U.S. patent application number 10/735174 was filed with the patent office on 2004-09-30 for assays using crosslinkable immobilized nucleic acids.
Invention is credited to Albagli, David, Cheng, Peter C., Huan, Bingfang, Van Atta, Reuel B., Wood, Michael L..
Application Number | 20040191806 10/735174 |
Document ID | / |
Family ID | 22480896 |
Filed Date | 2004-09-30 |
United States Patent
Application |
20040191806 |
Kind Code |
A1 |
Huan, Bingfang ; et
al. |
September 30, 2004 |
Assays using crosslinkable immobilized nucleic acids
Abstract
Improved methods for in situ hybridization assays of cellular
and subcellular systems and tissue sections, and
immobilization-based assay techniques such as Northern blotting,
Southern blotting, dot blots, and the like, and assay techniques
wherein the probes are bound to substrates are disclosed. The
subject invention employs crosslinker-containing hybridization
probes capable of forming covalent bonds between the probe and the
target nucleic acid. Upon activation, the crosslinker will, if the
probe has hybridized with its essentially complementary target,
form covalent bonds with the complementary strand to covalently
crosslink the probe to the target. Subsequently, stringent wash
conditions may be employed to reduce background signals due to
non-specific absorption or probes or targets, while retaining all
crosslinked probe/target hybrids. Also disclosed are diagnostic
kits for use in clinical and diagnostic laboratories.
Inventors: |
Huan, Bingfang; (Cupertino,
CA) ; Albagli, David; (Menlo Park, CA) ; Wood,
Michael L.; (Mountain View, CA) ; Van Atta, Reuel
B.; (Mountain View, CA) ; Cheng, Peter C.;
(San Jose, CA) |
Correspondence
Address: |
RALPH T. LILORE
371 FRANKLIN AVENUE
THIRD FLOOR - PO BOX 570
NUTLEY
NJ
07110
US
|
Family ID: |
22480896 |
Appl. No.: |
10/735174 |
Filed: |
December 12, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10735174 |
Dec 12, 2003 |
|
|
|
09379888 |
Aug 23, 1999 |
|
|
|
6696246 |
|
|
|
|
09379888 |
Aug 23, 1999 |
|
|
|
09138195 |
Aug 21, 1998 |
|
|
|
Current U.S.
Class: |
506/9 ; 435/6.16;
506/16; 506/32 |
Current CPC
Class: |
C12Q 1/6827 20130101;
C12Q 1/6841 20130101; C12Q 1/6832 20130101; C12Q 1/6837 20130101;
C12Q 1/6827 20130101; C12Q 2537/143 20130101; C12Q 1/6827 20130101;
C12Q 2565/518 20130101; C12Q 2545/114 20130101; C12Q 2523/101
20130101; C12Q 1/6832 20130101; C12Q 2565/518 20130101; C12Q
2545/114 20130101; C12Q 2523/101 20130101; C12Q 1/6837 20130101;
C12Q 2565/518 20130101; C12Q 2545/114 20130101; C12Q 2523/101
20130101; C12Q 1/6841 20130101; C12Q 2565/518 20130101; C12Q
2545/114 20130101; C12Q 2523/101 20130101; C12Q 1/6832 20130101;
C12Q 2523/101 20130101; C12Q 1/6837 20130101; C12Q 2523/101
20130101; C12Q 1/6841 20130101; C12Q 2523/101 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Claims
We claim:
1. A method for determining the presence of a target nucleic acid
molecule in an biological sample, wherein one of the probe or
target biological sample molecules is immobilized comprising: (a)
contacting a nucleic acid probe with a biological sample, wherein
the nucleic acid probe hybridizes to a target nucleic acid molecule
in the biological sample, and wherein the nucleic acid probe
comprises a crosslinking moiety capable of forming a covalent
crosslink between the nucleic acid probe and the target nucleic
acid molecule; (b) forming a covalent bond between the nucleic acid
probe and the target nucleic acid molecule; (c) washing to remove
excess mobile probe or target; and (d) determining the amount of
crosslinked nucleic acid probe target complexes.
2. The method of claim 1 comprising a plurality of different
nucleic acid probes and target molecules.
3. The method of claim 1 comprising a plurality of different
nucleic acid probes for a single target molecule.
4. The method of claim 1, wherein the biological sample is
immobilized.
5. The method of claim 1, further comprising the step of disrupting
nucleic acid hybridization within the biological sample.
6. The method of claim 1, wherein the biological sample is a cell,
a subcellular structure, a body fluid, or a tissue section.
7. The method of claim 6, wherein said biological sample is fixed
on a slide.
8. The method of claim 1, wherein the biological sample is a sample
of nucleic acid molecules.
9. The method of claim 8, wherein the sample of nucleic acid
molecules is immobilized on nylon membrane or nitrocellulose
paper.
10. The method of claim 1, wherein the target nucleic acid molecule
is selected from the group consisting of animal, bacterial, fungal,
human, parasitic, plant and viral nucleic acids.
11. The method of claim 1, wherein the precursor of the
crosslinking moiety is selected from the group consisting of
coumarins, furocoumarins and benzodipyrones.
12. The method of claim 1, wherein the precursor of the
crosslinking moiety is selected from the group consisting of
coumarin, 7-hydroxycoumarin, 6,7-dihydroxycoumarin,
4-methyl-7-hydroxy-coumarin, 6-alkoxy-7-hydroxycoumarin, psoralen,
8-methoxypsoralen, 5-methoxypsoralen, 4,5',8-trimethylpsoralen,
4'-hydroxymethyl-4,5',8-trim- ethylpsoralen, and
4'-aminomethyl-4,5',8-trimethylpsoralen, a haloalkyl coumarin,
haloalkyl furcoumarin, and a haloalkyl benzodipyrone.
13. The method of claim 1, wherein the crosslinking moiety is a
mono-adducted furocoumarin:nucleoside adduct.
14. The method of claim 1, wherein the formation of the covalent
bond occurs photochemically.
15. The method of claim 1, wherein the formation of the covalent
bond occurs chemically.
16. In a method for hybridizing a nucleic acid probe to a target
nucleic acid molecule in a biological sample, the improvement
comprising: using a labeled nucleic acid probe having a
crosslinking molecule capable of forming a covalent crosslink
between the nucleic acid probe and the target nucleic acid
molecules; and forming covalent bonds between the nucleic acid
probe and the target nucleic acid molecule.
17. A method for diagnosing a disease condition in a patient,
comprising: (a) contacting a solution containing a nucleic acid
probe to an immobilized sample from the patient, wherein the
nucleic acid probe hybridizes to a target nucleic acid molecule
indicative of a disease condition and wherein the labeled nucleic
acid probe comprises a crosslinking moiety which is capable of
forming a covalent crosslink between the nucleic acid probe and the
target nucleic acid; (b) forming a covalent bond between the
nucleic acid probe and the target nucleic acid molecule; (c)
washing to remove excess, probe or target nucleic acid molecules;
and (d) determining the amount of nucleic acid probe target
complexes formed.
18. The method of claim 17, further comprising the step of removing
nucleic acid probe or target which is not covalently bound, prior
to the final step.
19. In a method for hybridizing a nucleic acid probe to an
immobilized target nucleic acid molecule, the improvement
comprising: using a nucleic acid probe having a crosslinking
molecule capable of forming a covalent crosslink between the
nucleic acid probe and the target single-stranded DNA; and forming
covalent bonds between the nucleic acid probe and the target DNA
molecule.
20. A kit for determining the presence of a target nucleic acid
molecule of an immobilized biological sample, comprising: a nucleic
acid probe having an essentially complementary base sequence to a
defined region of the target nucleic acid molecule and having a
crosslinking moiety which is capable of forming a covalent
crosslink between the nucleic acid probe and the target nucleic
acid; and means for removing nucleic acid probe which is not bound
to the target nucleic acid molecule.
21. The kit of claim 20, further comprising means of removing
nucleic acid probe which is not covalently bound to the target
nucleic acid molecule.
22. The kit of claim 20, further comprising means of labeling said
nucleic acid probe.
23. A kit for determining the presence of a target nucleic acid
molecule which is immobilized on a nylon membrane or nitrocellulose
paper, comprising: a nucleic acid probe having an essentially
complementary base sequence to a defined region of the target
nucleic acid molecule and having a crosslinking moiety which is
capable of forming a covalent crosslink between the nucleic acid
probe and the target nucleic acid; and means for removing nucleic
acid probe which is not bound to the target nucleic acid
molecule.
24. The kit of claim 23, further comprising means of removing
nucleic acid probe which is not covalently bound to the target
nucleic acid molecule.
25. The kit of claim 23, further comprising means of labeling said
nucleic acid probe.
26. An array, comprising: a solid support; and a plurality of
different nucleic acid probes immobilized on said solid support,
each nucleic acid probe having a base sequence essentially
complementary to a defined region of a target nucleic acid molecule
and having a crosslinking moiety which is capable of forming a
covalent crosslink between the nucleic acid probe and the target
nucleic acid molecule.
27. The array of claim 26, wherein at least one of the nucleic acid
probes is complementary to a target nucleic acid molecule selected
from the group consisting of animal, bacterial, fungal, human,
parasitic, plant and viral nucleic acids.
28. The array of claim 26, wherein the crosslinking moiety is
selected from the group consisting of coumarins, furocoumarins and
benzodipyrones.
29. The array of claim 26, wherein the crosslinking moiety is
selected from the group consisting of coumarin, 7-hydroxycoumarin,
6,7-dihydroxycoumarin, 6-alkoxy-7-hydroxycoumarin, psoralen,
8-methoxypsoralen, 5-methoxypsoralen, 4,5',8-trimethylpsoralen,
4'-hydroxymethyl-4,5',8-trimethylpsoralen, and
4'-aminomethyl-4,5',8-trim- ethylpsoralen, a haloalkyl coumarin, a
haloalkyl furocoumarin and a haloalkyl benzodipyrone.
30. The array of claim 26, wherein the crosslinking moiety is a
mono-adducted furocoumarin:nucleoside adduct.
31. A method for determining the presence of a plurality of target
nucleic acid molecules in a biological sample, comprising: (a)
contacting the sample with the array of claim 26, wherein the
target nucleic acid molecules hybridize to the immobilized nucleic
acid probes; (b) forming covalent bonds between the nucleic acid
probes and their hybridized target nucleic acid molecules; (c)
washing the array to remove excess nucleic acid molecules; and (d)
determining the amount and position of nucleic acid molecules which
remain bound to the array.
32. The method of claim 31, further comprising the step of washing
the array to remove non-specifically bound nucleic acid
molecules.
33. The method of claim 31, further comprising the step of applying
an electric field across the substrate to desorb non-specifically
bound nucleic acid molecules.
34. The method of claim 31, further comprising the step of
disrupting nucleic acid hybridization within the immobilized
biological sample.
35. The method of claim 31, wherein the formation of the covalent
bond occurs photochemically.
36. The method of claim 31, wherein the formation of the covalent
bond occurs chemically.
37. A method for diagnosing a disease condition in a patient,
comprising: (a) contacting a sample from a patient with the array
of claim 26, so that target nucleic acid molecules which are
indicative of a disease condition can hybridize to the immobilized
nucleic acid probes; (b) forming covalent bonds between the nucleic
acid probes and the hybridized target nucleic acid molecules; (c)
washing the array to remove nonspecifically bound nucleic acid
molecules; and (d) determining the amount and position of target
nucleic acid molecules which remain bound to the array.
38. The method of claim 37, further comprising the step of removing
nucleic acid molecules which are not covalently bound to the target
nucleic acid molecules, prior to the final step.
39. A method for genotyping a polymorphic sequence in a patient,
comprising: (a) contacting a solution containing a nucleic acid
probe to an immobilized sample from the patient, wherein the
nucleic acid probe hybridizes to a target nucleic acid molecule
indicative of a disease condition and wherein the labeled nucleic
acid probe comprises a crosslinking moiety which is capable of
forming a covalent crosslink between the nucleic acid probe and the
target nucleic acid; (b) forming a covalent bond between the
nucleic acid probe and the target nucleic acid molecule; (c)
washing to remove excess, probe or target nucleic acid molecules;
and (d) determining the amount of nucleic acid probe target
complexes formed.
40. The method of claim 39, further comprising the step of removing
nucleic acid probe or target which is not covalently bound, prior
to the final step.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S. Ser. No.
09/138,195, filed Aug. 21, 1998, the disclosure of which is
incorporated by reference herein.
BACKGROUND OF THE INVENTION
[0002] a) Field of the Invention
[0003] This invention relates generally to methods of detecting
nucleic acid sequences using oligonucleotide probes or arrays of
probes that have a crosslinking moiety in assays where either the
probe or the target molecule is bound to a solid support. The
surface-bound DNA or RNA may be immobilized cellular or subcellular
systems, or immobilized arrays of DNA or RNA preparations.
[0004] b) Description of Related Art
[0005] Numerous useful techniques in the biological sciences
involve the immobilization of biological material on a solid
support of some kind. Immobilized nucleic acid hybridization assays
constitute an important class of these methods. Examples of nucleic
acid-based assays where the sample being assayed is immobilized
include in situ hybridization and blotting assays. Examples of
assays where the sample is contacted with immobilized probes
include gene chip technologies.
[0006] In situ hybridization techniques are a valuable method for
identifying the presence of specific nucleic acid sequences within
cellular or subcellular systems. Unlike in vitro techniques in
which the nucleic acids of interest are retained in some manner
while the remainder of the sample is degraded in order to perform
the assay measurement, in situ techniques allow one to assay for
the presence of specific sequences among substantially intact
cellular or subcellular structures.
[0007] In blotting assays, DNA or RNA bound to a membrane (or
filter paper), in many cases after having been migrated through a
gel, is probed for the presence of a specific nucleic acid
sequence. Immobilization techniques for DNA assays were first
demonstrated by Southern, J. Mol. Biol., 1975, 98, 503. Since then
many derivative procedures have been developed. These derivative
procedures include Northern blot techniques in which RNA is
immobilized and assayed via hybridization and dot blot techniques
where a solution containing nucleic acid molecules is directly
immobilized on the membrane or filter and assayed via
hybridization.
[0008] In immobilized nucleic acid-based assays, oligonucleotide
probes are contacted with the immobilized sample, or a sample is
contacted with immobilized probes, and evidence that the probe has
hybridized with its essentially complementary sequence is
determined by development of a signal from a direct or an indirect
reporter system.
[0009] Achieving a desirable signal-to-noise ratio is a major
challenge of immobilized nucleic acid hybridization assays. In situ
PCR is one method that has been attempted for improving the
sensitivity of in situ assays. In this technique, cellular,
subcellular, or tissue samples are prepared and primer pairs are
introduced. The samples are then subjected to repeated thermal
cycles in the same manner that PCR is typically carried out. It is
expected that if the target sequence is present then copies of the
PCR amplicons will be amplified. However, significant problems with
the in situ PCR technique remain.
[0010] In addition to the problems encountered for solution-based
PCR such as enzyme inhibition, false priming, and primer
dimerization, there are other issues specific to the in situ
technique that contribute to inconsistent assay results:
[0011] 1. The extent of cell permeabilization. If the pore size is
too small then polymerase enzymes may not be able to enter the
cell. If the pore size is too large then the amplicon may freely
leave the cell. These effects may be variable within one sample as
well as from sample to sample.
[0012] 2. Endogeneous inhibitors. Whereas for solution-based PCR
assays a purpose of sample preparation procedures is to isolate the
nucleic acids and remove enzyme inhibitors, in situ assays are
necessarily performed within a cellular or subcellular environment
and limit the possibilities for removing inhibitors.
[0013] 3. Loss of amplicon. The permeabilized membranes may permit
the amplicon to leave the cell during wash steps subsequent to the
amplification reaction. It may also allow amplicons that have been
washed out of adjacent cells to enter, leading to signal being
observed in cells that did not originally contain the target.
[0014] 4. Diffuse signals. The amplicons are not localized at the
site of the target sequence, unlike probes that hybridize to the
target. The amplicons freely move through the sample and may thus
generate a diffuse signal that may be difficult to detect and not
permit localization of the sequence being assayed.
[0015] Together, the above factors account for some of the reasons
for inconsistent results obtained by in situ PCR assays.
[0016] There is a recognized need to improve the detection
sensitivity of probe-based hybridization assays for detection of
immobilized nucleic acids. For example, methods to improve the
rates of hybridization through the use of volume exclusion agents
(U.S. Pat. No. 4,886,741) or increased probe concentrations (U.S.
Pat. No. 5,707,801) have been disclosed. In U.S. Pat. No.
5,521,061, Bresser et al. describe the use of permeation enhancers
and signal enhancers as a means to increase the sensitivity.
[0017] Previous disclosures indicate the need for improved methods
for assays of immobilized nucleic acids, particularly in in situ
hydridization assays.
[0018] The use of long probes (200 to 500,000 nucleotides in
length) in these assays requires long hybridization times and
contributes heavily to high background signals, because of
countless opportunities for undesired, non-specific binding
interactions provided by the additional sequence. However, long
probes provide the advantage of being able to contain many reporter
groups and thus provide stronger signals. Shorter probes (less than
200 nucleotides) offer the advantage of reduced hybridization
times, but shorter probes are more susceptible to being washed
away, thereby reducing the signal. Shorter probes also have the
advantage of being prepared by automated synthesis procedures, but
their use is limited in many types of assays because of the loss of
hybridized probes during the critical washing steps.
[0019] Crosslinker-containing probes have been previously used in
in vitro hybridization techniques (for instance, see U.S. Pat. No.
4,599,303, Yabusaki et al.). However, whether such probes are
applicable to in situ hybridization or blotting techniques was not
known. In in vitro techniques, the various biologic components have
normally been chemically degraded by sample preparation steps,
typical among which are boiling in alkaline solution, proteinase K
treatment, and the like. In any event, the in vitro assays are
typically designed to retain only the nucleic acid material on some
solid support temporarily while removing the other components
through removal of the supernatant solution in a series of wash
steps. The hybridization step itself is usually performed in
solution. If there should be nonspecific interaction between a
probe and non-nucleic acid and biological components, this would
not contribute to a false signal because these components are not
retained in the assay.
[0020] However, in techniques in which the target DNA or RNA is
ipimobilized during the hybridization step, especially in the
presence of other biological components, non-specific interactions
between the crosslink er-containing probes and any of these
materials, including the solid support on which the target DNA or
RNA is immobilized, would be disastrous to the outcome of the
assay. Non-specific interactions between the crosslinker-containing
probes and solid support material on which the biological sample is
immobilized are of particular concern. For instance,
positively-charged groups on a solid support material are helpful
in the original immobilization of the target nucleic acid molecule,
but they will also attract binding of the nucleic acid probe.
Alternatively, exposed hydroxyl groups on the surface of a solid
support material may form hydrogen bonds with the nucleic acid
probe used. Crosslinker-containing probes are particularly
problematic for non-specific binding, because they necessarily
contain a highly reactive functional moiety. Although the intention
is to use the crosslinking moiety to covalently attach the nucleic
acid probe to the target nucleic acid, any crosslinker-containing
probe which is non-specifically bound to the support or a
non-target nucleic acid molecule could potentially become
covalently attached, resulting in an excessively high background
level.
[0021] In addition to the potentially problematic presence of
biological material other than the target nucleic acid molecules,
other aspects of the procedures used in hybridization protocols
where the biological sample is immobilized can be detrimental to
efforts to obtain a clear hybridization signal. For instance, in
situ hybridization procedures employ the use of a fixative, a
compound which kills the cell but preserves its morphology and/or
nucleic acids for an extended period of time. However, these
fixatives, while preserving structure, often reduce hybridization
efficiency. Networks may be formed in the process, trapping nucleic
acids and antigens and rendering them inaccessible to probes. Some
fixatives also covalently modify nucleic acids, preventing later
hybrid formation and decreasing signal.
[0022] Thus, there exists a need for immobilized nucleic acid
hybridization assays with improved signal-to-noise ratios. However,
the applicability of crosslinker-containing probes to these
immobilized assays and their effectiveness in combating the
signal-to-noise problem have been unclear.
[0023] The use of electric fields to direct the binding of charged
biomolecules has been disclosed in U.S. Pat. Nos. 5,929,208;
5,605,662; 5,849,486; and 5,632,957. This technique suffers from
transient binding of the probe to the target. Moreover, the
application of electric-field induced stringent wash techniques
suffers from having to use compromised conditions in the same way
as buffered stringent washes because the probes are always subject
to being washed away.
SUMMARY OF THE INVENTION
[0024] It is an object of the present invention to provide a method
for assaying immobilized nucleic acid targets using
crosslinker-containing probes to improve the sensitivity and the
reproducibility of the assay.
[0025] It is a further object of the present invention to provide
methods for assaying solutions of target nucleic acids using
immobilized crosslinker-containing probes to improve the
sensitivity and the reproducibility of the assay.
[0026] The sensitivity of an assay is determined by the
signal-to-background ratio of the observable being measured. The
reproducibility of an assay is determined by factors that influence
the signal levels or the background levels. Variation of either of
these levels will cause varying signal-to-background ratios and
complicate the interpretation of the assay.
[0027] The present invention satisfies the need for improved
methods of assaying immobilized nucleic acids. These methods
provided by the invention offer the advantage of superior
signal-to-background ratios compared to standard hybridization
assay techniques.
[0028] The present invention provides for a method of determining
the presence of a target nucleic acid molecule in a biological
sample, wherein either the target molecule or the biological sample
is immobilized. In this method, a nucleic acid probe having a
crosslinking moiety capable of forming a covalent crosslink between
the nucleic acid probe and the target nucleic acid is contacted
with the biological sample so that hybridization between the target
nucleic acid and the nucleic acid probe occurs. A covalent bond
between the nucleic acid probe and the target nucleic acid molecule
is then formed. At least one washing step follows to remove the
excess or nonspecifically bound hybridization partner from the site
of the biological sample. Stringent, denaturing conditions and
washes may also optionally be used to remove any nucleic acid probe
which is not covalently bound to a target nucleic acid. In a final
step, the amount of crosslinked nucleic acid probe target complexes
is determined.
[0029] In one embodiment, the biological sample is a cell,
subcellular structure, body fluid, or tissue section. In another
embodiment of the invention, the biological sample is a sample of
nucleic acid molecules, preferably immobilized on nylon membrane or
nitrocellulose paper.
[0030] The target nucleic acid molecule may be an animal,
bacterial, fungal, human, parasitic, plant or viral nucleic
acid.
[0031] In one embodiment of the invention, the crosslinking moiety
of the labeled nucleic acid probe is selected from the group
consisting of coumarins, furocoumarins, and benzodipyrones.
[0032] The formation of the covalent bond between the target
nucleic acid and the nucleic acid probe may occur either
photochemically or chemically.
[0033] In another embodiment, the present invention provides for an
array, comprising a solid support and a plurality of different
nucleic acid probes immobilized on the solid support, each nucleic
acid probe having a base sequence essentially complementary to a
defined region of a target nucleic acid molecule and having a
crosslinking moiety capable of forming a covalent crosslink between
the nucleic acid probe and the target nucleic acid molecule. The
target nucleic acid molecule may be an animal, including human,
bacterial, fungal, parastic, plant or viral nucleic acid. The
crosslinking-moiety employed on the array is optionally selected
from the group consisting of coumarins, furocoumarins, and
benzodipyrones.
[0034] Methods for using arrays of probes for determining the
presence of a plurality of target nucleic acid molecules in a
biological sample are also provided.
[0035] Methods for using arrays for determining genotypes of
particular sequences where several polymorphic sequences may be
expected are also provided.
[0036] In alternative embodiments of the invention, methods for
diagnosing a disease condition in a patient and kits useful in
carrying out the methods of the invention are also provided.
BRIEF DESCRIPTION OF THE DRAWING
[0037] FIGS. 1a-1c show cells which have been assayed by in situ
hybridization for the presence of human papillomavirus with a probe
that contains a crosslinking moiety, with and without UV
irradiation to induce crosslink formation.
DETAILED DESCRIPTION OF THE INVENTION
[0038] The present invention provides improved methods for
performing immobilized nucleic acid hybridization assays. Examples
of such assays include, but are not limited to, in situ
hybridization, blotting assays, and the use of gene chips.
[0039] Nucleic acid hybridization is a process where two or more
opposite strands of modified polynucleotides such as "PNA" (Nielson
et al., U.S. Pat. No. 5,773,571) DNA, RNA, oligonucleotides,
polynucleotides, or any combination thereof recognize one another
and bind together through the formation of hydrogen bonds.
[0040] One embodiment of the invention provides for a method of
determining the presence of a target nucleic acid molecule in a
biological sample. This method involves first contacting a nucleic
acid probe with the biological sample so that the nucleic acid
probe can hybridize to the target nucleic acid molecule. The
nucleic acid probe hybridized to the target nucleic acid molecule
bears a crosslinking moiety capable of forming a covalent crosslink
between the nucleic acid probe and the target nucleic acid
molecule. The method also involves forming covalent crosslinks
between the nucleic acid probe and the hybridized target nucleic
acid molecule and washing to remove excess probe or target. A final
step involves determining the amount of crosslinked nucleic acid
probe target complexes.
[0041] The method for determining the presence of a target nucleic
acid molecule in a biological sample may optionally comprise
forming a covalent bond between the nucleic acid probe and the
target nucleic acid molecule and subjecting the sample to
stringent, denaturing conditions to remove non-covalently bound
nucleic acid.
[0042] In one embodiment the biological sample is immobilized on a
solid support. In another embodiment, the probe is immobilized on a
solid support.
[0043] Typically, standard hybridization assays only allow for
relatively gentle washings with salt buffers and the like. These
washes are sufficient to remove nucleic acid probes which are not
bound in any way to the biological sample. They are also sufficient
to remove some of the probe molecules which are bound, but are
bound only non-specifically (via limited hydrogen bonding and ionic
interactions, for instance). The use of more stringent washes are
problematic in these standard hybridization assays since they can
cause denaturation of the critical duplex between the nucleic acid
probe and the target nucleic acid molecule.
[0044] In the methods of the present invention, one or more
stringent, denaturing washes may be performed. This invention
provides for duplexes where the probe and target molecules are
covalently linked to one another, not just hydrogen bonded
together. Therefore, harsher conditions can be employed which will
disrupt any undesirable, non-specific background binding, and even
much or all of the hydrogen bonding between the target nucleic acid
and the nucleic acid probe, but will not break the covalent bond
linking the labeled probe to its target. For instance, washes with
urea solutions or alkaline solutions may be used. Electric
field-induced removal of non-crosslinking binding partners may be
used. Heat may also be used. The covalent linkage therefore allows
for a significant improvement in the signal-to-noise ratio of the
assay.
[0045] The nucleic acid probe may consist of chemically synthesized
or biologically prepared DNA or RNA polynucleotides from about 8 to
about 200 bases in length or longer. The nucleic acid probe is
preferably single-stranded. The nucleic acid probe has a base
sequence which is essentially complementary to a defined region of
its target nucleic acid molecule.
[0046] The crosslinking moiety can be directly incorporated into
synthetic polynucleotides at the time of synthesis through the use
of appropriately modified nucleoside or nucleotide derivatives.
Alternatively, the crosslinking molecules can be introduced onto
the probe through photochemical or chemical monoaddition. In some
cases, the crosslinking moiety may be incorporated into a
polynucleotide probe enzymatically by using an appropriately
modified nucleotide or oligonucleotide which contains a
cross-linking moiety.
[0047] The crosslinking moiety which is employed on the nucleic
acid probe may be any chemical moiety which is capable of forming a
covalent crosslink between the nucleic acid probe and the target
nucleic acid molecule. For instance, the precursor to the
crosslinking moiety can optionally be a coumarin, furocoumarin, or
a benzodipyrone. Several of such crosslinkers useful in the present
invention are known to those skilled in the art. For instance, U.S.
Pat. Nos. 4,599,303 and 4,826,967 disclose crosslinking compounds
based on furocoumarin suitable for use in the present invention.
Also, in U.S. Pat. No. 5,082,934, Saba et al describe a
photoactivatible nucleoside analogue comprising a coumarin moiety
linked through its phenyl ring to a ribose or deoxyribose sugar
moiety without an intervening base moiety. In addition, copending
and commonly owned U.S. patent application Ser. No. 08/401,630
discloses non-nucleosidic, stable, photoactive compounds that can
be used as photo-crosslinking reagents in nucleic acid
hybridization assays. These references, and all others referred to
herein are incorporated by reference in their entirety.
[0048] The precursor of the crosslinking moiety may be a coumarin,
7-hydroxycoumarin, 6,7-dihydroxycoumarin,
6-alkoxy-7-hydroxycoumarin, psoralen, 8-methoxypsoralen,
5-methoxypsoralen, 4,5',8-trimethylpsoralen,
4'-hydroxymethyl-4,5',8-trimethylpsoralen, and
4'-aminomethyl-4,5',8-trim- ethylpsoralen, a haloalkyl coumarin, a
haloalkyl furocoumarin, a haloalkyl benzodipyrone, or a derivative
thereof. The moiety is incorporated into a nucleic acid sequence by
methods taught in the above referred patents. Compounds containing
fused coumarin-cinnoline ring systems are also appropriate for use
in the present invention. In some embodiments, the cross-linking
moiety may be part of a mono-adducted furocoumarin:nucleoside
adduct.
[0049] The nature of the formation of the covalent bond comprising
the crosslink will depend upon the crosslinking moiety chosen. In a
preferred embodiment, the formation of the covalent bond occurs
photochemically. In an alternative embodiment, the formation of the
covalent bond occurs chemically.
[0050] The label on the nucleic acid probe can be attached to the
crosslinking moiety directly. Alternatively, the label can be
attached to another region of the probe. The label may be any
molecule which can be detected. For instance, the label may be a
radioactive nuclide, chromogenic, a chromophore, fluorogenic, a
fluorophore, a chemiluminescent dye, an enzyme, or a ligand.
Biotin-labeled nucleotides can be incorporated into DNA or RNA by
nick translation, enzymatic, or chemical means. The biotinylated
probes can be detected after hybridization using
avidin/streptavidin, fluorescent, enzymatic or colloidal gold
conjugates. Nucleic acids may also be labeled with other
fluorescent compounds, with immunodetectable fluorescent
derivatives or with biotin analogues. Nucleic acids may also be
labeled by means of attaching a protein. Nucleic acids coupled or
conjugated to radioactive or fluorescent histone H1, enzymes
(alkaline phosphatase and peroxidases), or single-stranded binding
(ssB) protein may also be used. Numerous such labeling methods are
known to those skilled in the art.
[0051] Exemplary probe types and their associated detection methods
include short (8-200 nt) probes with incorporated label and
crosslinker, short probes with incorporated crosslinker and
detection via in situ extension and concomitant label
incorporation, and long (>200 nt) probes in which the
crosslinker(s) is incorporated by use of crosslinker-containing
primers, enzymatic incorporation of crosslinker-modified
nucleotides, or enzymatic incorporation of crosslinker-containing
oligonucleotides.
[0052] The target nucleic acid molecule in the assays of the
present invention may be a DNA molecule or an RNA molecule. The
target nucleic acid molecule may be an animal, bacterial, fungal,
human, parasitic, plant or viral nucleic acid. The viral sequence
may be from human papillomavirus, Epstein-Barr virus, or
cytomegalovirus. However, many other possible targets exist and
could be used in conjunction with the present invention. For
instance, the target nucleic acid molecule may be of interest
because it generates a selected gene product, is suspected of
performing a critical cell-control function, is related to a repeat
sequence, is suspected of containing a genetic defect which
prevents expression of an active gene product, or may be related in
chromosome position to a marker probe region with a known map
position. Some applications of in situ hybridization assays include
infectious disease testing (pathogen detection), cancer marker
screening, mutation detection, tissue typing, gene profiling,
analysis of trait incorporation, polymorphism genotyping, and
assaying for antibiotic resistance genes.
[0053] In one embodiment of the invention, the biological sample is
a cell, a subcellular system or structure, such as nuclei or
mitochondria, a body fluid, or a tissue section, and the method
provides an improved procedure for in situ hybridization. In in
situ hybridization procedures, cells or tissue sections which
contain the target nucleic acid, typically chromosomal DNA or mRNA
transcripts, are immobilized, and exposed to a solution of
probes.
[0054] In one embodiment of the invention, the biological sample is
a cell or tissue section collected from a patient. Cell samples
that may be collected, immobilized, and used in the present
invention are, for example, cervical cells (typically to test for
human papillomavirus), buccal cells from the cheek (an easy source
for chromosomal analyses), metaphase cells (for chromosomal
spreads) or lymphocytes (to test for Epstein-Barr Virus or other
viruses found in the lymphatic system). Tissue samples of interest
may be tumor sections or biopsy specimens, which would typically be
assayed for the presence of viruses or the expression of oncogenes
or abnormal copy numbers of chromosomes.
[0055] Methods of fixing biological samples for in situ
hybridization purposes are known to those skilled in the art. The
cellular compartment and DNA structure may be fixed or
permeabilized by treatment with an organic solvent and acid or
bifunctional reagent to fix the structural components in their
natural morphological relationship. Common fixatives include acetic
acid, salts, methanol, formalin, paraformaledhyde, and
glutaraldehyde. A tissue sample may be prepared for hybridization
assays by first embedding the sample in wax or freezing the sample,
followed by sectioning it into thin slices. The tissue section is
then mounted on a slide and deparaffinized or thawed.
[0056] The biological material may also typically be treated with
one or more of a number of agents capable of deproteinizing and/or
delipidizing the structures. Such methods can involve the use of
proteases, lipases, acid, organic solvents including alcohol,
detergents or heat denaturation or combinations of these
treatments. A common treatment involves one or more washes with
methanol:acetic acid.
[0057] Subcellular structures, such as nuclei and mitochondria, can
be prepared by conventional fractionation methods, such as
isopycnic centrifugation, to obtain subcellular material in
enriched or substantially purified form. Thereafter, the enriched
structure preparation may be permeabilized and deproteinized as
above and affixed to a slide by drying in preparation for
probing.
[0058] In a preferred embodiment of the invention, the biological
sample is affixed to a glass slide, typically by drying. The glass
slide may be coated with a material to promote adhesion, such as,
for example, poly-L-lysine. The biological sample may alternatively
be immobilized on other types of support such as nylon or
nitrocellulose.
[0059] Exemplary procedures for performing in situ hybridization
using crosslinker-containing probes are detailed in Examples 1, 2,
3, and 4 below. The results of in situ hybridization experiments in
which human papillomavirus was probed are described in Examples 2
and 4.
[0060] In an alternative embodiment of the invention, the
biological sample is a sample of nucleic acid molecules. The sample
of nucleic acid molecules may optionally be purified or
semi-purified. The sample may comprise only nucleic acid molecules
with a single sequence. In a preferred embodiment of the invention,
however, the biological sample will comprise a mixture of many
different nucleic acid molecules, the mixture being at least
semi-purified from non-nucleic acid biological materials.
[0061] If the biological sample is a semi-purified or purified
mixture of nucleic acid molecules, the sample is preferably
immobilized on nylon membrane or nitrocellulose paper. In these
embodiments, the hybridization assay is a modified blotting assay.
In blotting assays, the DNA or RNA is bound to a membrane after
having been migrated through a gel or is bound directly to the
membrane, and then exposed to a solution of probes. There are three
common nucleic acid-based blotting procedures in use: Southern
blots, Northern blots, and dot blots.
[0062] Southern and Northern blotting procedures are useful for a
variety of applications. In these techniques, the DNA (Southern) or
RNA (Northern) is migrated through a gel to separate the nucleic
acids into bands, after which a probe solution is contacted with
the gel for hybridization. Information is obtained not only from
simply observing in which band the probe/target hybrids are formed,
but also from the position of those bands relative to other samples
analyzed in the gel. Applications of Southern blots include
mutation detection, restriction fragment length polymorphism (RFLP)
analysis, DNA fingerprinting, and infectious disease detection.
Northern blotting is a powerful tool for analyzing gene expression
in cells. Densitometric analysis of the target band in the gel
permits estimation of the level of gene expression. Furthermore,
comparison of the length of the target RNA band with known
standards allows for detection of incompletely processed or mutant
species.
[0063] For Southern blots, the DNA is extracted from the sample by
standard procedures. The DNA is digested with the restriction
enzymes of choice, denatured, and the fragments obtained by these
processes are separated through an agarose gel. The DNA is
transferred to a nitrocellulose or nylon membrane by capillary
elution, electroblotting, or vacuum transfer. Once the DNA is
immobilized, the membrane is soaked in a solution of the
crosslinker-containing probes and left to incubate to allow
hybridization. The membrane is rinsed to remove excess
hybridization solution and the probe-target hybrids are crosslinked
for from about 5 to about 30 minutes, usually about 10 minutes,
with light from a UV or visible source, depending upon the
crosslinking moiety used. The membrane is washed, and the
crosslinked probe/target hybrids are visualized either directly if,
e.g., a fluorescent label has been incorporated into the probe, or
after additional steps to incorporate, e.g. alkaline phosphatase to
the crosslinked probes via ligand-receptor or antibody-antigen
binding, and subsequent reaction of the bound enzyme with a
substrate to produce a colored, luminescent, or chemiluminescent
product.
[0064] For Northern blot applications, RNA is extracted from the
sample under conditions that stabilize the RNA and inactivate
endogenous RNase enzymes. The RNA is denatured with gentle heat and
separated through an agarose gel. Thereafter, the procedure is
essentially the same as for Southern blotting.
[0065] Dot blots are simple membrane-based procedures that
concentrate the entire extracted nucleic acid sample in a small
circular `dot` on the membrane. The technique is useful for
determining the presence or absence of a target sequence and can be
adapted to quantitative applications by analyzing standards
containing known target levels in parallel with the samples and
quantifying the detection products with densitometric techniques.
In addition, because each sample `dot` occupies only a small area
of the entire membrane, multiple samples can be assayed
together.
[0066] Unlike a Southern or Northern blot, where the DNA/RNA
fragments are separated through gels prior to transfer on to the
membrane, no such step is required for a dot blot. After
immobilization of the total sample on the membrane, labeled
crosslinker-containing probes specific for the target sequence are
hybridized and crosslinked to the target using the same procedures
used for Southern and Northern blots. Detection of the crosslinked
products is also done in the same way.
[0067] Another embodiment of the present invention provides for an
improvement to a method for hybridizing a labeled nucleic acid
probe to a target nucleic acid molecule in a biological sample.
This improvement comprises using a nucleic acid probe having a
crosslinking molecule capable of forming a covalent crosslink
between the nucleic acid probe and the target single-stranded DNA
and the additional step of forming covalent bonds between the
nucleic acid probe and the target DNA molecule.
[0068] Still another embodiment of the invention provides an
improvement to a method of hybridizing a nucleic acid probe to a
target nucleic acid molecule immobilized on a substrate. The method
involves using a nucleic acid probe having a crosslinking moiety
capable of forming a covalent crosslink between the probe and the
target, performing the step of forming the covalent crosslink, and
thereafter applying an electric field across the substrate such
that non-bound nucleic acid molecules will be repelled from the
substrate and removed prior to the detection step.
[0069] Still another embodiment of the invention provides an
improvement to a method of hybridizing a nucleic acid probe to a
target nucleic acid molecule immobilized on nylon membrane or
nitrocellulose paper (or the like). The method involves using a
nucleic acid probe having a crosslinking moiety capable of forming
a covalent crosslink between the nucleic acid probe and the target
single-stranded DNA and performing the additional step of forming
covalent bonds between the nucleic acid probe and the target DNA
molecule.
[0070] An alternative embodiment of the present invention provides
for a method for diagnosing a disease condition in a patient. This
method also involves use of a labeled nucleic acid probe which
comprises a crosslinking moiety capable of forming a covalent
crosslink between the nucleic acid probe and the target nucleic
acid. This method comprises the following steps: contacting a
solution containing a labeled nucleic acid probe to an immobilized
sample from the patient so that the labeled nucleic acid probe can
hybridize to a target nucleic acid molecule indicative of a disease
condition; forming a covalent bond between the nucleic acid probe
and the target nucleic acid molecule; washing the immobilized
biological sample to remove labeled nucleic acid probe which is not
bound to the target nucleic acid molecules; and determining the
amount of labeled nucleic acid probe retained at the site of the
immobilized biological sample. This method may optionally further
comprise, prior to the final step, the additional step of removing
labeled nucleic acid probe which is not covalently bound to the
target nucleic acid molecules.
[0071] In alternative embodiments, kits for carrying out the
methods of the invention are also provided.
[0072] A kit for determining the presence of a target nucleic acid
molecule of a biological sample comprises a nucleic acid probe
having a base sequence essentially complementary to a defined
region of the target nucleic acid molecule and having a
crosslinking moiety which is capable of forming a covalent
crosslink between the nucleic acid probe and the target nucleic
acid molecule and means for removing nucleic acid probe or target
which is non-specifically bound. The means for removing the excess
nucleic acid will typically consist of one or more containers of
prepared washing solutions. The washing solution may be water, a
buffered low salt solution, a buffered high salt solution, a
solution of urea, an alkaline solution, or the like. Such wash
solutions are familiar to those skilled in the art.
[0073] A kit for determining the presence of a target nucleic acid
molecule which is immobilized on a nylon membrane or nitrocellulose
paper is also provided. This kit comprises a nucleic acid probe
having a base sequence which is essentially complementary to a
defined region of the target nucleic acid molecule and having a
crosslinking moiety which is capable of forming a covalent
crosslink between the nucleic acid probe and the target nucleic
acid. The kit also comprises means for removing nucleic acid probe
which is not bound to the target nucleic acid.
[0074] The kits may also optionally further comprise means of
removing nucleic acid probe which is not covalently bound to the
target nucleic acid molecules. A denaturing wash solution capable
of disrupting hydrogen bonding between hybridized nucleic acid
molecules would be a suitable means for removing nucleic acid probe
which is not covalently bound to the target nucleic acid molecules.
Again, such wash solutions are familiar to those skilled in the
art.
[0075] In an alternative embodiment, the kits may further comprise
means of labeling said nucleic acid probe.
[0076] The present invention also finds suitable use in
polynucleotide or oligonucleotide array applications. In these gene
chip applications, typically probes, which can either be short
oligonucleotides or long amplicon products, are bound to the
surface of a substrate in an arrayed pattern, and exposed to a
solution containing the target DNA or RNA from the sample.
[0077] Gene chips are used primarily for
sequencing-by-hybridization, gene expression profiling and single
nucleotide polymorphism (SNP) typing. The
sequencing-by-hybridization technique is best suited to
resequencing for mutation analysis within a known gene sequence
rather than the sequencing of unknown regions. For mutation and SNP
analysis it is necessary to discriminate minor differences such as
single nucleotide mismatches. These chips also typically use short
probes from 8 to 20 bases in length. For both these reasons
selectively maintaining the proper probe/target hybrids while
washing away the non-specifically bound material and mismatched
hybrids requires delicate adjustment of the wash stringency. Using
crosslinker-containing probes eliminates these difficulties by
covalently joining the probe/target hybrid together once the hybrid
has formed, while still providing the capability of single-base
discrimination.
[0078] The present invention provides for an array that comprises a
solid support and a plurality of different nucleic acid probes
immobilized on the solid support, each nucleic acid probe having a
base sequence essentially complementary to a defined region of a
target nucleic acid molecule and having a crosslinking moiety which
is capable of forming a covalent crosslink between the nucleic acid
probe and the target nucleic acid molecule.
[0079] The target nucleic acid molecule may be an animal,
bacterial, fungal, human, parasitic, plant or viral nucleic acid.
Other possible target sequences are listed above.
[0080] The precursor of the crosslinking moiety used on the probes
of the array may be selected from the group consisting of
coumarins, furocoumarins, and benzodipyrones. For instance,
possibilities for the cross-linking moiety include
7-hydroxycoumarin, 6,7-dihydroxycoumarin,
6-alkoxy-7-hydroxy-coumarin, psoralen, 8-methoxypsoralen,
5-methoxypsoralen, 4,5',8-trimethylpsoralen,
4'-hydroxymethyl-4,5',8-trim- ethylpsoralen, and
4'-aminomethyl-4,5',8-trimethylpsoralen, a haloalkyl coumarin, and
a haloalkyl benzodipyrone. The US patents cited above (in
conjunction with the methods for determining the presence of a
target nucleic acid molecule in an immobilized biological sample)
disclose crosslinking compounds which would be equally suitable for
use in the arrays of the invention.
[0081] Probes containing crosslinking molecules can be synthesized
either directly within a specific array location on the chip, or by
standard methods off the chip and then bound within a specific area
to create the gene chip array. Examples of methods of producing
oligonucleotide and polynucleotide arrays which are adaptable to
the present invention can be found in U.S. Pat. Nos. 5,700,637 and
5,744,305, herein incorporated by reference in their entirety. The
solid support material is preferably glass, silicon, or
polyacrylate. However, other possibilities exist such as various
metals and polymers, including conducting polymers or
biopolymers.
[0082] The chip is exposed to a sample solution containing the
target nucleic acid. Following hybridization under the desired
stringency conditions, the chip is irradiated with UV or visible
light to initiate the crosslinking reaction. Subsequently, the chip
can be washed with solutions of very high stringency to remove
non-specifically bound probes and other contaminants without the
risk of losing the crosslinked probe/target hybrids.
[0083] Crosslinker-containing probes are reported to be able to
discriminate between single-base polymorphic sites in target
sequences in solution hybridization assays. (Zehnder et al.,
Clinical Chemistry 1997 43:1703-1708).
[0084] Gene expression profiling typically employs long DNA
amplicons as the chipbound probe. Expressed mRNA bind to their
complement within the array of probes and the strength of the
signal reflects the relative amount of each mRNA and therefore the
level of expression of that gene. The relative intensity maps
generated illustrate the profile of genetic activity in a cell.
Important to the proper evaluation of the results is the signal to
noise ratio and the absence of false signals arising from
non-specific adsorption of mRNA to the chip. These parameters are
the same as those for immobilized nucleic acid assays. Just as
crosslinker-containing probes have been demonstrated to improve in
situ hybridization assays, similar gains can be made for gene chip
technologies.
[0085] In addition to the arrays themselves, the present invention
also provides for methods of determining the presence of a
plurality of target nucleic acid molecules in a biological sample.
One such method comprises the following steps: contacting the
sample with the array, thereby allowing the target nucleic acid
molecules to hybridize to the immobilized nucleic acid probes;
forming covalent bonds between the nucleic acid probes and their
hybridized target nucleic acid molecules; washing the array to
remove excess nucleic acid molecules; and determining the amount
and position of nucleic acid molecules which remain bound to the
array. This method may also optionally include the step of removing
nucleic acid molecules which are not covalently bound or are
non-specifically bound to the target nucleic acid molecules.
[0086] Determining the amount and position of nucleic acid
molecules can be carried out via a number of ways. For instance,
the polynucleotides in a biological sample which is applied to the
array could be labeled through any of the number of ways familiar
to those skilled in the art. (See discussion above.) If all of the
polynucleotides in the biological sample are labeled, the labeled
polynucleotides remaining bound to the array at the end of the
procedure can be identified as target nucleic acid molecules.
[0087] Depending upon the nature of the crosslinking moiety used in
the method, the formation of the cross-link between the target
nucleic acid and the nucleic acid probe may either be photochemical
or chemical.
[0088] A similar method for using the invention array to diagnose a
disease is also provided. A method for diagnosing a disease
condition in a patient comprises first contacting a sample from a
patient with the array, so that target nucleic acid molecules which
are indicative of a disease condition can hybridize to the
immobilized nucleic acid probes. The method also includes causing
the formation of covalent bonds between the nucleic acid probes and
the hybridized target nucleic acid molecules to occur. Washing the
array to remove excess nucleic acid molecules is also important. As
a final step, the amount and position of target nucleic acid
molecules which remain bound to the array is determined. This
method may also optionally include the intermediary step of
removing by stringent washing, or electric field induced
desorption, nucleic acid molecules which are not covalently bound
to the target nucleic acid molecules or are nonspecifically
bound.
[0089] An alternative embodiment of the present invention provides
for a method of determining the genotype of a patient particularly
where it relates to determining which of several polymorphic
sequences or nucleotides is present. An array comprised of a series
of oligonucleotide probes comprising the polymorphic sequences is
prepared, and the sample is contacted with the array. The method is
then carried out in the same manner as above.
EXAMPLES
[0090] The following specific examples are intended to illustrate
the invention and should not be construed as limiting the scope of
the claims.
Example 1
In Situ Hybridization of Cells Using Crosslinker-Containing
Probes
[0091] Cells are collected from a patient and washed with
phosphate-buffered saline (PBS) and pelleted at 1000 g. The cells
are resuspended in PBS to a concentration of 106/mL and 10 .mu.L
aliquots are spotted on slides which are then air dried. The cells
are fixed in 4% paraformaldehyde for 20 minutes at room temperature
and rinsed once with water. The cells are dehydrated with
sequential immersion in 70%, 80%, and 100% ethanol and air
dried.
[0092] The immobilized cells are treated with proteinase K in PBS
at 37.degree. C. for 20 minutes and rinsed with water. The cells
are then treated with acetic anhydride in 0.1 M triethanolamine (pH
8) for 10 minutes at room temperature and rinsed with water. The
cells are dehydrated in ethanol, as above, and then the nucleic
acids are denatured by treatment with 90% formamide in 0.1.times.
sodium saline citrate (SSC) for 15 minutes at 65.degree. C. The
cells are rinsed with water and again dehydrated with ethanol.
[0093] Hybridization is performed with the crosslinker-containing
DNA probes in 20% formamide, 2.times.SSC, 10% dextran sulphate, 20
mM HEPES, pH 7.4, 1.times. Denhardt's solution, 200 .mu.g/mL
calf-thymus DNA for one hour at 37.degree. C. The slides are washed
briefly with 2.times.SSC and 0.05% Tween.TM. at 37.degree. C. and
then irradiated with a UV light source (300-370 nm) for 15 minutes
at 37.degree. C. Post-crosslinking washing is done three times for
fifteen minutes each with 2.times.SSC/0.05% Tween 20 at 60.degree.
C.
[0094] To detect the crosslinked hybrids, the immobilized cells are
equilibrated in 0.1 M Tris (pH 7.4), 0.15 M NaCl, 0.05% Tween 20
(TNT) for five minutes at room temperature and then blocked with
0.1 M Tris (pH 7.4), 0.15 M NaCl containing 0.05% blocking reagent
for 45 minutes at room temperature. Bound hybrids are labeled with
200 .mu.L antifluorescein-horseradish peroxidase (HRP) in a 30
minute incubation at room temperature, washed four times with TNT
at room temperature, and then incubated with 120 .mu.L biotinyl
tyramide for 10 minutes at room temperature. The slides are washed
four times in TNT, incubated with SA-HRP at room temperature for 30
minutes and washed 4 times with TNT, incubated with 120 .mu.L
Cy3-tyramide for 10 minutes at room temperature, and again washed
in TNT. The cells are counter-stained with 5 .mu.g/mL DAPI, mounted
with Vectashield.RTM., and visualized under a fluorescent
microscope equipped with the necessary excitation and emission
filters for the fluorophore and counterstain.
Example 2
Detection of Human Papillomavirus Type 16 in Cells
[0095] In situ hybridization experiments were undertaken to
demonstrate the utility of crosslinkable probes. The target
organism was human papillomavirus type 16. The probe sequences are
sequence ID Numbers 1-14 of Table 1. Two types of cell lines were
used in the experiments, CaSki cells, and C-33 cells. CaSki cells
contain .about.500 copies of the viral genome, whereas C-33 cells
do not contain the viral genome and were used as negative
controls.
[0096] Each cell type was mounted on slides and treated to the same
pretreatment and hybridization protocol as detailed in Example 1,
above. Some samples of each cell type were then irradiated with UV
light to initiate the crosslinking reaction as described above,
while other samples were incubated without being exposed to UV
light. Subsequently, all samples were treated to the same washing
and detection protocol detailed in Example 1, above.
[0097] The images of FIG. 1 illustrate the results of the
experiments. The images represent the fluorescent emission from the
dye Cy-3, which has been deposited via an indirect detection
procedure for antigen-labeled oligonucleotide probes specific for
HPV 16. FIG. 1a shows the CaSki cells, with crosslinking, under low
power magnification. FIG. 1b shows the CaSki cells, without
crosslinking, under low power magnification. FIG. 1c shows the C-33
cells, with crosslinking, under low power magnification.
[0098] The hybridization procedure has clearly distinguished
between cells which contain the human papillomavirus (FIGS. 1a and
1b) and cells which do not (FIG. 1c). The imaging threshold in the
image of FIG. 1cwas adjusted to a low value in order to find any
low level of signal, and only a homogeneous background signal was
observed. FIG. 1a indicates that in the cells containing human
papillomavirus, the probes specifically localize in the nucleus and
provide a strong signal.
[0099] The difference in the intensity of the signal between FIG.
1a (crosslinked probe) and FIG. 1b (no crosslinking) is clearly
evident. With crosslinking, the probe/target hybrids are retained
and therefore contribute to signal generation, whereas without
crosslinking the hybrids are washed apart and are not present to
contribute to signal generation.
[0100] Image analysis of such slides in a similar experiment
revealed a difference in integrated signal intensity of more than
an order of magnitude.
Example 3
In Situ Hybridization of a Tissue Section Using
Crosslinker-Containing Probes
[0101] If the sample type is a tissue section, thin (5 .mu.m)
tissue sections are first cut from paraffin-embedded tissue blocks
and then placed on glass slides. The embedded tissue is dewaxed by
two five minute immersions in xylene, washed twice in 100% ethanol,
and airdried. After this, the assay procedure is the same as for
cell-based in situ hybridization, starting from the
paraformaldehyde fixing step (see Example 1, above).
Example 4
In Situ Hybridization Assay for Human Papillomavirus 16 DNA in
Clinical Specimens
[0102] Pap smear samples from two patients were collected, and
placed into a buffered methanol solution (PreserveCyt.TM. solution,
from CYTYC Corporation). Several drops of this solution were
spotted onto poly-L-lysine coated slides (Newcomer Supply) and left
to dry.
[0103] The immobilized cells were treated with pepsin (50 ug/mL) in
20 mM HCl at 37.degree. C. for 20 minutes and then rinsed with
water. The assay procedure given in Example 1 was then followed.
The assay was performed with 17 nucleic acid probes, sequence ID
numbers 1, 3, 4, 5, 6, 7, 8, 9, 12, 14, 15, 16, 17, 18, 19, 20 and
21, using 10 pmol of total probe amount (0.588 pmol of each probe)
per assay.
[0104] Examination of the assays using fluorescence microscopy
indicated sample 1 was positive for HPV 16 DNA and sample 2 was
negative.
[0105] Cells from the same patient samples not fixed on slides were
also tested for HPV 16 using a PCR procedure. The results from the
PCR tests correlated with the results obtained by the in situ
hybridization assay.
[0106] All documents cited in the above specification are herein
incorporated by reference. Various modifications and variations of
the present invention will be apparent to those skilled in the art
without departing from the scope and spirit of the invention.
Although the invention has been described in connection with
specific preferred embodiments, it should be understood that the
invention as claimed should not be unduly limited to such specific
embodiments. Indeed, various modifications of the described modes
for carrying out the invention which are obvious to those skilled
in the art are intended to be within the scope of the following
claims.
1TABLE 1 Human Papillomavirus Type 16 Probes complementary to
sequences within the E6 and E7 genes Probes for Example 2: 1-14
Probes for Example 4: 1,3,4,5,6,7,8,9,12,14, 15,16,17,18,19,20,21
Probe and SEQ ID No. Sequence 1 3'-GTGGTTTTCTCTTGACGTTACAXAF 2
3'-GGTGTCCTCGCTGGGTCTTTCAXTF 3 3'-AXATTATAATCTTACACACATGACF 4
3'-TATACGACATACACTATTTACAX- AF 5 3'-AXAATAAGATTTTAATCACTCATAF 6
3'-TXATCTTGTCGTTATGTTGTTTGGF 7 3'-AXACAATTAATCCACATAATTGA- CF 8
3'-AXACAGGACTTCTTTTCGTTTCTGF 9 3'-AXACCTGTTTTTCGTTTCTAAGGTF 10
3'-TACGTACCTCTATGTGGATGTX- AF 11 3'-TAXATACAATCTAAACGTTGGTCTCF 12
3'-TTCGTCTTGGCCTGTCTCGGGTXAF 13 3'-GAXATGCGAAGCCAACACGCAT- GTTF 14
3'-GTGTGTGCATCTGTAAGCATGAXAF 15 3'-AXTACGTGTCTCGACGTTTGTTGAF 16
3'-GACGCAGCACTCCATATACTGA- XAF 17 3'-AXAGCCCTAAATACGTATCATATAF 18
3'-TXATAACAATATCAAACATACCTTF 19 3'-AXATTCCCCAGCCACCTGGCCA- GCF 20
3'-AXAACAACGTCTAGTAGTTCTTGAF 21 3'-TXACATTGGAAAACAACGTTCACAF X =
crosslinker = 3-O-(7-coumarinyl)glycerol F = fluorescein
[0107]
Sequence CWU 1
1
21 1 23 DNA Artificial Sequence nucleic acid probe 1 aacattgcag
ttctcttttg gtg 23 2 23 DNA Artificial Sequence nucleic acid probe 2
tactttctgg gtcgctcctg tgg 23 3 23 DNA Artificial Sequence nucleic
acid probe 3 cagtacacac attctaatat taa 23 4 23 DNA Artificial
Sequence nucleic acid probe 4 aacatttatc acatacagca tat 23 5 23 DNA
Artificial Sequence nucleic acid probe 5 atactcacta attttagaat aaa
23 6 23 DNA Artificial Sequence nucleic acid probe 6 ggtttgttgt
attgctgttc tat 23 7 23 DNA Artificial Sequence nucleic acid probe 7
cagttaatac acctaattaa caa 23 8 23 DNA Artificial Sequence nucleic
acid probe 8 gtctttgctt ttcttcagga caa 23 9 23 DNA Artificial
Sequence nucleic acid probe 9 tggaatcttt gctttttgtc caa 23 10 22
DNA Artificial Sequence nucleic acid probe 10 atgtaggtgt atctccatgc
at 22 11 24 DNA Artificial Sequence nucleic acid probe 11
ctctggttgc aaatctaaca taat 24 12 23 DNA Artificial Sequence nucleic
acid probe 12 atgggctctg tccggttctg ctt 23 13 24 DNA Artificial
Sequence nucleic acid probe 13 ttgtacgcac aaccgaagcg taag 24 14 23
DNA Artificial Sequence nucleic acid probe 14 aagtacgaat gtctacgtgt
gtg 23 15 23 DNA Artificial Sequence nucleic acid probe 15
agttgtttgc agctctgtgc ata 23 16 23 DNA Artificial Sequence nucleic
acid probe 16 aagtcatata cctcacgacg cag 23 17 24 DNA Artificial
Sequence nucleic acid probe 17 atatactatg cataaatccc gcaa 24 18 23
DNA Artificial Sequence nucleic acid probe 18 ttccatacaa actataacaa
tat 23 19 23 DNA Artificial Sequence nucleic acid probe 19
cgaccggtcc accgacccct taa 23 20 23 DNA Artificial Sequence nucleic
acid probe 20 agttcttgat gatctgcaac aaa 23 21 23 DNA Artificial
Sequence nucleic acid probe 21 acacttgcaa caaaaggtta cat 23
* * * * *