Yield, 1.46 or 89%. NMR supported
the proposed structure.
[0137] c) Preparation of
2-[(2,5-dimethylphenyl)chloromethylsulfonyl]-4-me-
thyl-pyridine-1-oxide 19
[0138] The sulfone (1.35 g or 0.0046 mole) prepared in step (b)
above was added to a mixture of 0.20 g (0.005 mole) of sodium
hydroxide, 1.5 g of carbon tetrachloride and 15 ml of DMF at
0.degree. C. After 20 minutes of stirring, the reaction mixture was
quenched with water and the precipitate was filtered off, washed
with water, and dried. Yield, 1.26 g of crude material. The solid
was recrystallized from a mixture of ethanol and chloroform to give
0.75 g of purified product, melting point 191.degree. C. with
decomposition. NMR supported the proposed structure.
EXAMPLE 30
Preparation of 2-(3,4-dichlorobenzylsulfonyl)-pyridine-N-oxide
(Compound 37)
[0139] 20
[0140] To a mixture of 11.4 g (0.04 mole) of
2-[(3,4-dichlorobenzylthio]-p- yridine-N-oxide in 50 ml of
chloroform were added with stirring at less than 10.degree. C. a
mixture of 16 g (0.08 mole) of metachloroperbenzoic acid (85%) in
10 ml of chloroform. The mixture was stirred overnight at room
temperature. The mixture was then washed with saturated sodium
bicarbonate solution, and the chloroform layer was separated and
dried over sodium sulfate. The sodium sulfate was filtered off and
the chloroform solution evaporated to leave a residue, which was
crystallized from ethanol. The product was filtered off, and
air-dried, melting point 170-173.degree. C., yield log. C, H, N,
calculated for C.sub.12H.sub.9NO.sub.3SCl.sub.2: % C=45.30, %
H=2.85; % N=4.40. Found: % C=45.10; % H=2.75; % N=4.49. An infrared
spectrum supported the proposed structure.
EXAMPLE 31
Preparation of 2-(2,4,6-trimethylbenzylsulfinyl]-pyridine-N-oxide
(Compound 88)
[0141] 21
[0142] To a mixture of 7.8 g (0.03 mole) of
2-(2,4,6-trimethylbenzylthio)-- pyridine-N-oxide in 50 ml of
chloroform were added, with stirring at less than 10.degree. C., a
mixture of 6 g (0.03 mole) of metachloroperbenzoic acid (85%) in
100 ml of chloroform. The mixture was stirred overnight at room
temperature. The mixture was then washed with saturated sodium
bicarbonate solution, the chloroform layer was separated and dried
over sodium sulfate. The sodium sulfate was filtered off and the
chloroform solution evaporated to leave a residue, which was
crystallized from ethanol. The product was filtered off, and
air-dried, melting point 164-166.degree. C., yield 7.2 g. C, H, N,
calculated for C.sub.15H.sub.17NO.sub.2S: % C=65.43, % H=6.22; %
N=5.09. Found: % C=66.22; % H=6.63; % N=5.13.
EXAMPLE 32
Preparation of
2-[[1-(2,5-dimethylphenyl)propyl]sulfonyl]-3-methylpyridine-
-1-oxide (Compound 79)
[0143] 22
[0144] To a mixture of 5 g of
2-[[1-(2,5-dimethylphenyl)methyl]sulfonyl]-3-
-methylpyridine-1-oxide dissolved in 20 ml of dry dimethylformanide
were added 0.8 g of sodium hydroxide. The mixture was cooled to
10.degree. C. for 15 minutes and turned a red color. Then, 1.4 ml
of ethyl iodide was added dropwise while maintaining the reaction
mixture at 10.degree. C. After addition, the mixture was allowed to
warm and stir at room temperature for two hours. Ice water was then
added to form a precipitate, 4.8 g which was recrystallized from
toluene, melting point 160-165.degree. C., 1.2 g. An nmr showed
this to be starting material. The toluene filtrate was concentrated
and ether was then added to precipitate the crude product, 2.3 g,
melting point 118-128.degree. C. The crude product was
recrystallized from methanol and ether to give 1 .2 g of purified
product, melting point 124-129.degree. C. NMR indicated that it was
the desired product and a C,H,N analysis corresponded to the
theoretical values for C.sub.17H.sub.21NO.sub.3S.
EXAMPLE 33
Activity against HIV
[0145] The cell type used to determine activity of the compounds of
the invention herein, i.e., the test compounds, against HIV was
human T-lymphoblast (CEM) cells obtained from the American Tissue
Cell Culture Collection (Rockville, Md.). HIV-1 (III.sub.B) was
originally obtained from the culture of persistently HIV-1 infected
H9 cells and was provided by R.C. Gallo and M. Popovic (National
Cancer Institute, National Institutes of Health, Bethesda, Md.).
HIV-2 (ROD) was originally obtained from L. M. Montagnier (Pasteur
Institute, Paris, France).
[0146] To determine the antiviral activity of the test compounds,
CEM cells were suspended at a cell density of approximately 300,000
cells per ml of culture medium and infected with approximately 100
CCID.sub.50 (100 CCID.sub.50 being the 50% cell culture infective
dose) of HIV-1 (IIB) or HIV-2 (ROD)). Then 100 .mu.l of the
infected cell suspensions was added to 200 .mu.l micro titer plate
wells containing 100 .mu.l of appropriate serial (5-fold) dilutions
of the test compounds. The inhibitory effect of the test compounds
on HIV-1 or HIV-2 syncytium formation in CEM cells was examined
microscopically on day four post infection. The 50% effective
concentration (EC.sub.50) was defined as the test compound
concentration that inhibits syncytium formation in the HIV-1 or
HIV-2 infected cell cultures by 50%.
[0147] In some cases, the compounds had considerable cytotoxicity
to CEM cells which made determination of the EC.sub.50 difficult.
In these cases, the percent protection of the cells against
virus-induced cytopathicity by the test compounds at the indicated
compound concentration in the previous column is given.
[0148] The results are summarized in Table 3.
EXAMPLE 34
Activity against HCMV
[0149] Confluent HEL cells grown in 96-cell microtiter plates were
inoculated with CMV at an input of 100 PFU (plaque forming units)
per well. After a one to two hour incubation period, residual virus
was removed and the infected cells were further incubated with MEM
(Minimal Essential Medium) (supplemented with 2% inactivated Fetal
Calf Serum (FCS), 2.mu.M L-glutamine, and 0.3% sodium bicarbonate)
containing varying concentrations of the test compounds. Antiviral
activity was expressed as EC.sub.50 (50% effective concentration),
or test compound concentration required to reduce virus-induced
cytopathicity after seven days by 50% compared to the untreated
control.
[0150] In some cases, the compounds had considerable cytotoxicity
against HEL cells, which made determination of the EC.sub.50
difficult. In these cases, an estimate of the percent protection at
the compound concentration indicated in the previous columns is
given.
[0151] The results are summarized in Table 3.
EXAMPLE 35
Activity Against HHV-6
[0152] Two human immature T-lymphoblastoid cell lines were used:
HSB-2, obtained from American Type Culture Collection (No. CCL
120.1); and MOLT-3, purchased from ABI Technologies (Columbia, Md.,
USA). The cells were propagated in RPMI 1640 medium supplemented
with 10% fetal calf serum, 2 mM L-glutamine, 0.075% sodium
bicarbonate and gentamycin. The cultures were incubated at
37.degree. C. in a humidified and CO.sub.2 controlled
incubator.
[0153] The GS strain of HHV-6 variant A was kindly provided by Dr.
R. Gallo, while the Z-29 strain of HHV-6 variant B was obtained
from ABI Technologies (Columbia, Md., USA). For preparation of
virus stocks, suspensions of HSB-2 cells infected with strain GS,
or MOLT-3 cells infected with strain Z-29, were collected at 10-12
days post infection, when the cytopathic effect (CPE) was maximal
and cells were >90% virus positive (as determined by
immunofluorescence detection of HHV-6 antigens). Since the titer of
virus released in culture supernatant was insufficient, virus
stocks were used as whole cell suspensions, which were relatively
stable when kept in aliquots at -80.degree. C.
[0154] Stock solutions of the test compounds or of standards were
prepared in dimethylsulfoxide or phosphate buffered saline (PBS).
Working dilutions for the antiviral assays were prepared by
appropriate dilution of the stock solutions in cell culture medium.
The antiherpetic drug Foscarnet (PFA, Foscavir.RTM. from Astra,
Sodertlje, Sweden) was used as standard.
[0155] The antiviral assays were carried out as follows:
[0156] On day 0, the GS and Z-29 strains of HHV-6 were inoculated
onto HSB-2 cells and MOLT-3 cells, respectively, at a multiplicity
of infection of 0.001 CCID.sub.50 (50% cell culture infective
doses) per cell, and a cell suspension having a cell density of
approximately 5.times.10.sup.6 cells per ml of culture medium.
After two hours of virus adsorption at 37.degree. C., the
unadsorbed virus was removed by centrifugation and the infected
cells were resuspended and transferred to 48-well microtrays
containing the test compounds or control in two- to five-fold
dilutions. The final cell density of the suspended cells was
approximately 0.8.times.10.sup.6 cells per ml of culture
medium.
[0157] The cells were incubated at 37.degree. C. and subcultivated
on days four and seven by two-fold dilution in medium containing
fresh test compound or control. On days 10-14, the cells were
examined microscopically to score the viral cytopathic effect (CPE)
visible by the appearance of large ballooning cells and drug
toxicity. Then total DNA was extracted from the infected cells with
the QIAamp Blood Kit (Qiagen, Germany), using the manufacturer's
instructions, and the DNA extracts were frozen at -20.degree. C.
until further analysis.
[0158] Viral DNA was detected by a slot blot assay as follows:
[0159] A digoxigenin labeled probe specific for strain GS or Z-29,
was prepared by PCR reaction in the presence of digoxigenin-dUTP,
on a 1-.mu.l aliquot of a DNA extract prepared from infected cells
showing manifest CPE. The 5'-3' primer sequence was GCTAGAACG
TATTTGCTGCAGAACG (Seq. Id. No. 1) and ATCCGAAACAACTGTCTGACTGGCA
(Seq. Id. No. 2), delimiting a 259 bp sequence within the U67 gene.
The amplified product was separated on agarose gel and extracted
from the gel fragment with the QIAquick gel extraction kit (Qiagen,
Germany) after which the purified probe was frozen at -20.degree.
C.
[0160] For quantitation of viral DNA in the infected and
drug-treated cell cultures, appropriate aliquots of the total DNA
extracts (containing 5 .mu.g of total DNA, as determined
spectrophotometrically at 260 nm) were boiled during 10 min, and
blotted on a nylon membrane (Hybond-N from Amersham) using a Hoefer
slot blot apparatus from Pharmacia (Sweden). After UV
cross-linking, the membrane was prehybridized during 30 min at
42.degree. C. with DIG (digoxigenin) easy Hyb solution.RTM.
(Boehringer Mannheim, Germany). Then, the GS- or Z-29 specific
digoxigenin labeled probe was added and allowed to hybridize by
incubation overnight at 42.degree. C. After thorough washing (twice
at room temperature in 2.times.SSC (sodium chloride/sodium
citrate), 0.1% SDS (sodium dodecylsulfate) and twice at 65.degree.
C. in 0.1.times.SSC, 0.1% SDS), the membrane was treated with
blocking reagent (Boehringer Mannheim, Germany). Then, the membrane
was incubated for one hour with alkaline phosphatase-conjugated
anti-digoxigenin antibody (Boehringer Mannheim, Germany) and after
stringent washing, chemiluminescence detection was performed using
CSPD (disodium 3-[4-methoxyspiro [1,2-dioxetane-3,2.sup.1-
-(5.sup.1-chloro) tricyclo [3,3,1,1,3,2]decan]-4-yl)phenylphosphate
substrate from Clontech). After visualization on film, the
intensity of the viral DNA bands was determined by densitometric
scanning. The amounts of probe, DIG anti-body and CSPD substrate
were standardized to ensure that the DNA band intensity was linear
to the amount of viral DNA loaded on the membrane.
[0161] The antiviral IC.sub.50 was calculated by extrapolation and
defined as the compound concentration that produced 50% inhibition
of virus replication as determined by microscopic examination or
quantitation of viral DNA. Toxicity of the compounds was expressed
as minimum cytotoxic concentration (MCC), or the lowest compound
concentration that caused amicroscopically visible alteration in
cellular morphology.
[0162] The HHV-6 activity of some selected compounds of this
invention and the PFA standard in MOLT-3 cells is shown in Table
4.
7TABLE 3 Antiviral EC50(ug/ Antiviral % Compound EC50(ug/ml) HIV-1%
EC50(ug/ HIV-2% ml) Davis strain Inhibition Davis No. HIV-1
Protection ml) HIV-2 Protection CMV strain CMV 1 20.00 41.0 >50
0.0 3 7.20 .gtoreq.20 37.5 36.0 4 .gtoreq.100 37.5 >100 0.0
>50 0.0 5 3.40 2.1 >50 0.0 6 4.40 4.4 19.5 7 >.8 0.0
>0.8 0.0 0.7 8 >20 0.0 >20 0.0 11.0 9 .gtoreq.100 37.5
>100 0.0 >50 0.0 10 1.80 5.8 10.0 11 13.00 10.0 29.0 12 9.50
9.5 20.0 13 6.50 6.0 >5 20.0 14 >4 0.0 >4 25.0 7.0 15 6.00
7.0 5.0 16 11.00 7.5 12.0 17 9.00 8.0 5.0 18 2.40 2.5 5.0 19
.gtoreq.20 37.5 14.0 20.0 20 7.00 13.0 13.0 21 11.70 6.3 10.0 22
12.00 6.3 7.0 23 .gtoreq.20 37.5 .gtoreq.20 37.5 >20 20.0 24
7.00 9.5 >5 30.0 25 10.00 .gtoreq.20 37.5 16.0 27 2.40 9.0 16.0
28 6.50 7.5 >20 40.0 29 11.00 7.0 >20 10.0 30 1.60 14.0 37.0
31 4.00 9.0 10.0 32 0.63 1.0 14.0 33 .gtoreq.4 37.5 .gtoreq.4 37.5
5.0 34 9.00 10.0 >20 10.0 35 .gtoreq.4 37.5 .gtoreq.4 37.5 3.2
37 1.00 1.3 >5 30.0 38 2.50 .gtoreq.4 37.5 5.0 39 9.00 15.5
>20 30.0 40 3.10 3.4 1.5 41 5.00 4.7 8.6 42 8.00 .gtoreq.4 37.5
>5 10.0 43 .gtoreq.4 37.5 .gtoreq.4 37.5 >50 20.0 44 5.30 3.4
>20 20.0 45 1.75 1.5 2.5 46 .gtoreq.20 37.5 15.0 >50 40.0 47
10.00 35.0 >50 20.0 48 9.50 16.0 >20 20.0 49 .gtoreq..8 37.5
.gtoreq..8 37.5 5.0 50 .gtoreq.20 37.5 .gtoreq.20 37.5 >50 20.0
51 >.8 0.0 >.8 0.0 1.3 52 6.00 6.5 12.0 53 2.33 4.1 >5
20.0 54 .gtoreq.4 37.5 4.0 5.0 55 .gtoreq.4 37.5 2.6 3.2 56 5.30
4.7 >5 20.0 58 3.40 2.6 5.0 59 5.50 5.0 10.0 60 40.00 17.0
>50 0.0 61 >4 0.0 >4.0 6.0 14.0 62 1.90 5.0 >5 20.0 63
2.30 2.5 3.7 64 1.50 1.9 >5 10.0 65 2.80 3.5 5.0 66 3.10 2.5 5.0
67 2.30 2.4 >50 20.0 69 2.90 2.9 >5 20.0 70 12.00 .gtoreq.20
37.5 11.0 71 0.05 >20.0 0.0 3.2 72 4.00 >100.0 0.0 >50 0.0
73 2.80 >100.0 0.0 >20 40.0 74 0.42 >100.0 0.0 34.5 76
0.90 2.4 9.1 77 0.70 >0.8 0.0 11.0 78 1.40 >100.0 0.0 10.0 79
1.40 .gtoreq.20 37.5 0.8 80 15.00 >20.0 0.0 >20 0.0 81
.gtoreq.20 37.5 >20.0 0.0 8.6 82 9.30 .gtoreq.20 37.5 >5 0.0
83 6.00 .gtoreq.20 37.5 12.0 85 13.00 17.0 >50 20.0 86 >.8
0.0 >0.8 0.0 3.8 88 1.50 1.5 25.0 89 2.50 2.8 20.0 90 .gtoreq.20
37.5 37.0 91 >4 0.0 >4.0 0.0 34.5 92 .gtoreq.20 37.5 4.0
>50 10.0 93 8.00 .gtoreq.20 37.5 >50 0.0 94 1.90 2.6 12.0 95
>4 .gtoreq.4 37.5 4.1 96 20.00 12.0 >50 0.0 97 >.8 0.0
>0.8 0.0 11.0 98 >.8 0.0 >0.8 0.0 10.0 102 >.8 0.0
>0.8 0.0 4.3 103 >.8 0.0 >0.8 0.0 4.3 104 40.00 2.5 34.5
105 16.00 2.5 23.0 106 0.90 >4.0 0.0 20.0 107 0.65 >100
>20 0.0 108 0.75 .gtoreq.20 37.5 38.0 110 5.50 >100.0 0.0
50.0 114 >.8 0.0 >0.80 0.0 >20 20.0 115 >20 0.0
>20.00 0.0 >50 40.0 117 3.40 >4.0 0.0 12.0 118 >4
>4.0 0.0 >5 10.0 120 3.30 >20.00 0.0 12.5 121 11.00 60.00
>50 0.0 123 60.00 >100 0.0 >50 40.0 124 >.8 0.0
>0.80 0.0 >5 10.0 125 >4 0.0 >4.0 0.0 31.5 128
.gtoreq.4 37.5 7.0 >20 40.0 129 >14 11.0 >5 20.0 132 2.40
>20.00 0.0 >50 0.0 133 0.14 >20.00 0.0 25.0 134 >20 0.0
>100.0 0.0 50.0 135 >20 0.0 >20.00 0.0 12.5 136 1.50
>4.0 0.0 4.7 137 >20 30.0 >20.00 0.0 28.0 138 >100 0.0
>100.0 0.0 >50 20.0 139 >20 0.0 >20.00 0.0 43.0 140
2.00 12.0 12.0 142 >4 0.0 >4 0.0 3.4 143 30.00 50.0 >50
0.0 146 2.30 .gtoreq.20 37.5 40.0 148 >20 >20 0.4 149 9.00
16.0 20.0 150 3.25 20.0 >50 20.0 151 >20 0.0 >20.00 0.0
>20 20.0 153 2.10 3.0 11.5 156 16.00 >100 0.0 >50 0.0 157
6.00 .gtoreq.20 37.5 >50 0.0 158 >4 0.0 >4 0.0 3.6 159
>20 0.0 >20 25.0 10.0 160 >20 0.0 >20 0.0 7.0 161 9.50
>100 0.0 38.0 162 >.8 0.0 >.16 0.0 1.6 163 3.25 >100
0.0 >50 0.0 164 1.0 >20 0.0 -- -- 165 0.14 >4 0.0 -- --
DHPG STANDARD FOR CMV 1 S-HPMPC STANDARD FOR CMV 0.3
[0163]
8TABLE 4 Anti-HHV-6 Activity in MOLT-3 Cells EC.sub.50 Based on
EC.sub.50 Based on Viral DNA Detection.sup.b CPE.sup.a (.mu.g/ml)
(.mu.g/ml) MIC.sup.c (.mu.g/ml) Compound Exp. 1 Exp. 2 Exp. 3 Exp.
1 Exp. 2 Exp. 3 Exp. 1 Exp. 2 Exp. 3 PFA 8.9 4.0 6.5 9.4 8.8 9.1
>100 >100 >100 Compound >100 >200 >100 >100 Nd
>100 100 100 100 No. 5 Compound 17.1 8.7 12.9 28.1 17.3 22.7 100
100 100 No. 6 Compound 12.6 11.1 11.8 21.8 9.4 15.6 50 100
.gtoreq.50 No. 10 .sup.aCompound concentration that produces 50%
inhibition of virus induced CPE (cytopathic effect) as determined
by microscopic examination. .sup.bCompound concentration that
produces 50% inhibition of virus replication as estimated from the
intensity of the bands obtained after viral DNA detection.
.sup.cMinimum inhibitory concentration or concentration causing
minimal changes in cell morphology as determined by microscopic
examination. Data are the individual data from independent
experiments. Nd = Not done
[0164]
Sequence CWU 1
1
2 1 25 DNA Artificial Sequence Description of Artificial Sequence
Primer 1 gctagaacgt atttgctgca gaacg 25 2 25 DNA Artificial
Sequence Description of Artificial Sequence Primer 2 atccgaaaca
actgtctgac tggca 25
* * * * *