U.S. patent application number 10/658100 was filed with the patent office on 2004-10-07 for nucleic acid detection method.
Invention is credited to Jakobsen, Kjetill Sigurd, Rudi, Knut.
Application Number | 20040197794 10/658100 |
Document ID | / |
Family ID | 10829712 |
Filed Date | 2004-10-07 |
United States Patent
Application |
20040197794 |
Kind Code |
A1 |
Rudi, Knut ; et al. |
October 7, 2004 |
Nucleic acid detection method
Abstract
The present invention provides a method of detecting a target
nucleotide sequence in a nucleic acid molecule, which comprises:
(a) binding of an oligonucleotide probe to said nucleic acid
molecule; (b) selective labelling of the bound oligonucleotide
probe in the presence of said target nucleotide sequence; (c)
hybridization of the labelled oligonucleotide to a complementary
sequence; and (d) subsequent detection of the label. Such methods
are suitable for qualitative and quantitative assays of
microbiological populations.
Inventors: |
Rudi, Knut; (Oslo, NO)
; Jakobsen, Kjetill Sigurd; (Oslo, NO) |
Correspondence
Address: |
DORSEY & WHITNEY LLP
INTELLECTUAL PROPERTY DEPARTMENT
250 PARK AVENUE
NEW YORK
NY
10177
US
|
Family ID: |
10829712 |
Appl. No.: |
10/658100 |
Filed: |
September 9, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10658100 |
Sep 9, 2003 |
|
|
|
09646847 |
Feb 2, 2001 |
|
|
|
6617138 |
|
|
|
|
09646847 |
Feb 2, 2001 |
|
|
|
PCT/GB99/01025 |
Apr 1, 1999 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/6.1 |
Current CPC
Class: |
C12Q 1/6816 20130101;
C12Q 1/6851 20130101; C12Q 2545/107 20130101; C12Q 2565/537
20130101; C12Q 1/6813 20130101; C12Q 1/6851 20130101; C12Q 1/689
20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 1, 1998 |
GB |
9807045.1 |
Claims
21. A kit for carrying out a method of detection of a target
nucleotide sequence in a nucleic acid molecule which comprises: (a)
an oligonucleotide probe capable of binding to a target nucleic
acid molecule containing the target nucleotide sequence; (b) means
for selective labelling of the oligonucleotide probe; and (c) a
nucleotide sequence complementary to the oligonucleotide probe.
22 A kit as claimed in claim 21 wherein the nucleotide sequence of
(c) is fully complementary to the oligonucleotide probe.
23 A kit as claimed in claim 21 wherein the oligonucleotide probe
is 20 to 30 nucleotides in length.
24 A kit as claimed in claim 21 wherein the means (b) for selective
labelling of the oligonucleotide probe provides for incorporation
of a labelled nucleotide.
25 A kit as claimed in claim 24 wherein means (b) for selective
labelling of the oligonucleotide probe comprises a labelled
nucleotide.
26 A kit as claimed in claim 25 wherein the labelled nucleotide is
a labelled dideoxynucleotide.
27 A kit as claimed in claim 24 wherein the means for selective
labelling of the oligonucleotide probe comprises one or more
labelled dideoxynucleotides and one or more unlabelled
dideoxynucleotides.
28 A kit as claimed in claim 27 wherein the means for selective
labelling of the oligonucleotide probes comprises one labelled
dideoxynucleotide and three unlabelled dideoxynucleotides.
29 A kit as claimed in claim 21 wherein the oligonucleotide probe
is designed with one or more mismatches at the 3'-end to non-target
nucleotide sequences.
30 A kit as claimed in claim 21 wherein the sequence complementary
to the labelled oligonucleotide is immobilised on a solid
support.
31 A kit as claimed in claim 30 wherein the solid support is a
membrane strip or nucleic acid chip.
32 A kit as claimed in claim 21 further comprising (d) means to
amplify the nucleic acid molecule which contains the target
sequence.
33 A kit as claimed in claim 32 which further comprises a
competitor nucleic acid molecule for coamplification with the
nucleic acid molecule which contains the target sequence.
34 A kit as claimed in claim 33 wherein the competitor molecule
comprises a recognition sequence which is complementary to a
competitor oligonucleotide probe.
35 A kit as claimed in claim 33 further comprising a competitor
oligonucleotide probe.
36 A kit as claimed in claim 35 wherein the competitor
oligonucleotide probe is capable of being selectively labelled
after hybridisation to the competitor molecule.
37 A kit as claimed in claim 36 further comprising the means to
detect said labelled competitor oligonucleotide probe.
38 A kit as claimed in claim 37 wherein the sequences which are
complementary to the oligonucleotide probe are immobilised on a
solid support in discrete, pre-determined positions.
39 A kit as claimed in claim 21 wherein the target nucleotide
sequence is characteristic of a particular organism or group of
organisms.
40 A kit as claimed in claim 39 which comprises a plurality of
different oligonucleotide probes, each probe species being capable
of binding to a different target nucleotide sequence, each target
sequence being characteristic of a particular organism or group of
organisms.
Description
[0001] The present invention relates to nucleic acid detection
methods, in particular to quantitative nucleic acid detection
methods.
[0002] Detection, especially quantitative detection of a particular
nucleic acid sequence, as an indication of the presence of an
organism e.g. a pathogen in a clinical sample or a contaminant in a
food or environmental sample, such as toxin-producing cyanobacteria
in water sources, or of mRNA to show a change in transcription
levels, is a valuable microbiological tool. In addition, in the
diagnostic or forensic use of nucleic acid analysis or in the study
of polymorphisms, full sequencing of the target nucleic acid may be
unnecessary where the detection of a single base variation or
mismatch is sufficient to give a positive identification. Such a
single base variation or mismatch may, for example, arise from
allelic variation or polymorphism, a point mutation, or any
deletion or insertion of genetic material where the detection of a
single abnormal or species specific base will give the required
information.
[0003] Through our work in the development of methods for the
detection of bacteria in water, we have developed a new nucleic
acid detection method suitable for a wide variety of applications
in the environmental, agricultural, food, veterinary, health and
medical fields and indeed as a general tool in molecular
biology.
[0004] There are a number of techniques available for the analysis
of nucleic acids including the manufacture of synthetic
oligonucleotide probes, particularly labelled probes, for
hybridisation to target sequences; in vitro amplification of target
nucleic acid sequences by PCR and other related amplification
methods and (automated) direct DNA sequencing. These have led to
the development of novel approaches for the detection and
characterisation of nucleic acids in environmental monitoring (Bej,
A. K. and Mahbubani, M. H. [1994] in PCR Technology: Current
Innovations p 327-339 and Bowman, J. P. and Sayler, G. S. [1996] in
Molecular approaches to environmental microbiology p 63-97). There
are three main strategies for quantification of amplified DNA; i.e.
size separation by electrophoresis, hybridization to capture
probes, and real-time detection. The problems with the gel
electrophoresis method are the detection of multiple targets in a
single reaction, and interpretation of the results. Size separation
detection of multiplex amplifications is also difficult to achieve
because the amplification ratios of amplicons with different sizes
are dependent on DNA quality.
[0005] The capture probe assay is based on hybridization of the
entire amplified fragments. Evidently, this assay is not suitable
for separation and quantification of homologous amplicons, e.g.
products of competitive amplifications. The different amplicons
will form sandwich hybridizations at the homologous sites, leading
to the capture of both target and non-target fragments, even if the
capture site is discriminating.
[0006] The ABI PRISM.TM. 7700 Sequence Detection System (Perkin
Elmer, Foster City, Calif.) provides real-time quantitative PCR
amplification. However, multiplex assays are limited by the number
of fluorochromes available and their overlapping fluorescent
spectra.
[0007] It is always an aim in nucleic acid detection methods to
increase their specificity, ie. to reduce non-specific binding or
detection of a non-specific background signal. A separate but
associated goal is to increase the sensitivity of the detection
method, ie. to allow measurement of very small amounts of target
nucleic acid.
[0008] It would also represent a significant advantage if the
method allowed the detection and quantification of several,
preferably a large number such as 10 or more, polymorphic sites in
a single reaction e.g. allowing the detection and quantification of
several different target organisms in a single multiplex assay.
[0009] We have developed a convenient detection method which
provides good sensitivity and specificity and the ability to detect
and quantitate a large number of polymorphic sites in a single
reaction. In particular, the methods represent significant
advantages over those employing agarose gel electrophoresis or
direct detection of the amplified DNA in the quantification.
[0010] The invention thus provides a method of detecting a target
nucleotide sequence in a nucleic acid molecule, which
comprises:
[0011] (a) binding of an oligonucleotide probe to said nucleic acid
molecule;
[0012] (b) selective labelling of the bound oligonucleotide probe
in the presence of said target nucleotide sequence;
[0013] (c) hybridisation of the labelled oligonucleotide to a
complementary sequence; and
[0014] (d) subsequent detection of the label.
[0015] The method of the invention can be used in the detection of
all target nucleotide sequences, such as DNA sequences,
particularly DNA resulting from PCR amplification cycles. The DNA
may be native or cDNA formed from mRNA by reverse transcriptase.
The DNA may be single or double stranded, linear or circular. The
target nucleic acid may be RNA, e.g. mRNA or in particular
ribosomal RNA which is present in a cell in multiple copies, for
example 3,000-20,000 copies per cell.
[0016] In the context of the present invention, the term
"nucleotide sequence" may refer to a `sequence` of only one
nucleotide in length, where the nucleic acid of interest differs by
only one nucleotide from other (non-target) sequences which it is
not desired to detect, such as in the case of detection of a point
mutation or polymorphism. More usually, the nucleotide sequence to
be detected is characteristic of a particular nucleic acid or group
of nucleic acids or of a particular organism or group of organisms
e.g. a species, where it is desired to detect the presence of that
target (e.g. the nucleic acid/or organism) in a sample containing a
number of different molecules or organisms, such as in the
detection of particular bacteria e.g. in a clinical or
environmental sample.
[0017] The oligonucleotide probe may comprise 5 to 50, preferably
10 to 40, more preferably 20 to 30 nucleotides. The probe is
selected to bind to the target nucleic acid, namely the nucleic
acid molecule containing the target nucleotide sequence. The
oligonucleotide is conveniently sufficiently large to provide
appropriate hybridisation to the target nucleic acid, yet still
reasonably short in order to avoid unnecessary chemical synthesis.
Methods for oligonucleotide production are standard in the art.
[0018] As discussed above, the target nucleic acid may be DNA, cDNA
or RNA. The oligonucleotide probe is designed to bind to a target
region in the nucleic acid molecule containing the target
nucleotide sequence. "Target region" is used herein to refer to the
sequence of nucleic acid which binds to the oligonucleotide probe.
This target region may be in the form of a "signature sequence"
which characterises a particular nucleic acid or group of nucleic
acids or organisms etc. or may be the section of nucleic acid
immediately preceding a single base position of interest, if a
polymorphism, point mutation, insertion or deletion is to be
detected.
[0019] It is of course desirable that the target region be absent
from any non-target molecules in the sample in order to introduce
selectivity between target and non-target nucleotide sequences.
This specificity of binding may be achieved by incorporating into
the probe regions of complementarity or substantial complementarity
to the desired target region and/or mismatches to non-target
sequences. The region of complementarity may be present at terminal
or internal segments of the probe, or both.
[0020] Conventionally, nucleic acid detection methods have involved
labelling of the oligonucleotide probe prior to hybridisation to
the target nucleic acid sequence. However, in our method, labelling
of the probe is dependent upon the sequence of the nucleic acid
molecule to which the probe is bound. In other words labelling of
the probe is template-sequence dependent (i.e.
sequence-specific)-incorporation of the label will only occur in
the presence of a desired or selected "sequence" in the target
molecule, which may be in the target region or in the target
nucleotide sequence itself, or it will occur selectively ie. the
step of label incorporation into the oligonucleotide probe may be
discriminating (ie. based on a "mini-sequencing" principle). This
adds an extra dimension of selectivity (specificity) to the
process; oligonucleotide probe binding will initially discriminate
against non-target nucleic acid but some binding to non-target
sequences may be expected. If the probe itself were labelled prior
to binding, then further discrimination would not be possible.
[0021] The present invention, on the other hand, adds a step of
selectively (sequence-specifically) incorporating a label, in the
presence of the target nucleotide sequence, into the
oligonucleotide probe. This selectivity may be achieved, for
example, by incorporation of the label only when the target
nucleotide sequence is present, or by incorporating the label in a
selective or discriminating manner such that the target nucleotide
sequence may be discriminated, or both.
[0022] Conveniently, selective labelling may be achieved using
labelled nucleotides ie. by incorporating (or not incorporating)
into the oligonucleotide probe a nucleotide carrying a label. In
other words selective labelling may occur by chain extension of the
oligonucleotide probe using a polymerase enzyme which incorporates
a labelled nucleotide. In the case of an RNA target, the polymerase
will be a reverse transcriptase enzyme. Conditions for chain
extension (ie. base incorporation) and suitable polymerase enzymes
are well known in the art and widely described in the
literature.
[0023] Selective labelling of the oligonucleotide is preferably
achieved by incorporation of a labelled dideoxynucleotide.
[0024] The term dideoxynucleotide as used herein includes all
2'-deoxynucleotides in which the 3'-hydroxyl group is absent or
modified and thus, while able to be added to the oligonucleotide
probe in the presence of a polymerase, is unable to enter into a
subsequent polymerisation reaction. This means that only one base
can be added to the probe.
[0025] Chain termination in this manner allows the reaction to be
controlled, and the assay to be quantitated, if desired (see
later).
[0026] Advantageously, as described above, the present invention
involves chain extension of the oligonucleotide probe to
incorporate a label. The present invention permits selective
labelling to be achieved both by incorporation of a labelled
nucleotide in a selective manner, (ie. discriminating on the basis
of the label, either its presence or absence, or by selective
detection of a particular label) or by nucleotide incorporation in
a selective manner such that incorporation of a nucleotide (whether
labelled or not) occurs only in the presence of the target
nucleotide sequence (or more accurately, that the efficiency of
incorporation is much reduced where the target nucleotide sequence
is not present) (ie. discriminating on the basis of nucleotide
incorporation or non-incorporation), or both.
[0027] As an example of such a method, if the target sequence is a
key differentiating base, e.g. if the base in the nucleic acid
molecule immediately adjacent to the target region to which the
probe binds, is a cytosine residue, then labelled dideoxyguanine
triphosphate (ddGTP) would be added to the reaction mixture for
incorporation. If the probe had bound to nucleic acid at a
non-target sequence, then it is unlikely that the next nucleotide
is the same as the key base, and the labelled ddGTP is then
unlikely to be incorporated in the oligonucleotide ie.
incorporation of the oligonucleotide takes place only (or largely
or substantially only) in the presence of target. The above method
of differentiation applies mutatis mutandis if the key base is
guanine, adenine, thymine or uracil.
[0028] In order further to reduce the likelihood of
misincorporation of the labelled dideoxynucleotide, unlabelled
dideoxynucleotide triphosphates may also be added to the reaction
mixture. Using the above example, where labelled ddGTP is added,
unlabelled ddCTP, ddATP and ddTTP would be added (where the target
nucleic acid molecule is DNA). If only one ddNTP is present, then
despite the rules of base pairing, there may be a risk that it will
be incorporated where the key base is not its natural base pair,
albeit at a low frequency. This may cause a background or noise
signal in the assay. The inclusion of the other ddNTPs means that
these will be incorporated preferentially, according to the normal
rules of base pairing (C-G and A-T/U), and misincorporation of the
labelled ddNTP is significantly reduced. The use of unlabelled
ddNTPs thus comprises a preferred embodiment of the present
invention.
[0029] In a further preferred embodiment of the present invention,
selectivity of the labelling reaction is further increased by
incorporation of mismatches immediately upstream of the key base.
Thus, the oligonucleotide probe is designed with a mismatch or
mismatches at the 3'-end to non-target nucleotide sequences, and
the presence of the mismatch(es) will reduce the likelihood of
oligonucleotide extension. Therefore, even if the next base after
the end of the bound oligonucleotide is by chance the same as the
key base, in non-target sequences incorporation of the labelled
ddNTP will be reduced where there is preceding mismatch between the
probe and the nucleic acid to which it has bound.
[0030] A large number of suitable labels and labelling methods are
known in the art and described in the literature. Any detectable or
signal-generating label or reporter molecule may be used.
Convenient labels include colorimetric, chemiluminescent,
chromogenic, radioactive and fluorescent labels, but enzymic or
antibody-based labelling methods or signal-generating systems may
also be used. Thus the term "label" as used herein includes not
only directly detectable signal-giving moieties, but also any
moiety which generates a signal or takes part in a signal
generating reaction. Fluorescein or other fluorescently labelled
ddNTPs are particularly suitable, which allow detection directly by
fluorescence or indirectly by antibody interactions. These are
commercially available from e.g. NEN/Dupont. ddNTPs can be labelled
by e.g. [.sup.35S], [.sup.3H] or .sup.32P] as described in Syvnen,
A. C. et al. Genomics 8, [1990], 684-692.
[0031] In order to enhance sensitivity, more than one labelling
step may be performed. In other words, the selective labelling step
may be repeated one or more times, ie. performed cyclically.
Increasing the number of cycles increases the sensitivity, and also
when the assay is performed quantitatively (see below), the
quantitative range of the method, by improving the label saturation
of the probes. In order to facilitate cyclic labelling, a
thermostable polymerase enzyme may be used in the
label-incorporation step. Conveniently, the number of cycles of the
selective labelling step may be from 1 to 50, e.g. 10 to 30 but
this may be varied according to choice. An appropriate or
convenient number of cycles for a given system may be determined by
routine experiments.
[0032] Minisequencing methods to detect multiple single-nucleotide
polymorphisms are known which involve single-nucleotide extension
reactions with fluorescently labelled dideoxynucleotides (Pastinen,
T. et al. Clinical Chemistry (1996) Vol. 42, 9, 1391-1397). In this
case, the minisequencing reaction products were analysed by gel
electrophoresis. In contrast, the present method involves a
hybridisation reaction between the labelled oligonucleotide and its
complementary nucleic acid sequence prior to detection and
analysis.
[0033] Thus, following the selective labelling step(s), the
labelled oligonucleotide probe is hybridised to a complementary
nucleotide sequence. Generally, this involves separation of the
labelled oligonucleotide probe from the previous reaction mixture.
Label incorporation by incorporation of a labelled nucleotide,
results in the so-labelled oligonucleotide probe hybridised to the
target nucleic acid molecule. Strand separation to separate the
probe may be achieved using denaturation methods conventional in
the art e.g. high temperature heating, treatment with high pH
(alkali) etc. Step (c), hybridisation to a sequence complementary
to the probe, may then take place. This "complementary sequence"
according to the invention may be any nucleotide sequence
containing or comprising a region of absolute or substantial
complementarity to the probe such that binding of the probe to the
"complementary sequence" can occur. The complementary sequence may
be DNA or a modification thereof such as PNA. Conveniently, the
complementary sequence may take the form of the complement of the
probe (ie. a sequence fully complementary to the probe). It will be
understood however, that this is not absolutely essential and that
the "complement" may be contained in a longer sequence, may be
partial or truncated, and/or may contain sequence variation (ie.
less than perfect complementarity) as long as binding of the probe
to the "complementary sequence" may still occur.
[0034] In a preferred embodiment, the complementary sequence is
immobilised on a solid support. Suitable immobilising supports to
which the complements can be attached are known in the art and
include any of the well known supports or matrices which are
currently widely used or proposed for immobilisation, separation
etc. These may take the form of particles, sheets, gels, filters,
membranes, fibres, capillaries, chips or microtitre strips, tubes,
plates or wells etc. Methods of immobilising or attaching
oligonucleotides to solid supports are likewise known in the art.
Particularly preferred are membrane strips (commercially available
from NEN and known as GeneScreen) on to which the complementary
sequences may be spotted and then U.V. cross-liked, or DNA chips
(microchips, glass chips) now common in molecular biology
procedures. The use of such solid supports, in particular chips
which can carry an oligonucleotide array ie. a number, e.g. up to
250, of different oligonucleotides complementary to the
oligonucleotide probes used in the earlier part of the assay,
represents a particularly preferred embodiment of the
invention.
[0035] Hybridisation step (c) permits the quantitative separation
of the labelled probes. This is advantageous in the context of a
quantitative assay.
[0036] Following the hybridisation step, the label on the
oligonucleotide probe is detected. As mentioned above in the
context of the label, the detection may be by any means known in
the art, depending on the label selected. Signal amplification may
also be used, if desired, as described in the art (see, for
example, P. Komminoth and M. Werner, Target and Signal
Amplification, approaches to increase the sensitivity of in situ
hybridisation, 1997 Histochem. Cell Biol. 108:325-333). Detection
may also be qualitative, or quantitative or semi-quantitative.
Thus, for example, a visual e.g. calorimetric, chromogenic,
fluorescent or other signal detectable from the label may be used
to provide a simple yes or no indication of the presence or absence
of the target nucleotide sequence. Advantageously, however, the
detection is such as to yield a quantitative assessment of the
amount of target nucleotide present in the sample. This may be an
absolute indication of the amount of target present or some other
quantitative or semi-quantitative indicator e.g. a percentage,
ratio, or similar indicator, e.g. relative to total nucleic acid in
the sample.
[0037] Quantitation of the target nucleotide sequence may further
be correlated to a quantitation of the number of organisms or cells
containing the target in question. Thus, in further aspects, the
invention provides methods of determining the amount of a target
nucleotide sequence or the number of cells containing a target
nucleotide sequence using the nucleic acid detection assay
hereinbefore described.
[0038] As mentioned above, the target nucleic acid may be any DNA
or RNA molecule. It may thus be directly the nucleic acid of a
target cell or organism. It may be desirable, however, to amplify
the nucleic acid prior to detection using the assay method of the
invention and advantageously the target nucleic acid may thus be an
amplicon of an in vitro amplification reaction. Amplification may
however also take place by other means including in vivo cloning
methods. Any method of in vitro amplification may be used,
including both linear and exponential methods. Representative
methods thus include PCR, NASBA and ligase chain reaction. Due to
its convenience, PCR and its variants will commonly be the method
of choice.
[0039] In the context of a quantitative assay, a quantitative in
vitro amplification method may be combined with the detection assay
of the invention. In particular, in a preferred embodiment of the
methods of the present invention, the oligonucleotide probe binding
step is preceded by a competitive PCR reaction. A variety of
methods of competitive PCR exist and are described in the
literature. Any of the known techniques may be used. (For a review
see e.g. Srebert, P. D. and Larrick, J. W. [1992] Nature, 369,
557-558).
[0040] In such a method, nucleic acid incorporating the target
nucleotide sequence is co-amplified with a selected competitor
molecule containing the same primer template sequences as the
target molecule and thus the competitor competes with the target
for PCR primer binding and amplification. The competitor comprises
a means for differentiating from the target, conveniently a
recognition sequence for binding to a competitor-specific
oligonucleotide probe, analogous to the "target-specific"
oligonucleotide probe described in the context of the detection
assay above (ie. the probe of step (a) above). The recognition
sequence is thus analogous to the "target region" of the
oligonucleotide probe above. A single known amount of competitor
may be added, for comparison to a standard curve, or a series of
amplifications may be performed using varying amounts of competitor
e.g. a dilution series. Primers complementary to sequences flanking
the target nucleotide sequence in the nucleic acid molecule of
interest (and to the same sequences in the competitor) are added
and PCR amplification is performed. Competitive PCR enables the
detection to be performed with a built in reference to provide more
accurate analysis of the results. A standard curve may be
constructed using standard techniques conventional in the art.
[0041] In such a competitive PCR step, amplicons are produced
deriving from both target and competitor DNA. The competitor
amplicon is subjected to a detection assay procedure in an
analogous manner to the target amplicon, as described above. The
amplified competitor sequence includes a known recognition sequence
which behaves in the same way as the target region in the target
nucleic acid molecule under detection. For example, an
oligonucleotide probe binding selectively to this recognition
region of the competitor is added to the reaction mixture at the
same time as the probe to the target region of the target molecule
is added, both oligonucleotides being designed to be single base
extended with a labelled ddNTP when bound to their respective
target sequences. A complementary sequence to the competitor
oligonucleotide probe which has been labelled following binding to
the competitor is also provided, preferably immobilised, and the
labelled oligonucleotide probe hybridises to this complementary
sequence before detection. The labels of the target and competitor
oligonucleotides can then be detected and, in particular, the
relative strengths of the measured signal used to evaluate the
amount of target nucleic acid which was present in the original
sample given the known amount of competitor added to the system.
This aspect of the invention is represented in FIG. 1. It is not
necessary that the label for the competitor and the target sequence
are different, indeed they are preferably the same. Differentiation
between competitor and target, as between a plurality of different
target sequences, is preferably achieved spatially; the position of
the complementary sequence to each oligonucleotide probe on e.g.
the microchip array is known and the strength of signal at each
position is measured.
[0042] Titration experiments can be used to determine the optimum
amount of competitor to be used in any particular assay, as
described in the following Examples. The amount of competitor
selected preferably allows detection of a low frequency of target
nucleic acid molecules and reproducible amplifications. Suitable
concentrations may vary from 6.times.10.sup.-8 to
6.times.10.sup.-10 pmol, preferably from 4.times.10.sup.-9 to
8.times.10.sup.-9 pmol.
[0043] Preferably, sufficient cycles of PCR are performed so that a
saturation level is achieved; in that way the amplified DNA
contains substantially the same ratio of target DNA to competitor
DNA as that present before PCR.
[0044] It is advantageous to provide conditions such that the
competitor and target DNA are amplified equally efficiently by PCR
and it is therefore desirable that the size and GC-content of each
fragment is kept substantially the same. In some instances it will
also be necessary to take into account the efficiency of the cell
lysis of the sample which can make some of the genomic DNA less
available for the PCR. In addition, the target DNA may be part of
chromosomal DNA in the initial cycles, while the competitor DNA may
be, for example, in the form of a small plasmid. Thus it might be
necessary to adjust for the relative amplification efficiencies of
these early PCR cycles.
[0045] Alternative amplification strategies may also be used in
this aspect of the invention, for example NASBA and ligase chain
reaction.
[0046] Any suitable polymerase may be used, although it is
preferred to use a thermophilic enzyme such as Taq polymerase to
permit the repeated temperature cycling without having to add
further polymerase, e.g. Klenow fragment, in each cycle.
[0047] As mentioned above, the target nucleic acid may be cDNA
synthesised from mRNA in the sample, and the method of the
invention is thus applicable to diagnosis on the basis of
characteristic mRNA. Such preliminary synthesis can be carried out
by a preliminary treatment with a reverse transcriptase,
conveniently in the same system of buffers and bases to be used in
the subsequent amplification (e.g. PCR) steps. Since the PCR
procedure requires heating to effect strand separation, the reverse
transcriptase will be inactivated in the first PCR cycle. When mRNA
is the target nucleic acid, it may be advantageous to submit the
initial sample, to treatment with an immobilized polydT
oligonucleotide in order to retrieve all mRNA via the terminal
polyA sequences thereof. Alternatively, a specific oligonucleotide
sequence may be used to retrieve the RNA via a specific RNA
sequence. The oligonucleotide can then serve as a primer for cDNA
synthesis, as described in International Patent Application
WO-A-90/11446.
[0048] The PCR (or other in vitro) amplification of target and
competitor nucleic acid provides a first level of specificity but a
low level of non-target/non-competitor molecules may be amplified
in this reaction, hence the selective labelling of the
oligonucleotide probes based on signature sequences in the target
and the competitor amplicons according to the present invention.
The quantification is based on the signal ratio of target to
competitor alone and is not affected by any
non-target/non-competitor molecules which may have been amplified
in the first reaction.
[0049] When the main detection assay follows a PCR or other in
vitro amplification step based on chain extension, then it is
necessary to separate the dNTPs from the previous reaction e.g. in
the PCR product or to inactivate them to ensure that they could not
be involved in subsequent elongation of the oligonucleotides bound
to target/competitor nucleic acid in place of the terminating
ddNTPs. Physical separation of the dNTPs from the PCR product is
possible by e.g. gel electrophoresis, precipitation, affinity
purification, chromatography or filtration. However it is preferred
to inactivate the dNTPs by removing the reactive phosphate groups
by a phosphatase so that the nucleotides can no longer be used for
significant chain elongation.
[0050] Target nucleic acid for use in the method of the invention
may be obtained or prepared by any convenient technique in the art.
Many different methods for isolating nucleic acids from cells and
organisms are described in the literature and any of these could be
used
[0051] For example, methods for the extraction of nucleic acid from
environmental samples are described by Bowman, J. P. and Sayler, G.
S. in Molecular Approaches to Environmental Microbiology (1996), pp
63-97. However, a particularly preferred embodiment of the present
invention combines a detection method as described above with the
solid-phase method for combined cell and nucleic acid isolation
described by us in Rudi et al., Appl. Environ. Microbiol. (1998),
64(1), pp 34-77.
[0052] The method of isolating nucleic acid from a sample of cells
which is described in this paper comprises:
[0053] (a) binding cells in the sample to a solid support to
isolate the cells from the sample;
[0054] (b) lysing the isolated cells; and
[0055] (c) binding nucleic acid released from said lysed cells to
said same solid support.
[0056] The bound nucleic acid may be used directly in a detection
assay of the invention or it may be released from the support.
[0057] The detection assay of the present invention may
advantageously find application in any procedure where it is
desired to detect nucleic acids, for example in any procedure
relying on DNA or RNA identification, e.g. diagnosis, detection of
infections or contaminating organisms or pathogens, clinical
monitoring, forensics, food and environmental safety and
monitoring, or for distinguishing between different cells or cell
types, mutation detection, analysis of polymorphisms, e.g. in
tissue typing etc. and as a general molecular biology tool. The
complete nucleic acid-based assay comprising sample preparation,
DNA amplification, selective labelling and detection is of
particular benefit in quantifying the amount of toxin-producing
cyanobacteria in water sources. This combined isolation and
detection method comprises a particularly preferred embodiment of
the present invention. The assay provides a lower detection limit
of 200, preferably 100 cells/ml (of a particular cyanobacteria
against a background of 10.sup.5 cells/ml of other cyanobacteria)
and a quantitative range of more than three orders of magnitude.
The methods described in principle above and in more detail below
are suited for automation, providing the means for the development
of high throughput systems for routine environmental
monitoring.
[0058] For example, water-blooms formed by cyanobacteria have a
relatively high frequency of toxicity (between 25 and 70%), and
constitute a potential health hazard to livestock and humans. This
is particularly the case for blooms of cyanobacteria belonging to
the genus Microcystis. Species of this genus can produce several
toxins, with the hepatotoxic microsystins being the most potent. It
would therefore be desirable if a method could be developed which
provided a reliable, quick and convenient way to detect and
quantify these bacteria.
[0059] The methods of the invention are particularly suitable in
this respect, in that by selection of oligonucleotides to signature
sequences within the genome of different bacteria of interest, a
single sample can be analysed in one procedure for several
different microorganisms. Signature sequences for distinct
bacterial groups are widely known and published in the literature,
for cyanobacteria a classification system based on 16S rDNA
sequence information can be used (see e.g. J. R. Marchesi, T. Sato,
A. J. Weightman, T. A. Martin, J. C. Fry, S. J. Hiom, and W. G.
Wade, 1998. Design and evaluation of useful bacterium-specific PCR
primers that amplify genes coding for bacterial 16S rRNA. Appl.
Environ. Microbiol. 64:795-799; Turner, S. (1998) Origins of algae
and their plastids, pp 13-53 Ed. Bhattacharya, D. NY:
Springer-Verlag and Giovanni, S. J., Turner, S., Olsen, G. J.,
Barns, S., Lane, D. J. and Pace, N. R. (1988) J. Bacteriol 170 pp
3584-92).
[0060] The Examples which follow describe a fully integrated assay
for analysis of complex cyanobacterial communities. The methods of
the invention are equally suitable for use in the investigation of
other microbial communities.
[0061] Complementary sequences to the different labelled
oligonucleotides can be arranged on a single microchip in a
pre-determined manner to allow quantification of the levels of
different bacteria, preferably by comparison of the ratio of
competitor signal to the signal for each bacterial group. Such
multiplex quantitative assays preferably use high density
oligonucleotide arrays immobilised on glass chips, with subsequent
direct detection of the fluorescein-label (see e.g. Schena, M. et
al., Science, (1996) 270: 467-470; and R. J. Lipshutz, D. M.
Morris, M. Chee, E. Hubbell, M. J. Kozal, N. Shah, N. Shen, R.
Yang, and S. P. A. Fodor. Using oligonucleotide probe arrays to
access genetic diversity, Bio Techniques 19:442-447).
[0062] The invention also comprises kits for carrying out the
methods of the invention. These will normally include at least the
following components:
[0063] (a) an oligonucleotide probe capable of binding to a target
nucleic acid molecule containing the target nucleotide sequence
(ie. directed to a target region within the nucleic acid
molecule;
[0064] (b) means for selective labelling of the oligonucleotide
probe; and
[0065] (c) nucleotide sequences complementary to the
oligonucleotide probes, preferably immobilised on a solid
support.
[0066] The means for selective labelling will conveniently comprise
a polymerase enzyme and at least a labelled nucleotide, preferably
a labelled ddNTP, optionally with corresponding unlabelled
nucleotides also present.
[0067] The above described invention will now be illustrated by the
following non-limiting Examples in the field of cyanobacteria
detection with reference to the drawings in which:
[0068] FIG. 1 is a schematic representation of the quantitative
labelling assay. A known concentration of competitor DNA was added
to the purified target and co-amplified with the same primer pair
(A). Two oligonucleotides, one complementary to an internal segment
of the competitor and one complementary to an internal segment of
the target were sequence specifically extended by a fluorescein
labelled dideoxy cytosine by thermo-cycling (B). The labelled
primers were then hybridized to their immobilized complements (C).
Finally, a chromogenic detection of the label was performed (D),
and the relative signal intensities determined.
[0069] FIG. 2(A)--shows gel results from a competitive PCR on
dilution series of DNA isolated from Microcystis aeruginosa
NIVA-CYA 43,p
[0070] (B)--shows the results of the labelling assay,
[0071] (C)--is a graph showing the intensities of the target
signals relative to the total signal intensities.
[0072] The assays were performed on dilution series of purified
DNA. The amount of DNA is given as genomic copies (assuming a
genomic copy weight of 5 fg). In panel A, 10 .mu.l of the products
from the competitive PCR reaction were loaded in each lane on a
1.5% agarose-gel (containing 30 .mu.g/ml of ethidium bromide) and
electrophoresed using 1.times.TBE at 100 volts for 1 hour. The
products were visualized by U.V.-transillumination. The labelling
assay shown in panel B was performed as described in the Examples.
In panel C, the signal intensities (measured as the difference in
the average pixel value in a 8 bits grayscale, between the signal
and the background) for the target in panel A measured relative to
the total signal intensities of both the target and the competitor
(.circle-solid.). Respective values for the labelling assay in
panel B are also shown (.tangle-solidup.). The pictures were taken
with a Cohu High Performance CCD Camera, and printed on a digital
color printer (Mavigraph UP-D1500CNE. Sony, Japan).
[0073] FIG. 3--is a graph showing the percentage of the signal
intensities for the target spots relative to the total signal
intensities, with mean value for all the experiments, and error
bars for standard deviation (3 degrees of freedom). Complete assay
with 6.times.10.sup.-9 pmol competitor on dilution series of
Microcystis aeruginosa NIVA-CYA 43 in different aqueous
environments. Cells were diluted in sterile water, water containing
Anabaena Lemmermannii NIVA-CYA 83/1 (10.sup.5 cells/ml), water
containing Planktothrix agardhii NIVA-CYA 29 (10.sup.5 cells/ml)
and in water from Lake Akersvatnet, Norway (sampled May 30, 1996).
The complete assay including solid-phase cell concentration and DNA
purification was performed as described in the Examples.
[0074] FIG. 4-(A)--shows the results of the labelling assay
following solid-phase cell concentration and DNA purification as
described in the Examples. Complete assay with 6.times.10.sup.-8
pmol competitor on dilution series of Microcystis aeruginosa
NIVA-CYA 43 in water from Lake Akersvatnet, Norway (sampled May 30,
1996).
[0075] (B)--is a graph showing the percentage of the signal
intensities for the target spots relative to the total signal
intensities. The pictures were taken with a Cohu High Performance
CCD Camera, and printed on a digital color printer (Mavigraph
UP-D1500CNE).
[0076] FIG. 5-(A)--shows membrane strips with probes.
[0077] (B)--shows signal intensities for the respective probes.
[0078] (C)--shows phylogenetic position for the different
probes.
[0079] The probes were spotted on the membrane in the following
order: first row--pKO, pAP and pMI3; second row--pMI2, pDK and
pPL2; third row--pPL1, pAL and pNOS; fourth row--pUN. The strains
tested are for membranes a1, Aphanizomenon gracile NIVA-CYA 103,
a2; Anabaena lemermannii NIVA-CYA 266/1, a3; Nostoc sp. NIV-CYA
123, b1; Phormidium sp. NIVA-CYA 203, b2; Planktothrix prolifica
NICA-CYA 320, b3; Microsystis aeruginosa NIVA-CYA 143, c1;
Microcystits flos-aquae NIVA-CYA 144, c2; Pseudanabaena limnetica
NIVA-CYA 276/6, and c3; Chlorobium. The signal intensities for each
spot was determined. The phylogenetic position of the different
strains and probes are visualised by a phylogenetic tree. The tree
was built with the neighbour-joining algorithm, using Kimura
distances. Each branch in the tree has a bootstrap support above
65%.
[0080] FIG. 6--shows a water profile analysis for 7 Norwegian
lakes. The lakes range from those with a relatively low content of
biomass (mesotroph) to lakes with high biomass content (eutroph).
The signal intensities relative to the universal probe pUN were
multiplied with a factor obtained from pure cultures to correct for
differences in probe-labelling efficiencies to obtain the relative
abundance of the different genotypes in the samples.
EXAMPLES
Example 1
[0081] Organisms and Sample Preparation
[0082] The organisms used are from the Norwegian Institute for
Water Research. The cultivation was performed in medium Z8. The
illumination was provided by fluorescent lamps exposing the strains
with 30 .mu.m.sup.2s.sup.-1. Two different Microcystis aeruginosa
strains (NIVA-CYA 228/1 and 43) were used as templates in the
development of the assay. The system was also tested on
experimentally modified water samples collected from Lake
Akersvatnet, Norway. The cells were counted by microscopy in a
Fuchst-Rosenthal counting chamber (Carl Hecht, Sondheim,
Germany).
[0083] DNA was either purified with a standard phenol/chloroform
protocol from cell pellets of unialgal cultures, or by a
solid-phase cell concentration and DNA purification protocol (Rudi,
K., Larsen F. and Jakobsen, K. J. in Applied and Environmental
Microbiology, (1998), 64, Vol. 1, pp 34-37). In the solid-phase
protocol, cells of cyanobacteria from 1 ml aqueous solution were
adsorbed for 20 minutes onto paramagnetic beads (final volume 2 ml)
in a buffer containing 50' isopropanol, 0.75 M ammonium acetate and
1 U (the beads in 200 .mu.l lysis buffer) Dynabeads DNA DIRECT
(Dynal A/S, Oslo, Norway). The magnetic beads and the adsorbed
bacteria were attracted to the side of a 2 ml microcentrifuge tube
by a MPC-Q magnet (Dynal A/S). Then 20 .mu.l of 4M guanidine
thiocyanate-1% Sarkosyl was added, and the incubation continued at
65.degree. C. for 10 minutes. The DNA was precipitated onto the
beads by addition of 40 .mu.l 96% ethanol, with subsequent
incubation at room temperature for 5 minutes. Finally, the DNA and
bead complex was washed twice with 500 .mu.l 70% ethanol using the
magnet between each washing. To remove residual ethanol the complex
was dried at 65.degree. C. for 5 minutes. The complete bead and DNA
complex was then used in the amplification reactions.
[0084] Competitive PCR (Schematically Shown in FIG. 1A)
[0085] For selective amplification of genomic DNA from Microcystis
we used the 16S rDNA primers 5'-AGCCAAGTCTG CCGTCAAATCA-3' (CH) and
5'-ACCGCTACACTGGGAATTCCTG-3' (CI) (Rudi, K. et al. in Appl.
Environ. Microbiol. 63, 2593-2599). The competitor
5'AGCCAAGTCTGCCGTCAAATCAAGCTG
CCTCACTGCGGAGCTCGGACCAGGAATTCCCAGTGTAGCGGT-3' is an oligonucleotide
with sequences complementary to the PCR primers CH-CI, and the
primer DK (see below) used in the cyclic labelling reaction.
Amplification reactions using the GeneAmp 2400 PCR thermocycler
(Perkin Elmer, Norwalk, Conn.) contained 10 pmol primers,
6.times.10.sup.-9 pmol competitor, 200 .mu.M of each
deoxynucleotide triphosphate, 10 mM Tris-HCl (pH 8.8), 1.5 mM
MgCl.sub.2, 50 mM KCl, 0.1% Triton X-100, 1 U of DynaZyme DNA
polymerase (Finnzymes Oy, Espoo, Finland) and purified DNA in a
final volume of 50 .mu.l. Prior to amplification, the DNA was
denatured for 4 minutes at 94.degree. C. and after amplification an
extension step for 7 minutes at 72.degree. C. was included. The
cycling was done for 40 cycles using the parameters; 94.degree. C.
for 30 seconds, 58.degree. C. for 30 seconds and 72.degree. C. for
30 seconds.
[0086] Cyclic Labelling (Schematically Shown in FIG. 1B)
[0087] Five .mu.l of the PCR products from the competitive reaction
were used in the cyclic labelling reaction. The deoxynucleotide
triphosphates were dephosphorylated by addition of 100 nm Tris-HCl
(pH 8.0), 50 nm MgCl.sub.2 and 1 U shrimp alkaline phosphatase
(USB, Cleveland, Ohio), with subsequent incubation at 37.degree. C.
for 1 hour. Finally, the phosphatase was inactivated by heating at
96.degree. C. for 10 minutes.
[0088] The cyclic labelling reactions were carried out in 20 .mu.l
volumes containing; 3 pmol primer 5'-GTCCGAGCTCCGCAGTGAGGCAG-3'
(DK) complementary to the competitor. 3 pmol primer
5'-TCTGCCAGTTTCCACCGCCTTTA- GGT-3' (DE) complementary to the
Microcystis amplicon, 10 pmol ddATP, 10 pmol ddGTP, 10 pmol ddTTP
(Boehringer GmbH, Mannheim, Germany), 7 pmol fluorescein-12-ddCTP
(NEN, Boston, Mass.), 1.25 .mu.l Thermo Sequenase reaction buffer,
1.1 .mu.l enzyme dilution buffer, 0.15 .mu.l Thermo Sequenase
(Amersham International plc, Buckinghamshire, England) and 6 .mu.l
phosphatase-treated PCR product. The labelling was done for 25
cycles using the parameters; 95.degree. C. for 30 seconds and
50.degree. C. for 4 minutes.
[0089] Hybridization and Chromogenic Detection (Schematically Shown
in FIGS. 1C and D)
[0090] One .mu.l (100 pmol/.mu.l) of primer
5'-ACCTAAAGGCGGTGGAAACTGGCAGA-- 3' (DA) and
5'-CTGCCTCACTGCGGAGCTCGGAC-3' (DJ) were spotted onto membrane
strips (0.4.times.2 cm) GeneScreen (NEN), and then U.V.
cross-linked with 5000 joule/cm.sup.2. Primer DA is complementary
to primer DB, and primer DJ is complementary to primer DK. The
strips were prehybridized for 2 hours at 37.degree. C. in a
prehybridization solution containing 0.7.times.SSC, 1.times.SPEP,
5.times. Denhardts and 100 .mu.g/ml heterologous DNA. The products
from the cyclic labelling reactions were added to 0.5 ml
hybridization solution (0.7.times.SSC, 1.times.SPEP, 1.times.
Denhardts, 10' Dextran sulfate and 100 .mu.g/ml heterologous DNA)
in a 2 ml microcentrifuge tube, and denatured at 95.degree. C. for
5 minutes. The strips were added, and the incubation continued with
gentle inversion for 2 hours at 37.degree. C. The membrane strips
were washed in 50 ml (1.times.SSC and 1% SDS), then in 50 ml
(0.1.times.SSC and 0.1% SDS), and finally twice in 50 ml (0.10 M
Tris-HCl [pH 7.5] and 0.15 M NaCl). Each washing was performed by
brief vortexing at room temperature.
[0091] For antibody detection the membrane strips were blocked with
20 ml (0.10 M Tris-HCl [pH 7.5], 0.15 M NaCl and 0.5% skimmed milk)
for 1 hour and incubated in 10 ml of the same buffer containing
{fraction (1/1000)} of Antifluorescein-HRP Conjugate (NEN) for an
additional 1 hour. The membrane strips were washed 3 times by brief
vortexing in 50 ml (0.10 M Tris-HCl [pH 7.5] and 0.15 M NaCl). The
chromogenic reaction was done with the RENAISSANCE 4CN Plus For
Chromogenic Detection of HRP for 5 minutes, according to the
manufacturers recommendations (NEN).
[0092] The relative signal strengths were measured using a CCD
video camera (Cohu High Performance CCD Camera, Japan), and
analyzed using the Gel-Pro ANALYZER software (Media Cybernetics,
Silver Spring, Md.).
[0093] Detection assay on defined samples containing purified DNA.
By titration experiments the optimum amount of competitor (both for
obtaining low detection limits, and for reproducible
amplifications) was found to be 6.times.10.sup.-9 pmol (i.e. 3600
molecules) per sample test. Accordingly, 6.times.10.sup.-9 pmol
competitor was used in the testing of the assay on purified DNA
from Microcystis aeruginosa NIVA-CYA 43. Dilution series of
Microcystis DNA from approximately 10.sup.7 to 10.sup.0 genomic
copies (assuming a genome size of 5.+-.3 Mb (9b)) were used in both
the competitive PCR assay (FIG. 2A), and in the subsequent
labelling assay (FIG. 2B).
[0094] Measurements of the ratio between target relative to
competitor products, as determined by agarose gel electrophoresis,
gave a quantitative range from 10.sup.5 to 10.sup.2 genomic copies
(FIG. 2C). In contrast, the labelling assay the subject of the
present invention gave a quantitative range of from more than
10.sup.7 down to 10.sup.2 genomic copies. This is approximately a
100-fold increase in dynamic range compared to agarose gel
electrophoresis detection assays (FIG. 2C). As few as 10 copies
could be detected for the labelling assay by increasing the
incubation time of the chromogenic detection reaction from 5 to 30
minutes. Live video capture of the chromogenic detection reaction
may be used to give a quantitative range down to this level. That
is, time-curves from 0 to 30 minutes for the colour density of the
target and competitor spots can be used to extrapolate the relative
signal intensities, although the competitor spot is colour-density
saturated after 30 minutes.
[0095] Effect on the quantitative range by the number of cycles in
the labelling reaction. The cyclic labelling reaction increased the
quantitative range of the assay compared to direct detection of the
amplified DNA. For competitive PCR--using a logarithmic scale for
the target concentration--the ratio of competitor and target
signals resulted in a sigmoid curve with relatively narrow
quantitative range (see FIG. 2C). A sigmoid curve was also obtained
by performing the cyclic labelling assay with just a few labelling
cycles. However, by increasing the number of labelling cycles, the
competitor or the target oligonucleotides were label saturated (all
the probes were labelled) at each of the dilution series endpoints,
respectively, leading to curve with a wider quantitative range (see
FIG. 2C). Increasing the cycle number further resulted in a curve
which was flatter in the middle because of label saturation of both
oligonucleotides at this location.
[0096] Quantification of Microcystis in water samples. The complete
quantitative assay which includes the solid-phase cell
concentration and DNA purification method was carried out on
dilution series (10.sup.5-10.sup.0 cells/ml) of Microcystis
aeruginosa (strains NIVA-CYA 43 and 228/1). Planktothrix agardhii
NIVA-CYA 29 (filamentous) and Anabaena lemmermanii NIVA-CYA 83/1
(filamentous and heterocyst containing) were used as controls of
the reaction specificity. Microcystis cultures were diluted in pure
water, water containing 10.sup.5 cells/ml of Planktothrix agardhii
NIVA-CYA 29, water containing 10.sup.5 cells/ml of Anabaena
lemmermanii NIVA-CYA 83/1, and water sampled from Lake Akersvatnet,
Norway.
[0097] There were no significant differences in either specificity
or sensitivity of the assay for the different conditions tested.
With 6.times.10.sup.-9 pmol competitor we obtained a quantitative
range spanning from more than 10.sup.5 down to 10.sup.2 cells/ml in
all cases (results for Microcystis aeruginosa NIVA-CYA 43 are shown
in FIG. 3). By lengthening the incubation time for the chromogenic
detection reaction from 5 to 30 minutes we could detect down to 10
cells/ml.
[0098] The detection curve for the complete detection assay
(including solid-phase cell concentration and DNA purification) has
about the same slope as the curve obtained for the dilution series
of purified DNA (compare FIGS. 2C and 3), indicating that the cell
concentration and DNA purification (sample preparation) method is
not affected by the sample composition. Furthermore, these results
also show that the solid-phase cell concentration and DNA
purification method can be used for quantitative analysis directly
from water-samples.
[0099] The detection limit was dependent on the amount of
competitor used, with a lower limit (6.times.10.sup.-9 pmol)
competitor. Increasing the amount of competitor 10-fold
(6.times.10.sup.-8 pmol) also resulted in about 10-fold increased
detection limit (FIG. 4). However, lowering the amount to
6.times.10.sup.-10 pmol gave irreproducible results. Thus, we
conclude that 6.times.10.sup.-9 pmol was also the optimum amount of
competitor both for obtaining low detection limits and reproducible
detections for the complete assay on water-samples.
[0100] Complete assay for quantification of cyanobacteria in water.
Cyanobacteria belonging to the genus Microcystis can produce
several different types of toxins, with the hepatotoxic
microcystins as the most potent. This toxin not only causes an
acute poisoning by liver damage, but can also be a carcinogenic
tumor promoter on long term exposure to low doses. Thus, a
continuous monitoring system to screen for the presence of the
organisms producing this toxin is important.
[0101] Health authorities in Australia (New South Wales Blue-green
Algae Task Force, 1992) have already adopted a three-level alert
system based on cyanobacterial cell counts in water. Level 1 is
500-2000 cells/ml, at this level water authorities are alerted and
water sampling for monitoring is increased. Level 2 is 2000-15000
cells/ml, at this point toxicity testing is carried out. Level 3 is
above 15.000 cells/ml, if activated carbon is not available then
the water may be declared unsafe for human consumption. With a
detection limit for Microcystis of 100 cells/ml and a quantitative
range of more than three orders of magnitude, the methods of the
invention described herein are suited for the monitoring of both
low Microcystis concentrations and the detection of potential toxic
waterblooms in drinking water.
[0102] Development of multiplex assays. The general sample
preparation with the solid-phase cell concentration and DNA
purification method, combined with the specificity in the detection
method, enable multiplex determinations. Using competitive PCR,
multiple targets may be quantified by using e.g. universal 16S rDNA
primers in the competitive reaction. Then, different
oligonucleotide probes can be labelled based on signature sequences
for distinct bacterial groups, and finally, the ratios of the
competitor signal can be compared to the signals for each of the
bacterial groups.
Example 2
[0103] Unlike traditional classification based on
morphology/cytology, classification based on nucleic acid sequences
reflect the evolution and phylogeny of the organisms. 16S
rDNA-targeted probes were constructed to detect the major
cyanobacterial groups Microcystis, Planktothrix, Anabaena and
Aphanizomenon. Probes were also constructed to differentiate groups
of different phylogenetic depth. A probe was constructed to detect
the Nostoc group (which includes Anabaena and Aphanizomenon), and
one probe was constructed to detect all eubacteria (including
chloroplasts). The specificity of the constructed probes was tested
on unialgal cultures. This information was subsequently used to
determine the relative distribution and abundance of the targeted
organisms in 7 lake communites.
[0104] Organism and Sample Preparation.
[0105] The following unialgal cultures from the Norwegian Institute
for Water Research was used; Aphanizomenon gracile NIVA-CYA 103,
Anabaena lemmermannii NIVA-CYA 266/1, Nostoc sp. NIVA-CYA 124,
Phormidium sp. NIVA-CYA 203, Planktothrix prolifica NIVA-CYA 320,
Microrystis aeruginosa NIVA-CYA 143, Microcystis flos-aquae
NIVA-CYA 144, Pseudanabaena limnetica NIVA-CYA 276/6. The
cultivation was performed in medium Z8
[Norwegian-institute-for-water-research, Oslo (1990) Culture
Collection of algae, catalogue of strains]. The illumination was
provided by fluorescent lamps exposing the strains with 30
.mu.Em.sup.-2s.sup.-1. Aliquots of dense cultures (1 ml
containining approximately 10.sup.0 cells/ml) were pelleted in a
microcentrifuge at 5,000 rpm for 10 min and immediately frozen at
-80.degree. C. The DNA was purified from the frozen pellets with
the magnetic bead-based DNA Direct DNA isolation Kit (Dynal A/S,
Oslo, Norway), using a protocol modified for the purification from
cyanobacteria [Rudi K., Kroken, M., Dahlberg, O. J., Deggerdal, A.,
Jakobsen, K. S. and Larsen, F. (1997) Biotechniques 22,
506-11].
[0106] The samples collected from the field were immediately
conserved in isopropanol, as described for the cell concentration
step below. The samples were then transported to the laboratory,
and processed further. The DNA was purified by a solid-phase cell
concentration and DNA purification protocol previously developed by
Rudi et at. (1.998). In the solid-phase protocol, cells from 0.8 ml
aqueous solution were adsorbed for 20 min onto paramagnetic beads
(final volume 2 ml) in a buffer containing 50% isopropanol, 0.75 M
ammonium acetate and 1 U (the beads in 200 .mu.l lysis buffer)
Dynabeads DNA DIRECT (Dynal A/S, Oslo, Norway). The magnetic beads
and the adsorbed bacteria were attracted to the side of a 2 ml
microcentrifuge tube by a MPC-Q magnet (Dynal A/S). Then 20 .mu.l
4M guanidine thiocyanate-1% Sarkosyl was added, and the incubation
continued at 65.degree. C. for 10 min. The DNA was precipitated
onto the beads by addition of 40 .mu.l 96% ethanol, with subsequent
incubation at room-temperature for 5 min. Finally, the DNA and bead
complex was washed twice with 500 .mu.l 70% ethanol using the
magnet between each washing. To remove residual ethanol the complex
was dried at 65.degree. C. for 5 min. The complete bead and DNA
complex was then used in the amplification reactions.
[0107] PCR Amplfication.
[0108] Ribosomal DNA was amplified, using the universal primer set
CC-CD. Amplification reactions using the GeneAmp 2400 PCR
thermocycler (Perkin Elmer, Norway, Conn.) contained 10 pmol
primers, 200 .mu.M of each deoxynucleotide triphosphate, 10 mM
Tris-HCl (pH 8.8), 1.5 mM MgCl.sub.2, 50 mM KCl, 0.1% Triton X-100,
1 U of DynaZyme DNA polymerase (Finnzymes Oy, Espoo, Finland) and
purified DNA in a final volume of 50 .mu.l. Prior to amplification,
the DNA was denatured for 4 min at 94.degree. C. and after
amplification an extension step for 7 min at 72.degree. C. was
included. The cycling was done for 35 cycles using the parameters;
96.degree. C. for 15 s, 70.degree. C. for 30 s and 72.degree. C.
for 1 min.
[0109] Cyclic Labelling.
[0110] Twenty .mu.l of the PCR products from the amplification
reactions were used in the cyclic labeling reaction. The
deoxynucleotide triphosphates were dephosphorylated by addition of
100 nm Tris-HCl (pH 8.0), 50 nm MgCl.sub.2 and 1 U shrimp alkaline
phosphatase (USB, Cleveland, Ohio), with subsequent incubation at
37.degree. C. for 1 hour. Finally, the phosphatase was inactivated
by heating at 96.degree. C. for 10 min.
[0111] The cyclic labeling reactions were carried out in 80 .mu.l
volumes containing 3 pmol of each of the primers in Table 1 below,
10 pmol ddATP, 10 pmol ddGTP, 10 pmol ddTTP (Boehringer GmbH,
Mannheim, Germany), 7 pmol fluorescein-12-ddCTP (NEN, Boston,
Mass.), 1.25 .mu.l Thermo Sequenase reaction buffer, 1.1 .mu.l
enzyme dilution buffer, 0.15 .mu.l 32 U/.mu.l Thermo Sequenase
(Amersham Pharmacia plc, Buckinghamshire, England) and 25 .mu.l
phosphatase-treated PCR product. The labeling was done for 10
cycles using the parameters; 95.degree. C. for 30 sec and
50.degree. C. for 4 min.
1TABLE 1 Oligonucleotide probes Probes probe sequences.sup.1 pKO
5'CCTCTGGTACCGTCAGGTTGCTTTCACA- A3' pMI3
5'CCCTGAGTGTCAGATACAGCCCAGTAG3' pMI2 5'GCAGGTGGTCAGCCAAGTCTGC3' pDK
5'TCTGCCAGTTTCCACCGCCTTTAGGT3' pPL1
5'TACAGGCCACACCTAGTTTCCATCGTTTAC3' pAL
5'CTGCTGTTAAAGAGTCTGGCTCAACCAGAT3' pAP
5'CCCCTAGCTTTCGTCCCTCAGTGTCAGT3' pNOS
5'GCTCAACCARATMARAGCAGTGGAAACTA3' pPL2
5'CAATCATTCCGGATAACGCTTGCATCC3' pUN 5'CCGTMTTACCGCGGCTGCTGGCA3'
.sup.1the primers complememtary to these probe sequences were
spoted on the membranes
[0112] Hybridization and Chromogenic Detection.
[0113] Half a .mu.l (100 pmol/.mu.l) of primers complementary to
the primers used in the labeling reaction were spotted onto
membrane strips (4.times.5 cm) Hybon (Amersham), and then U.V.
cross-linked with 5000 joule/cm.sup.2. The strips were
prehybridized for 2 hours at 37.degree. C. in a prehybridization
solution containing 0.7.times.SSC, 1.times.SPEP, 5.times. Denhardts
and 100 .mu.g/ml heterologous DNA. The products from the cyclic
labeling reactions were added to 0.5 ml hybridization solution
(0.7.times.SSC, 1.times.SPEP, 1.times. Denhardts, 10% Dextran
sulfate and 100 .mu.g/ml heterologous DNA) in a 2 ml
microcentrifuge tube, and denatured at 95.degree. C. for 5 min. The
strips were added, and the incubation continued with gentle
inversion for 2 hours at 37.degree. C. The membrane strips were
washed in 50 ml (1.times.SSC and 1 SDS), then in 50 ml
(0.1.times.SSC and 0.1% SDS), and finally twice in 50 ml (0.10 M
Tris-HCl [pH 7.5] and 0.15 M NaCl). Each washing was performed by
brief vortexing at room temperature.
[0114] For antibody detection the membrane strips were blocked with
20 ml (0.10 M Tris-HCl [pH 7.5], 0.15 M NaCl and 0.5% skimmed milk)
for 1 hour and incubated in 20 ml of the same buffer containing
{fraction (1/1000)} of Antifluorescein-HRP Conjugate (NEN) for an
additional 1 hour. The membrane strips were washed 3 times by brief
vortexing in 50 ml (0.10 M Tris-HCl [pH 7.5] and 0.15 M NaCl). The
chromogenic reaction was done with the RENAISSANCE 4CN Plus For
Chromogenic Detection of HRP for 5 min, according to the
manufacturers recommendations (NEN).
[0115] The relative signal strengths were determined by scanning
the membranes with an Agfa snapscanner 600, and analyzed using the
Gel-Pro ANALYZER sofware (Media Cybernetics, Silver Spring,
Md.).
[0116] Validation of the Probe Labeling Assay on Pure Cultures.
[0117] The probe labeling assay was applied on 8 different
cyanobacterial strains representing the major lineages. The
outgroup Chlorobium sp. was included as an additional control of
the specificity of the probes. Approximately 5% of the DNA purified
form the unialgal cultures were amplified with the universal
primer-pair CC-CD in a 50 .mu.l PCR reaction volume. The products
were visualized on a 1.5% ethidium bromide-stained agarose gel,
prior to the labeling, to confirm the amplification reaction. All
of the samples were uniformly amplified, yielding a strong band at
approx. 600 bp, with no visible additional bands.
[0118] Related to the probe-labeling assay, the universal probe pUN
was labeled relatively uniformly (with an exception for
Pseudanabaena limnetica NIVA-CYA 276/6) for the strains tested
(FIG. 5A). This probe was also labeled for the outgroup Chlorobium
sp. Except for the probe pPL2, the different cyanobacteria specific
probes gave signals as expected from their phylogenetic position
(FIGS. 5B and C). The low specificity of pPL2 may be due to the
fact that the hybridization temperature used was not optimal for
this probe. Generally, however, there was a high signal to noise
ratio in the assay. For instance, there is only one base-pair
difference between M. aeruginosa strains NIVA-CYA 143 and 144.
Probe pMI2 distinguished NIVA-CYA 143 and 144 with a signal to
noise ratio of 80.
[0119] The incorporation efficiency of fluorescently labeled
dideoxy nucleotides is sequence dependent. There are also
differences in the probe-labeling due to probe-target hybridrzation
efficiencies. The base composition and the melting point, in
addition to the sequences flanking the probe region, affect the
probe hybridisation. The different labeling efficiencies ranged
from 1.0 to 5, as determined relative to the labeling of the
universal probe pUN for the probes developed in this work. For the
respective probes, the efficiencies were as follows; pKO--1.7,
pM13--2.2, pM12--1.4, pDK--1.9, pPL1--4.0, pAL--1.6, pAP--3.3,
pNOS--4.3, and pPL2--4.9.
[0120] Distribution of Cyanobacteria from 7 Selected
Localities.
[0121] The generality of the sample preparation and probe labeling
strategies were tested on water samples from 7 different
localities, ranging from water with a moderate level of plant
biomass (mesotrophic) to water with a high biomass content
(eutrophic).
[0122] Three samples were collected from each sampling site. The
cell concentration and DNA purification were performed as described
above for all three samples in parallel. Ribosomal DNA was
amplified from 90.9, and 1% of the purified material. Amplification
reactions were obtained for .O slashed.stensj.o slashed.vatnet v
Oslo, Gj.ae butted.rsj.o slashed.en and .ANG.rungen for 90% of the
purified DNA. For 9% of the material all the samples were
amplified, except the samples from Langen, while for 1%
amplification reactions were obtained for all the samples.
[0123] The average signal strength and standard deviation for the
probe labelling were calculated for each investigated locality
(based on the three collected samples). Since the different probes
are not labelled with equal efficiently, this was adjusted for
based on the relative labelling efficiencies obtained from the
analyses of pure cultures (FIG. 6). The bars in this figure show
the approximate relative composition of the determined genotypes in
the sample. Because there is an unknown component of heterotrophic
bacteria in some of the cultures used for correlation, the
quantitation of the respective organisms may be an
overestimate.
[0124] As a further verification of the probe-labelling assay the
samples were also examined by microscopy. Here, the dominant
species for each locality was determined based on morphological and
cytological characteristics, according to the criteria given by
Skulberg et al [Skulberg, O. M. Carmichael, W. W., Codd, G. A. and
Skulberg R. (1993) Algal toxins in seafood and drinking water pp
145-164 Ed. Falconer I. R., London Academic Press Ltd]. There was
generaly a good correlation between the groups of organisms in the
sample, as determined by the genetic and the microscopic analyses.
The 16S rDNA gene used in the genetic analysis, however, does not
have enough sequence variation for discrimination to the species
level. In addition, we could not distinguish between the
morphologically defined genera Anabaena and Aphanizomenon with the
probe-labelling assay. The reason for this is that the two
positions used for discrimination do not follow the species
designation. This can be due to that there have been several
independent substitutions for the respective positions, that there
have been recombination events in the 16S rDNA between the two
probes, or that the species definition is not phyletically
relevant. The hierarchical probe pNOS, on the other hand, seemed
specific for the Nostoc group--including Anabaena and
Aphanizomenon.
[0125] The Planktothrix specific probe pPL1 gave a relatively
strong signal with the probe-labelling assay for lake Gjers.o
slashed.en, while this organism was not detected by the microscopic
examinations of water from this lake. This diiference may be
explained by the fact that samples for microscope analysis was
concentrated through a 2 .mu.m plankton net before the analysis,
while for the genetic analysis the sample was analyzed directly.
Furthermore, the cyanobaceria may not be distributed evenly in the
lake, which may also explain the diiferences in the probe labeling
and the microscopic examinations.
Sequence CWU 1
1
17 1 69 DNA artificial sequence misc_feature ()..() competitor
oligonucleotide complementary to various primers 1 agccaagtct
gccgtcaaat caagctgcct cactgcggag ctcggaccag gaattcccag 60 tgtagcggt
69 2 23 DNA artificial sequence misc_feature ()..() probe 2
gtccgagctc cgcagtgagg cag 23 3 26 DNA artificial sequence
misc_feature ()..() primer 3 tctgccagtt tccaccgcct ttaggt 26 4 26
DNA artificial sequence misc_feature ()..() primer 4 acctaaaggc
ggtggaaact ggcaga 26 5 23 DNA artificial sequence misc_feature
()..() primer 5 ctgcctcact gcggagctcg gac 23 6 29 DNA artificial
sequence misc_feature ()..() probe 6 cctctggtac cgtcaggttg
ctttcacaa 29 7 27 DNA artificial sequence misc_feature ()..() probe
7 ccctgagtgt cagatacagc ccagtag 27 8 22 DNA artificial sequence
misc_feature ()..() probe 8 gcaggtggtc agccaagtct gc 22 9 26 DNA
artificial sequence misc_feature ()..() probe 9 tctgccagtt
tccaccgcct ttaggt 26 10 30 DNA artificial sequence misc_feature
()..() probe 10 tacaggccac acctagtttc catcgtttac 30 11 30 DNA
artificial sequence misc_feature ()..() probe 11 ctgctgttaa
agagtctggc tcaaccagat 30 12 28 DNA artificial sequence misc_feature
()..() probe 12 cccctagctt tcgtccctca gtgtcagt 28 13 29 DNA
artificial sequence misc_feature ()..() probe 13 gctcaaccar
atmaragcag tggaaacta 29 14 27 DNA artificial sequence misc_feature
()..() probe 14 caatcattcc ggataacgct tgcatcc 27 15 23 DNA
artificial sequence misc_feature ()..() probe 15 ccgtmttacc
gcggctgctg gca 23 16 22 DNA artificial sequence misc_feature ()..()
probe 16 agccaagtct gccgtcaaat ca 22 17 22 DNA artificial sequence
misc_feature ()..() probe 17 accgctacac tgggaattcc tg 22
* * * * *