U.S. patent application number 10/836673 was filed with the patent office on 2004-09-30 for nucleotide sequences encoding bovine respiratory syncytial virus immunogenic proteins.
Invention is credited to Lerch, Robert, Wertz, Gail W..
Application Number | 20040191886 10/836673 |
Document ID | / |
Family ID | 32176914 |
Filed Date | 2004-09-30 |
United States Patent
Application |
20040191886 |
Kind Code |
A1 |
Wertz, Gail W. ; et
al. |
September 30, 2004 |
Nucleotide sequences encoding bovine respiratory syncytial virus
immunogenic proteins
Abstract
The present invention relates to recombinant DNA molecules which
encode bovine respiratory syncytial (BRS) virus proteins, to BRS
viral proteins, and peptides and to recombinant BRS virus vaccines
produced therefrom. It is based, in part, on the cloning of
substantially full length cDNAs which encode the entire BRS virus
G, F, and N proteins. According to particular embodiments of the
invention, DNA encoding a BRS virus protein or peptide may be used
to diagnose BRS virus infection, or, alternatively, may be inserted
into an expression vector, including, but not limited to, vaccinia
virus as well as bacterial, yeast, insect, or other vertebrate
vectors. These expression vectors may be utilized to produce the
BRS virus protein or peptide in quantity; the resulting
substantially pure viral peptide or protein may be incorporated
into subunit vaccine formulations or may be used to generate
monoclonal or polyclonal antibodies which may be utilized in
diagnosis of BRS virus infection or passive immunization. In
additional embodiments, BRS virus protein sequence provided by the
invention may be used to produce synthetic peptides or proteins
which may be utilized in subunit vaccines, or polyclonal or
monoclonal antibody production. Alternatively a nonpathogenic
expression vector containing the genes, parts of the genes, any
combination of the genes, or parts thereof may itself be utilized
as a recombinant virus vaccine.
Inventors: |
Wertz, Gail W.; (Birmingham,
AL) ; Lerch, Robert; (Madison, WI) |
Correspondence
Address: |
GIFFORD, KRASS, GROH, SPRINKLE
ANDERSON & CITKOWSKI, PC
280 N OLD WOODARD AVE
SUITE 400
BIRMINGHAM
MI
48009
US
|
Family ID: |
32176914 |
Appl. No.: |
10/836673 |
Filed: |
April 30, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10836673 |
Apr 30, 2004 |
|
|
|
09567458 |
May 8, 2000 |
|
|
|
6730305 |
|
|
|
|
09567458 |
May 8, 2000 |
|
|
|
08118148 |
Sep 8, 1993 |
|
|
|
6060280 |
|
|
|
|
08118148 |
Sep 8, 1993 |
|
|
|
07557267 |
Jul 24, 1990 |
|
|
|
Current U.S.
Class: |
435/235.1 ;
424/199.1 |
Current CPC
Class: |
C12N 2710/24143
20130101; C07K 14/005 20130101; A61K 38/00 20130101; A61K 39/12
20130101; A61K 39/155 20130101; C12N 2760/18534 20130101; A61K
2039/5256 20130101; A61K 39/00 20130101; C12N 2760/18522
20130101 |
Class at
Publication: |
435/235.1 ;
424/199.1 |
International
Class: |
A61K 039/12; C12N
007/00 |
Claims
1. A vaccine composition comprising a suitable pharmaceutical
vehicle and a recombinant infectious nonpathogenic virus which
comprises an isolated nucleotide sequence, said isolated sequence
comprising a coding sequence for an immunogenic bovine respiratory
syncytial virus (BRSV) protein wherein said protein is selected
from the group consisting of BRSV G, BRSV F, BRSV N and immunogenic
fragments of BRSV G, BRSV F and BRSV N.
2. A method of treating or preventing bovine respiratory syncytial
virus infection in a bovine subject comprising administering to
said subject a therapeutically effective amount of a vaccine
composition according to claim 1.
Description
1.1 RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 09/567,458 filed May 8, 2000 (U.S. Pat. No. 6,730,305
issue date: May 4, 2004). U.S. Ser. No. 09/567,458 is a divisional
of U.S. patent application Ser. No. 08/118,148 filed Sep. 8, 1993
(U.S. Pat. No. 6,060,280 issue date: May 9, 2000). U.S. Ser. No.
08/118,148 is a continuation of U.S. patent application Ser. No.
07/557,267 filed Jul. 24, 1990 (abandoned).
1.2 INTRODUCTION
[0002] The present invention relates to recombinant DNA molecules
which encode bovine respiratory syncytial (BRS) virus proteins as
well as corresponding BRS virus proteins and peptides derived
therefrom. It is based, in part, on the cloning of full length
cDNAs encoding a number of bovine respiratory syncytial virus
proteins, including, F, G, and N. DNAs encoding the G and F
proteins have been inserted into vaccinia virus vectors, and these
vectors have been used to express the G and F proteins in culture
and G protein encoding vectors have been used to induce an
anti-bovine respiratory syncytial virus immune response. The
molecules of the invention may be used to produce safe and
effective bovine respiratory syncytial virus vaccines.
2. BACKGROUND OF THE INVENTION
[0003] 2.1. Bovine Respiratory Syncytial Virus
[0004] Bovine respiratory syncytial (BRS) virus strain, 391-2 was
isolated from an outbreak of respiratory syncytial virus in cattle
in North Carolina during the winter of 1984 to 1985. The outbreak
involved five dairy herds, a beef calf and cow operation, and a
dairy and steer feeder operation (Fetrow et al., North Carolina
State University Agric. Extension Service Vet. Newsl.).
[0005] Respiratory syncytial virus, an enveloped, single-stranded,
negative-sense RNA virus (Huang and Wertz, 1982, J. Virol.
43:150-157; Kingsbury et al., 1978, Intervirology 10:137-153), was
originally isolated from a chimpanzee (Morris, et al., 1956, Proc.
Soc. Exp. Biol. Med. 92:544-549). Subsequently, respiratory
syncytial virus has been isolated from humans, cattle, sheep and
goats (Chanock et al. 1957, Am. J. Hyg. 66:281-290; Evermann et
al., 1985, AM. J. Vet. Res. 46:947-951; Lehmkuhl et al., 1980,
Arch. Virol. 65:269-276; Lewis, F. A., et al., 1961, Med. J. Aust.
48:932-33; Paccaud and Jacquier, 1970, Arch. Gesamte Virusforsch
30:327-342). Human respiratory syncytial (HRS) virus is a major
cause of severe lower respiratory tract infections in children
during their first year of life, and epidemics occur annually
(Stott and Taylor, 1985, Arch. Virol. 84:1-52). Similarly, BRS
virus causes bronchiolitis and pneumonia in cattle, and there are
annual winter epidemics of economic significance to the beef
industry (Bohlender et al., 1982, Mod. Vet. Pract. 63:613-618;
Stott and Taylor, 1985, Arch. Virol. 84:1-52; Stott et al., 1980,
J. Hyg. 85:257-270). The highest incidence of severe BRS
virus-caused disease is usually in cattle between 2 and 4.5 months
old. The outbreak of BRS virus strain 391-2 was atypical in that
the majority of adult cows were affected, resulting in a 50% drop
in milk production for one dairy herd and causing the death of some
animals, while the young of the herds were only mildly affected
(Fetrow et al., 1985, North Carolina State University Agric.
Extension Service Vet. Newsl.).
[0006] BRS virus was first isolated in 1970 (Paccaud and Jacquier,
1970, Arch. Gesamte Virusforsch. 30:327-342), and research has
focused on the clinical (van Nieuwstadt, A. P. et al., 1982, Proc.
12th World Congr. Dis. Cattle 1:124-130; Verhoeff et al., 1984,
Vet. Rec. 114:288-293) and pathological effects of the viral
infection on the host (Baker et al., 1986, J. Am. Vet. Med. Assoc.
189:66-70; Castleman et al., 1985, Am. J. Vet. Res. 46:554-560;
Castleman et al. 1985, Am. J. Vet. Res. 46:547-553) and on
serological studies (Baker et al., 1985, Am. J. Vet. Res.
46:891-892; Kimman et al., 1987, J. Clin. Microbiol. 25:1097-1106;
Stott et al., 1980, J. Hyg. 85:257-270). The virus has not been
described in molecular detail. Only one study has compared the
proteins found in BRS virus-infected cells with the proteins found
in HRS virus-infected cells (Cash et al., 1977, Virology
82:369-379). In contrast, a detailed molecular analysis of HRS
virus has been undertaken. cDNA clones to the HRS virus mRNAs have
been prepared and used to identify 10 virus-specific mRNAs which
code for 10 unique polypeptides, and the complete nucleotide
sequences for 9 of the 10 genes are available (Collins, P. L., et
al., 1986, in "Concepts in Viral Pathogenesis II,"
Springer-Verlag., New York; Stott and Taylor, 1985, Arch. Virol.
84:1-52).
[0007] Two lines of evidence suggest that HRS virus and BRS virus
belong in distinct respiratory syncytial virus subgroups. First,
BRS virus and HRS virus differ in their abilities to infect tissue
culture cells of different species (Paccaud and Jacquier, 1970,
Arch. Gesamte Virusforsch. 30:327-342). With one exception, studies
have shown that BRS virus exhibits a narrower host range than HRS
virus. Matumoto et al. (1974, Arch. Gesamte Virusforsch.
44:280-290) reported that the NMK7 strain of BRS virus has a larger
host range than the Long strain of HRS virus. Others have been
unable to repeat this with other BRS strains (Paccaud and Jacquier,
1970, Arch. Gesamte Virusforsch. 30:327-342; Pringle and Crass,
1978, Nature (London) 276:501-502). The second line of evidence
indicating that BRS virus differs from HRS virus comes from the
demonstration of antigenic differences in the major glycoprotein,
G, of BRS virus and HRS virus (Orvell et al., 1987, J. Gen. Virol.
68:3125-3135). Studies using monoclonal antibodies have grouped HRS
virus strains into two subgroups on the basis of relatedness of the
G glycoprotein (Anderson 1985, J. Infect. Dis. 151:626-633; Mufson,
et al., 1985, J. Gen. Virol. 66:2111-2124). The G protein of BRS
virus strains included in these studies did not react with
monoclonal antibodies generated against viruses from either HRS
virus subgroup (Orvell et al., 1987, J. Gen. Virol.
68:3125-3135).
[0008] BRS virus provides an opportunity to study the role of the
major glycoprotein, G, in attachment, the possible host range
restrictions of BRS virus compared to HRS virus, and the roles of
the individual viral antigens necessary to elicit a protective
immune response in the natural host, which is something that cannot
be done easily for HRS virus at present.
[0009] 2.2. The G Protein
[0010] Previous work has shown that there is no cross reactivity
between the attachment surface glycoproteins, G, of BRS virus and
HRS virus, whereas there is cross antigenic reactivity between the
other transmembrane glycoprotein, the fusion, F, protein and the
major Structural proteins, N, P, and M (Lerch et al., 1989, J.
Virol. 63:833-840; Orville et al., 1987, J. Gen. Virol.
68:3125-3135). Available evidence indicates that BRS virus has a
more narrow host restriction, infecting only cattle and bovine
cells in culture, whereas HRS virus can infect a variety of cell
types and experimental animals (Jacobs and Edington, 1975, Res.
Vet. Sci. 18:299-306; Mohanty et al., 1976, J. Inf. Dis.
134:409-413; Paccaud and Jacquier, 1970, Arch. Gesamte Virusforsch
30:327-342). Since the G protein of HRS virus is the viral
attachment protein (Levine et al., 1987, J. Gen. Virol.
68:2521-2524), this observation suggested that the differences in
the BRS virus and HRS virus G proteins may be responsible for the
differences in attachment and host range observed between BRS virus
and HRS virus.
[0011] Based on sequence analysis of the HRS virus G MRNA, the G
protein is proposed to have three domains; an internal or
cytoplasmic domain, a transmembrane domain, and an external domain
which comprises three quarters of the polypeptide (Satake et al.,
1985, Nucl. Acids Res: 13:7795-7812; Wertz et al., 1985, Proc.
Natl. Acad. Sci. U.S.A. 82:4075-4079). Evidence suggests that the
respiratory syncytial virus G protein is oriented with its amino
terminus internal, and its carboxy terminus external, to the virion
(Olmsted et al., 1989, J. Viral. 13:7795-7812; Vijaya et al., 1988,
Mol. Cell. Biol. 8:1709-1714; Wertz et al., 1985, Proc. Natl. Acad.
Sci. U.S.A. 82:4075-4079). Unlike the other Paramyxovirus
attachment proteins, the respiratory syncytial virus G protein
lacks both neuraminidase and hemagglutinating activity (Gruber and
Levine, 1983, J. Gen. Virol. 64:825-832; Richman et al., 1971,
Appl. Microbiol. 21:1099). The mature G protein, found in virions
and infected cells, has an estimated molecular weight of 80-90 kDa
based on migration in SDS-polyacrylamide gels (Dubovi, 1982, J.
Viol. 42:372-378; Gruber and Levine, 1983, J. Gen. Virol.
64:825-832; Lambert and Pons, 1983, Virology 130:204-214; Peeples
and Levine, 1979, Viol. 95:137-145). In contrast, the G mRNA
sequence predicts a protein with a molecular weight of 32 kDa
(Satake et al., 1985, Nucl. Acids Res. 13:7795-7812; Wertz et al.,
1985, Proc. Natl. Acad. Sci. U.S.A. 82:4075-4079), and when the G
mRNA is translated in vitro it directs synthesis of a 36 kDa
protein that is specifically immunoprecipitated by anti-G serum. It
has been shown that there is N-linked and extensive O-linked
glycosylation of the polypeptide backbone (Lambert, 1988, Virology
164:458-466; Wertz et al., 1989, J. Virol. 63:X). Experiments using
glycosidases (inhibitors of sugar addition) and a cell line
defective in O-linked glycosylation suggest that 55% of the
molecular weight of the mature G protein is due to O-linked
glycosylation, and 3% is due to N-linked glycosylation. However,
these estimates are based on migration in SDS-polyacrylamide gels
and are only approximate values. Consistent with the evidence for
extensive O-linked glycosylation is a high content (30%) of
threonine and serine residues in the predicted amino acid sequence
of the G protein (Satake et al., 1985, Nucl. Acids Res.
13:7795-7812; Wertz et al., 1985, Proc. Natl. Acad. Sci. U.S.A.
82:4075-4079). Threonine and serine are amino acid residues that
serve as sites for O-linked oligosaccharide attachment (Kornfield
and Komfield, 1980, in "The Biochemistry of Glycoproteins and
Proteoglycans," Lenarz, ed., Plenum Press, N.Y. pp. 1-32) and in
the HRS virus G protein 85% of the threonine and serine residues
are in the extracellular domain (Wertz et al., 1985, Proc. Natl.
Acad. Sci. U.S.A. 82:4075-4079). The high content of proline (10%),
serine and threonine (30%) and the extensive O-linked glycosylation
of the G protein are features similar to those of a group of
cellular glycoproteins known as the mucinous proteins (Ibid.), but
unusual among viral glycoproteins.
[0012] Isolates of HRS virus have been divided into two subgroups,
A and B, based on the antigenic variation observed among G proteins
using panels of monoclonal antibodies (Anderson et al., 1985, J.
Inf. Dis. 151:626-633; Mufson et al., 1985, J. Gen. Virol.
66:2111-2124). However, a few monoclonal antibodies exist which
recognize the G protein of both subgroups (Mufson et al., 1985, J.
Gen. Virol. 66:2111-2124; Orvell et al., 1987, J. Gen. Virol.
68:3125-3135). Sequence analysis of the G mRNA of HRS viruses from
the two subgroups showed a 54% overall amino acid identity between
the predicted G proteins, with 44% amino acid identity in the
extracellular domain of the protein (Johnson et al., 1987 Proc.
Natl. Acad. Sci. U.S.A. 84:5625-5629).
[0013] 2.3. The F Protein
[0014] The mature BRS virus F protein consists of two disulfide
linked polypeptides, F.sub.1 and F.sub.2 (Lerch et al., 1989, J.
Virol. 63:833-840). There are differences in the electrophoretic
mobility of the BRS virus and HRS virus F protein in
SDS-polyacrylamide gels (Lerch et al., 1989, supra). Polyclonal and
most monoclonal antibodies react to the F protein of both HRS virus
and BRS virus (Stott et al., 1984; Orvell et al., 1987; Kennedy et
al., 1988, J. Gen. Virol. 69:3023-3032; Lerch et al., 1989,
supra).
[0015] The fusion protein, F, of paramyxoviruses causes fusion of
the virus to cells and fusion of infected cells to surrounding
cells. Structurally, the F proteins of the various paramyxoviruses
are similar to one another. The F protein is synthesized as a
precursor, F.sub.0, that is proteolytically cleaved at an internal
hydrophobic region to yield two polypeptides, F.sub.1 and F.sub.2,
that are disulfide linked and form the active fusion protein. A
carboxy terminal hydrophobic region in the F.sub.1 polypeptide is
thought to anchor the F protein in the membrane with its carboxy
terminus internal to the cell and the amino terminus external. The
F protein is N-glycosylated (see review, Morrison, 1988, Virus
Research 10:113-136). The HRS virus F protein is a typical
paramyxovirus fusion protein. Antibodies specific to the F protein
will block the fusion of infected cells (Walsh and Hruska, 1983, J.
Virol. 47:171-177; Wertz et al., 1987, J. Virol. 61:293-301) and
also neutralize infectivity of the virus (Fernie and Gerin, 1982,
Inf. Immun. 37:243-249; Walsh and Hruska, 1.983, J. Virol.
47:171-177; Wertz et al., 1987, J. Virol. 61:293-301), but do not
block attachment (Levine et al., 1987, J. Gen. Virol.
68:2521-2524). The F protein is synthesized as a polypeptide
precursor F.sub.0, that is cleaved into two polypeptides, F.sub.1
and F.sub.2. These two polypeptides are disulfide linked and
N-glycosylated (Fernie and Gerin, 1982, Inf. Immun. 37:243-249;
Gruber and Levine, 1983, J. Gen. Virol. 64:825-832; Lambert and
Pons, 1983, Virol. 130:204-24).
[0016] 2.4. Bovine Respiratory Syncytial Virus Vaccines
[0017] Bovine respiratory syncytial virus (BRS) vaccines have been
developed comprising live or inactivated virus, or viral proteins.
Frennet et al. (1984, Ann. Med. Vet. 128:375-383) reported that 81
percent of calves administered a combined live BRS virus and bovine
viral diarrhea vaccine were protected against severe respiratory
symptoms induced by field challenge. Stott et al. (1984, J. Hyg.
93:251-262) compared an inactivated BRS viral vaccine (consisting
of glutaraldehyde-fixed bovine nasal mucosa cells persistently
infected with BRS virus and emulsified with oil adjuvant) to two
live vaccines, one directed toward BRS virus and the other toward
HRS virus. Eleven out of twelve calves given the inactivated viral
vaccine in the Stott study (supra) were completely protected
against BRS viral challenge, but all control animals and those
given the live vaccines became infected.
[0018] It is possible that live vaccines may exacerbate BRS viral
infection. A severe outbreak of respiratory disease associated with
BRS virus occurred shortly after calves were vaccinated with a
modified live BRS virus (Kimman et al., 1989, Vet. Q. 11:250-253).
Park et al. (1989, Res. Rep. Rural Dev. Adm. 31:24-29) reports the
development of a binary ethylenimine (BEI)-inactivated BRS virus
vaccine which was tested for its immunogenicity in guinea pigs and
goats. Serum neutralizing antibody was detected 2 weeks following
inoculation and antibodies increased following a booster
vaccination at four weeks. In goats, a protective effect against
BRS virus was observed when animals were challenged with virus 12
weeks following inoculation.
[0019] Trudel et al. (1989, Vaccine 7:12-16) studied the ability of
immunostimulating complexes, made from the surface proteins of both
human (Long) and bovine (A-51908) RS strains, adsorbed to the
adjuvant Quil A, to induce neutralizing antibodies.
Immunostimulating complexes prepared from bovine RS virus proteins
were found to be significantly more efficient than their human
counterpart in inducing neutralizing antibodies.
3. SUMMARY OF THE INVENTION
[0020] The present invention relates to recombinant DNA molecules
which encode bovine respiratory syncytial (BRS) virus proteins, to
BRS virus proteins and peptides and to recombinant BRS virus
vaccines produced therefrom. It is based, in part, on the cloning
of substantially full length cDNAs which encode the entire BRS
virus G, F, and N proteins. Nucleotide sequences of the G, F, and N
cDNAs have been determined, and are set forth in FIGS. 2A-2C (G
protein), FIGS. 9A-C (F protein), and FIGS. 17A and B (N
protein).
[0021] According to particular embodiments of the invention, DNA
encoding a BRS virus protein or peptide may be used to diagnose BRS
virus infection, or, alternatively, may be inserted into an
expression vector, including, but not limited to, vaccinia virus,
as well as bacterial, yeast, insect, or other vertebrate vectors.
These expression vectors may be utilized to produce the BRS virus
protein or peptide in quantity; the resulting substantially pure
viral peptide or protein may be incorporated into subunit vaccine
formulations or may be used to generate monoclonal or polyclonal
antibodies which may be utilized in diagnosis of BRS virus
infection or passive immunization. In additional embodiments, BRS
virus protein sequence provided by the invention may be used to
produce synthetic peptides or proteins which may be utilized in
subunit vaccines, or polyclonal or monoclonal antibody production.
Alternatively, a nonpathogenic expression vector may itself be
utilized as a recombinant virus vaccine.
4. DESCRIPTION OF THE FIGURES
[0022] FIG. 1. Sequencing strategy of G cDNAs of BRS virus. The
scale at the bottom indicates the number of nucleotides from the 5'
end of the BRS virus G mRNA. cDNA were inserted into M13 mp19
replicative form (RF) DNA and the nucleotide sequence determined by
dideoxynucleotide sequencing using a M13 specific sequencing
primer. The arrow indicates the portion of the G mRNA sequence
determined by extension of a synthetic oligonucleotide primer on
BRS virus mRNA. The sequence of the primer was complementary to
bases 154-166 of the BRS virus G mRNA sequence. The cDNAs in clones
G4, G10 and G33 were also excised using PstI and KpnI and inserted
into M13 mp18 RF DNA for sequencing of the opposite end of the
cDNA. The lines for each clone indicate the sequence of the mRNA
determined from that clone. Only clones G10 and G33 were sequenced
in their entirety. Clones G1, G7, G12, G5 and G3 were all less than
500 nucleotides in length and only partially sequenced for this
reason.
[0023] FIGS. 2A-C. Alignment of the complete BRS virus G mRNA
sequence with those of the HRS viruses A2 and 18537 G mRNAs.
Alignment was done by the method of Needleman and Wunsch (1970, J.
Mol. Biol. 48:443-453) comparing the BRS virus G sequence against
the HRS virus A2 G sequence. Only nonidentical bases are shown for
the G mRNA sequences of the HRS viruses A2 and 18537. Gaps, shown
by the dotted lines, were used to maximize sequence identity of the
HRS virus A2 G sequence as determined by Johnson et al. (1987,
Proc. Natl. Acad. Sci. U.S.A. 84:5625-5629). The HRS virus
consensus gene start and gene stop signals are overlined. The
consensus initiation codon and the stop codon for the different
viruses G mRNA are boxed. The dots above the sequences are spaced
every ten nucleotides and the number of the last nucleotide on a
line is indicated to the right of the sequence.
[0024] FIGS. 3A and B. Alignment of the predicted amino acid
sequence of the BRS virus G protein and the G proteins of the HRS
viruses A2 and 18537. Alignment was done by the method of Needleman
and Wunsch (1970, J. Mol. Biol. 48:443-453). Identical amino acids
for the HRS virus A2 and 18537 G proteins are indicated by an
asterisk. The proposed domains are indicated above the sequence.
Potential N-linked carbohydrate addition sites are indicated for
the BRS virus G protein by black triangles above the sequences, for
the BRS virus A2 G protein by black diamonds above the sequences,
and for the HRS virus 18537 protein by black triangles below the
sequences. The four conserved cysteine residues are indicated by
the dark circles. The conserved thirteen amino acid region of the
HRS virus A2 and 18537 G proteins is boxed. A gap in the HRS virus
A2 G protein sequence compared to the HRS virus 18537 G protein
sequence, as described by Johnson et al. (1987, Proc. Natl. Acad.
Sci. U.S.A. 84:5625-5629) is shown by a dash. The dots above the
sequences are spaced every ten amino acid residues and the number
of the last amino acid residue on a line is indicated to the right
of the sequence.
[0025] FIG. 4. Amino acid identity between the RS virus G proteins.
The overall identity, and identity in the different proposed
domains between the various G proteins is shown based on the
alignment shown in FIG. 3.
[0026] FIGS. 5A-C. Hydrophilicity plots for the G protein of BRS
(FIG. 5B) virus, and the HRS viruses A2 (FIG. 5A) and 18537 (FIG.
5C). The distribution of the hydrophilic and hydrophobic regions
along the predicted amino acid sequence of the G proteins was
determined using the algorithm of Kyte and Doolittle (1982, J. Mol.
Biol. 157:105-132). The value for each amino acid was calculated
over a window of nine amino acids. The bottom scale indicates the
amino acid residue starting with the amino terminal methionine.
Hydrophilic regions of the amino acid sequence are shown above the
axis, and hydrophobic regions below the axis.
[0027] FIG. 6. Western blot analysis of BRS virus and recombinant
vaccinia virus expressed G proteins. BT cells were infected with
recombinant vaccinia viruses (moi=10), wild type vaccinia virus
(moi=10) or BRS virus (moi=1). Proteins from BRS virus (lane B),
wild type vaccinia virus (lane VV), recombinant vaccinia virus
containing the BRS virus G gene in the forward (lane G642+) and
reverse (lane G4567-) orientation, and mock (lane M) infected cells
were harvested by lysing the cells at six hours postinfection for
vaccinia virus infected cells, and 36 hours postinfection for BRS
virus infected cells. The proteins were separated by
electrophoresis in 10% polyacrylamide-SDS gel under non-reducing
conditions, and analyzed by western blotting using anti-391-2 serum
as a first antibody. Horseradish peroxidase-conjugated anti-bovine
IgG was used to identify the bound first antibody. The BRS virus
proteins are indicated. Prestained protein molecular weight markers
are shown and labeled according to their molecular weight in
kilodaltons.
[0028] FIG. 7. Surface immunofluorescence of recombinant vaccinia
virus infected cells. HEp-2 cells, grown on glass cover slips, were
either mock (M) infected, infected with wild type vaccinia virus
(VV; moi=10) or recombinant virus G642 (rVV; moi=10). At 24 hours
postinfection, the live cells were stained with anti-391-2 serum,
followed by fluorescein conjugated anti-bovine IgG (H+L). Phase
contrast (left panels) and fluorescent (right panels) photographs
are shown.
[0029] FIG. 8. Sequencing strategy of cDNAs of BRS virus F
messenger RNA. The scale at the bottom indicates the number of
nucleotides from the 5' end of the BRS virus F mRNA. cDNAs were
inserted into M13 mp19 replicative form (RF) DNA and the nucleotide
sequence was determined by dideoxynucleotide sequencing using a M13
specific sequencing primer. The lines for each clone indicate the
portion of the MRNA sequence determined from that clone. The arrow
indicates the area of the F mRNA sequence that was determined by
extension of an oligonucleotide on BRS virus mRNA. The
oligonucleotide was complementary to bases 267 to 284 of the BRS
virus F mRNA. The cDNAs in clones F20, FB3, and FB5 were also
excised using PstI and KpnI and inserted into M13 mp18 RF DNA for
sequencing of the opposite end of the cDNA. Fragments of cDNAs in
clones F20, FB5 and FB3 were generated by the use of the
restriction enzymes EcoRI (FB3, FB5), or AlwNI (F20), PflMI (F20)
and HpaI (F20) and EcoRV (F20) and subcloned back into M13 mp19, or
mp18 RF DNA to determine the sequence in the internal areas of the
F mRNA.
[0030] FIGS. 9A-C. Nucleotide sequence of the BRS virus F mRNA. The
nucleotide sequence of the BRS virus F mRNA as determined from cDNA
clones and primer extension on BRS virus mRNA is shown. The dots
above the sequence are spaced every ten nucleotides and the number
of the last base on a line is indicated to the right of the
sequence. The predicted amino acid sequence of the major open
reading frame is also shown. The number of the last codon starting
on a line is indicated to the right of the amino acid sequence. The
potential N-linked glycosylation sites are boxed. The amino
terminal and carboxy terminal hydrophobic domains are underlined in
black as is the hydrophobic region at the proposed amino terminus
of the F1 polypeptide. The proposed cleavage sequence is underlined
in gray.
[0031] FIG. 10. Hydrophilicity plot for the F protein of BRS virus.
The distribution of the hydrophilic and hydrophobic regions along
the predicted amino acid sequence of the F protein was determined
using the algorithm of Kyte and Doolittle (1982, J. Mol. Biol.
157:105-132). The value for each amino acid was calculated over a
window of nine amino acids. The bottom scale indicates the amino
acid residue starting with the amino terminal methionine.
Hydrophilic regions of the amino acid sequence are shown above the
axis, and hydrophobic regions below the axis.
[0032] FIGS. 11A-C. Alignment of the predicted amino acid sequences
of the BRS virus F protein and the F proteins of HRS viruses A2,
Long, RSS-2, and 18537. Alignment was done by the method of
Needleman and Wunsch (1970, J. Mol. Biol. 48:443-453) comparing the
BRS virus F protein against the F proteins of different HRS
viruses. Only the non-identical amino acids are indicated for the
HRS viruses F proteins. The dots below the sequence are spaced
every ten amino acids and the number of the last residue on a line
is indicated to the right of the sequence. The potential N-linked
glycosylation sites of the proteins are boxed. Cysteine residues
conserved between all five proteins are indicated by an open
triangle. The amino terminal and carboxy terminal hydrophobic
domains are underlined in black as is the hydrophobic region at the
proposed amino terminus of the F1 polypeptide. The proposed
cleavage sequence is underlined in gray.
[0033] FIG. 12. Comparison of proteins from BRS virus and HRS virus
infected cells synthesized in the presence and absence of
tunicamycin. Proteins from BRS virus (B), HRS virus (H), or mock
(M) infected cells were labeled by the incorporation of [.sup.35S]
methionine in the presence (lanes B.sub.T, H.sub.T, and M.sub.T) or
absence (lanes B, H and M) of tunicamycin. Virus specific proteins
were immunoprecipitated using an anti-respiratory syncytial virus
serum, and separated by electrophoresis on a 15% SDS-polyacrylamide
gel. An autoradiograph of the gel is shown. All lanes are from the
same gel with lanes H and .sub.HT from a longer exposure than the
other lanes. [.sup.14C]-labeled protein molecular weight markers
are shown and labeled according to their molecular weight in
kilodaltons.
[0034] FIG. 13. Expression of the BRS virus F protein from
recombinant vaccinia virus infected cells. BT cells were infected
with recombinant vaccinia viruses (moi=10), wild type vaccinia
virus (moi=10) or BRS virus (moi=1). Proteins from recombinant
viruses containing the BRS virus F gene in the forward (lanes
F464+) and reverse (F1597-) orientations and wild type vaccinia
virus (VV) were radioactively labeled by the incorporation of
[.sup.35S] methionine from three to six hours postinfection.
Proteins from BRS virus infected (lane B), and mock infected cells
(lane M) which were also radioactively labeled by the incorporation
of [.sup.35S] methionine for three hours at 24 hours postinfection.
The proteins were immunoprecipitated using the Wellcome anti-RS
serum and compared by electrophoresis on a 15% polyacrylamide-SDS
gel. Fluorography was done on the gel and an autoradiograph is
shown. The BRS virus F, N, M and P proteins are indicated.
[.sup.14C]-labeled protein molecular weight markers are shown and
labeled according to their molecular weight in kilodaltons.
[0035] FIG. 14. Comparison of the BRS virus and recombinant
vaccinia virus expressed F proteins synthesized in the presence of
tunicamycin. BT cells were infected with recombinant vaccinia
viruses (moi=10) wild type vaccinia virus (moi=10) or BRS virus
(moi=1). Proteins from recombinant vaccinia viruses containing the
BRS virus F gene in the forward orientation (F 464=F), wild type
vaccinia virus (V), BRS virus infected (B) and mock infected cells
(M) were radioactively labeled by the incorporation of
[.sup.35S]-methionine for three hours, at three hours postinfection
for vaccinia infected cells and 24 hours postinfection for BRS
virus infected cells, in the absence (lanes F, V, B, M) or presence
(lanes F.sub.T, V.sub.T, B.sub.T, M.sub.T) of tunicamycin. The
proteins were immunoprecipitated using the Wellcome anti-RS serum
and compared by electrophoresis on a 15% polyacrylamide-SDS gel.
Fluorography was done on the gel and an autoradiograph is shown.
The BRS virus F, N, M and P proteins are indicated.
[.sup.14C]-labeled protein molecular weight markers are shown and
labeled according to their molecular weight in kilodaltons.
[0036] FIG. 15. Surface immunofluorescence of recombinant vaccinia
virus infected HEp-2 cells. HEp-2 cells, grown on glass cover
slips, were either mock (M) infected, infected with wild type
vaccinia virus (VV; moi=10), recombinant virus F 464 (rVVf;
moi=10). At 24 hours postinfection, the live cells were stained
with anti-391-2 serum, followed by fluorescein conjugated
anti-bovine IgG (H+L). Phase contrast (left panels) and fluorescent
(right panels) photographs are shown.
[0037] FIGS. 16A-16C. Immunoprecipitation of .sup.3H-glucosamine
labeled proteins from mock (M) bovine RS virus (Bov) or human RS
virus (Hu) infected BT cells. FIG. 16A. Antisera specific for the
human RS virus G protein was prepared by immunizing rabbits with a
recombinant VV vector (vG301) expressing the HRS virus A2 G protein
(Stott et al., 1986, J. Virol. 60:607-613) and used to
immunoprecipitate the radiolabeled proteins from the mock, BRS
virus (Bov) or HRS virus (Hu) infected cells. FIG. 16B. Antisera
specific for the bovine RS virus G protein was prepared by
immunizing mice with a recombinant VV vector (vvG642) expressing
the BRS virus G and used to immunoprecipitate proteins from the
mock, BRS virus (Bov) or HRs virus (Hu) infected cells. FIG. 16C.
Total .sup.3H-glucosamine labeled proteins present in cytoplasmic
extracts of mock, BRS virus (Bov) or HRS virus (Hu) infected
cells.
[0038] FIGS. 17A and B. Nucleotide sequence of the BRS virus N
MRNA.
[0039] FIG. 18. Amino acid sequence of BRS virus N protein.
5. DETAILED DESCRIPTION OF THE INVENTION
[0040] The present invention relates to bovine respiratory
syncytial virus nucleic acids and proteins. For purposes of clarity
of disclosure, and not by way of limitation, the detailed
description of the invention is divided into the following
subsections:
[0041] (i) cloning bovine respiratory syncytial virus genes;
[0042] (ii) expression of bovine respiratory syncytial virus
proteins;
[0043] (iii) the genes and proteins of the invention; and
[0044] (iv) the utility of the invention.
[0045] 5.1. Cloning Bovine Respiratory Syncytial Virus Genes
[0046] Bovine respiratory syncytial (BRS) virus genes, defined
herein as nucleic acid sequences encoding BRS viral proteins, may
be identified according to the invention by cloning cDNA
transcripts of BRS virus mRNA and identifying clones containing
full length BRS virus protein-encoding sequences, or,
alternatively, by identifying BRS virus encoding nucleic acid
sequences using probes derived from plasmids pRLG414-76-191,
pRLF2012-76-192, or pRLNB3-76 or using oligonucleotide probes
designed from the sequences presented in FIGS. 2A-C (SEQ ID No. 1),
9A-C (SEQ ID No. 3) or 17A and B (SEQ ID No. 5).
[0047] For example, and not by way of limitation, a cDNA containing
the complete open reading frame of a BRS virus mRNA corresponding
to a particular protein may be synthesized using BRS virus mRNA
template and a specific synthetic oligonucleotide for second strand
synthesis. The nucleotide sequence for the oligonucleotide may be
determined from sequence analysis of BRS viral mRNA. First strand
synthesis may be performed as described in D'Alessio et al. (1987,
Focus 9:1-4). Following synthesis, the RNA template may be digested
with RNase A (at least about 1 .mu.g/.mu.l) for about 30 minutes at
37 degrees Centigrade. The resulting single-stranded cDNAs may then
be isolated by phenol extraction and ethanol precipitation. The
oligonucleotide used for second strand synthesis should preferably
have a sequence specific for the 5' end of the viral mRNA of
interest, and may also, preferably, contain a useful restriction
endonuclease cleavage site to facilitate cloning. The
single-stranded cDNAs may then be mixed with the oligonucleotide
(at about 50 .mu.g/ml), heated to 100 degrees C. for one minute and
placed on ice. Reverse transcriptase may then be used to synthesize
the second strand of the cDNAs in a reaction mixture which may
comprise 50 mM Tris-HCl (pH 8.0), 50 mM KCl, 5 mM MgCl.sub.2, 10 mM
dithiothreitol, 1.6 mM dNTPs, and 100 U reverse transcriptase,
incubated for about one hour at 50 degrees C. The cDNAs may then be
separated from protein by phenol extraction, recovered by ethanol
precipitation, and ends made blunt with T4 DNA polymerase.
Blunt-ended cDNAs may then be digested with an appropriate
restriction endonuclease (for example, which recognizes a cleavage
site in the oligonucleotide primer but not within the
protein-encoding sequence), separated from protein by phenol
extraction, and then cloned into a suitable vector.
[0048] Alternatively, cDNAs generated from viral mRNA may be cloned
into vectors, and clones carrying the nucleic acid sequences of
interest may be generated using, as probes, oligonucleotides
containing proteins of the nucleotide sequences presented in FIGS.
2A-C (SEQ ID No. 1) and 9A-C (SEQ ID No. 3) for the BRS virus G and
F proteins, respectively. Viral cDNA libraries may be screened, for
example, using the method set forth in Grunstein and Hogness (1975,
Proc. Natl. Acad. Sci. U.S.A.). Retrieved clones may then be
analyzed by restriction-fragment mapping and sequencing techniques
(e.g., Sanger et al., 1979, Proc. Natl. Acad. Sci. U.S.A.
72:3918-3921) well known in the art. Alternatively, all or portions
of the desired gene may be synthesized chemically based on the
sequence presented in FIGS. 2A-C (SEQ ID No. 1) or 9A-C (SEQ ID No.
3).
[0049] In additional embodiments, primers derived from the nucleic
acid molecules of the invention and/or nucleic acid sequences as
set forth in FIGS. 2A-C (SEQ ID No. 1) or 9A-C, (SEQ ID No. 3) or
nucleic acid sequences encoding amino acid sequences substantially
as set forth in FIGS. 3A and B (SEQ ID No. 2) or 11A-C (SEQ ID No.
4), may be used in polymerase chain reaction (PCR); Saiki et al.,
1985, Science 230:1350-1354) to produce nucleic acid molecules
which encode BRS virus proteins or related peptides.
[0050] PCR requires sense strand as well as anti-sense strand
primers. Accordingly, a degenerate oligonucleotide primer
corresponding to one segment of BRS virus nucleic acid or amino
acid sequence may be used as a primer for one DNA strand (e.g. the
sense strand) and another degenerate oligonucleotide primer
homologous to a second segment of BRS virus nucleic acid or amino
acid sequence may be used as primer for the second DNA strand (e.g.
the anti-sense strand). Preferably, these primers may be chosen
based on a contiguous stretch of known amino acid sequence, so that
the relevant DNA reaction product resulting from the use of these
primers in PCR may be of a predictable size (i.e. the length of the
product, in number of basepairs, should equal the sum of the
lengths of the two primers plus three times the number of amino
acid residues in the segment of protein bounded by the segments
corresponding to the two primers). These primers may then be used
in PCR with nucleic acid template which comprises BRS virus nucleic
acid sequences, preferably cDNA prepared from BRS virus mRNA.
[0051] DNA reaction products may be cloned using any method known
in the art. A large number of vector-host systems known in the art
may be used. Possible vectors include, but are not limited to,
cosmids, plasmids or modified viruses, but the vector system must
be compatible with the host cell used. Such vectors include, but
are not limited to, bacteriophages such as lambda derivatives, or
plasmids such as pBR322, pUC, or Bluescript.RTM. (Stratagene)
plasmid derivatives. Recombinant molecules can be introduced into
host cells via transformation, transfection, infection,
electroporation, etc.
[0052] The BRS virus gene may be inserted into a cloning vector
which can be used to transform, transfect, or infect appropriate
host cells so that many copies of the gene sequences are generated.
This can be accomplished by ligating the DNA fragment into a
cloning vector which has complementary cohesive termini. However,
if the complementary restriction sites used to fragment the DNA are
not present in the cloning vector, the ends of the DNA molecules
may be enzymatically modified. Alternatively, any site desired may
be produced by ligating nucleotide sequences (linkers) onto the DNA
termini; these ligated linkers may comprise specific chemically
synthesized oligonucleotides encoding restriction endonuclease
recognition sequences. Furthermore, primers used in PCR reactions
may be engineered to comprise appropriate restriction endonuclease
cleavage sites. In an alternative method, the cleaved vector and
BRS viral gene may be modified by homopolymeric tailing. In
specific embodiments, transformation of host cells with recombinant
DNA molecules that incorporate an isolated BRS virus gene, cDNA, or
synthesized DNA sequence enables generation of multiple copies of
the gene. Thus, the gene may be obtained in large quantities by
growing transformants, isolating the recombinant DNA molecules from
the transformants and, when necessary, retrieving the inserted gene
from the isolated recombinant DNA.
[0053] 5.2. Expression of Bovine Respiratory Syncytial Virus
Proteins
[0054] The nucleotide sequence coding for a BRS virus protein, or a
portion thereof, can be inserted into an appropriate expression
vector, i.e., a vector which contains the necessary elements for
the transcription and translation of the inserted protein-coding
sequence. The necessary transcriptional and translation signals can
also be supplied by the native BRS viral gene. A variety of
host-vector systems may be utilized to express the protein-coding
sequence. These include but are not limited to mammalian cell
systems infected with virus (e.g., vaccinia virus, adenovirus,
etc.); insect cell systems infected with virus (e.g., baculovirus);
microorganisms such as yeast containing yeast vectors, or bacteria
transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA. The
expression elements of these vectors vary in their strengths and
specificities. Depending on the host-vector system utilized, any
one of a number of suitable transcription and translation elements
may be used.
[0055] Any of the methods previously described for the insertion of
DNA fragments into a vector may be used to construct expression
vectors containing a chimeric gene consisting of appropriate
transcriptional/translational control signals and the protein
coding sequences. These methods may include in vitro recombinant
DNA and synthetic techniques and in vivo recombinations (genetic
recombination). Expression of nucleic acid sequence encoding BRS
virus protein or peptide fragment may be regulated by a second
nucleic acid sequence so that a BRS virus protein or peptide is
expressed in a host transformed with the recombinant DNA molecule.
For example, expression of BRS viral protein may be controlled by
any promoter/enhancer element known in the art. Promoters which may
be used to control BRS viral protein or peptide expression include,
but are not limited to, the CMV promoter (Stephens and Cockett,
1989, Nucl. Acids Res. 17:7110), the SV40 early promoter region
(Bernoist and Chambon, 1981, Nature 290:304-310), the promoter
contained in the 3' long terminal repeat of Rous sarcoma virus
(Yamamoto, et al., 1980, Cell 22:787-797), the herpes thymidine
kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A.
78:144-1445), the regulatory sequences of the metallothionine gene
(Brinster et al., 1982, Nature 296:39-42); prokaryotic expression
vectors such as the p-lactamase promoter (Villa-Kamaroff, et al.,
1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731), or the tac
promoter (DeBoer, et al., 1983, Proc. Natl. Acad. Sci. U.S.A.
80:21-25), see also "Useful proteins from recombinant bacteria" in
Scientific American, 1980, 242:74-94; plant expression vectors
comprising the nopaline synthetase promoter region
(Herrera-Estrella et al., Nature 303:209-213) or the cauliflower
mosaic virus 35S RNA promoter (Gardner, et al., 1981, Nucl. Acids
Res. 9:2871), and the promoter for the photosynthetic enzyme
ribulose biphosphate carboxylase (Herrera-Estrella et al., 1984,
Nature 310:115-120); promoter elements from yeast or other fungi
such as the Gal 4 promoter, the ADC (alcohol dehydrogenase)
promoter, PGK (phosphoglycerol kinase) promoter, alkaline
phosphatase promoter, and the following animal transcriptional
control regions, which exhibit tissue specificity and have been
utilized in transgenic animals: elastase I gene control region
which is active in pancreatic acinar cells (Swift et al., 1984,
Cell 38:639-646; Ornitz et al., 1986, Cold Spring Harbor Symp.
Quant. Biol. 50:399-409; MacDonald, 1987, Hepatology 7:425-515);
insulin gene control region which is active in pancreatic beta
cells (Hanahan, 1985, Nature 315:115-122), immunoglobulin gene
control region which is active in lymphoid cells (Grosschedl et
al., 1984, Cell 38:647-658; Adames et al., 1985, Nature
318:533-538; Alexander et al., 1987, Mol. Cell. Biol. 7:1436-1444),
mouse mammary tumor virus control region which is active in
testicular, breast, lymphoid and mast cells (Leder et al., 1986,
Cell 45:485-495), albumin gene control region which is active in
liver (Pinkert et al., 1987, Genes and Devel. 1:268-276),
alpha-fetoprotein gene control region which is active in liver
(Krumlauf et al., 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et
al., 1987, Science 235:53-58); alpha 1-antitrypsin gene control
region which is active in the liver (Kelsey et al, 1987, Genes and
Devel. 1:161-171), beta-globin gene control region which is active
in myeloid cells (Mogram et al., 1985, Nature 315:338-340; Kollias
et al., 1986, Cell 46:89-94); myelin basic protein gene control
region which is active in oligodendrocyte cells in the brain
(Readhead et al., 1987, Cell 48:703-712); myosin light chain-2 gene
control region which is active in skeletal muscle (Sani, 1985,
Nature 314:283-286), and gonadotropic releasing hormone gene
control region which is active in the hypothalamus (Mason et al.,
1986, Science 234:1372-1378).
[0056] Expression vectors containing BRS virus gene inserts can be
identified by three general approaches: (a) DNA-DNA hybridization,
(b) presence or absence of "marker" gene functions, and (c)
expression of inserted sequences. In the first approach, the
presence of a foreign gene inserted in an expression vector can be
detected by DNA-DNA hybridization using probes comprising sequences
that are homologous to an inserted BRS virus gene. In the second
approach, the recombinant vector/host system can be identified and
selected based upon the presence or absence of certain "marker"
gene functions (e.g., thymidine kinase activity, resistance to
antibiotics, transformation phenotype, occlusion body formation in
baculovirus, etc.) caused by the insertion of foreign genes in the
vector. For example, if the BRS gene is inserted within the marker
gene sequence of the vector, recombinants containing the BRS insert
can be identified by the absence of the marker gene function. In
the third approach, recombinant expression vectors can be
identified by assaying the foreign gene product expressed by the
recombinant.
[0057] Once a particular recombinant DNA molecule is identified and
isolated, several methods known in the art may be used to propagate
it. Once a suitable host system and growth conditions are
established, recombinant expression vectors can be propagated and
prepared in quantity. As previously explained, the expression
vectors which can be used include, but are not limited to, the
following vectors or their derivatives: human or animal viruses
such as vaccinia virus or adenovirus, in particular bovine
adenovirus, as well as bovine herpes virus; insect viruses such as
baculovirus; yeast vectors; bacteriophage vectors (e.g., lambda),
and plasmid and cosmid DNA vectors, to name but a few.
[0058] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired.
Expression from certain promoters can be elevated in the presence
of certain inducers; thus, expression of the genetically engineered
BRS virus protein may be controlled. Furthermore, different host
cells have characteristic and specific mechanisms for the
translational and post-translational processing and modification
(e.g., glycosylation, cleavage) of proteins. Appropriate cell lines
or host systems can be chosen to ensure the desired modification
and processing of the foreign protein expressed. For example,
expression in a bacterial system can be used to produce an
unglycosylated core protein product. Expression in mammalian cells
can be used to ensure "native" glycosylation of the heterologous
BRS virus protein. Furthermore, different vector/host expression
systems may effect processing reactions such as proteolytic
cleavages to different extents.
[0059] Once a recombinant which expresses the BRS virus gene is
identified, the gene product should be analyzed. This can be
achieved by assays based on the physical or functional properties
of the product.
[0060] Once the BRS virus protein or peptide is identified, it may
be isolated and purified by standard methods including
chromatography (e.g., ion exchange, affinity, and sizing column
chromatography), centrifugation, differential solubility, or by any
other standard technique for the purification of proteins.
[0061] In additional embodiments of the invention, BRS virus
proteins or peptides may be produced by chemical synthesis using
methods well known in the art. Such methods, are reviewed, for
example, in Barany and Merrifield (1980, in "The Peptides," Vol.
II, Gross and Meienhofer, eds., J. Academic Press, N.Y. pp.
1-284)
[0062] Additionally, recombinant viruses which infect but are
nonpathogenic in cattle, including but not limited to vaccinia
virus, bovine herpes virus and bovine adenovirus, may be engineered
to express BRS virus proteins using suitable promoter elements.
Such recombinant viruses may be used to infect cattle and thereby
produce immunity to BRS virus. Additionally, recombinant viruses
capable of expressing BRS virus protein, but which are potentially
pathogenic, may be inactivated prior to administration as a
component of a vaccine.
[0063] 5.3. The Genes and Proteins of the Invention
[0064] Using the methods detailed supra and in Example Sections 6
and 7 infra, the following nucleic acid sequences were determined,
and their corresponding amino acid sequences deduced. The BRS virus
G protein cDNA sequence was determined, and the corresponding mRNA
sequence is depicted in FIGS. 2A-C. BRS virus F protein cDNA
sequence was determined, and the corresponding mRNA sequence is
depicted in FIGS. 9A-C. BRS virus N protein cDNA sequence was
determined, and the corresponding sequence is depicted in FIGS. 17A
and B. Each of these sequences, or their functional equivalents,
can be used in accordance with the invention. The invention is
further directed to sequences and subsequences of BRS virus G, F or
N protein encoding nucleic acids comprising at least ten
nucleotides, such subsequences comprising hybridizable portions of
the BRS virus G, F or N encoding nucleic acid sequence which have
use, e.g., in nucleic acid hybridization assays, Southern and
Northern blot analyses, etc. The invention also provides for BRS
virus G, F or N proteins, fragments and derivatives thereof,
according to the amino acid sequences set forth in FIGS. 3A and B
(SEQ ID No. 2), 11A-C (SEQ ID No. 4) or 18 (SEQ ID No. 6) or their
functional equivalents or as encoded by the following cDNA clones
as deposited with the ATCC: pRLG414-76-191, pRLF2012-76-192,
pRLNB3-76. The invention also provides fragments or derivatives of
BRS virus G or F proteins which comprise antigenic
determinant(s).
[0065] For example, the nucleic acid sequences depicted in FIGS.
2A-C (SEQ ID No. 1), 9A-C (SEQ ID No. 3) or 17A and B (SEQ ID No.
5) can be altered by substitutions, additions or deletions that
provide for functionally equivalent molecules. Due to the
degeneracy of nucleotide coding sequences, other DNA sequences
which encode substantially the same amino acid sequence as depicted
in FIGS. 3A and B, 11A-C or 18 may be used in the practice of the
present invention. These include but are not limited to nucleotide
sequences comprising all or portions of the nucleotide sequences
encoding BRS virus G, F or N proteins depicted in FIGS. 2A-C (SEQ
ID No. 1), 9A-C (SEQ ID No. 3) or 17A and B (SEQ ID No. 5) which
are altered by the substitution of different codons that encode a
functionally equivalent amino acid residue within the sequence,
thus producing a silent change. Likewise, the BRS virus G, F or N
proteins, or fragments or derivatives thereof, of the invention
include, but are not limited to, those containing, as a primary
amino acid sequence, all or part of the amino acid sequence
substantially as depicted in FIGS. 3A and B (SEQ ID No. 2), 11A-C
(SEQ ID No. 4) or 18 (SEQ ID No. 6) or as encoded by
pRLG414-76-191, pRLF2012-76-192, or pRLNB3-76 including altered
sequences in which functionally equivalent amino acid residues are
substituted for residues within the sequence resulting in a silent
change. For example, one or more amino acid residues within the
sequence can be substituted by another amino acid of a similar
polarity which acts as a functional equivalent, resulting in a
silent alteration. Substitutes for an amino acid within the
sequence may be selected from other members of the class to which
the amino acid belongs. For example, the nonpolar (hydrophobic)
amino acids include alanine, leucine, isoleucine, valine, proline,
phenylalanine, tryptophan and methionine. The polar neutral amino
acids include glycine, serine, threonine, cysteine, tyrosine,
asparagine, and glutamine. The positively charged (basic) amino
acids include arginine, lysine and histidine. The negatively
charged (acidic) amino acids include aspartic acid and glutamic
acid. Also included within the scope of the invention are BRS virus
proteins or fragments or derivatives thereof which are
differentially modified during or after translation, e.g., by
glycosylation, proteolytic cleavage, linkage to an antibody
molecule or other cellular ligand, etc.
[0066] In addition, the recombinant BRS virus G, F or N protein
encoding nucleic acid sequences of the invention may be engineered
so as to modify processing or expression of BRS virus protein. For
example, and not by way of limitation, a signal sequence may be
inserted upstream of BRS virus G, F or N protein encoding sequences
to permit secretion of BRS virus G, F or N protein and thereby
facilitate harvesting or bioavailability.
[0067] Additionally, a given BRS virus protein-encoding nucleic
acid sequence can be mutated in vitro or in vivo, to create and/or
destroy translation, initiation, and/or termination sequences, or
to create variations in coding regions and/or form new restriction
endonuclease sites or destroy preexisting ones, to facilitate
further in vitro modification. Any technique for mutagenesis known
in the art can be used, including but not limited to, in vitro
site-directed mutagenesis (Hutchinson, et al., 1978, J. Biol. Chem.
253:6551), use of TAB.RTM. linkers (Pharmacia), etc.
[0068] 5.4. The Utility of the Invention
[0069] 5.4.1. Bovine Respiratory Syncytial Virus Vaccines
[0070] The present invention may be utilized to produce safe and
effective BRS virus vaccines. According to the invention, the term
vaccine is construed to refer to a preparation which elicits an
immune response directed toward a component of the preparation.
Advantages of the present invention include the capability of
producing BRS virus proteins in quantity for use in vaccines or for
the generation of antibodies to be used in passive immunization
protocols as well as the ability to provide a recombinant virus
vaccine which produces immunogenic BRS virus proteins but which is
nonpathogenic. These alternatives circumvent the use of modified
live BRS virus vaccines which may cause exacerbated symptoms in
cattle previously exposed to BRS virus.
[0071] According to the invention, the BRS virus nucleic acid
sequences may be inserted into an appropriate expression system
such that a desired BRS virus protein is produced in quantity. In
specific embodiments of the invention, BRS virus G, F or N proteins
may be produced in quantity in this manner for use in subunit
vaccines. In preferred specific embodiments of the invention, the
BRS virus G, F or N protein may be expressed by recombinant
vaccinia viruses, including, but not limited to, rVVF464 (F protein
producing virus), or rVVG642 (G protein producing virus),
harvested, and then administered as a protein subunit in a suitable
pharmaceutical carrier.
[0072] Alternatively, recombinant virus, including, but not limited
to, vaccinia virus, bovine herpes virus and bovine adenovirus and
retroviruses which are nonpathogenic in cattle but which express
BRS virus proteins, may be used to infect cattle and thereby
produce immunity to BRS virus without associated disease. The
production of the BRS G protein in recombinant virus vaccinated
animals, or a portion or derivative thereof, may additionally
prevent attachment of virus to cells, and thereby limit
infection.
[0073] In further embodiments of the invention, BRS virus protein
or peptide may be chemically synthesized for use in vaccines.
[0074] In vaccines which comprise peptide fragments of a BRS virus
protein, it may be desirable to select peptides which are more
likely to elicit an immune response. For example, the amino acid
sequence of a BRS virus protein may be subjected to computer
analysis to identify surface epitopes using a method such as, but
not limited to, that described in Hopp and Woods (1981, Proc. Natl.
Acad. Sci. U.S.A. 2078:3824-3828), which has been successfully used
to identify antigenic peptides of Hepatitis B surface antigen. It
may also be desirable to modify the BRS virus peptides in order to
increase their immunogenicity, for example, by chemically modifying
the peptides or by linking the peptides to a carrier molecule.
[0075] The vaccines of the invention may be administered, in a
suitable pharmaceutical carrier, by a variety of routes, including,
but not limited to, nasally, orally, intramuscularly,
subcutaneously, or intravenously and preferably intratracheally or
by scarification. In preferred embodiments of the invention,
between about 10.sup.6 and 10.sup.8 recombinant viruses may be
administered in an inoculation. It may be desirable to administer
subunit vaccines of the invention together with an adjuvant, for
example, but not limited to, Freunds (complete or incomplete),
mineral gels such as aluminum hydroxide, surface active substances
such as lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanins, dinitrophenol, or Bacille
calmette-Guerin (BCG) or Corynebacterium parvum. Multiple
inoculations may be necessary in order to achieve protective and/or
long-lasting immunity.
[0076] 5.4.2. Antibosies Directed Toward Bovine Respiratory
Syncytial Virus Proteins
[0077] In additional embodiments, nucleic acid, protein or peptide
molecules of the invention may be utilized to develop monoclonal or
polyclonal antibodies directed toward BRS virus protein. For
preparation of monoclonal antibodies directed toward a BRS virus
protein, any technique which provides for the production of
antibody molecules by continuous cell lines in culture may be used.
For example, the hybridoma technique originally developed by Kohler
and Milstein (1975, Nature 256:495-497) may be used.
[0078] A molecular clone of an antibody to a BRS virus protein may
be prepared by known techniques. Recombinant DNA methodology (see
e.g. Maniatis et al., 1982, Molecular Cloning, A Laboratory Manual,
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.) may be
used to construct nucleic acid sequences which encode a monoclonal
antibody molecule or antigen binding region thereof.
[0079] Antibody molecules may be purified by known techniques.
e.g., immunoabsorption or immunoaffinity chromatography,
chromatographic methods such as HPLC (high performance liquid
chromatography), or a combination thereof, etc.
[0080] Antibody fragments which contain the idiotype of the
molecule can be generated by known techniques. For example, such
fragments include but are not limited to: the F(ab').sub.2 fragment
which can be produced by pepsin digestion of the antibody molecule;
the Fab' fragments which can be generated by reducing the disulfide
bridges of the F(ab').sub.2 fragment, and the 2 Fab or Fab
fragments which can be generated by treating the antibody molecule
with papain and a reducing agent.
[0081] 5.4.3. Diagnostic Applications
[0082] The present invention, which relates to nucleic acids
encoding BRS virus proteins and to proteins, peptide fragments, or
derivatives produced therefrom, as well as antibodies directed
against BRS virus proteins and peptides, may be utilized to
diagnose BRS virus infection.
[0083] For example, the nucleic acid molecules of the invention may
be utilized to detect the presence of BRS viral nucleic acid in BRS
virus-infected animals by hybridization techniques, including
Northern blot analysis, wherein a nucleic acid preparation obtained
from an animal is exposed to a potentially complementary nucleic
acid molecule of the invention under conditions which allow
hybridization to occur and such that hybridization may be detected.
For example, and not by way of limitation, total RNA may be
prepared from swabs of nasal tissue, tracheal swabs, or isolates
from any upper respiratory tract mucosal surface obtained from a
cow potentially infected with BRS virus. The RNA may then be
subjected to Northern blot analysis in which detectably labeled
(e.g. radiolabeled) oligonucleotide probe derived from a BRS virus
nucleic acid may be exposed to a Northern blot filter bearing the
cow RNA under conditions permissive for hybridization; following
hybridization, the filter may be washed and binding of probe to the
filter may be visualized by autoradiography. Alternatively, if low
levels of BRS virus are present in a diagnostic sample, it may be
desirable to detect the presence of BRS virus nucleic acid using
oligonucleotides of the invention in PCR reaction in order to
amplify the amount of BRS virus nucleic acid present.
[0084] In a preferred embodiment of the invention, viral RNA
amplified from cultured cells may be analyzed for RS virus
sequences by dot blot hybridization. The presence of BRS virus
sequence not provided by the primer in the product of such a PCR
reaction would be indicative of BRS virus infection.
[0085] In further embodiments, the BRS virus proteins and peptides
of the invention may be used in the diagnosis of BRS virus
infection. For example, and not by way of limitation, BRS virus
proteins and peptides may be utilized in enzyme linked
immunosorbent assay (ELISA), immunoprecipitation, resetting or
Western blot techniques to detect the presence of anti-BRS virus
antibody. In preferred embodiments, a rise in the titer of anti-BRS
virus antibodies may be indicative of active BRS virus infection.
According to these embodiments, a serum sample may be exposed to
BRS virus protein or peptide under conditions permissive for
binding of antibody to protein or peptide and such that binding of
antibody to protein or peptide may be detected. For example, and
not by way of limitation, BRS virus protein or peptide may be
immobilized on a solid surface, exposed to serum potentially
comprising anti-BRS virus antibody (test serum) under conditions
permissive for binding of antibody to protein or peptide, and then
exposed to an agent which permits detection of binding of antibody
to BRS virus protein or peptide, e.g. a detectably labeled
anti-immunoglobulin antibody. Alternatively, BRS virus protein or
peptide may be subjected to Western blot analysis, and then the
Western blot may be exposed to the test serum, and binding of
antibody to BRS virus protein or peptide may be detected as set
forth above. In further, non-limiting embodiments of the invention,
BRS virus protein or peptide may be adsorbed onto the surface of a
red blood cell, and such antigen-coated red blood cells may be
exposed to serum which potentially contains anti-BRS virus
antibody. Rosette formation by serum of antigen coated red blood
cells may be indicative of BRS virus exposure or active
infection.
[0086] In additional embodiments of the invention, antibodies which
recognize BRS virus proteins may be utilized in ELISA or Western
blot techniques in order to detect the presence of BRS virus
proteins, which would be indicative of active BRS virus
infection.
6. EXAMPLE: NUCLEOTIDE SEQUENCE OF THE ATTACHMENT PROTEIN, G, OF
BOVINE RESPIRATORY SYNCYTIAL VIRUS AND EXPRESSION FROM A VACCINIA
VIRUS VECTOR
[0087] 6.1. Materials and Methods
[0088] 6.1.1. Virus and Cells
[0089] The growth and propagation of BRS virus isolate 391-2, wild
type (Copenhagen strain) and recombinant vaccinia viruses (VV)
bovine nasal turbinate (BT) cells, HEp-2 cells, and thymidine
kinase negative (tk.sup.-) 143B cells were as described in Hruby
and Ball (1981, J. Virol. 40:456-464), Lerch et al., (1989, J.
Virol. 63:833-840) and Stott et al. (1986, J. Virol.
60:607-613).
[0090] 6.1.2. cDNA Synthesis, Molecular Cloning, and Identification
of BRS Virus G Specific cDNA Clones
[0091] cDNAS were synthesized using the strand replacement method
of Gubler and Hoffman (1983, Gene 25:263-269) as described in
D'Allesio, et al. (1987, Focus 9:1-4). T4 DNA polymerase (BRL) was
used to make the ends of the cDNAs blunt (Maniatis et al., 1982, in
"Molecular Cloning, a laboratory manual", Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y.). The cDNAs were ligated into
M13mp19 replicative form (RF) DNA, which had been digested with
SmaI and treated with calf intestinal alkaline phosphatase and
transfected into competent E. coli DH5 .alpha.F' cells (Bethesda
Research Laboratories; Hanahan, 1983, J. Mol. Biol. 166:557-580).
M13mp19 phage containing BRS virus G specific inserts were
identified by dot blot hybridization of phage DNA (Davis, et al.,
1986, in "Basic Methods in Molecular Biology," Elsevier Science
Publishing Co., Inc., New York, N.Y.) probed with a BRS virus G
clone (Lerch et al., 1989, J. Virol. 63:833-840) that had been
labeled by nick translation (Rigby, et al., 1977, J. Mol. Biol.
113:237-251). Growth and manipulations of M13mp19 and recombinant
phage were as described by Messing (1983, Methods Enzymol.
101:20-78).
[0092] 6.1.3. Nucleotide Sequencing and Primer Extension on RNA
[0093] Dideoxynucleotide sequencing using the Klenow fragment of E.
coli DNA polymerase I (Pharmacia) or a modified T7 DNA polymerase
(Sequenase, U.S. Biochemicals) was done essentially as described in
Lim and Pene (1988, Gene Anal. Tech. 5:32-39) and Tabor and
Richardson (1987, Proc. Natl. Acad. Sci. U.S.A. 84:4746-4771) using
an M13 sequencing primer (New England Biolabs). Extension of a
synthetic DNA primer, complementary to bases 154 to 166 of the BRS
virus G mRNA, on BRS virus mRNA template using Avian myeloblastosis
virus (AMV) reverse transcriptase (Molecular Genetic Resources) was
done to determine the 5' sequence of the BRS virus G MRNA (Air,
1979, Virol. 97:468-472). BRS virus mRNA used as template in the
primer extension on RNA was harvested as described for mRNA used
for cDNA synthesis (Lerch et al., 1989, J. Virol. 63:833-840).
Nucleotide sequencing and primer extension were done using
[.alpha.-.sup.35S] DATP (Amersham) and polyacrylamide-urea gradient
gel electrophoresis as described by Biggin et al. (1983, Proc.
Natl. Acad. Sci. U.S.A. 80:3963-3965). The nucleotide sequence was
analyzed using the University of Wisconsin Genetics Computer Group
software package (Devereux, et al., 1984, Nucleic Acids Res.
12:387-395).
[0094] 6.1.4. Synthesis and Cloning of Complete cDNAs to the BRS
Virus G mRNA
[0095] A cDNA containing the complete open reading frame of the BRS
virus G mRA was synthesized using a specific synthetic
oligonucleotide for second strand synthesis. The nucleotide
sequence for the oligonucleotide was determined from sequence
analysis of BRS virus mRNAs. First strand synthesis occurred as
described in D'Alessio et al. (1987, Focus 9:1-4). Following
synthesis, the RNA template was digested with RNase A (1
.mu.g/.mu.l) for thirty minutes at 37 degrees Centigrade (C.). The
resulting single stranded cDNAs were isolated by phenol extraction
and ethanol precipitation. The oligonucleotide used for second
strand synthesis had the sequence 5'CACGGATCCACAAGTATGTCCAACC 3'
(SEQ ID No. 7) with the 5' first nine bases of the oligonucleotide
containing a BamHI restriction enzyme site in the gene. The
single-stranded cDNAs were mixed with the oligonucleotides at a
concentration of about 50 .mu.g/ml, heated to 100 degrees C. for
one minute and placed on ice. AMV reverse transcriptase was used to
synthesize the second strand of the cDNAs in a reaction comprising
50 mM Tris-HCl (pH8.0), 50 mM KCl, 5 mM MgCI.sub.2, 10 mM
dithiothreitol, 1.6 mM dNTPs, and 100 U AMV reverse transcriptase
that was incubated for one hour at 50.degree. C. The cDNAs were
separated from protein by phenol extraction, recovered by ethanol
precipitation, and ends made blunt with T4 DNA polymerase.
Blunt-ended cDNAs were then digested with the restriction enzyme
BamHI (Bethesda Research Laboratories) and separated from protein
by phenol extraction. M13mp18 RF DNA, that was digested with BamHI
and SmaI and treated with calf intestinal phosphatase, was mixed in
solution with the cDNAs and recovered by ethanol precipitation. The
cDNAs and vector were ligated and transfected into competent
DH5.alpha.F' cells (Bethesda Research Laboratories) as described in
Hanahan (1983, J. Mol. Biol. 166:557-580).
[0096] 6.1.5. Construction and Isolation of Recombinant Vaccinia
Virus Vectors
[0097] A complete cDNA clone, G4, corresponding to the BRS virus G
mRNA was subcloned into a recombinant plasmid, pIB176-192, by
digestion with BamHI and KpnI, treatment with T4 DNA polymerase to
make the ends of the cDNA blunt, and ligation into the unique
SmaIsite of pEB176-192. The plasmid pIB176-192 is similar to
recombination plasmids described in Ball, et al. (1986, Proc. Natl.
Acad. Sci. USA 83:246-250). pIB176-192 contains base pairs (bp) 1
to 1710 of the HindIII J fragment of vaccinia virus inserted
between the HindIII and SmaI sites of p1B176 (International
Biotechnology Inc.). Inserted into the EcoRI site (bp 670 of the
HindIII J fragment) of the vaccinia virus thymidine kinase (tk)
gene (bp 502 to 1070 of the HindIII J fragment; Weir and Moss,
1983, J. Virol. 46: 530-537) is a 280 bp fragment of DNA that
contains the 7.5K promoter of vaccinia virus. The orientation of
this promoter fragment was such that it directed transcription from
right to left on the conventional vaccinia virus map, opposite to
the direction of transcription of the vaccinia virus tk gene. The
unique SmaI site in pIB176-192 is downstream from the major
transcriptional start site of the 7.5K promoter.
[0098] The isolation of recombinant vaccinia viruses containing the
BRS virus G mRNA sequence was as described in Stott, et al. (1986,
J. Virol. 60:607-613) except that the recombinant viruses were
identified using the blot procedure of Lavi and Ektin (1981,
Carcinogenesis 2:417-423).
[0099] 6.1.6. Characterization of Recombinant Vaccinia Virus
Vectors
[0100] Vaccinia virus core DNA from wild type and recombinant
viruses was prepared for Southern blot analysis as described by
Esposito et al. (1981, J. Virol. Methods 2:175-179). Restriction
enzyme digestion, Southern blot analysis, and radioactive labeling
of DNA by nick translation were performed using standard techniques
(Maniatis et al., 1982, in "Molecular Cloning: a laboratory
manual," Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.;
Rigby, et al., 1977, J. Mol. Biol. 113:237-251). Metabolic labeling
of proteins from BRS virus and wild type and recombinant vaccinia
virus infected cells was as described in Lerch et al. (1989, J.
Virol. 63:833-840) except that proteins in vaccinia virus infected
cells were labeled for three hours starting at three hours
postinfection. SDS-polyacrylamide gel electrophoresis of proteins
was done using standard procedures. For western blot analysis,
proteins from infected and uninfected cells were harvested as
described in Lerch et al. (1989, J. Virol. 63:833-840) at thirty
hours postinfection for BRS virus infected BT cells, and six hours
postinfection for vaccinia virus infected BT cells. Anti-BRS virus
391-2 serum (ibid) was used in the western blot analysis.
Immunofluorescence was done on HEp-2 grown on glass cover slips.
HEp-2 cells were infected with wild type or recombinant vaccinia
viruses (multiplicity of infection (moi)=10). At 48 hours
postinfection, the cells were stained for surface
immunofluorescence using anti-BRS virus 391-2 serum as a first
antibody followed by fluorescein conjugated anti-bovine IgG (H+L).
Fluorescence was observed through a fluorescence microscope
available through Nikon.
[0101] 6.2. Results
[0102] 6.2.1. Nucleic Acid Sequence and Comparison
[0103] In order to determine the sequence of the BRS virus G mRNA
and deduce the amino acid sequence, cDNAs to the BRS virus G mRNA
were generated, and the nucleotide sequence was determined from
nine cDNA clones. The nine clones were derived independently from
four separate cDNA synthesis reactions. Direct sequencing of the 5'
end of G MRNA by primer extension of a synthetic DNA primer on BRS
virus mRNA was also performed. The areas of the BRS virus G mRNA
sequence determined from the different clones and from primer
extension are shown in FIG. 1. Clone G4 is a full length BRS virus
G clone synthesized using an oligonucleotide primer specific for
second strand synthesis. Three independent clones, G4 (bases
8-838), G10 (bases 19-828) and G33 (bases 23-808), were excised
with PstI an KpnI, and subcloned into M13mp18 RF DNA to allow for
sequencing from the opposite end of the cDNA. Clones G10 and G33
were sequenced in their entirety. Clones G1, G7, G12, G5, and G3
were all less than 500 nucleotides in length and only partially
sequenced for this reason.
[0104] The BRS virus G protein mRNA was found to be about 838
nucleotides in length excluding the polyadenylate tail (FIGS. 2A-C)
(SEQ ID No. 1). The BRS virus G mRNA sequence was compared to the
published nucleotide sequences of the G protein mRNAs of HRS
viruses A2 and 18537, a subgroup A virus and a subgroup B virus,
respectively (FIGS. 2A-C) (Johnson et al., 1987, Proc. Natl. Acad.
Sci. U.S.A. 84:5625-5629; Wertz et al., 1985, Proc. Natl. Acad.
Sci. U.S.A. 82: 4075-4079). The BRS virus G mRNA was shorter than
the HRS virus A2 and 18537 G mRNAs by 81 and 84 bases,
respectively. There were some conserved features in common between
the BRS virus G mRNA and the HRS virus G mRNAs. With the exception
of the first nucleotide, the BRS virus G mRNA had the conserved
gene start signal 5'GGGGCAAAU . . . 3'. Collins, et al., (1986,
Proc. Natl. Acad. Sci. USA 83:4594-4598) found at the 5' end of all
HRS virus mRNAs. The 3' end of the BRS virus G mRNA also conformed
to one of the two consensus gene end sequences 5' . . .
AGUA/UAUA/Upoly A3' found at the 3' end of all HRS virus genes
(Collins, et al., 1986, Proc. Natl. Acad. Sci. USA 83:4594-4598).
The position of the initiation codon, nucleotides 16-18, for the
major open reading frame of the BRS virus G mRNA was identical to
the position of the initiation codons of the G mRNAs of HRS viruses
(Johnson et al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:5625-5629;
Satake, et al., 1985, Nucleic Acids Res. 13:7795-7812; Wertz et
al., 1985, Proc. Natl. Acad. Sci. U.S.A. 82:4075-4079). The
noncoding region at the 3' end of the BRS virus mRNA, however, was
42 bases long compared to six bases for the HRS virus A2G MRNA and
27 bases for the HRS virus 18537 G mRNA (Johnson et al., 1987,
Proc. Natl. Acad. Sci. U.S.A. 84:5625-5629; Satake, et al., 1985,
Nucleic Acids Res. 13:7795-7812; Wertz et al., 1985, Proc. Natl.
Acad. Sci. U.S.A. 82:4075-4079). This resulted in the termination
codon for the BRS virus G protein occurring 119 bases prior to the
termination codon for the G protein of HRS virus A2, and 98 bases
prior to the termination codon in the 18537 G mRNA. One clone, G4,
was missing bases 812, 819 and 824, all of which were after the
termination codon in the 3' noncoding region. The BRS virus G mRNA
lacked an upstream ATG found in the HRS virus G mRNAs (Johnson et
al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:5625-5629; Satake, et
al., 1985, Nucleic Acids Res. 13:7795-7812; Wertz et. al., 1985,
Proc. Natl. Acad. Sci. U.S.A. 82:4075-4079).
[0105] The BRS virus G mRNA shared 51.7% sequence identity with the
HRS virus A2 G mRNA and 50.8% with the HRS virus 18537 G mRNA when
the BRS virus G mRNA was aligned with the HRS virus A2 G mRNA. The
HRS virus A2 and 18537 G mRNAs share 67.4% sequence identity
(Johnson et al., 1987, Proc. natl. Acad. Sci. U.S.A. 84:
5625-5629). A slightly different alignment occurs when the BRS
virus G mRNA is aligned with the HRS virus 18537 G mRNA, but
resulted in a change of less than 1% in sequence identity between
the G MRNA of BRS virus and the G mRNA of either HRS virus A2 or
18537 viruses. Computer analysis was used to determine if an
internal deletion would result in a better alignment, but one was
not found.
[0106] 6.2.2. Amino Acid Sequence and Comparison
[0107] The BRS virus G mRNA had a major open reading frame which
predicted a polypeptide of 257 amino acids. The predicted molecular
weight of this polypeptide was 28.6 kD. The deduced amino acid
sequence of the BRS virus G protein is shown (FIGS. 3A and B) (SEQ
ID No. 2) and compared with the published amino acid sequences of
the HRS virus A2 and 18537 G proteins (Johnson et al., 1987, Proc.
Natl. Acad. Sci. U.S.A. 84:5625-5629; Wertz et al., 1985, Proc.
Natl. Acad. Sci. U.S.A. 82:4075-4079). The BRS virus G protein was
similar in overall amino acid composition to the HRS virus G
proteins, with a high content of threonine and serine residues,
25.7%, compared to that observed for the G proteins of the HRS
viruses 18537 (28.4%) and A2 (30.6%). Serine and threonine residues
are potential sites for the addition of O-linked carbohydrate side
chains. Out of 66 threonine and serine residues in the BRS virus
protein, 52 (79%) of these are in the proposed extracellular
domain. The position of only nine threonine residues (amino acids
12, 52, 72, 92, 129, 139, 199, 210, 211, 235) and eight (8) serine
residues (amino acids 2, 28, 37, 44, 53, 102, 109, 174) were
conserved between predicted amino acid sequences of all the G
proteins examined to date (FIGS. 3A and B) (SEQ ID No. 2). In
addition to the potential O-linked carbohydrate addition sites,
there were four sites for potential N-linked carbohydrate addition
in the BRS virus G protein. The position of none of the potential
N-linked addition sites was conserved between BRS virus and the
subtype B HRS virus; two of the four potential sites were the same
in HRS virus A2 and BRS virus G proteins. The BRS virus G protein
had a high proline content, 7.8%, similar to that observed for the
G proteins of the HRS viruses A2 (10%) and 18537 (8.6%) (Johnson et
al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:5625-5629; Satake, et
al., 1985, Nucleic Acids Res. 13:7795-7812; Wertz et al., 1985,
Proc. Natl. Acad. Sci. U.S.A. 82:4075-4079). Six proline residues
were conserved among all RS virus G proteins sequenced to date.
These proline residues were amino acids 146, 155, 156, 172, 194,
and 206 (FIGS. 3A and B) (SEQ ID No. 2). There were four cysteine
residues in the proposed extracellular domain of the BRS virus G
protein. These four residues were exactly conserved in position,
relative to the amino terminus of the protein, with the four
cysteine residues conserved among the HRS virus A2, Long and 18537
(FIGS. 3A and B) (SEQ ID No. 2) (Johnson et al., 1987, Proc. Natl.
Acad. Sci. U.S.A. 84:5625-5629; Satake, et al., 1985, Nucleic Acids
Res. 13:7795-7812; Wertz et al., 1985, Proc. Natl. Acad. Sci.
U.S.A. 82:4075-4079). In addition, the G proteins of BRS virus, HRS
virus A2, and HRS virus 18537 all shared a cysteine residue in the
proposed cytoplasmic domain (FIGS. 3A and B) (SEQ ID No. 2).
However, this cysteine residue is not present in the HRS virus Long
G protein.
[0108] While the cysteine residues were conserved in the BRS virus
G protein, a thirteen amino acid region reported previously to be
exactly conserved in the E proteins of subgroups A and B HRS
viruses was not conserved in the BRS virus G protein. Only six of
the thirteen amino acids in this region of the BRS virus G protein
were conserved, and two of these six were the cysteine residues
(FIGS. 3A and B) (SEQ ID No. 2).
[0109] The amino acid identity among the BRS virus G protein and
the HRS virus proteins was significantly lower than the amino acid
identity observed between the G proteins of the HRS virus subgroup
A and B (FIG. 4). The overall amino acid identity between the HRS
virus A2 and 18357 G proteins is 53%. The BRS virus G protein
shared only 29% amino acid identity with the HRS virus A2 G protein
and 30% amino acid identity with the HRS virus 18537 G protein.
Comparison of amino acid identity within each of the three
postulated domains of the G proteins showed distinct differences in
the levels of identity in the three domains. The identity between
the proposed extracellular domain of the BRS virus and HRS virus G
proteins was significantly lower than the overall amino acid
identity, and lower than the identity between extracellular domains
of the two HRS virus G proteins (FIG. 4). The proposed cytoplasmic
and transmembrane domains of the BRS virus G protein were more
conserved than the extracellular domain, with 43% and 55% amino
acid identity, respectively, observed among the corresponding
domains of either HRS virus G protein (FIG. 4).
[0110] Although the overall identity of the BRS virus G protein to
either HRS G protein was lower than that between HRS virus G
proteins, there were similarities in the hydropathy profiles of the
different G proteins (FIGS. 5A-C) (Johnson et al., 1987, Proc.
Natl. Acad. Sci. U.S.A. 84:5625-5629; Satake, et al., 1985, Nucleic
Acids Res. 13:7795-7812; Wertz et al., 1985, Proc. Natl. Acad. Sci.
U.S.A. 82:4075-4079). There was an initial hydrophilic region
followed by a hydrophobic peak in the G protein of HRS virus A2,
HRS virus 18537 and the G protein of BRS virus. These two regions
together corresponded to the proposed cytoplasmic domain (amino
acids 1-37). This was ream of followed by a region of strong
hydrophobicity, corresponding to the proposed transmembrane domain
(amino acids 38-66). The remainder of the protein was mainly
hydrophilic, corresponding to the proposed extracellular domain
(amino acids 67-257, 292, or 298). This hydrophilic extracellular
domain was interrupted in all three G proteins by a short region of
hydrophobicity (amino acids 166-188) which corresponded to the area
containing the four conserved cysteine residues.
[0111] The BRS virus G mRNA contained two open reading frames in
addition to the major open reading frame. One open reading frame
began at nucleotide 212, ended at nucleotide 352, and coded for a
predicted polypeptide of 46 amino acids. The other and larger of
the two was in the same coding frame as the first but began at
nucleotide 380 and ended at nucleotide 814. This open reading frame
coded for a predicted polypeptide of 144 amino acids.
[0112] 6.2.3. Construction and Characterization of Recombinant
Vaccinia Virus Vectors Containing the BRS Virus G Gene
[0113] A cDNA containing the complete major open reading frame of
the BRS virus G mRNA was inserted into a plasmid, pIB176-192,
designed for the construction of vaccinia virus recombinants. The
plasmid pIB176-192 is similar to recombination plasmids described
previously (Ball, et al., 1986, Proc. Natl. Acad. Sci. USA
83:246-250) which contain a portion of the HindIII J fragment of
vaccinia virus with the 7.5K promoter inserted into the thymidine
kinase (tk) gene. However, in the case of pIB176-192, the 1710 base
pair fragment between the HindIII and PvuII sites of the HindIII J
fragment was inserted between the HindIII and SmaI sites of pIB176
and the 7.5K promoter directs transcription in the direction
opposite of the tk promoter. The cDNA of the BRS virus G mRNA was
inserted downstream of the major transcriptional start site of the
7.5K promoter. The HindIII J fragment containing the inserted BRS
virus G gene was inserted into the genome of vaccinia virus
(Copenhagen strain) by homologous recombination (Stott, et al.,
1986, J. Virol. 60:607-613). Thymidine kinase negative recombinant
vaccinia viruses (rVV) were identified by hybridization of
recombinant viral DNA with a probe specific for the BRS virus G
gene and selected by three rounds of plaque purification.
Recombinant vaccinia virus G642 and G4567 contained the BRS virus G
gene in the forward and reverse orientation with respect to the
7.5K promoter, respectively. The genome structures of recombinant
vaccinia viruses were confirmed by southern blot analysis of
digests of vaccinia virus core DNA to confirm that the BRS virus G
gene was inserted within the tk gene of the recombinant
viruses.
[0114] 6.2.4. Analysis of Proteins from Cells Infected with
Recombinant Vaccinia Virus Containing the BRS Virus G Gene
[0115] The ability of the recombinant vaccinia virus containing the
BRS virus G gene to express the BRS virus G protein was examined in
BT cells. The proteins from BT cells infected with either BRS
virus, wild type vaccinia virus, or the recombinant vaccinia
viruses containing the BRS virus G gene were analyzed by western
blot analysis with BRS virus 391-2 specific antiserum because the
BRS virus G protein is not readily labeled with
[.sup.35S]-methionine due to the scarcity of this amino acid in the
BRS virus G amino acid sequence, and the fact that the 391-2
antiserum does not work for immunoprecipitation. The 391-2
antiserum was shown previously to recognize the BRS virus G protein
in a western blot analysis of proteins from BRS virus infected
cells (Lerch et al., 1989, J. Virol. 63:833-840). The serum
recognized two proteins present in rVV G642 (forward orientation)
infected cells (FIG. 6, lane G642+) but not in rVV G4567 (reverse
orientation) or wild type vaccinia infected cells (FIG. 6, lanes
G4567- and VV respectively). The two proteins produced in rVV G642
infected cells comigrated with proteins recognized by the antiserum
in BRS virus infected cells. One of the proteins in rVV G642
infected cells comigrated with the mature BRS virus G protein,
migrating as a broad band between the 68 kD and 97 kD protein
markers. The other protein migrated at approximately 43 kD.
[0116] 6.2.5. Surface Expression of BRS Virus G Protein Expressed
from Recombinant Vaccinia Viruses
[0117] The G protein is a glycoprotein expressed on the surface of
infected cells and incorporated in the membranes of virions (Huang,
1985, Virus Res. 2:157-173). In order to determine if the BRS virus
G protein expressed in the recombinant vaccinia virus infected
cells was transported to and expressed on the surface of infected
cells, indirect immunofluorescent staining was performed on
recombinant virus infected cells. BT cells were found to be
extremely sensitive to vaccinia virus infection. There was high
background fluorescence and very few cells survived the staining
procedure. For these reasons immunofluorescence staining was done
on recombinant virus infected HEp-2 cells. HEp-2 cells that were
infected with recombinant G642 (FIG. 7, panel rVVG) demonstrated
specific surface fluorescence which was not present in either
uninfected cells (FIG. 7, panel M) or wild type vaccinia virus
infected cells (FIG. 7, panel VV).
[0118] 6.3. Discussion
[0119] The G protein of respiratory syncytial virus is an unusual
viral glycoprotein for a variety of reasons. Although it has been
characterized as the attachment protein for HRS virus (Levine et
al., 1987, J. Gen. Virol. 68:2521-2524), it lacks both
neuraminidase and hemagglutinating activities observed in the
attachment proteins of other viruses in the Paramyxovirus family
(Gruber and Levine, 1983, J. Gen. Virol. 64:825-832; Richman et
al., 1971, Appl. Microbiol. 21: 1099). Evidence suggests the HRS
virus G protein is extensively glycosylated with approximately 55%
of the mass of the mature protein estimated to be due to addition
of O-linked oligosaccharide side chains (Lambert, 1988, Virology
164:458-466). The G protein of BRS virus has been shown to be
antigenically distinct from the HRS virus G protein (Lerch et al.,
1989, J. Virol. 63:833-840; Orvell et al., 1987, J. Gen. Virol.
68:3125-3135). In addition, with the exception of one report
(Matumoto et al., Arch. Gesamte Virusforsch 44:280-290), BRS virus
is unable to productively infect cells of human origin while HRS
virus infects both human and bovine cells. It is possible that the
difference in host range between BRS and HRS viruses may be
reflected in the amino acid sequence differences observed in the
attachment proteins.
[0120] In order to further examine the differences between the BRS
virus and the HRS virus G proteins the nucleotide sequence of the
BRS virus G protein mRNA from cDNA clones was determined. The BRS
virus G mRNA was smaller than the G mRNAs of the HRS viruses, and
shared 51% sequence identity with the G mRNAs of the HRS viruses
sequenced to date. The consensus viral gene start and end sequences
observed in HRS virus genes were conserved in the BRS virus G mRNA,
as was the position of the initiation codon with respect to the
initiation codon of the HRS virus G mRNA. The BRS virus G mRNA had
a larger 3' noncoding region, which combined with the smaller size
of the BRS virus G mRNA, resulted in a major open reading frame
which coded for a polypeptide of 257 amino acids and having an
estimated molecular weight of 28 kDa. This compares to polypeptides
of 298 and 292 amino acids coded for by the G mRNAs of HRS virus
subgroup A and subgroup B viruses, respectively, and estimated
molecular weights of about 32 kDa for each. The size of the
predicted BRS virus G polypeptide when compared to the estimated
size of the mature BRS virus G protein found in infected cells
suggested that there is extensive modification of the BRS virus G
polypeptide.
[0121] Studies using endoglycosidases, inhibitors of carbohydrate
addition, and a cell line deficient in O-linked glycosylation have
shown that the HRS virus G protein is extensively glycosylated with
both N- and O-linked carbohydrate side chains (Lambert, 1988,
Virology 164:458-466). The mature BRS virus G protein from infected
cells was shown to be glycosylated and had an electrophoretic
mobility similar to the 90 kDa HRS virus G protein whereas the
predicted amino acid sequence for the polypeptide indicated a
protein of 28 kDa (Lerch et al., 1989, J. Virol. 63:833-840;
Westenbrink et al., 1989, J. Gen. Virol. 70:591-601). This
suggested the BRS virus G protein was also extensively glycosylated
as is the HRS virus G protein. The predicted amino acid sequence of
the BRS virus G protein had high levels of serine and threonine
(25%), similar to the levels for the HRS virus G proteins (30% and
28% for subgroup A and B, respectively) although the actual number
of potential 0-glycosylation sites for BRS virus (66) is lower than
the 91 potential sites found in HRS virus subgroup A (Johnson et
al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:5625-5629; Satake, et
al., 1985, Nucleic Acids Res. 13:7795-7812; Wertz et al., 1985,
Proc. Natl. Acad. Sci. U.S.A. 82:4075-4079). The high content of
serine and threonine in the deduced BRS virus G amino acid sequence
suggests that the BRS virus G protein also has the potential for
extensive O-linked glycosylation.
[0122] Although the overall amino acid composition of the BRS virus
G protein was similar to that of the HRS virus G protein, the BRS
virus G amino acid sequence had a lower level of overall amino acid
identity with the HRS virus G proteins of either the subgroup A or
B viruses (Johnson et al., 1987, Proc. Natl. Acad. Sci. U.S.A.
84:5625-5629). There was only 29-30% identity between the BRS virus
G protein and the G protein of either subgroup A or B HRS viruses,
whereas there is 53% amino acid identity when the G proteins of the
HRS virus subgroup A and subgroup B viruses are compared (Johnson
et al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:5625-5629). Higher
levels of amino acid identity were present between the BRS virus G
protein and the HRS virus G proteins in the proposed cytoplasmic
and transmembrane domains, but again this level was not as high as
that found when comparing those regions of the G proteins of
subgroup A and B HRS viruses (FIG. 4). The fact that the BRS virus
G protein amino acid sequence is not significantly more closely
related to the G protein amino acid sequence of either HRS virus
subgroup A or B suggests that the human and bovine respiratory
syncytial viruses diverged prior to the emergence of the HRS virus
A and B subgroups and that they should be classified in separate
Pneumovirus subgroups.
[0123] The predicted amino acid sequence of the BRS virus G protein
showed that the BRS virus and HRS virus G proteins shared only
29-30% amino acid identity. In spite of these differences, the
hydropathy profiles of the two proteins showed strong similarities
suggesting the possibility of similar overall structural
features.
[0124] Johnson et al. (1987, Proc. Natl. Acad. Sci. U.S.A.
84:5625-5629) suggested that a conserved 13 amino acid region found
in the extracellular domain of the G protein of HRS viruses could
be a candidate for a receptor binding site. The fact that this
conserved region is not conserved in the G protein of BRS virus
could relate to the host specificity of BRS virus. The four
conserved cysteine residues found in the G protein of both the BRS
virus and HRS viruses could result in a similar secondary structure
among the G proteins with specific differences in the conserved
region changing the host specificity. Convalescent calf serum has
suggested the possibility that BRS virus may have antigenic
subgroups as does HRS virus (Lerch et al., 1989, J. Virol.
63:833-840).
[0125] Recombinant vaccinia viruses containing a cDNA insert to the
BRS virus G gene expressed the BRS virus G protein. This BRS virus
G protein had an electrophoretic mobility in SDS-polyacrylamide
gels which was similar to the G protein from BRS virus infected
cells. Antiserum specific for BRS virus 391-2 recognized the BRS
virus G protein produced by recombinant vaccinia virus in infected
cells as shown by western blot analysis. The BRS virus G protein
expressed from the recombinant vaccinia virus was transported to
and expressed on the surface of infected cells as shown by surface
immunofluorescence.
7. EXAMPLE: NUCLEOTIDE SEQUENCE ANALYSIS OF BOVINE RESPIRATORY
SYNCYTIAL VIRUS FUSION PROTEIN mRNA AND A RECOMBINANT VACCINIA
VIRUS
[0126] 7.1. Materials and Methods
[0127] 7.1.1. Virus and Cells
[0128] The growth and propagation of BRS virus 391-2, wild type
(Copenhagen strain) and recombinant vaccinia viruses, bovine nasal
turbinate (BT) cells HEp-2 cells, and thymidine kinase negative
(tk.sup.-) 143B cells were as described in Hruby and Ball (1981, J.
Virol. 40:456-464; Stott et al., 1986, J. Virol. 60: 607-613; Lerch
et al., 1989, J. Virol. 63:833-840).
[0129] 7.1.2. Protein Labeling and Harvest of BRS Virus Infected
Cells
[0130] Cell monolayers of bovine nasal turbinate (BT) cells were
mock, BRS virus or HRS virus-infected. Tunicamycin (1.5 .mu.g/ml,
Boehringer Mannheim) was added to the medium covering the cells at
25 hours post infection where indicated. After one hour the medium
was removed from all monolayers and replaced with DMEM lacking
methionine (Gibco). Tunicamycin was re-added where indicated.
Following a 30 minute incubation, [.sup.35S]methionine (100
.mu.Ci/ml, New England Nuclear) was added to the medium. The cells
were incubated for two hours and proteins harvested as described in
Lerch et al., 1989, J. Virol. 63:833-840. Virus-specific proteins
were immunoprecipitated as described in Wertz et al., (1985, Proc.
Natl. Acad. Sci. U.S.A. 82:4075-4079) using Wellcome anti-RS serum
(Wellcome Reagents Ltd.). Proteins were analyzed by
SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (Laemmli, 1970,
Nature (London) 227:680-685), and detected by fluorography (Davis
and Wertz, 1982, J. Virol. 2041:821-832).
[0131] 7.1.3. cDNA Synthesis, Molecular Cloning, and Identification
of F Specific cDNA Clones
[0132] cDNAs were synthesized using the strand replacement method
of Gubler and Hoffman (1983, Gene 25:263-269) as described in
D'Alessio et al. (1987, Focus 9:1-4). T4 DNA polymerase (BRL) was
used to make the ends of the cDNAs blunt (Maniatis et al., 1982, in
"Molecular Cloning: a laboratory manual," Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y.). The cDNAs were ligated into
M13mp19 replicative form (RF) DNA, which had been digested with
SmaI and treated with calf intestinal alkaline phosphatase
(Maniatis et al., supra), and transfected into competent E. coli
DH5 .alpha.F' cells (Bethesda Research Laboratories) (Hanahan,
1983, J. Mol. Biol. 166:557-580). M13mp19 phage containing BRS
virus F specific inserts were identified by dot blot hybridization
of phage DNA (Davis et al., 1986, "Basic Methods in Molecular
Biology." Elsevier Science Publishing Co., Inc., New York, N.Y.)
probed with a previously identified BRS virus F gene specific clone
(Lerch et al., 1989, J. Virol. 63:833-840) which had been labeled
by nick translation (Rigby et al., 1977, J. Mol. Biol.
113:237-251). Growth and manipulations of M13mp19 and recombinant
phage were as described by Messing (1983, Meth. Enzymol.
101:20-78).
[0133] 7.1.4. Nucleotide Sequencing and Primer Extension on RNA
[0134] Dideoxynucleotide sequencing using the Klenow fragment E.
coli DNA polymerase I (Pharmacia) or a modified T7 DNA Polymerase
(Sequenase, U.S. Biochemicals) was done as described in Tabor and
Richardson (1987, Proc. Natl. Acad. Sci. U.S.A. 84:4746-4771) and
Lim and Pene (1988, Gene Anal. Tech. 5:32-39) using an M13
sequencing primer (New England Biolabs). Extension of a synthetic
DNA primer, complementary to bases 267 to 284 of the BRS virus F
MRNA, was done on BRS virus rnRNA using Avian myeloblastosis virus
(AMV) reverse transcriptase (Molecular Genetic Resources) (Air,
1979, Virology 97:468-472). BRS virus mRNA used a template in the
primer extension on RNA and was harvested as described for mRNA
used for cDNA synthesis (Lerch et al., 1989, J. Virol. 63:833-840).
Nucleotide sequencing and primer extension were done using
[.alpha.-.sup.35S] DATP (Amersham) and polyacrylamide-urea gradient
gel electrophoresis as described by Biggin et al. (1983, Proc.
Natl. Acad. Sci. U.S.A. 80:3963-3965). The nucleotide sequence was
analyzed using the University of Wisconsin Genetics Computer Group
software package (Devereux et al., 1984, Nucl. Acids Res.
12:387-395).
[0135] 7.1.5. Synthesis and Cloning of a Complete cDNA to the BRS
Virus F mRNA
[0136] A cDNA containing the complete major open reading frame of
the BRS virus F mRNA was synthesized using a specific synthetic
oligonucleotide for second strand synthesis. The nucleotide
sequence for this oligonucleotide was determined from sequence
analysis of BRS virus mRNAs. First strand synthesis occurred as
described in D'Alessio et al. (1987, Focus 9:1-4). Following
synthesis, the RNA template was digested with RNase A (1
.mu.g/.mu.l) for thirty minutes at 37.degree. C. The resulting
single-stranded cDNAs were isolated by phenol extraction and
ethanol precipitation. The oligonucleotide used for second strand
synthesis had the sequence 5'CACGGATCCACAAGTATGTCCAACC3' (SEQ ID
No. 7) with the 5' first nine bases of the oligonucleotide
containing a BamHI restriction enzyme site. The single-stranded
cDNAs were mixed with the oligonucleotide (50 .mu.g/ml), heated to
100.degree. C. for one minute and placed on ice. AMV reverse
transcriptase was used to synthesize the second strand of the cDNAs
in a reaction [50 mM Tris-HCl (pH8.0), 50 mM KCl, 5 mMgC12, 10 mM
dithiothreitol, 1.6 mM dNTPs, 100 U AMV reverse transcriptase] that
was incubated for one hour at 50.degree. C. The cDNAs were
separated from protein by phenol extraction, recovered by ethanol
precipitation, and the ends made blunt with T4 DNA polymerase.
Blunt-ended cDNAs were then digested with the restriction enzyme
BamHI (Bethesda Research Laboratories) and separated from protein
by phenol extraction. M13mp18 RF DNA, that was digested with BamHI
and SmaI and treated with calf intestinal phosphatase, was added to
the cDNAs and recovered by ethanol precipitation. The cDNAs and
vector were ligated and transfected into competent DH5.alpha.F'
cells (Bethesda Research Laboratories) as described in Hanahan
(1983, J. Mol. Biol. 166:557-580).
[0137] 7.1.6. Construction and Isolation of Recombinant Vaccinia
Virus Vectors
[0138] A complete cDNA clone, F20, corresponding to the BRS virus F
mRNA was subcloned into a recombination plasmid, pIBI76-192, by
digestion with BamHI and KpnI, treatment with T4 DNA polymerase to
make the ends of the cDNA blunt, and ligation into the unique SmaI
site of pIBI76-192. The plasmid pIB176-192 is similar to
recombination plasmids described in Ball et al. (1986, Proc. Natl.
Acad. Sci. U.S.A. 83:246-250). In the case of pIBI76-192, base
pairs (bp) 1 to 1710 of the HindIII J fragment of vaccinia virus
was inserted between the HindIII and SmaI sites of pIBI76
(International Biotechnology Inc.). A 280 bp. fragment of DNA that
contains the 7.5k promoter of vaccinia virus was inserted into the
EcoRI site (bp 670 of the HindIII J fragment) of the vaccinia virus
thymidine kinase (tk) gene (bp 502 to 1070 of the HindIII J
fragment, Weir and Moss, 1983, J. Virol. 46:530-537). The
orientation of this promoter was such that it directed
transcription from right to left on the conventional vaccinia virus
map, opposite to the direction of transcription of the vaccinia
virus tk gene. The unique SmaI site in pEBI76-192 was downstream of
the major transcriptional start site of the 7.5K promoter.
[0139] The isolation of recombinant vaccinia viruses containing the
BRS virus F mRNA sequence was as described in Stott et al. (1986,
J. Virol. 60:607-613) except that the recombinant viruses were
identified using the blot procedure of Lavi and Ektin (1981,
Carcinogenesis 2:417-423).
[0140] 7.1.7. Characterization of Recombinant Vaccinia Varus
Vectors
[0141] DNA from vaccinia virus cores isolated from wild type and
recombinant viruses was prepared for southern blot analysis as
described by Esposito et al. (1981, J. Virol. Meth. 2:175-179).
Restriction enzyme digestion, southern blot analysis, and
radioactive labeling of DNA by nick translation were as described
in Section 6, supra. Metabolic labeling of proteins from wild type
and recombinant vaccinia virus infected cells was as above except
that infected cells were exposed to label for three hours starting
at three hours postinfection. Proteins were analyzed by
SDS-polyacrylamide gel electrophoresis using standard procedures.
Immunoprecipitation of virus-specific proteins was as described in
Wertz et al. (1985, Proc. Natl. Acad. Sci. U.S.A. 82:4075-4079)
using Wellcome anti-RS serum (Wellcome Reagents Ltd.). For
immunofluorescence HEp-2 cells were grown on glass cover slips.
Cells were infected with wild type or recombinant vaccinia viruses
(moi=10) and at 24 hours postinfection the cells were stained by
indirect immunofluorescence using anti-BRS virus 391-2 serum (Lerch
et al., 1989, J. Virol. 63:833-840) as a first antibody followed by
fluorescein conjugated anti-bovine IgG (H+L). Fluorescence was
observed through a fluorescence microscope (available from
Nikon).
[0142] 7.2. Results
[0143] 7.2.1. Nucleic Acid Sequence and Comparison
[0144] In order to determine the complete nucleotide sequence of
the BRS virus F mRNA, cDNA clones in M13 phage vectors were
isolated and their nucleotide sequence analyzed. The BRS virus F
mRNA sequence was determined from eight clones derived
independently from four separate cDNA synthesis reactions. The
areas of the BRS virus F MRNA sequence determined from the
different clones are shown in FIG. 8. The majority of the sequence
was determined from three clones, FB3, FB5 and F20. Clone F20 is a
full length BRS virus F cDNA which was synthesized using
oligonucleotide specific for the 5' end of the BRS virus F MRNA.
The inserts from clones FB3, FB5 and F20 were excised using the
restriction enzymes PstI and KpnI, which do not cut within the
inserts, and subcloned into M13mp18 RF DNA to sequence from the
opposite end of the cDNA. In addition, restriction fragments of the
inserts were subcloned into M13mp18 and mp19 RF DNA to allow for
determination of the sequence of the middle of the cDNAs. Clone F20
was digested with the restriction enzymes AlwNI, PflMI, EcoRV, or
HpaI, and clones FB3 and FB5 were digested with the restriction
enzyme EcoRI. The 5' end of the BRS virus F mRNA sequence was
determined by extension of a DNA oligonucleotide on mRNA from BRS
virus infected cells. The sequence for the oligonucleotide,
complementary to bases 267 to 284 of the BRS virus F mRNA, was
determined from the sequence provided by the cDNA clones. Clones
F29, FB2, F138 and FB1, all 750 nucleotides or less, were not
sequenced extensively.
[0145] The BRS virus F mRNA contained 1899 nucleotides excluding a
polyadenylate tail (FIGS. 9A-C) (SEQ ID No. 3). Seven bases at the
exact 5' end of the mRNA could not be determined due to strong stop
signals in all four nucleotide reactions for each base during
primer extension on mRNA. The sequence at the 3' end of the BRS
virus F mRNA conformed to one of the two consensus gene-end
sequences, 5' . . . AGUA/UAUA/UpolyA3', found at the end of all HRS
virus genes (Collins et al., 1986, Proc. Natl. Acad. Sci. U.S.A.
83:4594-4598) and at the 3' end of the BRS virus G mRNA. The BRS
virus F mRNA had a single major open reading frame starting with an
initiation codon beginning at nucleotide 14 and extending to a
termination codon at nucleotide 1736. There was a 161 nucleotide
noncoding region at the 3' end prior to the 3' polyadenylate tract
(FIGS. 9A-C) (SEQ ID No. 3).
[0146] The nucleotide sequence of the BRS virus F mRNA was compared
to the published sequences for the F mRNA of HRS virus A2 (Collins
et al., 1986, Proc. Natl. Acad. Sci. U.S.A. 83:4594-4598), Long
(Lopez et al., 1988, Virus Res. 10:249-262), RSS-2 (Baybutt and
Pringle, 1987, J. Gen. Vir. 68:2789-2796) and 18537 (Johnson and
Collins, 1988, J. Gen. Virol. 69:2623-2628) to determine the extent
of nucleic acid identity among the different F mRNA sequences
(Table 1).
1TABLE 1 Nucleic Acid Identity Between the Fusion Protein Genes of
Respiratory Syncytial Viruses (% Identity Within Indicated Areas)
Coding 3' Noncoding Viruses Compared Total Sequence Sequence HRS
Virus, Subgroup A 97-98 97 98-99 vs HRS Virus, Subgroup A HRS
Virus, Subgroup B 79 82 47 vs HRS Virus, Subgroup A BRS Virus 72 75
36-37 vs HRS Virus, Subgroup A BRS Virus 71 74 39 vs HRS Virus,
Subgroup B
[0147] HRS virus A2, Long and RSS-2 are subgroup A viruses, and
18537 is a subgroup B virus (Anderson et al., 1985, J. Infect. Dis.
151:626-633; Mufson et al., 1985, J. Gen. Virol. 66:2111-2124). The
level of nucleic acid identity between the F mRNAs of BRS virus and
HRS viruses (71.5%) was similar to that observed when comparing the
F mRNAs of the two HRS virus subgroups (79%). Both the level of
identity between the F mRNAs of BRS virus and HRS virus, and
between the F mRNAs of the two HRS virus subgroups was lower than
the level of identity between the F mRNAs of HRS viruses within the
same subgroups (97-98%). The level of nucleotide sequence identity
between the BRS virus and HRS viruses in the 3' noncoding region of
the F sequence was 37.5% compared to 74.5% in the F sequence coding
region. This was similar to the levels of identity in 3' noncoding
and coding regions, 47% and 82% respectively, when comparing the F
sequences of the subgroup A HRS viruses to the subgroup B HRS
virus. There was variation in the nucleotides at two positions in
the F mRNA sequence. In one clone, clone F20, nucleotides 455 and
473 were a G and C, respectively, rather than the A and G observed
in the other clone and shown in the sequence (FIGS. 9A-C).
[0148] 7.2.2. Predicted Amino Acid Sequence of the BRS Virus F
Protein and Comparison to the F Proteins Sequences of HRS Virus
[0149] The open reading frame of the BRS virus F mRNA predicted a
polypeptide of 574 amino acids. The amino acid sequence of this
polypeptide is shown below the MRNA sequence in FIGS. 9A-C (SEQ ID
No. 4). The estimated molecular weight of the predicted BRS virus F
polypeptide was 63.8 kDA. A hydropathy profile of the predicted
polypeptide indicated strong hydrophobic regions at the amino
terminus, corresponding to residues 1 through 26, and close to the
carboxy terminus, corresponding to residues 522 through 549 (FIG.
10). The hydropathy profile and amino acid sequence suggested
domains in the BRS virus F protein similar to those described for
the HRS virus F protein, including an amino terminal signal peptide
region (residues 1-26), carboxy terminal anchor region (residues
522-549), and putative cleavage sequence (residues 131-136) that
generates the F.sub.1 and F.sub.2 polypeptides (see FIGS. 10 and
11A-C). There were three potential sites for addition of N-linked
carbohydrate side chains, two in the proposed F.sub.2 polypeptide,
and one in the proposed F.sub.1 polypeptide (FIGS. 9A-C) (SEQ ID
No. 4).
[0150] The predicted BRS virus F amino acid sequence was compared
to the predicted amino acid sequences of the F polypeptides of HRS
viruses A2 (Collins et al., 1984, Proc. Natl. Acad. Sci., U.S.A.
81:7i683-7i687), Long (Lopez et al., 1988, Virus Res. 10:249-262),
RSS-2 (Baybutt and Pringle, 1987, J. Gen. Virol. 68:2789-2796) and
18537 (Johnson and Collins, 1988, J. Gen. Virol. 69:2623-2628)
(FIGS. 11A-C). The BRS virus F polypeptide was 574 amino acids as
are all four HRS virus F polypeptides. Proposed carboxy terminal
hydrophobic anchor (residues 522-549) and amino terminal signal
regions (residues 1-26) present in the BRS virus F protein were
similar to those in the HRS virus F proteins. In addition, the
sequence of Lys-Lys-Arg-Lys-Arg-Arg at residues 131 to 136 in the
BRS virus F protein represented a proposed cleavage signal. This
sequence was identical to the proposed cleavage signals in all the
HRS virus F proteins. The cleavage sequence in the BRS virus F
protein was followed by a stretch of hydrophobic residues (residues
137-158) that would represent the amino terminus of the F.sub.1
polypeptide following cleavage. The nucleotide differences in clone
F20 would result in amino acids residues 148 and 154, part of the
proposed F.sub.1 amino terminus, changing from Val to Ile, and Leu
to Val, respectively. These differences would result in the amino
acids at these two positions in the BRS virus F protein being
identical to the corresponding amino acid positions in the HRS
virus F proteins.
[0151] With the exception of one cysteine residue (residue 25) in
the proposed amino terminal signal peptide, all the cysteine
residues were conserved in position among the BRS virus and HRS
virus F proteins. This includes the cysteine residue at position
550, which has been shown to be the site of covalent attachment of
palmitate to the human RS virus F protein (Arumugham et al., 1989,
J. Biol. Chem. 264: 10339-10342). There was a single potential site
for N-linked glycosylation (residue 500) in the F.sub.1 polypeptide
of the BRS virus F protein that was conserved in all the HRS virus
F proteins (FIGS. 11A-C). There were two potential sites for
N-linked glycosylation (residues 27 and 120) in the BRS virus
F.sub.2 polypeptide (FIGS. 9A-C and 11A-C). The potential site at
residue 27 was conserved among the BRS virus and HRS virus F
proteins (FIGS. 11A-C). However, the HRS virus F.sub.2 polypeptides
contained a total of four or five potential sites, depending on the
isolate, and the position of the remaining potential site for
N-linked glycosylation in the BRS virus F.sub.2 polypeptide was not
conserved in all the HRS virus F.sub.2 polypeptides (FIGS. 11A-C).
The existence of only two potential N-linked glycosylation sites on
the BRS virus F.sub.2 polypeptide was consistent with the earlier
observation that there were differences in electrophoretic mobility
of the BRS virus and HRS virus F.sub.2 polypeptides (Lerch et al.,
1989, J. Virol. 63:833-840).
[0152] The amino acid identity between the F proteins of the
different viruses is shown for the different regions of the F
protein (Table 2).
2TABLE 2 Amino Acid Identity Between the Fusion Proteins of
Respiratory Syncytial Viruses (% Identity Within Indicated Areas)
F.sub.1 F.sub.2 Signal Viruses Compared Total Peptide Peptide
Peptide HRS Virus, Subgroup A 97-98 98-99 93-96 81-88 vs HRS Virus,
Subgroup A HRS Virus, Subgroup B 89 93 83 36 vs HRS Virus, Subgroup
A BRS Virus 80 88 67-68 4 vs HRS Virus, Subgroup A BRS Virus 81 88
68 12 vs HRS Virus, Subgroup B
[0153] HRS viruses A2, Long, and RSS-2 are subgroup A viruses, and
18537 is a subgroup B virus (Anderson et al., 1985, J. Infect. Dis.
151:626-633); Mufson et al., 1985, J. Gen. Virol. 66:2111-2124).
Although the greatest extent of variation was in the proposed
signal peptide region (residues 1-26), the overall hydrophobicity
of this region was conserved in the BRS virus F protein (FIG. 10).
The proposed F.sub.2 polypeptide of the BRS virus F protein showed
a lower level of identity to the F.sub.2 polypeptides than is
present between the F.sub.2 polypeptides of the HRS virus A and B
subgroups (Johnson and Collins, 1988, J. Gen. Virol. 2623-2628). In
contrast, the levels of identity between the different F.sub.1
polypeptides were similar whether comparing BRS virus to HRS virus
or comparing two HRS virus subgroups.
[0154] 7.2.3. Effects of Tunicamycin on Electrophorectic Mobility
of BRS Virus F Protein
[0155] To determine whether previously observed glycosylation of
the BRS virus F protein (Lerch et al., 1989, J. Virol. 63:833-840)
was due to N-linked glycosylation, the electrophoretic mobility of
the BRS virus F protein radioactively labeled in the presence and
absence of tunicamycin, an inhibitor of N-linked glycosylation, was
examined. Proteins in BRS virus, HRS virus, and mock infected cells
were radioactively labeled by exposure to [.sup.35S]methionine in
the presence and absence of tunicamycin, immunoprecipitated and
separated by SDS-polyacrylamide gel electrophoresis. BRS virus F
protein labeled in the presence of tunicamycin demonstrated a
change in electrophoretic mobility compared to BRS virus F protein
labeled in the absence of tunicamycin (FIG. 12, lanes B.sub.T and
B). In addition, the BRS virus F.sub.0, F.sub.1 and F.sub.2
polypeptides synthesized in the presence of tunicamycin had
electrophoretic mobilities similar to the respective HRS virus
F.sub.0, F.sub.1 and F.sub.2 polypeptides synthesized in the
presence of tunicamycin (FIG. 12, lanes H.sub.T and B.sub.T. These
results indicated that the BRS virus F protein was glycosylated via
N-linked carbohydrate additions, and the observed differences in
the electrophoretic mobility of the BRS virus and HRS virus F.sub.2
polypeptides are due to differences in the extent of glycosylation
as predicted by the deduced amino acid sequence (FIGS. 11A-C).
[0156] 7.2.4. Construction and Isolation of Recombinant Vaccinia
Virus Vectors Containing the BRS Virus Gene
[0157] To facilitate the study of the role of individual proteins
of BRS virus in eliciting a protective immune response in the host,
the BRS virus F gene was placed in a vaccinia virus expression
vector. A cDNA (F20) containing the complete major open reading
frame of the BRS virus F mRNA was inserted into a plasmid,
pIBI76-192, designed for construction of vaccinia virus
recombinants. The plasmid pIEI76-192 is similar to recombination
plasmids described in Ball et al. (1986, Proc. Natl. Acad. Sci.
U.S.A. 83:246-250) that contain a portion of the HindIII J fragment
of vaccinia virus with the 7.5K promoter inserted into the
thymidine kinase (tk) gene. However, in the case of pIBI76-192, the
7.5K promoter directs transcription in the opposite direction of
transcription of the tk gene. The cDNA of the BRS virus F mRNA was
inserted downstream of the major transcriptional start site of the
7.5K promoter. The HindIII J fragment containing the inserted BRS
virus F gene was inserted into the genome of vaccinia virus
(Copenhagen strain) by homologous recombination (Stott et al.,
1986, J. Virol. 60:607-613). Thymidine kinase negative recombinant
vaccinia viruses (rVV) were identified by hybridization of
recombinant viruses with a probe specific for the BRS virus F gene
and selected by three rounds of plaque purification. Recombinant
vaccinia virus F464 and F1597 contained the BRS virus F gene in the
forward and reverse orientation with respect to the 7.5K promoter,
respectively. The genome structures of recombinant vaccinia viruses
were examined by Southern blot analysis of restriction enzyme
digests of vaccinia virus core DNA. These experiments confirmed
that the BRS virus F gene was inserted within the tk gene of the
recombinant viruses.
[0158] 7.2.5. Analysis of Proteins from Cells Infected with
Recombinant Vaccinia Virus containing the BRS Virus F Gene
[0159] The ability of the recombinant vaccinia viruses containing
the BRS virus F gene to express the BRS virus F protein was
examined in tissue culture cells. BT cells were infected with
either BRS virus, wild type vaccinia virus, or the recombinant
vaccinia viruses containing the BRS virus F gene in the positive or
negative orientation with respect to the promoter. The proteins in
cells were labeled by incorporation of [.sup.35S]methionine,
harvested, and then immunoprecipitated with the Wellcome anti-RS
serum and separated by SDS-polyacrylamide gel electrophoresis. The
recombinant vaccinia virus F464 (forward orientation) produced at
least two proteins in infected cells which were precipitated by the
Wellcome anti-RS serum (FIG. 13, lane F464+), and were not-present
in wild type vaccinia virus infected cells (FIG. 13, lane VV) or
rVV F1597 (reverse orientation) infected cells (FIG. 13, lane
F1597-). The two proteins specific to rVVF464 infected cells had
electrophoretic mobilities identical to the BRS virus F.sub.0 and
F.sub.1 polypeptides. A cellular protein that was precipitated by
the serum (FIG. 12, lane M), had an electrophoretic mobility
similar to the BRS virus F.sub.2 polypeptide and inhibited the
detection of an F.sub.2 polypeptide in rVV F464 infected cells. It
was presumed that if the Fo protein was produced and cleaved to
generate the F.sub.1 polypeptide, the F.sub.2 polypeptide was also
present even though it could not be visualized.
[0160] An additional protein that had been previously observed in
BRS virus infected cells (Lerch et al., 1989, J. Virol. 63:833-840)
and was slightly larger than the BRS virus 22K protein was observed
in rVV F464 infected cells (FIG. 13, lane F464+). This additional
protein was only produced in BRS virus infected cells or rVV F464
infected cells and was immunoprecipitated by the Wellcome
antiserum. This result indicated that the additional protein may be
either specific cleavage fragment of the BRS virus F protein or
interact with the BRS virus F protein.
[0161] 7.2.6. Glycosylation of the BRS Virus F Protein Expressed
from a Recombinant Vaccinia Virus
[0162] In order to determine whether the F polypeptides synthesized
in the recombinant virus infected cells were glycosylated in a
manner similar to the authentic BRS virus F polypeptides, the
proteins in rVV F464 infected BT cells were labeled with
[.sup.35S]methionine in the presence and absence of tunicamycin.
These proteins were compared to similarly labeled proteins from BRS
virus infected BT cells by immunoprecipitation and
SDS-polyacrylamide gel electrophoresis (FIG. 14). In the presence
of tunicamycin, the F.sub.0 and F.sub.1 polypeptides produced in
rVV F464 virus infected cells had faster electrophoretic mobilities
than their counterparts synthesized in the absence of tunicamycin
(FIG. 14, compare lane F.sub.T to lane F), and had electrophoretic
mobilities identical to the unglycosylated F.sub.0 and F.sub.1
polypeptides from BRS virus infected cells (FIG. 13, lane F.sub.T
compared to lane B.sub.T). In the presence of tunicamycin, the
protein band from recombinant virus infected cells which presumably
contained the BRS virus F.sub.2 polypeptide along with a cellular
protein disappeared, and there was an increase in intensity of a
band at the bottom of the gel (FIG. 14, lane F.sub.T) where the
unglycosylated BRS virus F.sub.2 migrates (see FIG. 12).
[0163] 7.2.7. Cell Surface Expression of the BRS Virus F Protein
Expressed from Recombinant Vaccinia Virus
[0164] The HRS virus F glycoprotein is expressed on the surface of
infected cells and incorporated in the membranes of virions (Huang,
1983, "The genome and gene products of human respiratory syncytial
virus" Univ. of North Carolina at Chapel Hill; Huang et al., 1985,
2:157-173). In order to determine if the BRS virus F protein
expressed in the recombinant vaccinia virus infected cells was
transported to and expressed on the surface of infected cells,
recombinant vaccinia virus infected cells were examined by indirect
immunofluorescence staining. BT cells were extremely sensitive to
vaccinia virus infection and could not be used for
immunofluorescence without high background fluorescence. For this
reason immunofluorescence was carried out on recombinant virus
infected HEp-2 cells. The antiserum used in the immunofluorescence
was BRS virus 391-2 specific antiserum which was shown previously
to recognize the BRS virus F protein in Western blot analysis of
proteins from BRS virus infected cells (Lerch et al., 1989, J.
Virol. 2563:833-840). This antisera was specific in
immunofluorescence assays for BRS virus infected, but not
uninfected cells. HEp-2 cells that were infected with recombinant
F-464 (FIG. 15, panel rVVF) demonstrated specific surface
fluorescence that was not present in either uninfected cells (FIG.
15, panel M) or wild type vaccinia virus infected cells (FIG. 15,
panel VV).
[0165] 7.3. Discussion
[0166] We have determined the nucleotide sequence of cDNA clones
corresponding to the BRS virus F mRNA. The nucleotide sequence and
deduced amino acid sequence were compared to that of the
corresponding HRS virus sequences. The F mRNA was identical in
length, 1899 nucleotides, to the HRS virus A2, Long and RSS-2 F
mRNAs (Collins et al., 1984, Proc. Natl Acad. Sci. U.S.A.
81:7683-7687; Baybutt and Pringle, 1987, J. Gen. Virol.
68:2789-2796; Lopez et al. 1988, Virus Res. 10: 249-262). The HRS
virus 18537 F mRNA is three nucleotides shorter in the 3' noncoding
region (Johnson and Collins, 1988, J. Gen. Virol. 69:2623-2628).
The level of nucleic acid identity between the BRS virus and HRS
virus F mRNAs was similar to the level between the F mRNAs of the
HRS virus subgroup A and B viruses (Johnson and Collins, 1988, J.
Gen. Virol. 69:2623-2628). The major open reading frame of the BRS
virus F MRNA encoded a predicted protein of 574 amino acids,
identical in size to the HRS virus F proteins (Collins et al.,
1984, Proc. Natl Acad. Sci. U.S.A. 81:7683-7687; Baybutt and
Pringle, 1987, J. Gen. Virol. 68:2789-2796; Johnson and Collins,
1988, J. Gen. Virol. 69:2623-2628; Lopez et al., 1988, Virus Res.
10:249-262). The predicted major structural features of the BRS
virus F protein, such as an N-terminal signal, a C-terminal anchor
sequence, and a cleavage sequence to yield F.sub.1 and F.sub.2
polypeptides were conserved with these features in the HRS virus F
protein. The deduced amino acid sequence of the BRS virus F protein
had 80% overall amino acid identity to the HRS virus F proteins.
The BRS virus and HRS virus F.sub.1 polypeptides were more
conserved, with 88% amino acid identity, than the F.sub.2
polypeptides which had 68% amino acid identity. If BRS virus and
HRS virus have diverged from a single common ancestor, the lower
levels of amino acid identity in F.sub.2 compared to F.sub.1
suggest there may be different, or fewer constraints on the F.sub.2
polypeptide to maintain a specific amino acid sequence than on the
F) polypeptide. Also, the difference in the levels of identity
among the human and bovine F.sub.2 polypeptides in comparison to
the F.sub.1 polypeptides suggests that conservation of the exact
amino acid sequence of the F.sub.2 polypeptide is not as important
as that of the F.sub.1 polypeptide amino acid sequence in
maintaining the structure and function of the F protein. The amino
acid sequence of the proposed anchor region and amino terminus of
the F.sub.1 polypeptide of BRS virus were highly conserved when
compared to those sequences in the HRS virus F proteins. The
proposed amino terminal signal peptides of the BRS virus and HRS
virus F proteins were not conserved in amino acid sequence but were
conserved in predicted hydrophobicity.
[0167] Synthesis of the BRS virus F polypeptides in the presence of
tunicamycin, an inhibitor of N-linked glycosylation, demonstrated
that the BRS virus F polypeptides were glycosylated by the addition
of N-linked carbohydrate moieties. Also, the F.sub.2 polypeptides
of BRS virus and HRS virus synthesized in the presence of
tunicamycin had the same electrophoretic mobility in
SDS-polyacrylamide gels. This indicated the BRS virus and HRS virus
F.sub.2 polypeptides had differences in the extent of
glycosylation. Nucleotide sequence analysis of cDNA clones to the
BRS virus F mRNA confirmed a difference in the number of potential
glycosylation sites. The deduced BRS virus F.sub.2 amino acid
sequence contained only two sites for potential N-linked
oligosaccharide addition, whereas there are four potential sites in
the F.sub.2 polypeptide of HRS virus A2.
[0168] The use of tunicamycin to inhibit N-linked glycosylation
showed that the difference in the electrophoretic mobility of HRS
virus and BRS virus F.sub.1 polypeptides was not due to
glycosylation differences as there were slight differences in the
electrophoretic mobilities of the unglycosylated F.sub.1
polypeptides of BRS virus and HRS virus. Nucleotide sequence
analysis showed the predicted BRS virus F.sub.1 amino acid sequence
and HRS virus F.sub.1 polypeptides were of the same size and both
contained one potential site for N-linked oligosaccharide addition.
At present it is concluded that slight differences which exist in
the amino acid compositions of the BRS virus and HRS virus F.sub.1
polypeptides caused the difference in electrophoretic migration. In
support of this conclusion is recent work that demonstrates that
changing a single amino acid in the vesicular stomatitis virus G
protein, while not changing the glycosylation of the protein alters
its electrophoretic mobility (Pitta et al., 1989, J. Virol.
63:3801-3809).
[0169] The BRS virus F protein, and the HRS virus F proteins have
conserved epitopes. Both convalescent calf serum and monoclonal
antibodies will recognize the F protein from either virus (Orvell
et al., 1987, J. Gen. Virol. 68:3125-3135; Stott et al., 1984, Dev.
Biol. Stand. 57:237-244; Kennedy et al., 1988, J. Gen. Virol.
69:3023-3032; Lerch et al., 1989, J. Virol. 63:833-840). Orvell et
al. (1987, J. Gen. Virol. 68:3125-3135) found that only 3 out of 35
monoclonal antibodies generated to an HRS virus F protein did not
recognize the F protein of three BRS virus strains. In addition,
all of the 11 monoclonal antibodies against the F protein which
were neutralizing for HRS virus also neutralized the infectivity of
the BRS virus strains (Orvell et al., 1987, J. Gen. Virol.
68:3125-3135). Studies using synthetic peptides and monoclonal
antibodies have suggested that at least two epitopes on the HRS
virus F protein are involved in neutralization of the virus. The
epitopes are positioned at amino acids 212 to 232 (Trudel et al.,
1987a, J. Gen. Virol. 68:2273-2280; Trudel et al., 1987b, Canad. J.
Microbiol. 33:933-938) and amino acids 283 to 299. The first of
these epitopes is exactly conserved in the BRS virus F protein. In
the second epitope, there are three changes in the BRS virus F
protein, all of which are conservative changes. Although both of
these epitopes are on the F.sub.1 polypeptide, amino acids
affecting neutralization have been localized to the F.sub.2
polypeptide in the fusion protein of Newcastle disease virus
(Totoda et al., 1988, J. Virol. 62:4427-4430; Neyt et al., 1989, J.
Virol. 63:952-954).
[0170] In contrast to the similarities of the HRS virus and BRS
virus F proteins, the G proteins of these viruses are antigenically
distinct. All monoclonal antibodies generated against the G protein
of either HRS virus subgroup did not recognize the BRS virus G
protein (Orvell et al., 1987, J. Gen. Virol. 68:3125-3135). It has
been shown that polyclonal convalescent serum from a calf infected
with BRS virus, while recognizing the BRS virus G protein, did not
recognize the G protein of a HRS virus (Lerch et al., 1989, J.
Virol. 63:833-840). The antigenic similarity between the BRS virus
and HRS virus F proteins and the difference in antigenic cross
reactivity between the BRS virus and HRS virus G proteins was also
reflected in the levels of amino acid identity between the
homologous proteins of HRS virus and BRS virus. The HRS virus and
BRS virus G proteins shared only 30% amino acid identity whereas
the F proteins of the two viruses shared 80% amino acid identity.
The differences in the F and G glycoproteins are also evident in
their presentation of epitopes. Garcia-Barreno et al. (1989, J.
Virol. 63:925-932), using panels of monoclonal antibodies, found
that the epitopes of the F protein divided into five nonoverlapping
groups, whereas the competition profiles of many of the epitopes on
the G protein are extensively overlapped.
[0171] Recombinant vaccinia viruses containing a cDNA insert to the
BRS virus F gene expressed the BRS virus F protein. This BRS virus
F protein was cleaved into F.sub.1 and F.sub.2 polypeptides, and
had an electrophoretic mobility in SDS-polyacrylamide gels which
was similar to the F protein from BRS virus infected cells.
Experiments with tunicamycin, an inhibitor of N-linked
glycosylation, demonstrated that the BRS virus F protein expressed
from recombinant infected cells was glycosylated to a level similar
to the F proteins from BRS virus infected cells. The BRS virus F
protein expressed from the recombinant vaccinia virus was
transported to and expressed on the surface of infected cells as
shown by surface immunofluorescence.
8. EXAMPLE: PRODUCTION OF MONOSPECIFIC, POLYCLONAL ANTIBODY TO THE
BRS VIRUS G PROTEIN AND DEMONSTRATION OF ANTIGENIC SPECIFICITY
[0172] To test the biological activity of the bovine RS virus
attachment protein expressed from the recombinant VV vectors and to
assess the antigenic cross-reactivity between the BRS and HRS virus
G proteins using a polyclonal antisera, recombinant VV expressing
either the BRS virus or HRS virus G protein were used to immunize
animals as described in Stott et al., 1986, J. Virol. 60:607-613.
Sera from animals immunized with the BRS virus G protein
specifically immunoprecipitated the BRS virus attachment protein,
but did not recognize the human RS virus G protein (FIG. 16).
Similarly, antisera raised against the HRS virus G protein was
specific for the HRS virus G protein and showed no recognition of
the bovine RS virus G protein, confirming the antigenic
distinctness of the two attachment proteins.
9. DEPOSIT OF MICROORGANISMS
[0173] The following [microorganisms] were deposited with the
American Type Culture Collection, Rockville, Md.
[0174] plasmid pRLG414-76-191
[0175] plasmid pRLF2012-76-1902
[0176] plasmid pRLNB3-76
[0177] virus rVG-642
[0178] virus rVF-464
[0179] The present invention is not limited in scope by the
microorganisms deposited or the embodiments disclosed in the
examples which are intended as illustrations of a few aspects of
the invention and any embodiments which are functionally equivalent
are within the scope of this invention. Indeed, various
modifications of the invention in addition to those shown and
described herein will become apparent to those skilled in the art
and are intended to fall within the scope of the appended claims. A
number of publications have been cited herein, which are
incorporated by reference in their entirety.
Sequence CWU 1
1
6 1 838 DNA Bovine respiratory syncytial virus misc_feature
(1)..(838) n is a, c, t, or g 1 ngggcaaata caagtatgtc caaccatacc
catcatctta aattcaagac attaaagagg 60 gcttggaaag cctcaaaata
ctttatagta ggattatcat gtttatataa gttcaattta 120 aaatcccttg
tccaaacggc tttgtccacc ctagcaatga taaccttgac atcactcgtc 180
atcacagcca ttatttacat tagtgtggga aatgctaaag ccaagcccac atccaaacca
240 accatccaac aaacacaaca gccccaaaac catacctcac catttttcac
agagcacaac 300 tacaaatcaa ctcacacatc aattcaaagc accacactgt
cccaactact aaacatagac 360 actactagag gaattacata tggtcactca
accaacgaaa cccaaaacag aaaaatcaaa 420 ggccaatcca ctctacccgc
caccagaaaa ccaccaatca atccatcggg aagcatcccc 480 cctgaaaacc
atcaagacca caacaacttc caaacactcc cctatgtgcc ttgcagtaca 540
tgtgaaggta atcttgcttg cttatcactc tgccatattg agacggagag agcaccaagc
600 agagccccta caatcaccct caaaaagact ccaaaaccca aaaccactaa
aaagccaacc 660 aagacaacaa tccaccacag aaccagccct gaaaccaaac
tgcaacctaa aaacaacaca 720 gcaactccac aacaaggcat cctctcttca
acagaacatc acacaaatca atcaactaca 780 cagatctagc aacacacctc
catataacat ctaattatng ttctatatat agttattt 838 2 257 PRT Bovine
respiratory syncytial virus 2 Met Ser Asn His Thr His His Leu Lys
Phe Lys Thr Leu Lys Arg Ala 1 5 10 15 Trp Lys Ala Ser Lys Tyr Phe
Ile Val Gly Leu Ser Cys Leu Tyr Lys 20 25 30 Phe Asn Leu Lys Ser
Leu Val Gln Thr Ala Leu Ser Thr Leu Ala Met 35 40 45 Ile Thr Leu
Thr Ser Leu Val Ile Thr Ala Ile Ile Tyr Ile Ser Val 50 55 60 Gly
Asn Ala Lys Ala Lys Pro Thr Ser Lys Pro Thr Ile Gln Gln Thr 65 70
75 80 Gln Gln Pro Gln Asn His Thr Ser Pro Phe Phe Thr Glu His Asn
Tyr 85 90 95 Lys Ser Thr His Thr Ser Ile Gln Ser Thr Thr Leu Ser
Gln Leu Leu 100 105 110 Asn Ile Asp Thr Thr Arg Gly Ile Thr Tyr Gly
His Ser Thr Asn Glu 115 120 125 Thr Gln Asn Arg Lys Ile Lys Gly Gln
Ser Thr Leu Pro Ala Thr Arg 130 135 140 Lys Pro Pro Ile Asn Pro Ser
Gly Ser Ile Pro Pro Glu Asn His Gln 145 150 155 160 Asp His Asn Asn
Phe Gln Thr Leu Pro Tyr Val Pro Cys Ser Thr Cys 165 170 175 Glu Gly
Asn Leu Ala Cys Leu Ser Leu Cys His Ile Glu Thr Glu Arg 180 185 190
Ala Pro Ser Arg Ala Pro Thr Ile Thr Leu Lys Lys Thr Pro Lys Pro 195
200 205 Lys Thr Thr Lys Lys Pro Thr Lys Thr Thr Ile His His Arg Thr
Ser 210 215 220 Pro Glu Thr Lys Leu Gln Pro Lys Asn Asn Thr Ala Thr
Pro Gln Gln 225 230 235 240 Gly Ile Leu Ser Ser Thr Glu His His Thr
Asn Gln Ser Thr Thr Gln 245 250 255 Ile 3 1899 DNA Bovine
respiratory syncytial virus misc_feature (1)..(257) n is a, c, t,
or g 3 nnnnnnnata aggatggcgg caacagccat gaggatgatc atcagcatta
tcttcatctc 60 tacctatatg acacatatca ctttatgcca aaacataaca
gaagaatttt atcaatcaac 120 atgcagtgca gttagtagag gttatcttag
tgcattaaga actggatggt atacaagtgt 180 agtaacaata gagttgagca
aaatacaaaa gaatgtgtgt aaaagtactg attcaaaagt 240 gaaattaata
aagcaagaac tggaaagata caacaatgca gtaatagaat tgcagtcact 300
tatgcaaaat gaaccggctt ccttcagtag agcaaaaaga gggataccag agttgataca
360 ttatacaaga aactctacaa agagatttta tgggttaatg ggcaagaaga
gaaagaggag 420 atttttagga ttcttgctag gtattggatc tgctgttgca
agtggtgtag cagtgtccaa 480 agtactacac ctggagggag aggtgaataa
aattaaaaat gcactgctat ccacaaataa 540 agcagtagtt agtctatcca
atggagttag tgtccttact agcaaagtac ttgatctaaa 600 gaactatata
gacaaagagc ttctacctaa agttaacaat catgattgta ggatatccaa 660
catagaaact gtgatagaat tccaacaaaa aaacaataga ttgttagaaa ttgctaggga
720 atttagtgta aatgctggta ttaccacacc cctcagtaca tacatgttga
ccaatagtga 780 attactatca ctaattaatg atatgcctat aacgaatgac
caaaaaaagc taatgtcaag 840 taatgttcaa atagtcagac aacagagtta
ttccattatg tcagtggtca aagaagaggt 900 catagcttat gttgtacaat
tgcctattta tggagttata gacaccccct gttggaaact 960 acacacctct
ccattatgca ccactgataa taaagaaggg tcaaacatct gcttaactag 1020
gacagatcgt gggtggtatt gtgacaatgc aggctctgtg tcttttttcc cacaggcaga
1080 gacatgtaag gtacaatcaa atagagtgtt ctgtgacaca atgaacagtt
taactctgcc 1140 tactgatgtt aacttatgca acactgacat attcaataca
aagtatgact gtaaaataat 1200 gacatctaaa actgacataa gtagctctgt
gataacttca ataggagcta ttgtatcatg 1260 ctatgggaag acaaaatgta
cagcttctaa taaaaatcgt ggaatcataa agactttttc 1320 caatgggtgt
gattatgtat caaacaaagg agttgacact gtatctgttg gtaacacact 1380
atattatgta aataagctag aggggaaagc actctatata aagggtgaac caattattaa
1440 ttactatgat ccactagtgt ttccttctga tgagtttgat gcatcaattg
cccaagtaaa 1500 tgcaaaaata aaccaaagcc tggctttcat acgtcgatct
gatgagttac ttcacagtgt 1560 agatgtagga aaatccacca caaatgtagt
aattactact attattatag tgatagttgt 1620 agtgatatta atgttaatag
ctgtaggatt actgttttac tgtaagacca ggagtactcc 1680 tatcatgcta
ggaaaggatc agcttagtgg tatcaacaat ctttccttta gtaaatgaaa 1740
tgcataatgt ttacaatcta aacctcagaa tcataaatgt gatgagctaa atttattaat
1800 acattcaaaa gttctatccg ccaagacctg cattttttta tcaggtctta
tataagctaa 1860 ccttacatgc tacactcagc tccatgttga tagttatat 1899 4
574 PRT Bovine respiratory syncytial virus 4 Met Ala Ala Thr Ala
Met Arg Met Ile Ile Ser Ile Ile Phe Ile Ser 1 5 10 15 Thr Tyr Met
Thr His Ile Thr Leu Cys Gln Asn Ile Thr Glu Glu Phe 20 25 30 Tyr
Gln Ser Thr Cys Ser Ala Val Ser Arg Gly Tyr Leu Ser Ala Leu 35 40
45 Arg Thr Gly Trp Tyr Thr Ser Val Val Thr Ile Glu Leu Ser Lys Ile
50 55 60 Gln Lys Asn Val Cys Lys Ser Thr Asp Ser Lys Val Lys Leu
Ile Lys 65 70 75 80 Gln Glu Leu Glu Arg Tyr Asn Asn Ala Val Ile Glu
Leu Gln Ser Leu 85 90 95 Met Gln Asn Glu Pro Ala Ser Phe Ser Arg
Ala Lys Arg Gly Ile Pro 100 105 110 Glu Leu Ile His Tyr Thr Arg Asn
Ser Thr Lys Arg Phe Tyr Gly Leu 115 120 125 Met Gly Lys Lys Arg Lys
Arg Arg Phe Leu Gly Phe Leu Leu Gly Ile 130 135 140 Gly Ser Ala Val
Ala Ser Gly Val Ala Leu Ser Lys Val Leu His Leu 145 150 155 160 Glu
Gly Glu Val Asn Lys Ile Lys Asn Ala Leu Leu Ser Thr Asn Lys 165 170
175 Ala Val Val Ser Leu Ser Asn Gly Val Ser Val Leu Thr Ser Lys Val
180 185 190 Leu Asp Leu Lys Asn Tyr Ile Asp Lys Glu Leu Leu Pro Lys
Val Asn 195 200 205 Asn His Asp Cys Arg Ile Ser Asn Ile Glu Thr Val
Ile Glu Phe Gln 210 215 220 Gln Lys Asn Asn Arg Leu Leu Glu Ile Ala
Arg Glu Phe Ser Val Asn 225 230 235 240 Ala Gly Ile Thr Thr Pro Leu
Ser Thr Tyr Met Leu Thr Asn Ser Glu 245 250 255 Leu Leu Ser Leu Ile
Asn Asp Met Pro Ile Thr Asn Asp Gln Lys Lys 260 265 270 Leu Met Ser
Ser Asn Val Gln Ile Val Arg Gln Gln Ser Tyr Ser Ile 275 280 285 Met
Ser Val Val Lys Glu Glu Val Ile Ala Tyr Val Val Gln Leu Pro 290 295
300 Ile Tyr Gly Val Ile Asp Thr Pro Cys Trp Lys Leu His Thr Ser Pro
305 310 315 320 Leu Cys Thr Thr Asp Asn Lys Glu Gly Ser Asn Ile Cys
Leu Thr Arg 325 330 335 Thr Asp Arg Gly Trp Tyr Cys Asp Asn Ala Gly
Ser Val Ser Phe Phe 340 345 350 Pro Gln Ala Glu Thr Cys Lys Val Gln
Ser Asn Arg Val Phe Cys Asp 355 360 365 Thr Met Asn Ser Leu Thr Leu
Pro Thr Asp Val Asn Leu Cys Asn Thr 370 375 380 Asp Ile Phe Asn Thr
Lys Tyr Asp Cys Lys Ile Met Thr Ser Lys Thr 385 390 395 400 Asp Ile
Ser Ser Ser Val Ile Thr Ser Ile Gly Ala Ile Val Ser Cys 405 410 415
Tyr Gly Lys Thr Lys Cys Thr Ala Ser Asn Lys Asn Arg Gly Ile Ile 420
425 430 Lys Thr Phe Ser Asn Gly Cys Asp Tyr Val Ser Asn Lys Gly Val
Asp 435 440 445 Thr Val Ser Val Gly Asn Thr Leu Tyr Tyr Val Asn Lys
Leu Glu Gly 450 455 460 Lys Ala Leu Tyr Ile Lys Gly Glu Pro Ile Ile
Asn Tyr Tyr Asp Pro 465 470 475 480 Leu Val Phe Pro Ser Asp Glu Phe
Asp Ala Ser Ile Ala Gln Val Asn 485 490 495 Ala Lys Ile Asn Gln Ser
Leu Ala Phe Ile Arg Arg Ser Asp Glu Leu 500 505 510 Leu His Ser Val
Asp Val Gly Lys Ser Thr Thr Asn Val Val Ile Thr 515 520 525 Thr Ile
Ile Ile Val Ile Val Val Val Ile Leu Met Leu Ile Ala Val 530 535 540
Gly Leu Leu Phe Tyr Cys Lys Thr Arg Ser Thr Pro Ile Met Leu Gly 545
550 555 560 Lys Asp Gln Leu Ser Gly Ile Asn Asn Leu Ser Phe Ser Lys
565 570 5 396 PRT Bovine respiratory syncytial virus 5 Lys Met Ala
Leu Ser Lys Val Lys Leu Asn Asp Thr Phe Asn Lys Asp 1 5 10 15 Gln
Leu Leu Ser Thr Ser Lys Tyr Thr Ile Gln Arg Ser Thr Gly Asp 20 25
30 Asn Ile Asp Ile Pro Asn Tyr Asp Val Gln Lys His Leu Asn Lys Leu
35 40 45 Cys Gly Met Leu Leu Ile Thr Glu Asp Ala Asn His Lys Phe
Thr Gly 50 55 60 Leu Ile Gly Met Leu Tyr Ala Met Ser Arg Leu Gly
Arg Glu Asp Thr 65 70 75 80 Leu Lys Ile Leu Lys Asp Ala Gly Tyr Gln
Val Arg Ala Asn Gly Val 85 90 95 Asp Val Ile Thr His Arg Gln Asp
Val Asn Gly Lys Glu Met Lys Phe 100 105 110 Glu Val Leu Thr Leu Val
Ser Leu Thr Ser Glu Val Gln Gly Asn Ile 115 120 125 Glu Ile Glu Ser
Arg Lys Ser Tyr Lys Lys Met Leu Lys Glu Met Gly 130 135 140 Glu Val
Ala Pro Glu Tyr Arg His Asp Phe Pro Asp Cys Gly Met Ile 145 150 155
160 Val Leu Cys Val Ala Ala Leu Val Ile Thr Lys Leu Ala Ala Gly Asp
165 170 175 Arg Ser Gly Leu Thr Ala Val Ile Arg Arg Ala Asn Asn Val
Leu Arg 180 185 190 Asn Glu Met Lys Arg Tyr Lys Gly Leu Ile Pro Lys
Asp Ile Ala Asn 195 200 205 Ser Phe Tyr Glu Val Phe Glu Lys Tyr Pro
His Tyr Ile Asp Val Phe 210 215 220 Val His Phe Gly Ile Ala Gln Ser
Ser Thr Arg Gly Gly Ser Arg Val 225 230 235 240 Glu Gly Ile Phe Ala
Gly Leu Phe Met Asn Ala Tyr Gly Ala Gly Gln 245 250 255 Val Met Leu
Arg Trp Gly Val Leu Ala Lys Ser Val Lys Asn Ile Met 260 265 270 Leu
Gly His Ala Ser Val Gln Ala Glu Met Glu Gln Val Val Glu Val 275 280
285 Tyr Glu Tyr Ala Gln Lys Leu Gly Gly Glu Ala Gly Phe Tyr His Ile
290 295 300 Leu Asn Asn Pro Lys Ala Ser Leu Leu Ser Leu Thr Gln Phe
Pro Asn 305 310 315 320 Phe Ser Ser Val Val Leu Gly Asn Ala Ala Gly
Leu Gly Ile Met Gly 325 330 335 Glu Tyr Arg Gly Thr Pro Arg Asn Gln
Asp Leu Tyr Asp Ala Ala Lys 340 345 350 Ala Tyr Ala Glu Gln Leu Lys
Glu Asn Gly Val Ile Asn Tyr Ser Val 355 360 365 Leu Asp Leu Thr Thr
Glu Glu Leu Glu Ala Ile Lys Asn Gln Leu Asn 370 375 380 Pro Lys Asp
Asn Asp Val Glu Leu Val Asn Lys Lys 385 390 395 6 1194 DNA Bovine
respiratory syncytial virus 6 caaaaatggc tcttagcaag gtcaaactaa
atgacacttt caacaaggac caactgttgt 60 caaccagcaa atatactatt
caacgtagta caggtgacaa cattgatata cccaattacg 120 atgtgcaaaa
acatctcaat aagttgtgtg gtatgctatt aataacagaa gatgccaatc 180
ataaatttac aggactgata ggtatgttat atgctatgtc ccgattgggg agagaagata
240 cccttaaaat actcaaagat gcaggctacc aagtgagggc caatggggtt
gatgtgataa 300 cacatcgaca ggatgtgaat ggaaaagaaa tgaaatttga
agtgctaaca ttagtcagct 360 taacatcaga agttcaaggt aatatagaaa
tagagtcaag gaagtcttac aaaaagatgc 420 taaaagagat gggagaggta
gctccagaat acagacatga ctctcctgat tgtggtatga 480 tagtgctatg
tgttgctgct ttggttataa caaaattagc agcaggtgat aggtcaggcc 540
tcactgcagt cattaggaga gccaacaatg tactaaggaa tgaaatgaaa cgatacaaag
600 gactcatccc gaaagatata gccaacagct tctatgaagt atttgaaaag
taccctcatt 660 acatagatgt attcgtacat tttggcattg ctcaatcctc
aactagagga ggtagtaggg 720 tagaaggaat ctttgcaggg ttattcatga
atgcatatgg agcaggtcaa gtgatgttaa 780 gatggggtgt actagccaaa
tcagtcaaga atattatgct tggtcatgcc agcgtacaag 840 cagaaatgga
acaggttgta gaagtctatg aatatgcaca aaagttaggt ggagaagctg 900
gtttttatca catactgaac aaccctaaag catcattgtt atccttaaca caattcccca
960 atttctctag tgtagtccta ggcaatgctg caggactagg tataatgggt
gagtatagag 1020 gtacaccaag aaaccaagac ttgtatgatg ctgccaaagc
atatgcagaa caactaaaag 1080 agaatggggt catcaattac agtgtattgg
atctgactac agaggaatta gaggcaatca 1140 agaaccaatt gaatcccaaa
gataatgatg tggaattgtg agttaataaa aaaa 1194
* * * * *