U.S. patent application number 10/627768 was filed with the patent office on 2004-09-30 for uncoupling protein homologue: ucp3.
Invention is credited to Boss, Olivier, Giacobino, Jean-Paul, Muzzin, Patrick.
Application Number | 20040191800 10/627768 |
Document ID | / |
Family ID | 4201804 |
Filed Date | 2004-09-30 |
United States Patent
Application |
20040191800 |
Kind Code |
A1 |
Giacobino, Jean-Paul ; et
al. |
September 30, 2004 |
Uncoupling protein homologue: UCP3
Abstract
The present invention relates to the cloned genes which code for
uncoupling proteins controlling thermogenesis in human skeletal
muscle and heart. A further aspect of the present invention relates
to the use of the said genes for correcting dysfunctions of
thermogenesis in human skeletal muscle and heart. The present
invention makes it possible to exploit novel therapeutic (or
preventive) methods for disorders such as obesity or cachexia. As a
result of the identification and isolation of the genes coding for
UCP3.sub.L and UCP3.sub.S, it is, in effect, possible to develop
medicaments which act on the basis of a correction, by gene therapy
or by antisense oligonucleotides relating to the sequence of the
gene in question or to one of its fragments, of a lack or an excess
of UCP3.
Inventors: |
Giacobino, Jean-Paul;
(Geneve, CH) ; Muzzin, Patrick; (Gland, CH)
; Boss, Olivier; (Boston, MA) |
Correspondence
Address: |
NOVARTIS
CORPORATE INTELLECTUAL PROPERTY
ONE HEALTH PLAZA 430/2
EAST HANOVER
NJ
07936-1080
US
|
Family ID: |
4201804 |
Appl. No.: |
10/627768 |
Filed: |
July 25, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10627768 |
Jul 25, 2003 |
|
|
|
09423410 |
Nov 4, 1999 |
|
|
|
6620594 |
|
|
|
|
09423410 |
Nov 4, 1999 |
|
|
|
PCT/EP98/02645 |
May 5, 1998 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/189; 435/320.1; 435/325; 435/69.1; 536/23.2 |
Current CPC
Class: |
C07K 14/705 20130101;
A61K 48/00 20130101; C12N 2799/021 20130101; C12N 2799/028
20130101; C12N 2799/022 20130101; A61P 43/00 20180101; A61P 3/04
20180101 |
Class at
Publication: |
435/006 ;
435/069.1; 435/189; 435/320.1; 435/325; 536/023.2 |
International
Class: |
C12Q 001/68; C07H
021/04; C12N 009/02 |
Foreign Application Data
Date |
Code |
Application Number |
May 7, 1997 |
CH |
1072/97 |
Claims
1. DNA fragment, characterized in that it contains the nucleotide
sequence depicted in SEQ ID NO 3, the said DNA fragment coding for
an uncoupling protein (UCP3.sub.L) which is characterized by the
amino acid sequence depicted in SEQ ID NO 4, or in that it contains
a homologous sequence coding for the same amino acid sequence.
2. DNA fragment according to claim 1, characterized in that it
originates from human skeletal muscle.
3. DNA fragment, characterized in that it contains the nucleotide
sequence depicted in SEQ ID NO 5, the said DNA fragment coding for
an uncoupling protein (UCP3.sub.S) possessing the amino acid
sequence depicted in SEQ ID NO 6, or in that it contains a
homologous sequence coding for the same amino acid sequence.
4. DNA fragment according to claim 3, characterized in that it
originates from human skeletal muscle.
5. Uncoupling protein, characterized in that it comprises the amino
acid sequence depicted in SEQ ID NO 4.
6. Uncoupling protein, characterized in that it comprises the amino
acid sequence depicted in SEQ ID NO 6.
7. Recombinant DNA fragment, characterized in that it comprises a
DNA sequence according to claims 1, 2, 3 or 4, or one of their
homologous sequences.
8. DNA molecule, characterized in that it comprises a cloning
vector into which a DNA sequence according to one of claims 1 to 4
or 7 is inserted.
9. DNA molecule according to claim 8, characterized in that the
cloning vector is a plasmid or a phage.
10. Recombinant DNA molecule according to claim 9, characterized in
that it consists of the nucleotide sequence depicted in SEQ ID NO
3, inserted into the vector pBluescript SK.sup.-.
11. Recombinant DNA molecule according to claim 10, deposited with
the ATCC (NO 97999).
12. Recombinant DNA molecule according to claim 9, characterized in
that it consists of the nucleotide sequence depicted in SEQ ID NO
5, inserted into the vector pBluescript SK.sup.-.
13. Recombinant DNA molecule according to claim 12, deposited with
the ATCC (NO 209000).
14. Microorganism selected from bacteria, yeasts and mammalian
cells, characterized in that it contains a recombinant DNA molecule
as claimed in claims 7 to 13.
15. Microorganism according to claim 14, characterized in that it
is an XL1-Blue MRF' bacterium (E. coli).
16. Pharmaceutical formulation for correcting a lack of UCP3
(UCP3.sub.L, UCP3.sub.S) by gene therapy, which comprises the gene
described in SEQ ID NO 3 or NO 5 and a suitable pharmaceutical
vehicle.
17. Pharmaceutical formulation according to claim 16, characterized
in that the said gene is contained in a vector chosen from
adenoviruses, retroviruses, adeno-associated viruses, herpesvirus,
liposomes or DNA plasmids.
18. Pharmaceutical formulation for correcting an excess of UCP3
(UCP3.sub.L, UCP3.sub.S), characterized in that it comprises as
active principle, antisense oligonucleotides relating to fragments
of the sequences of UCP3.sub.L or of UCP3.sub.S.
Description
[0001] The present invention relates to a cloned gene which codes
for an uncoupling protein (UCP3.sub.L) which controls thermogenesis
in human skeletal muscle and heart.
[0002] The present invention also relates to a cloned gene which
codes for an uncoupling protein (UCP3.sub.S), also controlling
thermogenesis in human skeletal muscle and heart.
[0003] A further aspect of the present invention relates to the use
of the said cloned genes for correcting dysfunctions of
thermogenesis in human skeletal muscle and heart.
[0004] A dysfunction of thermogenesis can induce disorders such as
obesity or cachexia.
[0005] Obesity is characterized by an excess of adipose mass which
can represent more than 30% of the bodyweight. The incidence of
this disturbance of energy balance is constantly increasing in
industrialized countries. Preventing the development of obesity, or
treating it, would enable the complications associated with this
pathology, namely cardiovascular diseases, hypertension and type II
diabetes, to be avoided.
[0006] In some special cases, the control of thermogenesis could
also prove useful. In man, weight loss following a slimming diet
induces a saving of energy by the body. On resumption of normal
feeding, the energy expenditure remains reduced until the body has
recovered the adipose mass and the lean mass which it has lost
previously. This decrease in energy expenditure often leads to an
excess weight regain. A similar problem is encountered in endurance
athletes as soon as they stop training. In effect, in a trained
person, the energy expenditure is decreased relative to that of a
sedentary person. This energy saving is responsible for a
substantial weight gain (most especially of fat) after chronic
physical activity has been stopped.
[0007] Cachexia is a metabolic situation in which the energy
expenditure exceeds the food intake. Its main causes are
underfeeding (e.g. anorexia nervosa), cancer, infectious diseases
including AIDS and a state of shock. The decrease in adipose and
muscle masses can threaten the individual's survival.
[0008] The energy expenditure is increased in the mitochondria by
uncoupling of the oxidative phosphorylations. The oxidations induce
the exit of protons (H.sup.+) from the mitochondrion, creating a
proton gradient which, as it dissipates, permits the synthesis of
ATP. Uncoupling can be induced by chemical compounds such as
2,4-dinitrophenol (DNP) and by other acidic aromatic compounds.
These substances carry H.sup.+ from the outside to the inside of
the inner mitochondrial membrane. In the presence of these
uncoupling agents, the oxidation of NADH takes place normally, but
ATP is not formed by the mitochondrial ATP synthetase since the
proton gradient is dissipated.
[0009] Brown adipose tissue (BAT), which is very rich in
mitochondria, is specialized in this process of thermogenesis. The
inner membrane of its mitochondria contains a large amount of an
uncoupling protein (UCP) which enables protons to return from the
outside to the inside of the mitochondrion. In essence, the
uncoupling protein produces heat by short-circuiting the battery of
mitochondrial protons. In spite of its tissue specificity, UCP is a
member of the mitochondrial carrier family, which includes the
ATP/ADP, phosphate and 2-oxoglutarate/malate carriers, in
particular. In contrast to the ATP/ADP carrier, which is a
constitutive carrier, UCP is subjected to substantial regulatory
processes (M. Klingenberg, J. Bioenerg. Biomembr. 25, 447 (1993)).
Its activity is decreased by purine di- or triphosphate nucleotides
and increased by fatty acids (J. Nedergaard, B. Cannon, in New
Comprehensive Biochemistry (Bioenergetics) L. Ernster, Ed (Elsevier
Science, Stockholm, 1992), vol. 23, 385).
[0010] The uncoupling of oxidative phosphorylation is very useful
from a biological standpoint; it is a means for BAT to generate
heat in order to maintain a physiological temperature in the
newborn offspring of some animals (including man) and in the
mammals of the cold regions.
[0011] The human UCP gene is localized at 4q31; it consists of six
exons and codes for a protein of 307 amino acids with no targeting
presequence signal. Like other mitochondrial carriers, UCP is
inserted into the mitochondrial membrane by six hydrophobic
.alpha.-helical domains, each encoded by a portion of the six exons
(L. P. Kozak et al., J. Biol. Chem. 263, 12274 (1988)). Its
polypeptide chain consists of three related sequences in tandem of
approximately 100 amino acids, each encoded by two exons and
corresponding to two transmembrane domains (F. Bouillaud et al.,
Biochem. Biophys. Res. Commun. 157, 783 (1988)). Topological
studies suggest that the amino- and carboxy-terminal ends of UCP
are oriented towards the cytosol side of the inner mitochondrial
membrane (B. Miroux et al., EMBO J. 12, 3739 (1993)). Furthermore,
J. Nedergaard et al. (New Comprehensive Biochemistry
(Bioenergetics) L. Ernster, Ed. (Elsevier Science, Stockholm,
1992), vol. 23, 385) and D. Ricquier et al. (FASEB J. 5, 2237
(1991)) have shown that the expression of UCP is increased at
transcriptional level by noradrenaline. This effect is mediated by
stimulation of the three subtypes of .beta.-adrenoceptors
(.beta..sub.1, .beta..sub.2 and .beta..sub.3) and of the
.alpha..sub.1-adrenoceptor.
[0012] However, M. E. J. Lean et al. (Brown Adipose Tissue P.
Trayhurn, D. G. Nicholls, Eds, (Edward Arnold, London, 1986), 339)
have shown that, in man, the BAT, expressing UCP, present in
newborn infants decreases considerably in adults. Hence, under
physiological conditions, BAT cannot play an important part in
non-shivering thermogenesis in man.
[0013] On the other hand, L. Simonsen et al. (Int. J. Obes. 17, S47
(1993)) have determined that, in man, skeletal muscle contributes
to the extent of approximately 40% to adrenaline-induced body
thermogenesis. Studies performed on rats (P. L. Thurlby et al.,
Can. J. Physiol. Pharmacol. 64, 1111 (1986); I. Nagase et al., J.
Clin. Invest. 97, 2898 (1996)) suggest that adrenaline-induced
thermogenesis in human skeletal muscle (L. Simonsen et al., Int. J.
Obes. 17, S47 (1993)) could be mediated by a muscle UCP.
[0014] In the search for homologues of UCP in human skeletal
muscle, we have screened a library of human skeletal muscle cDNA,
and three clones (UCP2, UCP3.sub.L and UCP3.sub.S) have been
isolated. Whereas UCP2 mRNA has been found in all human tissues
studied, as has also been described by Fleury et al. (Nature Genet.
15, 269 (1997)), UCP3 has proved to be very specific to human
skeletal muscle. This new member of the UCP family, with a strong
specificity of expression in skeletal muscle, is involved in the
control of oxidative phosphorylations in man.
[0015] The characterization of the genes coding for UCP3.sub.L and
UCP3.sub.S in terms of nucleotides and of amino acids is described
here for the first time.
[0016] One aspect of the present invention is hence a DNA fragment,
characterized in that it contains the nucleotide sequence depicted
in SEQ ID NO 3, the said DNA fragment coding for an uncoupling
protein (UCP3.sub.L) which is characterized by the amino acid
sequence depicted in SEQ ID NO 4, or in that it contains a
homologous sequence coding for the same amino acid sequence.
Preferably, the chosen DNA fragment originates from human skeletal
muscle.
[0017] Another aspect of the present invention is a DNA fragment,
characterized in that it contains the nucleotide sequence depicted
in SEQ ID NO 5, the said DNA fragment coding for an uncoupling
protein (UCP3.sub.S) possessing the amino acid sequence depicted in
SEQ ID NO 6, or in that it contains a homologous sequence coding
for the same amino acid sequence. Preferably, the chosen DNA
fragment originates from human skeletal muscle.
[0018] One subject of the present invention is an uncoupling
protein, characterized in that it comprises the amino acid sequence
depicted in SEQ ID NO 4.
[0019] Another subject of the present invention is an uncoupling
protein, characterized in that it comprises the amino acid sequence
depicted in SEQ ID NO 6.
[0020] Furthermore, the present invention sets out to provide a
recombinant DNA fragment which contains one of the nucleotide
sequences depicted in SEQ ID NO 3 or NO 5, or one of their
homologous sequences.
[0021] Another subject of the present invention provides a DNA
molecule, characterized in that it comprises a cloning vector into
which one of the said DNA sequences is inserted. Preferably, this
cloning vector is a plasmid or a phagemid.
[0022] Another subject of the present invention is a recombinant
DNA molecule, characterized in that it consists of the nucleotide
sequence depicted in SEQ ID NO 3, inserted into the vector
pBluescript SK.sup.-. This recombinant DNA molecule is deposited
with the ATCC, Rockville, Md. 20852 USA (ATCC Designation NO
97999--date of deposition: Apr. 25, 1997).
[0023] Another subject of the present invention is a recombinant
DNA molecule, characterized in that it consists of the nucleotide
sequence depicted in SEQ ID NO 5, inserted into the vector
pBluescript SK.sup.-. This recombinant DNA molecule is deposited
with the ATCC, Rockville, Md. 20852 USA (ATCC Designation NO
209000--date of deposition: Apr. 25, 1997).
[0024] Another subject of the present invention is a microorganism
selected from bacteria, yeasts and mammalian cells, characterized
in that it contains one of the said recombinant DNA molecules.
Preferably, the chosen microorganism is an XL1 -Blue MRF' bacterium
(E. coli).
[0025] Another aspect of the present invention relates to a
pharmaceutical formulation for correcting a lack of UCP3 by gene
therapy, which comprises the gene described in SEQ ID NO 3 or NO 5
and a suitable pharmaceutical vehicle. The said gene is preferably
contained in a vector chosen from adenoviruses, retroviruses,
adeno-associated viruses, herpesvirus, liposomes or DNA
plasmids.
[0026] Construction of the adenoviral vector and production of the
recombinant adenovirus may be accomplished using standard
techniques (Graham et al., Method in Molecular Biology, 1991, Vol.
7, chap. 11, Murray, E. J., Ed., The Humana Press, Inc., Clifton,
N.J.; Zabner et al., Cell, 75, 207-216 (1993); Crystal, et al.,
Nature Genetics, 8, 42-51 (1994)).
[0027] Construction of the retroviral vector and production of the
recombinant retrovirus may be accomplished using standard
techniques (Miller, A. D. et al., Meth. Enzymol., 217, 581-599
(1993); Blaese et al., Human Gene Therapy, 1, 331-362, (1990)).
[0028] Construction of the adeno-associated viral vector and
production of the recombinant adeno-associated virus may be
accomplished using standard techniques (Muzyczka, Curr. Top.
Microbiol. Immunol., 158, 97-129 (1992)).
[0029] Construction of the herpesviral vector and production of the
recombinant herpesvirus may be accomplished using standard
techniques (Glorioso et al., Semin. Virol., 3, 265-276 (1992)).
[0030] Production of the liposome containing the UCP3 gene may be
accomplished using standard techniques (Kirby et al.,
Biotechnology, 2, 979-984 (1984); Feigner et al., Proc Natl Acad
Sci USA, 84, 7413-7417 (1987); Gregoriadis et al., J. Drug
Targeting, 3, 467-475 (1966)).
[0031] Construction of the DNA plasmid and production of the
recombinant DNA plasmid may be accomplished using standard
techniques (Lee et al., Cancer Res., 54, 3325-3328 (1994)). The
functionality of the recombinant retroviral vector, the recombinant
adeno-associated viral vector, the recombinant herpesviral vector,
the UCP3 gene encapsidated in the liposome, and the recombinant DNA
plasmid may, in each case, be evaluated by the expression of UCP3
in transfected cells and by the presence of the UCP3 protein, using
the northern blot technique (Sambrook, et al., Molecular Cloning,
1989, Nolan, C., Ed., Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.) and the western blot technique (Sambrook, et
al., Molecular Cloning, 1989, Nolan, C., Ed., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.), respectively.
[0032] In addition, a subject of the present invention is a
medicament for correcting an excess of UCP3, which comprises as
active principle antisense oligonucleotides relating to fragments
of the sequences of UCP3.sub.L and of UCP3.sub.S.
[0033] The present invention thus makes it possible to exploit
novel therapeutic (or preventive) methods for disorders of the
abovementioned type. As a result of the identification and
isolation of the genes coding for UCP3.sub.L and UCP3.sub.S, it is,
in effect, possible to develop medicaments which act on the basis
of a correction, by gene therapy or by antisense oligonucleotides
relating to the sequence of the gene in question or to one of its
fragments, of a lack or an excess of UCP3.
[0034] Gene therapy is indicated in the case of a dysfunction of
UCP3 due to one or more mutations of the UCP3 gene. In this case,
there is transfer of a normal gene into the UCP3-deficient cells
using an appropriate vector. Preferably, the vector is chosen from
adenoviruses, retroviruses, adeno-associated viruses, herpesvirus,
liposomes or plasmids. In this case the UCP3 gene is under the
control of an exogenous promoter. The administration of antisense
oligonucleotides is specifically indicated for cases where the UCP3
level and/or the activity of the UCP3 might be excessive.
[0035] By means of the present invention, it will, in addition, be
possible to develop medicaments which act on the modification of
the activity and/or on the level of expression of endogenous
UCP3.
[0036] Intervention in respect of the modification of endogenous
UCP3 activity could be especially indicated for inducing a loss of
bodyweight (loss of adipose mass and maintenance of the lean mass)
in all types of obesity by promoting the dissipation of energy. It
was shown that the level of UCP3 mRNA in skeletal muscle is lower
in fa/fa obese rats than in lean Fa/? rats (O. Boss et al., J.
Biol. Chem. 273, 5 (1998)). The same intervention could also be
applied for preventing an excessive weight regain following a
restrictive food diet or after ceasing a physical training
programme. It was shown that food restriction induces a decrease in
the UCP3 gene expression in skeletal muscle (O. Boss et al., J.
Biol. Chem. 273, 5 (1998)), and this expression remains very low
for a prolonged period of time during refeeding (D. W. Gong et al.,
J. Biol. Chem. 272, 24129 (1997)). It was also reported that
endurance exercise training induces a decrease in the UCP3 gene
expression in skeletal muscle (O. Boss et al., FASEB J 12, 335
(1998)). The same intervention could be applied for preventing and
treating type II diabetes by improving the sensitivity to insulin,
and for preventing hypertension. The same intervention could also
be applied for increasing muscle mass in states of cachexia. It
could also be applied for the treatment of insufficiencies or
disturbances of cardiac rhythm due to a dysfunction of UCP3, or for
the treatment of neuromuscular diseases due to a dysfunction of
UCP3. The UCP3 activators or inhibitors could be administered
enterally or parenterally.
[0037] Modification of the level of expression of endogenous UCP3
would also be indicated for the abovementioned cases; intervention
could take place using activators or inhibitors of UCP3 expression.
These substances could be administered enterally or parenterally.
Possible candidates for modulating the expression would be
activators or inhibitors of transcription factors specific to UCP3,
or hormones. It was shown that thyroid hormones (T3),
glucocorticoids (dexamethasone), .beta.-adrenergic receptor
agonists (Ro 16-8714), leptin, and fatty acids induce an increase
in the UCP3 gene expression in skeletal muscle (D. W. Gong et al.,
J. Biol. Chem. 272, 24129 (1997), S. Larkin et al., Biochem.
Biophys. Res. Com. 240, 222 (1997), O. Boss et al., Unpublished
observations (1997), I. Cusin et al., Diabetes, (in press, 1998),
D. S. Weigle et al., Diabetes 47, 298 (1998)). On the other hand
hypothyroidism was shown to be associated with a lower level of
UCP3 mRNA in skeletal muscle (D. W. Gong et al., J. Biol. Chem.
272, 24129 (1997)).
[0038] The construction of cells containing the UCP3.sub.L and/or
UCP3.sub.S gene may be accomplished using standard techniques
(Methods in Molecular Biology, 1991, Vol. 7, chap. 2-5, Murray, E.
J., Ed., The Humana Press, Inc., Clifton, N.J.; Sambrook, et al.,
Molecular Cloning, 1989, Nolan, C., Ed., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.). The expression of the
UCP3 gene in the transfected cells may be evaluated by the northern
blot technique and western blot technique. Cultured C.sub.2C.sub.12
mouse myoblasts have been transfected with the human UCP3.sub.L
cDNA, and the expression of UCP3 has been evaluated by the northern
blot technique (O. Boss et al., J. Biol. Chem. 273, 5 (1998)). The
functionality of the UCP3 protein may be evaluated by measuring the
respiration on isolated cells expressing the UCP3 protein or
mitochondrial fractions (Methods in Enzymology, Vol. 10, chap. 14,
86-94 (1967)) containing the UCP3 protein. The measurements of
oxygen consumption are performed by polarography (Methods in
Enzymology, Vol.10, chap. 7, 41-48 (1967)) using a Clark electrode.
It is also possible to evaluate the activity of the UCP3 protein
using cytofluorometric methods for measuring the mitochondrial
membrane potential (Methods in Enzymology, Vol. 260, chap. 29,
406-417, chap. 31, 428-447 (1985)). Fluorescent compounds are used
to analyse the changes in mitochondrial membrane potential. With
the help of a cytofluorometric method the UCP3 has been shown to
decrease the mitochondrial membrane potential of C.sub.2C.sub.12
mouse myoblasts that have been transfected with the human
UCP3.sub.L cDNA (O. Boss et al., J. Biol. Chem. 273, 5 (1998)). A
screening of medicaments capable of modifying UCP3 activity could
be accomplished by measuring the oxygen consumption and/or the
mitochondrial membrane potential on isolated cells and/or
mitochondria containing the UCP3 protein. Medicaments that modify
the activity of the UCP3 protein could then be tested in vivo on
animal models displaying an excess or otherwise a defect of UCP3
activity.
[0039] Antibodies, or their derivatives, against UCP3 or UCP3
fragments could be developed in order to enable the UCP3 level to
be measured in biological samples for diagnostic purposes. These
antibodies could serve to target substances in proximity to UCP3
with a view to modifying UCP3 activity.
[0040] In addition, transgenic animals expressing an excess of
normal or modified UCP3, and animals with an invalidation of the
UCP3 (knock-out), could be created in order to permit an evaluation
of the biological role of UCP3 and/or the effects of a change in
activity and/or in level and/or in structure of the UCP3 on the
animal's biology. The transgenic animals could also be used to
screen or test substances that modify UCP3 expression and/or
activity.
[0041] Other advantages of the present invention will become
manifest on reading the description which follows.
[0042] Brief description of the figures as disclosed in O. Boss et
al., FEBS Lett. 408, 39 (1997) which are hereby incorporated by
reference into the present specification:
[0043] FIG. 1: Alignment of the amino acid sequences of human
UCP3.sub.L, UCP3.sub.S, UCP2 and UCP, obtained using the ClustalW
Multiple Sequence Alignment programme (K. C. Worley, Human Genome
Center, Baylor College of Medicine). The sequences are presented
according to the one-letter code. The spaces introduced into the
sequences to optimize the alignment are illustrated by a dash. The
potential transmembrane .alpha.-helices are underlined and numbered
using Roman numbers (I-VI). The potential purine nucleotide binding
domain (PNBD) is doubly underlined. The 3 signature domains of the
mitochondrial energy transfer proteins are boxed. The 14 amino
acids which are fully conserved in the mitochondrial carriers are
indicated with asterisks.
[0044] FIG. 2: Expression of UCP2 and UCP3 in human and rat
tissues. (A) Autoradiogram of a northern blot of poly(A) RNA of
various human tissues hybridized with a .sup.32P-labelled human
UCP2 probe consisting of whole UCP2 cDNA. The molecular size
markers are indicated in kb. Inset: Expression of UCP2 in total
RNAs. Brown adipose tissue (BAT); white adipose tissue (WAT). (B)
Autoradiogram of a northern blot of poly(A) RNA of various human
tissues hybridized with a .sup.32P-labelled human UCP3 probe
consisting of whole UCP3 cDNA. Inset: Expression of UCP3 in total
RNAs. (C) Autoradiogram of a northern blot of total RNAs of various
rat tissues. The .sup.32P-labelled rat atypical UCP cDNA probe
hybridizes with the three rat UCPs, UCP (1.4 kb), UCP2 (1.7 kb) and
UCP3 (2.5 and 2.8 kb).
PREPARATION OF A RAT ATYPICAL UCP cDNA PROBE AND SCREENING OF THE
HUMAN SKELETAL MUSCLE cDNA LIBRARY (O. Boss et al., FEBS Lett. 408,
39 (1997))
[0045] Total RNAs of rat tibialis anterior muscle and interscapular
BAT were purified by the method described by Chomczynski et al.
(Anal. Biochem. 162, 156 (1987)). 1-2 .mu.g of each RNA were
reverse transcribed using oligo(dT).sub.15 primers and Moloney
murine leukaemia virus (M-MLV) reverse transcriptase (Gibco BRL,
New York, N.Y.). Briefly, the RNA was mixed with 1.5 .mu.l (150 ng)
of oligo(dT).sub.15 in a total volume of 17.5 .mu.l. The mixture
was heated to 70.degree. C. for 10 min and cooled on ice. After a
brief centrifugation, the RNA was reverse transcribed for one hour
at 41.degree. C. (total volume 25 .mu.l). The aliquots of first
strand cDNA were stored at -20.degree. C. until use. The polymerase
chain reaction was performed in a Perkin Elmer DNA Thermal Cycler
480 (Perkin Elmer, Lausanne, Switzerland). The first strand cDNA (2
.mu.l) was amplified in a total volume of 50 .mu.l in the presence
of oligonucleotide primers corresponding, on rat UCP, to domains
conserved between the species:
1 positions CTGGACACCGCCAAAGTCCG (UCPRF) 279-298: positions
AGCACACAAACATGATGACGTTCC (UCPRR) 1021-1044:
[0046] on GenBank Accession M11814. A unique fragment of similar
size was obtained in the BAT and in the tibialis anterior muscle.
The sequence of the BAT PCR product was identical to that of rat
UCP, whereas the sequence of the tibialis anterior muscle PCR
product was 60% identical to that of rat UCP. This fragment, called
rat atypical UCP cDNA, was radioactively labelled with the
nucleotide [.alpha.-.sup.32P]dCTP and used as probe to screen a
human skeletal muscle cDNA library (Stratagene, #936215, La Jolla,
Calif.).
[0047] Approximately one million phages of the human skeletal
muscle cDNA library (Human Muscle cDNA Library Lambda ZAP.RTM. II
Vector, #936215, Stratagene) were screened using the abovementioned
rat atypical UCP cDNA probe according to the manufacturer's
instructions (8th Mar. 1994). The screening led to the isolation of
ten positive clones. Among these, three different categories were
purified using a kit for plasmids (Qiagen, Santa Clarita, Calif.)
according to the manufacturer's instructions, and sequenced with an
ABI373A automatic sequencer according to the standard protocols
using the oligonucleotide primers M13-20 and T3 and others specific
to the gene, until the sequence was determined on both strands. The
predicted peptide sequences of these three clones, which contain
309, 312 and 275 amino acids, are illustrated in FIG. 1 (O. Boss et
al., FEBS Lett. 408, 39 (1997)). The protein of 309 amino acids is
UCP2 (GenBank Accession U82819), which was also isolated by Fleury
et al., (Nature Genet. 15, 269 (1997)). The other two proteins have
their first 275 amino acids in common, suggesting that they are
isoforms. It was shown that these isoforms arise from alternative
splicing of the UCP3 RNA (G. Solanes et al., J. Biol. Chem. 272,
25433 (1997)). They have a 56 % and 73% identity of amino acids
with human UCP and UCP2, respectively, and are hence considered to
be new proteins, called UCP3 long and short forms, UCP3.sub.L and
UCP3.sub.S, respectively (GenBank Accessions U84763 and U82818).
Like the other mitochondrial carriers, UCP2 and UCP3.sub.L contain
six potential transmembrane domains (FIG. 1). The potential purine
nucleotide binding domain extends from nucleotides 276 to 298 in
UCP2 and from 279 to 301 in UCP3.sub.L. UCP3.sub.S does not have
the sixth potential transmembrane region, or the purine nucleotide
binding domain involved in the control of the uncoupling activity
of UCP (F. Bouillaud et al., EMBO J. 13,1990(1994)).
[0048] The binding of guanosine diphosphate (GDP) to UCP induces a
conformational change causing an inhibition of the permeability of
H.sup.+ and Cl.sup.- ions (J. Nedergaard et al., in New
Comprehensive Biochemistry (Bioenergetics) L. Ernster, Ed.
(Elsevier Science, Stockholm, 1992), vol.23, 385). Thus, UCP3.sub.S
appears to exert its biological activity without control by GDP. As
illustrated in FIG. 1, other structural features of the
mitochondrial carriers are observed in UCP2, as well as in
UCP3.sub.L and UCP3.sub.S: the three signature domains of the
mitochondrial energy transfer proteins (A. Bairoch, Nucleic Acids
Res. 21, 3097 (1993)), which can be identified at the downstream
border of the first, third and fifth potential transmembrane
domains (O. Boss et al., FEBS Lett. 408, 39 (1997)), and the
fourteen conserved residues of the mitochondrial carriers (F.
Palmieri, FEBS Lett. 346, 48 (1994)).
[0049] UCP2 and UCP3 have the strongest homology (with respect to
amino acids and nucleotides) with UCP, compared to the other
members of the mitochondrial carrier family (O. Boss et al., FEBS
Lett. 408, 39 (1997)). In fact, their identity with UCP is 55% and
56%, respectively, whereas that with the most homologous
mitochondrial protein, the 2-oxoglutarate/malate carrier, is 32 %.
UCP2 and UCP3 should hence belong to the UCP family. In fact,
Fleury et al., (Nature Genet. 15, 269 (1997)) and Gimeno et al.
(Diabetes 46, 900 (1997)) have shown that UCP2 has mitochondrial
uncoupling properties when it is expressed in yeast, whereas Gong
et al. (J. Biol. Chem. 272, 24129 (1997)) and Boss et al. (J. Biol.
Chem. 273, 5 (1998)) have shown that UCP3 has mitochondrial
uncoupling properties when it is expressed in yeast or in
C.sub.2C.sub.12 mouse myoblasts, respectively.
COMPARISON OF THE DISTRIBUTION OF UCP2 AND UCP3 IN HUMAN AND RAT
TISSUES (O. Boss et al., FEBS Lett. 408, 39 (1997))
[0050] The tissue distribution of UCP3 was compared with that of
UCP2 by northern blotting. For this purpose, the following
materials were made available:
[0051] Samples of Human Tissues
[0052] The poly(A) RNA membrane of numerous human tissues (#7760-1)
is obtained from Clontech Laboratories Inc. (Palo Alto, Calif.).
Fragments of abdominal white adipose tissue (10 to 40 g) or of
abdominal skeletal muscle (800 mg) were obtained during
intra-abdominal surgical operations. Pieces of perirenal brown
adipose tissue weighing approximately 1.5 g were obtained during
renal surgical operations on children (average age: 3 months). The
project was approved by the Ethical Committee of the Department of
Surgery, Faculty of Medicine, University of Geneva.
[0053] Samples of Rat Tissues
[0054] Seven-week-old male Sprague-Dawley rats fed ad libitum with
a standard laboratory feed were kept in individual cages with a
day-night cycle of 12 h. They were sacrificed by cervical
dislocation. All the experiments were performed in accordance with
the instructions of our establishment.
[0055] Northern Analysis
[0056] The total RNAs (10-20 .mu.g) were subjected to
electrophoresis in a 1.2% agarose gel containing formaldehyde, as
described by Lehrach et al., (Biochemistry 16, 4743 (1977)), and
transferred onto a nylon membrane (Electran Nylon Blotting
Membrane, BDH Laboratory Supplies, Poole, United Kingdom) with a
vacuum apparatus (Stratagene, La Jolla, Calif.). The probes were
labelled using random primers (Megaprime DNA Labelling System,
Amersham, Bucks, United Kingdom) with [.alpha.-.sup.32P]dCTP (3000
Ci/mmol) (Amersham, Bucks, United Kingdom) at a specific activity
of approximately 1.times.10.sup.9 dpm/.mu.g DNA. The RNA membranes
were hybridized for 2 h at 65.degree. C. in QuikHyb (Stratagene, La
Jolla, Calif.), and then washed in a 2.times.SSC (1.times.SSC is
150 mM NaCl, 15 mM sodium citrate, pH 7.0)/0.1% SDS solution at
50.degree. C. for twice 5 minutes and in 0.1.times.SSC/0.1% SDS at
50.degree. C. for 5 minutes. The membranes were exposed to
Hyperfilm ECL films (Amersham, Bucks, United Kingdom) at
-80.degree. C. with intensifying screens. The standard RNAs used
are the Kb RNA Ladder from Gibco BRL (New York, N.Y.).
[0057] As illustrated in FIG. 2A, a UCP2 signal 1.7 kb in size was
detected in all the tissues studied. UCP2 is expressed at the
highest level in BAT>white adipose tissue>skeletal muscle. In
contrast, the expression of UCP3 (signal at 2.3 kb) is limited to
the skeletal muscle and the heart. In the latter tissue, UCP3 is 10
times less strongly expressed than in skeletal muscle (FIG. 2B).
Direct comparison of the northern blots hybridized with the UCP2
and UCP3 probes showed that UCP3 is much more strongly expressed in
skeletal muscle than UCP2. Probes specific for the long form or the
short form of UCP3 showed that both forms give the same signal at
2.3 kb, and quantification of the intensity of the signal showed
that both forms are expressed at a similar level in human skeletal
muscle (O. Boss et al., FEBS Lett. 408, 39 (1997)).
[0058] The tissue distribution of UCP2 mRNA and UCP3 mRNA was also
studied in rats using the rat atypical UCP cDNA probe, which
hybridizes with the three species of rat UCP, UCP, UCP2 and UCP3
(O. Boss et al., FEBS Lett. 408, 39 (1997)). As illustrated in FIG.
2C, UCP2 is expressed in all the tissues studied:
heart>BAT>white adipose tissue>skeletal muscle. A major
difference from human UCP2 is its high level of expression in
heart. UCP3 is expressed at the highest level in BAT, at a high
level in the tensor fascia latae (fast-twitch, glycolytic),
tibialis anterior (fast-twitch, oxidative-glycolytic) and
gastrocnemius (mixed) muscles and at a lower level in the soleus
muscle (slow-twitch, oxidative). This suggests that UCP3 is more
strongly expressed in the glycolytic than in the oxidative skeletal
muscles. In rats, UCP3 was also detected, though at a much lower
level, in the heart and kidney, and occasionally in the white
adipose tissue.
[0059] It can be seen in FIG. 2C that the UCP3 signal is a doublet
whereas that of UCP2 is unique. The size of the messengers,
compared with an RNA ladder, are 1.4 and 1.8 kb for UCP, 1.7 kb for
UCP2 and 2.5 and 2.8 kb for UCP3.
[0060] The results thus show that the tissue distribution of UCP2
and UCP3 in man is very different from that of UCP: the expression
of UCP2 is ubiquitous and that of UCP3 is highly specific to
skeletal muscle.
Sequence CWU 1
1
6 1 20 DNA Unknown Description of Unknown Organism Oligonucleotide
Primer DNA (UCPRF) 1 ctggacaccg ccaaagtccg 20 2 24 DNA Unknown
Description of Unknown Organism Oligonucleotide Primer DNA (UCPRR)
2 agcacacaaa catgatgacg ttcc 24 3 1231 DNA Unknown Description of
Unknown Organism cDNA from clone UCP3L 3 tcctgggatg gagccctagg
gagcccctgt gctgcccctg ccgtggcagg actcacagcc 60 ccaccgctgc
actgaagccc agggctgtgg agcagcctct ctccttggac ctcctctcgg 120
ccctaaaggg actgggcaga gccttccagg actatggttg gactgaagcc ttcagacgtg
180 cctcccacca tggctgtgaa gttcctgggg gcaggcacag cagcctgttt
tgctgacctc 240 gttacctttc cactggacac agccaaggtc cgcctgcaga
tccaggggga gaaccaggcg 300 gtccagacgg cccggctcgt gcagtaccgt
ggcgtgctgg gcaccatcct gaccatggtg 360 cggactgagg gtccctgcag
cccctacaat gggctggtgg ccggcctgca gcgccagatg 420 agcttcgcct
ccatccgcat cggcctctat gactccgtca agcaggtgta cacccccaaa 480
ggcgcggaca actccagcct cactacccgg attttggccg gctgcaccac aggagccatg
540 gcggtgacct gtgcccagcc cacagatgtg gtgaaggtcc gatttcaggc
cagcatacac 600 ctcgggccat ccaggagcga cagaaaatac agcgggacta
tggacgccta cagaaccatc 660 gccagggagg aaggagtcag gggcctgtgg
aaaggaactt tgcccaacat catgaggaat 720 gctatcgtca actgtgctga
ggtggtgacc tacgacatcc tcaaggagaa gctgctggac 780 taccacctgc
tcactgacaa cttcccctgc cactttgtct ctgcctttgg agccggcttc 840
tgtgccacag tggtggcctc cccggtggac gtggtgaaga cccggtatat gaactcacct
900 ccaggccagt acttcagccc cctcgactgt atgataaaga tggtggccca
ggagggcccc 960 acagccttct acaagggatt tacaccctcc tttttgcgtt
tgggatcctg gaacgtggtg 1020 atgttcgtaa cctatgagca gctgaaacgg
gccctgatga aagtccagat gttacgggaa 1080 tcaccgtttt gaacaagaca
agaaggccac tggtagctaa cgtgtccgaa accagttaag 1140 aatggaagaa
aacggtgcat ccacgcacac atggacacag acccacacat gtttacagaa 1200
ctgttgttta cttgttgctg attcaagaaa c 1231 4 312 PRT Unknown
Description of Unknown Organism Protein UCP3L 4 Met Val Gly Leu Lys
Pro Ser Asp Val Pro Pro Thr Met Ala Val Lys 1 5 10 15 Phe Leu Gly
Ala Gly Thr Ala Ala Cys Phe Ala Asp Leu Val Thr Phe 20 25 30 Pro
Leu Asp Thr Ala Lys Val Arg Leu Gln Ile Gln Gly Glu Asn Gln 35 40
45 Ala Val Gln Thr Ala Arg Leu Val Gln Tyr Arg Gly Val Leu Gly Thr
50 55 60 Ile Leu Thr Met Val Arg Thr Glu Gly Pro Cys Ser Pro Tyr
Asn Gly 65 70 75 80 Leu Val Ala Gly Leu Gln Arg Gln Met Ser Phe Ala
Ser Ile Arg Ile 85 90 95 Gly Leu Tyr Asp Ser Val Lys Gln Val Tyr
Thr Pro Lys Gly Ala Asp 100 105 110 Asn Ser Ser Leu Thr Thr Arg Ile
Leu Ala Gly Cys Thr Thr Gly Ala 115 120 125 Met Ala Val Thr Cys Ala
Gln Pro Thr Asp Val Val Lys Val Arg Phe 130 135 140 Gln Ala Ser Ile
His Leu Gly Pro Ser Arg Ser Asp Arg Lys Tyr Ser 145 150 155 160 Gly
Thr Met Asp Ala Tyr Arg Thr Ile Ala Arg Glu Glu Gly Val Arg 165 170
175 Gly Leu Trp Lys Gly Thr Leu Pro Asn Ile Met Arg Asn Ala Ile Val
180 185 190 Asn Cys Ala Glu Val Val Thr Tyr Asp Ile Leu Lys Glu Lys
Leu Leu 195 200 205 Asp Tyr His Leu Leu Thr Asp Asn Phe Pro Cys His
Phe Val Ser Ala 210 215 220 Phe Gly Ala Gly Phe Cys Ala Thr Val Val
Ala Ser Pro Val Asp Val 225 230 235 240 Val Lys Thr Arg Tyr Met Asn
Ser Pro Pro Gly Gln Tyr Phe Ser Pro 245 250 255 Leu Asp Cys Met Ile
Lys Met Val Ala Gln Glu Gly Pro Thr Ala Phe 260 265 270 Tyr Lys Gly
Phe Thr Pro Ser Phe Leu Arg Leu Gly Ser Trp Asn Val 275 280 285 Val
Met Phe Val Thr Tyr Glu Gln Leu Lys Arg Ala Leu Met Lys Val 290 295
300 Gln Met Leu Arg Glu Ser Pro Phe 305 310 5 1132 DNA Unknown
Description of Unknown Organism cDNA from clone UCP3S 5 tcctgggatg
gagccctagg gagcccctgt gctgcccctg ccgtggcagg actcacagcc 60
ccaccgctgc actgaagccc agggctgtgg agcagcctct ctccttggac ctcctctcgg
120 ccctaaaggg actgggcaga gccttccagg actatggttg gactgaagcc
ttcagacgtg 180 cctcccacca tggctgtgaa gttcctgggg gcaggcacag
cagcctgttt tgctgacctc 240 gttacctttc cactggacac agccaaggtc
cgcctgcaga tccaggggga gaaccaggcg 300 gtccagacgg cccggctcgt
gcagtaccgt ggcgtgctgg gcaccatcct gaccatggtg 360 cggactgagg
gtccctgcag cccctacaat gggctggtgg ccggcctgca gcgccagatg 420
agcttcgcct ccatccgcat cggcctctat gactccgtca agcaggtgta cacccccaaa
480 ggcgcggaca actccagcct cactacccgg attttggccg gctgcaccac
aggagccatg 540 gcggtgacct gtgcccagcc cacagatgtg gtgaaggtcc
gatttcaggc cagcatacac 600 ctcgggccat ccaggagcga cagaaaatac
agcgggacta tggacgccta cagaaccatc 660 gccagggagg aaggagtcag
gggcctgtgg aaaggaactt tgcccaacat catgaggaat 720 gctatcgtca
actgtgctga ggtggtgacc tacgacatcc tcaaggagaa gctgctggac 780
taccacctgc tcactgacaa cttcccctgc cactttgtct ctgcctttgg agccggcttc
840 tgtgccacag tggtggcctc cccggtggac gtggtgaaga cccggtatat
gaactcacct 900 ccaggccagt acttcagccc cctcgactgt atgataaaga
tggtggccca ggagggcccc 960 acagccttct acaaggggtg agcctcctcc
tgcctccagc actccctccc agagaacagg 1020 ggcttctttc ttttcgaatg
tggctaccgt gggtcaacct gggatgtagc ggtgaagagt 1080 acagatgtaa
atgccacaaa gaagaagttt aaaaaaccat gcaaaaaaaa aa 1132 6 275 PRT
Unknown Description of Unknown Organism Protein UCP3S 6 Met Val Gly
Leu Lys Pro Ser Asp Val Pro Pro Thr Met Ala Val Lys 1 5 10 15 Phe
Leu Gly Ala Gly Thr Ala Ala Cys Phe Ala Asp Leu Val Thr Phe 20 25
30 Pro Leu Asp Thr Ala Lys Val Arg Leu Gln Ile Gln Gly Glu Asn Gln
35 40 45 Ala Val Gln Thr Ala Arg Leu Val Gln Tyr Arg Gly Val Leu
Gly Thr 50 55 60 Ile Leu Thr Met Val Arg Thr Glu Gly Pro Cys Ser
Pro Tyr Asn Gly 65 70 75 80 Leu Val Ala Gly Leu Gln Arg Gln Met Ser
Phe Ala Ser Ile Arg Ile 85 90 95 Gly Leu Tyr Asp Ser Val Lys Gln
Val Tyr Thr Pro Lys Gly Ala Asp 100 105 110 Asn Ser Ser Leu Thr Thr
Arg Ile Leu Ala Gly Cys Thr Thr Gly Ala 115 120 125 Met Ala Val Thr
Cys Ala Gln Pro Thr Asp Val Val Lys Val Arg Phe 130 135 140 Gln Ala
Ser Ile His Leu Gly Pro Ser Arg Ser Asp Arg Lys Tyr Ser 145 150 155
160 Gly Thr Met Asp Ala Tyr Arg Thr Ile Ala Arg Glu Glu Gly Val Arg
165 170 175 Gly Leu Trp Lys Gly Thr Leu Pro Asn Ile Met Arg Asn Ala
Ile Val 180 185 190 Asn Cys Ala Glu Val Val Thr Tyr Asp Ile Leu Lys
Glu Lys Leu Leu 195 200 205 Asp Tyr His Leu Leu Thr Asp Asn Phe Pro
Cys His Phe Val Ser Ala 210 215 220 Phe Gly Ala Gly Phe Cys Ala Thr
Val Val Ala Ser Pro Val Asp Val 225 230 235 240 Val Lys Thr Arg Tyr
Met Asn Ser Pro Pro Gly Gln Tyr Phe Ser Pro 245 250 255 Leu Asp Cys
Met Ile Lys Met Val Ala Gln Glu Gly Pro Thr Ala Phe 260 265 270 Tyr
Lys Gly 275
* * * * *