U.S. patent application number 10/833440 was filed with the patent office on 2004-09-30 for qualitative differential screening.
Invention is credited to Bracco, Laurent, Schweighoffer, Fabien, Tocque, Bruno.
Application Number | 20040191828 10/833440 |
Document ID | / |
Family ID | 56290085 |
Filed Date | 2004-09-30 |
United States Patent
Application |
20040191828 |
Kind Code |
A1 |
Schweighoffer, Fabien ; et
al. |
September 30, 2004 |
Qualitative differential screening
Abstract
The invention concerns a method for identifying and/or cloning
nucleic acid regions representing qualitative differences
associated with alternative splicing events and/or with insertions,
deletions located in RNA transcribed genome regions, between two
physiological situations, comprising either hybridization of RNA
derived from the test situation with cDNA's derived from the
reference situation and/or reciprocally, or double-strand
hybridization of cDNA derived from the test situation with cDNA's
derived from the reference situation; and identifying and/or
cloning nucleic acids representing qualitative differences. The
invention also concerns compositions or banks of nucleic acids
representing qualitative differences between two physiological
situations, obtainable by the above method, and their use as probe,
for identifying genes or molecules of interest, or still for
example in methods of pharmacogenomics, and profiling of molecules
relative to their therapeutic and/or toxic effects. The invention
further concerns the use of dysregulation of splicing RNA as
markers for predicting molecule toxicity and/or efficacy, and as
markers in pharmacogenomics.
Inventors: |
Schweighoffer, Fabien;
(Vincennes, FR) ; Bracco, Laurent; (Paris, FR)
; Tocque, Bruno; (Courbevoie, FR) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Family ID: |
56290085 |
Appl. No.: |
10/833440 |
Filed: |
April 28, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10833440 |
Apr 28, 2004 |
|
|
|
09623828 |
Nov 30, 2000 |
|
|
|
09623828 |
Nov 30, 2000 |
|
|
|
PCT/FR99/00547 |
Mar 11, 1999 |
|
|
|
10833440 |
Apr 28, 2004 |
|
|
|
09046920 |
Mar 24, 1998 |
|
|
|
6251590 |
|
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/287.2 |
Current CPC
Class: |
C12Q 1/6809 20130101;
C12Q 1/6809 20130101; C12Q 1/6809 20130101; C12Q 2537/113 20130101;
C12Q 2521/301 20130101; C12Q 2565/501 20130101; C12Q 2539/105
20130101; C12Q 2565/501 20130101; C12Q 2537/113 20130101; C12Q
1/6809 20130101 |
Class at
Publication: |
435/006 ;
435/287.2 |
International
Class: |
C12Q 001/68; C12M
001/34 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 11, 1998 |
FR |
98 02997 |
Claims
1. A device for identifying at least one differentially spliced
gene product, wherein said device comprises a solid support
material and single-stranded oligonucleotides of between 5 and 100
nucleotides in length attached to said support material, wherein
said oligonucleotides comprise at least a first and a second
oligonucleotide molecule arranged serially on the support material,
wherein said first oligonucleotide molecule comprises a first
sequence that is complementary to and specific for a first exon or
exon-exon or exon-intron junction region of a first gene or RNA,
and wherein said first sequence corresponds to a region of
variability in at least one product of said first gene due to
differential splicing, wherein said second oligonucleotide molecule
comprises a second sequence that is complementary to and specific
for a second exon or exon-exon or exon-intron junction region of
said first gene or RNA, and wherein said second sequence
corresponds to a region of variability in at least one product of
said first gene due to differential splicing, said device allowing,
when contacted with a sample containing at least one nucleic acid
molecule under conditions allowing hybridisation to occur, the
determination of the presence or absence of said differentially
spliced gene product.
2. The device of claim 1, wherein said first and second
oligonucleotide molecules are available from a compilation of
published sequences or sequence information from at least one
database.
3. The device of claim 1, wherein the support material is selected
from the group consisting of a filter, a membrane and a chip.
4. The device of claim 1, wherein said single-stranded
oligonucleotides are RNA or DNA molecules.
5. The device of claim 1, wherein said single-stranded
oligonucleotides comprise oligonucleotides of less than 50
nucleotides in length.
6. The device of claim 1, wherein said single-stranded
oligonucleotides are specific for alternative splicings
representative of a cell or tissue in a given pathological
condition.
7. The device of claim 6, wherein said single-stranded
oligonucleotides are specific for alternative splicings
representative of a tumor cell or tissue.
8. The device of claim 6, wherein said single-stranded
oligonucleotides are specific for alternative splicings
representative of a cell or tissue undergoing apoptosis.
9. The device of claim 1, where said device is useful to evaluate
the toxicity of a compound or treatment to a cell, tissue, or
organism by determining the presence or absence of said
differentially spliced gene product in a sample treated with said
compound or treatment.
10. The device of claim 1, where said device is useful to evaluate
the therapeutic efficacy of a compound to a cell, tissue, or
organism by determining the presence or absence of said
differentially spliced gene product in a sample from said cell,
tissue, or organism.
11. The device of claim 1, where said device is useful to evaluate
the responsiveness of a subject to a compound or treatment by
determining the presence or absence of said differentially spliced
gene product in a sample from said subject exposed to said compound
or treatment.
12. The device of claim 1, wherein said device allows the
determination of the presence or absence of two or more
differentially spliced gene products of said first gene.
13. The device of claim 1, wherein said device allows the
determination of the presence or absence of one or more
differentially spliced gene products of two or more genes.
14. A method of producing a device comprising a support material
and single-stranded oligonucleotide of between 5 and 100
nucleotides in length attached to said solid support material,
wherein said method comprises: (a) providing said oligonucleotides,
wherein said oligonucleotides comprise at least a first and a
second oligonucleotide molecule, wherein said first oligonucleotide
molecule comprises a first sequence that is complementary to and
specific for a first exon or exon-exon or exon-intron junction
region of a first gene or RNA, and wherein said first sequence
corresponds to a region of variability in at least one product of
said first gene due to differential splicing, wherein said second
oligonucleotide molecule comprises a second sequence that is
complementary to and specific for a second exon or exon-exon or
exon-intron junction region of said first gene or RNA, and wherein
said second sequence corresponds to a region of variability in at
least one product of said first gene due to differential splicing,
(b) arranging and immobilizing said oligonucleotides serially on
said support material, said device allowing, when contacted with a
sample containing at least one nucleic acid molecule under
conditions allowing hybridisation to occur, the determination of
the presence or absence of at least one differentially spliced gene
product.
15. The method of claim 14, wherein said first or second
oligonucleotide molecule is obtained by a method comprising: (a)
identifying at least two different oligonucleotides corresponding
to a differentially spliced domain of a gene, wherein said
differentially spliced domain is characteristic of a
physiopathological condition, and (b) synthesizing one or several
single-stranded oligonucleotides complementary to and specific for
a junction region formed by the splicing or absence of splicing of
said domain.
16. The method of claim 15, wherein the identification step (a)
comprises: i) hybridizing a plurality of different RNA or cDNA
molecules derived from a first sample, wherein the composition or
sequence of the RNA or cDNA molecules is at least partially
unknown, with a plurality of different cDNA molecules derived from
RNA molecules of a second sample, wherein the composition or
sequence of the cDNA molecules is at least partially unknown; and
ii) identifying, from the hybrids formed in i), a population of
nucleic acid molecules comprising an unpaired region, wherein said
unpaired region corresponds to a region of a gene that is
differentially spliced between said first and second sample.
17. The method of claim 14, wherein said first and second
oligonucleotide molecules are obtained from a compilation of
published sequences or sequence information from databases.
18. The method of claim 14, wherein the support material is
selected from a filter, a membrane, and a chip.
19. The method of claim 14, wherein said single-stranded
oligonucleotides are specific for alternative splicings
representative of a cell or tissue in a given pathological
condition.
20. The method of claim 19, wherein said single-stranded
oligonucleotides are specific for alternative splicings
representative of a tumor cell or tissue.
21. The method of claim 19, wherein said single-stranded
oligonucleotides are specific for alternative splicings
representative of a cell or tissue undergoing apoptosis.
22. The method of claim 14, wherein said single-stranded
oligonucleotides comprise oligonucleotides of less than 50
nucleotides in length.
Description
[0001] The present invention relates to the fields of biotechnology
medicine, biology and biochemistry. Applications thereof are aimed
at human health, animal and plant care. More particularly, the
invention makes it possible to identify nucleic acid sequences
whereby both novel screening methods for identifying molecules of
therapeutic interest and novel gene therapy tools can be developed,
and it further provides information on the toxicity and potency of
molecules, as well as pharmacogenomic data.
[0002] The present invention primarily describes a set of original
methods for identifying nucleic acid sequences which rely on
demonstrating qualitative differences between RNAs derived from two
distinct states being compared, in particular those derived from a
diseased organ or tissue and healthy equivalents thereof. More
specifically, these methods are intended to specifically clone
alternative exons and introns which are differentially spliced with
respect to a pathological condition and a healthy state or with
respect to two physiological conditions one wishes to compare.
These qualitative differences in RNAs can also be due to genome
alterations such as insertions or deletions in the regions to be
transcribed to RNA. This set of methods is identified by the
acronym DATAS: Differential Analysis of Transcripts with
Alternative Splicing.
[0003] The characterization of gene expression alterations which
underly or are linked to a given disorder raises substantial hope
regarding the discovery of novel therapeutic targets and of
original diagnostic tools. However, the identification of a genomic
or complementary DNA sequence, whether through positional cloning
or quantitative differential screening techniques, yields little,
if any, information on the function, and even less on the
functional domains, involved in the regulation defects related to
the disease under study. The present invention describes a set of
original methods aimed at identifying differences in RNA splicing
occurring between two distinct pathophysiological conditions.
Identifying such differences provides information on qualitative
but not on quantitative differences as has been the case for
techniques described so far. The techniques disclosed in the
present invention are hence all encompassed under the term of
"qualitative differential screening", or DATAS. The methods of the
invention may be used to identify novel targets or therapeutic
products, to devise genetic research and/or diagnostic tools, to
construct nucleic acid libraries, and to develop methods for
determining the toxicological profile or potency of a compound for
example.
[0004] A first object of the invention is based more particularly
on a method for identifying and/or cloning nucleic acid regions
which correspond to qualitative genetic differences occurring
between two biological samples, comprising hybridizing a population
of double stranded cDNAs or RNAs derived from a first biological
sample, with a population of cDNAs derived from a second biological
sample (FIG. 1A).
[0005] As indicated hereinabove, the qualitative genetic
differences may be due to alterations of RNA splicing or to
deletions and/or insertions in the regions of the genome which are
transcribed to RNA.
[0006] In a first embodiment, the hybridization is carried out
between RNAs derived from a first biological sample and cDNAs
(single stranded or double stranded) derived from a second
biological sample.
[0007] In another embodiment, the hybridization is carried out
between double stranded cDNAs derived from a first biological
sample, and cDNAs (double stranded or, preferably, single stranded)
derived from a second biological sample.
[0008] A more specific object of the invention is to provide a
method for identifying differentially spliced nucleic acid regions
occurring between two physiological conditions, comprising
hybridizing a population of RNAs or double stranded cDNAs derived
from a test condition with a population of cDNAs originating from a
reference condition and identifying nucleic acids which correspond
to differential splicing events.
[0009] Another object of the invention is to provide a method for
cloning differentially spliced nucleic acids occurring between two
physiological conditions, comprising hybridizing a population of
RNAs or double stranded cDNAs derived from the test condition with
a population of cDNAs originating from the reference condition and
cloning nucleic acids which correspond to differential splicing
events.
[0010] In a particular embodiment, the method of nucleic acid
identification and/or cloning according to the invention comprises
running two hybridizations in parallel consisting of:
[0011] (a) hybridizing RNAs derived from the first sample (test
condition) with cDNAs derived from the second sample (reference
condition);
[0012] (b) hybridizing RNAs derived from the second sample
(reference condition) with cDNAs derived from the first sample
(test condition); and
[0013] (c) identifying and/or cloning, from the hybrids formed in
steps (a) and (b), those nucleic acids corresponding to qualitative
genetic differences.
[0014] The present invention is equally directed to the preparation
of nucleic acid libraries, to the nucleic acids and libraries thus
prepared, as well as to uses of such materials in all fields of
biology/biotechnology, as illustrated hereinafter.
[0015] In this respect, the invention is equally directed to a
method for preparing profiled nucleic acid compositions or
libraries, representative of qualitative differences occurring
between two biological samples, comprising hybridizing RNAs derived
from a first biological sample with cDNAs originating from a second
biological sample.
[0016] The invention further concerns a method for profiling a cDNA
composition, comprising hybridizing this composition with RNAs, or
vice versa.
[0017] As indicated hereinabove, the present invention relates in
particular to methods for identifying and cloning nucleic acids
representative of a physiological state. In addition, the nucleic
acids identified and/or cloned represent the qualitative
characteristics of a physiological state in that these nucleic
acids are generally involved to a great extent in the physiological
state being observed. Thus, the qualitative methods of the
invention afford direct exploration of genetic elements or protein
products thereof, playing a functional role in the development of a
pathophysiological state.
[0018] The methods of the invention are partly based on an original
step consisting of cross hybridization between RNAs and cDNAs
belonging to distinct physiological states. This or these cross
hybridization procedures advantageously allow one to demonstrate,
in the hybrids formed, unpaired regions, i.e. regions present in
RNAs in a given physiological condition and not in RNAs from
another physiological condition. Such regions essentially
correspond to alternative forms of splicing typical of a
physiological state, but may also be a reflection of genetic
alterations such as insertions or deletions, and thus form genetic
elements particularly useful in the fields of therapeutics and
diagnostics as set forth below. The invention therefore consists
notably in keeping the complexes formed after cross
hybridization(s), so as to deduce therefrom the regions
corresponding to qualitative differences. This methodology can be
distinguished from quantitative subtraction techniques known to
those skilled in the art (Sargent and Dawid (1983), Science, 222:
135-139; Davis et al. (1984), PNAS, 81: 2194-2198; Duguid and
Dinauer (1990), Nucl. Acid Res., 18: 2789-2792; Diatchenko et al.
(1996), PNAS, 93: 6025-6030), which discard the hybrids formed
after hybridization(s) so as to conserve only the non-hybridized
nucleic acids.
[0019] The invention therefore first deals with a method for
identifying nucleic acids of interest comprising hybridizing the
RNAs of a test sample with the cDNAs of a reference sample. This
hybridization procedure makes it possible to identify, in the
complexes formed, qualitative genetic differences between the
conditions under study, and thus to identify and/or clone for
example the splicings which are characteristic of the test
condition.
[0020] According to a first variant of the invention, the method
therefore allows one to generate a nucleic acid population
characteristic of splicing events that occur in the physiological
test condition as compared to the reference condition (FIG. 1A,
1B). As indicated hereinafter, this population can be used for the
cloning and characterization of nucleic acids, their use in
diagnostics, screening, therapeutics and antibody production or
synthesis of whole proteins or protein fragments. This population
can also be used to generate libraries that may be used in
different fields of application as shown hereinafter and to
generate labeled probes (FIG. 1D).
[0021] According to another variant of the invention, the method
comprises a first hybridization as described hereinbefore and a
second hybridization, conducted in parallel, between RNAs derived
from the reference condition and cDNAs derived from the test
condition. This variant is particularly advantageous since it
allows one to generate two nucleic acid populations, one
representing the qualitative characteristics of the test condition
with respect to the reference condition, and the other representing
the qualitative characteristics of the reference condition in
relation to the test condition (FIG. 1C). These two populations can
also be utilized as nucleic acid sources, or as libraries which
serve as genetic fingerprints of a particular physiological
condition, as will be more fully described in the following (FIG.
1D).
[0022] The present invention may be applied to all types of
biological samples. In particular, the biological sample can be any
cell, organ, tissue, sample, biopsy material, etc. containing
nucleic acids. In the case of an organ, tissue or biopsy material,
the samples can be cultured so as to facilitate access to the
constituent cells. The samples may be derived from mammals
(especially human beings), plants, bacteria and lower eukaryotes
(yeasts, fungal cells, etc.). Relevant materials are exemplified in
particular by a tumor biopsy, neurodegenerative plaque or cerebral
zone biopsy displaying neurodegenerative signs, a skin sample, a
blood sample obtained by collecting blood, a colorectal biopsy,
biopsy material derived from bronchoalveolar lavage, etc. Examples
of cells include notably muscle cells, hepatic cells, fibroblasts,
nerve cells, epidermal and dermal cells, blood cells such as B and
T lymphocytes, mast cells, monocytes, granulocytes and
macrophages.
[0023] As indicated hereinabove, the qualitative differential
screening according to the present invention allows the
identification of nucleic acids characteristic of a given
physiological condition (condition B) in relation to a reference
physiological condition (condition A), that are to be cloned or
used for other applications. By way of illustration, the
physiological conditions A and B being investigated may be chosen
among the following:
1 CONDITION A CONDITION B Healthy subject-derived sample
Pathological sample Healthy subject-derived sample Apoptotic sample
Healthy subject-derived sample Sample obtained after viral
infection X-sensitive sample X-resistant sample Untreated sample
Treated sample (for example by a toxic compound) Undifferentiated
sample Sample that has undergone cellular or tissue
differentiation
[0024] RNA Populations
[0025] The present invention can be carried out by using total RNAs
or messenger RNAs. These RNAs can be prepared by any conventional
molecular biology methods, familiar to those skilled in the art.
Such methods generally comprise cell, tissue or sample lysis and
RNA recovery by means of extraction procedures. This can be done in
particular by treatment with chaotropic agents such as guanidium
thiocyanate (which disrupts the cells without affecting RNA)
followed by RNA extraction with solvents (phenol, chloroform for
instance). Such methods are well known in the art (see Maniatis et
al., Chomczynski et al., (1987), Anal. Biochem., 162: 156). These
methods may be readily implemented by using commercially available
kits such as for example the US73750 kit (Amersham) or the Rneasy
kit (Quiagen) for total RNAs. It is not necessary that the RNA be
in a fully pure state, and in particular, traces of genomic DNA or
other cellular components (protein, etc.) remaining in the
preparations will not interfere, in as much as they do not
significantly affect RNA stability and as the modes of preparation
of the different samples under comparison are the same. Optionally,
it is further possible to use messenger RNA instead of total RNA
preparations. These may be isolated, either directly from the
biological sample or from total RNAs, by means of polyT sequences,
according to standard methods. In this respect, the preparation of
messenger RNAs can be carried out using commercially available kits
such as for example the US72700 kit (Amersham) or the kit involving
the use of oligo-(dT) beads (Dynal). An advantageous method of RNA
preparation consists in extracting cytosolic RNAs and then
cytosolic polyA+ RNAs. Kits allowing the selective preparation of
cytosolic RNAs that are not contaminated by premessenger RNAs
bearing unspliced exons and introns are commercially available.
This is the case in particular for the Rneasy kit marketed by
Qiagen (example of catalog number: 74103). RNAs can also be
obtained directly from libraries or other samples prepared
beforehand and/or available from collections, stored under suitable
conditions.
[0026] Generally, the RNA preparations used advantageously comprise
at least 0.1 .mu.g of RNA, preferably at least 0.5 .mu.g of RNA.
Quantities can vary depending on the particular cells and methods
being used, while keeping the practice of the invention unchanged.
In order to obtain sufficient quantities of RNA (preferably at
least 0.1 .mu.g), it is generally recommended to use a biological
sample including at least 10.sup.5 cells. In this respect, a
typical biopsy specimen generally comprises from 10.sup.5 to
10.sup.8 cells, and a cell culture on a typical petri dish (6 to 10
cm in diameter) contains about 10.sup.6 cells, so that sufficient
quantities of RNA can be readily obtained.
[0027] The RNA preparations may be used extemporaneously or stored,
preferably in a cold place, as a solution or in the frozen state,
for later use.
[0028] cDNA Populations
[0029] The cDNA used within the scope of the present invention may
be obtained by reverse transcription according to conventional
molecular biology techniques. Reference is made in particular to
Maniatis et al. Reverse transcription is generally carried out
using an enzyme, reverse transcriptase, and a primer.
[0030] In this respect, many reverse transcriptases have been
described in the literature and are.commercially available (1483188
kit, Boehringer). Examples of the most commonly employed reverse
transcriptases include those derived from avian virus AMV (Avian
Myeloblastosis Virus) and from murine leukemia virus MMLV (Moloney
Murine Leukemia Virus). It is also worth mentioning certain
thermostable DNA polymerases having reverse transcriptase activity
such as those isolated from Thermus flavus and Thermus thermophilus
HB-8 (commercially available; Promega catalog numbers M1941 and
M2101). According to an advantageous variant, the present invention
is practiced using AMV reverse transcriptase since this enzyme,
active at 42.degree. C. (in contrast to that of MMLV which is
active at 37.degree. C.), destabilizes certain RNA secondary
structures that might stop elongation, and therefore allows reverse
transcription of RNA of greater length, and provides cDNA
preparations in high yields that are much more faithful copies of
RNA.
[0031] According to a further advantageous variant of the
invention, a reverse transcriptase devoid of RNaseH activity is
employed. The use of this type of enzyme has several advantages,
particularly that of increasing the yield of cDNA. synthesis and
avoiding any degradation of RNAs, which will then be engaged in
heteroduplex formation with the newly synthesized cDNAs, thereby
optionally making it possible to omit the phenol extraction of the
latter. Reverse transcriptases devoid of RNaseH activity may be
prepared from any reverse transcriptase by deletion(s) and/or
mutagenesis. In addition, such enzymes are also commercially
available (for example Life Technologies, catalog number
18053-017).
[0032] The operating conditions that apply to reverse
transcriptases (concentration and temperature) are well known to
those skilled in the art. In particular, 10 to 30 units of enzyme
are generally used in a single reaction, in the presence of an
optimal Mg.sup.2+ concentration of 10 mM.
[0033] The primer(s) used for reverse transcription may be of
various types. It might be, in particular, a random oligonucleotide
comprising preferably from 4 to 10 nucleotides, advantageously a
hexanucleotide. Use of this type of random primer has been
described in the literature and allows random initiation of reverse
transcription at different sites within the RNA molecules. This
technique is especially employed for reverse transcribing total RNA
(i.e. comprising mRNA, tRNA and rRNA in particular). Where it is
desired to carry out reverse transcription of mRNA only, it is
advantageous to use an oligo-dT oligonucleotide as primer, which
allows initiation of reverse transcription starting from polyA
tails specific to messenger RNAs. The oligo-dT oligonucleotide may
comprise from 4 to 20-mers, advantageously about 15-mers. Use of
such a primer represents a preferred embodiment of the invention.
In addition, it might be advantageous to use a labeled primer for
reverse transcription. As a matter of fact, this allows recognition
and/or selection and/or subsequent sorting of RNA from cDNA. This
may also allow one to isolate RNA/DNA heteroduplexes the formation
of which represents a crucial step in the practice of the
invention. Labeling of the primer may be done by any
ligand-receptor based system, i.e. providing affinity mediated
separation of molecules bearing the primer. It may consist for
instance of biotin labeling, which can be captured on any support
(bead, column, plates, etc.) previously coated with streptavidin.
Any other labeling system allowing separation without affecting the
properties of the primer may be likewise utilized.
[0034] In typical operating conditions, this reverse transcription
generates single stranded complementary DNA (cDNA). This represents
a first advantageous embodiment of the present invention.
[0035] In a second variant of practicing the invention, reverse
transcription is accomplished such that double stranded cDNAs are
prepared. This result is achieved by generating, following
transcription of the first cDNA strand, the second strand using
conventional molecular biology techniques involving enzymes capable
of modifying DNA such as phage T4 DNA ligase, DNA polymerase I and
phage T4 DNA polymerase.
[0036] The cDNA preparations may be used extemporaneously or
stored, preferably in a cold place, as a solution or in the frozen
state, for later use.
[0037] Hybridizations
[0038] As set forth hereinabove, the methods according to the
invention are partly based on an original cross hybridization step
between RNAs and cDNAs derived from biological samples in distinct
physiological conditions or from different origins.
[0039] In a preferred embodiment, hybridization according to the
invention is advantageously performed in the liquid phase.
Furthermore, it may be carried out in any appropriate device, such
as for example tubes (Eppendorff tubes, for instance), plates or
any other suitable support that is commonly used in molecular
biology. Hybridization is advantageously carried out in volumes
ranging frum 10 to 1000 .mu.l, for example from 10 to 500 .mu.l. It
should be understood that the particular device as well as the
volumes used can be easily adapted by those skilled in the art. The
amounts of nucleic acids used for hybridization are equally well
known in the art. In general, it is sufficient to use a few
micrograms of nucleic acids, for example in the range of 0.1 to 100
.mu.g.
[0040] An important factor to be considered when performing
hybridization is the respective quantities of nucleic acids used.
Thus, it is possible to use nucleic acids in a cDNAIRNA ratio
ranging from 50 to 0.02 approximately, preferably from 40 to 0.1.
In a more particularly advantageous manner, the cDNA/RNA ratio is
preferably close to or greater than 1. Indeed, in such experiments,
RNA forms the tester compound and cDNA forms the driver.
Accordingly, in order to improve the specificity of the method, it
is preferred to choose operating conditions where the driver is in
excess relative to the tester. In fact, in such conditions, the
cooperativity effect between nucleic acids occurs and mismatches
are strongly disfavored. As a result, the only mismatches that are
observed are generally due to the presence of regions in the tester
RNA which are absent from the driver cDNA and which can therefore
be considered as specific. In order to enhance the specificity of
the method, hybridization is therefore advantageously performed
using a cDNA/RNA ratio comprised between about 1 and about 10. It
is understood that this ratio can be adapted by those skilled in
the art depending on the operating conditions (nucleic acid
quantities available, physiological conditions, required results,
etc.). The other hybridization parameters (time, temperature, ionic
strength) are also adaptable by those skilled in the art. Generally
speaking, after denaturation of the tester and driver (by heating
for instance), hybridization is accomplished for about 2 to 24
hours, at a temperature of approximately 37.degree. C. (and by
optionally performing temperature shifts as set forth below), and
under standard ionic strength conditions (ranging from 0.1 M to 5 M
NaCl for instance). It is known that ionic strength is one of the
factors that defines hybridization stringency, notably in the case
of hybridization on a solid support.
[0041] According to a specific embodiment of the invention,
hybridization is carried out in phenol emulsion, for instance
according to the PERT technique (Phenol Emulsion DNA Reassociation
Technique) described by Kohne D. E. et al. (Biochemistry, (1977),
16 (24): 5329-5341). Advantageously, use is made within the scope
of the present invention of phenol emulsion hybridization under
temperature cycling (temperature shifts from about 37.degree. C. to
about 60/65.degree. C.) instead of stirring, according to the
technique of Miller and Riblet (NAR, (1995), 23: 2339). Any other
liquid phase hybridization technique, notably in emulsion phase,
may be used within the scope of the present invention. Thus, in
another particularly advantageous embodiment, hybridization is
carried out in a solution containing 80% formamide, at a
temperature. of 40.degree. C. for instance.
[0042] Hybridization may also be carried out with one of the
partners fixed to a support. Advantageously, the cDNA is
immobilized. This may be done by taking advantage of cDNA labeling
(see hereinabove), especially by using biotinylated primers. Biotin
moieties are contacted with magnetic beads coated with streptavidin
molecules. cDNAs can then be held in contact with the filter or the
microtiter dish well by applying a magnetic field. Under
appropriate ionic strength conditions, RNAs are subsequently
contacted with cDNAs. Unpaired RNAs are eliminated by washing.
Hybridized RNAs as well as cDNAs are recovered upon removal of the
magnetic field.
[0043] Where the cDNA is double stranded, the hybridization
conditions used are essentially similar to those described
hereinabove, and adaptable by those skilled in the art. In this
case, hybridization is preferably performed in the presence of
formamide and the complexes are exposed to a range of temperatures
varying for instance from 60 to 40.degree. C., preferably from
56.degree. C. to 44.degree. C., so as to promote the formation of
R-loop complexes. In addition, it is desirable to add, following
hybridization, a stabilizing agent to stabilize the triplex
structures formed, once formamide is removed from the medium, such
as glyoxal for example (Kaback et al., (1979), Nuc. Acid Res., 6:
2499-2517).
[0044] These cross hybridizations according to the invention thus
generate compositions comprising cDNA/RNA heteroduplex or
heterotriplex structures, representing the qualitative properties
of each physiological condition being tested. As already noted, in
each of the present compositions, nucleic acids essentially
corresponding to differential alternative splicing or to other
genetic alterations, specific to each physiological condition, can
be identified and/or cloned.
[0045] The invention therefore advantageously relates to a method
for identifying and/or cloning nucleic acid regions representative
of genetic differences occurring between two physiological
conditions, comprising hybridizing RNAs derived from a biological
sample in a first physiological condition with single stranded
cDNAs derived from a biological sample in a second physiological
condition, and identifying and/or cloning, from the hybrids thus
formed, unpaired RNA regions.
[0046] This first variant is more specifically based upon the
formation of heteroduplex structures between RNAs and single
stranded cDNAs (see FIGS. 2-4). This variant is advantageously
implemented using messenger RNAs or cDNAs produced by reverse
transcription of essentially messenger mRNAs, i.e. in the presence
of an oligo-dT primer.
[0047] In a particular embodiment, the method for identifying
and/or cloning nucleic acids according to the invention
comprises
[0048] (a) hybridizing RNAs derived from the test condition with
single stranded cDNAs derived from the reference condition;
[0049] (b) hybridizing RNAs derived from the reference condition
with single stranded cDNAs derived from the test condition; and
[0050] (c) identifying and/or cloning, from the hybrids formed in
steps (a) and (b), unpaired RNA regions.
[0051] In a particular alternative mode of execution, the method of
the invention comprises the following steps:
[0052] (a) obtaining RNAs from a biological sample in a
physiological condition A (rA);
[0053] (b) obtaining RNAs from an identical biological sample in a
physiological condition B (rB);
[0054] (c) preparing cDNAs from a portion of rA RNAs provided in
step (a) (cA cDNAs) and from a portion of rB RNAs provided in step
B (cB cDNAs) by means of polyT primers,
[0055] (d) hybridizing in liquid phase a portion of rA RNAs with a
portion of cB DNAs (to generate rA/cB heteroduplexes)
[0056] (e) hybridizing in liquid phase a portion of rB RNAs with a
portion of cA DNAs (to generate rB/cA heteroduplexes),
[0057] (f) identifying and/or cloning unpaired RNA regions within
the rA/cB and rB/cA heteroduplexes obtained in steps (d) and
(e).
[0058] According to an alternative mode of practicing the
invention, the method of the invention comprises hybridizing RNAs
derived from the test condition with double stranded cDNAs derived
from the reference condition, and identifying and/or cloning the
resulting double stranded DNA regions. This second variant is more
specifically based upon the formation of heterotriplex structures
between RNAs and double stranded cDNAs, derived from R-loop type
structures (see FIG. 5). This variant is equally preferentially
practiced by using messenger RNAs or cDNAs produced by reverse
transcription of essentially messenger RNA, i.e. in the presence of
a polyT primer. In this variant again, a particular embodiment
comprises running two hybridizations in parallel, whereby two
nucleic acid populations according to the invention are generated.
In this variant, the desired regions, specific of alternative
splicing events, are not the unpaired RNA regions, but instead
double stranded DNA which was not displaced by a homologous RNA
sequence (see FIG. 5).
[0059] In another variant of the invention, the method to detect
qualitative genetic differences (eg., alternative splicing events)
occurring between two samples, comprises hybridizing double
stranded cDNAs derived from a first biological sample with cDNAs
(double stranded or, preferably single stranded) derived from a
second biological sample (FIG. 6).
[0060] Unlike the variants described hereinabove, this variant does
not make use of DNA/RNA heteroduplex or heterotriplex structures,
but instead of DNA/DNA homoduplexes. This variant is advantageous
in that it reveals not only alternative introns and exons but also,
and within a same nucleic acid library, specific junctions formed
by deletion of an exon or an intron. Furthermore, the sequences in
such a library give information about the flanking sequences of
alternative introns and exons.
[0061] For both samples (i.e. pathophysiological conditions) under
study, cytosolic polyA+ RNAs are extracted by techniques known in
the art and described previously. These RNAs are converted to cDNA
through the action of a reverse transcriptase with or without
intrinsic RNase H activity, as described hereinabove. One of these
single stranded cDNAs is then converted to double stranded cDNA by
priming with random hexamers and according to techniques known to
those skilled in the art. For one of the conditions under study one
therefore has a single stranded cDNA (called a "driver") and for
the other condition, a double-stranded cDNA (called a "tester").
These cDNAs are denatured by heating and then mixed such that the
river is in excess relative to the tester. This excess is chosen
between 1 and 50-fold, advantageously 10-fold. In a given
experiment, conducted starting with two pathophysiological
conditions, the choice of the condition which generates the driver
is arbitrary and must not affect the nature of the data collected.
As a matter of fact, as in the case of the approaches described
hereinabove, the strategy for identifying qualitative differences
occurring between two mRNA populations is based on cloning these
differences present in common messengers: the strategy is based on
cloning sequences present within duplexes instead of single strands
corresponding to unique sequences or sequences in excess in one of
the conditions under study. The mixture of cDNAs is precipitated,
then taken up in a solution containing formamide (for example,
80%). Hybridization is carried out for 16 hours to 48 hours,
advantageously for 24 hours. The hybridization products are
precipitated, then subjected to the action of a restriction
endonuclease having a 4-base recognition site for double stranded
DNA. Such a restriction enzyme will therefore cleave the double
stranded cDNA formed during the hybridization on average every 256
bases. This enzyme is advantageously chosen so as to generate
cohesive ends. Such enzymes are exemplified by restriction enzymes
such as Sau3Al, Hpall, Taql and Msel. The double stranded fragments
digested by these enzymes are therefore accessible to a cloning
strategy making use of the cleaved restriction sites. Such
fragments are of two types: fully hybridized fragments, the two
strands of which are fully complementary, and partially hybridized
fragments, i.e. comprising a single stranded loop flanked by double
stranded regions (FIG. 6A). These latter fragments, which are in
the minority, contain the information of interest. In order to
separate them from fully hybridized fragments, which are in the
majority since they are derived from most of the cDNA length,
separation methods on a gel or on any other suitable matrix are
used. These methods take advantage of the slower migration, during
electrophoreis or gel filtration in particular, of DNA fragments
which contain a single stranded DNA loop. In this manner the
minority fragments which contain the desired information can be
preparatively separated from the majority of fragments
corresponding to identical DNA regions in both populations. This
variant, which makes it possible to isolate, from a same
population, positive and negative fingerprints linked to
qualitative differences, can also be practiced with RNA/DNA
heteroduplex structures. In this respect, an example of slower
migration of a RNA/DNA heteroduplex in which a portion of the RNA
is not paired, as compared to homologous heteroduplex in which all
the sequences are paired, is illustrated in he grb2/grb33 model
described in the examples (in particular see FIG. 8, lanes 2 and
3).
[0062] Identification and/or Cloning
[0063] Starting from nucleic acid populations generated by
hybridization, the regions characterizing qualitative differences
(eg., differential alternative splicing events), may be identified
by any technique known to those skilled in the art.
[0064] Identification and/or Cloning Starting with RNA/DNA
Heteroduplexes
[0065] Hence, in case of an RNA/DNA heteroduplex (first variant of
this method), these regions essentially appear as unpaired RNA
regions (RNA loops), as shown in FIG. 3. These regions may thus be
identified and cloned by separating the heteroduplexes and single
stranded nucleic acids (DNA, RNA) (unreacted nucleic acids in
excess), selectively digesting the double stranded RNA (portions
engaged in heteroduplex structures) and finally separating the
resulting single stranded RNA from the single stranded DNA.
[0066] In this respect, according to a first approach illustrated
in FIG. 3, the unpaired RNA regions are identified by treatment of
heteroduplexes by means of an enzyme capable of selectively
digesting the RNA domains engaged in RNA/DNA heteroduplexes.
Enzymes having such activity are known from the prior art and are
commercially available. It can be mentioned RNases H, such as in
particular, those derived from E. coli by recombinant techniques
and commercially available (Promega catalog number M4281; Life
Technologies catalog number 18021). This first treatment thus
generates a mixture comprising unpaired single stranded RNA regions
and single stranded cDNA. The RNAs may be separated from cDNAs by
any technique known in the art, and notably on the basis of
labeling of those primers used to prepare cDNA (see above). These
RNAs can be used as a source of material for identifying targets,
gene products of interest or for any other application. These RNAs
can be equally converted into cDNA, and then cloned into vectors,
as described hereinafter.
[0067] In this regard, cloning RNAs may be done in different ways.
One way is to insert at each RNA end oligonucleotides acting as
templates for a reverse transcription reaction in the presence of
compatible primers. Primers may be appended according to techniques
well known to those skilled in the art by means of an enzyme, such
as for example RNA ligase derived from phage T4 and which catalyzes
intermolecular phosphodiester bond formation between a 5' phosphate
group of a donor molecule and a 3' hydroxyl group of an acceptor
molecule. Such an RNA ligase is commercially available (for example
Life Technologies--GIBCO BRL catalog number 18003). The cDNAs thus
obtained may then be amplified by conventional techniques (PCR for
example) using the appropriate primers, as illustrated in FIG. 3.
This technique is especially adapted to cloning short RNA molecules
(less than 1000 bases).
[0068] Another approach for cloning and/or identifying specific RNA
regions involves for example a reverse transcription reaction,
performed upon the digests of an enzyme acting specifically on
double stranded RNA, such as RNase H, using random primers, which
will randomly initiate transcription along RNAs. cDNAs thus
obtained are then amplified according to conventional molecular
biology techniques, for example by PCR using primers formed by
appending oligonucleotides to cDNA ends by means of T4 phage DNA
ligase (commercially available; for example from Life
Technologies--GIBCO BRL catalog number 18003). This second
technique is illustrated in FIG. 4 and in the examples. This
technique is especially adapted to long RNAs, and provides a
sufficient part of the sequence data to subsequently reconstruct
the entire initial sequence.
[0069] A further approach for cloning and/or identifying specific
RNA regions is equally based on a reverse transcription reaction
using random primers (FIG. 4). However, according to this variant,
the primers used are at least in part semi-random primers, i.e.
oligonucleotides comprising:
[0070] a random (degenerated) region,
[0071] a minimal priming region having a defined degree of
constraint, and
[0072] a stabilizing region.
[0073] Preferably, these are oligonucleotides comprising, in the
5'.fwdarw.3' direction
[0074] a stabilizing region comprising 8 to 24 defined nucleotides,
preferably 10 to 18 nucleotides. This stabilizing region may itself
correspond to the sequence of an oligonucleotide used to reamplify
fragments derived from initial amplifications performed by means of
the semi-random primers of the invention. In addition, the
stabilizing region may comprise the sequence of one or more sites,
preferably non-palindromic, corresponding to restriction enzymes.
This makes it possible for example to simplify the cloning of the
fragments thus amplified. A particular example of a stabilizing
region is given by the sequence GAG AAG CGT TAT (residues 1 to 12
of SEQ ID NO:1);
[0075] a random region having 3 to 8 nucleotides, more particularly
5 to 7 nucleotides, and
[0076] a minimal priming region defined such that the
oligonucleotide hybridizes on average at least about every 60 base
pairs, preferably about every 250 base pairs. More preferentially,
the priming region comprises 2 to 4 defined nucleotides, preferably
3 or 4, such as for example AGGX, where X is one of the four bases
A, C, G, or T. The presence of such a priming region gives the
oligonucleotide the capacity to hybridize on average about every
256 base pairs.
[0077] In an especially preferential manner, the oligonucleotides
have the formula
[0078] GAGAAGCGTTATNNNNNNNAGGX (SEQ ID NO: 1) where the fixed bases
are ordered so as to minimize background due to self-pairing in PCR
experiments, where N indicates that the four bases may be present
in a random fashion at the indicated position, and where X is one
of the four bases A, C, G or T. Such oligonucleotides equally
constitute an object of the present invention.
[0079] In this respect, so as to increase the priming events on the
RNAs to be cloned, reactions may be carried out in parallel with
oligonucleotides such as:
2 GAGAAGCGTTATNNNNNNNAGGT (oligonucleotides A)
GAGAAGCGTTATNNNNNNNAGGA (oligonucleotides B)
GAGAAGCGTTATNNNNNNNAGGC (oligonucleotides C)
GAGAAGCGTTATNNNNNNNAGGG, (oligonucleotides D)
[0080] each oligonucleotide population (A, B, C, D) being able to
be used alone or in combination with another.
[0081] After the reverse transcription reaction, the cDNAs are
amplified by PCR using oligonucleotides A or B or C or D.
[0082] As indicated hereinabove, depending on the complexity and
the specificity of the desired oligonucleotide population, the
number of degenerated positions may range from 3 to 8, preferably
from 5 to 7. Below 3 hybridizations are limited and above 8 the
oligonucleotide population is too complex to ensure good
amplification of specific bands.
[0083] Furthermore, the length of the fixed 3' end (constrained
priming region) of these oligonucleotides may also be modified:
while the primers described above, with 4 fixed bases, allow
amplification of 256 base pair fragments on average, primers with 3
fixed bases allow amplification of shorter fragments (64 base pairs
on average). In a first preferred embodiment of the invention, one
uses oligonucleotides in which the priming region comprises 4 fixed
bases. In another preferred embodiment of the invention, one uses
oligonucleotides having a priming region of 3 fixed bases. In fact,
as exons have an average size of 137 bases, they are advantageously
amplified with such oligonucleotides. In this respect, refer also
to oligonucleotides with sequence SEQ ID NO: 2, 3 and 4, for
example.
[0084] Finally, in general, the identification and/or cloning step
of RNA is based on different methods of PCR and cloning, so as to
generate as much information as possible.
[0085] Identification and/or Cloning Starting with
Heterotriplexes.
[0086] In the case of heterotriplex structures (another variant of
the method), the qualitatively different regions (insertions,
deletions, differential splicing) appear essentially in the form of
double stranded DNA regions, as shown in FIG. 5. Such regions may
thus be identified and cloned by treating them in the presence of
appropriate enzymes such as an enzyme capable of digesting RNA, and
next by an enzyme capable of digesting single stranded DNA. The
nucleic acids are thus directly obtained in the form of double
stranded DNA and can be cloned into any suitable vector, such as
the vector pMos-Blue (Amersham, RPN 5110), for example. This
methodology should be distinguished from previously described
approaches using RNAs or oligonucleotides of predetermined
sequences, modified so as to have nuclease activity (Landgraf et
al., (1994), Biochemistry, 33: 10607-10615).
[0087] Identification and/or Cloning Starting with DNA/DNA
Homoduplexes (FIG. 6).
[0088] The fragments isolated on the basis of their atypical
structures are then ligated, at each of their ends, to adaptors, or
linkers, having cleaved restriction sites at one of their ends.
This step may be carried out according to the techniques known to
those skilled in the art, for example by ligation with phage T4 DNA
ligase. The restriction sites thus introduced are chosen to be
compatible with the sites of the cDNA fragments. The linkers
introduced are double stranded cDNA sequences, of known sequence,
making it possible to generate the primers for enzymatic
amplifications (PCR). Since the next step consists in amplifying
the two strands which each bear the qualitative differences to be
identified, it is necessary to use linkers with phosphorylated 5'
ends. Thus after heat denaturation of double stranded cDNA appended
with linkers, each of these cDNA ends is covalently linked to a
specific priming sequence. Following PCR by means of appropriate
specific primers, two categories of double stranded cDNA are
obtained: fragments which contain sequences specific of qualitative
differences which distinguish the two pathophysiological
conditions, and fragments which comprise the negative fingerprint
of these splicing events. Cloning these fragments generates an
alternative splicing library in which, for each splicing event,
positive and negative fingerprints are present. This library
therefore gives access not only to alternative exons and introns
but also to the specific junctions formed by excision of these
spliced sequences. In a same library, this differential genetic
information may be derived from two pathophysiological conditions
indiscriminately. Furthermore, so as to check the differential
nature of the identified splicing events and so as to determine the
condition in which they are specifically elicited, the clones in
the library may. be hybridized with probes derived from each of the
total mRNA populations.
[0089] The. cDNA fragments derived from the qualitative differences
so identified have two principal uses
[0090] cloning into suitable vectors so as to construct libraries
representative of the qualitative differences occurring between the
two pathophysiological conditions under study,
[0091] use as probes to screen a DNA library allowing
identification of differential splicing events.
[0092] The vectors used in the invention can be in particular
plasmids, cosmids, phages, YAC, HAC, etc. These nucleic acids may
thus be stored as such, or introduced into microorganisms
compatible with the cloning vector being used, for replication
and/or stored in the form of cultures.
[0093] The time interval required for carrying out the methods
herein described for each sample is generally less than two months,
in particular less than 6 weeks. Furthermore, these different
methods may be automated so that the total length of time is
reduced and treatment of a large number of samples is
simplified.
[0094] In this regard, another object of the invention concerns
nucleic acids that have been identified and/or cloned by the
methods of the invention. As already noted, these nucleic acids may
be RNAs or cDNAs. More generally, the invention concerns a nucleic
acid composition, essentially comprising nucleic acids
corresponding to alternative splicings which are distinctive of two
physiological conditions: More particularly, these nucleic acids
correspond to alternative splicings identified in a biological test
sample and not present in the same biological sample under a
reference condition. The invention is equally concerned with the
use of the nucleic acids thus cloned as therapeutic or diagnostic
products, or as screening tools to identify active molecules, as
set forth hereinafter.
[0095] The different methods disclosed hereinabove thus all lead to
the cloning of cDNA sequences representative of differentially
spliced genetic information between two pathophysiological
conditions. The whole set of clones derived from one of these
methods makes it thus possible to construct a library
representative of qualitative differences occurring between two
conditions of interest.
[0096] Generation of Qualitative Libraries
[0097] In this respect, the invention is further directed to a
method for preparing nucleic acid libraries representative of a
given physiological state of a biological sample. This method
advantageously comprises cloning nucleic acids representative of
qualitative markers of genetic expression (for example alternative
splicings) of said physiological state but not present in a
reference state, to generate libraries specific to qualitative
differences occurring between the two states being
investigated.
[0098] These libraries are constituted by cDNA inserted in plasmid
or phage vectors. Such libraries can be deposited on nitrocellulose
filters or any other support known to those skilled in the art,
such as chips or biochips.
[0099] One of the features as well as one of the original
characteristics of qualitative differential screening is that this
technique leads not to one but advantageously to two differential
libraries which represent the whole set of qualitative differences
occurring between two given conditions : a library pair (see FIG.
1D).
[0100] Thus, the invention preferentially concerns any nucleic acid
composition or library that can be obtained by hybridizing RNAs
derived from a first biological sample with cDNAs derived from a
second biological sample. More preferentially, the libraries or
compositions of the invention comprise nucleic acids representative
of qualitative differences in expression between two biological
samples, and are generated by a method comprising (i) at least one
hybridization step between RNAs derived from a first biological
sample and cDNAs derived from a second biological sample, (ii)
selecting those nucleic acids representative of qualitative
differences in expression and, optionally, (iii) cloning said
nucleic acids.
[0101] Furthermore, once such libraries are constructed, it is
possible to proceed with a step of clone selection in order to
improve the specificity of the resulting libraries. Indeed, it may
be that certain mismatches observed are not due solely to
qualitative differences (eg., to differential alternative
splicings) but might result from reverse transcription defects for
example. Although such events are not generally significant, it is
preferable to prevent them or reduce their incidence prior to
nucleic acid cloning. To accomplish this, the library clones may be
hybridized with the cDNA populations occurring in both
physiological conditions being investigated (cf. step.COPYRGT.
hereinabove). The clones which hybridize in a non-differential
manner with both populations would be considered as nonspecific and
optionally discarded or treated as second priority (in fact, the
appearance of a new isoform in the test sample does not always
indicate that the initial isoform present in the reference sample
has disappeared from this test sample). Clones hybridizing with
only one of either populations or hybridizing preferentially with
one of the populations are considered specific and could be
selected in priority to constitute enriched or refined
libraries.
[0102] A refining step may be equally performed by hybridizing and
checking the identify of clones by means of probes derived from a
statistically relevant number of pathological samples.
[0103] The present application is therefore equally directed to any
nucleic acid library comprising nucleic acids specific to
alternative splicings typical of a physiological condition. These
libraries advantageously comprise cDNAs, generally double stranded,
corresponding to RNA regions specific of alternative splicing.
[0104] Such libraries may be comprised of nucleic acids, generally
incorporated within a cloning vector, or of cell cultures
containing said nucleic acids.
[0105] The choice of initial RNAs partly determines the
characteristics of the resulting libraries
[0106] the RNAs of both conditions A and B are mRNAs or total
mature RNAs isolated according to techniques known to those skilled
in the art. The libraries are thus so-called restricted qualitative
differential screening libraries, since they are restricted to
qualitative differences that characterize the mature RNAs of both
pathophysiological conditions.
[0107] the RNAs of one of either conditions are mRNAs or mature
total RNAs whereas the RNAs of the other condition are premessenger
RNAs, not processed by splicing, isolated according to techniques
known to those skilled in the art, from cell nuclei. In this
situation the resulting libraries are so-called complex
differential screening libraries, as being not restricted to
differences between mature RNAs but rather comprising the whole set
of spliced transcripts in a given condition which are absent from
the other, including all introns.
[0108] finally, the RNAs could arise from a single
pathophysiological condition and in this case the differential
screening involves mature RNAs and premessenger RNAs of the same
sample. In such a case, the resulting libraries are autologous
qualitative differential screening libraries. The usefulness of
such libraries lies in that they include exclusively the whole
range of introns transcribed in a given condition. Whether they
hybridize with a probe derived from mature RNAs of a distinct
condition allows one to quickly ascertain if the condition under
study is characterized by persisting introns while providing for
their easy identification.
[0109] Generally speaking, the libraries are generated by
spreading, on a solid medium (notably on agar medium), of a cell
culture transformed by the cloned nucleic acids. Transformation is
done by any technique known to those skilled in the art
(transfection, calcum phosphate precipitation, electroporation,
infection with bacteriophage, etc.). The cell culture is generally
a bacterial culture, such as for example E. coli. It may also be a
eukaryotic cell culture, notably lower eukaroytic cells (yeasts for
example). This spreading step can be performed in sterile
conditions on a dish or any other suitable support. Additionally,
the spread cultures on agar medium can be stored in a frozen state
for example (in glyerol or any other suitable agent). Naturally,
these libraries can be used to produce "duplicates", i.e. copies
made according to common techniques more fully described
hereinafter. Furthermore, such libraries are generally used to
prepare an amplified library, i.e. a library comprising each clone
in an amplified state. An amplified library is prepared as follows
: starting from a spread culture, all cellular clones are recovered
and packaged for storage in the frozen state or in a cold place,
using any compatible medium. This amplified library is
advantageously prepared from E. coli bacterial cultures, and is
stored at 4.degree. C., in sterile conditions. This amplified
library allows. preparation and unlimited replication of any
subsequently prepared library containing such clones, on different
supports, for a variety of applications. Such a library further
allows the isolation and characterization of any clone of interest.
Each clone composing the libraries of the invention is indeed a
characteristic element of a physiological condition, and
constitutes therefore a particularly interesting target for various
studies such as the search for markers, antibody production,
diagnostics, gene transfer therapy, etc. These different
applications are discussed in more detail below. Th e library is
generally prepared as described above by spreading the cultures in
an agar medium, on a suitable support (petri dish for example). The
advantage of using an agar medium is that each colony can be
separated and distinctly recognized. Starting from this culture,
identical duplicates may be prepared in substantial amounts simply.
by replica-plating on any suitable support according to techniques
known in the art. Thus, the duplicate may be obtained by means of
filters, membranes (nylon, nitrocellulose, etc.) on which cell
adhesion is possible. Filters may then be stored as such, at
4.degree. C. for example, in a dried state, in any packing medium
that does not after nucleic acids. Filters may equally be treated
in such a manner as to discard cells, proteins, etc., and to retain
only such components as nucleic acids. These treatment procedures
may notably comprise the use of proteases, detergents, etc. Treated
filters may be equally stored in any device or under any condition
acceptable for nucleic acids.
[0110] The nucleic acid libraries can be equally directly prepared
from nucleic acids, by transfer onto biochips or any other suitable
device.
[0111] The invention is equally directed to any library comprising
oligonucleotides specific of alternative splicing events that
distinguish two physiological conditions. These are advantageously
single stranded oligonucleotides comprising from 5 to 100-mers,
preferably less than 50-mers, for example in the range of
25-mers.
[0112] These oligonucleotides are specific of alternative splicings
representative of a given condition or type of physiological
condition. Thus, such oligonucleotides may for example be
oligonucleotides representative of alternative splicing events
characteristic of apoptotic states. Indeed, it has been reported in
the literature that certain alternative splicing events are
observed in apoptotic conditions. This holds especially true for
splicing within Bclx, Bax, Fas or Grb2 genes for example. By
referring to published data or sequences available in the
literature and/or in databases, it is possible to generate
oligonucleotides specific to spliced or unspliced forms. These
oligonucleotides may for example be generated according to the
following strategy
[0113] (a) identifying a protein or a splicing event characteristic
of an apoptotic condition and the sequence of the spliced domain.
This identification procedure can be based upon published data or a
compilation of available. sequences in databases;
[0114] (b) synthesizing artificially one or more oligonucleotides
corresponding to one or more regions of this domain, which
therefore allow the identification of the unspliced form in the
RNAs of a test sample through hybridization
[0115] (c) synthesizing artificially one or more oligonucleotides
corresponding to the junction region between two domains separated
by the spliced domain. These oligonucleotides therefore allow the
identification of the spliced form in the RNAs of a test sample
through hybridization;
[0116] (d) repeating steps (a) to (c) listed above with other
proteins or splicing events characteristic of apoptotic
conditions;
[0117] (e) transferring upon a first suitable support one or a
plurality of oligonucleotides specific to apoptotic forms of
messengers identified hereinabove and, upon another suitable
support, one or a plurality of oligonucleotides specific to
non-apoptotic forms.
[0118] The two supports thus obtained may be used to assess the
physiological state of cells or test samples, and particularly
their apoptotic state, through hybridization of a nucleic acid
preparation derived from such cells or samples.
[0119] Other similar libraries can be generated using
oligonucleotides specific to different pathophysiological states
(neurodegeneration, toxicity, proliferation, etc.), thus broadening
the range of applications.
[0120] Alternative intron or exon libraries can also be in the form
of computerized data base systems compiled by systematically
analyzing databases in which information about genomes of
individual organisms, tissues or cell cultures is recorded. In such
a case, the data obtained by elaboration of such virtual databases
may be used to generate oligonucleotide primers that will serve in
testing two pathophysiological conditions in parallel.
[0121] The computerized databases may further be used to derive
versatile nucleotide probes, representative of a given class of
proteins, or specific of a particular sequence. These probes can
then be deposited on the clone libraries derived from different
alternative intron and exon cloning techniques in order to
appreciate the complexity of these molecular libraries and rapidly
determine whether a given class of protein or a given defined
sequence is differentially spliced when comparing two distinct
pathophysiological states.
[0122] A further nucleic acid composition or library according to
the invention is an antisense library, generated from the sequences
identified according to the methods of the invention (DATAS). To
generate this type of library, such sequences are cloned so as to
be expressed as RNA fragments corresponding to an antisense
orientation relative to the messenger RNAs used for DATAS. This
results in a so-called antisense library. This approach
preferentially makes use of the cloning variant which allows
orientation of the cloned fragments. The usefulness of such an
antisense library is that it allows transfection of cell lines and
monitoring of all phenotypic alterations whether morphological or
enzymatic, or revealed by the use of reporter genes or genes that
confer resistance to a selective agent. Analysis of phenotypic
variations subsequent to the introduction of an antisense
expression vector is generally done after selection of so-called
stable clones, i.e. allowing coordinated replication of the
expression vector and the host genome. This coordination is enabled
through the integration of the expression vector into the cellular
genome or, when the expression vector is episomal, through
selective pressure. Such selective pressure is applied by treating
the transfected cell culture with a toxic agent that can only be
detoxified when the product of a gene carried by the expression
vector is expressed within the cell. This results in
synchronization between host and transgene replication. One
advantageously uses episomal vectors derived from the Epstein-Barr
virus which allow expression of 50 to 100 vector copies within a
given cell (Deiss et al., (1996), EMBO J., 15: 3861-3870; Kissil et
al., (1995), J. Biol. Chem, 270: 27932-27936).
[0123] The advantage of these antisense libraries related to the
DATAS sequences they contain is that they not only allow
identification of the gene the expression of which is inhibited to
produce the selected phenotype, but also identification of which
splicing isoform of this gene was affected. When the antisense
fragment targets a given exon, it may be deduced therefrom that the
protein domain and thus the function involving this domain
counteracts the observed phenotype. In this respect coupling of
DATAS with an antisense approach represents a shortcut towards
functional genomics.
[0124] DNA Chips
[0125] The invention is further directed to any support material
(membrane, filter, biochip, chip, etc.) comprising a nucleic acid
composition or library as. defined hereinabove. This may inore
particularly be a cell library or a nucleic acid library. The
invention also concerns any kit or support material comprising
several libraries according to the invention. In particular, it may
be advantageous to use in parallel a library representative of the
qualitative features of a test physiological condition with respect
to a reference physiological condition and, as control, a library
representative of the features of a reference physiological
condition in relation to the test physiological condition (a
"library pair"). An advantageous kit according to the invention
thus comprises two differential qualitative libraries belonging to
two physiological conditions (a "library pair"). According to one
particular embodiment, the kits pursuant to the invention comprise
several library pairs as defined hereinabove, corresponding to
distinct physiological states or to different biological samples
for example. The kits may comprise for example these different
library pairs arranged serially on a common support.
[0126] Generation of Probes
[0127] Another use of the cDNA compositions according to the
invention, representative of qualitative differences occurring
between two pathophysiological.
[0128] states, consists in deriving probes thereof. Such probes may
in fact be used to screen differential splicing events between two
pathophysiological conditions.
[0129] These probes (see FIG. 1D) may be prepared by labeling
nucleic acid libraries or populations according to conventional
techniques known in the art. Thus, the labeling may be carried out
by enzymatic, radioactive, fluorescent, immunological means, etc.
The labeling is preferably radioactive or fluorescent. This type of
labeling may be accomplished for example by introducing into the
nucleic acid population (either after synthesis or during
synthesis) labeled nucleotides, enabling their visualization by
conventional methods.
[0130] One application is therefore to screen a conventional
genomic library. Such a library may comprise, depending on whether
the vector is derived from a phage or a cosmid, DNA fragments of 10
kb to 40 kb. The number of clones hybridizing with the probes
generated by DATAS and representative of differential splicing
events occurring between two conditions thus approximately reflects
the number of genes affected by alternative splicings, according to
whether they are expressed in one or the other condition being
investigated.
[0131] Preferably, the probes of the invention are used to screen a
genomic DNA library (generally of human origin) adapted to
identifying splicing events. Such a genomic library is preferably
composed of DNA fragments of restricted size (generally cloned into
vectors), so as to yield statistically only a single differentially
spliceable element, i.e. a single exon or a single exon. The
genomic DNA library is therefore prepared by digesting genomic DNA
with an enzyme having a recognition site restricted by 4 bases,
thus providing the possibility of obtaining by controlled digestion
DNA fragments with an average size of 1 kb. Such fragments require
the generation of 10.sup.7 clones to constitute a DNA library
representative of a higher eukaryotic genome. Such a library is
equally an object of the present application. This library is then
hybridized with the probes derived from qualitative differential
screening. In fact, for each experiment being investigated and
which compares two pathophysiological conditions A and B, two
probes (probe pair) are obtained. One probe is enriched in splicing
events characteristic of condition A and one probe is enriched in
splicing markers characteristic of B. Clones in the genomic library
which hybridize preferentially with one of either probe harbor
sequences that are preferentially spliced in the corresponding
pathophysiological conditions.
[0132] The methods of the invention thus provide for the systematic
identification of qualitative differences in gene expression. These
methods have many applications, related to the identification
and/or cloning of molecules of interest, in the fields of
toxicology, pharmacology or still, in pharmacogenomics for
example.
[0133] Applications
[0134] The invention is therefore additionally concerned with the
use of the methods, nucleic acids or libraries previously described
for identifying molecules of therapeutic or diagnostic value. The
invention is more specifically concerned with the use of the
methods, nucleic acids or libraries described hereinabove for
identifying proteins or protein domains that are altered in a
pathology.
[0135] One of the major strengths of these techniques is, indeed,
the identification, within a messenger, and consequently within the
corresponding protein, of the functional domains which are affected
in a given disorder. This makes it possible to assess the
importance of a given domain in the development and persistence of
a pathological state. The direct advantage of restricting to a
given protein domain the impact of a pathological disorder resides
in that the latter can be viewed as a relevant target for screening
small molecules for therapeutic purposes. This information further
constitutes a key for designing therapeutically active polypeptides
that may be delivered by gene therapy; such polypeptides can
notably be single chain antibodies derived from neutralizing
antibodies directed against domains identified by the techniques
herein described.
[0136] More specifically, the methods according to the invention
provide molecules which:
[0137] may be coding sequences derived from alternative exons.
[0138] may correspond to noncoding sequences borne by introns
differentially spliced between two pathophysiological states.
[0139] From these two points, different information can be
obtained.
[0140] Alternative splicings of exons which discriminate between
two pathophysiological states reflect a regulatory mechanism of
gene expression capable of modulating (in more precise terms
suppressing or restoring) one or a number of functions of a
particular protein. Therefore, as the majority of structural and
functional domains (SH2, SH3, PTB, PDZ, and catalytic domains of
various enzymes) are encoded by several contiguous exons, two
configurations might be considered:
[0141] i) the domains are truncated in the pathological condition
(Zhu, Q. et al., (1994), J. Exp. Med., 180 (2): 461-470); this
indicates that the signaling pathways involving such domains must
be restored for therapeutical purposes.
[0142] ii) the domains are retained in the course of a pathological
disorder whereas they are absent in the healthy state; these
domains can be considered as screening targets for low molecular
weight compounds intended to antagonize signal transduction
mediated by such domains.
[0143] The differentially spliced sequences may correspond to
noncoding regions located 5' or 3' of the coding sequence or to
introns occurring between two coding exons. In the noncoding
regions, these differential splicings could reflect a modification
of messenger stability or translatability (Bloom, T. J. and Beavo,
J. A., (1995), Proc. Natl. Acad. Sci. USA, 93 (24): 14188-14192;
Ambartsumian, N. et al., (1995), Gene, 159 (1): 125-130). A search
for these phenomena should be conducted based on such information
and might qualify the corresponding protein as a candidate target
in view of its accumulation or disappearance. Retention of an
intron in a coding sequence often results in the truncation of the
native protein by introducing a stop codon within the reading frame
(Varesco, L., et al., (1994), Hum. Genet., 93 (3): 281-286; Canton,
H., et al., (1996), Mol. Pharmacol., 50 (4): 799-807; Ion, A., et
al., (1996), Am. J. Hum. Genet., 58 (6): 1185-1191). Before such a
stop codon is read, there generally occurs translation of a number
of additional codons whereby a specific sequence is appended to the
translated portion, which behaves as a protein marker of
alternative splicing. These additional amino acids can be used to
produce antibodies specific to the alternative form inherent to the
pathological condition. These antibodies may subsequently be used
as diagnostic tools. The truncated protein undergoes a change or
even an alteration in properties. Thus enzymes may loose their
catalytic or regulatory domain, becoming inactive or constitutively
activated. Adaptors may lose their capacity to link different
partners of a signal transduction cascade (Watanabe, K. et al.,
(1995), J. Biol. Chem., 270 (23): 13733-13739). Splicing products
of receptors may lead to the formation of receptors having lost
their ability to bind corresponding ligands (Nakajima, T. et al.,
(1996), Life Sci., 58 (9): 761-768) and may also generate soluble
forms of receptor by release of their extracellular domain (Cheng
J., (1994), Science, 263 (5154): 1759-1762). In this case,
diagnostic tests can be designed, based on the presence of
circulating soluble forms of receptor which bind a given ligand in
different physiological fluids.
[0144] The invention is more specifically concerned with the use of
the methods, nucleic acids or libraries described hereinabove for
identifying antigenic domains that are specific for proteins
involved in a pathology. The invention is equally directed to the
use of the nucleic acids, proteins or peptides as described above
for diagnosing pathological conditions.
[0145] The invention is equally directed to a method for
identifying and/or producing proteins or protein domains involved
in a pathology comprising:
[0146] (a) hybridizing messenger RNAs of a pathological sample with
cDNAs of a healthy sample, or vice versa, or both in parallel,
[0147] (b) identifying, within the hybrids formed, regions
corresponding to qualitative differences (unpaired (RNA) or paired
(double stranded DNA)) which are specific to the pathological state
in relation to the healthy state,
[0148] (c) identifying and/or producing the protein or protein
domain corresponding to one or several regions identified in step
(b).
[0149] The regions so identified generally correspond to
differential splicings, but they may also correspond to other
genetic alterations such as insertion(s) or deletion(s), for
example.
[0150] The protein(s) or protein domains may be isolated,
sequenced, and used in therapeutic or diagnostic applications,
notably for antibody production.
[0151] To better illustrate this point, the qualitative
differential screening of the invention allows one to
advantageously identify tumor suppressor genes. Indeed, may
examples indicate that one way suppressor genes are inactivated in
the course of tumor progression is inactivation by modulation of
alternative forms of splicing.
[0152] Hence, in small cell lung carcinoma, the gene of protein
p130 belonging to the RB family (retinoblastoma protein) is mutated
at a consensus splicing site. This mutation results in the removal
of exon 2 and in the absence of synthesis of the protein due to the
presence of a premature stop codon. This observation was the first
of its. kind to underscore the importance of RB family members in
tumorigenesis. Likewise, in certain non small cell lung cancers,
the gene of protein p161NK4A, a protein which is an inhibitor of
cyclin-dependent kinases cdk4 and cdk6, is mutated at a donor
splicing site. This mutation results in the production of a
truncated protein with a short half-life, leading to the
accumulation of the inactive phosphorylated forms of RB.
Furthermore, WT1, the Wilm's tumor suppressor gene, is transcribed
into several messenger RNAs generated by alternative splicings. In
breast cancers, the relative proportions of different variants are
modified in comparison to healthy tissue, thereby yielding
diagnostic tools or clues to understanding the importance of the
various functional domains of WT1 in tumor progression. The same
alteration process affecting ratios between different messenger RNA
forms and protein isoforms during cellular transformation is again
found in the case of neurofibrin NF1. In addition, the concept that
modulation of splicing phenomena behaves as a marker of tumor
progression is further supported by the example of HDM2 where five
alternative splicing events are detected in ovarian and pancreatic
carcinoma, the expression of which increases depending on the stage
of tumor development. Furthermore, in head and neck cancers, one of
the mechanisms by which p53 is inactivated involves a mutation at a
consensus splicing site.
[0153] These few examples clearly illustrate the interest of the
methods of the invention based on systematic screening for
alternative splicing patterns which discriminate between a given
tumor and an adjacent healthy tissue. Results thus obtained allow
not only the characterization of known tumor suppressor genes but
also, in view of the original and systematic aspect of qualitative
differential screening methods, the identification of novel
alternative splicings specific to tumors that are likely to affect
new tumor suppressor genes.
[0154] The invention is therefore further directed to identifying
and/or cloning tumor suppressor genes or genetic alterations (eg.,
splicing events) within those tumor suppressor genes, as previously
defined. This method may advantageously comprise the following
steps:
[0155] (a) hybridizing messenger RNAs of a tumor sample with cDNAs
of a healthy sample, or vice versa, or both in parallel,
[0156] (b) identifying, within the hybrids formed, regions specific
to the tumor sample in relation to the healthy sample,
[0157] (c) identifying and/or cloning the protein or protein domain
corresponding to one or more regions identified in step (b).
[0158] The tumor suppressor properties of the proteins or protein
domains identified may then be tested in different known models.
These proteins, or their native forms (displaying the splicing
pattern observed in healthy tissue) may then be use for various
therapeutic or diagnostic applications, notably for antitumoral
gene therapy.
[0159] The present application therefore relates not only to
different. aspects of embodying the present technology but also to
the exploitation of the resulting information in research,
development of screening assays for chemical compounds of low
molecular weight, and development of gene therapy or diagnostic
tools.
[0160] In this connection, the invention further concerns the use
of the methods, nucleic acids or libraries described above in
genotoxicology, i.e. to predict the toxicity of test compounds.
[0161] The genetic programs initiated during treatment of cells or
tissues by toxic agents are predominantly correlated with apoptotic
processes, or programmed cell death. The importance of alternative
splicing processes in regulating such apoptotic mechanisms is well
described in the literature. However, no single gene engineering
technique described to date allows exhaustive screening and
isolation of sequence variations due to alternative splicings
distinctive of two given pathophysiological conditions. The
qualitative differential splicing screening methods developed by
the present invention make it possible to gather all splicing
differences occurring between two conditions within cDNA libraries.
Comparing RNA sequences (for example messenger RNAs) of a tissue
(or of a cell culture) either treated or not with a standard toxic
compound allows the generation of cDNA libraries which comprise
gene expression qualitative differences characterizing the toxic
effect being investigated. These cDNA libraries may then be
hybridized with probes derived from RNA arising from the same
tissues or cells treated with the chemical being assessed for
toxicity. The relative capacity of these probes to hybridize with
the genetic sequences specific to a given standard toxic condition
allows toxicity of the compound to be determined. Furthermore, in
addition to the use of DATAS for the generation and utilization of
qualitative differential libraries induced by toxic agents, a part
of the invention consists equally in demonstrating that regulation
defects in the splicing of certain messenger RNAs may be induced by
certain toxic agents, at doses lower than the IC50 determined in
the cytotoxicity and apoptosis tests known to those skilled in the
art. Such regulation defects (or deregulations) may be used as
markers to assess the toxicity and/or potency of molecules
(chemical or genetic).
[0162] The invention therefore equally concerns any method for
detecting or monitoring the toxicity and/or therapeutic potential
of a compound based on the detection of splicing forms and/or
patterns induced by this compound on a biological sample. It
further concerns the use of any modification of splicing forms
and/or patterns as a marker to assess the toxicity and/or potency
of molecules.
[0163] Toxicity assessment or monitoring may be performed more
specifically following two approaches:
[0164] According to a first approach, the qualitative differential
screening may be accomplished between a reference tissue or cell
culture not subjected to treatment on the one hand, and treated by
the product whose toxicity is to be assessed on the other hand. The
analysis of clones representative of qualitative differences
specifically induced by this product subsequently provides for the
eventual detection within these clones of events closely related to
cDNA involved in toxic reactions such as apoptosis.
[0165] Such markers are monitored as they arise as a function of
the dose and duration of treatment by the product in question so
that the toxicological profile thereof may be established.
[0166] The present application is therefore equally directed to a
method for identifying, by means of qualitative differential
screening according to the methods set forth above, toxicity
markers induced in a model biological system by a chemical compound
whose toxicity is to be measured. In this respect, the invention
relates in particular to a method for identifying and/or cloning
nucleic acids specific of a toxic state of a given biological
sample comprising preparing qualitative differential libraries
between the cDNAs and the RNAs of the sample either subjected or
not to treatment by the test toxic compound, and searching for
toxicity markers specific to the properties of the sample
post-treatment.
[0167] According to the second approach, abacus are prepared for
different classes of toxic products, that are fully representative
of the toxicity profiles as a function of dosage and treatment
duration for a given reference tissue or cell model. For each
abacus dot, cDNA libraries representative of qualitative genetic
differences can be generated. The latter represent qualitative
differential libraries, i.e. they are obtained by extracting
genetic information from the dot selected in the abacus diagram and
from the corresponding dot in the control tissue or cell model. As
set forth in the examples, the qualitative differential screening
is based on hybridizing mRNA derived from one condition with cDNAs
derived from another condition. As noted above, the qualitative
differential screening may also be conducted using total RNAs or
nuclear RNAs containing premessenger species.
[0168] In this respect, the invention concerns a method for
determining or assessing the toxicity of a test compound to a given
biological sample comprising hybridizing:
[0169] differential libraries between cDNAs and RNAs of said
biological sample from a healthy state and at various stages of
toxicity resulting from treatment of said sample with a reference
toxic compound, with,
[0170] a nucleic acid preparation of the biological sample treated
by said test compound, and
[0171] assessing the toxicity of the test compound by determining
the extent of hybridization with the different libraries.
[0172] According to this method, it is advantageous to proceed with
two cross hybridizations for each condition (compound dosage and/or
incubation time), between:
[0173] RNAs from condition A (test) and cDNAs from condition B
(reference) (rA/cB)
[0174] RNAs from condition B (reference) and cDNAs from condition A
(test) (rB/cA).
[0175] Each reference toxic condition, at each abacus dot, thus
corresponds to two qualitative differential screening libraries.
One of such libraries is a full collection of qualitative
differences, i.e. notably the alternative splicing events, specific
to the normal reference condition whereas the other library is a
full collection of splicing events specific to the toxic
situations. These libraries are replica-plated on solid support
materials such as nylon or nitrocellulose filters or advantageously
on chips. These libraries initially formed of cDNA fragments of
variable length (according to the splicing events being considered)
may be optimized by using oligonucleotides derived from previously
isolated sequences.
[0176] Where a chemical compound is a candidate for pharmaceutical
development, this may be tested with the same tissue or cell models
as those recorded in the toxicity abacus diagram. Molecular probes
may then be synthesized from mRNAs extracted from the biological
samples treated with the chemical compound of interest. These
probes are then hybridized on filters bearing cDNA of rA/cB and
rB/cA libraries. For instance, the rA/cB library may contain
sequences specific to the normal condition and the rB/cA library
may contain alternative spliced species specific to the toxic
condition. Innocuity or toxicity of the chemical compound is then
readily assessed by examining the hybridization profile of an
mRNA-derived probe belonging to the reference tissue or cell model
that has been treated by the test compound:
[0177] efficient hybridization with the rA/cB library and no signal
in the rB/cA library demonstrates that the compound has no toxicity
in the model under study
[0178] positive hybridization between the probe and the rB/cA
library clones is evidence of test compound-induced toxicity.
[0179] Practical applications related to such libraries may be
provided by hepatocyte culture models, such as the HepG2 line,
renal epithelial cells, such as the HK-2 line, or endothelial
cells, such as the ECV304 line, following treatment by toxic agents
such as ethanol, camptothecin or PMA.
[0180] A preferred example may be provided by use in cosmetic
testing of skin culture models subjected or not to treatment by
toxic agents or irritants.
[0181] A further object of the present application is therefore
differential screening libraries (between cDNAs and RNAs) made from
reference organs, tissues or cell cultures treated by chemical
compounds representative of broad classes of toxic agents according
to abacus charts disclosed in the literature. The invention further
encompasses the spreading of these libraries on filters or support
materials known to those skilled in the art (nitrocellulose, nylon
. . . ). Advantageously, these support materials may be chips which
hence define genotoxicity chips. The invention is further concerned
with the potential exploitation of the sequencing data about
different clones making up these libraries in order to understand
the mechanisms underlying the action of various toxic agents, as
well as with the use of such libraries in hybridization with probes
derived from cells or tissues treated by a chemical compound or a
pharmaceutical product whose toxicity is to be determined.
Advantageously, the invention relates to nucleic acid libraries
such as of the type defined above, prepared from skin cells treated
under different toxic conditions. The invention is further
concerned with a kit comprising these individual skin differential
libraries.
[0182] The invention is further directed to the use of the methods,
nucleic acids or libraries previously described to assess (predict)
or enhance the therapeutic effectiveness of test compounds
(genopharmacology).
[0183] In this particular use, the underlying principle is very
similar to that previously described. Reference differential
libraries are established between cDNAs and RNA from a control cell
culture of organ and counterparts thereof simulating a pathological
model. The therapeutic efficacy of a product may then be evaluated
by monitoring its potential to antagonize qualitative variations of
gene expression which are specific of the pathological model. This
is demonstrated by a change in the hybridization profile of a probe
derived from the pathological model with the reference libraries:
in the absence of treatment, the probe only hybridizes with the
library containing the specific markers of the disease. Following
treatment with an effective product, the probe, though it is
derived from the pathological model, hybridizes preferentially with
the other library, which bears the markers of the healthy model
equivalent.
[0184] In this respect, the model is further directed to a method
for determining or assessing the therapeutic efficacy of a test
compound on a given biological sample comprising hybridizing:
[0185] differential libraries.between cDNAs and RNAs from said
biological sample in a healthy state and in a pathological state
(at different development stages), with,
[0186] a preparation of nucleic acids derived from the biological
sample treated by said test compound, and
[0187] assessing the therapeutic potential of the test compound by
determining the extent of hybridization with the different
libraries.
[0188] Such an application is exemplified by an apoptosis model
simulating certain aspects of neurodegeneration which are
antagonized by standard trophic factors. Thus, cells derived from
the PC12 pheochromocytoma line which differentiate into neurites in
the presence of NGF enter into apoptosis upon removal of this
growth factor. This apoptotic process is accompanied by expression
of many programmed cell death markers, several of which are
regulated by alternative splicing and downregulated by IGF1. Two
libraries derived from qualitative differential screening are
generated from mRNA extracts of differentiated PC12 cells in the
process of apoptosis following NGF removal on the one hand and from
differentiated PC12 cells prevented from undergoing apoptosis by
supplementing IGF-1 on the other hand. To these libraries, may be
hybridized probes prepared from mRNA derived from differentiated
PC12 in the process of apoptosis and whose survival is enhanced by
treatment with a neuroprotective product to be tested. The
efficiency of the test compound to reverse the qualitative
characteristics can thus be appreciated by monitoring the capacity
of the probe to selectively hybridize to those specific library
clones representing cells having a better survival rate. This test
could be subsequently used to test the efficiency of derivatives of
such a compound or any other novel family of neuroprotective
compounds and to improve the pharmacological profile thereof.
[0189] In a specific embodiment, the method of the invention allows
one to assess. the efficacy of a neuroprotective test compound by
carrying out hybridization with a differential library according to
the invention derived from a healthy nerve cell and this
neurodegenerative model cell.
[0190] In another embodiment, one is interested in testing an
antitumor compound using differential libraries established from
tumor and healthy cell samples.
[0191] As already noted, the method of the invention could
furthermore be used to improve the properties of a compound, by
testing the capacity of various derivatives thereof to induce a
hybridization profile similar to that of the library representative
of the healthy sample.
[0192] The invention is further directed to the use of the methods,
nucleic acids or libraries described hereinabove in
pharmacogenomics, i.e. to assess (predict) the response of a
patient to a test compound or treatment.
[0193] Pharmacogenomics is aimed at establishing genetic profiles
of patents with a view to determine which treatment would
reasonably be successful for a given pathology. The techniques
described in the present invention make it possible in this respect
to establish cDNA libraries that are representative of qualitative
differences occurring between a pathological condition which is
responsive to a given treatment and another condition which is
unresponsive or poorly responsive thereto, and thus may qualify for
a different therapeutic strategy. Once these standard libraries are
established, they can be hybridized with probes prepared from the
patients' messenger RNAs. The hybridization results allow one to
determine which patient has a hybridization profile corresponding
to the responsive or non responsive condition and thus refine
treatment choice in patient management.
[0194] In this application, the purpose is on the one hand to
suggest depending on the patient's history the most appropriate
treatment regimen likely to be successful and on the other hand to
enroll in a given treatment regimen those patients most likely to
benefit therefrom. As with other applications, two qualitative
differential screening libraries are prepared: one based on a
pathological model or sample known to respond to a given treatment,
and another based on a further pathological model or sample which
is poorly responsive or unresponsive to therapy. These two
libraries are then hybridized with probes derived from mRNAs
extracted from biopsy tissues of individual patients. Depending on
whether such probes preferentially hybridize with the alternatively
spliced forms specific to one particular condition, the patients
may be divided into responsive and unresponsive subjects to the
standard treatment which initially served to define the models.
[0195] In this respect, the invention is also directed to a method
for determining or assessing the response of a patient to a test
compound or treatment comprising hybridizing:
[0196] differential libraries between cDNAs and RNAs from a
biological sample responsive to said compound/treatment and from a
biological sample which is poorly responsive or unresponsive to
said compound/treatment, with,
[0197] a nucleic acid preparation derived from a pathological
biological sample of the patient, and
[0198] assessing the responsiveness of the patient by determining
the extent of hybridization with the different libraries.
[0199] A preferred example of the usefulness of qualitative
differential screening in pharmacogenomics is illustrated by a
qualitative differential screening between two tumors of the same
histological origin, one of which showing regression when treated
with an antitumor compound (for example transfer of cDNA coding for
wild type p53 protein by gene therapy), while the other being
unresponsive to such treatment. The first benefit derived from
constructing qualitative differential libraries between these two
conditions is the ability to determine, by analyzing clones making
up these libraries, which molecular mechanisms are elicited during
regression as observed in the first model and absent in the
second.
[0200] Subsequently, the use of filters or any other support
material bearing cDNAs derived from these libraries allows one to
conduct hybridization with probes derived from mRNAs of tumor
biopsies whose response to said treatment is to be predicted. It is
possible by looking at the results to assign patients to an
optimized treatment regimen.
[0201] One particular example of this method consists in
determining the tumor response to p53 tumor suppressor gene
therapy. It has indeed been reported that certain patients and
certain tumors respond more or less to this type of treatment (Roth
et al., (1995) Nature Medicine, 2: 958). It is therefore essential
to be able to determine which types of tumors and/or which patients
are sensitive to wild type p53 gene therapy, in order to optimize
treatment and make the best choice regarding the enrollment of
patients in clinical trials being undertaken. Advantageously, the
method of the invention makes it possible to simplify the procedure
by providing libraries specific to qualitative characteristics of
p53-responsive cells and non responsive cells. Examples of cell
models sensitive or resistant to p53 are described for instance by
Sabbatini et al. (Genes Dev., (1995), 9: 2184) or by Roemer et al.
(Oncogene, (1996), 12: 2069). Hybridization of these libraries with
probes derived from patients' biopsy samples will make assessment
of patient responsiveness easier. In addition, the specific
libraries will allow identification of nucleic acids involved in
p53 responsiveness.
[0202] The present application is therefore also directed to the
establishment of differential screening libraries from pathological
samples, or pathological models, which vary in responsiveness to at
least one pharmacological agent. These libraries can be restricted,
complex or autologous libraries as defined supra. It is also
concerned with the spreading of these libraries upon filters or
support materials known to those skilled in the art
(nitrocellulose, nylon . . . ). In an advantageous manner, these
support materials may be chips which thus define pharmacogenomic
chips. The invention further relates to the potential exploitation
of sequencing data of different clones forming such libraries with
a view to elucidate the mechanisms which lead the pathological
samples to respond differently to various treatments, as well as to
the use of such libraries for conducting hybridization with probes
derived from biopsy tissue originating from pathological conditions
one wishes to predict the response to the standard treatment
initially used to define those libraries.
[0203] The present invention thus describes that variations in
splicing forms and/or patterns represent sources of pharmacogenomic
markers, i.e. sources of markers by which to determine the capacity
of and the manner in which a patient will respond to treatments. In
this respect, the invention is thus further directed to the use of
inter-individual variability in the isoforms generated by
alternative splicing (spliceosome analysis) as a source of
pharmacogenomic markers. The invention also concerns the use of
splicing modifications induced by treatments as a source of
pharmacogenomic markers. Thus, as explained hereinabove, the DATAS
methods of the invention make it possible to generate nucleic acids
representative of qualitative differences occurring between two
biological samples. Such nucleic acids, or derivatives thereof
(probes, primers, complementary acids, etc.) may be used to analyze
the spliceosome of subjects, with a view to demonstrating their
capacity and manner of responding to treatments, or their
predisposition to a given treatment/pathology, etc.
[0204] These various general examples illustrate the usefulness of
qualitative differential screening libraries in studies of
genotoxicity, genopharmacology and pharmacogenomics as well as in
research on potential diagnostic or therapeutic targets. Such
libraries are derived from cloning the qualitative differences
occurring between two pathophysiological situations. Since another
use of the cDNAs representative of these qualitative differences is
to generate probes designed to screen a genomic DNA library whose
characteristics are described hereinabove, such an approach may
also be implemented for any study of genotoxicity, genopharmacology
and pharmacogenomics as well as for gene identification. In
genotoxicity studies for instance, genomic clones statistically
restricted by the size of their insertions to a single intron or to
a single exon are arranged on filters according to their
hybridization with DATAS probes derived from qualitative
differential analysis between a reference cell or tissue sample and
the same cells or tissues treated by a reference toxic compound.
Once such clones representative of different classes of toxicity
are selected, they can then be hybridized with a probe derived from
total messenger RNAs of a same cell population or a same tissue
sample treated by a compound whose toxicity is to be assessed.
[0205] Other advantages and practical applications of the present
invention will become more apparent from the following examples
which are given for purposes of illustration and not by way of
limitation. The fields of application of the invention are shown in
FIG. 7.
LEGENDS TO FIGURES
[0206] FIG. 1. Schematic representation of differential screening
assays according to the invention (FIG. 1A) using one (FIG. 1B) or
two (FIG. 1C) hybridization procedures, and use of nucleic acids
(FIG. 1D).
[0207] FIG. 2. Schematic representation of the production of
RNA/DNA hybrids allowing characterization of single stranded RNA
sequences, specific markers of the pathological or healthy
state.
[0208] FIG. 3. Schematic representation of a method for isolating
and characterizing by sequencing single stranded RNA sequences
specific to a pathological or healthy condition.
[0209] FIG. 4. Schematic representation of another means for
characterizing by sequencing all or part of the single stranded
RNAs specific to a pathological or healthy condition.
[0210] FIG. 5. Schematic representation of the isolation of
alternatively spliced products based on R-loop structures.
[0211] FIG. 6. Schematic representation of qualitative differential
screening by loop restriction (formation of ds cDNA/cDNA
homoduplexes and extraction of data, FIG. 6A) and description of
the data obtained (FIG. 6B).
[0212] FIG. 7. Benefits of qualitative differential screening at
different stages of pharmaceutical research and development.
[0213] FIG. 8. Isolation of a differentially spliced domain in the
grb2/grb33 model. A) Production of synthetic grb2 and grb33 RNAs.
B) Description of the first steps of DATAS leading to
characterization of an RNA fragment corresponding to a
differentially spliced domain; 1: grb2 RNA, 2: Hybridization
between grb2 RNA and grb33 cDNA, 3: Hybridization between grb2 RNA
and grb2 cDNA, 4: Hybridization between grb2 RNA and water, 5:
Supernatant after passage of (2) on streptavidin beads, 6:
Supernatant after passage of (3) on streptavidin beads, 7:
Supernatant after passage of (4) on streptavidin beads, 8: RNase H
digestion of grb2 RNA/grb33 cDNA duplex, 9: RNase H digestion of
grb2 RNA/grb2 cDNA duplex, 10: RNase H digestion of grb2 RNA, 11:
same as (8) after passage on an exclusion column, 12: same as (9)
after passage on an exclusion column, 13: same as (10) after
passage on an exclusion column.
[0214] FIG. 9 . Representation of unpaired RNAs derived from RNase
H digestion of RNA/single stranded cDNA duplexes originating from
HepG2 cells treated or not by ethanol.
[0215] FIG. 10. Representation of double stranded cDNAs generated
by one of the DATAS variants. 1 to 12: PCR on RNA loop populations
derived from RNase H digestion, 13: PCR on total cDNA.
[0216] FIG. 11. Application of the DATAS variant involving double
stranded cDNA in the grb2/grb33 model. A) Agarose gel analysis of
the complexes following hybridization: 1: :double stranded grb2
cDNA/grb33 RNA, 2: double stranded grb2 cDNA/grb2 RNA, 3: double
stranded grb2 cDNA/water. B) Digestion of samples 1, 2 and 3 in (A)
by nuclease S1 and mung bean nuclease: 1 to 3: complexes 1 to 3
before glyoxal treatment; 4 to 6: complexes 1 to 3 after glyoxal
treatment; 7 to 9 Nuclease S1 digestion of 1 to 3; 10 to 12: Mung
bean nuclease digestion of 1 to 3.
[0217] FIG. 12. Application of the DATAS variant involving single
stranded cDNA and RNase H in a HepG2 cell system treated or not
with 0.1 M ethanol for 18 hours. Cloned inserts were transferred to
a membrane after agarose gel electrophoresis And hybridized with
probes corresponding to the treated (Tr) and untreated (NT)
conditions.
[0218] FIG. 13. Experimental procedure for assessing the toxicity
of a product.
[0219] FIG. 14. Experimental procedure for monitoring the efficacy
of a product.
[0220] FIG. 15. Experimental procedure for investigating the
sensitivity of a pathological condition to a treatment.
[0221] FIG. 16. Analysis of differential hybridization of clones
derived from DATAS using RNAs from induced cells and cDNAs from
non-induced cells. A) Use of bacterial colonies deposited and lysed
on a membrane. B) Southern blot on a selection of clones from
A.
[0222] FIG. 17. Nucleotide and peptide sequence of ASHC (SEQ ID NO:
9 and 10).
[0223] FIG. 18. Cytotoxicity and apoptosis tests on HepG2 cells
treated with A) ethanol; B) camptothecin; C) PMA.
[0224] FIG. 19. RT-PCR reactions using RNAs derived from HepG2
cells treated or not (NT) with ethanol (Eth.), camptothecin (Camp.)
and PMA (PMA) allowing amplification of the fragments corresponding
to MACH-a, BCL-X, FASR domains and using beta-actin as
normalization control.
[0225] In the examples and the description of the invention,
reference is made to sequences from the List of Sequences, which
contains the following free text:
[0226] <223> OLIGO
[0227] <223> OLIGO
[0228] <223> OLIGO
[0229] <223> OLIGO
[0230] <223> OLIGO
[0231] <223> OLIGO
[0232] <223> OLIGO
[0233] <223> OLIGO
[0234] <223> OLIGO
[0235] <223> OLIGO
[0236] <223> OLIGO
[0237] <223> OLIGO
EXAMPLES
[0238] 1. Differential Cloning of Alternative Splicings and Other
Qualitative Modifications in RNAS using Single Stranded cDNAs
[0239] Messenger RNAs corresponding to two conditions, one being
normal (mN) and the other being of a pathological origin (mP), are
isolated from biopsy samples or cultured cells. These messenger
RNAs are converted into complementary DNAs (cN) and (cP) by means
of reverse transcriptase (RT). mN/cP and cN/mP hybrids are then
prepared in a liquid phase (see the diagram of FIG. 2 illustrating
one of either cases leading to the formation of cN/mP).
[0240] These hybrids are advantageously prepared in phenol emulsion
(PERT technique or Phenol Emulsion DNA Reassociation Technique)
continuously subjected to thermocycling (Miller, R., D. and Riblet,
R., (1995), Nucleic Acids Research, 23 (12): 2339-2340). Typically,
this hybridization is executed using between 0.1 and 1 .mu.g of
polyA+ RNA and 0.1 to 2 .mu.g of complementary DNA in an emulsion
formed of an aqueous phase (120 mM sodium phosphate buffer, 2.5 M
NaCl, 10 mM EDTA) and an organic phase representing 8% of the
aqueous phase and formed of twice distilled phenol.
[0241] Another method is also advantageously employed to obtain the
heteroduplexes : after the reverse transcription reaction, the
newly synthesized cDNA is separated from the biotinylated oligodT
primer by exclusion chromatography. 0.1 to 2 .mu.g of this cDNA is
coprecipitated with 0.1 to 1 .mu.g of polyA+ RNA in the presence of
0.3 M sodium acetate and two volumes of ethanol. These
coprecipitated nucleic acids are taken up in 30 .mu.l of a
hybridization buffer composed of 80% formamide, 40 mM PIPES
(piperazinebis(2-ethanesulfonic acid)) pH 6.4, 0.4 M NaCl and 1 mM
EDTA.
[0242] The nucleic acids in solution are heat-denatured at
85.degree. C. for 10 min and hybridization is then carried out at
40.degree. C. for at least 16 h and up to 48 h.
[0243] The advantage of the formamide hybridization procedure is
that it provides more highly selective conditions for cDNA and RNA
strand pairing.
[0244] As a result of these two hybridization techniques there is
obtained an RNA/DNA heteroduplex the base pairing extent of which
depends on the ability of RT to synthesize the entire cDNA. Other
single stranded structures observed are RNA (and DNA) regions
corresponding to alternative splicings which distinguish the two
pathophysiological states under study.
[0245] The method is then aimed at characterizing the genetic
information borne by such splice loops.
[0246] To this end, the heteroduplexes are purified by capture of
cDNAs (primed with biotinylated oligo-dT) by means of
streptavidin-coated beads. Advantageously these beads are beads
having magnetic properties, allowing them to be separated from RNAs
not engaged in the heteroduplex structures by the action of a
magnetic separator. Such beads and such separators are commercially
available.
[0247] At this stage of the procedure are isolated heteroduplexes
and cDNAs not engaged in hybridization with RNAs. This material is
then subjected to the action of RNase H which will'selectively
hydrolyze regions of RNA hybridized with cDNAs.
[0248] The products of this hydrolysis are on the one hand cDNAs
and on the other hand, RNA fragments which correspond to splice
loops or non hybridized regions as a result of incomplete reverse
transcriptase reaction. The RNA fragments are separated from DNA by
magnetic separation according to the same experimental procedure as
set forth above and by digestion with DNase free of contaminating
RNase activity.
[0249] 1.1. Validation of the DATAS Method on Splicing Variants of
the Grb2 Gene
[0250] The feasibility of this approach was demonstrated in an in
vitro system using RNA corresponding to the coding region of Grb2
on the one hand and single stranded cDNA complementary to the
coding region of Grb3.3. The Grb2 gene has an open reading frame of
651 base pairs. Grb33 is an isoform of grb2 generated by
alternative splicing and comprising a deletion of 121 base pairs in
the SH2 functional domain of grb2 (Fath et al., (1994), Science
264: 971-4). Grb2 and Grb33 RNAs are synthesized by methods known
to those skilled in the art from a plasmid harboring the Grb2 or
Grb33 coding sequence driven by the T7 promoter by means of the
RiboMax kit (Promega). Analysis of the products shows that the
synthesis is homogeneous (FIG. 8A). For purposes of visualization,
Grb2 RNA was also radiolabeled by incorporation of a labeled base
during in vitro transcription by means of the RiboProbe kit
(Promega). Grb2 and Grb33 cDNAs were synthesized by reverse
transcription from the above-obtained synthetic RNA products, using
the Superscript II kit (Life Technologies) and a biotinylated
oligonucleotide primer common to Grb2 and Grb33 corresponding to
the complement of the Grb2 sequence (618-639). RNAs and cDNAs were
treated according to the suppliers' instructions (Promega, Life
Technologies), purified on an exclusion column (RNase-free Sephadex
G25 or G50, 5 Prime, 3 Prime) and quantified by
spectrophotometry.
[0251] The first steps of DATAS were executed by combining in
suspension 10 ng of labeled Grb2 RNA with:
[0252] 1. 100 ng of biotinylated grb33 cDNA,
[0253] 15 2. 100 ng of biotinylated grb2 cDNA,
[0254] 3. water
[0255] in 30 .mu.l of a hybridization buffer containing 80%
formamide, 40 mM PIPES (pH 6.4), 0.4 M NaCl, 1 mM EDTA. The nucleic
acids are denatured by heating for 10 min at 85.degree. C., after
which the hybridization is carried out for 16 hours at 40.degree.
C. After capture on streptavidin beads, the samples are treated
with RNase H as described hereinabove.
[0256] These steps are analyzed by electrophoresis on a 6%
acrylamide gel followed by processing of the gels with an Instant
Imager (Packard Instruments) which allows the qualification and
quantification of the species derived from labeled grb2 RNA (FIG.
8B). Thus, lanes 2, 3 and 4 show that grb2/grb33 and grb2/grb2
duplexes are formed quantitatively. Migration of the grb2/grb33
complex is slower relative to that of grb2 RNA (lane 2) while that
of the grb2/grb2 complex is faster (lane 3). Lanes 5, 6 and 7
correspond to samples not retained by the streptavidin beads
showing that 80% of grb2/grb33 and grb2/grb2 complexes were
captured by the beads whereas non-biotinylated grb2 RNA alone was
found solely in the bead supernatant. Treatment with RNase H
releases, in addition to free nucleotides which migrate faster than
bromophenol blue (BPB), a species that migrates below xylene cyanol
blue (XC) (indicated by an arrow in the figure) and this,
specifically in lane 8 corresponding to the grb2/grb33 complex
relative to lanes 9 and 10 which correspond to the grb2/grb2
complex and to grb2 RNA. Lanes 11, 12 and 13 correspond to lanes 8,
9 and 10 after passage of the samples through an exclusion column
to remove free nucleotides. The migration observed in lanes 8 and
11 is that expected for an RNA molecule corresponding to the
121-nucleotide deletion that distinguishes grb2 from grb33.
[0257] This result clearly shows that it is possible to obtain RNA
loops generated by the formation of heteroduplexes between two
sequences derived from two splicing isoforms.
[0258] 1.2. Application of the DATAS Method to Generate Qualitative
Libraries of Hepatic Cells in a Healthy and Toxic State
[0259] A more complex situation was examined. Within the scope of
the application of DATAS technology as a tool to predict the
toxicity of molecules, the human hepatocyte cell line HepG2 was
treated with 0.1 M ethanol for 18 hours. RNAs were extracted from
cells that were or were not subjected to treatment. The
aforementioned DATAS variant (preparation of biotinylated ss cDNA,
cross hybridizations in liquid phase, application of a magnetic
field to separate the species, RNase H digestion) was effected with
untreated cells in the reference condition (or condition A) and
with treated cells in the test condition (or condition B) (FIG. 9).
As the extracted RNAs were not radiolabeled, the RNAs generated by
RNase H digestion were visualized by carrying out an exchange
reaction to replace the RNA 5' phosphate with a labeled phosphate,
by means of T4 polynucleotide kinase and gamma-P.sup.32ATP. These
labeled products were then loaded on an acrylamide/urea gel and
analyzed by exposure using an Instant Imager (Packard Instruments).
Complex signatures derived from A/B and B/A hybridizations could
then be visualized with a first group of signals migrating slowly
in the gel and corresponding to large nucleic acid sequences and a
second group of signals migrating between 25 and 500 nucleotides.
These signatures are of much lower intensity in condition A/A,
suggesting that ethanol can induce a reprogramming of RNA splicing
events, manifested as the presence of A/B and B/A signals.
[0260] 1.3. Cloning and Preparation of Libraries from the
Identified Nucleic Acids
[0261] Several experimental alternatives may then be considered to
clone these RNA fragments resistant to the action of RNase H
[0262] A. A first approach consists in isolating and cloning such
loops (FIG. 3).
[0263] According to this approach, one proceeds with ligation of
oligonucleotides to each end by means of RNA ligase according to
conditions known in the art. These oligonucleotides are then used
as primers to effect RT PCR. The PCR products are cloned and
screened with total complementary DNA probes corresponding to the
two pathophysiological conditions of interest. Only those clones
preferentially hybridizing with one of either probes contain the
splice loops which are then sequenced and/or used to generate
libraries.
[0264] B. The second approach (FIG. 4) consists in carrying out a
reverse transcription reaction on single stranded RNA released from
the heteroduplex structures by RNase H digestion, initiated by
means of at least partly random primers. Thus, these may be primers
with random 3' and 5' sequences, primers with random 3' ends and
defined 5' sequences, or yet semi-random oligonucleotides, i.e.
comprising a region of degeneration and a defined region.
[0265] According to this strategy, the primers may therefore
hybridize either anywhere along the single stranded RNA, or at each
succession of bases determined by the choice of semi-random primer.
PCR is then run using primers corresponding to the above-described
oligonucleotides in order to obtain splice loop-derived
sequences.
[0266] FIG. 10 (lanes 1 to 12) presents the acrylamide gel analysis
of the PCR fragments obtained in several DATAS experiments and
coupled to the use of the following semi-random
oligonucleotides:
3 GAGAAGCGTTATNNNNNNNAGGT (SEQ ID NO: 1, X = T)
GAGAAGCGTTATNNNNNNNAGGA (SEQ ID NO: 1, X = A)
GAGAAGCGTTATNNNNNNNAGGC (SEQ ID NO: 1, X = C)
GAGAAGCGTTATNNNNNNNAGGG (SEQ ID NO: 1, X = G)
[0267] Comparing these results with the complexity of the signals
obtained using the same oligonucleotides, but with total cDNA as
the template (lane 13), demonstrates that DATAS makes it possible
to filter (profile) the information corresponding to qualitative
differences.
[0268] This variant was used to clone an event corresponding to the
grb2 RNA domain generated by RNase H digestion of the grb2
RNA/grb33 single stranded cDNA duplex according to the
above-described protocol (example 1.1). To do so, an
oligonucleotide with the sequence: GAGAAGCGTTATNNNNNNNNTCCC (SEQ ID
NO: 2), chosen from the model GAGAAGCGTTATNNNNNNNWXYZ (where N is
defined as above, W, X and Y each represent a defined fixed base,
and Z designates either a defined base, or a 3'-OH group, SEQ ID
NO: 3) and selected so as to amplify a fragment in the grb2
deletion, was used, allowing generation of a CR fragment which,
after cloning and sequencing, was shown to indeed be derived from
the grb2 deleted domain (194-281 in grb2).
[0269] These two approaches therefore allow the production of
nucleic acid compositions representative of the differential
splicings in both conditions being tested, which may be used as
probes or to construct qualitative differential cDNA libraries. The
capacity of DATAS technology to generated profiled cDNA libraries
representative of qualitative differences is further illustrated in
example 1.4 below.
[0270] 1.4. Production of Profiled Libraries Representative of
Human Endothelial Cells
[0271] This example was carried out using a human endothelial cell
line (ECV304). The qualitative analysis of gene expression was
achieved by using cystolic RNA extracted from growing cells, on the
one hand, and from cells in the process of anoikis (apoptosis
induced by removing the adhesion support), on the other hand.
[0272] ECV cells were grown in 199 medium supplemented with Earle
salts (Life Sciences). Anoikis was induced by passage for 4 hours
on polyHEMA-treated culture dishes. For RNA preparation, cells were
lysed in a buffer containing Nonidet P-40. Nuclei are then
eliminated by centrifugation. The cytoplasmic solution was then
adjusted so as to specifically fix the RNA to the Rneasy silica
matrix according to the instructions of the Quiagen company. After
washing, total RNA is eluted in DEPC-treated water. Messenger RNAs
are prepared from total RNAs by separation on Dynabeads oligo
(dT).sub.25 magnetic beads (Dynal). After suspending the beads in a
fixation buffer, total RNA is incubated for 5 min at room
temperature. After magnetic separation and washing, the beads are
taken up in elution buffer and incubated at 65.degree. C. to
release messenger RNAs.
[0273] The first DNA strand is synthesized from the messenger RNA
by means of SuperScript II or ThermoScript reverse transcriptase
(Life Technologies) and olido-(dT) primers. After RNase H
digestion, free nucleotides are eliminated by passage through a
Sephadex G50 (5 Prime-3 Prime) column. Following phenol/chloroform
extraction and ethanol precipitation, samples are quantified by UV
absorbance.
[0274] The required quantities of RNA and cDNA (in this case 200 ng
of each) are pooled and ethanol-precipitated. The samples are taken
up in a volume of 30 .mu.l in hybridization buffer (40 mM Hepes (pH
7.2), 400 mM NaCl, 1 mM EDTA) supplemented with deionized formamide
(80% (v/v), except if otherwise indicated). After denaturation for
5 min at 70.degree. C., samples are incubated overnight at
40.degree. C.
[0275] The streptavidin beads (Dynal) are washed then reconditioned
in fixation buffer (2.times.=10 mM Tris-HCl (pH 7.5), 2 M NaCl, 1
mM EDTA). The hybridization samples are diluted to a volume of 200
.mu.l with water, then adjusted to 200 .mu.l of beads and incubated
for 60 min at 30.degree. C. After magnetic capture and washing of
the beads, the latter are suspended in 150 .mu.l of RNase H buffer
then incubated for 20 min at 37.degree. C. After magnetic capture,
nonhybridized regions are released into the supernatant which is
treated with Dnase, then extracted with acidic phenol/chloroform
and ethanol-precipitated. Ethanol precipitations of small
quantities of nucleic acids are carried out using a commercial
polymer SeeDNA (Amersham Pharmacia Biotech) allowing quantitative
recovery of nucleic acids from very dilute solutions (in the ng/ml
range).
[0276] Synthesis of cDNA from the RNA samples derived from RNase H
digestion is carried out by means of random hexanucleotides and
Superscript II reverse transcriptase. The RNA is then digested with
a mixture of RNase H and RNase T1. The primer, the unincorporated
nucleotides and the enzymes are separated from the cDNA by means of
a GlassMAX Spin cartridge. The cDNA corresponding to splice loops
is then subjected to PCR using the semi-random oligonucleotides
described hereinabove in the invention. In this case the chosen
oligonucleotides are as follows
[0277] GAGAAGCGTTATNNNNNCCA (SEQ ID NO: 4)
[0278] The PCR reaction is effected using Taq Polymerase for 30
cycles:
[0279] Initial denaturation: 94.degree. C. for 1 min.
[0280] 94.degree. C. for 30 s
[0281] 55.degree. C. for 30 s
[0282] 72.degree. C. for 30 s
[0283] Final elongation: 72.degree. C. for 5 min.
[0284] The PCR products are cloned into the pGEM-T vector (Promega)
with a floating T at the 3' ends so as to simplify cloning of the
fragments derived from the activity of Taq polymerase. After
transformation in competent JM109 bacteria (Promega), the resulting
colonies are transferred to nitrocellulose filters, and hybridized
with probes derived from the products of PCR carried out on total
cDNA from growing cells on the one hand and in anoikis on the other
hand. The same oligonucleotides GAGAAGCGTTATNNNNNCCA are used for
these PCR reactions. In a first experimental embodiment, 34 clones
preferentially hybridizing with the probe from cells in apoptosis
and 13 clones preferentially hybridizing with the probe from
growing cells were isolated.
[0285] Among these 13 clones, 3 clones contain the same cDNA
fragment derived from the SH2 domain of the SHC protein.
[0286] This fragment has the following sequence:
4 CCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGA (SEQ ID NO: 5)
GTGGGCAGCCAGCCTAAGCATTTGCACTGG
[0287] The use of PCR primers flanking the SHC SH2 domain (5'
oligo: GGGACCTGTTTGACATGAAGCCC (SEQ ID NO:6); 3' oligo:
CAGTTTCCGCTCCACAGGTTGC (SEQ ID NO:7)) allowed characterization of
the SHC SH2 domain deletion which is specifically observed in ECV
cells in anoikis. With this primer pair, a single amplification
product corresponding to a 382 base pair cDNA fragment which
contains the intact SH2 domain is obtained from RNA from
exponentially growing ECV cells. A further 287 base pair fragment
is observed when the PCR is carried out with RNA from cells in
anoikis. This additional fragment derives from a messenger RNA
derived from the SCH messenger but with a deletion.
[0288] This deletion has the following sequence:
5 GTACGGGAGAGCACGACCACACCTGGCCAGTATGTG (SEQ ID NO: 8)
CTCACTGGCTTGCAGAGTGGGCAGCCTAAGCATTTG CTACTGGTGGACCCTGAGGGTGTG.
[0289] This deletion corresponds to bases 1198 to 1293 of the
messenger open reading frame encoding the 52 kDa and 46 kDa forms
of the SHC protein (Pelicci, G. et al., (1992), Cell, 70:
93-104).
[0290] Structural data on the SH2 domains together with the
literature indicate that such a deletion leads to the loss of
affinity for phosphotyrosines since it encompasses the amino acids
involved in interactions with phosphorylated tyrosines (Waksman, G.
et al., (1992), Nature, 358: 646-653). As SHC proteins are adaptors
which link different partners via their SH2 and PTB domains
(PhosphoTyrosine Binding domain), this deletion therefore generates
a native negative dominant form of SHC which we call .DELTA.SHC As
the SH2 domains of proteins for which the genes have been sequenced
are carried on two exons, it is likely that the deletion identified
by DATAS corresponds to an alternative exon of the SHC gene.
[0291] The protein and nucleic acid sequences of .DELTA.SHC are
given in FIG. 17 (SEQ ID NO: 9 and 10).
[0292] As the SHC SH2 domain is involved in the transduction of
numerous signals involved in cell proliferation and viability,
examination of the .DELTA.SHC sequence makes it possible to predict
its negative dominant properties on the SHC protein and its
capacity to interfere with various cellular signals.
[0293] The invention equally concerns this new spliced form of SHC,
the protein domain corresponding to the splicing, any antibody or
nucleic acid probe allowing its detection in a biological sample,
and their use for diagnostic or therapeutic purposes, for
example.
[0294] The invention particularly concerns any SHC variant
comprising at least one deletion corresponding to bases 1198 to
1293, more particularly a deletion of sequence SEQ ID NO: 8. The
invention more specifically concerns the .DELTA.SHC variant
possessing the sequence SEQ ID NO: 9, coded by the sequence SEQ ID
NO: 10.
[0295] The invention therefore concerns any nucleic acid probe,
oligonucleotide or antibody by which to identify the hereinabove
.DELTA.SHC variant, and/or any alteration of the SHC/.DELTA.SHC
ratio in a biological sample. This may notably be a probe or
oligonucleotide complementary to all or part of the sequence SEQ ID
NO: 8, or an antibody directed against the protein domain encoded
by this sequence. Such probes, oligonucleotides or antibodies make
it possible to detect the presence of the nonspliced form (eg.,
SHC) in a biological sample.
[0296] The materials may further be used in parallel with the
probes, oligonucleotides and/or antibodies specific of the spliced
form (eg., .DELTA.SHC), i.e. corresponding for example to the
junction region resulting from splicing (located around nucleotide
1198 in sequence SEQ ID NO: 10).
[0297] Such materials may be used for the diagnosis of diseases
related to immune suppression (cancer, immunosuppressive therapy,
AIDS, etc.).
[0298] The invention also concerns any screening method for
molecules based on blocking (i) the spliced domain in the SHC
protein (especially in order to induce a state of immune tolerance
for example in autoimmune diseases or graft rejection and cancer)
or (ii) the added functions acquired by the .DELTA.SHC protein.
[0299] The invention is further directed to the therapeutic use of
.DELTA.SHC, and notably to the treatment of cancerous cells or
cancers (ex vivo or in vivo) in which SHC protein
hyperphosphorylation can be demonstrated, for example. In this
respect, the invention therefore concerns any vector, notably a
viral vector, comprising a sequence coding for .DELTA.SHC. This
vector is preferably capable of transfecting cancerous or growing
cells, such as smooth muscle cells, endothelial cells (restenosis),
fibroblasts (fibrosis), preferably of mammalian, notably human,
origin. Viral vectors may be exemplified in particular by
adenoviral, retroviral, AAV, herpes vectors, etc.
[0300] 2. Differential Cloning of Alternative Splicing and Other
Qualitative Modifications of RNA Using Double Stranded cDNA (FIG.
5).
[0301] Messenger RNAs corresponding to normal (mN) and pathological
(mP) conditions are produced, as well as corresponding double
stranded complementary DNAs (dsN and dsP) by standard molecular
biology procedures. R-loop structures are then obtained by
hybridizing mN with dsP and mP with dsN in a solution containing
70% formamide. Differentially spliced nucleic acid domains between
conditions N and P will remain in the form of double stranded DNA.
Displaced single stranded DNAs are then treated with glyoxal to
avoid further displacement of the RNA strand upon removal of
formamide. After removal of formamide and glyoxal and treatment
with RNase H, there are obtained bee-type structures, the unpaired
single stranded DNAs being representative of the bee wings and the
paired double stranded domain of interest being reminiscent of the
bee's body. The use of enzymes which specifically digest single
stranded DNA such as nuclease Si or mung bean nuclease allows the
isolation of DNA that has remained in double stranded form, which
is next cloned and sequenced. This second technique allows for
direct formation of a double stranded DNA fingerprint of the domain
of interest, when compared to the first procedure which yields an
RNA fingerprint of this domain.
[0302] This approach was carried out on the grb2/grb33 model
described above. Grb2 double stranded DNA was produced by PCR
amplification of grb2 single stranded cDNA using two. nucleotide
primers corresponding to the sequence (1-22) of grb2 and to the
complementary sequence (618-639) of grb2. This PCR fragment was
purified on an agarose gel, cleaned on an affinity column
(JetQuick, Genomed) and quantified by spectrophotometry. At the
same time, two synthetic RNAs corresponding to the grb2 and grb33
reading frames were produced from plasmid vectors harboring grb2 or
grb33 cDNAs under the control of the T7 promoter, by means of the
RiboMax kit (Promega). The RNAs were purified as instructed by the
supplier and cleaned on an exclusion column (Sephadex G50, 5
prime-3 prime). 600 ng of double stranded grb2 DNA (1-639) were
combined with:
[0303] 1. 3 .mu.g of grb33RNA
[0304] 2. 3 .mu.g of grb2 RNA
[0305] 3. water
[0306] in three separate reactions, in the following buffer:
[0307] 100 mM PIPES (pH 7.2), 35 mM NaCl, 10 mM EDTA, 70% deionized
formamide (Sigma).
[0308] The samples were heated to 56.degree. C., then cooled to
44.degree. C. by -0.2.degree. C. increments every 10 minutes. They
are then stored at 4.degree. C. Analysis of the agarose gel reveals
the altered migration patterns of lanes 1 and 2 as compared with
the control lane 3 (FIG. 11A), indicating that new complexes were
formed. Samples are then treated with deionized glyoxal (Sigma) (5%
v/v or 1 M) for 2 h at 12.degree. C. The complexes are then
precipitated with ethanol (0.1 M NaCl, 2 volumes of ethanol),
washed with 70% ethanol, dried, then resuspended in water. They are
next treated by RNase H (Life Technologies), then by an enzyme
specific for single stranded DNA. Nuclease S1 and mung bean
nuclease have such a property and are commercially available (Life
Technologies, Amersham). Such digestions (incubations for 5 minutes
in the buffers supplied with the enzymes) were analyzed on agarose
gels (FIG. 11B). Significant digest products were obtained only
from the complexes derived from reaction 1 (grb2/tgrb33) (FIG. 11B,
lanes 7 and 10). These digestions appear more complete with
nuclease S1 (lane 7) than with mung bean nuclease (lane. 10). Thus,
the band corresponding to a size slightly greater than 100 base
pairs (indicated by an arrow on lane 7) was purified, cloned into
the pMos-Blue vector (Amersham) and sequenced. This fragment
corresponds to the 120 base pair domain of grb2 which is deleted in
grb33.
[0309] This approach may now be implemented starting with a total
messenger RNA population and a total double stranded cDNA
population produced according to methods known to those skilled in
the art. RNAs corresponding to the reference condition are
hybridized with double stranded cDNAs derived from the test
condition and vice versa. After application of the hereinabove
protocol, the digests are loaded on agarose gels so as to isolate
and purify the bands corresponding to sizes ranging from 50 to 300
base pairs. Such bands are then cloned in a vector (pMos-Blue,
Amersham) to generate a library of inserts enriched in qualitative
differential events.
[0310] 3. Construction of Libraries Derived From Qualitative
Differential Screening
[0311] The two examples described hereinabove lead to the cloning
of cDNAs representative of all or part of differentially spliced
sequences occurring between two given pathophysiological
conditions. These cDNAs allow the construction of libraries by
insertion of such cDNAs into plasmid or phage vectors. These
libraries may be deposited on nitrocellulose filters or any other
support material known in the art, such as chips or biochips or
membranes. The aforementioned libraries may be stored in a cold
place, away from light. These libraries, once deposited and fixed
on support materials by conventional techniques, may be treated by
compounds to eliminate the host bacteria which allowed the
replication of the plasmids or phages. These libraries may also be
advantageously composed of cDNA fragments corresponding to cloned
cDNAs but prepared by PCR so as to deposit on the filter only those
sequences derived from alternative splicing events.
[0312] One of the features as well as one of the original
characteristics of qualitative differential screening is that this
method advantageously leads to not only one but two differential
libraries ("library pair") which represent the whole array of
qualitative differences occurring between two given conditions. In
particular, one of the differential splicing libraries of the
invention represents the unique qualitative markers of the test
physiological condition as compared to the reference physiological
condition, while the other library represents the unique
qualitative markers of the reference physiological condition in
relation to the test physiological condition. This couple of
libraries is equally termed a library pair or "differential
splicing library".
[0313] As one of the benefits of qualitative differential screening
is that it makes it. possible to assess the toxicity of a compound,
as will be set forth in the next section, a good example of the
implementation of the technology is the use of DATAS to obtain cDNA
clones corresponding to sequences specific of untreated HepG2
cells, on the one hand, and ethanol-treated cells, on the other
hand. The latter cells exhibit signs of cytotoxicity and DNA
degradation via internucleosomal fragmentation starting from 18
hours of exposure to 1 M ethanol. In order to obtain early markers
of ethanol toxicity, messenger RNAs were prepared from untreated
cells and from cells treated with 0.1 M ethanol for 18 h. After
execution of the DATAS variant which makes use of single stranded
cDNA and RNase H, the resulting cloned cDNAs were amplified by PCR,
electrophoresed on agarose gels and then transferred to a nylon
filter according to techniques known to those skilled in the art.
For each set of clones specific on the one hand of specific
qualitative differences of the untreated state and on the other
hand of sequences specific of ethanol-treated cells, two identical
filter duplicates are prepared. Thus the fingerprints of each set
of clones are hybridized on the one hand with a probe specific to
untreated cells and on the other hand with a probe specific to
cells treated with 0.1 M ethanol for 18 h.
[0314] The differential hybridization profile obtained and shown in
FIG. 12 makes it possible to appreciate the quality of the
subtraction afforded by the DATAS technique. Thus the clones
derived from hybridization of mRNA from untreated cells (NT) with
cDNA from treated cells (Tr) and which should correspond to
qualitative differences specific of the untreated condition,
hybridize preferentially with a probe representing the total
messenger RNA population of untreated cells. Conversely, clones
derived from products resistant to the action of RNase H on
RNA(Tr)/cDNA(NT) heteroduplexes hybridize preferentially with a
probe derived from total messenger RNAs from treated cells.
[0315] The two sets of clones specific on the one hand to the
treated condition and on the other hand to the untreated condition
represent an example of qualitative differential libraries
characteristic of two distinct cell states.
[0316] 4. Uses and Benefits of Qualitative Differential
Libraries.
[0317] The potential applications of the differential splicing
libraries of the invention are illustrated notably in FIGS. 13 to
15. Thus, these libraries are useful for:
[0318] 4.1. Evaluating the Toxicity of a Compound (FIG. 13):
[0319] In this example, the reference condition is designated A and
the toxic condition is designated B. Toxicity abacus charts are
obtained by treating condition A in the presence of various
concentrations of a reference toxic compound, for different periods
of time. For different dots of toxicity abacus charts, qualitative
differential libraries are constructed (library pairs), namely in
this example, restricted libraries rA/cB and rB/cA. The library
pairs are advantageously deposited on a support. The support is
then hybridized with probes derived from the original biological
sample treated with different doses of test compounds : products X,
Y and Z. The hybridization reaction is developed in order to
determine the toxicity potential of the test products : in this
example, product Z is highly toxic and product Y shows an
intermediate profile. The feasibility of constructing toxicity
abacus charts is clearly illustrated in the aforementioned example
regarding the construction of qualitative differential screening
libraries involving ethanol treatment and HepG2 cells.
[0320] 4.2. Assessing the Potency of a Pharmaceutical Composition
(FIG. 14):
[0321] In this example, a restricted library pair according to the
invention is constructed starting with a pathological model B and a
healthy model A (or a pathological model treated with a reference
active product). The differential libraries rA/cB and rB/cA are
optionally deposited on a support. This library pair is fully
representative of the differences in splicing which occur between
both conditions. This library pair allows the efficacy of a test
compound to be assessed, i.e. to determine its capacity to generate
a "healthy-like" profile (rA/cB) starting from a pathological-type
profile (rB/cA). In this example, the library pair is hybridized
with probes prepared from conditions A and B either treated or not
by the test compound. The hybridization profile that can be
obtained is shown in FIG. 14. The feasibility of this application
is identical to that of the aforementioned construction of
qualitative differential libraries characteristic of healthy and
toxic conditions. The toxic condition is replaced by the
pathological condition and one assesses the capacity of a test
compound to produce a probe hybridizing more or less preferentially
with the reference or pathological conditions.
[0322] 4.3. Predicting the Response of a Pathological Sample to a
Treatment (FIG. 15):
[0323] In this example, a restricted library pair according to the
invention is constructed starting with two pathological models, one
of which is responsive to treatment with a given product (the wild
type p53 gene for example): condition A; while the other being
unresponsive: condition B. This library pair (rA/cB; rB/cA) is
deposited on a support.
[0324] This library pair is then used to determine the sensitivity
of a pathological test sample to the same product. For that
purpose, this library pair is hybridized with probes derived from
patients' biopsy tissues one wishes to evaluate the response to the
reference treatment. The hybridization profile of a responsive
biopsy sample and of an unresponsive biopsy sample is presented in
FIG. 15.
[0325] 4.4 Identification of Ligands for Orphan Receptors
[0326] The activation of membrane or nuclear receptors by their
ligands can specifically induce regulation defects in the splicing
of certain RNAs. Identification of these events by the DATAS
methods of the invention provides a tool (markers, libraries, kits,
etc.) by which to monitor receptor activation, which can be used to
search for natural or synthetic ligands for receptors, especially
orphan receptors. According to this application, markers associated
with regulation defects are identified and deposited on supports.
Total cellular RNA, (over)expressing the receptor under study,
treated or not by different compositions and/or test compounds, is
extracted and used as probe in a hybridization reaction with the
supports. Detection of hybridization with some or even all of the
markers deposited on the support, indicates that the receptor of
interest was activated, and therefore that the corresponding
composition/compound constitutes or contains the ligand of said
receptor.
[0327] 4.5 Identification of Targets of Therapeutic Interest:
[0328] This is accomplished by identifying genes the splicing of
which is altered in a pathology or in a pathological model and more
specifically by identifying the modified exons or introns. This
approach should make it possible to determine the sequences which
code for functional domains that are altered in pathologies or in
any pathophysiological process involving the phenomena of growth,
differentiation or apoptosis for example.
[0329] An example of the benefit of qualitative differential
screening for identifying differentially spliced genes is provided
by the application of DATAS to a model of apoptosis induction via
induction of wild type p53 expression. This cellular model was
established by transfecting an inducible p53 tumor suppressor gene
expression system. In order to identify qualitative differences
which are specifically associated with p53-induced apoptosis, DATAS
was implemented starting with messenger RNAs derived from induced
and non-induced cells. For these experiments 200 ng of polyA+ RNA
and 200 ng of cDNA were used for heteroduplex formation. About 100
clones were obtained from each cross hybridization. Hybridization
of these bacterial clones, then of the cDNA fragments they contain,
with probes representative of total messenger RNAs from the
original conditions allowed identification of sequences
specifically expressed during the potent p53 induction which leads
to cell death (FIG. 16).
[0330] These fragments derive from exon or intron sequences which
modulate the quality of the message present and qualify the
functional domains in which they participate or which they
interrupt, as targets for treatment to induce or to inhibit cell
death.
[0331] Such an approach equally leads to the construction of a
library pair comprising all the differential splicing events
between a non-apoptotic condition and an apoptotic condition. This
library pair may be used to test the hybridizing capacity of a
probe derived from another pathophysiological condition or a given
treatment.
[0332] The results of such a hybridization will give an indication
as to the potential commitment of the gene expression program of
the test condition towards apoptosis.
[0333] As is apparent from the above description, the invention is
further concerned with:
[0334] any nucleic acid probe, any oligonucleotide, any antibody
which recognizes a sequence identified by the method described in
the present application and characterized in that they are
characteristic of a pathological condition,
[0335] the use of information derived from applying the techniques
disclosed herein for the search of organic molecules for
therapeutic purposes by devising screening assays characterized in
that they target differentially spliced domains occurring between a
healthy and a pathological condition or else characterized in that
they are based on the inhibition of functions acquired by the
protein as a result of differential splicing,
[0336] the utilization of the information derived from the methods
described in the present application for gene therapy
applications,
[0337] the use of cDNAs delivered by gene therapy, wherein said
cDNAs behave as antagonists or agonists of defined cell signal
transduction pathways,
[0338] any construction or any use of molecular libraries of
alternative exons or introns for purposes of:
[0339] commercial production of diagnostic means or reagents for
research purposes
[0340] generation or search of molecules, polypeptides, nucleic
acids for therapeutical applications.
[0341] any construction or any use of all computerized virtual
libraries containing an array of alternative exons or introns
characterized in that said libraries allow the design of nucleic
acid probes or oligonucleotide primers in order to characterize
alternative splicing forms which distinguish two different
pathophysiological conditions.
[0342] any pharmaceutical or diagnostic composition comprising
polypeptides, sense or antisense nucleic acids or chemical
compounds capable of interfering with alternative splicing products
identified and cloned by the methods of the invention,
[0343] any pharmaceutical or diagnostic composition comprising
polypeptides, sense or antisense nucleic acids, or chemical
compounds capable of restoring a splicing pattern representative of
a normal condition in contrast to an alternative splicing event
inherent to a pathological condition.
[0344] 5. Deregulations of RNA Splicing Mechanisms by Toxic
Compounds
[0345] This example shows that differential splicing forms and/or
profiles may be used as markers to monitor and/or determine the
toxicity and/or the efficacy of compounds.
[0346] The effects of toxic compounds on RNA splicing regulation
defects were tested as follows. HepG2 hepatocyte cells were treated
with different doses of three toxic compounds (ethanol,
camptothecin, PMA (phorbol 12-myristate 13-acetate)). Two
cytotoxicity tests (trypan blue, MTT) were performed at different
time points: 4 h and 18 h for ethanol; 4 h and 18 h for
camptothecin; 18 h and 40 h for PMA.
[0347] Trypan blue is a dye that can be incorporated by living
cells. Simple counting of "blue" and "white" cells under a
microscope gives the percentage of living cells after treatment or
the percentage of survival. The experimental points are determined
in triplicate.
[0348] The MTT test is a calorimetric test measuring the capacity
of living cells to convert soluble tetrazolium salts (MTT) into an
insoluble formazan precipitate. These dark blue formazan crystals
can be dissolved and their concentration determined by measuring
absorbance at 550 nm. Thus, after overnight seeding of 24-well
dishes with 150,000 cells, followed by treatment of the cells with
the toxic compounds, 50 .mu.l of MTT (Sigma) are added (at a
concentration of 5 mg/ml in PBS). The formazan crystal formation
reaction is carried out for 5 h in a CO2 incubator (37.degree. C.,
5% CO2, 95% humidity). After addition of 500 .mu.l of
solubilization solution (0.1 N HCl in isopropanol-Triton X-100
(10%)), the crystals are dissolved with stirring and their
absorbance is measured at 550 to 660 nm. Determinations re done in
triplicate with suitable controls (viability, cell death,
blanks).
[0349] A test of apoptosis or programmed cell death was also
performed by measuring DNA fragmentation with an anti-histone
antibody and ELISA. The Cell Death ELISA Plus from Roche was
used.
[0350] The results of these three tests (FIGS. 18 A, B, C) indicate
that the following concentrations
[0351] ethanol: 0.1 M
[0352] camptothecin: 1 .mu.g/ml
[0353] PMA: 50 ng/ml
[0354] were well below the measured IC50 values.
[0355] HepG2 cells were thus treated with these three
concentrations of these three compounds for 4 h in the case of
ethanol and camptothecin and for 18 h in the case of PMA. Messenger
RNAs were purified on Dynal-Oligo-(dT). beads starting from total
RNAs purified with the Rneasy kit (Quiagen). cDNA was synthesized
from these messenger RNAs using Superscript reverse transcriptase
(Life Technologies) and random hexamers as primers
[0356] These initial strands served as templates for PCR
amplification reactions (94.degree. C. 1 min, 55.degree. C. 1 min,
72.degree. C. 1 min, 30 cycles) by means of the following
oligonucleotide primers:
[0357] MACH-.alpha.:
6 5'-TGCCCAAATCAACAAGAGC-3' (SEQ ID NO: 11)
5'-CCCCTGACAAGCCTGAATA-3' (SEQ ID NO: 12)
[0358] These primers correspond to the regions common to the
different described isoforms of MACH-.alpha. (1, 2 and 3,
respectively amplifying 595, 550 and 343 base pairs). MACH-.alpha.
(Caspase-8) is a protease involved in programmed cell death (Boldin
et al., (1996), Cell, 85: 803-815).
[0359] BCL-X:
7 5' ATGTCTCAGAGCAACCGGGAGCTG 3' (SEQ ID NO: 13) 5'
GTGGCTCCATTCACCGCGGGGCTG 3' (SEQ ID NO: 14)
[0360] These primers correspond to the regions common to the
different described isoforms of bcl-X (bcl-XI, bcl-Xs, BCL-X.beta.)
(Boise et al., (1993), Cell 74: 597-608; U72398 (Genbank)) and
should amplify a single 204 base pair fragment for these three
isoforms.
[0361] FASR:
8 5'-TGCCAAGAAGGGAAGGAGT-3' (SEQ ID NO: 15)
5'-TGTCATGACTCCAGCAATAG-3' (SEQ ID NO: 16)
[0362] These primers correspond to the regions common to certain
FASR isoforms and should amplify a 478 base pair fragment for wild
type form FasR, 452 base pairs for isoform A8 and 415 for isoform
.DELTA.TM.
[0363] The results presented in FIG. 19 indicate that:
[0364] Camptothecin induces a decrease in the expression of isoform
MACH-.alpha.1 and an increase in isoform MACH-.alpha.3.
[0365] Camptothecin induces the appearance of a new bcl-X isoform
(upper band in the doublet near 200 base pairs).
[0366] Camptothecin induces a decrease in the wild type form of the
fas receptor, replaced by expression of a shorter isoform which may
correspond to Fas .DELTA.TM.
[0367] Ethanol induces the disappearance of bcl-x which is replaced
by a shorter isoform.
[0368] Ethanol induces an increase in the long wild type form of
the fas receptor at the expense of the shorter isoform.
[0369] These results demonstrate that treatment with low
concentrations of toxic compounds can induce regulation defects in
the alternative splicings of certain RNAs, and this in a specific
manner. The identification of these regulation defects at the
post-transcriptional level, notably by application of DATAS
technology, thus constitutes a tool to predict the toxicity of
molecules.
Sequence CWU 1
1
16 1 23 DNA Artificial Sequence Synthetic 1 gagaagcgtt atnnnnnnna
ggn 23 2 24 DNA Artificial Sequence Synthetic 2 gagaagcgtt
atnnnnnnnn tccc 24 3 23 DNA Artificial Sequence Synthetic 3
gagaagcgtt atnnnnnnnn nnn 23 4 20 DNA Artificial Sequence Synthetic
4 gagaagcgtt atnnnnncca 20 5 66 DNA Artificial Sequence Synthetic 5
ccacacctgg ccagtatgtg ctcactggct tgcagagtgg gcagccagcc taagcatttg
60 cactgg 66 6 23 DNA Artificial Sequence Synthetic 6 gggacctgtt
tgacatgaag ccc 23 7 22 DNA Artificial Sequence Synthetic 7
cagtttccgc tccacaggtt gc 22 8 96 DNA Artificial Sequence Synthetic
8 gtacgggaga gcacgaccac acctggccag tatgtgctca ctggcttgca gagtgggcag
60 cctaagcatt tgctactggt ggaccctgag ggtgtg 96 9 441 PRT Artificial
Sequence Synthetic 9 Met Asn Lys Leu Ser Gly Gly Gly Gly Arg Arg
Thr Arg Val Glu Gly 1 5 10 15 Gly Gln Leu Gly Gly Glu Glu Trp Thr
Arg His Gly Ser Phe Val Asn 20 25 30 Lys Pro Thr Arg Gly Trp Leu
His Pro Asn Asp Lys Val Met Gly Pro 35 40 45 Gly Val Ser Tyr Leu
Val Arg Tyr Met Gly Cys Val Glu Val Leu Gln 50 55 60 Ser Met Arg
Ala Leu Asp Phe Asn Thr Arg Thr Gln Val Thr Arg Glu 65 70 75 80 Ala
Ile Ser Leu Val Cys Glu Ala Val Pro Gly Ala Lys Gly Ala Thr 85 90
95 Arg Arg Arg Lys Pro Cys Ser Arg Pro Leu Ser Ser Ile Leu Gly Arg
100 105 110 Ser Asn Leu Lys Phe Ala Gly Met Pro Ile Thr Leu Thr Val
Ser Thr 115 120 125 Ser Ser Leu Asn Leu Met Ala Ala Asp Cys Lys Gln
Ile Ile Ala Asn 130 135 140 His His Met Gln Ser Ile Ser Phe Ala Ser
Gly Gly Asp Pro Asp Thr 145 150 155 160 Ala Glu Tyr Val Ala Tyr Val
Ala Lys Asp Pro Val Asn Gln Arg Ala 165 170 175 Cys His Ile Leu Glu
Cys Pro Glu Gly Leu Ala Gln Asp Val Ile Ser 180 185 190 Thr Ile Gly
Gln Ala Phe Glu Leu Arg Phe Lys Gln Tyr Leu Arg Asn 195 200 205 Pro
Pro Lys Leu Val Thr Pro His Asp Arg Met Ala Gly Phe Asp Gly 210 215
220 Ser Ala Trp Asp Glu Glu Glu Glu Glu Pro Pro Asp His Gln Tyr Tyr
225 230 235 240 Asn Asp Phe Pro Gly Lys Glu Pro Pro Leu Gly Gly Val
Val Asp Met 245 250 255 Arg Leu Arg Glu Gly Ala Ala Pro Gly Ala Ala
Arg Pro Thr Ala Pro 260 265 270 Asn Ala Gln Thr Pro Ser His Leu Gly
Ala Thr Leu Pro Val Gly Gln 275 280 285 Pro Val Gly Gly Asp Pro Glu
Val Arg Lys Gln Met Pro Pro Pro Pro 290 295 300 Pro Cys Pro Gly Arg
Glu Leu Phe Asp Asp Pro Ser Tyr Val Asn Val 305 310 315 320 Gln Asn
Leu Asp Lys Ala Arg Gln Ala Val Gly Gly Ala Gly Pro Pro 325 330 335
Asn Pro Ala Ile Asn Gly Ser Ala Pro Arg Asp Leu Phe Asp Met Lys 340
345 350 Pro Phe Glu Asp Ala Leu Arg Val Pro Pro Pro Pro Gln Ser Val
Ser 355 360 365 Met Ala Glu Gln Leu Arg Gly Glu Pro Trp Phe His Gly
Lys Leu Ser 370 375 380 Arg Arg Glu Ala Glu Ala Leu Leu Gln Leu Asn
Gly Asp Phe Leu Val 385 390 395 400 Arg Thr Lys Asp His Arg Phe Glu
Ser Val Ser His Leu Ile Ser Tyr 405 410 415 His Met Asp Asn His Leu
Pro Ile Ile Ser Ala Gly Ser Glu Leu Cys 420 425 430 Leu Gln Gln Pro
Val Glu Arg Lys Leu 435 440 10 1326 DNA Artificial Sequence
Synthetic 10 atgaacaagc tgagtggagg cggcgggcgc aggactcggg tggaaggggg
ccagcttggg 60 ggcgaggagt ggacccgcca cgggagcttt gtcaataagc
ccacgcgggg ctggctgcat 120 cccaacgaca aagtcatggg acccggggtt
tcctacttgg ttcggtacat gggttgtgtg 180 gaggtcctcc agtcaatgcg
tgccctggac ttcaacaccc ggactcaggt caccagggag 240 gccatcagtc
tggtgtgtga ggctgtgccg ggtgctaagg gggcgacaag gaggagaaag 300
ccctgtagcc gcccgctcag ctctatcctg gggaggagta acctgaaatt tgctggaatg
360 ccaatcactc tcaccgtctc caccagcagc ctcaacctca tggccgcaga
ctgcaaacag 420 atcatcgcca accaccacat gcaatctatc tcatttgcat
ccggcgggga tccggacaca 480 gccgagtatg tcgcctatgt tgccaaagac
cctgtgaatc agagagcctg ccacattctg 540 gagtgtcccg aagggcttgc
ccaggatgtc atcagcacca ttggccaggc cttcgagttg 600 cgcttcaaac
aatacctcag gaacccaccc aaactggtca cccctcatga caggatggct 660
ggctttgatg gctcagcatg ggatgaggag gaggaagagc cacctgacca tcagtactat
720 aatgacttcc cggggaagga accccccttg gggggggtgg tagacatgag
gcttcgggaa 780 ggagccgctc caggggctgc tcgacccact gcacccaatg
cccagacccc cagccacttg 840 ggagctacat tgcctgtagg acagcctgtt
gggggagatc cagaagtccg caaacagatg 900 ccacctccac caccctgtcc
aggcagagag ctttttgatg atccctccta tgtcaacgtg 960 cagaacctag
acaaggcccg gcaagcagtg ggtggtgctg ggccccccaa tcctgctatc 1020
aatggcagtg caccccggga cctgtttgac atgaagccct tcgaagatgc tcttcgggtg
1080 cctccacctc cccagtcggt gtccatggct gagcagctcc gaggggagcc
ctggttccat 1140 gggaagctga gccggcggga ggctgaggca ctgctgcagc
tcaatgggga cttcttggtt 1200 cggactaagg atcaccgctt tgaaagtgtc
agtcacctta tcagctacca catggacaat 1260 cacttgccca tcatctctgc
gggcagcgaa ctgtgtctac agcaacctgt ggagcggaaa 1320 ctgtga 1326 11 19
DNA Artificial Sequence Synthetic 11 tgcccaaatc aacaagagc 19 12 19
DNA Artificial Sequence Synthetic 12 cccctgacaa gcctgaata 19 13 24
DNA Artificial Sequence Synthetic 13 atgtctcaga gcaaccggga gctg 24
14 24 DNA Artificial Sequence Synthetic 14 gtggctccat tcaccgcggg
gctg 24 15 19 DNA Artificial Sequence Synthetic 15 tgccaagaag
ggaaggagt 19 16 20 DNA Artificial Sequence Synthetic 16 tgtcatgact
ccagcaatag 20
* * * * *