U.S. patent application number 10/646569 was filed with the patent office on 2004-09-30 for antisense modulation of focal adhesion kinase expression.
Invention is credited to Gaarde, William A., Monia, Brett P., Nero, Pamela S..
Application Number | 20040192628 10/646569 |
Document ID | / |
Family ID | 23488586 |
Filed Date | 2004-09-30 |
United States Patent
Application |
20040192628 |
Kind Code |
A1 |
Monia, Brett P. ; et
al. |
September 30, 2004 |
Antisense modulation of focal adhesion kinase expression
Abstract
Compounds, compositions and methods are provided for inhibiting
FAK mediated signaling. The compositions comprise antisense
compounds targeted to nucleic acids encoding FAK. Methods of using
these antisense compounds for inhibition of FAK expression and for
treatment of diseases, particularly cancers, associated with
overexpression or constitutive activation of FAK are provided.
Inventors: |
Monia, Brett P.; (La Costa,
CA) ; Gaarde, William A.; (Carlsbad, CA) ;
Nero, Pamela S.; (San Diego, CA) |
Correspondence
Address: |
Licata & Tyrrell P.C.
66 E. Main Street
Marlton
NJ
08053
US
|
Family ID: |
23488586 |
Appl. No.: |
10/646569 |
Filed: |
August 22, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10646569 |
Aug 22, 2003 |
|
|
|
09757100 |
Jan 9, 2001 |
|
|
|
09757100 |
Jan 9, 2001 |
|
|
|
PCT/US00/18999 |
Jul 13, 2000 |
|
|
|
PCT/US00/18999 |
Jul 13, 2000 |
|
|
|
09377310 |
Aug 19, 1999 |
|
|
|
6133031 |
|
|
|
|
Current U.S.
Class: |
514/44A ;
435/375; 536/23.2 |
Current CPC
Class: |
C12N 15/1137 20130101;
C12N 2310/321 20130101; C12N 2310/3525 20130101; C12N 2310/321
20130101; C12N 2310/3341 20130101; C12N 2310/346 20130101; A61P
9/00 20180101; A61P 27/02 20180101; C12N 2310/341 20130101; C12N
2310/315 20130101; A61P 43/00 20180101; A61K 38/00 20130101; A61P
35/00 20180101 |
Class at
Publication: |
514/044 ;
536/023.2; 435/375 |
International
Class: |
A61K 048/00; C07H
021/04; C12N 005/00 |
Claims
What is claimed is:
1. An antisense compound 8 to 30 nucleobases in length targeted to
the 5'-untranslated region, translational termination region or 3'
untranslated region of a nucleic acid molecule encoding focal
adhesion kinase, wherein said antisense compound inhibits the
expression of said focal adhesion kinase.
2. The antisense compound of claim 1 which is an antisense
oligonucleotide.
3. The antisense compound of claim 2 wherein the antisense
oligonucleotide has a sequence comprising SEQ ID NO: 3, 4, 6, 7, 8,
9, 16, 17, 18, 20 or 23.
4. The antisense compound of claim 2 wherein the antisense
oligonucleotide comprises at least one modified internucleoside
linkage.
5. The antisense compound of claim 4 wherein the modified
internucleoside linkage is a phosphorothioate linkage.
6. The antisense compound of claim 2 wherein the antisense
oligonucleotide comprises at least one modified sugar moiety.
7. The antisense compound of claim 6 wherein the modified sugar
moiety is a 2'-O-methoxyethyl moiety.
8. The antisense compound of claim 2 wherein the antisense
oligonucleotide comprises at least one modified nucleobase.
9. The antisense compound of claim 8 wherein the modified
nucleobase is a 5-methyl cytosine.
10. The antisense compound of claim 2 wherein the antisense
oligonucleotide is a chimeric oligonucleotide.
11. A pharmaceutical composition comprising the antisense compound
of claim 1 and a pharmaceutically acceptable carrier or
diluent.
12. The pharmaceutical composition of claim 11 further comprising a
colloidal dispersion system.
13. The pharmaceutical composition of claim 11 wherein the
antisense compound is an antisense oligonucleotide.
14. The pharmaceutical composition of claim 11 further comprising a
chemotherapeutic agent.
15. The pharmaceutical composition of claim 14 wherein the
chemotherapeutic agent is 5-fluorouracil.
16. A method of inhibiting the growth of a tumor in an animal
comprising administering to said animal an effective amount of the
pharmaceutical composition of claim 14.
17. A method of inhibiting the expression of focal adhesion kinase
in cells or tissues comprising contacting said cells or tissue with
the antisense compound of claim 1 so that expression of focal
adhesion kinase is inhibited.
18. An antisense compound up to 30 nucleobases in length targeted
to the coding region, or start site of a nucleic acid molecule
encoding focal adhesion kinase, wherein said antisense compound
inhibits the expression of said focal adhesion kinase and has a
sequence comprising at least an 8 nucleobasic portion of SEQ ID NO:
10, 11, 12, 14, 15, 30, 31 or 33.
19. The antisense compound of claim 18 which is an antisense
oligonucleotide.
20. The antisense compound of claim 19 wherein the antisense
oligonucleotide comprises at least one modified internucleoside
linkage.
21. The antisense compound of claim 20 wherein the modified
internucleoside linkage is a phosphorothioate linkage.
22. The antisense compound of claim 19 wherein the antisense
oligonucleotide comprises at least one modified sugar moiety.
23. The antisense compound of claim 22 wherein the modified sugar
moiety is a 2'-O-methoxyethyl moiety.
24. The antisense compound of claim 19 wherein the antisense
oligonucleotide comprises at least one modified nucleobase.
25. The antisense compound of claim 24 wherein the modified
nucleobase is a 5-methyl cytosine.
26. The antisense compound of claim 19 wherein the antisense
oligonucleotide is a chimeric oligonucleotide.
27. A pharmaceutical composition comprising the antisense compound
of claim 18 and a pharmaceutically acceptable carrier or
diluent.
28. The pharmaceutical composition of claim 27 further comprising a
colloidal dispersion system.
29. The pharmaceutical composition of claim 27 wherein the
antisense compound is an antisense oligonucleotide.
30. The pharmaceutical composition of claim 27 further comprising a
chemotherapeutic agent.
31. The pharmaceutical composition of claim 30 wherein the
chemotherapeutic agent is 5-fluorouracil.
32. A method of inhibiting the growth of a tumor in an animal
comprising administering to said animal an effective amount of the
pharmaceutical composition of claim 30.
33. A method of inhibiting the expression of focal adhesion kinase
in cells or tissues comprising contacting said cells or tissue with
the antisense compound of claim 18 so that expression of focal
adhesion kinase is inhibited.
34. A method of treating an animal having a disease or condition
associated with focal adhesion kinase comprising administering to
said animal a therapeutically or prophylactically effective amount
of an antisense compound 8 to 30 nucleobases in length targeted to
a nucleic acid molecule encoding human focal adhesion kinase
wherein said antisense compound inhibits the expression of human
focal adhesion kinase.
35. The method of claim 34 wherein the disease or condition is
cancer.
36. The method of claim 35 wherein said cancer is of the breast,
colon, mouth or skin.
37. The method of claim 34 wherein said disease or condition is an
angiogenic disorder.
38. The method of claim 37 wherein said angiogenic disorder is
retinal neovascularization.
39. A method of preventing migration of cells associated with
expression of focal adhesion kinase comprising administering to
said cells a therapeutically or prophylactically effective amount
of an antisense compound 8 to 30 nucleobases in length targeted to
a nucleic acid molecule encoding human focal adhesion kinase
wherein said antisense compound inhibits the expression of human
focal adhesion kinase.
40. A method of preventing neovascularization associated with
expression of focal adhesion kinase in an animal comprising
administering to said animal a therapeutically or prophylactically
effective amount of an antisense compound 8 to 30 nucleobases in
length targeted to a nucleic acid molecule encoding human focal
adhesion kinase wherein said antisense compound inhibits the
expression of human focal adhesion kinase.
41. A method of treating an animal having a disease or condition
associated with focal adhesion kinase comprising administering to
said animal a therapeutically or prophylactically effective amount
of an antisense compound 8 to 30 nucleobases in length targeted to
a nucleic acid molecule encoding human focal adhesion kinase in
combination with a therapeutically or prophylactically effective
amount of a chemotherapeutic agent.
42. The method of claim 41 wherein the chemotherapeutic agent is
5-fluorouracil.
43. The method of claim 41 wherein the disease or condition is
cancer.
44. The method of claim 43 wherein said cancer is melanoma.
Description
[0001] This application is a continuation of U.S. Application Ser.
No. 09/757,100 filed Jan. 9, 2001, which is a continuation-in-part
of the PCT Application No. PCT/US00/18999 filed Jul. 13, 2000 which
corresponds to U.S. Application Ser. No. 09/377,310 filed Aug. 19,
1999 now issued U.S. Pat. No. 6,133,031.
FIELD OF THE INVENTION
[0002] This invention relates to compositions and methods for
modulating expression of the human focal adhesion kinase (FAK)
gene, which encodes a signaling protein involved in growth factor
response and cell migration and is implicated in disease. This
invention is also directed to methods for inhibiting FAK-mediated
signal transduction; these methods can be used diagnostically or
therapeutically. Furthermore, this invention is directed to
treatment of conditions associated with expression of the human FAK
gene.
BACKGROUND OF THE INVENTION
[0003] Cell migration is fundamental to a variety of biological
processes and can be induced by both integrin receptor-mediated
signals (haptotaxis migration) and/or soluble growth
factor-mediated signals (chemotaxis migration). Integrin receptor
engagement activates focal adhesion kinase (FAK, also pp125FAK), a
non-receptor protein-tyrosine kinase localized to cell
substratum-extracellular matrix (ECM) contact sites that function
as part of a cytoskeletal-associated network of signaling proteins
(Schlaepfer, D. D., et al., Prog. Biophys. Mol. Biol., 1999, 71,
435-478). In adherent cells, FAK is often associated with integrins
at focal adhesions (Schaller, M. D., et al., Proc. Natl. Acad. Sci.
USA, 1992, 89, 5192-5196). Numerous other signaling proteins,
including other protein tyrosine kinases are associated with FAK at
these regions. Phosphorylation of FAK results in activation of the
mitogen-activated protein kinase pathway. In addition, FAK
regulates activation of phosphatidylinositol 3'-kinase which may
serve to prevent apoptosis. FAK has also been shown to be required
for internalization of bacteria mediated by invasin (Alrutz, M. A.
and Isberg, R. R., Proc. Natl. Acad. Sci. USA, 1998, 95,
13658-13663).
[0004] Normal cells typically require anchorage to the
extracellular matrix in order to grow. When these cells are removed
from the extracellular matrix, they undergo apoptosis. Transformed
cells, on the other hand, can grow under anchorage-independent
conditions, providing them a growth advantage and the ability to be
removed from their normal cellular environment.
[0005] Overexpression of FAK is involved in cancer progression.
High levels of FAK correlates with invasiveness and metastatic
potential in colon tumors (Weiner, T. M., et al., Lancet, 1993,
342, 1024-1025), breast tumors (Owens, L. V., et al., Cancer Res.,
1995, 55, 2752-2755), and oral cancers (Kornberg, L. J., Head Neck,
1998, 20, 634-639).
[0006] FAK's role in cell migration has led to the speculation that
it may be relevant in other diseases such as embryonic development
disfunctions and angiogenic disorders (Kornberg, L. J., Head Neck,
1998, 20, 634-639).
[0007] There is a lack of specific inhibitors of FAK. Antisense
approaches have been a means by which the function of FAK has been
investigated. Lou, J. et al. (J. Orthopaedic Res., 1997, 15,
911-918) used an adenoviral based vector to express antisense FAK
RNA to show that FAK is involved in wound healing in tendons.
Another antisense FAK expression vector containing 400 bp of
complementary sequence was used to study the interaction of type I
collagen and ?2?1 integrin (Takeuchi, Y., et al., J. Biol. Chem.,
1997, 272, 29309-29316).
[0008] Antisense oligonucleotides have been used in several
studies. Tanaka, S. et al. (J. Cell. Biochem., 1995, 58, 424-435)
disclose two antisense phosphorothioate oligonucleotides targeted
to the start site of mouse FAK. Xu, L.-H., et al. (Cell Growth
Diff., 1996, 7, 413-418) disclose two antisense phosphorothioate
oligonucleotides targeted within the coding region of human FAK.
They also show that FAK antisense treatment could induce apoptosis
in tumor cells. Sonoda, Y., et al. (Biochem. Biophys. Res. Comm.,
1997, 241, 769-774) also demonstrated a role for FAK in apoptosis
using antisense phosphorothioate oligonucleotides targeted to the
start site and within the coding region of human FAK. Shibata, K.,
et al. (Cancer Res., 1998, 58, 900-903) disclose antisense
phosphorothioate oligonucleotides targeted to the start site and
coding region of human FAK. Narase, K., et al. (Oncogene, 1998, 17,
455-463) disclose an antisense phosphorothioate oligonucleotide
targeted to the start site of human FAK.
[0009] There remains a long-felt need for improved compositions and
methods for inhibiting FAK gene expression.
SUMMARY OF THE INVENTION
[0010] The present invention provides antisense compounds which are
targeted to nucleic acids encoding focal adhesion kinase expression
(FAK) and are capable of modulating FAK mediated signaling. The
present invention also provides chimeric oligonucleotides targeted
to nucleic acids encoding human FAK. The antisense compounds of the
invention are believed to be useful both diagnostically and
therapeutically, and are believed to be particularly useful in the
methods of the present invention.
[0011] The present invention also comprises methods of modulating
FAK mediated signaling, in cells and tissues, using the antisense
compounds of the invention. Methods of inhibiting FAK expression
are provided; these methods are believed to be useful both
therapeutically and diagnostically. These methods are also useful
as tools, for example, for detecting and determining the role of
FAK in various cell functions and physiological processes and
conditions and for diagnosing conditions associated with expression
of FAK.
[0012] The present invention also comprises methods for diagnosing
and treating cancers, including those of the colon, breast and
mouth. These methods are believed to be useful, for example, in
diagnosing FAK-associated disease progression. These methods employ
the antisense compounds of the invention. These methods are
believed to be useful both therapeutically, including
prophylactically, and as clinical research and diagnostic
tools.
DETAILED DESCRIPTION OF THE INVENTION
[0013] FAK plays important roles in integrin-mediated signal
transduction. Overexpression of FAK is associated with tumor
progression and metastatic potential. As such, this protein
represents an attractive target for treatment of such diseases. In
particular, modulation of the expression of FAK may be useful for
the treatment of diseases such as colon cancer, breast cancer and
cancer of the mouth.
[0014] The present invention employs antisense compounds,
particularly oligonucleotides, for use in modulating the function
of nucleic acid molecules encoding FAK, ultimately modulating the
amount of FAK produced. This is accomplished by providing
oligonucleotides which specifically hybridize with nucleic acids,
preferably mRNA, encoding FAK.
[0015] This relationship between an antisense compound such as an
oligonucleotide and its complementary nucleic acid target, to which
it hybridizes, is commonly referred to as "antisense". "Targeting"
an oligonucleotide to a chosen nucleic acid target, in the context
of this invention, is a multistep process. The process usually
begins with identifying a nucleic acid sequence whose function is
to be modulated. This may be, as examples, a cellular gene (or mRNA
made from the gene) whose expression is associated with a
particular disease state, or a foreign nucleic acid from an
infectious agent. In the present invention, the targets are nucleic
acids encoding FAK; in other words, a gene encoding FAK, or mRNA
expressed from the FAK gene. mRNA which encodes FAK is presently
the preferred target. The targeting process also includes
determination of a site or sites within the nucleic acid sequence
for the antisense interaction to occur such that modulation of gene
expression will result.
[0016] In accordance with this invention, persons of ordinary skill
in the art will understand that messenger RNA includes not only the
information to encode a protein using the three letter genetic
code, but also associated ribonucleotides which form a region known
to such persons as the 5'-untranslated region, the 3'-untranslated
region, the 5' cap region and intron/exon junction ribonucleotides.
Thus, oligonucleotides may be formulated in accordance with this
invention which are targeted wholly or in part to these associated
ribonucleotides as well as to the informational ribonucleotides.
The oligonucleotide may therefore be specifically hybridizable with
a transcription initiation site region, a translation initiation
codon region, a 5' cap region, an intron/exon junction, coding
sequences, a translation termination codon region or sequences in
the 5'- or 3'-untranslated region. Since, as is known in the art,
the translation initiation codon is typically 5'-AUG (in
transcribed mRNA molecules; 5'-ATG in the corresponding DNA
molecule), the translation initiation codon is also referred to as
the "AUG codon," the "start codon" or the "AUG start codon." A
minority of genes have a translation initiation codon having the
RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and
5'-CUG have been shown to function in vivo. Thus, the terms
"translation initiation codon" and "start codon" can encompass many
codon sequences, even though the initiator amino acid in each
instance is typically methionine (in eukaryotes) or
formylmethionine (prokaryotes). It is also known in the art that
eukaryotic and prokaryotic genes may have two or more alternative
start codons, any one of which may be preferentially utilized for
translation initiation in a particular cell type or tissue, or
under a particular set of conditions. In the context of the
invention, "start codon" and "translation initiation codon" refer
to the codon or codons that are used in vivo to initiate
translation of an mRNA molecule transcribed from a gene encoding
FAK, regardless of the sequence(s) of such codons. It is also known
in the art that a translation termination codon (or "stop codon")
of a gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and
5'-UGA (the corresponding DNA sequences are 5'-TAA, 5'-TAG and
5'-TGA, respectively). The terms "start codon region," "AUG region"
and "translation initiation codon region" refer to a portion of
such an mRNA or gene that encompasses from about 25 to about 50
contiguous nucleotides in either direction (i.e., 5' or 3')from a
translation initiation codon. This region is a preferred target
region. Similarly, the terms "stop codon region" and "translation
termination codon region" refer to a portion of such an mRNA or
gene that encompasses from about 25 to about 50 contiguous
nucleotides in either direction (i.e., 5' or 3') from a translation
termination codon. This region is a preferred target region. The
open reading frame (ORF) or "coding region," which is known in the
art to refer to the region between the translation initiation codon
and the translation termination codon, is also a region which may
be targeted effectively. Other preferred target regions include the
5' untranslated region (5'UTR), known in the art to refer to the
portion of an mRNA in the 5' direction from the translation
initiation codon, and thus including nucleotides between the 5' cap
site and the translation initiation codon of an mRNA or
corresponding nucleotides on the gene and the 3' untranslated
region (3'UTR), known in the art to refer to the portion of an mRNA
in the 3' direction from the translation termination codon, and
thus including nucleotides between the translation termination
codon and 3' end of an mRNA or corresponding nucleotides on the
gene. The 5' cap of an mRNA comprises an N7-methylated guanosine
residue joined to the 5'-most residue of the mRNA via a 5'-5'
triphosphate linkage. The 5' cap region of an mRNA is considered to
include the 5' cap structure itself as well as the first 50
nucleotides adjacent to the cap. The 5' cap region may also be a
preferred target region.
[0017] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns",
which are excised from a pre-mRNA transcript to yield one or more
mature mRNA. The remaining (and therefore translated) regions are
known as "exons" and are spliced together to form a continuous mRNA
sequence. mRNA splice sites, i.e., exon-exon or intron-exon
junctions, may also be preferred target regions, and are
particularly useful in situations where aberrant splicing is
implicated in disease, or where an overproduction of a particular
mRNA splice product is implicated in disease. Aberrant fusion
junctions due to rearrangements or deletions are also preferred
targets. Targeting particular exons in alternatively spliced mRNAs
may also be preferred. It has also been found that introns can also
be effective, and therefore preferred, target regions for antisense
compounds targeted, for example, to DNA or pre-mRNA.
[0018] Once the target site or sites have been identified,
oligonucleotides are chosen which are sufficiently complementary to
the target, i.e., hybridize sufficiently well and with sufficient
specificity, to give the desired modulation.
[0019] "Hybridization", in the context of this invention, means
hydrogen bonding, also known as Watson-Crick base pairing, between
complementary bases, usually on opposite nucleic acid strands or
two regions of a nucleic acid strand. Guanine and cytosine are
examples of complementary bases which are known to form three
hydrogen bonds between them. Adenine and thymine are examples of
complementary bases which form two hydrogen bonds between them.
[0020] "Specifically hybridizable" and "complementary" are terms
which are used to indicate a sufficient degree of complementarity
such that stable and specific binding occurs between the DNA or RNA
target and the oligonucleotide.
[0021] It is understood that an oligonucleotide need not be 100%
complementary to its target nucleic acid sequence to be
specifically hybridizable. An oligonucleotide is specifically
hybridizable when binding of the oligonucleotide to the target
interferes with the normal function of the target molecule to cause
a loss of utility, and there is a sufficient degree of
complementarity to avoid non-specific binding of the
oligonucleotide to non-target sequences under conditions in which
specific binding is desired, i.e., under physiological conditions
in the case of in vivo assays or therapeutic treatment or, in the
case of in vitro assays, under conditions in which the assays are
conducted.
[0022] Hybridization of antisense oligonucleotides with mRNA
interferes with one or more of the normal functions of mRNA. The
functions of mRNA to be interfered with include all vital functions
such as, for example, translocation of the RNA to the site of
protein translation, translation of protein from the RNA, splicing
of the RNA to yield one or more mRNA species, and catalytic
activity which may be engaged in by the RNA. Binding of specific
protein(s) to the RNA may also be interfered with by antisense
oligonucleotide hybridization to the RNA.
[0023] The overall effect of interference with mRNA function is
modulation of expression of FAK. In the context of this invention
"modulation" means either inhibition or stimulation; i.e., either a
decrease or increase in expression. This modulation can be measured
in ways which are routine in the art, for example by Northern blot
assay of mRNA expression, or reverse transcriptase PCR, as taught
in the examples of the instant application or by Western blot or
ELISA assay of protein expression, or by an immunoprecipitation
assay of protein expression. Effects on cell proliferation or tumor
cell growth can also be measured, as taught in the examples of the
instant application. Inhibition is presently preferred.
[0024] The oligonucleotides of this invention can be used in
diagnostics, therapeutics, prophylaxis, and as research reagents
and in kits. Since the oligonucleotides of this invention hybridize
to nucleic acids encoding FAK, sandwich, calorimetric and other
assays can easily be constructed to exploit this fact. Provision of
means for detecting hybridization of oligonucleotide with the FAK
genes or mRNA can routinely be accomplished. Such provision may
include enzyme conjugation, radiolabelling or any other suitable
detection systems. Kits for detecting the presence or absence of
FAK may also be prepared.
[0025] The present invention is also suitable for diagnosing
abnormal inflammatory states or certain cancers in tissue or other
samples from patients suspected of having an autoimmune or
inflammatory disease such as hepatitis or cancers such as those of
the colon, liver or lung, and lymphomas. A number of assays may be
formulated employing the present invention, which assays will
commonly comprise contacting a tissue sample with an
oligonucleotide of the invention under conditions selected to
permit detection and, usually, quantitation of such inhibition. In
the context of this invention, to "contact" tissues or cells with
an oligonucleotide or oligonucleotides means to add the
oligonucleotide(s), usually in a liquid carrier, to a cell
suspension or tissue sample, either in vitro or ex vivo, or to
administer the oligonucleotide(s) to cells or tissues within an
animal.
[0026] The oligonucleotides of this invention may also be used for
research purposes. Thus, the specific hybridization exhibited by
the oligonucleotides may be used for assays, purifications,
cellular product preparations and in other methodologies which may
be appreciated by persons of ordinary skill in the art.
[0027] In the context of this invention, the term "oligonucleotide"
refers to an oligomer or polymer of ribonucleic acid or
deoxyribonucleic acid. This term includes oligonucleotides composed
of naturally-occurring nucleobases, sugars and covalent intersugar
(backbone) linkages as well as oligonucleotides having
non-naturally-occurring portions which function similarly. Such
modified or substituted oligonucleotides are often preferred over
native forms because of desirable properties such as, for example,
enhanced cellular uptake, enhanced binding to target and increased
stability in the presence of nucleases.
[0028] The antisense compounds in accordance with this invention
preferably comprise from about 5 to about 50 nucleobases.
Particularly preferred are antisense oligonucleotides comprising
from about 8 to about 30 nucleobases (i.e. from about 8 to about 30
linked nucleosides). As is known in the art, a nucleoside is a
base-sugar combination. The base portion of the nucleoside is
normally a heterocyclic base. The two most common classes of such
heterocyclic bases are the purines and the pyrimidines. Nucleotides
are nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2=, 3= or 5=hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn the respective ends of this
linear polymeric structure can be further joined to form a circular
structure, however, open linear structures are generally preferred.
Within the oligonucleotide structure, the phosphate groups are
commonly referred to as forming the internucleoside backbone of the
oligonucleotide. The normal linkage or backbone of RNA and DNA is a
3= to 5=phosphodiester linkage.
[0029] Specific examples of preferred antisense compounds useful in
this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, oligonucleotides having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified oligonucleotides that do not have a phosphorus atom
in their internucleoside backbone can also be considered to be
oligonucleosides.
[0030] Preferred modified oligonucleotide backbones include, for
example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters,
methyl and other alkyl phosphonates including 3=-alkylene
phosphonates and chiral phosphonates, phosphinates,
phosphoramidates including 3=-amino phosphoramidate and
aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriesters, and
boranophosphates having normal 3=-5=linkages, 2=-5=linked analogs
of these, and those having inverted polarity wherein the adjacent
pairs of nucleoside units are linked 3=-5= to 5=-3= or 2=-5= to
5=-2=. Various salts, mixed salts and free acid forms are also
included.
[0031] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050.
[0032] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; alkene containing backbones; sulfamate backbones;
methyleneimino and methylenehydrazino backbones; sulfonate and
sulfonamide backbones; amide backbones; and others having mixed N,
O, S and CH.sub.2 component parts.
[0033] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and
5,677,439.
[0034] In other preferred oligonucleotide mimetics, both the sugar
and the internucleoside linkage, i.e., the backbone, of the
nucleotide units are replaced with novel groups. The base units are
maintained for hybridization with an appropriate nucleic acid
target compound. One such oligomeric compound, an oligonucleotide
mimetic that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA
compounds, the sugar-backbone of an oligonucleotide is replaced
with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative United States patents that
teach the preparation of PNA compounds include, but are not limited
to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262. Further
teaching of PNA compounds can be found in Nielsen et al. (Science,
1991, 254, 1497-1500).
[0035] Most preferred embodiments of the invention are
oligonucleotides with phosphorothioate backbones and
oligonucleosides with heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone], --CH.sub.2--O--N(CH.sub.3)
--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above referenced U.S. Pat. No. 5,602,240. Also
preferred are oligonucleotides having morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0036] Modified oligonucleotides may also contain one or more
substituted sugar moieties. Preferred oligonucleotides comprise one
of the following at the 2' position: OH; F; O--, S--, or N-alkyl,
O-alkyl-O-alkyl, O--, S--, or N-alkenyl, or O--, S-- or N-alkynyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or
unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10
alkenyl and alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2, O(CH.sub.2).sub.nNH.sub.2,
O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10. Other preferred oligonucleotides comprise
one of the following at the 2=position: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or
O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3,
SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3,
NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an RNA cleaving group, a
reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes 2'-methoxyethoxy
(2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta
1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred
modification includes 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
and 2'-dimethylamino-ethoxyethoxy (2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.su- b.2--N(CH.sub.2).sub.2.
[0037] Other preferred modifications include 2'-methoxy
(2'-O--CH.sub.3), 2'-aminopropoxy
(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2'-fluoro (2'-F).
Similar modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2=-5=linked oligonucleotides and the
5' position of 5' terminal nucleotide. Oligonucleotides may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative U.S. patents that teach the
preparation of such modified sugars structures include, but are not
limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080;
5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134;
5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,0531
5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920.
[0038] Oligonucleotides may also include nucleobase (often referred
to in the art simply as "base") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include other synthetic and natural nucleobases such as
5-methylcytosine (5-me-C or m5c), 5-hydroxymethyl cytosine,
xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl
derivatives of adenine and guanine, 2-propyl and other alkyl
derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and
cytosine, 6-azo uracil, cytosine and thymine, 5-uracil
(pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol,
8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and
guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other
5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and
7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further
nucleobases include those disclosed in U.S. Pat. No. 3,687,808,
those disclosed in the Concise Encyclopedia Of Polymer Science And
Engineering 1990, pages 858-859, Kroschwitz, J. I., ed. John Wiley
& Sons, those disclosed by Englisch et al. (Angewandte Chemie,
International Edition 1991, 30, 613-722), and those disclosed by
Sanghvi, Y. S., Chapter 15, Antisense Research and Applications
1993, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press.
Certain of these nucleobases are particularly useful for increasing
the binding affinity of the oligomeric compounds of the invention.
These include 5-substituted pyrimidines, 6-azapyrimidines and N-2,
N-6 and O-6 substituted purines, including 2-aminopropyladenine,
5-propynyluracil and 5-propynylcytosine. 5-methylcytosine
substitutions have been shown to increase nucleic acid duplex
stability by 0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and
Lebleu, B., eds., Antisense Research and Applications 1993, CRC
Press, Boca Raton, pages 276-278) and are presently preferred base
substitutions, even more particularly when combined with
2'-O-methoxyethyl sugar modifications.
[0039] Representative U.S. patents that teach the preparation of
certain of the above noted modified nucleobases as well as other
modified nucleobases include, but are not limited to, the above
noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205;
5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187;
5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469;
5,594,121, 5,596,091; 5,614,617; and 5,681,941.
[0040] Another modification of the oligonucleotides of the
invention involves chemically linking to the oligonucleotide one or
more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the oligonucleotide. Such
moieties include but are not limited to lipid moieties such as a
cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA
1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med.
Chem. Lett. 1994, 4, 1053-1059), a thioether, e.g.,
hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci. 1992,
660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let. 1993, 3,
2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res.
1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or
undecyl residues (Saison-Behmoaras et al., EMBO J. 1991, 10,
1111-1118; Kabanov et al., FEBS Lett. 1990, 259, 327-330;
Svinarchuk et al., Biochimie 1993, 75, 49-54), a phospholipid,
e.g., di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett. 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res. 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett. 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther. 1996, 277, 923-937).
[0041] Representative U.S. patents that teach the preparation of
such oligonucleotide conjugates include, but are not limited to,
U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465;
5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731; 5,580,731;
5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603;
5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025;
4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582;
4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963;
5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250;
5,292,873; 5,317,098; 5,371,241; 5,391,723; 5,416,203; 5,451,463;
5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142;
5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928
and 5,688,941.
[0042] The present invention also includes oligonucleotides which
are chimeric oligonucleotides. "Chimeric" oligonucleotides or
"chimeras," in the context of this invention, are oligonucleotides
which contain two or more chemically distinct regions, each made up
of at least one nucleotide. These oligonucleotides typically
contain at least one region wherein the oligonucleotide is modified
so as to confer upon the oligonucleotide increased resistance to
nuclease degradation, increased cellular uptake, and/or increased
binding affinity for the target nucleic acid. An additional region
of the oligonucleotide may serve as a substrate for enzymes capable
of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H
is a cellular endonuclease which cleaves the RNA strand of an
RNA:DNA duplex. Activation of RNase H, therefore, results in
cleavage of the RNA target, thereby greatly enhancing the
efficiency of antisense inhibition of gene expression. Cleavage of
the RNA target can be routinely detected by gel electrophoresis
and, if necessary, associated nucleic acid hybridization techniques
known in the art. This RNAse H-mediated cleavage of the RNA target
is distinct from the use of ribozymes to cleave nucleic acids.
Ribozymes are not comprehended by the present invention.
[0043] Examples of chimeric oligonucleotides include but are not
limited to "gapmers," in which three distinct regions are present,
normally with a central region flanked by two regions which are
chemically equivalent to each other but distinct from the gap. A
preferred example of a gapmer is an oligonucleotide in which a
central portion (the "gap") of the oligonucleotide serves as a
substrate for RNase H and is preferably composed of
2'-deoxynucleotides, while the flanking portions (the 5' and 3'
"wings") are modified to have greater affinity for the target RNA
molecule but are unable to support nuclease activity (e.g., fluoro-
or 2'-O-methoxyethyl-substituted). Chimeric oligonucleotides are
not limited to those with modifications on the sugar, but may also
include oligonucleosides or oligonucleotides with modified
backbones, e.g., with regions of phosphorothioate (P.dbd.S) and
phosphodiester (P.dbd.O) backbone linkages or with regions of MMI
and P.dbd.S backbone linkages. Other chimeras include "wingmers,"
also known in the art as "hemimers," that is, oligonucleotides with
two distinct regions. In a preferred example of a wingmer, the 5'
portion of the oligonucleotide serves as a substrate for RNase H
and is preferably composed of 2'-deoxynucleotides, whereas the 3'
portion is modified in such a fashion so as to have greater
affinity for the target RNA molecule but is unable to support
nuclease activity (e.g., 2'-fluoro- or
2'-O-methoxyethyl-substituted), or vice-versa. In one embodiment,
the oligonucleotides of the present invention contain a
2'-O-methoxyethyl (2'-O--CH.sub.2CH.sub.2OCH.sub.3) modification on
the sugar moiety of at least one nucleotide. This modification has
been shown to increase both affinity of the oligonucleotide for its
target and nuclease resistance of the oligonucleotide. According to
the invention, one, a plurality, or all of the nucleotide subunits
of the oligonucleotides of the invention may bear a
2'-O-methoxyethyl (--O--CH.sub.2CH.sub.2OCH.sub.3) modification.
Oligonucleotides comprising a plurality of nucleotide subunits
having a 2'-O-methoxyethyl modification can have such a
modification on any of the nucleotide subunits within the
oligonucleotide, and may be chimeric oligonucleotides. Aside from
or in addition to 2'-O-methoxyethyl modifications, oligonucleotides
containing other modifications which enhance antisense efficacy,
potency or target affinity are also preferred. Chimeric
oligonucleotides comprising one or more such modifications are
presently preferred.
[0044] The oligonucleotides used in accordance with this invention
may be conveniently and routinely made through the well-known
technique of solid phase synthesis. Equipment for such synthesis is
sold by several vendors including Applied Biosystems. Any other
means for such synthesis may also be employed; the actual synthesis
of the oligonucleotides is well within the talents of the
routineer. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and 2'-alkoxy or
2'-alkoxyalkoxy derivatives, including 2'-O-methoxyethyl
oligonucleotides (Martin, P., Helv. Chim. Acta 1995, 78, 486-504).
It is also well known to use similar techniques and commercially
available modified amidites and controlled-pore glass (CPG)
products such as biotin, fluorescein, acridine or psoralen-modified
amidites and/or CPG (available from Glen Research, Sterling, Va.)
to synthesize fluorescently labeled, biotinylated or other
conjugated oligonucleotides.
[0045] The antisense compounds of the present invention include
bioequivalent compounds, including pharmaceutically acceptable
salts and prodrugs. This is intended to encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof. Accordingly,
for example, the disclosure is also drawn to pharmaceutically
acceptable salts of the nucleic acids of the invention and prodrugs
of such nucleic acids. Pharmaceutically acceptable salts are
physiologically and pharmaceutically acceptable salts of the
nucleic acids of the invention: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto (see, for example, Berge et
al., "Pharmaceutical Salts," J. of Pharma Sci. 1977, 66, 1-19).
[0046] For oligonucleotides, examples of pharmaceutically
acceptable salts include but are not limited to (a) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (b) acid
addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (c) salts formed with organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid,
succinic acid, maleic acid, fumaric acid, gluconic acid, citric
acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
and (d) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0047] The oligonucleotides of the invention may additionally or
alternatively be prepared to be delivered in a Aprodrug form. The
term Aprodrug indicates a therapeutic agent that is prepared in an
inactive form that is converted to an active form (i.e., drug)
within the body or cells thereof by the action of endogenous
enzymes or other chemicals and/or conditions. In particular,
prodrug versions of the oligonucleotides of the invention are
prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives
according to the methods disclosed in WO 93/24510 to Gosselin et
al., published Dec. 9, 1993.
[0048] For therapeutic or prophylactic treatment, oligonucleotides
are administered in accordance with this invention. Oligonucleotide
compounds of the invention may be formulated in a pharmaceutical
composition, which may include pharmaceutically acceptable
carriers, thickeners, diluents, buffers, preservatives, surface
active agents, neutral or cationic lipids, lipid complexes,
liposomes, penetration enhancers, carrier compounds and other
pharmaceutically acceptable carriers or excipients and the like in
addition to the oligonucleotide. Such compositions and formulations
are comprehended by the present invention.
[0049] Pharmaceutical compositions comprising the oligonucleotides
of the present invention may include penetration enhancers in order
to enhance the alimentary delivery of the oligonucleotides.
Penetration enhancers may be classified as belonging to one of five
broad categories, i.e., fatty acids, bile salts, chelating agents,
surfactants and non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems 1991, 8, 91-192; Muranishi,
Critical Reviews in Therapeutic Drug Carrier Systems 1990, 7,
1-33). One or more penetration enhancers from one or more of these
broad categories may be included.
[0050] Various fatty acids and their derivatives which act as
penetration enhancers include, for example, oleic acid, lauric
acid, capric acid, myristic acid, palmitic acid, stearic acid,
linoleic acid, linolenic acid, dicaprate, tricaprate, recinleate,
monoolein (a.k.a. 1-monooleoyl-rac-glycerol), dilaurin, caprylic
acid, arachidonic acid, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, mono-
and di-glycerides and physiologically acceptable salts thereof
(i.e., oleate, laurate, caprate, myristate, palmitate, stearate,
linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug
Carrier Systems 1991, page 92; Muranishi, Critical Reviews in
Therapeutic Drug Carrier Systems 1990, 7, 1; El-Hariri et al., J.
Pharm. Pharmacol. 1992 44, 651-654).
[0051] The physiological roles of bile include the facilitation of
dispersion and absorption of lipids and fat-soluble vitamins
(Brunton, Chapter 38 In: Goodman & Gilman's The Pharmacological
Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill,
New York, N.Y., 1996, pages 934-935). Various natural bile salts,
and their synthetic derivatives, act as penetration enhancers.
Thus, the term "bile salt" includes any of the naturally occurring
components of bile as well as any of their synthetic
derivatives.
[0052] Complex formulations comprising one or more penetration
enhancers may be used. For example, bile salts may be used in
combination with fatty acids to make complex formulations.
[0053] Chelating agents include, but are not limited to, disodium
ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g.,
sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl
derivatives of collagen, laureth-9 and N-amino acyl derivatives of
beta-diketones (enamines) [Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems 1991, page 92; Muranishi, Critical
Reviews in Therapeutic Drug Carrier Systems 1990, 7, 1-33; Buur et
al., J. Control Rel. 1990, 14, 43-51). Chelating agents have the
added advantage of also serving as DNase inhibitors.
[0054] Surfactants include, for example, sodium lauryl sulfate,
polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems
1991, page 92); and perfluorochemical emulsions, such as FC-43
(Takahashi et al., J. Pharm. Phamacol. 1988, 40, 252-257).
[0055] Non-surfactants include, for example, unsaturated cyclic
ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et
al., Critical Reviews in Therapeutic Drug Carrier Systems 1991,
page 92); and non-steroidal anti-inflammatory agents such as
diclofenac sodium, indomethacin and phenylbutazone (Yamashita et
al., J. Pharm. Pharmacol. 1987, 39, 621-626).
[0056] As used herein, "carrier compound" refers to a nucleic acid,
or analog thereof, which is inert (i.e., does not possess
biological activity per se) but is recognized as a nucleic acid by
in vivo processes that reduce the bioavailability of a nucleic acid
having biological activity by, for example, degrading the
biologically active nucleic acid or promoting its removal from
circulation. The coadministration of a nucleic acid and a carrier
compound, typically with an excess of the latter substance, can
result in a substantial reduction of the amount of nucleic acid
recovered in the liver, kidney or other extracirculatory
reservoirs, presumably due to competition between the carrier
compound and the nucleic acid for a common receptor.
[0057] In contrast to a carrier compound, a "pharmaceutically
acceptable carrier" (excipient) is a pharmaceutically acceptable
solvent, suspending agent or any other pharmacologically inert
vehicle for delivering one or more nucleic acids to an animal. The
pharmaceutically acceptable carrier may be liquid or solid and is
selected with the planned manner of administration in mind so as to
provide for the desired bulk, consistency, etc., when combined with
a nucleic acid and the other components of a given pharmaceutical
composition. Typical pharmaceutically acceptable carriers include,
but are not limited to, binding agents (e.g., pregelatinized maize
starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose,
etc.); fillers (e.g., lactose and other sugars, microcrystalline
cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose,
polyacrylates or calcium hydrogen phosphate, etc.); lubricants
(e.g., magnesium stearate, talc, silica, colloidal silicon dioxide,
stearic acid, metallic stearates, hydrogenated vegetable oils, corn
starch, polyethylene glycols, sodium benzoate, sodium acetate,
etc.); disintegrates (e.g., starch, sodium starch glycolate, etc.);
or wetting agents (e.g., sodium lauryl sulphate, etc.). Sustained
release oral delivery systems and/or enteric coatings for orally
administered dosage forms are described in U.S. Pat. Nos.
4,704,295; 4,556,552; 4,309,406; and 4,309,404.
[0058] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may contain additional
compatible pharmaceutically-active materials, such as, e.g.,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the composition of present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the invention.
[0059] Regardless of the method by which the oligonucleotides of
the invention are introduced into a patient, colloidal dispersion
systems may be used as delivery vehicles to enhance the in vivo
stability of the oligonucleotides and/or to target the
oligonucleotides to a particular organ, tissue or cell type.
Colloidal dispersion systems include, but are not limited to,
macromolecule complexes, nanocapsules, microspheres, beads and
lipid-based systems including oil-in-water emulsions, micelles,
mixed micelles, liposomes and lipid:oligonucleotide complexes of
uncharacterized structure. A preferred colloidal dispersion system
is a plurality of liposomes. Liposomes are microscopic spheres
having an aqueous core surrounded by one or more outer layers made
up of lipids arranged in a bilayer configuration (see, generally,
Chonn et al., Current Op. Biotech. 1995, 6, 698-708).
[0060] The pharmaceutical compositions of the present invention may
be administered in a number of ways depending upon whether local or
systemic treatment is desired and upon the area to be treated.
Administration may be topical (including ophthalmic, vaginal,
rectal, intranasal, epidermal, and transdermal), oral or
parenteral. Parenteral administration includes intravenous drip,
subcutaneous, intraperitoneal or intramuscular injection, pulmonary
administration, e.g., by inhalation or insufflation, or
intracranial, e.g., intrathecal or intraventricular,
administration. Oligonucleotides with at least one
2'-O-methoxyethyl modification are believed to be particularly
useful for oral administration.
[0061] Formulations for topical administration may include
transdermal patches, ointments, lotions, creams, gels, drops,
suppositories, sprays, liquids and powders. Conventional
pharmaceutical carriers, aqueous, powder or oily bases, thickeners
and the like may be necessary or desirable. Coated condoms, gloves
and the like may also be useful.
[0062] Compositions for oral administration include powders or
granules, suspensions or solutions in water or non-aqueous media,
capsules, sachets or tablets. Thickeners, flavoring agents,
diluents, emulsifiers, dispersing aids or binders may be
desirable.
[0063] Compositions for parenteral administration may include
sterile aqueous solutions which may also contain buffers, diluents
and other suitable additives. In some cases it may be more
effective to treat a patient with an oligonucleotide of the
invention in conjunction with other traditional therapeutic
modalities in order to increase the efficacy of a treatment
regimen. In the context of the invention, the term "treatment
regimen" is meant to encompass therapeutic, palliative and
prophylactic modalities. For example, a patient may be treated with
conventional chemotherapeutic agents, particularly those used for
tumor and cancer treatment. Examples of such chemotherapeutic
agents include but are not limited to daunorubicin, daunomycin,
dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin,
bleomycin, mafosfamide, ifosfamide, cytosine arabinoside,
bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D,
mithramycin, prednisone, hydroxyprogesterone, testosterone,
tamoxifen, dacarbazine, procarbazine, hexamethylmelamine,
pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil,
methylcyclohexylnitrosurea, nitrogen mustards, melphalan,
cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA),
5-azacytidine, hydroxyurea, deoxycoformycin,
4-hydroxyperoxycyclophosphor- amide, 5-fluorouracil (5-FU),
5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine,
taxol, vincristine, vinblastine, etoposide, trimetrexate,
teniposide, cisplatin and diethylstilbestrol (DES). See, generally,
The Merck Manual of Diagnosis and Therapy, 15th Ed. 1987, pp.
1206-1228; Berkow et al., eds., Rahway, N.J. When used with the
compounds of the invention, such chemotherapeutic agents may be
used individually (e.g., 5-FU and oligonucleotide), sequentially
(e.g., 5-FU and oligonucleotide for a period of time followed by
MTX and oligonucleotide), or in combination with one or more other
such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide,
or 5-FU, radiotherapy and oligonucleotide).
[0064] The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill of
those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50s found to be
effective in vitro and in in vivo animal models. In general, dosage
is from 0.01 .mu.g to 100 g per kg of body weight, and may be given
once or more daily, weekly, monthly or yearly, or even once every 2
to 20 years. Persons of ordinary skill in the art can easily
estimate repetition rates for dosing based on measured residence
times and concentrations of the drug in bodily fluids or tissues.
Following successful treatment, it may be desirable to have the
patient undergo maintenance therapy to prevent the recurrence of
the disease state, wherein the oligonucleotide is administered in
maintenance doses, ranging from 0.01 .mu.g to 100 g per kg of body
weight, once or more daily, to once every 20 years.
[0065] The following examples illustrate the present invention and
are not intended to limit the same.
EXAMPLES
Example 1
Synthesis of Oligonucleotides
[0066] Unmodified oligodeoxynucleotides are synthesized on an
automated DNA synthesizer (Applied Biosystems model 380B) using
standard phosphoramidite chemistry with oxidation by iodine.
.beta.-cyanoethyldiisopropyl-phosphoramidites are purchased from
Applied Biosystems (Foster City, Calif.). For phosphorothioate
oligonucleotides, the standard oxidation bottle was replaced by a
0.2 M solution of .sup.3H-1,2-benzodithiole-3-one 1,1-dioxide in
acetonitrile for the stepwise thiation of the phosphite linkages.
The thiation cycle wait step was increased to 68 seconds and was
followed by the capping step. Cytosines may be 5-methyl cytosines.
(5-methyl deoxycytidine phosphoramidites available from Glen
Research, Sterling, Va. or Amersham Pharmacia Biotech, Piscataway,
N.J.)
[0067] 2'-methoxy oligonucleotides are synthesized using 2'-methoxy
.beta.-cyanoethyldiisopropyl-phosphoramidites (Chemgenes, Needham,
Mass.) and the standard cycle for unmodified oligonucleotides,
except the wait step after pulse delivery of tetrazole and base is
increased to 360 seconds. Other 2'-alkoxy oligonucleotides are
synthesized by a modification of this method, using appropriate
2'-modified amidites such as those available from Glen Research,
Inc., Sterling, Va.
[0068] 2'-fluoro oligonucleotides are synthesized as described in
Kawasaki et al. (J. Med. Chem. 1993, 36, 831-841). Briefly, the
protected nucleoside N.sup.6-benzoyl-2'-deoxy-2'-fluoroadenosine is
synthesized utilizing commercially available
9-.beta.-D-arabinofuranosyladenine as starting material and by
modifying literature procedures whereby the 2'-a-fluoro atom is
introduced by a S.sub.N2-displacement of a 2'-.beta.-O-trifyl
group. Thus N.sup.6-benzoyl-9-.beta.-D-arabinofuranosy- ladenine is
selectively protected in moderate yield as the
3',5'-ditetrahydropyranyl (THP) intermediate. Deprotection of the
THP and N.sup.6-benzoyl groups is accomplished using standard
methodologies and standard methods are used to obtain the
5'-dimethoxytrityl-(DMT) and 5'-DMT-3'-phosphoramidite
intermediates.
[0069] The synthesis of 2'-deoxy-2'-fluoroguanosine is accomplished
using tetraisopropyldisiloxanyl (TPDS) protected
9-.beta.-D-arabinofuranosylgua- nine as starting material, and
conversion to the intermediate
diisobutyryl-arabinofuranosylguanosine. Deprotection of the TPDS
group is followed by protection of the hydroxyl group with THP to
give diisobutyryl di-THP protected arabinofuranosylguanine.
Selective O-deacylation and triflation is followed by treatment of
the crude product with fluoride, then deprotection of the THP
groups. Standard methodologies are used to obtain the 5'-DMT- and
5'-DMT-3'-phosphoramidit- es.
[0070] Synthesis of 2'-deoxy-2'-fluorouridine is accomplished by
the modification of a known procedure in which
2,2'-anhydro-1-.beta.-D-arabin- ofuranosyluracil is treated with
70% hydrogen fluoride-pyridine. Standard procedures are used to
obtain the 5'-DMT and 5'-DMT-3' phosphoramidites.
2'-deoxy-2'-fluorocytidine is synthesized via amination of
2'-deoxy-2'-fluorouridine, followed by selective protection to give
N.sup.4-benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures are
used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.
[0071] 2'-(2-methoxyethyl)-modified amidites were synthesized
according to Martin, P. (Helv. Chim. Acta 1995, 78, 486-506). For
ease of synthesis, the last nucleotide may be a deoxynucleotide.
2'-O--CH.sub.2CH.sub.2OCH.s- ub.3-cytosines may be 5-methyl
cytosines.
Synthesis of 5-Methyl Cytosine Monomers
[0072] 2,2'-Anhydro
[1-(.beta.-D-arabinofuranosyl)-5-methyluridine]:
[0073] 5-Methyluridine (ribosylthymine, commercially available
through Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenylcarbonate
(90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) were
added to DMF (300 mL). The mixture was heated to reflux, with
stirring, allowing the evolved carbon dioxide gas to be released in
a controlled manner. After 1 hour, the slightly darkened solution
was concentrated under reduced pressure. The resulting syrup was
poured into diethylether (2.5 L), with stirring. The product formed
a gum. The ether was decanted and the residue was dissolved in a
minimum amount of methanol (ca. 400 mL). The solution was poured
into fresh ether (2.5 L) to yield a stiff gum. The ether was
decanted and the gum was dried in a vacuum oven (60.degree. C. at 1
mm Hg for 24 h) to give a solid which was crushed to a light tan
powder (57 g, 85% crude yield). The material was used as is for
further reactions.
[0074] 2'-O-Methoxyethyl-5-methyluridine:
[0075] 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M),
tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol
(1.2 L) were added to a 2 L stainless steel pressure vessel and
placed in a pre-heated oil bath at 160.degree. C. After heating for
48 hours at 155-160.degree. C., the vessel was opened and the
solution evaporated to dryness and triturated with MeOH (200 mL).
The residue was suspended in hot acetone (1 L). The insoluble salts
were filtered, washed with acetone (150 mL) and the filtrate
evaporated. The residue (280 g) was dissolved in CH.sub.3CN (600
mL) and evaporated. A silica gel column (3 kg) was packed in
CH.sub.2Cl.sub.2/acetone/MeOH (20:5:3) containing 0.5% Et.sub.3NH.
The residue was dissolved in CH.sub.2Cl.sub.2 (250 mL) and adsorbed
onto silica (150 g) prior to loading onto the column. The product
was eluted with the packing solvent to give 160 g (63%) of
product.
[0076] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine:
[0077] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M). was
co-evaporated with pyridine (250 mL) and the dried residue
dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the mixture stirred at
room temperature for one hour. A second aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the reaction stirred for
an additional one hour. Methanol (170 mL) was then added to stop
the reaction. HPLC showed the presence of approximately 70%
product. The solvent was evaporated and triturated with CH.sub.3CN
(200 mL). The residue was dissolved in CHCl.sub.3 (1.5 L) and
extracted with 2.times.500 mL of saturated NaHCO.sub.3 and
2.times.500 mL of saturated NaCl. The organic phase was dried over
Na.sub.2SO.sub.4, filtered and evaporated. 275 g of residue was
obtained. The residue was purified on a 3.5 kg silica gel column,
packed and eluted with EtOAc/Hexane/Acetone (5:5:1) containing 0.5%
Et.sub.3NH. The pure fractions were evaporated to give 164 g of
product. Approximately 20 g additional was obtained from the impure
fractions to give a total yield of 183 g (57%).
[0078]
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine:
[0079] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyl-uridine (106
g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from
562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38
mL, 0.258 M) were combined and stirred at room temperature for 24
hours. The reaction was monitored by tlc by first quenching the tlc
sample with the addition of MeOH. Upon completion of the reaction,
as judged by tlc, MeOH (50 mL) was added and the mixture evaporated
at 35.degree. C. The residue was dissolved in CHCl.sub.3 (800 mL)
and extracted with 2.times.200 mL of saturated sodium bicarbonate
and 2.times.200 mL of saturated NaCl. The water layers were back
extracted with 200 mL of CHCl.sub.3. The combined organics were
dried with sodium sulfate and evaporated to give 122 g of residue
(approx. 90% product). The residue was purified on a 3.5 kg silica
gel column and eluted using EtOAc/Hexane(4:1). Pure product
fractions were evaporated to yield 96 g (84%).
[0080]
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triaz-
oleuridine:
[0081] A first solution was prepared by dissolving
3'-O-acetyl-2'-O-methox-
yethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in
CH.sub.3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M)
was added to a solution of triazole (90 g, 1.3 M) in CH.sub.3CN (1
L), cooled to -5?C. and stirred for 0.5 h using an overhead
stirrer. POCl.sub.3 was added dropwise, over a 30 minute period, to
the stirred solution maintained at 0-10.degree. C., and the
resulting mixture stirred for an additional 2 hours. The first
solution was added dropwise, over a 45 minute period, to the later
solution. The resulting reaction mixture was stored overnight in a
cold room. Salts were filtered from the reaction mixture and the
solution was evaporated. The residue was dissolved in EtOAc (1 L)
and the insoluble solids were removed by filtration. The filtrate
was washed with 1.times.300 mL of NaHCO.sub.3 and 2.times.300 mL of
saturated NaCl, dried over sodium sulfate and evaporated. The
residue was triturated with EtOAc to give the title compound.
[0082] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine:
[0083] A solution of
3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5--
methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and
NH.sub.4OH (30 mL) was stirred at room temperature for 2 hours. The
dioxane solution was evaporated and the residue azeotroped with
MeOH (2.times.200 mL). The residue was dissolved in MeOH (300 mL)
and transferred to a 2 liter stainless steel pressure vessel. MeOH
(400 mL) saturated with NH.sub.3 gas was added and the vessel
heated to 100.degree. C. for 2 hours (tlc showed complete
conversion). The vessel contents were evaporated to dryness and the
residue was dissolved in EtOAc (500 mL) and washed once with
saturated NaCl (200 mL). The organics were dried over sodium
sulfate and the solvent was evaporated to give 85 g (95%) of the
title compound.
[0084]
N.sup.4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-cyt-
idine:
[0085] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyl-cytidine (85
g, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride
(37.2 g, 0.165 M) was added with stirring. After stirring for 3
hours, tlc showed the reaction to be approximately 95% complete.
The solvent was evaporated and the residue azeotroped with MeOH
(200 mL). The residue was dissolved in CHCl.sub.3 (700 mL) and
extracted with saturated NaHCO.sub.3 (2.times.300 mL) and saturated
NaCl (2.times.300 mL), dried over MgSO.sub.4 and evaporated to give
a residue (96 g). The residue was chromatographed on a 1.5 kg
silica column using EtOAc/Hexane (1:1) containing 0.5% Et.sub.3NH
as the eluting solvent. The pure product fractions were evaporated
to give 90 g (90%) of the title compound.
[0086]
N.sup.4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcyti-
dine-3'-amidite:
[0087]
N.sup.4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcyti-
dine (74 g, 0.10 M) was dissolved in CH.sub.2Cl.sub.2 (1 L).
Tetrazole diisopropylamine (7.1 g) and
2-cyanoethoxytetra(isopropyl)phosphite (40.5 mL, 0.123 M) were
added with stirring, under a nitrogen atmosphere. The resulting
mixture was stirred for 20 hours at room temperature (tlc showed
the reaction to be 95% complete). The reaction mixture was
extracted with saturated NaHCO.sub.3 (1.times.300 mL) and saturated
NaCl (3.times.300 mL). The aqueous washes were back-extracted with
CH.sub.2Cl.sub.2 (300 mL), and the extracts were combined, dried
over MgSO.sub.4 and concentrated. The residue obtained was
chromatographed on a 1.5 kg silica column using EtOAcHexane (3:1)
as the eluting solvent. The pure fractions were combined to give
90.6 g (87%) of the title compound.
[0088] 5-methyl-2'-deoxycytidine (5-me-C) containing
oligonucleotides were synthesized according to published methods
(Sanghvi et al., Nucl. Acids Res. 1993, 21, 3197-3203) using
commercially available phosphoramidites (Glen Research, Sterling
Va. or ChemGenes, Needham Mass.).
2=-O-(dimethylaminooxyethyl) nucleoside amidites
[0089] 2'-(Dimethylaminooxyethoxy) nucleoside amidites [also known
in the art as 2'-O-(dimethylaminooxyethyl) nucleoside amidites] are
prepared as described in the following paragraphs. Adenosine,
cytidine and guanosine nucleoside amidites are prepared similarly
to the thymidine (5-methyluridine) except the exocyclic amines are
protected with a benzoyl moiety in the case of adenosine and
cytidine and with isobutyryl in the case of guanosine.
[0090]
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
[0091] O.sup.2-2'-anhydro-5-methyluridine (Pro. Bio. Sint., Varese,
Italy, 100.0 g, 0.416 mmol), dimethylaminopyridine (0.66 g, 0.013
eq, 0.0054 mmol) were dissolved in dry pyridine (500 ml) at ambient
temperature under an argon atmosphere and with mechanical stirring
tert-Butyldiphenylchlorosilane (125.8 g, 119.0 mL, 1.1 eq, 0.458
mmol) was added in one portion. The reaction was stirred for 16 h
at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicated a
complete reaction. The solution was concentrated under reduced
pressure to a thick oil. This was partitioned between
dichloromethane (1 L) and saturated sodium bicarbonate (2.times.1
L) and brine (1 L). The organic layer was dried over sodium sulfate
and concentrated under reduced pressure to a thick oil. The oil was
dissolved in a 1:1 mixture of ethyl acetate and ethyl ether (600
mL) and the solution was cooled to -10.degree. C. The resulting
crystalline product was collected by filtration, washed with ethyl
ether (3.times.200 mL) and dried (40.degree. C., 1 mm Hg, 24 h) to
149 g (74.8%) of white solid. TLC and NMR were consistent with pure
product.
[0092]
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
[0093] In a 2 L stainless steel, unstirred pressure reactor was
added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the
fume hood and with manual stirring, ethylene glycol (350 mL,
excess) was added cautiously at first until the evolution of
hydrogen gas subsided.
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
(149 g, 0.311 mol) and sodium bicarbonate (0.074 g, 0.003 eq) were
added with manual stirring. The reactor was sealed and heated in an
oil bath until an internal temperature of 160.degree. C. was
reached and then maintained for 16 h (pressure<100 psig). The
reaction vessel was cooled to ambient and opened. TLC (Rf 0.67 for
desired product and Rf 0.82 for ara-T side product, ethyl acetate)
indicated about 70% conversion to the product. In order to avoid
additional side product formation, the reaction was stopped,
concentrated under reduced pressure (10 to 1 mm Hg) in a warm water
bath (40-100.degree. C.) with the more extreme conditions used to
remove the ethylene glycol. [Alternatively, once the low boiling
solvent is gone, the remaining solution can be partitioned between
ethyl acetate and water. The product will be in the organic phase.]
The residue was purified by column chromatography (2 kg silica gel,
ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate
fractions were combined, stripped and dried to product as a white
crisp foam (84 g, 50%), contaminated starting material (17.4 g) and
pure reusable starting material 20 g. The yield based on starting
material less pure recovered starting material was 58%. TLC and NMR
were consistent with 99% pure product.
[0094]
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridi-
ne
[0095]
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
(20 g, 36.98 mmol) was mixed with triphenylphosphine (11.63 g,
44.36 mmol) and N-hydroxyphthalimide (7.24 g, 44.36 mmol). It was
then dried over P.sub.2O.sub.5 under high vacuum for two days at
40.degree. C. The reaction mixture was flushed with argon and dry
THF (369.8 mL, Aldrich, sure seal bottle) was added to get a clear
solution. Diethyl-azodicarboxylate (6.98 mL, 44.36 mmol) was added
dropwise to the reaction mixture. The rate of addition is
maintained such that resulting deep red coloration is just
discharged before adding the next drop. After the addition was
complete, the reaction was stirred for 4 hrs. By that time TLC
showed the completion of the reaction (ethylacetate:hexane, 60:40).
The solvent was evaporated in vacuum. Residue obtained was placed
on a flash column and eluted with ethyl acetate:hexane (60:40), to
get
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine
as white foam (21.819, 86%).
[0096]
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-met-
hyluridine
[0097]
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridi-
ne (3.1 g, 4.5 mmol) was dissolved in dry CH.sub.2Cl.sub.2 (4.5 mL)
and methylhydrazine (300 mL, 4.64 mmol) was added dropwise at
-10.degree. C. to 0.degree. C. After 1 hr the mixture was filtered,
the filtrate was washed with ice cold CH.sub.2Cl.sub.2 and the
combined organic phase was washed with water, brine and dried over
anhydrous Na.sub.2SO.sub.4. The solution was concentrated to get
2'-O-(aminooxyethyl) thymidine, which was then dissolved in MeOH
(67.5 mL). To this formaldehyde (20% aqueous solution, w/w, 1.1
eg.) was added and the mixture for 1 hr. Solvent was removed under
vacuum; residue chromatographed to get
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)
ethyl]-5-methyluridine as white foam (1.95, 78%).
[0098] 5'-O-tert-Butyldiphenylsilyl-2
'-O-[N,N-dimethylaminooxyethyl]-5-me- thyluridine
[0099]
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-met-
hyluridine (1.77 g, 3.12 mmol) was dissolved in a solution of 1M
pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6 mL). Sodium
cyanoborohydride (0.39 g, 6.13 mmol) was added to this solution at
10.degree. C. under inert atmosphere. The reaction mixture was
stirred for 10 minutes at 10.degree. C. After that the reaction
vessel was removed from the ice bath and stirred at room
temperature for 2 hr, the reaction monitored-by TLC (5% MeOH in
CH.sub.2Cl.sub.2). Aqueous NaHCO.sub.3 solution (5%, 10 mL) was
added and extracted with ethyl acetate (2.times.20 mL). Ethyl
acetate phase was dried over anhydrous Na.sub.2SO.sub.4, evaporated
to dryness. Residue was dissolved in a solution of 1M PPTS in MeOH
(30.6 mL). Formaldehyde (20% w/w, 30 mL, 3.37 mmol) was added and
the reaction mixture was stirred at room temperature for 10
minutes. Reaction mixture cooled to 10.degree. C. in an ice bath,
sodium cyanoborohydride (0.39 g, 6.13 mmol) was added and reaction
mixture stirred at 10.degree. C. for 10 minutes. After 10 minutes,
the reaction mixture was removed from the ice bath and stirred at
room temperature for 2 hrs. To the reaction mixture 5% NaHCO.sub.3
(25 mL) solution was added and extracted with ethyl acetate
(2.times.25 mL). Ethyl acetate layer was dried over anhydrous
Na.sub.2SO.sub.4 and evaporated to dryness . The residue obtained
was purified by flash column chromatography and eluted with 5% MeOH
in CH.sub.2Cl.sub.2 to get
5'-O-tert-butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5-methyluri-
dine as a white foam (14.6 g, 80%).
[0100] 2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0101] Triethylamine trihydrofluoride (3.91 mL, 24.0 mmol) was
dissolved in dry THF and triethylamine (1.67 mL, 12 mmol, dry, kept
over KOH). This mixture of triethylamine-2HF was then added to
5'-O-tert-butyldiphenylsil-
yl-2'-O-[N,N-dimethylaminooxyethyl]-5-methyluridine (1.40 g, 2.4
mmol) and stirred at room temperature for 24 hrs. Reaction was
monitored by TLC (5% MeOH in CH.sub.2Cl.sub.2). Solvent was removed
under vacuum and the residue placed on a flash column and eluted
with 10% MeOH in CH.sub.2Cl.sub.2 to get
2'-O-(dimethylaminooxyethyl)-5-methyluridine (766 mg, 92.5%).
[0102] 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0103] 2'-O-(dimethylaminooxyethyl)-5-methyluridine (750 mg, 2.17
mmol) was dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. It was then co-evaporated with anhydrous pyridine (20
mL). The residue obtained was dissolved in pyridine (11 mL) under
argon atmosphere. 4-dimethylaminopyridine (26.5 mg, 2.60 mmol),
4,4'-dimethoxytrityl chloride (880 mg, 2.60 mmol) was added to the
mixture and the reaction mixture was stirred at room temperature
until all of the starting material disappeared. Pyridine was
removed under vacuum and the residue chromatographed and eluted
with 10% MeOH in CH.sub.2Cl.sub.2 (containing a few drops of
pyridine) to get 5'-O-DMT-2'-O-(dimethylamino-oxyethyl)-5--
methyluridine (1.13 g, 80%).
[0104]
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2--
cyanoethyl)-N,N-diisopropylphosphoramidite]
[0105] 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine (1.08
g, 1.67 mmol) was co-evaporated with toluene (20 mL). To the
residue N,N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) was
added and dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. Then the reaction mixture was dissolved in anhydrous
acetonitrile (8.4 mL) and
2-cyanoethyl-N,N,N.sup.1,N.sup.1-tetraisopropylphosphoramidite
(2.12 mL, 6.08 mmol) was added. The reaction mixture was stirred at
ambient temperature for 4 hrs under inert atmosphere. The progress
of the reaction was monitored by TLC (hexane:ethyl acetate 1:1).
The solvent was evaporated, then the residue was dissolved in ethyl
acetate (70 mL) and washed with 5% aqueous NaHCO.sub.3 (40 mL).
Ethyl acetate layer was dried over anhydrous Na.sub.2SO.sub.4 and
concentrated. Residue obtained was chromatographed (ethyl acetate
as eluent) to get 5'-O-DMT-2'-O-(2-N,N-dim-
ethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoethyl)-N,N-diisopropylphos-
phoramidite] as a foam (1.04 g, 74.9%).
[0106] Oligonucleotides having methylene(methylimino) (MMI)
backbones are synthesized according to U.S. Pat. No. 5,378,825,
which is coassigned to the assignee of the present invention and is
incorporated herein in its entirety. For ease of synthesis, various
nucleoside dimers containing MMI linkages are synthesized and
incorporated into oligonucleotides. Other nitrogen-containing
backbones are synthesized according to WO 92/20823 which is also
coassigned to the assignee of the present invention and
incorporated herein in its entirety.
[0107] Oligonucleotides having amide backbones are synthesized
according to De Mesmaeker et al. (Acc. Chem. Res. 1995, 28,
366-374). The amide moiety is readily accessible by simple and
well-known synthetic methods and is compatible with the conditions
required for solid phase synthesis of oligonucleotides.
[0108] Oligonucleotides with morpholino backbones are synthesized
according to U.S. Pat. No. 5,034,506 (Summerton and Weller).
[0109] Peptide-nucleic acid (PNA) oligomers are synthesized
according to P. E. Nielsen et al. (Science 1991, 254,
1497-1500).
[0110] After cleavage from the controlled pore glass column
(Applied Biosystems) and deblocking in concentrated ammonium
hydroxide at 55.degree. C. for 18 hours, the oligonucleotides are
purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes
ethanol. Synthesized oligonucleotides were analyzed by
polyacrylamide gel electrophoresis on denaturing gels or capillary
gel electrophoresis and judged to be at least 85% full length
material. The relative amounts of phosphorothioate and
phosphodiester linkages obtained in synthesis were periodically
checked by .sup.31P nuclear magnetic resonance spectroscopy, and
for some studies oligonucleotides were purified by HPLC, as
described by Chiang et al. (J. Biol. Chem. 1991, 266, 18162).
Results obtained with HPLC-purified material were similar to those
obtained with non-HPLC purified material.
[0111] Alternatively, oligonucleotides are synthesized in 96 well
plate format via solid phase P(III) phosphoramidite chemistry on an
automated synthesizer capable of assembling 96 sequences
simultaneously in a standard 96 well format. Phosphodiester
internucleotide linkages are afforded by oxidation with aqueous
iodine. Phosphorothioate internucleotide linkages are generated by
sulfurization utilizing 3,H-1,2 benzodithilole-3-one 1,1 dioxide
(Beaucage Reagent) in anhydrous acetonitrile. Standard
base-protected beta-cyanoethyl-di-isopropyl phosphoramidites are
purchased from commercial vendors (e.g. PE-Applied Biosystems,
Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard
nucleosides are synthesized as per published methods. They are
utilized as base protected beta-cyanoethyldiisopropyl
phosphoramidites.
[0112] Oligonucleotides were cleaved from support and deprotected
with concentrated NH.sub.4OH at elevated temperature (55-60.degree.
C.) for 12-16 hours and the released product then dried in vacuo.
The dried product was then re-suspended in sterile water to afford
a master plate from which all analytical and test plate samples are
then diluted utilizing robotic pipettors.
Example 2
Human FAK Oligonucleotide Sequences
[0113] Antisense oligonucleotides were designed to target human
FAK. Target sequence data are from the focal adhesion kinase (FAK)
cDNA sequence published by Whitney, G.S., et al. (DNA Cell Biol.,
1993, 12, 823-830); Genbank accession number L13616, provided
herein as SEQ ID NO: 1. One set of oligonucleotides were
synthesized as chimeric oligonucleotides ("gapmers"), 20
nucleotides in length, composed of a central "gap" region
consisting of ten 2'-deoxynucleotides, which is flanked on both
sides (5' and 3' directions) by five-nucleotide "wings." The wings
are composed of 2'-methoxyethyl (2'-MOE) nucleotides. The
internucleoside (backbone) linkages are phosphorothioate (P.dbd.S)
throughout the oligonucleotide. All 2'-MOE cytosines were
5-methyl-cytosines. These oligonucleotide sequences are shown in
Table 1. An identical set of sequences were prepared as fully
phosphorothioated oligodeoxynucleotides. These are shown in Table
2. An additional set of oligonucleotides were synthesized as
chimeric oligonucleotides ("gapmers"), 15 nucleotides in length,
composed of a central "gap" region consisting of five
2'-deoxynucleotides, which is flanked on both sides (5' and 3'
directions) by five-nucleotide "wings." The wings are composed of
2'-methoxyethyl (2'-MOE) nucleotides. The internucleoside
(backbone) linkages are phosphorothioate (P.dbd.S) throughout the
oligonucleotide. All 2'-MOE cytosines were 5-methyl-cytosines.
These oligonucleotide sequences are shown in Table 3. An identical
set of sequences were prepared as fully phosphorothioated
oligodeoxynucleotides. These are shown in Table 4.
[0114] Human A549 lung carcinoma cells (American Type Culture
Collection, Manassas, Va.) were grown in DMEM supplemented with 10%
fetal bovine serum (FBS), non-essential amino acids for MEM, sodium
pyruvate (1 mM), penicillin (50 U/ml) and streptomycin (50
.mu.g/ml). All cell culture reagents were obtained from Life
Technologies (Rockville, Md.).
[0115] The cells were washed once with OPTIMEM.TM. (Life
Technologies, Rockville, Md.), then transfected with 400 nM
oligonucleotide and 12 mg/ml LIPOFECTIN.RTM. (Life Technologies,
Rockville, Md.), a 1:1 (w/w) liposome formulation of the cationic
lipid N-[1-(2,3-dioleyloxy)propyl]-n- ,n,n-trimethylammonium
chloride (DOTMA), and dioleoyl phosphotidylethanolamine (DOPE) in
membrane filtered water. The cells were incubated with
oligonucleotide for four hours, after which the media was replaced
with fresh media and the cells incubated for another 20 hours.
[0116] Total cellular RNA was isolated using an ATLAS.TM. Pure RNA
isolation kit (Clontech, Palo Alto, Calif.). RNA was then separated
on a 1.2% agarose-formaldehyde gel, transferred to
Hybond-N+membrane (Amersham Pharmacia Biotech, Arlington Heights,
Ill.), a positively charged nylon membrane. Immobilized RNA was
cross-linked by exposure to UV light. Membranes were probed with
either FAK or glyceraldehyde 3-phosphate dehydrogenase (G3PDH)
probes. The probes were labeled by random primer using the
PRIME-A-GENE.sup.7 Labeling System, Promega, Madison, Wis.) and
hybridized to the membranes. mRNA signals were quantitated by a
PhosphoImager (Molecular Dynamics, Sunnyvale, Calif.).
[0117] Results of an initial screen of the FAK antisense
oligonucleotides are shown in Tables 5 (20 mers) and 6 (15 mers).
Oligonucleotides 15392 (SEQ ID NO. 3), 15394 (SEQ ID NO. 4), 15397
(SEQ ID NO. 6), 15399 (SEQ ID NO. 7), 15401 (SEQ ID NO. 8),
15403.(SEQ ID NO. 9), 15405 (SEQ ID NO. 10), 15407 (SEQ ID NO. 11),
15409 (SEQ ID NO. 12), 15413 (SEQ ID NO. 14), 15415 (SEQ ID NO.
15), 15458 (SEQ ID NO. 16), 15460 (SEQ ID NO. 17), 15421 (SEQ ID
NO. 18), 15425 (SEQ ID NO. 20), 15393 (SEQ ID NO. 23), 15406 (SEQ
ID NO. 30), 15408 (SEQ ID NO. 31) and 15412 (SEQ ID NO. 33)
resulted in about 50% or greater inhibition of FAK mRNA expression
in this assay. Oligonucleotides 15401 (SEQ ID NO. 8), 15403 (SEQ ID
NO. 9), 15409 (SEQ ID NO. 12), 15413 (SEQ ID NO. 14), 15415 (SEQ ID
NO. 15), and 15421 (SEQ ID NO. 18) resulted in about 80% or greater
inhibition of FAK mRNA expression.
1TABLE 1 Nucleotide Sequences of Human FAK Chimeric (deoxy gapped)
20 mer Phosphorothioate Oligonucleotides SEQ TARGET GENE GENE ISIS
NUCLEOTIDE SEQUENCE.sup.1 ID NUCLEOTIDE TARGET NO. (5'->3') NO:
CO-ORDINATES.sup.2 REGION 15392 CCGCGGGCTCACAGTGGTCG 3 0001-0020
5'-UTR 15394 GGCGCCGTGAAGCGAAGGCA 4 0078-0097 5'-UTR 15395
CAGTTCTGCTCGGACCGCGG 5 0101-0120 5'-UTR 15397 GAAACTGCAGAAGGCACTGA
6 0150-0169 5'-UTR 15399 TTCTCCCTTCCGTTATTCTT 7 0183-0202 5'-UTR
15401 CTAGATGCTAGGTATCTGTC 8 0206-0225 5'-UTR 15403
TTTTGCTAGATGCTAGGTAT 9 0211-0230 5'-UTR 15405 GGTAAGCAGCTGCCATTATT
10 0229-0248 start 15407 AGTACCCAGGTGAGTCTTAG 11 0285-0304 coding
15409 CCTGACATCAGTAGCATCTC 12 0408-0427 coding 15411
GTTGGCTTATCTTCAGTAAA 13 0641-0660 coding 15413 GGTTAGGGATGGTGCCGTCA
14 1218-1237 coding 15415 TGTTGGTTTCCAATCGGACC 15 2789-2808 coding
15417 CTAGGGGAGGCTCAGTGTGG 16 3383-3402 stop 15419
ATTCCTCGCTGCTGGTGGAA 17 3444-3463 3'-UTR 15421 TTTCAACCAGATGGTCATTC
18 3510-3529 3'-UTR 15423 TTCTGAATATCATGATTGAA 19 3590-3609 3'-UTR
15425 CATGATGCTTAAAAGCTTAC 20 3658-3677 3'-UTR 15427
AATGTGAACATAAATTGTTC 21 3680-3699 3'-UTR 15429 AAGGTAGTTTAGGAATTAAG
22 3738-3757 3'-UTR .sup.1Emboldened residues are 2'-methoxyethoxy
residues, 2'-methoxyethoxy cytosine residues are
5-methyl-cytosines; all linkages are phosphorothioate linkages.
.sup.2Coordinates from Genbank Accession No. L13616, locus name
"HUMFAKX", SEQ ID NO. 1.
[0118]
2TABLE 2 Nucleotide Sequences of Human FAK 20 mer Phosphorothioate
Oligonucleotides SEQ TARGET GENE GENE ISIS NUCLEOTIDE
SEQUENCE.sup.1 ID NUCLEOTIDE TARGET NO. (5'->3') NO:
CO-ORDINATES.sup.2 REGION 15432 CCGCGGGCTCACAGTGGTCG 3 0001-0020
5'-UTR 15434 GGCGCCGTGAAGCGAAGGCA 4 0078-0097 5'-UTR 15436
CAGTTCTGCTCGGACCGCGG 5 0101-0120 5'-UTR 15438 GAAACTGCAGAAGGCACTGA
6 0150-0169 5'-UTR 15440 TTCTCCCTTCCGTTATTCTT 7 0183-0202 5'-UTR
15442 CTAGATGCTAGGTATCTGTC 8 0206-0225 5'-UTR 15444
TTTTGCTAGATGCTAGGTAT 9 0211-0230 5'-UTR 15446 GGTAAGCAGCTGCCATTATT
10 0229-0248 start 15448 AGTACCCAGGTGAGTCTTAG 11 0285-0304 coding
15450 CCTGACATCAGTAGCATCTC 12 0408-0427 coding 15452
GTTGGCTTATCTTCAGTAAA 13 0641-0660 coding 15454 GGTTAGGGATGGTGCCGTCA
14 1218-1237 coding 15456 TGTTGGTTTCCAATCGGACC 15 2789-2808 coding
15458 CTAGGGGAGGCTCAGTGTGG 16 3383-3402 stop 15460
ATTCCTCGCTGCTGGTGGAA 17 3444-3463 3'-UTR 15462 TTTCAACCAGATGGTCATTC
18 3510-3529 3'-UTR 15464 TTCTGAATATCATGATTGAA 19 3590-3609 3'-UTR
15466 CATGATGCTTAAAAGCTTAC 20 3658-3677 3'-UTR 15468
AATGTGAACATAAATTGTTC 21 3680-3699 3'-UTR 15470 AAGGTAGTTTAGGAATTAAG
22 3738-3757 3'-UTR .sup.1All linkages are phosphorothioate
linkages. .sup.2Coordinates from Genbank Accession No. L13616,
locus name "HUMFAKX", SEQ ID NO. 1.
[0119]
3TABLE 3 Nucleotide Sequences of Human FAK Chimeric (deoxy gapped)
15 mer Phosphorothioate Oligonucleotides SEQ TARGET GENE GENE ISIS
NUCLEOTIDE SEQUENCE.sup.1 ID NUCLEOTIDE TARGET NO. (5'->3') NO:
CO-ORDINATES.sup.2 REGION 15393 GCGGGCTCACAGTGG 23 0004-0018 5'-UTR
15431 CGCCGTGAAGCGAAG 24 0081-0095 5'-UTR 15396 GTTCTGCTCGGACCG 25
0104-0118 5'-UTR 15398 AACTGCAGAAGGCAC 26 0153-0167 5'-UTR 15400
CTCCCTTCCGTTATT 27 0186-0200 5'-UTR 15402 AGATGCTAGGTATCT 28
0209-0223 5'-UTR 15404 TTGCTAGATGCTAGG 29 0214-0228 5'-UTR 15406
TAAGCAGCTGCCATT 30 0232-0246 start 15408 TACCCAGGTGAGTCT 31
0288-0302 coding 15410 TGACATCAGTAGCAT 32 0411-0425 coding 15412
TGGCTTATCTTCAGT 33 0644-0658 coding 15414 TTAGGGATGGTGCCG 34
1221-1235 coding 15416 TTGGTTTCCAATCGG 35 2792-2806 coding 15418
AGGGGAGGCTCAGTG 36 3386-3400 stop 15420 TCCTCGCTGCTGGTG 37
3447-3461 3'-UTR 15422 TCAACCAGATGGTCA 38 3513-3527 3'-UTR 15424
CTGAATATCATGATT 39 3593-3607 3'-UTR 15426 TGATGCTTAAAAGCT 40
3661-3675 3'-UTR 15428 TGTGAACATAAATTG 41 3683-3697 3'-UTR 15430
GGTAGTTTAGGAATT 42 3741-3755 3'-UTR .sup.1Emboldened residues are
2'-methoxyethoxy residues, 2'-methoxyethoxy cytosine residues are
5-methyl-cytosines; all linkages are phosphorothioate linkages.
.sup.2Coordinates from Genbank Accession No. L13616, locus name
"HUMFAKX", SEQ ID NO. 1.
[0120]
4TABLE 4 Nucleotide Sequences of Human FAK 15 mer Phosphorothioate
Oligonucleotides SEQ TARGET GENE GENE ISIS NUCLEOTIDE
SEQUENCE.sup.1 ID NUCLEOTIDE TARGET NO. (5'->3') NO:
CO-ORDINATES.sup.2 REGION 15433 GCGGGCTCACAGTGG 23 0004-0018 5'-UTR
15435 CGCCGTGAAGCGAAG 24 0081-0095 5'-UTR 15437 GTTCTGCTCGGACCG 25
0104-0118 5'-UTR 15439 AACTGCAGAAGGCAC 26 0153-0167 5'-UTR 15441
CTCCCTTCCGTTATT 27 0186-0200 5'-UTR 15443 AGATGCTAGGTATCT 28
0209-0223 5'-UTR 15445 TTGCTAGATGCTAGG 29 0214-0228 5'-UTR 15447
TAAGCAGCTGCCATT 30 0232-0246 start 15449 TACCCAGGTGAGTCT 31
0288-0302 coding 15451 TGACATCAGTAGCAT 32 0411-0425 coding 15453
TGGCTTATCTTCAGT 33 0644-0658 coding 15455 TTAGGGATGGTGCCG 34
1221-1235 coding 15457 TTGGTTTCCAATCGG 35 2792-2806 coding 15459
AGGGGAGGCTCAGTG 36 3386-3400 stop 15461 TCCTCGCTGCTGGTG 37
3447-3461 3'-UTR 15463 TCAACCAGATGGTCA 38 3513-3527 3'-UTR 15465
CTGAATATCATGATT 39 3593-3607 3'-UTR 15467 TGATGCTTAAAAGCT 40
3661-3675 3'-UTR 15469 TGTGAACATAAATTG 41 3683-3697 3'-UTR 15471
GGTAGTTTAGGAATT 42 3741-3755 3'-UTR .sup.1All linkages are
phosphorothioate linkages. .sup.2Coordinates from Genbank Accession
No. L13616, locus name "HUMFAKX", SEQ ID NO. 1.
[0121]
5TABLE 5 Inhibition of Human Fak mRNA expression in A549 Cells by
FAK 20 mer Antisense Oligonucleotides SEQ GENE ISIS ID TARGET %
mRNA % mRNA No: NO: REGION EXPRESSION INHIBITION control -- -- 100%
0% 15392 3 5'-UTR 29% 71% 15432 3 5'-UTR 108% -- 15394 4 5'-UTR 30%
70% 15434 4 5'-UTR 147% -- 15395 5 5'-UTR 57% 43% 15436 5 5'-UTR
88% 12% 15397 6 5'-UTR 31% 69% 15438 6 5'-UTR 64% 36% 15399 7
5'-UTR 48% 52% 15440 7 5'-UTR 92% 8% 15401 8 5'-UTR 17% 83% 15442 8
5'-UTR 63% 37% 15403 9 5'-UTR 17% 83% 15444 9 5'-UTR 111% -- 15405
10 start 46% 54% 15446 10 start 145% -- 15407 11 coding 36% 64%
15448 11 coding 90% 10% 15409 12 coding 13% 87% 15450 12 coding
149% -- 15411 13 coding 70% 30% 15452 13 coding 129% -- 15413 14
coding 22% 78% 15454 14 coding 82% 18% 15415 15 coding 20% 80%
15456 15 coding 88% 12% 15417 16 stop 56% 44% 15458 16 stop 39% 61%
15419 17 3'-UTR 55% 45% 15460 17 3'-UTR 42% 58% 15421 18 3'-UTR 20%
80% 15462 18 3'-UTR 60% 40% 15423 19 3'-UTR 55% 45% 15464 19 3'-UTR
97% 3% 15425 20 3'UTR 51% 49% 15466 20 3'-UTR 74% 26% 15427 21
3'-UTR 67% 33% 15468 21 3'-UTR 131% -- 15429 22 3'-UTR 57% 43%
15470 22 3'-UTR 71% 29%
[0122]
6TABLE 6 Inhibition of Human Fak mRNA expression in A549 Cells by
FAK 15 mer antisense oligonucleotides SEQ GENE ISIS ID TARGET %
mRNA % mRNA No: NO: REGION EXPRESSION INHIBITION control -- -- 100%
0% 15393 23 5'-UTR 40% 60% 15433 23 5'-UTR 160% -- 15431 24 5'-UTR
59% 41% 15435 24 5'-UTR 121% -- 15396 25 5'-UTR 76% 24% 15437 25
5'-UTR 123% -- 15398 26 5'-UTR 72% 28% 15439 26 5'-UTR 64% 36%
15400 27 5'-UTR 79% 21% 15441 27 5'-UTR 66% 34% 15402 28 5'-UTR 69%
31% 15443 28 5'-UTR 99% 1% 15404 29 5'-UTR 70% 30% 15445 29 5'-UTR
151% -- 15406 30 start 32% 68% 15447 30 start 69% 31% 15408 31
coding 35% 65% 15449 31 coding 89% 11% 15410 32 coding 67% 33%
15451 32 coding 142% -- 15412 33 coding 43% 57% 15453 33 coding
115% -- 15414 34 coding 64% 36% 15455 34 coding 59% 41% 15416 35
coding 69% 31% 15457 35 coding 121% -- 15418 36 stop 140% -- 15459
36 stop 72% 28% 15420 37 3'-UTR 158% -- 15461 37 3'-UTR 62% 38%
15422 38 3'-UTR 153% -- 15463 38 3'-UTR 91% 9% 15424 39 3'-UTR 207%
-- 15465 39 3'-UTR 88% 12% 15426 40 3'-UTR 171% -- 15467 40 3'-UTR
105% -- 15428 41 3'-UTR 95% 5% 15469 41 3'-UTR 96% 4% 15430 42
3'-UTR 137% -- 15471 42 3'-UTR 131% --
Example 3
Dose Response of Antisense Phosphorothioate Oligonucleotide Effects
on FAK Levels in A549 Cells
[0123] Several of the more active oligonucleotides were chosen for
a dose response study. A549 cells were grown, treated and processed
as described in Example 2, except the concentration of
oligonucleotide was varied.
[0124] Results are shown in Table 7. Many oligonucleotides showed
IC.sub.50s of 50 nM or less and maximal inhibition seen was
95%.
7TABLE 7 Dose Response of A549 cells to FAK Phosphorothioate
Oligonucleotides SEQ ID ASO Gene % mRNA % mRNA ISIS # NO: Target
Dose Expression Inhibition control -- -- -- 100.0% -- 15932 3
5'-UTR 50 nM 80.3% 19.7% " " " 200 nM 41.6% 58.4% " " " 400 nM
28.3% 71.7% 15393 23 5'-UTR 50 nM 116.6% -- " " " 200 nM 87.8%
12.2% " " " 400 nM 60.7% 39.3% 15401 8 5'UTR 50 nM 31.9% 68.1% " "
" 200 nM 26.8% 73.2% " " " 400 nM 20.4% 79.6% 15403 9 5'-UTR 50 nM
82.7% 17.3% " " " 200 nM 27.8% 72.2% " " " 400 nM 18.6% 81.4% 15406
30 start 50 nM 51.6% 48.4% " " " 200 nM 40.5% 59.5% " " " 400 nM
39.3% 60.7% 15408 31 coding 50 nM 47.7% 52.3% " " " 200 nM 67.8%
32.2% " " " 400 nM 53.2% 46.8% 15409 12 coding 50 nM 30.1% 69.9% "
" " 200 nM 29.7% 70.3% " " " 400 nM 18.9% 81.1% 15413 14 coding 50
nM 45.6% 54.4% " " " 200 nM 21.6% 78.4% " " " 400 nM 20.6% 79.4%
15415 15 coding 50 nM 46.9% 53.1% " " " 200 nM 18.0% 82.0% " " "
400 nM 8.0% 92.0% 15421 18 3'-UTR 50 nM 25.0% 75.0% " " " 200 nM
14.8% 85.2% " " " 400 nM 5.0% 95.0%
[0125] A dose response experiment on protein levels was done with
two oligonucleotides. A549 cells were grown and treated as
described in Example 2 except the concentration was varied as shown
in Table 3. The LIPOFECTIN.RTM. to oligonucleotide ratio was
maintained at 3 mg/ml LIPOFECTIN.RTM. per 100 nM oligonucleotide.
FAK protein levels were determined 48 hours after antisense
treatment in whole cell lysates by anti-FAK blotting. Cells on 10
cm plates were lysed with 0.5 ml modified RIPA lysis buffer,
diluted with 0.5 ml HNTG buffer (50 mM HEPES, pH 7.4, 150 mM NaCl,
0.1% Triton X-100, 10% glycerol), incubated with agarose beads, and
cleared by centrifugation. Immunoprecipitations with a polyclonal
FAK antibody (Salk Institute of Biological Studies, La Jolla,
Calif.; additional FAK antibodies available from Upstate
Biotechnology Incorporated, Lake Placid, N.Y.) were performed for 4
hr at 4.degree. C., collected on protein A (Repligen, Cambridge,
Mass.) or protein G-plus (Calbiochem) agarose beads, and the
precipitated protein complexes were washed at 4.degree. C. in
Triton only lysis buffer (modified RIPA without sodium deoxycholate
and SDS) followed by washing in HNTG buffer prior to direct
analysis by SDS-PAGE. For immunoblotting, proteins were transferred
to polyvinylidene fluoride membranes (Millipore) and incubated with
a 1:1000 dilution of polyclonal antibody for 2 hr at room
temperature. Bound primary antibody was visualized by enhanced
chemiluminescent detection.
[0126] Results are shown in Table 8.
8TABLE 8 Dose Response of A549 cells to FAK Phosphorothioate
Oligonucleotides SEQ ID ASO Gene % protein % protein ISIS # NO:
Target Dose Expression Inhibition control -- -- -- 100% -- 15409 12
coding 25 nM 60% 40% " " " 100 nM 57% 43% " " " 200 nM 23% 77%
15421 18 3'-UTR 25 nM 73% 27% " " " 100 nM 34% 66% " " " 200 nM 24%
76%
Example 4
Effect of FAK Antisense Phosphorothioate Oligonucleotides on Growth
Factor Stimulated Migration and Invasion
[0127] Integrin-regulated focal adhesion kinase (FAK) is an
important component of epidermal (EGF) and platelet-drived (PDGF)
growth factor-induced motility of primary fibroblasts, smooth
muscle, and adenocarcinoma cells. To measure the effect of FAK
antisense oligonucleotides on cell migration, a modified Boyden
chamber (Millipore, Bedford, Mass.) assay was used (Sieg, D. J., et
al., J. Cell Sci., 1999, 112, 2677-2691). Both membrane sides were
coated with rat tail collagen (5 ?g/ml in PBS, Boehringer Mannheim)
for 2 hr at 37.degree. C., washed with PBS, and the chambers were
placed into 24 well dishes containing migration media (0.5 ml DMEM
containing 0.5% BSA) with or without human recombinant PDGF-BB,
EGF, or basic-FGF (Calbiochem, San Diego, Calif.) at the indicated
concentrations. Serum-starved A549 cells (1.times.10.sup.5 cells in
0.3 ml migration media) were added to the upper chamber and after 3
hr at 37.degree. C., the cells on the membrane upper surface were
removed by a cotton tip applicator, the migratory cells on the
lower membrane surface were fixed, stained (0.1% crystal violet,
0.1 M borate pH 9.0, 2% EtOH), and the dye eluted for absorbance
measurements at 600 nM. Individual experiments represent the
average from three individual chambers. Background levels of cell
migration (less than 5% of total) in the absence of chemotaxis
stimuli (0.5% BSA only) were subtracted from all points.
[0128] Results are shown in Table 9. ISIS 17636 (SEQ ID NO. 43) is
a five base mismatch control oligonucleotide for ISIS 15421 (SEQ ID
NO. 18).
9TABLE 9 Effect of FAK Antisense Phosphorothioate Oligonucleotides
on EGF-Stimulated Cell Migration SEQ ID ASO Gene EGF ISIS # NO:
Target (ng/ml) A.sub.600 control -- -- 2.5 0.74 15421 18 3'-UTR "
0.26 17636 43 control " 0.90 control -- -- 5.0 0.89 15421 18 3'-UTR
" 0.25 17636 43 control " 0.77
[0129] FAK antisense oligonucleotides were tested in an in vitro
invasion assay using an .about.1 mm MATRIGEL.RTM. (Becton
Dickinson, Franklin Lakes, N.J.) basement membrane barrier (Albini,
A., Pathol. Oncol. Res., 1998, 4, 230-241). Migration chambers were
coated with the indicated concentration of MATRIGEL.RTM., dried
under laminar flow and then rehydrated with cold serum free DMEM
for 90 min on an orbital shaker. A549 cells were grown and
transfected as described in Example 2. Cells (1.times.10.sup.5)
were then placed onto the MATRIGEL.RTM. coated membrane and allowed
to invade through the MATRIGEL.RTM. towards a 10% FBS
chemoattractant for the indicated times. Cells that invaded through
the MATRIGEL.RTM. were visualized by crystal violet staining as
detailed in the migration assay. The amount of MATRIGEL.RTM. was
varied in the assay to show that invasion was being measured and
that the migration was not serum-induced.
[0130] Results are shown in Table 10.
10TABLE 10 Effect of FAK Antisense Phosphorothioate
Oligonucleotides on Tumor Cell Invasion SEQ ID ASO Gene
MATRIGEL.sup.R Migration ISIS # NO: Target (.mu.g/chamber)
(A.sub.600) control -- -- 0 8.3 15421 18 3'-UTR " 2.8 17636 43
control " 9.9 control -- -- 15 4.5 15421 18 3'-UTR " 2.0 17636 43
control " 4.3 control -- -- 26 1.6 15421 18 3'-UTR " 0.7 17636 43
control " 1.3
Example 5
FAK Antisense Oligonucleotides in a Retinal Neovascularization
Model
[0131] FAK antisense oligonucleotides were tested in a rabbit model
of retinal neovascularization (Kimura, H., et al., Invest.
Opthalmol. Vis. Sci., 1995, 36, 2110-2119). In this model, growth
factors are encapsulated and injected beneath the retina.
[0132] Eight male Dutch Belt rabbits and one male Black Satin/New
Zealand White Cross rabbit were used in this study. ISIS 15409 (SEQ
ID NO. 12) was administered intravitreally by injection, once prior
to surgical implantation of the polymeric pellets and once during
pellet implantation. Retinal neovascularization was monitored by
indirect opthalmolscopy and documented by fundus photography.
Retinal neovascularization was graded on a scale from 1 to 5, with
one being normal and five showing retinal hemorrhaging and/or
detachment. In animals injected with saline and the growth factor
containing pellets, evidence of retinal neovascularization could be
detected in the first week and retinal hemorrhaging began by the
end of the third week. Animals receiving the antisense FAK
oligonucleotide showed no evidence of retinal neovascularization
over a four week period.
Example 6
Effect of FAK Antisense Phosphorothioate Oligonucleotide (ISIS
15421) Alone and in Combination with 5-Flurouracil on the Viability
of Melanoma Cell Lines
[0133] Inhibition of FAK in tumor cell lines causes cell rounding,
loss of adhesion, and apoptosis which suggests a role for these
inhibitors in the treatment of metastatic conditions. In these
studies, an antisense inhibitor of FAK was tested alone and in
combination with the chemotherapeutic agent, 5-FU for its effects
on melanoma cell line viability.
[0134] C8161 and BL human melanoma cell lines were treated with
ISIS 15421 (SEQ. ID. NO 18) or a control oligonucleotide, ISIS
29848, a 20-mer random oligonucleotide (NNNNNNNNNNNNNNNNNNNN,
wherein each N is a mixture of A, C, G and T; herein incorporated
as SEQ ID NO: 44) using the lipofectin protocol described herein.
Oligonucleotides were transfected for four hours at 300 nM in
lipofectin reagent and 5-FU (200 .mu.g/mL; SIGMA) was added after
the incubation for 20 hours. Cell viability was determined by the
MTT assay. Loss of adhesion and apoptosis were determined by cell
counting and the TUNEL assay, respectively. FAK expression was
assayed by Western blot, probing with the anti-FAK clone 4.47
antibody (Upstate Biotechnology, Lake Placid, N.Y.).
[0135] In The BL melanoma cell line, treatment with ISIS 15421
resulted in a 23% reduction in cell viability compared to control
(p<0.0001). Addition of 5-FU to the antisense treated cells
resulted in a significant further reduction in cell viability (69%;
p<0.0001) compared to treatment with ISIS 15421 or 5-FU alone
(4.4% reduction; p=0.15) or the control oligonucleotide, ISIS
29848. Similar results were seen with the C8161 cell line.
[0136] In both cell lines, reduction in cell viability was
accompanied by a proportional loss of cell adhesion and an increase
in apoptosis. Western blots showed that treatment with ISIS 15421
resulted in a decrease of FAK protein expression. FAK protein
levels were decreased in BL melanoma cells upon treatment with 5-FU
alone and were undetectable upon treatment with the combination of
ISIS 15421 and 5-FU. These studies suggest that ISIS 15421, in
combination with the chemotherapeutic agent 5-FU, may be a useful
in the treatment of melanoma.
Example 7
Effect of FAK Antisense Phosphorothioate Oligonucleotide (ISIS
15421) on Human Melanoma Xenograft Tumor Growth in Mice
[0137] Another model used to investigate the efficacy of antisense
oligonucleotides on tumor growth involves the use of mice
transplanted with human cancer cells or cell line tumors. In these
experiments human C8161 melanoma tumor xenografts were transplanted
onto the side of nude mice with sutures or surgical staples. Mice
were treated with ISIS 15421 (SEQ ID NO. 18) or the control ISIS
29848 (SEQ ID No. 44) over a 28 day treatment course.
[0138] At the end of the timecourse, mice were sacrificed and tumor
volumes measured. Tumor volumes in the antisense treated mice were
significantly smaller than tumor volumes in control-treated mice
with no observation of toxicity to the mice. Additionally, one
third of the control-treated mice had grossly evident
intraperitoneal metastases, while none of the antisense-treated
mice displayed such metastases. These studies suggest that
antisense oligonucleotides represent potential chemotherapeutic
agents in the treatment of melanoma and the prevention of tumor
metastasis.
Sequence CWU 0
0
* * * * *