U.S. patent application number 10/698689 was filed with the patent office on 2004-09-23 for antisense modulation of cd40 expression.
Invention is credited to Bennett, C. Frank, Cowsert, Lex M., Eldrup, Anne B., Malik, Leila, Siwkowski, Andrew.
Application Number | 20040186071 10/698689 |
Document ID | / |
Family ID | 38233450 |
Filed Date | 2004-09-23 |
United States Patent
Application |
20040186071 |
Kind Code |
A1 |
Bennett, C. Frank ; et
al. |
September 23, 2004 |
Antisense modulation of CD40 expression
Abstract
Antisense compounds, compositions and methods are provided for
modulating the expression of CD40. The compositions comprise
antisense compounds, particularly antisense oligonucleotides,
targeted to nucleic acids encoding CD40. Methods of using these
compounds for modulation of CD40 expression and for treatment of
diseases associated with CD40 are provided.
Inventors: |
Bennett, C. Frank;
(Carlsbad, CA) ; Cowsert, Lex M.; (Pittsburgh,
PA) ; Malik, Leila; (Copenhagen, DK) ;
Siwkowski, Andrew; (Carlsbad, CA) ; Eldrup, Anne
B.; (Ridgefield, CT) |
Correspondence
Address: |
WOODCOCK WASHBURN LLP
ONE LIBERTY PLACE - 46TH FLOOR
PHILADELPHIA
PA
19103
US
|
Family ID: |
38233450 |
Appl. No.: |
10/698689 |
Filed: |
October 31, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10698689 |
Oct 31, 2003 |
|
|
|
10261382 |
Sep 30, 2002 |
|
|
|
10698689 |
Oct 31, 2003 |
|
|
|
PCT/US03/31166 |
Sep 30, 2003 |
|
|
|
10698689 |
Oct 31, 2003 |
|
|
|
09067638 |
Apr 28, 1998 |
|
|
|
60081483 |
Apr 13, 1998 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/23.5 |
Current CPC
Class: |
A61K 48/00 20130101;
C12N 15/1138 20130101; C12N 15/1048 20130101; C12N 2310/11
20130101; C12N 2310/321 20130101; A61K 38/00 20130101; C07K 14/003
20130101; C12N 2310/3513 20130101; C12N 2310/321 20130101; C12N
2310/52 20130101; B01J 2219/007 20130101; C12N 2310/3521 20130101;
C12N 2310/3181 20130101 |
Class at
Publication: |
514/044 ;
536/023.5 |
International
Class: |
A61K 048/00; C07H
021/04 |
Claims
What is claimed is:
1. An antisense compound 8 to 80 nucleobases in length targeted to
a nucleic acid molecule encoding CD40, wherein said compound is at
least 70% complementary to said nucleic acid molecule encoding
CD40, and wherein said compound inhibits the expression of CD40
mRNA by at least 10%.
2. The antisense compound of claim 1 comprising 12 to 50
nucleobases in length.
3. The antisense compound of claim 2 comprising 15 to 30
nucleobases in length.
4. The antisense compound of claim 1 comprising an
oligonucleotide.
5. The antisense compound of claim 4 comprising a DNA
oligonucleotide.
6. The antisense compound of claim 4 comprising an RNA
oligonucleotide.
7. The antisense compound of claim 4 comprising a chimeric
oligonucleotide.
8. The antisense compound of claim 4 wherein at least a portion of
said compound hybridizes with RNA to form an oligonucleotide-RNA
duplex.
9. The antisense compound of claim 1 having at least 80%
complementarity with said nucleic acid molecule encoding CD40.
10. The antisense compound of claim 1 having at least 90%
complementarity with said nucleic acid molecule encoding CD40.
11. The antisense compound of claim 1 having at least 95%
complementarity with said nucleic acid molecule encoding CD40.
12. The antisense compound of claim 1 having at least 99%
complementarity with said nucleic acid molecule encoding CD40.
13. The antisense compound of claim 1 having at least one modified
internucleoside linkage, sugar moiety, or nucleobase.
14. The antisense compound of claim 1 having at least one
2'-O-methoxyethyl sugar moiety.
15. The antisense compound of claim 1 having at least one
phosphorothioate internucleoside linkage.
16. The antisense compound of claim 1 wherein at least one cytosine
is a 5-methylcytosine.
17. A method of inhibiting the expression of CD40 in a cell or
tissue comprising contacting said cell or tissue with the antisense
compound of claim 1 so that expression of CD40 is inhibited.
18. The method of claim 17 wherein said cells are B-cells or
macrophages.
19. A method of screening for a modulator of CD40, the method
comprising the steps of: contacting a preferred target segment of a
nucleic acid molecule encoding CD40 with one or more candidate
modulators of CD40, and identifying one or more modulators of CD40
expression which modulate the expression of CD40.
20. The method of claim 19 wherein the modulator of CD40 expression
comprises an oligonucleotide, an antisense oligonucleotide, a DNA
oligonucleotide, an RNA oligonucleotide, an RNA oligonucleotide
having at least a portion of said RNA oligonucleotide capable of
hybridizing with RNA to form an oligonucleotide-RNA duplex, or a
chimeric oligonucleotide.
21. A diagnostic method for identifying a disease state comprising
identifying the presence of CD40 in a sample using at least one of
the primers comprising SEQ ID NOs 86 or 87, or the probe comprising
SEQ ID NO: 88.
22. A kit or assay device comprising the antisense compound of
claim 1.
23. A method of treating an animal having a disease or condition
associated with CD40 comprising administering to said animal a
therapeutically or prophylactically effective amount of the
antisense compound of claim 1 so that expression of CD40 is
inhibited.
24. The method of claim 23 wherein the disease or condition is an
immune-associated disorder, an inflammatory condition or a
hyperproliferative condition.
25. The method of claim 24 wherein the immune-associated disorder
is graft-versus-host disease, allograft rejection or an autoimmune
disease or condition.
26. The method of claim 24 wherein the inflammatory condition is
asthma, rheumatoid arthritis, allograft rejection, inflammatory
bowel disease or psoriasis.
27. The method of claim 24 wherein the hyperproliferative condition
is atherosclerosis, cancer or a tumor.
28. The antisense compound of claim 1, wherein said antisense
compound comprises at least an 8-nucleobase portion of SEQ ID NOs
1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 20, 23, 25, 26, 27, 31,
32, 33, 35, 37, 40, 41, 43, 46, 47, 49, 52, 53, 54, 57, 58, 59, 60,
64, 65, 71, 73, 74, 77, 81 or 82.
29. The antisense compound of claim 28, wherein said antisense
compound has a sequence selected from the group consisting of SEQ
ID NOs 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 20, 23, 25, 26,
27, 31, 32, 33, 35, 37, 40, 41, 43, 46, 47, 49, 52, 53, 54, 57, 58,
59, 60, 64, 65, 71, 73, 74, 77, 81 and 82.
30. The antisense compound of claim 1, wherein said antisense
compound comprises at least an 8-nucleobase portion of SEQ ID NO
116, 117, 118, 119, 120, 123, 124, 125, 127, 128, 130, 131, 134,
138, 139, 142, 143, 144, 145, 146, 147, 153, 154, 155, 156, 157,
158, 159 or 160.
31. The antisense compound of claim 30, wherein said antisense
compound has a sequence selected from the group consisting of SEQ
ID NOs 116, 117, 118, 119, 120, 123, 124, 125, 127, 128, 130, 131,
134, 138, 139, 142, 143, 144, 145, 146, 147, 153, 154, 155, 156,
157, 158, 159 and 160.
32. The antisense compound of claim 1, wherein said antisense
compound comprises an antisense nucleic acid molecule that is
specifically hybridizable with a 5'-untraslated region (5' UTR) of
a nucleic acid molecule encoding CD40.
33. The antisense compound of claim 1, wherein said antisense
compound comprises an antisense nucleic acid molecule that is
specifically hybridizable with a start region of a nucleic acid
molecule encoding CD40.
34. The antisense compound of claim 1, wherein said antisense
compound comprises an antisense nucleic acid molecule that is
specifically hybridizable with a coding region of a nucleic acid
molecule encoding CD40.
35. The antisense compound of claim 1, wherein said antisense
compound comprises an antisense nucleic acid molecule that is
specifically hybridizable with a stop region of a nucleic acid
molecule encoding CD40.
36. The antisense compound of claim 1, wherein said antisense
compound comprises an antisense nucleic acid molecule that is
specifically hybridizable with a 3'-untranslated region of a
nucleic acid molecule encoding CD40.
37. The antisense compound of claim 1 which does not elicit RNase H
cleavage of its RNA target in an antisense compound-target RNA
duplex.
38. The antisense compound of claim 14 wherein every sugar moiety
is a 2'-O-methoxyethyl sugar moiety.
39. The antisense compound of claim 1 which is a peptide-nucleic
acid antisense compound.
40. The antisense compound of claim 39 wherein the peptide-nucleic
acid antisense compound has at least one cationic moiety conjugated
thereto.
41. The antisense compound of claim 40 wherein at least one
cationic moiety is conjugated to the C-terminal end of the
peptide-nucleic acid antisense compound.
42. The antisense compound of claim 40 wherein at least one
cationic moiety is conjugated to the N-terminal end of the
peptide-nucleic acid antisense compound.
43. The antisense compound of claim 40 wherein at least one
cationic moiety is conjugated to the N-terminal end and at least
one cationic moiety is conjugated to the C-terminal end of the
peptide-nucleic acid antisense compound.
44. The antisense compound of claim 40 wherein the cationic moiety
comprises a cationic amino acid.
45. The antisense compound of claim 44 wherein the cationic amino
acid is L-lysine, D-lysine, L-dimethylysine, D-dimethylysine,
L-histidine, D-histidine, L-ornithine, D-ornithine, L-arginine,
L-homoarginine, D-homoarginine, L-norarginine, D-norarginine,
L-homohomoarginine, D-homohomoarginine, lysine peptoid, 2,4-diamino
butyric acid, homolysine or .beta.-lysine.
46. The antisense compound of claim 45 wherein the cationic amino
acid is L-lysine or L-arginine.
47. The antisense compound of claim 40 wherein the peptide-nucleic
acid antisense compound has at least two cationic moieties
conjugated thereto.
48. The antisense compound of claim 47 wherein the peptide-nucleic
acid antisense compound has at least three cationic moieties
conjugated thereto.
49. The antisense compound of claim 48 wherein the peptide-nucleic
acid antisense compound has at least four cationic moieties
conjugated thereto.
50. The antisense compound of claim 49 wherein the peptide-nucleic
acid antisense compound has at least five cationic moieties
conjugated thereto.
51. The antisense compound of claim 50 wherein the peptide-nucleic
acid antisense compound has at least six cationic moieties
conjugated thereto.
52. The antisense compound of claim 51 wherein the peptide-nucleic
acid antisense compound has at least seven cationic moieties
conjugated thereto.
53. The antisense compound of claim 52 wherein the peptide-nucleic
acid antisense compound has at least eight cationic moieties
conjugated thereto.
54. The antisense compound of claim 39 wherein the peptide-nucleic
acid antisense compound is at least 12 nucleobases in length.
55. The antisense compound of claim 54 wherein the peptide-nucleic
acid antisense compound is at least 14 nucleobases in length
56. The antisense compound of claim 1 wherein said CD40 is human or
mouse CD40.
57. An antisense compound of claim 37 which causes redirection of
splicing of CD40 RNA.
58. The antisense compound of claim 57 wherein the ratio of CD40
Type 2 transcript is increased relative to the CD40 Type 1
transcript.
59. the antisense compound of claim 58 wherein the expression of
cell surface-associated CD40 is reduced.
60. The antisense compound of claim 1 which reduces CD40
signaling.
61. The antisense compound of claim 60 which reduces CD40-dependent
IL-12 cytokine production.
62. A method of redirecting splicing of CD40 RNA in a cell or
tissue comprising contacting said cell or tissue with an antisense
compound of claim 57, so that the ratio of CD40 splice products is
altered.
63. The method of claim 62 wherein the ratio of CD40 Type 2
transcript is increased relative to the CD40 Type 1 transcript.
64. The method of claim 63 wherein CD40 signaling is reduced.
65. The method of claim 64 wherein IL-12 cytokine production is
reduced.
66. A method of reducing CD40 signaling in a cell or tissue
comprising contacting said cell or tissue with an antisense
compound of claim 57, so that the ratio of CD40 splice products is
altered and CD40 signaling is reduced.
67. A method of reducing IL-12 cytokine production in a cell or
tissue comprising contacting said cell or tissue with an antisense
compound of claim 57, so that the ratio of CD40 splice products is
altered and IL-12 cytokine production is reduced.
68. An immunomodulatory agent comprising an antisense compound of
claim 1.
69. An immunomodulatory agent comprising an antisense compound of
claim 57.
Description
[0001] This application is a continuation-in-part of U.S.
application Ser. No. 10/261,382 filed Sep. 30, 2002 and
International Patent Application No. PCT/US03/31166 filed Sep. 30,
2003. This application is also a continuation-in-part of U.S.
application Ser. No. 09/067,638, filed on Apr. 28, 1998, which
claims priority to U.S. application Ser. No. 60/081,483, filed on
Apr. 13, 1998. All of the foregoing are incorporated by reference
herein in their entirety.
FIELD OF THE INVENTION
[0002] The present invention provides compositions and methods of
modulating the expression of CD40. In particular, this invention
relates to antisense compounds, particularly oligonucleotides, that
are specifically hybridizable with nucleic acids encoding human
CD40. Such oligonucleotides have been shown to modulate the
expression of CD40.
BACKGROUND OF THE INVENTION
[0003] The immune system serves a vital role in protecting the body
against infectious agents. It is well established, however, that a
number of disease states and/or disorders are a result of either
abnormal or undesirable activation of immune responses. Common
examples include graft versus host disease (GVHD), graft rejection,
inflammation, and autoimmune linked diseases such as multiple
sclerosis (MS), systemic lupus erythematosus (SLE), and certain
forms of arthritis.
[0004] In general, an immune response is activated as a result of
either tissue injury or infection. Both cases involve the
recruitment and activation of a number of immune system effector
cells (i.e. B- and T-lymphocytes, macrophages, eosinophils,
neutrophils) in a process coordinated through a series of complex
cell-cell interactions. A typical scenario by which an immune
response is mounted against a foreign protein is as follows:
Foreign proteins captured by antigen presenting cells (APC's) such
as macrophages or dendritic cells are processed and displayed on
the cell surface of the APC. Circulating T-helper cells which
express an immunoglobulin that recognizes (i.e. binds) the
displayed antigen undergo activation by the APC. These activated
T-helpers in turn activate appropriate B-cell clones to proliferate
and differentiate into plasma cells that produce and secrete
humoral antibodies targeted against the foreign antigen. The
secreted humoral antibodies are free to circulate and bind to any
cells expressing the foreign protein on their cell surface, in
effect marking the cell for destruction by other immune effector
cells. In each of the stages described above, direct cell-cell
contact between the involved cell types is required in order for
activation to occur [Gruss et al., Leuk. Lymphoma, 24, 393 (1997)].
In recent years, a number of cell surface receptors that mediate
these cell-cell contact dependent activation events have been
identified. Among these cell surface receptors is CD40 and its
physiological ligand, CD40 Ligand (CD40L).
[0005] CD40 was first characterized as a receptor expressed on
B-lymphocytes. It was later found that engagement of B-cell CD40
with CD40L expressed on activated T-cells is essential for T-cell
dependent B-cell activation (i.e. proliferation, immunoglobulin
secretion, and class switching. It was subsequently revealed that
functional CD40 is expressed on a variety of cell types other than
B-cells, including macrophages, dendritic cells, thymic epithelial
cells, Langerhans cells, and endothelial cells. These studies have
led to the current belief that CD40 plays a broad role in immune
regulation by mediating interactions of T-cells with B-cells as
well as other cell types. In support of this notion, it has been
shown that stimulation of CD40 in macrophages and dendritic results
is required for T-cell activation during antigen presentation
[Gruss et al., Leuk. Lymphoma, 24, 393 (1997)]. Recent evidence
points to a role for CD40 in tissue inflammation as well.
Production of the inflammatory mediators IL-12 and nitric oxide by
macrophages have been shown to be CD40 dependent [Buhlmann and
Noelle, J. Clin. Immunol., 16, 83 (1996)]. In endothelial cells,
stimulation of CD40 by CD40L has been found to induce surface
expression of E-selectin, ICAM-1, and VCAM-1, promoting adhesion of
leukocytes to sites of inflammation [Buhlmann and Noelle, J. Clin.
Immunol., 16, 83 (1996); Gruss et al., Leuk. Lymphoma, 24, 393
(1997)]. Finally, a number of reports have documented
overexpression of CD40 in epithelial and hematopoietic tumors as
well as tumor infiltrating endothelial cells, indicating that CD40
may play a role in tumor growth and/or angiogenesis as well [Gruss
et al., Leuk. Lymphoma, 24, 393 (1997); Kluth et al., Cancer Res.,
57, 891 (1997)].
[0006] Due to the pivotal role that CD40 plays in humoral immunity,
the potential exists that therapeutic strategies aimed at
downregulating CD40 or interfering with CD40 signaling may provide
a novel class of agents useful in treating a number of immune
associated disorders, including but not limited to
graft-versus-host disease (GVHD), graft rejection, and autoimmune
diseases such as multiple sclerosis (MS), systemic lupus
erythematosus (SLE), and certain forms of arthritis. Inhibitors of
CD40 may also prove useful as anti-inflammatory compounds, and
could therefore be useful as treatment for a variety of
inflammatory and allergic conditions such as asthma, rheumatoid
arthritis, allograft rejections, inflammatory bowel disease,
autoimmune encephalomyelitis, thyroiditis, various dermatological
conditions, and psoriasis. Recently, both CD40 and CD154 have been
shown to be expressed on vascular endothelial cells, vascular
smooth muscle cells and macrophages present in atherosclerotic
plaques, suggesting that inflammation and immunity contribute to
the atherogenic process. That this process involves CD40 signaling
is suggested by several studies in mouse models in which disruption
of CD154 (by knockout or by monoclonal antibody) reduced the
progression or size of atherosclerotic lesions. Mach et al., 1998,
Nature, 394, 200-3, Lutgens et al., 1999, Nat Med. 5, 1313-6.
[0007] Finally, as more is learned of the association between CD40
overexpression and tumor growth, inhibitors of CD40 may prove
useful as anti-tumor agents and inhibitors of other
hyperproliferative conditions as well.
[0008] Currently, there are no known therapeutic agents which
effectively inhibit the synthesis of CD40. To date, strategies
aimed at inhibiting CD40 function have involved the use of a
variety of agents that disrupt CD40/CD40L binding. These include
monoclonal antibodies directed against either CD40 or CD40L,
soluble forms of CD40, and synthetic peptides derived from a second
CD40 binding protein, A20. The use of neutralizing antibodies
against CD40 and/or CD40L in animal models has provided evidence
that inhibition of CD40 signaling would have therapeutic benefit
for GVHD, allograft rejection, rheumatoid arthritis, SLE, MS, and
B-cell lymphoma [Buhlmann and Noelle, J. Clin. Immunol, 16, 83
(1996)]. Clinical investigations were initiated using CD154
monoclonal antibody in patients with lupus nephritis. However,
studies were terminated due to the development of thrombotic
events. Boumpas et al., 2003, Arthritis Rheum. Mar;48, 719-27.
[0009] Due to the problems associated with the use of large
proteins as therapeutic agents, there is a long-felt need for
additional agents capable of effectively inhibiting CD40 function.
Antisense oligonucleotides avoid many of the pitfalls of current
agents used to block CD40/CD40L interactions and may therefore
prove to be uniquely useful in a number of therapeutic, diagnostic
and research applications. U.S. Pat. No. 6,197,584 (Bennett and
Cowsert) discloses antisense compounds targeted to CD40.
[0010] Peptide nucleic acids, alternately referenced as PNAs, are
known to be useful as oligonucleotide mimetics. In PNAs, both the
sugar and the internucleoside linkage, i.e., the backbone, of the
nucleotide units of oligonucleotides are replaced with novel
groups. The sugar-backbone of an oligonucleotide is replaced with
an amide containing backbone, in particular an aminoethylglycine
backbone. The nucleobases are retained and are bound directly or
indirectly to aza nitrogen atoms of the amide portion of the
backbone. The base units, i.e., nucleobases, are maintained for
hybridization with an appropriate nucleic acid target compound.
[0011] PNAs have been shown to have excellent hybridization
properties as well as other properties useful for diagnostics,
therapeutics and as research reagents. They are particularly useful
as antisense reagents. Other uses include monitoring telomere
length, screening for genetic mutations and for affinity capture of
nucleic acids. As antisense reagents they can be used for
transcriptional and translational blocking of genes and to effect
alternate splicing. Further they can be used to bind to double
stranded nucleic acids. Each of these uses are known and have been
published in either the scientific or patent literature.
[0012] The synthesis of and use of PNAs has been extensively
described. Representative United States patents that teach the
preparation of and use of PNA compounds include, but are not
limited to, U.S. Pat. Nos. 5,539,082; 5,5539,083; 5,641,625;
5,714,331; 5,719,262; 5,766,855; 5,773,571; 5,786,461; 5,831,014;
5,864,010; 5,986,053; 6,201,103; 6,204,326; 6,210,892; 6,228,982;
6,350,853; 6,414,112; 6,441,130; and 6,451,968, each of which is
herein incorporated by reference. Additionally PNA compounds are
described in numerous published PCT patent applications including
WO 92/20702. Further teaching of PNA compounds can be found in
scientific publications. The first such publication was Nielsen et
al., Science, 1991, 254, 1497-1500.
[0013] Depending on sequence, the solubility of PNAs can differ
and, as such, some PNA sequences are not soluble as might be
desirable for a particular use. It was suggested in Karras, et al.,
Biochemistry, 2001, 40, 7853-7859, that PNAs could mediate splicing
activity in cells. They compared a PNA 15mer (a PNA having 15
monomeric units) to the same PNA having a single lysine amino acid
jointed to its C terminus. They suggested that the attached, i.e.,
conjugated, lysine residue might improve the cellular uptake.
However, they concluded that their present data "do not show a
clear difference in activity between the PNA 15mer with and without
a C-terminal lysine."
[0014] In published application US-2002-0049173-A1, published Apr.
25, 2002, it was suggested that antisense compounds might have one
or more cationic tails, preferable positively charged amino acids
such as lysine or arginine, conjugated thereto. It was further
suggested that one or more lysine or arginine residues might be
conjugated to the C-terminal end of a PNA compound. No
discrimination was made between the effects resulting from the
conjugation of one lysine or arginine versus more than one of these
lysine or arginine residues.
[0015] U.S. Pat. No. 6,593,292 suggests using guanidine or amidine
moieties for uptake of various compounds including macromolecules.
PNA is a suggested macromolecule. In one instance this patent
suggests that the guanidine or amidine moieties comprise
non-peptide backbones but in a further instance it suggested that
the guanidine moiety will exist as a polyarginine molecule.
However, no data is shown wherein any of these moieties are
actually conjugated to a macromolecule and uptake is achieved.
[0016] In a transgenic mouse model, a 4-lysine conjugated PNA
targeted to .beta.-globin was demonstrated to provide efficacy in a
range of tisues (Sazani et al., 2002, Nature Biotech. 20,
1228-1233).
SUMMARY OF THE INVENTION
[0017] The present invention is directed to antisense compounds,
particularly oligonucleotides, that are targeted to a nucleic acid
encoding CD40, and that modulate the expression of CD40.
Pharmaceutical and other compositions comprising the antisense
compounds of the invention are also provided. Further provided are
methods of modulating the expression of CD40 in cells or tissues
comprising contacting said cells or tissues with one or more of the
antisense compounds or compositions of the invention. Further
provided are methods of treating an animal, particularly a human,
suspected of having or being prone to a disease or condition
associated with expression of CD40 by administering a
therapeutically or prophylactically effective amount of one or more
of the antisense compounds or compositions of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0018] A. Overview of the Invention
[0019] The present invention employs antisense compounds,
preferably oligonucleotides and similar species for use in
modulating the function or effect of nucleic acid molecules
encoding CD40. This is accomplished by providing oligonucleotides
which specifically hybridize with one or more nucleic acid
molecules encoding CD40. As used herein, the terms "target nucleic
acid" and "nucleic acid molecule encoding CD40" have been used for
convenience to encompass DNA encoding CD40, RNA (including pre-mRNA
and mRNA or portions thereof) transcribed from such DNA, and also
cDNA derived from such RNA. The hybridization of a compound of this
invention with its target nucleic acid is generally referred to as
"antisense". Consequently, the preferred mechanism believed to be
included in the practice of some preferred embodiments of the
invention is referred to herein as "antisense inhibition." Such
antisense inhibition is typically based upon hydrogen bonding-based
hybridization of oligonucleotide strands or segments such that at
least one strand or segment is cleaved, degraded, or otherwise
rendered inoperable. In this regard, it is presently preferred to
target specific nucleic acid molecules and their functions for such
antisense inhibition.
[0020] The functions of DNA to be interfered with can include
replication and transcription. Replication and transcription, for
example, can be from an endogenous cellular template, a vector, a
plasmid construct or otherwise. The functions of RNA to be
interfered with can include functions such as translocation of the
RNA to a site of protein translation, translocation of the RNA to
sites within the cell which are distant from the site of RNA
synthesis, translation of protein from the RNA, splicing of the RNA
to yield one or more RNA species, and catalytic activity or complex
formation involving the RNA which may be engaged in or facilitated
by the RNA. One preferred result of such interference with target
nucleic acid function is modulation of the expression of CD40. In
the context of the present invention, "modulation" and "modulation
of expression" mean either an increase (stimulation) or a decrease
(inhibition) in the amount or levels of a nucleic acid molecule
encoding the gene, e.g., DNA or RNA. Inhibition is often the
preferred form of modulation of expression and mRNA is often a
preferred target nucleic acid.
[0021] In the context of this invention, "hybridization" means the
pairing of complementary strands of oligomeric compounds. In the
present invention, the preferred mechanism of pairing involves
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases (nucleobases) of the strands of oligomeric
compounds. For example, adenine and thymine are complementary
nucleobases which pair through the formation of hydrogen bonds.
Hybridization can occur under varying circumstances.
[0022] An antisense compound is specifically hybridizable when
binding of the compound to the target nucleic acid interferes with
the normal function of the target nucleic acid to cause a loss of
activity, and there is a sufficient degree of complementarity to
avoid non-specific binding of the antisense compound to non-target
nucleic acid sequences under conditions in which specific binding
is desired, i.e., under physiological conditions in the case of in
vivo assays or therapeutic treatment, and under conditions in which
assays are performed in the case of in vitro assays.
[0023] In the present invention the phrase "stringent hybridization
conditions" or "stringent conditions" refers to conditions under
which a compound of the invention will hybridize to its target
sequence, but to a minimal number of other sequences. Stringent
conditions are sequence-dependent and will be different in
different circumstances and in the context of this invention,
"stringent conditions" under which oligomeric compounds hybridize
to a target sequence are determined by the nature and composition
of the oligomeric compounds and the assays in which they are being
investigated.
[0024] "Complementary," as used herein, refers to the capacity for
precise pairing between two nucleobases of an oligomeric compound.
For example, if a nucleobase at a certain position of an
oligonucleotide (an oligomeric compound), is capable of hydrogen
bonding with a nucleobase at a certain position of a target nucleic
acid, said target nucleic acid being a DNA, RNA, or oligonucleotide
molecule, then the position of hydrogen bonding between the
oligonucleotide and the target nucleic acid is considered to be a
complementary position. The oligonucleotide and the further DNA,
RNA, or oligonucleotide molecule are complementary to each other
when a sufficient number of complementary positions in each
molecule are occupied by nucleobases which can hydrogen bond with
each other. Thus, "specifically hybridizable" and "complementary"
are terms which are used to indicate a sufficient degree of precise
pairing or complementarity over a sufficient number of nucleobases
such that stable and specific binding occurs between the
oligonucleotide and a target nucleic acid.
[0025] It is understood in the art that the sequence of an
antisense compound need not be 100% complementary to that of its
target nucleic acid to be specifically hybridizable. Moreover, an
oligonucleotide may hybridize over one or more segments such that
intervening or adjacent segments are not involved in the
hybridization event (e.g., a loop structure or hairpin structure).
It is preferred that the antisense compounds of the present
invention comprise at least 70%, or at least 75%, or at least 80%,
or at least 85% sequence complementarity to a target region within
the target nucleic acid, more preferably that they comprise at
least 90% sequence complementarity and even more preferably
comprise at least 95% or at least 99% sequence complementarity to
the target region within the target nucleic acid sequence to which
they are targeted. For example, an antisense compound in which 18
of 20 nucleobases of the antisense compound are complementary to a
target region, and would therefore specifically hybridize, would
represent 90 percent complementarity. In this example, the
remaining noncomplementary nucleobases may be clustered or
interspersed with complementary nucleobases and need not be
contiguous to each other or to complementary nucleobases. As such,
an antisense compound which is 18 nucleobases in length having 4
(four) noncomplementary nucleobases which are flanked by two
regions of complete complementarity with the target nucleic acid
would have 77.8% overall complementarity with the target nucleic
acid and would thus fall within the scope of the present invention.
Percent complementarity of an antisense compound with a region of a
target nucleic acid can be determined routinely using BLAST
programs (basic local alignment search tools) and PowerBLAST
programs known in the art (Altschul et al., J. Mol. Biol., 1990,
215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
[0026] Percent homology, sequence identity or complementarity, can
be determined by, for example, the Gap program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, Madison Wis.), using default settings,
which uses the algorithm of Smith and Waterman (Adv. Appl. Math.,
1981, 2, 482-489). In some preferred embodiments, homology,
sequence identity or complementarity, between the oligomeric and
target is between about 50% to about 60%. In some embodiments,
homology, sequence identity or complementarity, is between about
60% to about 70%. In preferred embodiments, homology, sequence
identity or complementarity, is between about 70% and about 80%. In
more preferred embodiments, homology, sequence identity or
complementarity, is between about 80% and about 90%. In some
preferred embodiments, homology, sequence identity or
complementarity, is about 90%, about 92%, about 94%, about 95%,
about 96%, about 97%, about 98%, about 99% or about 100%.
[0027] B. Compounds of the Invention
[0028] According to the present invention, antisense compounds
include antisense oligomeric compounds, antisense oligonucleotides,
ribozymes, external guide sequence (EGS) oligonucleotides,
alternate splicers, primers, probes, and other oligomeric compounds
which hybridize to at least a portion of the target nucleic acid.
As such, these compounds may be introduced in the form of
single-stranded, double-stranded, circular or hairpin oligomeric
compounds and may contain structural elements such as internal or
terminal bulges or loops. Once introduced to a system, the
compounds of the invention may elicit the action of one or more
enzymes or structural proteins to effect modification of the target
nucleic acid.
[0029] One non-limiting example of such an enzyme is RNAse H, a
cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. It is known in the art that single-stranded antisense
compounds which are "DNA-like" elicit RNAse H. Activation of RNase
H, therefore, results in cleavage of the RNA target, thereby
greatly enhancing the efficiency of oligonucleotide-mediated
inhibition of gene expression. Similar roles have been postulated
for other ribonucleases such as those in the RNase III and
ribonuclease L family of enzymes.
[0030] While the preferred form of antisense compound is a
single-stranded antisense oligonucleotide, in many species the
introduction of double-stranded structures, such as double-stranded
RNA (dsRNA) molecules, has been shown to induce potent and specific
antisense-mediated reduction of the function of a gene or its
associated gene products. The first evidence that dsRNA could lead
to gene silencing in animals came in 1995 from work in the
nematode, Caenorhabditis elegans (Guo and Kempheus, Cell, 1995, 81,
611-620). Montgomery et al. have shown that the primary
interference effects of dsRNA are posttranscriptional (Montgomery
et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507). The
posttranscriptional antisense mechanism defined in Caenorhabditis
elegans resulting from exposure to double-stranded RNA (dsRNA) has
since been designated RNA interference (RNAi). This term has been
generalized to mean antisense-mediated gene silencing involving the
introduction of dsRNA leading to the sequence-specific reduction of
endogenous targeted mRNA levels (Fire et al., Nature, 1998, 391,
806-811). Recently, it has been shown that it is, in fact, the
single-stranded RNA oligomers of antisense polarity of the dsRNAs
which are the potent inducers of RNAi (Tijsterman et al., Science,
2002, 295, 694-697).
[0031] In the context of this invention, the term "oligomeric
compound" refers to a polymer or oligomer comprising a plurality of
monomeric units. In the context of this invention, the term
"oligonucleotide" refers to an oligomer or polymer of ribonucleic
acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras,
analogs and homologs thereof. This term includes oligonucleotides
composed of naturally occurring nucleobases, sugars and covalent
internucleoside (backbone) linkages as well as oligonucleotides
having non-naturally occurring portions which function similarly.
Such modified or substituted oligonucleotides are often preferred
over native forms because of desirable properties such as, for
example, enhanced cellular uptake, enhanced affinity for a target
nucleic acid and increased stability in the presence of
nucleases.
[0032] While oligonucleotides are a preferred form of the antisense
compounds of this invention, the present invention comprehends
other families of antisense compounds as well, including but not
limited to oligonucleotide analogs and mimetics such as those
described herein.
[0033] The antisense compounds in accordance with this invention
preferably comprise from about 8 to about 80 nucleobases (i.e. from
about 8 to about 80 linked nucleosides). One of ordinary skill in
the art will appreciate that the invention embodies compounds of 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59,
60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76,
77, 78, 79, or 80 nucleobases in length.
[0034] In one preferred embodiment, the antisense compounds of the
invention are 12 to 50 nucleobases in length. One having ordinary
skill in the art will appreciate that this embodies compounds of
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,
46, 47, 48, 49, or 50 nucleobases in length.
[0035] In another preferred embodiment, the antisense compounds of
the invention are 15 to 30 nucleobases in length. One having
ordinary skill in the art will appreciate that this embodies
compounds of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30 nucleobases in length.
[0036] Particularly preferred compounds are oligonucleotides from
about 12 to about 50 nucleobases, even more preferably those
comprising from about 15 to about 30 nucleobases.
[0037] Antisense compounds 8-80 nucleobases in length comprising a
stretch of at least eight (8) consecutive nucleobases selected from
within the illustrative antisense compounds are considered to be
suitable antisense compounds as well.
[0038] Exemplary preferred antisense compounds include
oligonucleotide sequences that comprise at least the 8 consecutive
nucleobases from the 5'-terminus of one of the illustrative
preferred antisense compounds (the remaining nucleobases being a
consecutive stretch of the same oligonucleotide beginning
immediately upstream of the 5'-terminus of the antisense compound
which is specifically hybridizable to the target nucleic acid and
continuing until the oligonucleotide contains about 8 to about 80
nucleobases). Similarly preferred antisense compounds are
represented by oligonucleotide sequences that comprise at least the
8 consecutive nucleobases from the 3'-terminus of one of the
illustrative preferred antisense compounds (the remaining
nucleobases being a consecutive stretch of the same oligonucleotide
beginning immediately downstream of the 3'-terminus of the
antisense compound which is specifically hybridizable to the target
nucleic acid and continuing until the oligonucleotide contains
about 8 to about 80 nucleobases). It is also understood that
preferred antisense compounds may be represented by oligonucleotide
sequences that comprise at least 8 consecutive nucleobases from an
internal portion of the sequence of an illustrative preferred
antisense compound, and may extend in either or both directions
until the oligonucleotide contains about 8 to about 80
nucleobases.
[0039] One having skill in the art armed with the preferred
antisense compounds illustrated herein will be able, without undue
experimentation, to identify further preferred antisense
compounds.
[0040] C. Targets of the Invention
[0041] "Targeting" an antisense compound to a particular nucleic
acid molecule, in the context of this invention, can be a multistep
process. The process usually begins with the identification of a
target nucleic acid whose function is to be modulated. This target
nucleic acid may be, for example, a cellular gene (or mRNA
transcribed from the gene) whose expression is associated with a
particular disorder or disease state, or a nucleic acid molecule
from an infectious agent. In the present invention, the target
nucleic acid encodes CD40.
[0042] The targeting process usually also includes determination of
at least one target region, segment, or site within the target
nucleic acid for the antisense interaction to occur such that the
desired effect, e.g., modulation of expression, will result. Within
the context of the present invention, the term "region" is defined
as a portion of the target nucleic acid having at least one
identifiable structure, function, or characteristic. Within regions
of target nucleic acids are segments. "Segments" are defined as
smaller or sub-portions of regions within a target nucleic acid.
"Sites," as used in the present invention, are defined as positions
within a target nucleic acid.
[0043] Since, as is known in the art, the translation initiation
codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in
the corresponding DNA molecule), the translation initiation codon
is also referred to as the "AUG codon," the "start codon" or the
"AUG start codon". A minority of genes have a translation
initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG,
and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo.
Thus, the terms "translation initiation codon" and "start codon"
can encompass many codon sequences, even though the initiator amino
acid in each instance is typically methionine (in eukaryotes) or
formylmethionine (in prokaryotes). It is also known in the art that
eukaryotic and prokaryotic genes may have two or more alternative
start codons, any one of which may be preferentially utilized for
translation initiation in a particular cell type or tissue, or
under a particular set of conditions. In the context of the
invention, "start codon" and "translation initiation codon" refer
to the codon or codons that are used in vivo to initiate
translation of an mRNA transcribed from a gene encoding CD40,
regardless of the sequence(s) of such codons. It is also known in
the art that a translation termination codon (or "stop codon") of a
gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and
5'-UGA (the corresponding DNA sequences are 5'-TAA, 5'-TAG and
5'-TGA, respectively).
[0044] The terms "start codon region" and "translation initiation
codon region" refer to a portion of such an mRNA or gene that
encompasses from about 25 to about 50 contiguous nucleotides in
either direction (i.e., 5' or 3') from a translation initiation
codon. Similarly, the terms "stop codon region" and "translation
termination codon region" refer to a portion of such an mRNA or
gene that encompasses from about 25 to about 50 contiguous
nucleotides in either direction (i.e., 5' or 3') from a translation
termination codon. Consequently, the "start codon region" (or
"translation initiation codon region") and the "stop codon region"
(or "translation termination codon region") are all regions which
may be targeted effectively with the antisense compounds of the
present invention.
[0045] The open reading frame (ORF) or "coding region," which is
known in the art to refer to the region between the translation
initiation codon and the translation termination codon, is also a
region which may be targeted effectively. Within the context of the
present invention, a preferred region is the intragenic region
encompassing the translation initiation or termination codon of the
open reading frame (ORF) of a gene.
[0046] Other target regions include the 5' untranslated region
(5'UTR), known in the art to refer to the portion of an mRNA in the
5' direction from the translation initiation codon, and thus
including nucleotides between the 5' cap site and the translation
initiation codon of an mRNA (or corresponding nucleotides on the
gene), and the 3' untranslated region (3'UTR), known in the art to
refer to the portion of an mRNA in the 3' direction from the
translation termination codon, and thus including nucleotides
between the translation termination codon and 3' end of an mRNA (or
corresponding nucleotides on the gene). The 5' cap site of an mRNA
comprises an N7-methylated guanosine residue joined to the 5'-most
residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap
region of an mRNA is considered to include the 5' cap structure
itself as well as the first 50 nucleotides adjacent to the cap
site. It is also preferred to target the 5' cap region.
[0047] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns,"
which are excised from a transcript before it is translated. The
remaining (and therefore translated) regions are known as "exons"
and are spliced together to form a continuous mRNA sequence.
Targeting splice sites, i.e., intron-exon junctions or exon-intron
junctions, may also be particularly useful in situations where
aberrant splicing is implicated in disease, or where an
overproduction of a particular splice product is implicated in
disease. Aberrant fusion junctions due to rearrangements or
deletions are also preferred target sites. mRNA transcripts
produced via the process of splicing of two (or more) mRNAs from
different gene sources are known as "fusion transcripts". It is
also known that introns can be effectively targeted using antisense
compounds targeted to, for example, DNA or pre-mRNA.
[0048] It is also known in the art that alternative RNA transcripts
can be produced from the same genomic region of DNA. These
alternative transcripts are generally known as "variants". More
specifically, "pre-mRNA variants" are transcripts produced from the
same genomic DNA that differ from other transcripts produced from
the same genomic DNA in either their start or stop position and
contain both intronic and exonic sequence.
[0049] Upon excision of one or more exon or intron regions, or
portions thereof during splicing, pre-mRNA variants produce smaller
"mRNA variants". Consequently, mRNA variants are processed pre-mRNA
variants and each unique pre-mRNA variant must always produce a
unique mRNA variant as a result of splicing. These mRNA variants
are also known as "alternative splice variants". If no splicing of
the pre-mRNA variant occurs then the pre-mRNA variant is identical
to the mRNA variant.
[0050] It is also known in the art that variants can be produced
through the use of alternative signals to start or stop
transcription and that pre-mRNAs and mRNAs can possess more that
one start codon or stop codon. Variants that originate from a
pre-mRNA or mRNA that use alternative start codons are known as
"alternative start variants" of that pre-mRNA or mRNA. Those
transcripts that use an alternative stop codon are known as
"alternative stop variants" of that pre-mRNA or mRNA. One specific
type of alternative stop variant is the "polyA variant" in which
the multiple transcripts produced result from the alternative
selection of one of the "polyA stop signals" by the transcription
machinery, thereby producing transcripts that terminate at unique
polyA sites. Within the context of the invention, the types of
variants described herein are also preferred target nucleic
acids.
[0051] The locations on the target nucleic acid to which the
preferred antisense compounds hybridize are hereinbelow referred to
as "preferred target segments." As used herein the term "preferred
target segment" is defined as at least an 8-nucleobase portion of a
target region to which an active antisense compound is targeted.
While not wishing to be bound by theory, it is presently believed
that these target segments represent portions of the target nucleic
acid which are accessible for hybridization.
[0052] While the specific sequences of certain preferred target
segments are set forth herein, one of skill in the art will
recognize that these serve to illustrate and describe particular
embodiments within the scope of the present invention. Additional
preferred target segments may be identified by one having ordinary
skill.
[0053] Target segments 8-80 nucleobases in length comprising a
stretch of at least eight (8) consecutive nucleobases selected from
within the illustrative preferred target segments are considered to
be suitable for targeting as well.
[0054] Target segments can include DNA or RNA sequences that
comprise at least the 8 consecutive nucleobases from the
5'-terminus of one of the illustrative preferred target segments
(the remaining nucleobases being a consecutive stretch of the same
DNA or RNA beginning immediately upstream of the 5'-terminus of the
target segment and continuing until the DNA or RNA contains about 8
to about 80 nucleobases). Similarly preferred target segments are
represented by DNA or RNA sequences that comprise at least the 8
consecutive nucleobases from the 3'-terminus of one of the
illustrative preferred target segments (the remaining nucleobases
being a consecutive stretch of the same DNA or RNA beginning
immediately downstream of the 3'-terminus of the target segment and
continuing until the DNA or RNA contains about 8 to about 80
nucleobases). It is also understood that preferred antisense target
segments may be represented by DNA or RNA sequences that comprise
at least 8 consecutive nucleobases from an internal portion of the
sequence of an illustrative preferred target segment, and may
extend in either or both directions until the oligonucleotide
contains about 8 to about 80 nucleobases. One having skill in the
art armed with the preferred target segments illustrated herein
will be able, without undue experimentation, to identify further
preferred target segments.
[0055] Once one or more target regions, segments or sites have been
identified, antisense compounds are chosen which are sufficiently
complementary to the target, i.e., hybridize sufficiently well and
with sufficient specificity, to give the desired effect.
[0056] The oligomeric antisense compounds may also be targeted to
regions of the target nucleobase sequence (e.g., such as those
disclosed in Example 9) comprising nucleobases 1-80, 81-160,
161-240, 241-320, 321-400, 401-480, 481-560, 561-640, 641-720,
721-800, 801-880, 881-960, 961-1004, or any combination
thereof.
[0057] D. Screening and Target Validation
[0058] In a further embodiment, the "preferred target segments"
identified herein may be employed in a screen for additional
compounds that modulate the expression of CD40. "Modulators" are
those compounds that decrease or increase the expression of a
nucleic acid molecule encoding CD40 and which comprise at least an
8-nucleobase portion which is complementary to a preferred target
segment. The screening method comprises the steps of contacting a
preferred target segment of a nucleic acid molecule encoding CD40
with one or more candidate modulators, and selecting for one or
more candidate modulators which decrease or increase the expression
of a nucleic acid molecule encoding CD40. Once it is shown that the
candidate modulator or modulators are capable of modulating (e.g.
either decreasing or increasing) the expression of a nucleic acid
molecule encoding CD40, the modulator may then be employed in
further investigative studies of the function of CD40, or for use
as a research, diagnostic, or therapeutic agent in accordance with
the present invention.
[0059] The preferred target segments of the present invention may
be also be combined with their respective complementary antisense
compounds of the present invention to form stabilized
double-stranded (duplexed) oligonucleotides.
[0060] Such double stranded oligonucleotide moieties have been
shown in the art to modulate target expression and regulate
translation as well as RNA processing via an antisense mechanism.
Moreover, the double-stranded moieties may be subject to chemical
modifications (Fire et al., Nature, 1998, 391, 806-811; Timmons and
Fire, Nature 1998, 395, 854; Timmons et al., Gene, 2001, 263,
103-112; Tabara et al., Science, 1998, 282, 430-431; Montgomery et
al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et
al., Genes Dev., 1999, 13, 3191-3197; Elbashir et al., Nature,
2001, 411, 494-498; Elbashir et al., Genes Dev. 2001, 15, 188-200).
For example, such double-stranded moieties have been shown to
inhibit the target by the classical hybridization of antisense
strand of the duplex to the target, thereby triggering enzymatic
degradation of the target (Tijsterman et al., Science, 2002, 295,
694-697).
[0061] The antisense compounds of the present invention can also be
applied in the areas of drug discovery and target validation. The
present invention comprehends the use of the compounds and
preferred target segments identified herein in drug discovery
efforts to elucidate relationships that exist between CD40 and a
disease state, phenotype, or condition. These methods include
detecting or modulating CD40 comprising contacting a sample,
tissue, cell, or organism with the compounds of the present
invention, measuring the nucleic acid or protein level of CD40
and/or a related phenotypic or chemical endpoint at some time after
treatment, and optionally comparing the measured value to a
non-treated sample or sample treated with a further compound of the
invention. These methods can also be performed in parallel or in
combination with other experiments to determine the function of
unknown genes for the process of target validation or to determine
the validity of a particular gene product as a target for treatment
or prevention of a particular disease, condition, or phenotype.
[0062] E. Kits, Research Reagents, Diagnostics, and
Therapeutics
[0063] The antisense compounds of the present invention can be
utilized for diagnostics, therapeutics, prophylaxis and as research
reagents and kits. Furthermore, antisense oligonucleotides, which
are able to inhibit gene expression with exquisite specificity, are
often used by those of ordinary skill to elucidate the function of
particular genes or to distinguish between functions of various
members of a biological pathway.
[0064] For use in kits and diagnostics, the compounds of the
present invention, either alone or in combination with other
compounds or therapeutics, can be used as tools in differential
and/or combinatorial analyses to elucidate expression patterns of a
portion or the entire complement of genes expressed within cells
and tissues.
[0065] As one nonlimiting example, expression patterns within cells
or tissues treated with one or more antisense compounds are
compared to control cells or tissues not treated with antisense
compounds and the patterns produced are analyzed for differential
levels of gene expression as they pertain, for example, to disease
association, signaling pathway, cellular localization, expression
level, size, structure or function of the genes examined. These
analyses can be performed on stimulated or unstimulated cells and
in the presence or absence of other compounds which affect
expression patterns.
[0066] Examples of methods of gene expression analysis known in the
art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett.,
2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE
(serial analysis of gene expression) (Madden, et al., Drug Discov.
Today, 2000, 5, 415-425), READS (restriction enzyme amplification
of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999,
303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et
al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), protein
arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16;
Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed
sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000,
480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57),
subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal.
Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41,
203-208), subtractive cloning, differential display (DD) (Jurecic
and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative
genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl.,
1998, 31, 286-96), FISH (fluorescent in situ hybridization)
techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35,
1895-904) and mass spectrometry methods (To, Comb. Chem. High
Throughput Screen, 2000, 3, 235-41).
[0067] The antisense compounds of the invention are useful for
research and diagnostics, because these compounds hybridize to
nucleic acids encoding CD40. For example, oligonucleotides that are
shown to hybridize with such efficiency and under such conditions
as disclosed herein as to be effective CD40 inhibitors will also be
effective primers or probes under conditions favoring gene
amplification or detection, respectively. These primers and probes
are useful in methods requiring the specific detection of nucleic
acid molecules encoding CD40 and in the amplification of said
nucleic acid molecules for detection or for use in further studies
of CD40. Hybridization of the antisense oligonucleotides,
particularly the primers and probes, of the invention with a
nucleic acid encoding CD40 can be detected by means known in the
art. Such means may include conjugation of an enzyme to the
oligonucleotide, radiolabelling of the oligonucleotide or any other
suitable detection means. Kits using such detection means for
detecting the level of CD40 in a sample may also be prepared.
[0068] The specificity and sensitivity of antisense is also
harnessed by those of skill in the art for therapeutic uses.
Antisense compounds have been employed as therapeutic moieties in
the treatment of disease states in animals, including humans.
Antisense oligonucleotide drugs, including ribozymes, have been
safely and effectively administered to humans and numerous clinical
trials are presently underway. It is thus established that
antisense compounds can be useful therapeutic modalities that can
be configured to be useful in treatment regimes for the treatment
of cells, tissues and animals, especially humans.
[0069] For therapeutics, an animal, preferably a human, suspected
of having a disease or disorder which can be treated by modulating
the expression of CD40 is treated by administering antisense
compounds in accordance with this invention. For example, in one
non-limiting embodiment, the methods comprise the step of
administering to the animal in need of treatment, a therapeutically
effective amount of a CD40 inhibitor. The CD40 inhibitors of the
present invention effectively inhibit the activity of the CD40
protein or inhibit the expression of the CD40 protein. In one
embodiment, the activity or expression of CD40 in an animal is
inhibited by about 10%. Preferably, the activity or expression of
CD40 in an animal is inhibited by about 30%. More preferably, the
activity or expression of CD40 in an animal is inhibited by 50% or
more. Thus, the oligomeric antisense compounds modulate expression
of CD40 mRNA by at least 10%, by at least 20%, by at least 25%, by
at least 30%, by at least 40%, by at least 50%, by at least 60%, by
at least 70%, by at least 75%, by at least 80%, by at least 85%, by
at least 90%, by at least 95%, by at least 98%, by at least 99%, or
by 100%.
[0070] For example, the reduction of the expression of CD40 may be
measured in serum, adipose tissue, liver or any other body fluid,
tissue or organ of the animal. Preferably, the cells contained
within said fluids, tissues or organs being analyzed contain a
nucleic acid molecule encoding CD40 protein and/or the CD40 protein
itself.
[0071] The antisense compounds of the invention can be utilized in
pharmaceutical compositions by adding an effective amount of a
compound to a suitable pharmaceutically acceptable diluent or
carrier. Use of the compounds and methods of the invention may also
be useful prophylactically.
[0072] F. Modifications
[0073] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base sometimes referred to as a "nucleobase" or simply
a "base". The two most common classes of such heterocyclic bases
are the purines and the pyrimidines. Nucleotides are nucleosides
that further include a phosphate group covalently linked to the
sugar portion of the nucleoside. For those nucleosides that include
a pentofuranosyl sugar, the phosphate group can be linked to either
the 2', 3' or 5' hydroxyl moiety of the sugar. In forming
oligonucleotides, the phosphate groups covalently link adjacent
nucleosides to one another to form a linear polymeric compound. In
turn, the respective ends of this linear polymeric compound can be
further joined to form a circular compound, however, linear
compounds are generally preferred. In addition, linear compounds
may have internal nucleobase complementarity and may therefore fold
in a manner as to produce a fully or partially double-stranded
compound. Within oligonucleotides, the phosphate groups are
commonly referred to as forming the internucleoside backbone of the
oligonucleotide. The normal linkage or backbone of RNA and DNA is a
3' to 5' phosphodiester linkage.
[0074] Modified Internucleoside Linkages (Backbones)
[0075] Specific examples of preferred antisense compounds useful in
this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, oligonucleotides having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified oligonucleotides that do not have a phosphorus atom
in their internucleoside backbone can also be considered to be
oligonucleosides.
[0076] Preferred modified oligonucleotide backbones containing a
phosphorus atom therein include, for example, phosphorothioates,
chiral phosphorothioates, phosphorodithioates, phosphotriesters,
aminoalkyl-phosphotriaminoalkylphosphotriesters, methyl and other
alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene
phosphonates and chiral phosphonates, phosphinates,
phosphoramidates including 3'-amino phosphoramidate and
aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriest- ers,
selenophosphates and boranophosphates having normal 3'-5' linkages,
2'-5' linked analogs of these, and those having inverted polarity
wherein one or more internucleotide linkages is a 3' to 3', 5' to
5' or 2' to 2' linkage. Preferred oligonucleotides having inverted
polarity comprise a single 3' to 3' linkage at the 3'-most
internucleotide linkage i.e. a single inverted nucleoside residue
which may be abasic (the nucleobase is missing or has a hydroxyl
group in place thereof). Various salts, mixed salts and free acid
forms are also included.
[0077] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555;
5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are
commonly owned with this application, and each of which is herein
incorporated by reference.
[0078] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; riboacetyl backbones; alkene containing backbones;
sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate and sulfonamide backbones; amide backbones;
and others having mixed N, O, S and CH.sub.2 component parts.
[0079] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, certain of which are commonly owned with
this application, and each of which is herein incorporated by
reference.
[0080] Modified Sugar and Internucleoside Linkages-Mimetics
[0081] In other preferred antisense compounds, e.g.,
oligonucleotide mimetics, both the sugar and the internucleoside
linkage (i.e. the backbone), of the nucleotide units are replaced
with novel groups. The nucleobase units are maintained for
hybridization with an appropriate target nucleic acid. One such
compound, an oligonucleotide mimetic that has been shown to have
excellent hybridization properties, is referred to as a peptide
nucleic acid (PNA). In PNA compounds, the sugar-backbone of an
oligonucleotide is replaced with an amide containing backbone, in
particular an aminoethylglycine backbone. The nucleobases are
retained and are bound directly or indirectly to aza nitrogen atoms
of the amide portion of the backbone. Representative United States
patents that teach the preparation of PNA compounds include, but
are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and
5,719,262, each of which is herein incorporated by reference.
Further teaching of PNA compounds can be found in Nielsen et al.,
Science, 1991, 254, 1497-1500.
[0082] Preferred embodiments of the invention are oligonucleotides
with phosphorothioate backbones and oligonucleosides with
heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a
methylene(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above referenced U.S. Pat. No. 5,602,240. Also
preferred are oligonucleotides having morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0083] Modified Sugars
[0084] Modified antisense compounds may also contain one or more
substituted sugar moieties. Preferred are antisense compounds,
preferably antisense oligonucleotides, comprising one of the
following at the 2' position: OH; F; O--, S--, or N-alkyl; O--,
S--, or N-alkenyl; O--, S-- or N-alkynyl; or O-alkyl-O-alkyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or
unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10
alkenyl and alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O)CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.su- b.3].sub.2, where n and
m are from 1 to about 10. Other preferred oligonucleotides comprise
one of the following at the 2' position: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl,
O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3,
OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2,
N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl,
aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving
group, a reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes 2'-methoxyethoxy(2'-O--CH.sub.2CH.sub.2O
CH.sub.3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et
al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy
group. A further preferred modification includes
2'-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2O
N(CH.sub.3).sub.2 group, also known as 2'-DMAOE, as described in
examples hereinbelow, and 2'-dimethylaminoethoxyethoxy (also known
in the art as 2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.3).sub.2, also described in
examples hereinbelow.
[0085] Other preferred modifications include
2'-methoxy(2'-O--CH.sub.3),
2'-aminopropoxy(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2),
2'-allyl(2'-CH.sub.2--CH.dbd.CH.sub.2),
2'-O-allyl(2'-O--CH.sub.2--CH.dbd- .CH.sub.2) and 2'-fluoro(2'-F).
The 2'-modification may be in the arabino (up) position or ribo
(down) position. A preferred 2'-arabino modification is 2'-F.
Similar modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Antisense compounds may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747;
and 5,700,920, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0086] A further preferred modification of the sugar includes
Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is
linked to the 3' or 4' carbon atom of the sugar ring, thereby
forming a bicyclic sugar moiety. The linkage is preferably a
methylene(--CH.sub.2--).sub.n group bridging the 2' oxygen atom and
the 4' carbon atom wherein n is 1 or 2. LNAs and preparation
thereof are described in WO 98/39352 and WO 99/14226.
[0087] Natural and Modified Nucleobases
[0088] Antisense compounds may also include nucleobase (often
referred to in the art as heterocyclic base or simply as "base")
modifications or substitutions. As used herein, "unmodified" or
"natural" nucleobases include the purine bases adenine (A) and
guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and
uracil (U). Modified nucleobases include other synthetic and
natural nucleobases such as 5-methylcytosine(5-me-C),
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-methyl and other alkyl derivatives of adenine and guanine,
2-propyl and other alkyl derivatives of adenine and guanine,
2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and
cytosine, 5-propynyl(--C.ident.C--CH.sub.3)uracil and cytosine and
other alkynyl derivatives of pyrimidine bases, 6-azo uracil,
cytosine and thymine, 5-uracil(pseudouracil), 4-thiouracil, 8-halo,
8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted
adenines and guanines, 5-halo particularly 5-bromo,
5-trifluoromethyl and other 5-substituted uracils and cytosines,
7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine,
8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine
and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases
include tricyclic pyrimidines such as phenoxazine
cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine
cytidine(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps
such as a substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4- -b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine(2H-pyrimido[4,5-b]indol-- 2-one), pyridoindole
cytidine(H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2- -one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John
Wiley & Sons, 1990, those disclosed by Englisch et al.,
Angewandte Chemie, International Edition, 1991, 30, 613, and those
disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and
Applications, pages 289-302, Crooke, S. T. and Lebleu, B. ed., CRC
Press, 1993. Certain of these nucleobases are particularly useful
for increasing the binding affinity of the compounds of the
invention. These include 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C. and
are presently preferred base substitutions, even more particularly
when combined with 2'-O-methoxyethyl sugar modifications.
[0089] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include, but are not limited to,
the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653;
5,763,588; 6,005,096; and 5,681,941, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference, and U.S. Pat. No. 5,750,692, which is
commonly owned with the instant application and also herein
incorporated by reference.
[0090] Conjugates
[0091] Another modification of the antisense compounds of the
invention involves chemically linking to the antisense compound one
or more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the oligonucleotide. These
moieties or conjugates can include conjugate groups covalently
bound to functional groups such as primary or secondary hydroxyl
groups. Conjugate groups of the invention include intercalators,
reporter molecules, polyamines, polyamides, polyethylene glycols,
polyethers, groups that enhance the pharmacodynamic properties of
oligomers, and groups that enhance the pharmacokinetic properties
of oligomers. Typical conjugate groups include cholesterols,
lipids, phospholipids, biotin, phenazine, folate, phenanthridine,
anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and
dyes. Groups that enhance the pharmacodynamic properties, in the
context of this invention, include groups that improve uptake,
enhance resistance to degradation, and/or strengthen
sequence-specific hybridization with the target nucleic acid.
Groups that enhance the pharmacokinetic properties, in the context
of this invention, include groups that improve uptake,
distribution, metabolism or excretion of the compounds of the
present invention. Representative conjugate groups are disclosed in
International Patent Application PCT/US92/09196, filed Oct. 23,
1992, and U.S. Pat. No. 6,287,860, the entire disclosure of which
are incorporated herein by reference. Conjugate moieties include
but are not limited to lipid moieties such as a cholesterol moiety,
cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a
thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl
residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or
triethylammonium 1,2-di-O-hexadecyl-rac-glyc- ero-3-H-phosphonate,
a polyamine or a polyethylene glycol chain, or adamantane acetic
acid, a palmityl moiety, or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety. Antisense compounds of
the invention may also be conjugated to active drug substances, for
example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen,
fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen,
dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid,
folinic acid, a benzothiadiazide, chlorothiazide, a diazepine,
indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an
antidiabetic, an antibacterial or an antibiotic.
Oligonucleotide-drug conjugates and their preparation are described
in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15,
1999) which is incorporated herein by reference in its
entirety.
[0092] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, certain of which are commonly owned with
the instant application, and each of which is herein incorporated
by reference.
[0093] Chimeric Compounds
[0094] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
compound or even at a single nucleoside within an
oligonucleotide.
[0095] The present invention also includes antisense compounds
which are chimeric compounds. "Chimeric" antisense compounds or
"chimeras," in the context of this invention, are antisense
compounds, particularly oligonucleotides, which contain two or more
chemically distinct regions, each made up of at least one monomer
unit, i.e., a nucleotide in the case of an oligonucleotide
compound. Chimeric antisense oligonucleotides are thus a form of
antisense compound. These oligonucleotides typically contain at
least one region wherein the oligonucleotide is modified so as to
confer upon the oligonucleotide increased resistance to nuclease
degradation, increased cellular uptake, increased stability and/or
increased binding affinity for the target nucleic, acid. An
additional region of the oligonucleotide may serve as a substrate
for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way
of example, RNAse H is a cellular endonuclease which cleaves the
RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore,
results in cleavage of the RNA target, thereby greatly enhancing
the efficiency of oligonucleotide-mediated inhibition of gene
expression. The cleavage of RNA:RNA hybrids can, in like fashion,
be accomplished through the actions of endoribonucleases, such as
RNAseL which cleaves both cellular and viral RNA. Cleavage of the
RNA target can be routinely detected by gel electrophoresis and, if
necessary, associated nucleic acid hybridization techniques known
in the art.
[0096] Chimeric antisense compounds of the invention may be formed
as composite structures of two or more oligonucleotides, modified
oligonucleotides, oligonucleosides and/or oligonucleotide mimetics
as described above. Such compounds have also been referred to in
the art as hybrids or gapmers. Representative United States patents
that teach the preparation of such hybrid structures include, but
are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007;
5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference in its entirety.
[0097] G. Formulations
[0098] The compounds of the invention may also be admixed,
encapsulated, conjugated or otherwise associated with other
molecules, molecule structures or mixtures of compounds, as for
example, liposomes, receptor-targeted molecules, oral, rectal,
topical or other formulations, for assisting in uptake,
distribution and/or absorption. Representative United States
patents that teach the preparation of such uptake, distribution
and/or absorption-assisting formulations include, but are not
limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016;
5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721;
4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170;
5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854;
5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948;
5,580,575; and 5,595,756, each of which is herein incorporated by
reference.
[0099] The antisense compounds of the invention encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal,
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof.
[0100] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the
compounds of the invention: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto. For oligonucleotides,
preferred examples of pharmaceutically acceptable salts and their
uses are further described in U.S. Pat. No. 6,287,860, which is
incorporated herein in its entirety.
[0101] The present invention also includes pharmaceutical
compositions and formulations which include the antisense compounds
of the invention. The pharmaceutical compositions of the present
invention may be administered in a number of ways depending upon
whether local or systemic treatment is desired and upon the area to
be treated. Administration may be topical (including ophthalmic and
to mucous membranes including vaginal and rectal delivery),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal), oral or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; or
intracranial, e.g., intrathecal or intraventricular,
administration. Oligonucleotides with at least one
2'-O-methoxyethyl modification are believed to be particularly
useful for oral administration. Pharmaceutical compositions and
formulations for topical administration may include transdermal
patches, ointments, lotions, creams, gels, drops, suppositories,
sprays, liquids and powders. Conventional pharmaceutical carriers,
aqueous, powder or oily bases, thickeners and the like may be
necessary or desirable. Coated condoms, gloves and the like may
also be useful.
[0102] The pharmaceutical formulations of the present invention,
which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general, the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0103] The compositions of the present invention may be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, gel capsules, liquid syrups, soft gels,
suppositories, and enemas. The compositions of the present
invention may also be formulated as suspensions in aqueous,
non-aqueous or mixed media. Aqueous suspensions may further contain
substances which increase the viscosity of the suspension
including, for example, sodium carboxymethylcellulose, sorbitol
and/or dextran. The suspension may also contain stabilizers.
[0104] Pharmaceutical compositions of the present invention
include, but are not limited to, solutions, emulsions, foams and
liposome-containing formulations. The pharmaceutical compositions
and formulations of the present invention may comprise one or more
penetration enhancers, carriers, excipients or other active or
inactive ingredients.
[0105] Emulsions are typically heterogenous systems of one liquid
dispersed in another in the form of droplets usually exceeding 0.1
.mu.m in diameter. Emulsions may contain additional components in
addition to the dispersed phases, and the active drug which may be
present as a solution in either the aqueous phase, oily phase or
itself as a separate phase. Microemulsions are included as an
embodiment of the present invention. Emulsions and their uses are
well known in the art and are further described in U.S. Pat. No.
6,287,860, which is incorporated herein in its entirety.
[0106] Formulations of the present invention include liposomal
formulations. As used in the present invention, the term "liposome"
means a vesicle composed of amphiphilic lipids arranged in a
spherical bilayer or bilayers. Liposomes are unilamellar or
multilamellar vesicles which have a membrane formed from a
lipophilic material and an aqueous interior that contains the
composition to be delivered. Cationic liposomes are positively
charged liposomes which are believed to interact with negatively
charged DNA molecules to form a stable complex. Liposomes that are
pH-sensitive or negatively-charged are believed to entrap DNA
rather than complex with it. Both cationic and noncationic
liposomes have been used to deliver DNA to cells.
[0107] Liposomes also include "sterically stabilized" liposomes, a
term which, as used herein, refers to liposomes comprising one or
more specialized lipids that, when incorporated into liposomes,
result in enhanced circulation lifetimes relative to liposomes
lacking such specialized lipids. Examples of sterically stabilized
liposomes are those in which part of the vesicle-forming lipid
portion of the liposome comprises one or more glycolipids or is
derivatized with one or more hydrophilic polymers, such as a
polyethylene glycol (PEG) moiety. Liposomes and their uses are
further described in U.S. Pat. No. 6,287,860, which is incorporated
herein in its entirety.
[0108] The pharmaceutical formulations and compositions of the
present invention may also include surfactants. The use of
surfactants in drug products, formulations and in emulsions is well
known in the art. Surfactants and their uses are further described
in U.S. Pat. No. 6,287,860, which is incorporated herein in its
entirety.
[0109] In one embodiment, the present invention employs various
penetration enhancers to effect the efficient delivery of nucleic
acids, particularly oligonucleotides. In addition to aiding the
diffusion of non-lipophilic drugs across cell membranes,
penetration enhancers also enhance the permeability of lipophilic
drugs. Penetration enhancers may be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants.
Penetration enhancers and their uses are further described in U.S.
Pat. No. 6,287,860, which is incorporated herein in its
entirety.
[0110] One of skill in the art will recognize that formulations are
routinely designed according to their intended use, i.e. route of
administration.
[0111] Preferred formulations for topical administration include
those in which the oligonucleotides of the invention are in
admixture with a topical delivery agent such as lipids, liposomes,
fatty acids, fatty acid esters, steroids, chelating agents and
surfactants. Preferred lipids and liposomes include neutral (e.g.
dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl
choline DMPC, distearolyphosphatidyl choline) negative (e.g.
dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g.
dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl
ethanolamine DOTMA).
[0112] For topical or other administration, oligonucleotides of the
invention may be encapsulated within liposomes or may form
complexes thereto, in particular to cationic liposomes.
Alternatively, oligonucleotides may be complexed to lipids, in
particular to cationic lipids. Preferred fatty acids and esters,
pharmaceutically acceptable salts thereof, and their uses are
further described in U.S. Pat. No. 6,287,860, which is incorporated
herein in its entirety. Topical formulations are described in
detail in U.S. patent application Ser. No. 09/315,298 filed on May
20, 1999, which is incorporated herein by reference in its
entirety.
[0113] Compositions and formulations for oral administration
include powders or granules, microparticulates, nanoparticulates,
suspensions or solutions in water or non-aqueous media, capsules,
gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
may be desirable. Preferred oral formulations are those in which
oligonucleotides of the invention are administered in conjunction
with one or more penetration enhancers surfactants and chelators.
Preferred surfactants include fatty acids and/or esters or salts
thereof, bile acids and/or salts thereof. Preferred bile
acids/salts and fatty acids and their uses are further described in
U.S. Pat. No. 6,287,860, which is incorporated herein in its
entirety. Also preferred are combinations of penetration enhancers,
for example, fatty acids/salts in combination with bile
acids/salts. A particularly preferred combination is the sodium
salt of lauric acid, capric acid and UDCA. Further penetration
enhancers include polyoxyethylene-9-lauryl ether,
polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention
may be delivered orally, in granular form including sprayed dried
particles, or complexed to form micro or nanoparticles.
Oligonucleotide complexing agents and their uses are further
described in U.S. Pat. No. 6,287,860, which is incorporated herein
in its entirety. Oral formulations for oligonucleotides and their
preparation are described in detail in U.S. applications Ser. Nos.
09/108,673 (filed Jul. 1, 1998), 09/315,298 (filed May 20, 1999)
and 10/071,822, filed Feb. 8, 2002, each of which is incorporated
herein by reference in their entirety.
[0114] Compositions and formulations for parenteral, intrathecal or
intraventricular administration may include sterile aqueous
solutions which may also contain buffers, diluents and other
suitable additives such as, but not limited to, penetration
enhancers, carrier compounds and other pharmaceutically acceptable
carriers or excipients.
[0115] Certain embodiments of the invention provide pharmaceutical
compositions containing one or more oligomeric compounds and one or
more other chemotherapeutic agents which function by a
non-antisense mechanism. Examples of such chemotherapeutic agents
include but are not limited to cancer chemotherapeutic drugs such
as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin,
idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide,
cytosine arabinoside, bis-chloroethylnitrosurea, busulfan,
mitomycin C, actinomycin D, mithramycin, prednisone,
hydroxyprogesterone, testosterone, tamoxifen, dacarbazine,
procarbazine, hexamethylmelamine, pentamethylmelamine,
mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea,
nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea,
deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil
(5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX),
colchicine, taxol, vincristine, vinblastine, etoposide (VP-16),
trimetrexate, irinotecan, topotecan, gemcitabine, teniposide,
cisplatin and diethylstilbestrol (DES). When used with the
compounds of the invention, such chemotherapeutic agents may be
used individually (e.g., 5-FU and oligonucleotide), sequentially
(e.g., 5-FU and oligonucleotide for a period of time followed by
MTX and oligonucleotide), or in combination with one or more other
such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide,
or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory
drugs, including but not limited to nonsteroidal anti-inflammatory
drugs and corticosteroids, and antiviral drugs, including but not
limited to ribivirin, vidarabine, acyclovir and ganciclovir, may
also be combined in compositions of the invention. Combinations of
antisense compounds and other non-antisense drugs are also within
the scope of this invention. Two or more combined compounds may be
used together or sequentially.
[0116] In another related embodiment, compositions of the invention
may contain one or more antisense compounds, particularly
oligonucleotides, targeted to a first nucleic acid and one or more
additional antisense compounds targeted to a second nucleic acid
target. Alternatively, compositions of the invention may contain
two or more antisense compounds targeted to different regions of
the same nucleic acid target. Numerous examples of antisense
compounds are known in the art. Two or more combined compounds may
be used together or sequentially.
[0117] H. Dosing
[0118] The formulation of therapeutic compositions and their
subsequent administration (dosing) is believed to be within the
skill of those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50s found to be
effective in in vitro and in vivo animal models. In general, dosage
is from 0.01 ug to 100 g per kg of body weight, and may be given
once or more daily, weekly, monthly or yearly, or even once every 2
to 20 years. Persons of ordinary skill in the art can easily
estimate repetition rates for dosing based on measured residence
times and concentrations of the drug in bodily fluids or tissues.
Following successful treatment, it may be desirable to have the
patient undergo maintenance therapy to prevent the recurrence of
the disease state, wherein the oligonucleotide is administered in
maintenance doses, ranging from 0.01 ug to 100 g per kg of body
weight, once or more daily, to once every 20 years.
[0119] While the present invention has been described with
specificity in accordance with certain of its preferred
embodiments, the following examples serve only to illustrate the
invention and are not intended to limit the same. Each of the
references, GenBank accession numbers, and the like recited in the
present application is incorporated herein by reference in its
entirety.
EXAMPLES
Example 1
Synthesis of Nucleoside Phosphoramidites
[0120] The following compounds, including amidites and their
intermediates were prepared as described in U.S. Pat. No. 6,426,220
and published as WO 02/36743; 5'-O-Dimethoxytrityl-thymidine
intermediate for 5-methyl dC amidite,
5'-O-Dimethoxytrityl-2'-deoxy-5-methylcytidine intermediate for
5-methyl-dC amidite,
5'-O-Dimethoxytrityl-2'-deoxy-N4-benzoyl-5-methylcyt- idine
penultimate intermediate for 5-methyl dC amidite,
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-deoxy-N.sup.4-benzoyl-5-methylcy-
tidin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite(5-methyl
dC amidite), 2'-Fluorodeoxyadenosine, 2'-Fluorodeoxyguanosine,
2'-Fluorouridine, 2'-Fluorodeoxycytidine, 2'-O-(2-Methoxyethyl)
modified amidites, 2'-O-(2-methoxyethyl)-5-methyluridine
intermediate, 5'-O-DMT-2'-O-(2-methoxyethyl)-5-methyluridine
penultimate intermediate,
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-5-methyluridi-
n-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite(MOE T
amidite),
5'-O-Dimethoxytrityl-2'-O-(2-methoxyethyl)-5-methylcytidine
intermediate,
5'-O-dimethoxytrityl-2'-O-(2-methoxyethyl)-N.sup.4-benzoyl-5-methyl-cytid-
ine penultimate intermediate,
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(-
2-methoxyethyl)-N.sup.4-benzoyl-5-methylcytidin-3'-O-yl]-2-cyanoethyl-N,N--
diisopropylphosphoramidite(MOE 5-Me-C amidite),
[5'-O-(4,4'-Dimethoxytriph-
enylmethyl)-2'-O-(2-methoxyethyl)-N.sup.6-benzoyladenosin-3'-O-yl]-2-cyano-
ethyl-N,N-diisopropylphosphoramidite(MOE A amdite),
[5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-N.sup.4-isobu-
tyrylguanosin-3'-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite(MOE
G amidite), 2'-O-(Aminooxyethyl)nucleoside amidites and
2'-O-(dimethylamino-oxyethyl)nucleoside amidites,
2'-(Dimethylaminooxyeth- oxy)nucleoside amidites,
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5- -methyluridine,
5'-O-tert-Butyldiphenylsilyl-21-O-(2-hydroxyethyl)-5-methy-
luridine,
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methylur-
idine,
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-met-
hyluridine, 5'-O-tert-Butyldiphenylsilyl-2'-O-[N,N
dimethylaminooxyethyl]-- 5-methyluridine,
2'-O-(dimethylaminooxyethyl)-5-methyluridine,
5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine,
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoe-
thyl)-N,N-diisopropylphosphoramidite],
2'-(Aminooxyethoxy)nucleoside amidites,
N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(-
4,4'-dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphora-
midite], 2'-dimethylaminoethoxyethoxy (2'-DMAEOE)nucleoside
amidites, 2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl
uridine,
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl
uridine and
5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl-
)]-5-methyl
uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite.
Example 2
Oligonucleotide and oligonucleoside synthesis
[0121] The antisense compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0122] Oligonucleotides: Unsubstituted and substituted
phosphodiester (P.dbd.O) oligonucleotides are synthesized on an
automated DNA synthesizer (Applied Biosystems model 394) using
standard phosphoramidite chemistry with oxidation by iodine.
[0123] Phosphorothioates (P.dbd.S) are synthesized similar to
phosphodiester oligonucleotides with the following exceptions:
thiation was effected by utilizing a 10% w/v solution of
3,H-1,2-benzodithiole-3-o- ne 1,1-dioxide in acetonitrile for the
oxidation of the phosphite linkages. The thiation reaction step
time was increased to 180 sec and preceded by the normal capping
step. After cleavage from the CPG column and deblocking in
concentrated ammonium hydroxide at 55.degree. C. (12-16 hr), the
oligonucleotides were recovered by precipitating with >3 volumes
of ethanol from a 1 M NH.sub.4OAc solution. Phosphinate
oligonucleotides are prepared as described in U.S. Pat. No.
5,508,270, herein incorporated by reference.
[0124] Alkyl phosphonate oligonucleotides are prepared as described
in U.S. Pat. No. 4,469,863, herein incorporated by reference.
[0125] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are
prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050,
herein incorporated by reference.
[0126] Phosphoramidite oligonucleotides are prepared as described
in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878, herein
incorporated by reference.
[0127] Alkylphosphonothioate oligonucleotides are prepared as
described in published PCT applications PCT/US94/00902 and
PCT/US93/06976 (published as WO 94/17093 and WO 94/02499,
respectively), herein incorporated by reference.
[0128] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are
prepared as described in U.S. Pat. No. 5,476,925, herein
incorporated by reference.
[0129] Phosphotriester oligonucleotides are prepared as described
in U.S. Pat. No. 5,023,243, herein incorporated by reference.
[0130] Borano phosphate oligonucleotides are prepared as described
in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated
by reference.
[0131] Oligonucleosides: Methylenemethylimino linked
oligonucleosides, also identified as MMI linked oligonucleosides,
methylenedimethylhydrazo linked oligonucleosides, also identified
as MDH linked oligonucleosides, and methylenecarbonylamino linked
oligonucleosides, also identified as amide-3 linked
oligonucleosides, and methyleneaminocarbonyl linked
oligonucleosides, also identified as amide-4 linked
oligonucleosides, as well as mixed backbone compounds having, for
instance, alternating MMI and P.dbd.O or P.dbd.S linkages are
prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023,
5,489,677, 5,602,240 and 5,610,289, all of which are herein
incorporated by reference.
[0132] Formacetal and thioformacetal linked oligonucleosides are
prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564,
herein incorporated by reference.
[0133] Ethylene oxide linked oligonucleosides are prepared as
described in U.S. Pat. No. 5,223,618, herein incorporated by
reference.
Example 3
RNA Synthesis
[0134] In general, RNA synthesis chemistry is based on the
selective incorporation of various protecting groups at strategic
intermediary reactions. Although one of ordinary skill in the art
will understand the use of protecting groups in organic synthesis,
a useful class of protecting groups includes silyl ethers. In
particular bulky silyl ethers are used to protect the 5'-hydroxyl
in combination with an acid-labile orthoester protecting group on
the 2'-hydroxyl. This set of protecting groups is then used with
standard solid-phase synthesis technology. It is important to
lastly remove the acid labile orthoester protecting group after all
other synthetic steps. Moreover, the early use of the silyl
protecting groups during synthesis ensures facile removal when
desired, without undesired deprotection of 2' hydroxyl.
[0135] Following this procedure for the sequential protection of
the 5'-hydroxyl in combination with protection of the 2'-hydroxyl
by protecting groups that are differentially removed and are
differentially chemically labile, RNA oligonucleotides were
synthesized.
[0136] RNA oligonucleotides are synthesized in a stepwise fashion.
Each nucleotide is added sequentially (3'- to 5'-direction) to a
solid support-bound oligonucleotide. The first nucleoside at the
3'-end of the chain is covalently attached to a solid support. The
nucleotide precursor, a ribonucleoside phosphoramidite, and
activator are added, coupling the second base onto the 5'-end of
the first nucleoside. The support is washed and any unreacted
5'-hydroxyl groups are capped with acetic anhydride to yield
5'-acetyl moieties. The linkage is then oxidized to the more stable
and ultimately desired P(V) linkage. At the end of the nucleotide
addition cycle, the 5'-silyl group is cleaved with fluoride. The
cycle is repeated for each subsequent nucleotide.
[0137] Following synthesis, the methyl protecting groups on the
phosphates are cleaved in 30 minutes utilizing 1 M
disodium-2-carbamoyl-2-cyanoethyl- ene-1,1-dithiolate trihydrate
(S.sub.2Na.sub.2) in DMF. The deprotection solution is washed from
the solid support-bound oligonucleotide using water. The support is
then treated with 40% methylamine in water for 10 minutes at
55.degree. C. This releases the RNA oligonucleotides into solution,
deprotects the exocyclic amines, and modifies the 2'-groups. The
oligonucleotides can be analyzed by anion exchange HPLC at this
stage.
[0138] The 2'-orthoester groups are the last protecting groups to
be removed. The ethylene glycol monoacetate orthoester protecting
group developed by Dharmacon Research, Inc. (Lafayette, Colo.), is
one example of a useful orthoester protecting group which, has the
following important properties. It is stable to the conditions of
nucleoside phosphoramidite synthesis and oligonucleotide synthesis.
However, after oligonucleotide synthesis the oligonucleotide is
treated with methylamine which not only cleaves the oligonucleotide
from the solid support but also removes the acetyl groups from the
orthoesters. The resulting 2-ethyl-hydroxyl substituents on the
orthoester are less electron withdrawing than the acetylated
precursor. As a result, the modified orthoester becomes more labile
to acid-catalyzed hydrolysis. Specifically, the rate of cleavage is
approximately 10 times faster after the acetyl groups are removed.
Therefore, this orthoester possesses sufficient stability in order
to be compatible with oligonucleotide synthesis and yet, when
subsequently modified, permits deprotection to be carried out under
relatively mild aqueous conditions compatible with the final RNA
oligonucleotide product.
[0139] Additionally, methods of RNA synthesis are well known in the
art (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996;
Scaringe, S. A., et al., J. Am. Chem. Soc., 1998, 120, 11820-11821;
Matteucci, M. D. and Caruthers, M. H. J. Am. Chem. Soc., 1981, 103,
3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett.,
1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem. Scand,. 1990,
44, 639-641; Reddy, M. P., et al., Tetrahedrom Lett., 1994, 25,
4311-4314; Wincott, F. et al., Nucleic Acids Res., 1995, 23,
2677-2684; Griffin, B. E., et al., Tetrahedron, 1967, 23,
2301-2313; Griffin, B. E., et al., Tetrahedron, 1967, 23,
2315-2331).
[0140] RNA antisense compounds (RNA oligonucleotides) of the
present invention can be synthesized by the methods herein or
purchased from Dharmacon Research, Inc (Lafayette, Colo.). Once
synthesized, complementary RNA antisense compounds can then be
annealed by methods known in the art to form double stranded
(duplexed) antisense compounds. For example, duplexes can be formed
by combining 30 .mu.l of each of the complementary strands of RNA
oligonucleotides (50 uM RNA oligonucleotide solution) and 15 .mu.l
of 5.times. annealing buffer (100 mM potassium acetate, 30 mM
HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1
minute at 90.degree. C., then 1 hour at 37.degree. C. The resulting
duplexed antisense compounds can be used in kits, assays, screens,
or other methods to investigate the role of a target nucleic acid,
or for diagnostic or therapeutic purposes.
Example 4
Synthesis of Chimeric Compounds
[0141] Chimeric oligonucleotides, oligonucleosides or mixed
oligonucleotides/oligonucleosides of the invention can be of
several different types. These include a first type wherein the
"gap" segment of linked nucleosides is positioned between 5' and 3'
"wing" segments of linked nucleosides and a second "open end" type
wherein the "gap" segment is located at either the 3' or the 5'
terminus of the oligomeric compound. Oligonucleotides of the first
type are also known in the art as "gapmers" or gapped
oligonucleotides. Oligonucleotides of the second type are also
known in the art as "hemimers" or "wingmers".
[2'-O-Me]-[2'-deoxy]-[2'-O-Me]Chimeric Phosphorothioate
Oligonucleotides
[0142] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate
and 2'-deoxy phosphorothioate oligonucleotide segments are
synthesized using an Applied Biosystems automated DNA synthesizer
Model 394, as above. Oligonucleotides are synthesized using the
automated synthesizer and
2'-deoxy-5'-dimethoxytrityl-3'-O-phosphor-amidite for the DNA
portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for
5' and 3' wings. The standard synthesis cycle is modified by
incorporating coupling steps with increased reaction times for the
5'-dimethoxytrityl-2'-O-methyl-3'-O- -phosphoramidite. The fully
protected oligonucleotide is cleaved from the support and
deprotected in concentrated ammonia (NH.sub.4OH) for 12-16 hr at
55.degree. C. The deprotected oligo is then recovered by an
appropriate method (precipitation, column chromatography, volume
reduced in vacuo and analyzed spetrophotometrically for yield and
for purity by capillary electrophoresis and by mass
spectrometry.
[2'-O-(2-Methoxyethyl)]-[2'-deoxy]-[2'-O-(Methoxyethyl)]Chimeric
Phosphorothioate Oligonucleotides
[0143]
[2'-O-(2-methoxyethyl)]-[2'-deoxy]-[-2'-O-(methoxyethyl)]chimeric
phosphorothioate oligonucleotides were prepared as per the
procedure above for the 2'-O-methyl chimeric oligonucleotide, with
the substitution of 2'-O-(methoxyethyl)amidites for the 2'-O-methyl
amidites.
[2'-O-(2-Methoxyethyl)Phosphodiester]-[2'-deoxy
Phosphorothioate]-[2'-O-(2- -Methoxyethyl)Phosphodiester]Chimeric
Oligonucleotides
[0144] [2'-O-(2-methoxyethyl phosphodiester]-[2'-deoxy
phosphorothioate]-[2'-O-(methoxyethyl) phosphodiester] chimeric
oligonucleotides are prepared as per the above procedure for the
2'-O-methyl chimeric oligonucleotide with the substitution of
2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites,
oxidation with iodine to generate the phosphodiester
internucleotide linkages within the wing portions of the chimeric
structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate
internucleotide linkages for the center gap.
[0145] Other chimeric oligonucleotides, chimeric oligonucleosides
and mixed chimeric oligonucleotides/oligonucleosides are
synthesized according to U.S. Pat. No. 5,623,065, herein
incorporated by reference.
Example 5
Design and Screening of Duplexed Antisense Compounds Targeting
CD40
[0146] In accordance with the present invention, a series of
nucleic acid duplexes comprising the antisense compounds of the
present invention and their complements can be designed to target
CD40. The nucleobase sequence of the antisense strand of the duplex
comprises at least an 8-nucleobase portion of an oligonucleotide in
Table 1. The ends of the strands may be modified by the addition of
one or more natural or modified nucleobases to form an overhang.
The sense strand of the dsRNA is then designed and synthesized as
the complement of the antisense strand and may also contain
modifications or additions to either terminus. For example, in one
embodiment, both strands of the dsRNA duplex would be complementary
over the central nucleobases, each having overhangs at one or both
termini.
[0147] For example, a duplex comprising an antisense strand having
the sequence CGAGAGGCGGACGGGACCG and having a two-nucleobase
overhang of deoxythymidine(dT) would have the following
structure:
1 cgagaggcggacgggaccgTT Antisense Strand
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline..vertline..vertline..vertli-
ne..vertline..vertline..vertline..vertline. TTgctctccgcctgccctggc
Complement
[0148] In another embodiment, a duplex comprising an antisense
strand having the same sequence CGAGAGGCGGACGGGACCG may be prepared
with blunt ends (no single stranded overhang) as shown:
2 cgagaggcggacgggaccg Antisense Strand
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline..vertline..vertline..vertline..vertline..vertline..vertli-
ne..vertline..vertline..vertline..vertline. gctctccgcctgccctggc
Complement
[0149] RNA strands of the duplex can be synthesized by methods
disclosed herein or purchased from Dharmacon Research Inc.,
(Lafayette, Colo.). Once synthesized, the complementary strands are
annealed. The single strands are aliquoted and diluted to a
concentration of 50 uM. Once diluted, 30 uL of each strand is
combined with 15uL of a 5.times. solution of annealing buffer. The
final concentration of said buffer is 100 mM potassium acetate, 30
mM HEPES-KOH pH 7.4, and 2mM magnesium acetate. The final volume is
75 uL. This solution is incubated for 1 minute at 90.degree. C. and
then centrifuged for 15 seconds. The tube is allowed to sit for 1
hour at 37.degree. C. at which time the dsRNA duplexes are used in
experimentation. The final concentration of the dsRNA duplex is 20
uM. This solution can be stored frozen (-20.degree. C.) and
freeze-thawed up to 5 times.
[0150] Once prepared, the duplexed antisense compounds are
evaluated for their ability to modulate CD40 expression.
[0151] When cells reached 80% confluency, they are treated with
duplexed antisense compounds of the invention. For cells grown in
96-well plates, wells are washed once with 200 .mu.L OPTI-MEM-1
reduced-serum medium (Gibco BRL) and then treated with 130 .mu.L of
OPTI-MEM-1 containing 12 .mu.g/mL LIPOFECTIN (Gibco BRL) and the
desired duplex antisense compound at a final concentration of 200
nM. After 5 hours of treatment, the medium is replaced with fresh
medium. Cells are harvested 16 hours after treatment, at which time
RNA is isolated and target reduction measured by RT-PCR.
Example 6
Oligonucleotide Isolation
[0152] After cleavage from the controlled pore glass solid support
and deblocking in concentrated ammonium hydroxide at 55.degree. C.
for 12-16 hours, the oligonucleotides or oligonucleosides are
recovered by precipitation out of 1 M NH.sub.4OAc with >3
volumes of ethanol. Synthesized oligonucleotides were analyzed by
electrospray mass spectroscopy (molecular weight determination) and
by capillary gel electrophoresis and judged to be at least 70% full
length material. The relative amounts of phosphorothioate and
phosphodiester linkages obtained in the synthesis was determined by
the ratio of correct molecular weight relative to the -16 amu
product (.+-.32 .+-.48). For some studies oligonucleotides were
purified by HPLC, as described by Chiang et al., J. Biol. Chem.
1991, 266, 18162-18171. Results obtained with HPLC-purified
material were similar to those obtained with non-HPLC purified
material.
Example 7
Oligonucleotide Synthesis--96 Well Plate Format
[0153] Oligonucleotides were synthesized via solid phase P(III)
phosphoramidite chemistry on an automated synthesizer capable of
assembling 96 sequences simultaneously in a 96-well format.
Phosphodiester internucleotide linkages were afforded by oxidation
with aqueous iodine. Phosphorothioate internucleotide linkages were
generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard
base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were
purchased from commercial vendors (e.g. PE-Applied Biosystems,
Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard
nucleosides are synthesized as per standard or patented methods.
They are utilized as base protected beta-cyanoethyldiisopropyl
phosphoramidites.
[0154] Oligonucleotides were cleaved from support and deprotected
with concentrated NH.sub.40H at elevated temperature (55-60.degree.
C.) for 12-16 hours and the released product then dried in vacuo.
The dried product was then re-suspended in sterile water to afford
a master plate from which all analytical and test plate samples are
then diluted utilizing robotic pipettors.
Example 8
Oligonucleotide Analysis--96-Well Plate Format
[0155] The concentration of oligonucleotide in each well was
assessed by dilution of samples and UV absorption spectroscopy. The
full-length integrity of the individual products was evaluated by
capillary electrophoresis (CE) in either the 96-well format
(Beckman P/ACE.TM. MDQ) or, for individually prepared samples, on a
commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270).
Base and backbone composition was confirmed by mass analysis of the
compounds utilizing electrospray-mass spectroscopy. All assay test
plates were diluted from the master plate using single and
multi-channel robotic pipettors. Plates were judged to be
acceptable if at least 85% of the compounds on the plate were at
least 85% full length.
Example 9
Antisense Sequences Targeted to Human CD40
[0156] In accordance with the present invention, a series of
antisense sequences were designed to target different regions of
the human CD40 mRNA, using published sequences [Stamenkovic et al.,
EMBO J., 8, 1403 (1989); GenBank accession number X60592]. The
sequences are shown in Table 1.
3TABLE 1 Antisense sequences targeted to human CD40 mRNA TARGET
TARGET SEQ ID ISIS# REGION SITE.sup.1 SEQUENCE NO. 18623 5' UTR 18
CCAGGCGGCAGGACCACT 1 18624 5' UTR 20 GACCAGGCGGCAGGACCA 2 18625 5'
UTR 26 AGGTGAGACCAGGCGGCA 3 18626 AUG 48 CAGAGGCAGACGAACCAT 4 18627
Coding 49 GCAGAGGCAGACGAACCA 5 18628 Coding 73 GCAAGCAGCCCCAGAGGA 6
18629 Coding 78 GGTCAGCAAGCAGCCCCA 7 18630 Coding 84
GACAGCGGTCAGCAAGCA 8 18631 Coding 88 GATGGACAGCGGTCAGCA 9 18632
Coding 92 TCTGGATGGACAGCGGTC 10 18633 Coding 98 GGTGGTTCTGGATGGACA
11 18634 Coding 101 GTGGGTGGTTCTGGATGG 12 18635 Coding 104
GCAGTGGGTGGTTCTGGA 13 18636 Coding 152 CACAAAGAACAGCACTGA 14 18637
Coding 156 CTGGCACAAAGAACAGCA 15 18638 Coding 162
TCCTGGCTGGCACAAAGA 16 18639 Coding 165 CTGTCCTGGCTGGCACAA 17 18640
Coding 176 CTCACCAGTTTCTGTCCT 18 18641 Coding 179
TCACTCACCAGTTTCTGT 19 18642 Coding 185 GTGCAGTCACTCACCAGT 20 18643
Coding 190 ACTCTGTGCAGTCACTCA 21 18644 Coding 196
CAGTGAACTCTGTGCAGT 22 18645 Coding 205 ATTCCGTTTCAGTGAACT 23 18646
Coding 211 GAAGGCATTCCGTTTCAG 24 18647 Coding 222
TTCACCGCAAGGAAGGCA 25 18648 Coding 250 CTCTGTTCCAGGTGTCTA 26 18649
Coding 267 CTGGTGGCAGTGTGTCTC 27 18650 Coding 286
TGGGGTCGCAGTATTTGT 28 18651 Coding 289 GGTTGGGGTCGCAGTATT 29 18652
Coding 292 CTAGGTTGGGGTCGCAGT 30 18653 Coding 318
GGTGCCCTTCTGCTGGAC 31 18654 Coding 322 CTGAGGTGCCCTTCTGCT 32 18655
Coding 332 GTGTCTGTTTCTGAGGTG 33 18656 Coding 334
TGGTGTCTGTTTCTGAGG 34 18657 Coding 345 ACAGGTGCAGATGGTGTC 35 18658
Coding 348 TTCACAGGTGCAGATGGT 36 18659 Coding 360
GTGCCAGCCTTCTTCACA 37 18660 Coding 364 TACAGTGCCAGCCTTCTT 38 18661
Coding 391 GGACACAGCTCTCACAGG 39 18662 Coding 395
TGCAGGACACAGCTCTCA 40 18663 Coding 401 GAGCGGTGCAGGACACAG 41 18664
Coding 416 AAGCCGGGCGAGCATGAG 42 18665 Coding 432
AATCTGCTTGACCCCAAA 43 18666 Coding 446 GAAACCCCTGTAGCAATC 44 18667
Coding 452 GTATCAGAAACCCCTGTA 45 18668 Coding 463
GCTCGCAGATGGTATCAG 46 18669 Coding 468 GCAGGGCTCGCAGATGGT 47 18670
Coding 471 TGGGCAGGGCTCGCAGAT 48 18671 Coding 474
GACTGGGCAGGGCTCGCA 49 18672 Coding 490 CATTGGAGAAGAAGCCGA 50 18673
Coding 497 GATGACACATTGGAGAAG 51 18674 Coding 500
GCAGATGACACATTGGAG 52 18675 Coding 506 TCGAAAGCAGATGACACA 53 18676
Coding 524 GTCCAAGGGTGACATTTT 54 18677 Coding 532
CACAGCTTGTCCAAGGGT 55 18678 Coding 539 TTGGTCTCACAGCTTGTC 56 18679
Coding 546 CAGGTCTTTGGTCTCACA 57 18680 Coding 558
CTGTTGCACAACCAGGTC 58 18681 Coding 570 GTTTGTGCCTGCCTGTTG 59 18682
Coding 575 GTCTTGTTTGTGCCTGCC 60 18683 Coding 590
CCACAGACAACATCAGTC 61 18684 Coding 597 CTGGGGACCACAGACAAC 62 18685
Coding 607 TCAGCCGATCCTGGGGAC 63 18686 Coding 621
CACCACCAGGGCTCTCAG 64 18687 Coding 626 GGGATCACCACCAGGGCT 65 18688
Coding 657 GAGGATGGCAAACAGGAT 66 18689 Coding 668
ACCAGCACCAAGAGGATG 67 18690 Coding 679 TTTTGATAAAGACCAGCA 68 18691
Coding 703 TATTGGTTGGCTTCTTGG 69 18692 Coding 729
GGGTTCCTGCTTGGGGTG 70 18693 Coding 750 GTCGGGAAAATTGATCTC 71 18694
Coding 754 GATCGTCGGGAAAATTGA 72 18695 Coding 765
GGAGCCAGGAAGATCGTC 73 18696 Coding 766 TGGAGCCAGGAAGATCGT 74 18697
Coding 780 TGGAGCAGCAGTGTTGGA 75 18698 Coding 796
GTAAAGTCTCCTGCACTG 76 18699 Coding 806 TGGCATCCATGTAAAGTC 77 18700
Coding 810 CGGTTGGCATCCATGTAA 78 18701 Coding 834
CTCTTTGCCATCCTCCTG 79 18702 Coding 861 CTGTCTCTCCTGCACTGA 80 18703
Stop 873 GGTGCAGCCTCACTGTCT 81 18704 3' UTR 910 AACTGCCTGTTTGCCCAC
82 18705 3' UTR 954 CTTCTGCCTGCACCCCTG 83 18706 3' UTR 976
ACTGACTGGGCATAGCTC 84 .sup.1Target sites are indicated by the 5'
most nucleotide to which the oligonucleotide hybridizes on the CD40
mRNA sequence. Nucleotide numbers are as given in the sequence
source reference (Genbank accession no. X60592, incorporated herein
as SEQ ID NO: 85). Target regions on the CD40 mRNA are also
indicated.
Example 10
Cell Culture and Oligonucleotide Treatment
[0157] The effect of antisense compounds on target nucleic acid
expression can be tested in any of a variety of cell types provided
that the target nucleic acid is present at measurable levels. This
can be routinely determined using, for example, PCR or Northern
blot analysis. The following four cell types are provided for
illustrative purposes, but other cell types can be routinely
used.
[0158] T-24 Cells:
[0159] The transitional cell bladder carcinoma cell line T-24 was
obtained from the American Type Culture Collection (ATCC)
(Manassas, Va.). T-24 cells were routinely cultured in complete
McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, Md.)
supplemented with 10% fetal calf serum (Gibco/Life Technologies,
Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin
100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.).
Cells were routinely passaged by trypsinization and dilution when
they reached 90% confluence. Cells were seeded into 96-well plates
(Falcon-Primaria #3872) at a density of 7000 cells/well for use in
real-time quantitative polymerase chain reaction (PCR).
[0160] For Northern blotting or other analysis, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
[0161] A549 cells:
[0162] The human lung carcinoma cell line A549 was obtained from
the American Type Culture Collection (ATCC) (Manassas, Va.). A549
cells were routinely cultured in DMEM basal media (Gibco/Life
Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf
serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100
units per mL, and streptomycin 100 .mu.g/mL (Gibco/Life
Technologies, Gaithersburg, Md.). Cells were routinely passaged by
trysinization and dilution when they reached 90% confluence.
NHDF Cells:
[0163] Human neonatal dermal fibroblast (NHDF)cells were obtained
from the Clonetics Corporation (Walkersville, Md.). NHDFs were
routinely maintained in Fibroblast Growth Medium (Clonetics
Corporation, Walkersville, Md.) as recommended by the supplier.
Cells were maintained for up to 10 passages as recommended by the
supplier.
[0164] HEK Cells:
[0165] Human embryonic keratinocytes (HEK) were obtained from the
Clonetics Corporation (Walkersville, Md.). HEKs were routinely
maintained in Keratinocyte Growth Medium (Clonetics Corporation,
Walkersville, Md.) formulated as recommended by the supplier. Cell
were routinely maintained for up to 10 passages as recommended by
the supplier.
[0166] Treatment with Antisense Compounds:
[0167] When cells reached 80% confluency, they were treated with
oligonucleotide. For cells grown in 96-well plates, wells were
washed once with 200 .mu.l Opti-MEM.TM.-1 reduced-serum medium
(Gibco BRL) and then treated with 130 .mu.l of Opti-MEM.TM.-1
containing 3.75 .mu.g/mL LIPOFECTIN.TM. (Gibco BRL) and the desired
oligonucleotide at a final concentration of 150 nM. After 4 hours
of treatment, the medium was replaced with fresh medium. Cells were
harvested 16 hours after oligonucleotide treatment.
Example 11
Analysis of Oligonucleotide Inhibition of CD40 Expression
[0168] Antisense modulation of CD40 expression can be assayed in a
variety of ways known in the art. For example, CD40 mRNA levels can
be quantitated by, e.g., Northern blot analysis, competitive PCR,
or real-time PCR. Real-time quantitative PCR is presently
preferred. RNA analysis can be performed on total cellular RNA or
poly(A)+ mRNA. For real-time quantitative PCR, poly(A)+ mRNA is
preferred. Methods of RNA isolation are taught in, for example,
Ausubel, F. M. et al., Current Protocols in Molecular Biology,
Volume 1, pp.4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons,
Inc., (1993). Northern blot analysis is routine in the art and is
taught in, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley &
Sons, Inc., (1996). Real-time quantitative polymerase chain
reaction (PCR) can be conveniently accomplished using the
commercially available ABI PRISM.TM. 7700 Sequence Detection
System, available from PE-Applied Biosystems, Foster City, Calif.
and used according to manufacturer's instructions. Other methods of
PCR are also known in the art.
[0169] CD40 protein levels can be quantitated in a variety of ways
well known in the art, such as immunoprecipitation, Western blot
analysis (immunoblotting), ELISA or fluorescence-activated cell
sorting (FACS). Antibodies directed to CD40 can be identified and
obtained from a variety of sources, such as those identified in the
MSRS catalog of antibodies, (Aerie Corporation, Birmingham, Mich.
or via the internet at http://www.antibodies-probes.com/), or can
be prepared via conventional antibody generation methods. Methods
for preparation of polyclonal antisera are taught in, for example,
Ausubel, F. M. et al., Current Protocols in Molecular Biology,
Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., (1997).
Preparation of monoclonal antibodies is taught in, for example,
Ausubel, F. M. et al., Current Protocols in Molecular Biology,
Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc.,
(1997)
[0170] Immunoprecipitation methods are standard in the art and can
be found at, for example, Ausubel, F. M. et al., Current Protocols
in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley
& Sons, Inc., (1998). Western blot (immunoblot) analysis is
standard in the art and can be found at, for example, Ausubel, F.
M. et al., Current Protocols in Molecular Biology, Volume 2, pp.
10.8.1-10.8.21, John Wiley & Sons, Inc., (1997). Enzyme-linked
immunosorbent assays (ELISA) are standard in the art and can be
found at, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley &
Sons, Inc., (1991).
Example 12
Poly(A)+ mRNA Isolation
[0171] Poly(A)+ mRNA was isolated according to Miura et al., Clin.
Chem., 42, 1758 (1996). Other methods for poly(A)+ mRNA isolation
are taught in, for example, Ausubel, F. M. et al., Current
Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John
Wiley & Sons, Inc., (1993). Briefly, for cells grown on 96-well
plates, growth medium was removed from the cells and each well was
washed with 200 .mu.l cold PBS. 60 .mu.l lysis buffer (10 mM
Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM
vanadyl-ribonucleoside complex) was added to each well, the plate
was gently agitated and then incubated at room temperature for five
minutes. 55 .mu.l of lysate was transferred to Oligo d(T) coated
96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated
for 60 minutes at room temperature, washed 3 times with 200 .mu.l
of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl).
After the final wash, the plate was blotted on paper towels to
remove excess wash buffer and then air-dried for 5 minutes. 60
.mu.l of elution buffer (5 mM Tris-HCl pH 7.6), preheated to
70.degree. C. was added to each well, the plate was incubated on a
90.degree. hot plate for 5 minutes, and the eluate was then
transferred to a fresh 96-well plate.
[0172] Cells grown on 100 mm or other standard plates may be
treated similarly, using appropriate volumes of all solutions.
Example 13 Northern Blot Analysis of CD40 mRNA Levels
[0173] Eighteen hours after oligonucleotide treatment monolayers
were washed twice with cold PBS and lysed in 0.5 mL RNAzo.TM.
(TEL-TEST "B" Inc., Friendswood, Tex.). Total RNA was prepared
following manufacturer's recommended protocols. Approximately ten
.mu.g of total RNA was fractionated by electrophoresis through 1.2%
agarose gels containing 1.1% formaldehyde using a MOPS buffer
system (Life Technologies, Inc., Rockville, Md.). RNA was
transferred from the gel to Hybond.TM.-N+ nylon membranes (Amersham
Pharmacia Biotech, Piscataway, N.J.) by overnight capillary
transfer using a Northern/Southern Transfer buffer system (TEL-TEST
"B" Inc., Friendswood, Tex.). RNA transfer was confirmed by UV
visualization. Membranes were fixed by UV cross-linking using a
Stratalinker.TM. UV Crosslinker 2400 (Stratagene, Inc, La Jolla,
Calif.).
[0174] Membranes were probed using QuickHyb.TM. hybridization
solution (Stratagene, La Jolla, Calif.) using manufacturer's
recommendations for stringent conditions with a CD40 specific probe
prepared by PCR using the forward primer CAGAGTTCACTGAAACGGAATGC
(SEQ ID No. 86) and the reverse primer GGTGGCAGTGTGTCTCTCTGTTC (SEQ
ID No. 87). To normalize for variations in loading and transfer
efficiency membranes were stripped and probed for
glyceraldehyde-3-phosphate dehydrogenase (G3PDH) RNA (Clontech,
Palo Alto, Calif.). Hybridized membranes were visualized and
quantitated using a PhosphorImager.TM. and ImageQuant Software V3.3
(Molecular Dynamics, Sunnyvale, Calif.). Data was normalized to
G3PDH levels in untreated controls.
Example 14
Real-time Quantitative PCR Analysis of CD40 mRNA Levels
[0175] Quantitation of CD40 mRNA levels was conducted by real-time
quantitative PCR using the ABI PRISM.TM. 7700 Sequence Detection
System (PE-Applied Biosystems, Foster City, Calif.) according to
manufacturer's instructions. This is a closed-tube, non-gel-based,
fluorescence detection system which allows high-throughput
quantitation of polymerase chain reaction (PCR) products in
real-time. As opposed to standard PCR, in which amplification
products are quantitated after the PCR is completed, products in
real-time quantitative PCR are quantitated as they accumulate. This
is accomplished by including in the PCR reaction an oligonucleotide
probe that anneals specifically between the forward and reverse PCR
primers, and contains two fluorescent dyes. A reporter dye (e.g.,
JOE or FAM, PE-Applied Biosystems, Foster City, Calif.) is attached
to the 5' end of the probe and a quencher dye (e.g., TAMRA,
PE-Applied Biosystems, Foster City, Calif.) is attached to the 3'
end of the probe. When the probe and dyes are intact, reporter dye
emission is quenched by the proximity of the 3' quencher dye.
During amplification, annealing of the probe to the target sequence
creates a substrate that can be cleaved by the 5'-exonuclease
activity of Taq polymerase. During the extension phase of the PCR
amplification cycle, cleavage of the probe by Taq polymerase
releases the reporter dye from the remainder of the probe (and
hence from the quencher moiety) and a sequence-specific fluorescent
signal is generated. With each cycle, additional reporter dye
molecules are cleaved from their respective probes, and the
fluorescence intensity is monitored at regular (six-second)
intervals by laser optics built into the ABI PRISMS.TM. 7700
Sequence Detection System. In each assay, a series of parallel
reactions containing serial dilutions of mRNA from untreated
control samples generates a standard curve that is used to
quantitate the percent inhibition after antisense oligonucleotide
treatment of test samples.
[0176] PCR reagents were obtained from PE-Applied Biosystems,
Foster City, Calif. Reverse transcriptase PCR reactions were
carried out by adding 25 .mu.l PCR cocktail (1.times. Taqman.TM.
buffer A, 5.5 mM MgCl.sub.2, 300 .mu.M each of dATP, dCTP and dGTP,
600 .mu.M of dUTP, 100 nM each of forward primer, reverse primer,
and probe, 20 units RNAse inhibitor, 1.25 units AmpliTaq Gold.TM.,
and 12.5 units Moloney Murine Leukemia Virus (MuLV) Reverse
Transcriptase to 96 well plates containing 25 .mu.l poly(A) mRNA
solution. The RT reaction was carried out by incubation for 30
minutes at 48.degree. C. following a 10 minute incubation at
95.degree. C. to activate the AmpliTaq Gold.TM., 40 cycles of a
two-step PCR protocol were carried out: 95.degree. C. for 15
seconds (denaturation) followed by 60.degree. C. for one minute
(annealing/extension).
[0177] For CD40, the PCR primers were: forward primer:
CAGAGTTCACTGAAACGGAATGC (SEQ ID No. 86) reverse primer:
GGTGGCAGTGTGTCTCTCTGTTC (SEQ ID No. 87) and the PCR probe was:
FAM-TTCCTTGCGGTGAAAGCGAATTCCT-TAMRA (SEQ ID No. 88) where FAM
(PE-Applied Biosystems, Foster City, Calif.) is the fluorescent
reporter dye) and TAMRA (PE-Applied Biosystems, Foster City,
Calif.) is the quencher dye.
[0178] For GAPDH the PCR primers were: forward primer:
GAAGGTGAAGGTCGGAGTC (SEQ ID No. 89) reverse primer:
GAAGATGGTGATGGGATTTC (SEQ ID No. 90) and the PCR probe was: 5'
JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID No. 91) where JOE
(PE-Applied Biosystems, Foster City, Calif.) is the fluorescent
reporter dye) and TAMRA (PE-Applied Biosystems, Foster City,
Calif.) is the quencher dye.
Example 15
Western Blot Analysis of CD40 Protein Levels
[0179] Western blot analysis (immunoblot analysis) is carried out
using standard methods. Cells are harvested 16-20 hr after
oligonucleotide treatment, washed once with PBS, suspended in
Laemmli buffer (100 .mu.l/well), boiled for 5 minutes and loaded on
a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and
transferred to membrane for western blotting. Appropriate primary
antibody directed to CD40 is used, with a radiolabelled or
fluorescently labeled secondary antibody directed against the
primary antibody species. Bands are visualized using a
PhosphorImager.TM. (Molecular Dynamics, Sunnyvale Calif.).
Example 16
Antisense Inhibition of CD40 Expression by Phosphorothioate
Oligodeoxynucleotides
[0180] In accordance with the present invention, a series of
oligonucleotides were designed to target different regions of the
human CD40 mRNA, using published sequences [Stamenkovic et al.,
EMBO J., 8, 1403 (1989); GenBank accession number X60592,
incorporated herein as SEQ ID NO: 85]. The oligonucleotides are
shown in Table 2. Target sites are indicated by the 5' most
nucleotide to which the oligonucleotide hybridizes on the CD40 mRNA
sequence. Nucleotide numbers are as given in the sequence source
reference (Genbank accession no. X60592, incorporated herein as SEQ
ID NO: 85). All compounds in Table 2 are oligodeoxynucleotides with
phosphorothioate backbones (internucleoside linkages) throughout.
The compounds were analyzed for effect on CD40 mRNA levels by
real-time PCR quantitation of RNA as described in Example 14. Data
are averages from three experiments.
4TABLE 2 Inhibition of CD40 mRNA levels by phosphorothioate
oligodeoxynucleotides TARGET TARGET % SEQ ID ISIS# REGION SITE
SEQUENCE INHIB. NO. 18623 5' UTR 18 CCAGGCGGCAGGACCACT 30.71 1
18624 5' UTR 20 GACCAGGCGGCAGGACCA 28.09 2 18625 5' UTR 26
AGGTGAGACCAGGCGGCA 21.89 3 18626 AUG 48 CAGAGGCAGACGAACCAT 0.00 4
18627 Coding 49 GCAGAGGCAGACGAACCA 0.00 5 18628 Coding 73
GCAAGCAGCCCCAGAGGA 0.00 6 18629 Coding 78 GGTCAGCAAGCAGCCCCA 29.96
7 18630 Coding 84 GACAGCGGTCAGCAAGCA 0.00 8 18631 Coding 88
GATGGACAGCGGTCAGCA 0.00 9 18632 Coding 92 TCTGGATGGACAGCGGTC 0.00
10 18633 Coding 98 GGTGGTTCTGGATGGACA 0.00 11 18634 Coding 101
GTGGGTGGTTCTGGATGG 0.00 12 18635 Coding 104 GCAGTGGGTGGTTCTGGA 0.00
13 18636 Coding 152 CACAAAGAACAGCACTGA 0.00 14 18637 Coding 156
CTGGCACAAAGAACAGCA 0.00 15 18638 Coding 162 TCCTGGCTGGCACAAAGA 0.00
16 18639 Coding 165 CTGTCCTGGCTGGCACAA 4.99 17 18640 Coding 176
CTCACCAGTTTCTGTCCT 0.00 18 18641 Coding 179 TCACTCACCAGTTTCTGT 0.00
19 18642 Coding 185 GTGCAGTCACTCACCAGT 0.00 20 18643 Coding 190
ACTCTGTGCAGTCACTCA 0.00 21 18644 Coding 196 CAGTGAACTCTGTGCAGT 5.30
22 18645 Coding 205 ATTCCGTTTCAGTGAACT 0.00 23 18646 Coding 211
GAAGGCATTCCGTTTCAG 9.00 24 18647 Coding 222 TTCACCGCAAGGAAGGCA 0.00
25 18648 Coding 250 CTCTGTTCCAGGTGTCTA 0.00 26 18649 Coding 267
CTGGTGGCAGTGTGTCTC 0.00 27 18650 Coding 286 TGGGGTCGCAGTATTTGT 0.00
28 18651 Coding 289 GGTTGGGGTCGCAGTATT 0.00 29 18652 Coding 292
CTAGGTTGGGGTCGCAGT 0.00 30 18653 Coding 318 GGTGCCCTTCTGCTGGAC
19.67 31 18654 Coding 322 CTGAGGTGCCCTTCTGCT 15.63 32 18655 Coding
332 GTGTCTGTTTCTGAGGTG 0.00 33 18656 Coding 334 TGGTGTCTGTTTCTGAGG
0.00 34 18657 Coding 345 ACAGGTGCAGATGGTGTC 0.00 35 18658 Coding
348 TTCACAGGTGCAGATGGT 0.00 36 18659 Coding 360 GTGCCAGCCTTCTTCACA
5.67 37 18660 Coding 364 TACAGTGCCAGCCTTCTT 7.80 38 18661 Coding
391 GGACACAGCTCTCACAGG 0.00 39 18662 Coding 395 TGCAGGACACAGCTCTCA
0.00 40 18663 Coding 401 GAGCGGTGCAGGACACAG 0.00 41 18664 Coding
416 AAGCCGGGCGAGCATGAG 0.00 42 18665 Coding 432 AATCTGCTTGACCCCAAA
5.59 43 18666 Coding 446 GAAACCCCTGTAGCAATC 0.10 44 18667 Coding
452 GTATCAGAAACCCCTGTA 0.00 45 18668 Coding 463 GCTCGCAGATGGTATCAG
0.00 46 18669 Coding 468 GCAGGGCTCGCAGATGGT 34.05 47 18670 Coding
471 TGGGCAGGGCTCGCAGAT 0.00 48 18671 Coding 474 GACTGGGCAGGGCTCGCA
2.71 49 18672 Coding 490 CATTGGAGAAGAAGCCGA 0.00 50 18673 Coding
497 GATGACACATTGGAGAAG 0.00 51 18674 Coding 500 GCAGATGACACATTGGAG
0.00 52 18675 Coding 506 TCGAAAGCAGATGACACA 0.00 53 18676 Coding
524 GTCCAAGGGTGACATTTT 8.01 54 18677 Coding 532 CACAGCTTGTCCAAGGGT
0.00 55 18678 Coding 539 TTGGTCTCACAGCTTGTC 0.00 56 18679 Coding
546 CAGGTCTTTGGTCTCACA 6.98 57 18680 Coding 558 CTGTTGCACAACCAGGTC
18.76 58 18681 Coding 570 GTTTGTGCCTGCCTGTTG 2.43 59 18682 Coding
575 GTCTTGTTTGTGCCTGCC 0.00 60 18683 Coding 590 CCACAGACAACATCAGTC
0.00 61 18684 Coding 597 CTGGGGACCACAGACAAC 0.00 62 18685 Coding
607 TCAGCCGATCCTGGGGAC 0.00 63 18686 Coding 621 CACCACCAGGGCTCTCAG
23.31 64 18687 Coding 626 GGGATCACCACCAGGGCT 0.00 65 18688 Coding
657 GAGGATGGCAAACAGGAT 0.00 66 18689 Coding 668 ACCAGCACCAAGAGGATG
0.00 67 18690 Coding 679 TTTTGATAAAGACCAGCA 0.00 68 18691 Coding
703 TATTGGTTGGCTTCTTGG 0.00 69 18692 Coding 729 GGGTTCCTGCTTGGGGTG
0.00 70 18693 Coding 750 GTCGGGAAAATTGATCTC 0.00 71 18694 Coding
754 GATCGTCGGGAAAATTGA 0.00 72 18695 Coding 765 GGAGCCAGGAAGATCGTC
0.00 73 18696 Coding 766 TGGAGCCAGGAAGATCGT 0.00 74 18697 Coding
780 TGGAGCAGCAGTGTTGGA 0.00 75 18698 Coding 796 GTAAAGTCTCCTGCACTG
0.00 76 18699 Coding 806 TGGCATCCATGTAAAGTC 0.00 77 18700 Coding
810 CGGTTGGCATCCATGTAA 0.00 78 18701 Coding 834 CTCTTTGCCATCCTCCTG
4.38 79 18702 Coding 861 CTGTCTCTCCTGCACTGA 0.00 80 18703 Stop 873
GGTGCAGCCTCACTGTCT 0.00 81 18704 3' UTR 910 AACTGCCTGTTTGCCCAC
33.89 82 18705 3' UTR 954 CTTCTGCCTGCACCCCTG 0.00 83 18706 3' UTR
976 ACTGACTGGGCATAGCTC 0.00 84
[0181] As shown in Table 2, SEQ ID NOs 1, 2, 7, 47 and 82
demonstrated at least 25% inhibition of CD40 expression in this
assay and are therefore preferred.
Example 17
Antisense Inhibition of CD40 Expression by Phosphorothioate 2'-MOE
Gapmer Oligonucleotides
[0182] In accordance with the present invention, a second series of
oligonucleotides targeted to human CD40 were synthesized. The
oligonucleotides are shown in Table 3. Target sites are indicated
by nucleotide numbers, as given in the sequence source reference
(Stamenkovic et al., EMBO J., 8, 1403 (1989); Genbank accession no.
X60592), to which the oligonucleotide binds.
[0183] All compounds in Table 3 are chimeric oligonucleotides
("gapmers") 18 nucleotides in length, composed of a central "gap"
region consisting of ten 2'-deoxynucleotides, which is flanked on
both sides (5' and 3' directions) by four-nucleotide "wings." The
wings are composed of 2'-methoxyethyl(2'-MOE)nucleotides. The
internucleoside (backbone) linkages are phosphorothioate (P.dbd.S)
throughout the oligonucleotide. Cytidine residues in the 2'-MOE
wings are 5-methylcytidines.
[0184] Data were obtained by real-time quantitative PCR as
described in Example 14 and are averaged from three experiments.
"ND" indicates a value was not determined.
5TABLE 3 Inhibition of CD40 mRNA levels by chimeric
phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy
gap % TARGET TARGET Inhi- SEQ ID ISIS# REGION SITE SEQUENCE bition
NO. 19211 5' UTR 18 CCAGGCGGCAGGACCACT 75.71 1 19212 5' UTR 20
GACCAGGCGGCAGGACCA 77.23 2 19213 5' UTR 26 AGGTGAGACCAGGCGGCA 80.82
3 19214 AUG 48 CAGAGGCAGACGAACCAT 23.68 4 19215 Coding 49
GCAGAGGCAGACGAACCA 45.97 5 19216 Coding 73 GCAAGCAGCCCCAGAGGA 65.80
6 19217 Coding 78 GGTCAGCAAGCAGCCCCA 74.73 7 19218 Coding 84
GACAGCGGTCAGCAAGCA 67.21 8 19219 Coding 88 GATGGACAGCGGTCAGCA 65.14
9 19220 Coding 92 TCTGGATGGACAGCGGTC 78.71 10 19221 Coding 98
GGTGGTTCTGGATGGACA 81.33 11 19222 Coding 101 GTGGGTGGTTCTGGATGG
57.79 12 19223 Coding 104 GCAGTGGGTGGTTCTGGA 73.70 13 19224 Coding
152 CACAAAGAACAGCACTGA 40.25 14 19225 Coding 156 CTGGCACAAAGAACAGCA
60.11 15 19226 Coding 162 TCCTGGCTGGCACAAAGA 10.18 16 19227 Coding
165 CTGTCCTGGCTGGCACAA 24.37 17 19228 Coding 176 CTCACCAGTTTCTGTCCT
22.30 18 19229 Coding 179 TCACTCACCAGTTTCTGT 40.64 19 19230 Coding
185 GTGCAGTCACTCACCAGT 82.04 20 19231 Coding 190 ACTCTGTGCAGTCACTCA
37.59 21 19232 Coding 196 CAGTGAACTCTGTGCAGT 40.26 22 19233 Coding
205 ATTCCGTTTCAGTGAACT 56.03 23 19234 Coding 211 GAAGGCATTCCGTTTCAG
32.21 24 19235 Coding 222 TTCACCGCAAGGAAGGCA 61.03 25 19236 Coding
250 CTCTGTTCCAGGTGTCTA 62.19 26 19237 Coding 267 CTGGTGGCAGTGTGTCTC
70.32 27 19238 Coding 286 TGGGGTCGCAGTATTTGT 0.00 28 19239 Coding
289 GGTTGGGGTCGCAGTATT 19.40 29 19240 Coding 292 CTAGGTTGGGGTCGCAGT
36.32 30 19241 Coding 318 GGTGCCCTTCTGCTGGAC 78.91 31 19242 Coding
322 CTGAGGTGCCCTTCTGCT 69.84 32 19243 Coding 332 GTGTCTGTTTCTGAGGTG
63.32 33 19244 Coding 334 TGGTGTCTGTTTCTGAGG 42.83 34 19245 Coding
345 ACAGGTGCAGATGGTGTC 73.31 35 19246 Coding 348 TTCACAGGTGCAGATGGT
47.72 36 19247 Coding 360 GTGCCAGCCTTCTTCACA 61.32 37 19248 Coding
364 TACAGTGCCAGCCTTCTT 46.82 38 19249 Coding 391 GGACACAGCTCTCACAGG
0.00 39 19250 Coding 395 TGCAGGACACAGCTCTCA 52.05 40 19251 Coding
401 GAGCGGTGCAGGACACAG 50.15 41 19252 Coding 416 AAGCCGGGCGAGCATGAG
32.36 42 19253 Coding 432 AATCTGCTTGACCCCAAA 0.00 43 19254 Coding
446 GAAACCCCTGTAGCAATC 0.00 44 19255 Coding 452 GTATCAGAAACCCCTGTA
36.13 45 19256 Coding 463 GCTCGCAGATGGTATCAG 64.65 46 19257 Coding
468 GCAGGGCTCGCAGATGGT 74.95 47 19258 Coding 471 TGGGCAGGGCTCGCAGAT
0.00 48 19259 Coding 474 GACTGGGCAGGGCTCGCA 82.00 49 19260 Coding
490 CATTGGAGAAGAAGCCGA 41.31 50 19261 Coding 497 GATGACACATTGGAGAAG
13.81 51 19262 Coding 500 GCAGATGACACATTGGAG 78.48 52 19263 Coding
506 TCGAAAGCAGATGACACA 59.28 53 19264 Coding 524 GTCCAAGGGTGACATTTT
70.99 54 19265 Coding 532 CACAGCTTGTCCAAGGGT 0.00 55 19266 Coding
539 TTGGTCTCACAGCTTGTC 45.92 56 19267 Coding 546 CAGGTCTTTGGTCTCACA
63.95 57 19268 Coding 558 CTGTTGCACAACCAGGTC 82.32 58 19269 Coding
570 GTTTGTGCCTGCCTGTTG 70.10 59 19270 Coding 575 GTCTTGTTTGTGCCTGCC
68.95 60 19271 Coding 590 CCACAGACAACATCAGTC 11.22 61 19272 Coding
597 CTGGGGACCACAGACAAC 9.04 62 19273 Coding 607 TCAGCCGATCCTGGGGAC
0.00 63 19274 Coding 621 CACCACCAGGGCTCTCAG 23.08 64 19275 Coding
626 GGGATCACCACCAGGGCT 57.94 65 19276 Coding 657 GAGGATGGCAAACAGGAT
49.14 66 19277 Coding 668 ACCAGCACCAAGAGGATG ND 67 19278 Coding 679
TTTTGATAAAGACCAGCA 30.58 68 19279 Coding 703 TATTGGTTGGCTTCTTGG
49.26 69 19280 Coding 729 GGGTTCCTGCTTGGGGTG 13.95 70 19281 Coding
750 GTCGGGAAAATTGATCTC 54.78 71 19282 Coding 754 GATCGTCGGGAAAATTGA
0.00 72 19283 Coding 765 GGAGCCAGGAAGATCGTC 69.47 73 19284 Coding
766 TGGAGCCAGGAAGATCGT 54.48 74 19285 Coding 780 TGGAGCAGCAGTGTTGGA
15.17 75 19286 Coding 796 GTAAAGTCTCCTGCACTG 30.62 76 19287 Coding
806 TGGCATCCATGTAAAGTC 65.03 77 19288 Coding 810 CGGTTGGCATCCATGTAA
34.49 78 19289 Coding 834 CTCTTTGCCATCCTCCTG 41.84 79 19290 Coding
861 CTGTCTCTCCTGCACTGA 25.68 80 19291 Stop 873 GGTGCAGCCTCACTGTCT
76.27 81 19292 3' UTR 910 AACTGCCTGTTTGCCCAC 63.34 82 19293 3' UTR
954 CTTCTGCCTGCACCCCTG 0.00 83 19294 3' UTR 976 ACTGACTGGGCATAGCTC
11.55 84
[0185] As shown in Table 3, SEQ ID NO: 1, 2, 3, 6, 7, 8, 9, 10, 11,
12, 13, 15, 20, 23, 25, 26, 27, 31, 32, 33, 35, 37, 40, 41, 46, 47,
49, 52, 53, 54, 57, 58, 59, 60, 65, 71, 73, 74, 77, 81 and 82
demonstrated at least 50% inhibition of CD40 expression in this
experiment and are therefore preferred.
Example 18:
Correlation of Quantitative Real-time PCR Measurements of RNA
Levels with Northern Analysis of RNA Levels
[0186] The reduction of CD40 mRNA levels by the oligonucleotide
compounds in Tables 2 and 3 was also demonstrated by Northern blot
analysis of CD40 mRNA from oligonucleotide treated cells, as
described in Example 13. The RNA measurements made by Northern
analysis were compared to the RNA measurements obtained using
quantitative real-time PCR, using averaged data from three
experiments in each case.
[0187] When the phosphorothioate oligodeoxynucleotides shown in
Table 2 were tested by Northern blot analysis, SEQ ID Nos 1, 2, 3,
7, 25, 31, 32, 37, 43, 47, 58, 64 and 82 were determined to reduce
CD40 mRNA levels by at least 75% and are therefore preferred. Of
these, SEQ ID Nos 1, 64 and 82 reduced CD40 mRNA levels by at least
80%.
[0188] The correlation coefficient for the results of quantitative
real-time PCR vs. Northern blot analysis for the phosphorothioate
oligodeoxynucleotides was found to be 0.67.
[0189] When the phosphorothioate 2'-MOE chimeric oligonucleotides
shown in Table 3 were tested by Northern blot analysis, SEQ ID Nos
1, 2, 3, 5, 7, 10, 20, 25, 26, 27, 31, 32, 33, 35, 37, 40, 46, 47,
49, 52, 54, 58, 59, 60, 73, 81 and 82 were determined to reduce
CD40 mRNA levels by at least 90% and are therefore preferred. Of
these, SEQ ID Nos 1, 2, 20, 31 and 58 reduced CD40 mRNA levels by
at least 95%.
[0190] The correlation coefficient for quantitative real-time PCR
vs Northern blot results for the phosphorothioate 2'-MOE chimeric
oligonucleotides was 0.78.
EXAMPLE 19
Oligonucleotide-Sensitive Sites of the CD40 Target Nucleic Acid
[0191] As the data presented in the preceding examples shows,
several sequences were present in preferred compounds of two
distinct oligonucleotide chemistries. Specifically, compounds
having SEQ ID NOS: 1, 2, 7, 47 and 82 are preferred in both
instances. These compounds are believed to define accessible sites
of the target nucleic acid to various antisense compositions and
are therefore preferred. For example, SEQ ID NOS: 1 and 2 overlap
each other and both map to the 5-untranslated region (5'-UTR) of
CD40. Accordingly, this region of CD40 is particularly preferred
for modulation via sequence-based technologies. Similarly, SEQ ID
NOS: 7 and 47 map to the open reading frame of CD40, whereas SEQ ID
NO: 82 maps to the 3'-untranslated region (3'-UTR). Thus, the ORF
and 3'-UTR of CD40 may be targeted by sequence-based technologies
as well.
[0192] It has been shown, furthermore, that certain target
sequences on the CD40 mRNA are particularly suitable to antisense
targeting. The reverse complements of the active CD40 compounds,
e.g., the sequence on the CD40 nucleic acid target to which the
active antisense compounds are complementary, are easily determined
by those skilled in the art and may be assembled to yield
nucleotide sequences corresponding to favorable sites on the target
nucleic acid. For example, when the antisense sequences shown in
Tables 1-3 were mapped onto the CD40 mRNA sequence [Stamenkovic et
al., EMBO J., 8, 1403 (1989); GenBank accession number X60592], in
some instances it was found in some cases that all the
oligonucleotides targeted to a particular sequence region of CD40
(usually called a "footprint") were active. Therefore, this
footprint region is particularly preferred for antisense targeting,
and oligonucleotide sequences hybridizable to this footprint are
preferred compounds of the invention. A library of this information
is compiled and may be used by those skilled in the art in a
variety of sequence-based technologies to study the molecular and
biological functions of CD40 and to investigate or confirm its role
in various diseases and disorders.
[0193] An example of such a compilation is shown in Table 4, in
which the antisense sequences shown in Tables 1-3 are mapped onto
the CD40 mRNA sequence [Stamenkovic et al., EMBO J., 8, 1403
(1989); GenBank accession number X60592]. The antisense sequences
(SEQ ID NO: 1, 2, 3, 6, 7, 8, 9, 10, 11, 12, 13, 15, 20, 23, 25,
26, 27, 31, 32, 33, 35, 37, 40, 41, 46, 47, 49, 52, 53, 54, 57, 58,
59, 60, 65, 71, 73, 74, 77, 81 and 82) which were determined by
real-time quantitative PCR assay to be active as inhibitors of CD40
are shown in bold. Examples of "footprint" sequences on the CD40
mRNA sequence to which a series of active oligonucleotides bind are
also shown in bold. These "footprint" sequences and antisense
compounds binding to them (including those not shown herein) are
preferred for targeting.
6TABLE 4 CD40 Antisense Sequence Alignment SEQ ID NO: 1 15 16 30 31
45 46 60 61 75 76 90 9 --------------- ---------------
--------------- --------------- --------------- ------------TGC 8
--------------- --------------- --------------- ---------------
--------------- --------TGCTTGC 7 --------------- ---------------
--------------- --------------- --------------- --TGGGGCTGCTTGC 6
--------------- --------------- --------------- ---------------
------------TCC TCTCGGGCTGCTTGC 5 --------------- ---------------
--------------- ---TGGTTCGTCTGC CTCTGC--------- --------------- 4
--------------- --------------- --------------- --ATGGTTCGTCTGC
CTCTG---------- --------------- 3 --------------- ----------TGCCG
CCTGGTCTCACCT-- --------------- --------------- --------------- 2
--------------- ----TGGTCCTGCCG CCTGGTC-------- ---------------
--------------- --------------- 1 --------------- --AGTGGTCCTGCCG
CCTGG---------- --------------- --------------- ---------------
X60592- GCCTCGCTCGGGCGC CCAGTGGTCCTGCCG CCTGGTCTCACCTCG
CCATGGTTCGTCTGC CTCTGCAGTGCGTCC TCTGGGGCTGCTTGC CD40 91 105 106 120
121 135 136 150 151 165 166 180 19 --------------- ---------------
--------------- --------------- --------------- -------------AC 18
--------------- --------------- --------------- ---------------
--------------- ----------AGGAC 17 --------------- ---------------
--------------- --------------- --------------T TGTGCCAGCCAGGAC 16
--------------- --------------- --------------- ---------------
-----------TCTT TGTGCCAGCCAGGA- 15 --------------- ---------------
--------------- --------------- -----TGCTGTTCTT TGTGCCAG------- 14
--------------- --------------- --------------- ---------------
-TCAGTGCTGTTCTT TGTG----------- 13 -------------TC CAGAACCACCCACTG
C-------------- --------------- --------------- --------------- 12
----------CCATC CAGAACCACCCAC-- --------------- ---------------
--------------- --------------- 11 -------TGTCCATC CAGAACCACC-----
--------------- --------------- --------------- --------------- 10
-GACCGCTGTCCATC CAGA----------- --------------- ---------------
--------------- --------------- 9 TGACCGCTGTCCATC ---------------
--------------- --------------- --------------- --------------- 8
TGACCGCTGTC---- --------------- --------------- ---------------
--------------- --------------- 7 TGACC---------- ---------------
--------------- --------------- --------------- ---------------
X60592- TGACCGCTGTCCATC CAGAACCACCCACTG CATGCAGAGAAAAAC
AGTACCTAATAAACA GTCAGTGCTGTTCTT TGTGCCAGCCAGGAC CD40 181 195 196
210 211 225 226 240 241 255 256 270 27 ---------------
--------------- --------------- --------------- ---------------
-----------GAGA 26 --------------- --------------- ---------------
--------------- ---------TAGACA CCTGGAACAGAG--- 25 ---------------
--------------- -----------TGCC TTCCTTGCGGTGAA- ---------------
--------------- 24 --------------- --------------- CTGAAACGGAATGCC
TTC------------ --------------- --------------- 23 ---------------
---------AGTTCA CTGAAACGGAAT--- --------------- ---------------
--------------- 22 --------------- ACTGCACAGAGTTCA CTG------------
--------------- --------------- --------------- 21 ---------TGAGTG
ACTGCACAGAGT--- --------------- --------------- ---------------
--------------- 20 ----ACTGGTGAGTG ACTGCAC-------- ---------------
--------------- --------------- --------------- 19 AGAAACTGGTGAGTG
A-------------- --------------- --------------- ---------------
--------------- 18 AGAAACTGGTGAG-- --------------- ---------------
--------------- --------------- --------------- 17 AG-------------
--------------- --------------- --------------- ---------------
--------------- X60592- AGAAACTGGTGAGTG ACTGCACAGAGTTCA
CTGAAACGGAATGCC TTCCTTGCGGTGAAA GCGAATTCCTAGACA CCTGGAACAGAGAGA
CD40 271 285 286 300 301 315 316 330 331 345 346 360 37
--------------- --------------- --------------- ---------------
--------------- --------------T 36 --------------- ---------------
--------------- --------------- --------------- --ACCATCTGCACCT 35
--------------- --------------- --------------- ---------------
--------------G ACACCATCTGCACCT 34 --------------- ---------------
--------------- --------------- ---CCTCAGAAACAG ACACCA--------- 33
--------------- --------------- --------------- ---------------
-CACCTCAGAAACAG ACAC----------- 32 --------------- ---------------
--------------- ------AGCAGAAGG GCACCTCAG------ --------------- 31
--------------- --------------- --------------- --GTCCAGCAGAAGG
GCACC---------- --------------- 30 --------------- ------ACTGCGACC
CCAACCTAG------ --------------- --------------- --------------- 29
--------------- ---AATACTGCGACC CCAACC--------- ---------------
--------------- --------------- 28 --------------- ACAAATACTGCGACC
CCA------------ --------------- --------------- --------------- 27
CACACTGCCACCAG- --------------- --------------- ---------------
--------------- --------------- X60592 CACACTGCCACCAGC
ACAAATACTGCGACC CCAACCTAGGGCTTC GGGTCCAGCAGAAGG GCACCTCAGAAACAG
ACACCATCTGCACCT CD40 361 375 376 390 391 405 406 420 421 435 436
450 44 --------------- --------------- ---------------
--------------- --------------- ----------GATTG 43 ---------------
--------------- --------------- --------------- -----------TTTG
GGGTCAAGCAGATT- 42 --------------- --------------- ---------------
----------CTCAT GCTCGCCCGGCTT-- --------------- 41 ---------------
--------------- ----------CTGTG TCCTGCACCGCTC-- ---------------
--------------- 40 --------------- --------------- ----TGAGAGCTGTG
TCCTGCA-------- --------------- --------------- 39 ---------------
--------------- CCTGTGAGAGCTGTG TCC------------ ---------------
--------------- 38 ---AAGAAGGCTGGC ACTGTA--------- ---------------
--------------- --------------- --------------- 37 GTGAAGAAGGCTGGC
AC------------- --------------- --------------- ---------------
--------------- 36 GTGAA---------- --------------- ---------------
--------------- --------------- --------------- 35 GT-------------
--------------- --------------- --------------- ---------------
--------------- X60592- GTGAAGAAGGCTGGC ACTGTACGAGTGAGG
CCTGTGAGAGCTGTG TCCTGCACCGCTCAT GCTCGCCCGGCTTTG GGGTCAAGCAGATTG
CD40 451 465 466 480 481 495 496 510 511 525 526 540 56
--------------- --------------- --------------- ---------------
--------------- -------------GA 55 --------------- ---------------
--------------- --------------- --------------- ------ACCCTTGGA 54
--------------- --------------- --------------- ---------------
-------------AA AATGTCACCCTTGGA 53 --------------- ---------------
--------------- ----------TGTGT CATCTGCTTTCGA-- --------------- 52
--------------- --------------- --------------- ----CTCCAATGTGT
CATCTGC-------- --------------- 51 --------------- ---------------
--------------- -CTTCTCCAATGTGT CATC----------- --------------- 50
--------------- --------------- ---------TCGGCT TCTTCTCCAATG---
--------------- --------------- 49 --------------- --------TGCGAGC
CCTGCCCAGTC---- --------------- --------------- --------------- 48
--------------- -----ATCTGCGAGC CCTGCCCA------- ---------------
--------------- --------------- 47 --------------- --ACCATCTGCGAGC
CCTGC---------- --------------- --------------- --------------- 46
------------CTG ATACCATCTGCGAGC --------------- ---------------
--------------- --------------- 45 -TACAGGGGTTTCTG ATAC-----------
--------------- --------------- --------------- --------------- 44
CTACAGGGGTTTC-- --------------- --------------- ---------------
--------------- --------------- X60592- CTACAGGGGTTTCTG
ATACCATCTGCGAGC CCTGCCCAGTCGGCT TCTTCTCCAATGTGT CATCTGCTTTCGAAA
AATGTCACCCTTGGA CD40 541 555 556 570 571 585 586 600 601 615 616
630 65 --------------- --------------- ---------------
--------------- --------------- ----------AGCCC 64 ---------------
--------------- --------------- --------------- ---------------
-----CTGAGAGCCC 63 --------------- --------------- ---------------
--------------- ------GTCCCCAGG ATCGGCTGA------ 62 ---------------
--------------- --------------- -----------GTTG TCTGTGGTCCCCAG-
--------------- 61 --------------- --------------- ---------------
----GACTGATGTTG TCTGTGG-------- --------------- 60 ---------------
--------------- ----GGCAGGCACAA ACAAGAC-------- ---------------
--------------- 59 --------------- --------------C AACAGGCAGGCACAA
AC------------- --------------- --------------- 58 ---------------
--GACCTGGTTGTGC AACAG---------- --------------- ---------------
--------------- 57 -----TGTGAGACCA AAGACCTG------- ---------------
--------------- --------------- --------------- 56 CAAGCTGTGAGACCA
A-------------- --------------- --------------- ---------------
--------------- 55 CAAGCTGTG------ --------------- ---------------
--------------- --------------- --------------- 54 C--------------
--------------- --------------- --------------- ---------------
--------------- X60592- CAAGCTGTGAGACCA AAGACCTGGTTGTGC
AACAGGCAGGCACAA ACAAGACTGATGTTG TCTGTGGTCCCCAGG ATCGGCTGAGAGCCC
CD40 631 645 646 660 661 675 676 690 691 705 706 720 69
--------------- --------------- --------------- ---------------
------------CCA AGAAGCCAACCAATA 68 --------------- ---------------
--------------- ---TGCTGGTCTTTA TCAAAA--------- --------------- 67
--------------- --------------- -------CATCCTCT TGGTGCTGGT-----
--------------- --------------- 66 --------------- -----------ATCC
TGTTTGCCATCCTC- --------------- --------------- --------------- 65
TGGTGGTGATCCC-- --------------- --------------- ---------------
--------------- --------------- 64 TGGTGGTG------- ---------------
--------------- --------------- --------------- ---------------
X60592- TGGTCCTGATCCCCA TCATCTTCGGGATCC TGTTTGCCATCCTCT
TGGTGCTGGTCTTTA TCAAAAAGGTGGCCA AGAAGCCAACCAATA CD40 721 735 736
750 751 765 766 780 781 795 796 810 78 ---------------
--------------- --------------- --------------- ---------------
--------------T 77 --------------- --------------- ---------------
--------------- --------------- ----------GACTT 76 ---------------
--------------- --------------- --------------- ---------------
CAGTGCAGGAGACTT 75 --------------- --------------- ---------------
--------------T CCAACACTGCTGCTC CA------------- 74 ---------------
--------------- --------------- ACGATCTTCCTGGCT CCA------------
--------------- 73 --------------- --------------- --------------G
ACGATCTTCCTCGCT CC------------- --------------- 72 ---------------
--------------- ---TCAATTTTCCCG ACGATC--------- ---------------
--------------- 71 --------------- --------------G AGATCAATTTTCCCG
AC------------- --------------- --------------- 70 --------CACCCCA
AGCAGGAACCC---- --------------- --------------- ---------------
--------------- X60592- AGGCCCCCCACCCCA AGCAGGAACCCCAGG
AGATCAATTTTCCCG ACGATCTTCCTGGCT CCAACACTGCTGCTC CAGTGCAGGAGACTT
CD40 811 825 826 840 841 855 856 870 871 885 886 900 81
--------------- --------------- --------------- ---------------
--AGACAGTGAGGCT GCACC---------- 80 --------------- ---------------
--------------- -----TCAGTGCAGG AGAGACAG------- --------------- 79
--------------- --------CAGGAGG ATGGCAAAGAG---- ---------------
--------------- --------------- 78 TACATGGATGCCAAC CG-------------
--------------- --------------- --------------- --------------- 77
TACATGGATGCCA-- --------------- --------------- ---------------
--------------- --------------- 86 TAC------------ ---------------
--------------- --------------- --------------- ---------------
X60592- TACATGGATGCCAAC CGGTCACCCAGGAGG ATGGCAAAGAGAGTC
GCATCTCAGTGCAGG AGAGACAGTGAGGCT GCACCCACCCAGGAG CD40 901 915 916
930 931 945 946 960 961 975 976 990 84 ---------------
--------------- --------------- --------------- ---------------
GAGCTATGCCCAGTC 83 --------------- --------------- ---------------
--------CAGGGGT GCAGGCAGAAG---- --------------- 82 ---------GTGGGC
AAACAGGCAGTT--- --------------- --------------- ---------------
--------------- X60592- TGTGGCCACGTGGGC AAACAGGCAGTTGGC
CAGAGAGCCTGGTGC TGCTGCTGCAGGGGT GCAGGCAGAAGCGGG GAGCTATGCCCAGTC
CD40 991 1004 84 AGT------------ X60592- AGTGCCAGCCCCTC CD40
Example 20
PNA Synthesis
[0194] Peptide nucleic acids (PNAs) can be prepared in accordance
with any of the various procedures referred to in Peptide Nucleic
Acids (PNA): Synthesis, Properties and Potential Applications,
Bioorganic & Medicinal Chemistry, 1996, 4, 5-23. They may also
be prepared in accordance with U.S. Pat. Nos. 5,539,082, 5,700,922,
5,719,262 and 6,395,474, herein incorporated by reference.
Method A
[0195] PNA oligomers are synthesized in 10 .mu.mol scale on a 433A
Applied Biosystems Peptide Synthesizer using commercially available
t-butyloxycarbonyl/benzyloxycarbonyl (Boc/Cbz)-protected monomers
(Applied Biosystems) and synthesis protocols based on previously
published procedures. The coupling efficiency is monitored by
qualitative Kaisertest.
Method B
[0196] PNA oligomers were synthesized manually using a LabMate 24
parallel synthesizer (Advanced Chemtech) as described for single
compound synthesis (Christensen et al, 1995, Koch et al, 1997).
Synthesis was performed on solid phase, in 10 .mu.mol scale using a
preloaded Boc-Lys(2-Cl-Z)--OH MBHA resin LL (NovaBiochem,
01-64-0006) and commercially available
tert-butyloxycarbonyl/benzyloxycarbonyl (Boc/Cbz) protected PNA
monomers (Perseptive Biosystems, GEN063010, GEN063011, GEN063012,
GEN063013). The MBHA resin was downloaded by preactivition with
HBTU (14 eq), N-methyl morpholine (14 eq) and Boc-Lysine
(2-Cl-Z)--OH (7 eq) in NMP and loading subsequently determined
using standard loading determination via Fmoc measurement (Nova
Biochem Catalog, 2003). Completion of coupling was verified by
randomized sampling and qualitative Kaiser test. An additional
coupling step was included when Kaiser test was non-conclusive.
PNAs were deprotected and cleaved in parallel using methods
previously applied to single compound synthesis (Christensen et al,
1995; Koch et al, 1997). Purification was performed on a Gilson
HPLC system (215 liquid handler, 155 UV/VIS and 321 pump), by
reverse phase high performance liquid chromatography (RP-HPLC),
using a DELTA PAK (C-18, 15 .mu.m, 300 .ANG., 300.times.7.8 mm, 3
mL/min). A linear gradient from solvent A: 0.1% trifluoroacetic
acid (Aldrich, T6,220-6) in water to B: 0.1 % trifluoroacetic acid
in acetonitrile (Burdick & Jackson, AH015-4) was used as the
liquid phase. Purity was determined by analytical HPLC (0.1%
trifluoroacetic acid in acetonitrile) and composition confirmed by
mass spectrometry. A purity level of greater than 95% was generally
accomplished. Samples were lyophilized on a FreezeZone 6 (LABCONCO,
equipped with a chamber to accommodate racks).
Example 21
Cationic Conjugated PNA
Method A
[0197] PNA-lysine conjugates were synthesized in 10 .mu.mol scale
in parallel on a LabMate 24 parallel synthesizer (Advanced
Chemtech) using a solid support bound PNA that was synthesized as
described above (Christensen et al, 1995, Koch et al, 1997). The
quality of the PNA synthesis was checked prior to peptide
conjugation by cleavage and QC of a fraction of the PNA from the
support. Peptide synthesis was performed by standard solid-phase
tert-butoxycarbonyl (Boc) strategy on support bound PNA, leading to
lysine conjugation at the N-terminal end of the PNA. In addition to
the N-terminal cationic conjugate each PNA also may contain one or
more amino acids, as for example a further lysine unit, at the
C-terminus due to the fact that synthesis is performed on
Boc-Lys(Z-Cl-Z)OH MBHA resin. The PNA-peptide constructs were
synthesized, deprotected and cleaved in parallel. Purification was
performed by reversed phase high performance liquid chromatography
(RP-HPLC). Purity and composition were determined/confirmed by
electrospray ionization mass spectrometry. Synthesis on a 10
.mu.mol scale typically yields>20 mg of PNA oligomer with a
purity level of greater than 95%. Samples were lyophilized on a
FreezeZone 6 (LABCONCO, equipped with a chamber to accommodate
racks).
Method B
[0198] The PNA part of the conjugates is assembled using an
automated 433 A peptide synthesizer (Applied Biosystems) and
commercially available tert-butyloxycarbonyl/benzyloxycarbonyl
(Boc/Cbz) protected PNA monomers (Applied Biosystems) according to
the published procedures of L. Christensen, et al. (1995), J. Pept.
Sci. 1, 175-183; and T. Koch, et al. (1997), J. Pept. Res. 49,
80-88, for PNA synthesis (Boc chemistry). The synthesis is
performed in a 400 .mu.mol scale on MBHA LL polystyrene resin
(NovaBiochem), pre-loaded with Boc-Lys(2-Cl-Z)-OH (NovaBiochem) to
about 0.1-0.2 mmol/g.
[0199] The synthesis of the peptide part of the conjugate is
carried out by either Fmoc- or Boc-chemistry, according to standard
procedures for solid phase peptide synthesis. For deprotection and
cleavage one vol. of a solution of TFA/DMS/m-cresol (1:3:1) is
mixed with one vol. of TFA/TFMSA (9:1) and added to the resin.
After 1 h of shaking the resin is washed with TFA and one vol. of
TFA/TFMSA/m-cresol (8:2:1) was added and the suspension is shaken
for another 1.5-6 h. The filtrate is then added to a 10-fold volume
of cold diethylether, mixed and centrifuged. The supernatant is
removed and the pellet is resuspended in ether. This is repeated
three times. The pellet is dried and re-dissolved in water or 0.1%
TFA for HPLC purification.
[0200] Purification is performed on a Gilson HPLC system (215
liquid handler, 155 UV/VIS and 321 pump), by reverse phase high
performance liquid chromatography (RP-HPLC), using a Zorbax (C-3, 5
.mu.m, 300 .ANG., 250.times.7.8 mm, 4 mL/min). A linear gradient
from solvent A: 0.1% heptafluorobutyric acid in water to B:
acetonitrile is used as the liquid phase. Purity is determined by
analytical HPLC and composition confirmed by electrospray mass
spectrometry. Samples are lyophilized and stored at -20.degree. C.
prior to use.
[0201] PNA oligomeric conjugates incorporating D-lysine,
L-dimethylysine, D-dimethylysine, L-histidine, D-histidine,
L-ornithine, D-ornithine, L-homoarginine, D-homoarginine,
L-norarginine, D-norarginine, L-homohomoarginine,
D-homohomo-arginine, lysine peptoid, 2,4-diamino butyric acid,
homolysine or beta-lysine are prepared in like manner using Boc
blocked histidine, ornithine, arginine, D-lysine, diaminobutyric
and arginine amino acids precursors except as outlined below in the
remainder of this example. Other blocking groups can also be
selected to protect the amino acid units during synthesis of the
conjugate groups.
[0202] PNA-Peptoid Conjugates
[0203] Oligomers of N-substituted glycines, or "peptoids" are a
class of unnatural peptide analogs that resist protease
degradation. For the monomer synthesis N-Z-1.4 diaminobutane (5 g,
19.3 mmole) was dissolved in 200 ml dry pyridine and 20 ml DMSO
were added. To this solution triethylamine (66.5 mmole, 9.24 ml)
was added. Methylbromoacetate (0.871 ml, 9.5 mmole) was diluted in
50 ml dry DMF and added dropwise to the mixture over 3 h, which was
then stirred for another 16 h. Di-tert-butyl dicarbonate (29 mmole,
6.33 g dissolved in 20 ml DCM) was added dropwise under stirring
and was allowed to react overnight. The resulting compound was
extracted with ethyl acetate and identified by TLC. After
evaporating the solvents, the compound was saponified with LiOH
(0.5 M, THF/MeOH/H.sub.2O 1:1:1). The solution was acidified with
HCl (3 M) and was extracted with DCM and identified by TLC, Proton
NMR and LC-MS. The PNA-peptoid-conjugates were synthesized,
deprotected, purified and characterized as described above.
[0204] PNA-Peptide Conjugates Containing L-Homo-Arginine and L-Bis
homo Arginine
[0205] Bis homoarginine is also known and described in this
application as homohomoarginine. For the synthesis of
L-homo-arginine- and L-bishomo-arginine-conjugated PNA,
Boc-L-lysine(Fmoc)-OH and Boc-L-homo lysine(Fmoc)-OH were used as
the initial building blocks and were converted postsynthetically
into L-homo-arginine and L-bishomo arginine, respectively. The
PNA-Peptide-conjugates were synthesized using Boc-chemistry as
described above in this example. After synthesis the
Fmoc-protecting groups of the peptide were removed with 20%
Piperidine in DMF. The free Amino-groups of the peptide-carrier
were guanidinylated by adding a solution of pyrazole
carboxamidine-HCl (0.27 g) in 0.363 ml DIEA and 0.637 ml DMF to the
peptide conjugate on the resin and reacting at 55.degree. C. for 24
h. Subsequently, the PNA-Peptide conjugates were deprotected,
purified and characterized as described above.
[0206] Disulfide-Containing Conjugates The peptide part of the
conjugate (H-dK).sub.8-Cys-NH.sub.2) was synthesized by solid phase
synthesis on a Sieber Amide Resin (NovaBiochem) using standard
peptide synthesis conditions (Fmoc chemistry). After acidic
cleavage from the resin (TFA/m-cresol/triisopropylsilane/H.sub.2O,
94:2,5:1:2.5) for 1 h at room temperature, the peptide was
precipitated into ice-cold diethylether, the precipitate spun down
and washed with ether and dried at 55.degree. C. A solution
containing 2,2-Dipyridyl-disulfide (300 .mu.mol) in AcCN (1500
.mu.L) was prepared. To a separate solution of 20%
pyridine/H.sub.2O (3000 .mu.L) was added the peptide
H-(dK).sub.8-Cys-NH.sub.2(61 .mu.mol) followed by 1% TEA/H.sub.2O
to obtain a pH of roughly 8.7. The solution containing the peptide
was immediately added to the dipyridyl-disulfide solution. The
reaction mixture was allowed to stir for 18 h. The solvents were
removed in vacuo and the desired peptide containing a
pyridyldisulfide-activated thiol group was purified by RP-HPLC.
[0207] The PNA part of the conjugates were synthesized on a
previously prepared Boc-PNA-K-MBHA polystyrene resin. Fmoc
chemistry was utilized to install the ethylene oxide spacer (O) and
the cysteine or penicillamine residue. The resulting
thiol-containing compound was cleaved from the resin using the
above-described Hi/Low TFMSA cleavage conditions and purified using
RP-HPLC as described above. For conjugation, the activated peptide
was dissolved in 10% pyridine/H.sub.2O (10 mM, 1.5 mL) and the
thiol-containing PNA was dissolved in 20% pyridine/H.sub.2O (0.1
mM, 7.5 mL) and the pH was adjusted to 10 using 1% TEA/H.sub.2O (2
mL). The two solutions were immediately combined while shaking. The
pH of the combined solution was 8.2. The reaction was allowed to
continue for 18 h. The solvents were removed in vacuo and the
desired conjugates were purified by RP-HPLC as described above.
Example 22
Cell Culture, Harvest and Transfection
[0208] BCL.sub.1 cells were obtained from the American Type Culture
Collection and grown in normal growth medium (Dulbecco's modified
Eagle medium, supplemented with 10% fetal bovine serum, and
antibiotics). Cells were incubated in a humidified chamber at
37.degree. C., containing 5% CO.sub.2. Antisense agents were
delivered to cells by electroporation (200 V, 13 W, 1000 mFa) using
0.4 cm gap width cuvettes and a BTX electroporator source. Cells
were re-plated in normal growth medium and re-incubated for the
indicated times prior to harvest.
[0209] Primary thioglycollate-elicited macrophages were isolated by
peritoneal lavage from 6-8 week old female C57Bl/6 mice that had
been injected with 1 mL 3% thioglycollate broth 4 days previously.
PNAs were delivered to unpurified peritoneal cells by a single 6 ms
pulse, 90V, on a BTX square wave electroporator in 1 mm cuvettes.
After electroporation, the cells were plated for 1 hour in
serum-free RPMI 1640 (supplemented with 10 mM HEPES) at 37.degree.
C., 5% CO.sub.2 to allow the macrophages to attach. Non-adherent
cells were then washed away and the media was replaced with
complete RPMI 1640 (10% FBS, 10 mM HEPES). Primary macrophages were
activated by treatment with 100 ng/mL rIFN-g (R&D Systems) for
4 hours, followed by 10 .mu.g/mL anti-CD40 antibody (clone 3/23, BD
Pharmingen) for the indicated timepoints.
Example 23
Flow Cytometry Analysis
[0210] Cells were detached from culture plates with 0.25% trypsin.
Trypsin was neutralized with an equal volume of normal growth
medium and cells were pelleted. Cell pellets were resuspended in
200 .mu.L staining buffer (phosphate buffered saline containing 2%
bovine serum albumin and 0.2% NaN.sub.3) containing 1 .mu.g either
FITC labeled isotype control antibody or FITC labeled anti-CD40
antibody (clone HM40-3, BD Biosciences). Cells were stained for one
hour, washed once with staining buffer, and re-suspended in PBS.
Where indicated, cells were resuspended in PBS containing 5
.mu.g/mL propidium iodide to allow for gating only cells that
excluded the dye. CD40 surface expression level was determined
using a FACScan flow cytometer (Becton Dickinson).
Example 24
Toxicity Assay
[0211] Approximately 10.sup.4 cells/well were seeded in 96-well
plates for 24 h. Media was then replaced with 100 .mu.l media
containing increasing amounts of free oligonucleotide. After 24 h,
MTS (Promega, Madison, Wis.) was added directly to the culture
wells as indicated by the manufacturer and the plates were
incubated at 37.degree. C. for 2 h. Absorbance at 490 nm was
measured and compared with that of mock-treated samples.
Example 25
Isolation of Total RNA and RT-PCR
[0212] Total RNA was isolated using an RNeasy Mini Kit (Qiagen).
Two-step RT-PCR was performed using primers complementary to
sequences of the CD40 gene (Genbank accession#M83312, incorporated
herein as SEQ ID NO: 92). Reverse transcription was performed using
a reverse primer (5'-TGATATAGAGAAACACCCCGAAAATGG-3'; SEQ ID NO: 93)
complementary to sequence in exon 7. The resulting cDNA was
subjected to 35 cycles of PCR using a forward primer consisting of
a sequence span identical to that found in exon 5 of the gene
(5'-GCCACTGAGACCACTGATACCGTCTGT-3'; SEQ ID NO: 94) as well as the
reverse primer used for cDNA generation. The resulting PCR products
were separated on a 1.6% agarose gel. PCR products were excised and
the DNA purified. The resulting products were sequenced using
primers used in PCR. Real-time quantitative RT-PCR was performed on
total RNA from BCL.sub.1 or primary macrophages using an ABI
Prism.RTM. 7700. Primer and dual labeled probe sequences were as
follows:
7 Mouse IL-12 p40: forward 5'-GCCAGTACACCTGCCACAAA- - 3', SEQ ID
No. 95 reverse 5'-GACCAAATTCCATTTTCCTTCTTG-3- ', SEQ ID No. 96
probe 5'-FAM-AGGCGAGACTCTGAGCCACTCACATCTG- -TAMRA-3', SEQ ID No. 97
Mouse CD18: Forward 5'-CTGCATGTCCGGAGGAAATT-3' SEQ ID No. 98
Reverse 5'-AGCCATCGTCTGTGGCAAA-3' SEQ ID No. 9 Probe
5'-FAM-CTGGCGCAATGTCACGAGGCTG-TAMRA-3', SEQ ID No. 100 Mouse CD40,
Type 1: Forward 5'-CACTGATACCGTCTGTCATCCCT-3- ' SEQ ID No. 101
Reverse 5'-AGTTCTTATCCTCACAGCTTGTCCA-3' SEQ ID No. 102 Probe
5'-FAM-AGTCGGCTTCTTCTCCAATCAGTCATCAC- TT-TAMRA-3' SEQ ID No. 103
Mouse CD40, Type 2: Forward 5'-CACTGATACCGTCTGTCATCCCT-3' SEQ ID
No. 104 Reverse 5'-CCACATCCGGGACTTTAAACCTTGT-3' SEQ ID No. 105
Probe 5'-FAM-CCAGTCGGCTTCTTCTCCAATCAGTCA-TAMRA-3' SEQ ID No. 106
Mouse CD40: Forward 5'-TGTGTTACGTGCAGTGACAAACAG-3- ' SEQ ID No. 107
Reverse 5'-GCTTCCTGGCTGGCACAA-3' SEQ ID No. 108 Probe
5'-FAM-CCTCCACGATCGCCAGTGCTGTG-TAMRA-3' SEQ ID No. 109 Mouse
cyclophilin: Forward 5'-TCGCCGCTTGCTGCA-3' SEQ ID No. 110 Reverse
5'-ATCGGCCGTGATGTCGA-3' SEQ ID No. 111 Probe
5'-FAM-CCATGGTCAACCCCACCGTGTTC-TAMRA-3' SEQ ID No. 112
Example 26
Western Blot
[0213] Cells were harvested in RIPA buffer (phosphate buffered
saline containing 1% NP40, 0.1% SDS, and 0.5% sodium deoxycholate).
Total protein concentrations were determined by Lowry assay
(BioRad) and equal quantities were precipitated with cold acetone
by centrifugation. Protein pellets were vacuum dried and
resuspended in load dye (Invitrogen) containing 5% mercaptoethanol.
Samples were heated to 92.degree. C. for 10 minutes prior to gel
loading. Protein samples were separated on 10% PAGE Tris-glycine
gels and transferred to PVDF membranes. Membranes were blocked with
blocking solution (TBS-T containing 5% non-fat dry milk) and
blotted with appropriate antibody. The polyclonal CD40 antibody was
obtained from Calbiochem. G3PDH monoclonal antibody was obtained
from Advanced Immunochemical, TRADD antibody was obtained from Cell
Signalling, and HRP-conjugated secondary antibodies were obtained
from Jackson Immunoresearch. Protein bands were visualized using
ECL-Plus (Amersham-Pharmacia).
Example 27
ELISA Assay
[0214] Levels of mouse IL-12 in the supernatants of activated
macrophages were measured with mouse IL-12 p40+p70 ELISA kit
(Biosource), according to the manufacturer's instructions.
Example 28
Identification of Specific PNA and MOE Inhibitors of CD40
Expression
[0215] A panel of oligomers containing either MOE and PNA backbones
was synthesized and are shown in Table 5.
8TABLE 5 Sequences of Uniform 2'-MOEs and PNAs targeting the murine
CD40 pre-mRNA SEQ ISIS No. Sequence of Target Target ID PNA MOE
PNA/MOE Region site NO. 208518 208342 GCTAGTCACTGAGCA 5'-UTR 389
113 208519 208343 CAAAGTCCCTGCTAG 5'-UTR 460 114 208520 208344
AGCCACAAGTCACTC 5'-UTR 475 115 208521 208345 AGACACCATCGCAG Start
529 116 codon 208522 208346 GCGAGATCAGAAGAG 5'-UTR 513 117 208523
208347 CGCTGTCAACAAGCA 3'-Exon 1 570 118 208524 208348
CTGCCCTAGATGGAC 5'-Exon 2 60 119 208525 208349 CTGGCTGGCACAAAT
3'-Exon 2 124 120 208526 208350 TGGGTTCACAGTGTC 3'-Exon 3 250 121
208527 208351 CATCTCCATAACTCC 3'-Exon 4 396 122 208528 208352
CTTGTCCAGGGATAA 3'-Exon 5 491 123 208529 208353 CACAGATGACATTAG
3'-Exon 6 553 124 208530 208354 TGATATAGAGAAACA 3'-Exon 7 640 125
208531 208355 TCTTGACCACCTTTT 5'-Exon 8 655 126 208532 208356
CTCATTATCCTTTGG 3'-Exon 9 672 127 208533 208357 GGTTCAGACCAGG Stop
codon 869 128 208534 208358 AAACTTCAAAGGTCA 3'-UTR 914 129 208535
208359 TTTATTTAGCCAGTA 3'-UTR 1175 130 208536 208360
AGCCCCACGCACTGG Intron 3 805 131
[0216] Table 5 shows Peptide Nucleic Acid (PNA) and
2'-O-methoxyethyl phosphorothioate oligonucleotide (MOE) sequences,
their corresponding ISIS numbers, and their placement on the murine
CD40 genome (Genbank Accession No. M94129, provided herein as SEQ
ID NO: 132). Sequences are provided in generic form. For PNAs,
sequences read from the aminoterminal (H--) to the carboxamide
(--NH.sub.2). Lysine inserted at the carboxamide terminal for all
sequences (hence for ISIS 208518, full sequences should read
H-GCTAGTCACTGAGCA-Lys-NH.sub.2). For MOEs, sequences read from 5'
to 3'. Purity generally exceeded 95% as assessed by analytical HPLC
(UV 260 nm).
[0217] These oligomers were designed to regions of the murine CD40
pre-mRNA that could potentially either alter splicing or inhibit
translation, both of which are validated non-RNase dependent
mechanisms (Sazani et al., Taylor et al., Baker et al. 1991, Chiang
et al. 1991, Karras et al.). The MOE and PNA oligomers were
delivered by electroporation into BCL.sub.1 cells, a mouse B cell
line that constitutively expresses high levels of CD40. Following a
48 hour incubation period, cells were harvested and analyzed for
surface expression of CD40 by flow cytometry. The activities of the
PNA oligomers were compared to those of the-MOE oligomers of
identical sequence and length. Isis 29848 (NNNNNNNNNNNNNNNNNNNN;
SEQ ID NO: 133) and ISIS 117886 (TCTCACTCCTATCCCAGT; SEQ ID NO:
134; a 2'-MOE gapmer with phosphorothioate backbone, targeted to
murine CD40. 2' MOE shown in bold) were included in each screen as
negative and positive controls, respectively, for RNase H-mediated
CD40 inhibition. The results are shown in Table 6 expressed as
percent of control (no oligo treatment).
9TABLE 6 Effect of PNA and Uniform 2' MOE Oligomers on CD40
expression CD40 Expression CD40 Expression MOE (% of control) PNA
(% of control) no oligomer 100 no oligomer 100 29848 89 29848 100
117886 32 117886 38 208342 90 208518 114 208343 88 208519 96 208344
86 208520 82 208345 64 208521 61 208346 79 208522 92 208347 40
208523 50 208348 48 208524 71 208349 61 208525 77 208350 90 208526
105 208360 75 208536 98 208351 90 208527 128 208352 50 208528 58
208353 26 208529 34 208354 50 208530 49 208355 66 208531 86 208356
42 208532 62 208357 86 208533 78 208358 92 208534 116 208359 62
208535 103
[0218] Sequences (SEQ ID NO: 116, 117, 118, 119, 120, 123, 124,
125, 127, 128, 130, 131) of compounds showing over 20% inhibition
of CD40 expression (levels of 80% or less in Table 6) are
preferred.
[0219] There was a strong correlation between the activities of PNA
and MOE oligomers designed to the same target sites, as
demonstrated by both paired sample t-test and Spearman rank
correlation (p<0.001, in both cases). These results demonstrate
that the sequence dependence of CD40 inhibitory activity is similar
for MOE and PNA based inhibitors. Inhibitors based on MOE and PNA
backbone chemistry were found to be of equal efficacy as determined
by the flow cytometry. A PNA targeted towards the 3' end of exon 6,
ISIS 208529 (SEQ ID NO: 124), was found to be the most active
sequence. The corresponding MOE sequence, ISIS 208353 was also the
most active within the series of MOE compounds. To further assess
the specificity of ISIS 208529, CD40 levels were measured by
western blot from BCl.sub.1, cells electroporated with either the
parent PNA (ISIS 208529), a PNA containing a four base mismatch
(ISIS 256644; CACTGATCAGATAAG; SEQ ID NO: 135), or one of two PNAs
of unrelated sequences (ISIS 256645; ACTAGTGCTAGCGTC; SEQ ID
NO:136, and ISIS 256646; CGTCATGATACCGAT; SEQ ID NO: 137). In each
case, protein was harvested and analyzed 48 hours after
electroporation. Using an antibody specific for the C-terminal
region of the CD40 Protein, western blot analysis showed that none
of the three mismatched PNAs affected CD40 expression, whereas the
inhibition of CD40 expression by ISIS 208529 was confirmed.
Example 29
Mode of Action of the PNA Inhibitor ISIS 208529
[0220] The target sequence for ISIS 208529 is located on the 3' end
of exon 6 of the primary murine CD40 transcript, abutting the
splice junction, and is therefore likely to affect splicing. The
naturally occurring splice forms of murine CD40 have been
previously described (Tone, M., Tone, Y., Fairchild, P. J., Wykes,
M., and Waldmann, H. (2001) Proc. Natl Acad. Sci. U.S.A. 98,
1751-1756). The type 1 transcript, which retains exon 6, is the
predominant form. Its translation product is the canonical
membrane-bound, signaling-competent CD40 protein. The type 2
transcript is lower in abundance and does not contain exon 6. The
omission of exon 6 causes a frame shift in codons contained in
exons 7, 8, and 9, and leads to mistranslation of the sequence
encoding for the transmembrane domain and truncation of the protein
due to a now in-frame stop codon in exon 8. The presence of the
type 2 transcript interferes with CD40 signaling. Tone et al.,
2001. In order to verify the mechanism by which ISIS 208529 reduces
the expression of cell surface CD40 expression, RT-PCR was
performed on RNA isolated from both treated and untreated cells
using primers seated in exons 5 and 7. A sequence specific, PNA
mediated shift in the relative abundance of the two splice forms
was observed upon treatment with ISIS 208529. No change in relative
abundance in splice forms was observed in cells treated with the
four base mismatched PNA, ISIS 256644. The identities of the splice
forms were verified by sequencing of the two RT-PCR products.
Example 30
Evaluation of PNAs Targeting Sequences Surrounding the Binding Site
for ISIS 208529
[0221] Further optimization of inhibitor binding was performed by
designing additional PNA oligomers targeted to sites adjacent to
the ISIS 208529 binding site. The PNA oligomers were designed to
bind to 15 nt spans of target RNA within a range of 10 nt upstream
and downstream of the ISIS 208529 binding site on the primary
transcript as shown in Table 7.
10TABLE 7 Optimization of PNA oligomers targeted to CD40 Isis #
Sequence SEQ ID No. 208529 H-CACAGATGACATTAG-Lys-NH.sub.2 124
256634 H-ATTAGTCTGACTCGT-Lys-NH.sub.2 138 256635
H-ACATTAGTCTGACTC-Lys- 139 256636 H-TGACATTAGTCTGAC-Lys- 140 256637
H-GATGACATTAGTCTG-Lys- 141 256638 H-CAGATGACATTAGTC-Lys- 142 256639
H-CTGGACTCACCACAG-Lys- 143 256640 H-GGACTCACCACAGAT-Lys- 144 256641
H-ACTCACCACAGATGA-Lys- 145 256642 H-TCACCACAGATGACA-Lys- 146 256643
H-ACCACAGATGACATT-Lys- 147 256644 H-CACTGATCAGATAAG-Lys- 135 256645
H-ACTAGTGCTAGCGTC-Lys- 136 256646 H-CGTCATGATACCGAT-Lys- 137 286242
H-ACATTAG-Lys- 148 286243 H-GACATTAG-Lys- 149 286244
H-TGACATTAG-Lys- 150 286245 H-ATGACATTAG-Lys- 151 286246
H-GATGACATTAG-Lys- 152 286247 H-AGATGACATTAG-Lys- 153 286248
H-CAGATGACATTAG-Lys- 154 286249 H-ACAGATGACATTAG-Lys- 155 298841
H-CCACAGATGACATTAG-Lys- 156 298842 H-ACCACAGATGACATTAG-Lys- 157
298843 H-CACCACAGATGACATTAG-Lys- 158 298844
H-TCACCACAGATGACATTAG-Lys- 159 298845 H-CTCACCACAGATGACATTAG-Lys-
160
[0222] The sequences align as shown below. 1
[0223] The activities of the resulting ten PNAs, as well as that of
ISIS 208529, were evaluated in parallel by western blot. Eight of
the ten PNAs (SEQ ID NO: 138, 139, 142, 143, 144, 145, 146, and
147) demonstrated a level of activity similar to that of ISIS
208529, and are therefore preferred. Two PNAs, ISIS 256636 and ISIS
256637 (SEQ ID NO: 140 and 141), positioned slightly upstream from
the 3' exon 6 splice site, failed to inhibit CD40 expression.
Examination of the primary sequences of the two inactive PNAs did
not reveal any obvious features, such as a high guanosine content,
that might promote the formation of undesirable secondary
structure. Likewise, the RP-HPLC elution profiles for these two
compounds did not indicate a tendency for self-aggregation.
Furthermore, examination of the target RNA sequence did not reveal
secondary structure that might limit target accessibility.
Example 31
The Effect of PNA Length on CD40 Inhibitory Activity
[0224] The effect of PNA length on activity was assessed by
systematic variation of length of the PNA inhibitor from 7 to 20
monomer units. For the initial examination of length effects, 13
PNAs were designed and synthesized (Table 3). The first set,
consisting of PNAs of 7 to 14 units in length, were all targeted to
portions of the binding site of ISIS 208529. Each of these
compounds as well as the 15-mer parent, ISIS 208529, were
electroporated into BCL.sub.1 cells at a final concentration of 10
.mu.M. Three days following delivery, the cells were harvested and
analyzed by western blot for CD40. G3PDH protein levels were also
measured to verify equal protein loading. While no apparent
reduction in CD40 levels was observed in cells treated with
compounds ranging from 7-11 units in length, inhibition of CD40
expression was observed with compounds ranging from 12-15 units in
length. The efficacy of the PNA inhibitors was found to increase
with increasing length, up to a PNA length of about 14 units, where
efficacy reached a level similar to that displayed by the lead
15-mer PNA, ISIS 208529. Subsequently, a second set of PNAs was
examined covering a range of 12 to 20 units in length. PNAs were
electroporated into BCL.sub.1 cells at various concentrations to
determine their relative potencies. Compounds were evaluated for
their ability to inhibit CD40 cell surface expression by flow
cytometry. Potency was found to increase with increasing length,
reaching a plateau at 14 unit length, beyond which no additional
gain was detected upon increasing length. This observation suggests
that the potency of ISIS 208529 is not limited by its length, and
that potency cannot be improved by increasing the length of this
PNA. At this target site, EC.sub.50 values were in the range of 0.6
to 0.9 .mu.M for all PNAs of 14 units or longer as is shown in
Table 8 where EC50 values and 95% confidence intervals were
determined by nonlinear regression analysis using a defined top and
bottom of 400 and 100, respectively.
11TABLE 8 Effect of length on PNA oligomer inhibitory activity
Length ISIS NO. EC50 95% confidence interval 12 286247 21.1 13.0 to
34.4 13 286248 1.85 1.59 to 2.16 14 286249 0.90 0.78 to 1.04 15
208529 0.87 0.75 to 1.00 16 298841 0.58 0.40 to 0.83 17 298842 0.79
0.50 to 1.23 18 298843 0.86 0.71 to 1.03 19 298844 0.57 0.44 to
0.74 20 298845 0.71 0.52 to 0.97
Example 32
Dose and time Dependence of CD40 Inhibitory Activity by ISIS
208529
[0225] The dose dependent reduction of cell surface CD40 protein
upon treatment of BCL.sub.1cells with ISIS 208529 (SEQ ID NO: 124)
was evaluated by flow cytometry and was further supported by
verification of CD40 protein depletion by western blot. Specificity
was verified by inclusion of a PNA containing a four base mismatch
(ISIS 256644; SEQ ID NO: 135). ISIS 208529 showed an increasing
dose response curve across a concentration range of 16, 8, 4, 2, 1,
0.5 and 0.25 .mu.M range where as the mismatch compound did not. In
order to assess the effect of ISIS 208529 over time, western blot
analysis was applied to study the effect of a single dose (10
.mu.M) of ISIS 208529 for eight days following electroporation.
Maximal inhibition of CD40 expression was observed four days post
treatment and persisted for at least five days. At day eight, the
level of CD40 expression was back to values found for the
no-treatment control. No change in CD40 expression levels was
observed in cells treated with the four base mismatched PNA (ISIS
256644).
Example 33
Inhibitory Activity of ISIS 208529 on CD40 Dependent IL-12
Production in Primary Murine Macrophages
[0226] The functional consequences of PNA-induced alternative
splicing in primary murine macrophages were examined.
Thioglycollate-elicited mouse peritoneal cells were electroporated
with various doses of ISIS 208529 (SEQ ID NO: 124) or with the PNA
containing a four base mismatch, ISIS 256644 (SEQ ID NO: 135).
After electroporation, macrophages were selected by adherence to
tissue culture plates and treated with IFN-.alpha. for 4 hours to
induce CD40 cell surface expression, and then stimulated with an
activating CD40 antibody for 24 hours. CD40 signaling in
macrophages results in production of multiple cytokines, including
IL-12. The level of IL-12 in the supernatant of PNA-treated
macrophages after CD40 activation was examined by an ELISA assay.
Electroporation of the macrophages with ISIS 208529 resulted in a
dose-dependent reduction in IL-12 production. Delivery of 3 .mu.M
ISIS 208529 to macrophages by electroporation resulted in 75%
inhibition of IL-12 production compared to macrophages
electroporated with no PNA. A maximal inhibition of 85% relative to
the untreated control was obtained with 10 .mu.M ISIS 208529.
Macrophages electroporated with the mismatch control PNA (ISIS
256644) showed no decrease in IL-12 production in response to PNA
treatment. Examination of the level of CD40 protein by western blot
showed a dose dependent reduction in CD40 protein following
treatment with ISIS 208529, which correlated to the decrease in
IL-12 production. No reduction in CD40 protein was found after
treatment with the mismatch control ISIS 256644. Examination of the
CD40 splice forms by quantitative RT-PCR showed a 70% decrease in
the predominant type 1 splice form, and a 2-fold increase in the
alternative type 2 splice form, at 3 .mu.M ISIS 208529. The four
base mismatch control, ISIS 256644, had no significant effect on
the relative abundance of the CD40 splice forms, indicating that
inhibitory activity was dependent on Watson-Crick
complementarity.
Example 34
Effect of ISIS 208529 Peptide Conjugation on CD40 Cell Surface
Expression in BCL.sub.1 Cells and in Macrophages
[0227] In order to obtain a PNA with potential to act without the
use of a delivery vehicle, the active PNA, ISIS 208529 (SEQ ID NO:
124), was conjugated with eight lysines at the N-terminus to give
ISIS 278647. In BCL.sub.1 cells that were treated with ISIS 278647
at 10 .mu.M, the relative abundance of the CD40 type 1 transcript
was decreased and the abundance of the type 2 transcript was
increased as determined by standard RT-PCR and real-time
quantitative RT-PCR. ISIS 278647 caused an 85% decrease in the type
1 transcript and a greater than 3 fold increase in the type 2
transcript. Neither the unconjugated lead PNA (ISIS 208529) nor an
eight lysine conjugated, four base mismatched PNA (ISIS 287294; SEQ
ID NO: 135) had any effect on the relative abundance of either
splice variant or on total CD40 transcript, relative to the
untreated control. Analysis of the protein lysates by western blot,
using an antibody that recognizes the C-terminal region of the
canonical CD40 protein, showed that ISIS 278647 promotes CD40
protein depletion, whereas the unconjugated PNA, ISIS 208529, and
the four base mismatched control, ISIS 287294, do not. These
results demonstrate that redirection of splicing and loss of the
CD40 protein encoded by the type 1 transcript variant is dependent
on both PNA sequence and inclusion of the eight lysine carrier when
no delivery vehicle is used.
[0228] The effect of lysine conjugation of ISIS 208529 (SEQ ID NO:
124) on CD40 expression, and on the relative abundance of the type
1 and type 2 transcripts, was also examined in primary murine
macrophages. Adherent peritoneal macrophages were incubated in with
various concentrations of unconjugated or conjugated PNA for 16
hours and CD40 expression then induced by IFN-.alpha.. The
reduction of CD40 protein in the PNA treated cells was examined by
western blot. No reduction in CD40 protein was observed after
treatment with ISIS 208529, while a modest reduction in CD40
protein was observed in macrophages treated with a 4 lysine
conjugated PNA of the same sequence (ISIS 278643; SEQ ID NO: 124).
In contrast, treatment with the eight lysine conjugated CD40 PNA of
the same sequence (ISIS 278647) resulted in a dramatic,
dose-dependent decrease in CD40 protein. Treatment with ISIS 278647
at 10 .mu.M resulted in reduction of CD40 protein to levels
undetectable by western blot, indicating that the eight lysine
conjugated PNA was readily taken up by the primary macrophages and
that carrier conjugation did not prevent the PNA from binding to
its target and from attenuating CD40 protein expression. Under
similar conditions, an eight lysine conjugated four base mismatch
control PNA (ISIS 287294; SEQ ID NO: 135) caused no reduction in
CD40 protein, indicating that the observed reduction in CD40
protein is sequence specific. Analysis of the CD40 splice forms by
quantitative RT-PCR demonstrated that the eight lysine conjugated
CD40 PNA (ISIS 278647) caused a substantial reduction in CD40 type
1 mRNA with a concomitant 5-fold induction of the CD40 type 2
transcript. The eight lysine conjugated four base mismatch PNA
(ISIS 287294) had no significant effect on the relative levels of
the type 1 and type 2 splice forms.
Example 35
Inhibitory Activity of Further PNA Cationic Conjugate Compounds
Against CD40
[0229] A series of PNA conjugate compounds of identical sequence to
ISIS 208529, i.e., CACAGATGACATTAC; Seq ID NO. 124, were prepared
and tested in BCL-1 cells using flow cytometry for free uptake at
10 .mu.M (FACS). The following abbreviations are used to identify
the components of each of the conjugates: (C)=C-terminal,
(N)=N-terminal, aca=6-aminocaproic acid, aoc=aminooctanoic acid,
.beta.A=beta-alanine, .beta.K=beta-lysine, aca=amino hexanoic acid,
adc=amino dodecanoic acid, O=8-amino-3,6-dioxaoctanoic acid,
Dab=L-2-4-diaminobutyric acid, Ci=L-citrulline, ab=4-aminobutyric
acid, hR=L-homo arginine, hhR=L-homohomo arginine, norR=L-nor
arginine, G=glycine, pK=lysine-peptoid, H=L-histidine, DhR=D-homo
arginine, dR=d-arginine, inp=isonipecotic acid,
amc=4-aminomethyl-cyclohexane carboxylic acid, dmK=L-dimethyl
lysine, Pen=penicillamine, Ada=adamantane acetyl, Pam=palmityl,
Ibu=(S)-(+)-ibuprofen, CHA=cholic acid, Chol=cholesteryl formyl,
mm=mismatch PNA.
[0230] The compounds and test results are as are shown in Table
9.
12TABLE 9 Additional PNA Cationic Conjugate Compounds of SEQ ID NO:
124 Est. t.sub.1/2 [h] in N-terminal C-terminal CD40 Protein
t.sub.1/2 [h] in 25% 100% mouse Isis #-Lot# modification
modification notes (% UTC @ 10 .mu.M) mouse serum serum 208529-1 K
80, 98, 100 stable stable 278640-1 K K 80 n.d. 278641-1 K.sub.2 K
90 n.d. 278642-1 K.sub.3 K 80 n.d. 278643-1 K.sub.4 (SEQ ID NO:
161) K 100 n.d. 278644-1 K.sub.5 (SEQ ID NO: 162) K 70 n.d.
278645-1 K.sub.6 (SEQ ID NO: 163) K 50 n.d. 278646-1 K.sub.7 (SEQ
ID NO: 164) K 30 n.d. 278647-1 K.sub.8 (SEQ ID NO: 165) K 20, 30,
35, 30, 15 5.7 1.4 287294-1 K.sub.8 K 4 mm 100 n.d. 287293-1
K.sub.6 K 4 mm 100 n.d. 284381-1 K.sub.2 95 n.d. 279866-1 K.sub.4
85 6.5 1.6 284375-1 K.sub.8 40, 35, 35, 40, 35, 45, 73, 68 1 0.25
290075-1 R K 100 n.d. 290076-1 R.sub.2 K 90 n.d. 290077-1 R.sub.3 K
90 n.d. 290078-1 R.sub.4 (SEQ ID NO: 166) K 80 n.d. 290079-1
R.sub.5 (SEQ ID NO: 167) K 80 n.d. 297780-1 R.sub.6 (SEQ ID NO:
168) K 75 n.d. 290081-1 R.sub.7 (SEQ ID NO: 169) K 70 n.d. 290082-2
R.sub.8 (SEQ ID NO: 170) K 60 3.2 0.8 301010-1 D-R.sub.8 K 49 n.d.
299870-1 K.sub.5RK.sub.2 (SEQ ID 48 n.d. NO: 171) 299871-1
D(K.sub.5RK.sub.2)(SEQ 53 n.d. ID NO: 172) 284382-1 K.sub.2 K.sub.2
85 n.d. 279867-1 K.sub.4 K.sub.4 75 n.d. 284383-1 Ada-O K.sub.2 80
n.d. 284384-1 Ada-O-K.sub.2 K.sub.2 85 n.d. 279975-1 Ada-O K.sub.4
95 n.d. 279976-1 Ada-O-K.sub.4 K.sub.4 75 n.d. 284376-1 Ada-O
K.sub.8 40 n.d. 284385-1 Pam-O K.sub.2 n/a tox. n.d. 284386-1
Pam-O-K.sub.2 K.sub.2 n/a tox. n.d. 283582-1 Pam-O K.sub.4 70 n.d.
283583-1 Pam-O-K.sub.4 K.sub.4 60 n.d. 284377-1 Pam-O K.sub.8 n/a
tox. n.d. 290061-1 Ibu-O K.sub.2 80 n.d. 287086-1 Ibu-O K.sub.8 30
1 0.25 311573-1 Ibu-O-K.sub.8 K n.d. n.d. 290063-1 CHA-O K.sub.2 95
n.d. 290064-1 Chol-O- K.sub.2 n/a tox. n.d. 292097-1 CHA-Q-K.sub.8
K 55 n.d. 292098-1 Chol-O-K.sub.8 K n/a tox. n.d. 298110-1
Branch1-K K 60 n.d. 298111-1 Branch3-K K 85 n.d. 298112-1 Branch4-K
K 60 n.d. 298113-1 Branch5-K K 75 n.d. 298114-1 Branch6-K K 70 n.d.
298116-1 Branch2-K K 40 n.d. 303537-1 RacaRRacaRRacaRR K 23, 29 2
0.5 303540-1 KacaKKacaKKacaKK K 70 n.d. 303538-1
RacaRacaRacaRacaRacaRacaR K 40 n.d. 309743-1
dR.aca.dR.dR.aca.dR.dR. K 35 n.d. aca.dR.dR 303539-1
KacaKacaKacaKacaKacaKacaK K 61 n.d. 291341-1 KGKKGKGK (SEQ ID K 87
n.d. NO: 173) 291342-1 KaocKKaocKaocK K 79 n.d. 330890-1
hR-O-hR-hR-O-hR-hR- K 25 at 3 uM 59 12 O-hR-hR 338896-1
hR-O-R-hR-O-R-hR-O- K 49 2 0.5 R-hR 338897-1 R-O-hR-R-O-hR-R-O- K
54 4 1 hR-R 315570-1 RacaRRacaRRacaRR- K 25 n.d. PKKKRKV 315571-1
RacaRRacaRRacaRR- K 41 n.d. KKVKPKR 315650-1 PKKKRKV- K 44 n.d.
RacaRRacaRRacaRR 315573-1 KKVKPKR- K 31 n.d. RacaRRacaRRacaRR
309860-1 R-.beta.A-RR-.beta.A-RR.beta.A- K 27 n.d. RR 309883-1
R-abu-RR-abu-RR-abu- K 26 n.d. RR 309861-1 R-aoc-RR-aoc-RR-aoc- K
25 n.d. RR 309864-1 R-aca-RR-aca-RR-aca- K 20 n.d. RR-aca 309862-1
R-O-RR-O-RR-O-RR K 24 2 0.5 309865-1 RR-aca-RR-aca-RR K 40 n.d.
309866-1 R-aca-RR-aca-RR K 58 n.d. 309884-1 R-inp-RR-inp-RR-inp- K
29 n.d. RR 309885-1 R-amc-RR-amc-RR- K 27 n.d. amc-RR 291350-2
(.beta.K).sub.8 K 66 n.d. 309843-1 .beta.K-.beta.K-KKKK-.beta.K-.-
beta.K K 52 n.d. 309844-1 (K-.beta.K).sub.4 K 62 n.d. 309845-1
KK-.beta.K-KK-.beta.K-KK K 61 n.d. 303536-1 D-(Orn).sub.8 K 67 n.d.
303327-1 (Orn).sub.8 64 n.d. 301011-2 (Orn).sub.8 K 77 >48
>12 309143-1 Orn-Orn-KKKK-Orn- K 52 n.d. Orn 309144-1
(K-Orn).sub.4 K 42 n.d. 309145-1 KK-Orn-KK-Orn-KK K 34 19 4.75
311069-1 KKKKK-Orn-KK K 50 n.d. 311070-1 KK-Orn-KKKKK K 53 n.d.
287292-2 (dK).sub.8 K 54 stable >48 305390-1 dKdK-KKKK-dKdK K 60
n.d. 305391-1 K-dK-K-dK-K-dK-K- K 69 n.d. dK 305392-1
KK-dK-KK-dK-KK K 62 stable >48 311071-1 KKKKK-dK-KK K 61 n.d.
311072-1 KK-dK-KKKKK K 59 n.d. 305393-1 RRKKKKKRR (SEQ K 65 n.d. ID
NO: 174) 305394-1 KRKRKRKR (SEQ ID K 52 n.d. NO: 175) 305395-1
KKRKKRKK (SEQ ID K 43 2.5 0.6 NO: 176) 308579-1 (hK).sub.8 K 31 18
4.5 308580-1 hKhK-KKKK-hKhK K 34 n.d. 308581-1 K-hK-K-hK-K-hK-K- K
32 n.d. hK 308582-1 KK-hK-KK-hK-KK K 31 7.5 1.9 316409-1
(Dab).sub.8 K 77 >48 >12 316410-1 (Dab).sub.2-K-(Dab).sub.2-
-K- K 64 n.d. (Dab).sub.2 316411-1 (Dab-K).sub.4 K 52 n.d. 316412-1
KK-Dab-KK-Dab-KK K 38 40 10 316427-1 (K-ab).sub.8 K 47 n.d.
316428-1 (K-(K-ab)).sub.4 K 41 n.d. 316429-1 KK-(K-ab)-KK-(K-ab)- K
39 n.d. KK 316430-1 (K-ab).sub.2-K-(K-ab).sub.2-K- K 55 n.d.
(K-ab).sub.2 325598-1 (dmK).sub.8 K 71 stable 325599-1
(K-dmK).sub.4 K 53 n.d. 325600-1 KK-dmK-KK-dmK-KK K 41 23 5.8
325601-1 (dmK).sub.2-K-(dmK).sub.2-K- K 63 n.d. (dmK).sub.2
326744-1 (hR).sub.8 K 30, 20 15.4 3.9 (hhR).sub.8 K n/a stable
stable 333677-1 (K-hR).sub.4 K 44 n.d. 333678-1 KK-hR-KK-hR-KK K 36
n.d. 338894-1 (DhR).sub.8 K n/a tox. n.d. 338895-1 RR-DhR-RR-DhR-RR
K 67 23.6 5.9 326746-1 (norR).sub.8 K 90 at 3 uM >48 >12
333674-1 G(pK).sub.8 K 56 >48 >12 333675-1 (K-pK).sub.4 K 70
n.d. 333676-1 KK-pK-KK-pK-KK K 60 29 7.25 332593-1 (H).sub.8 (SEQ
ID NO: 177) K 64 44.5 11 332672-1 (KH).sub.4 (SEQ ID K 73 n.d. NO:
178) 332673-1 KKHKKHKK (SEQ ID K 52 5.7 1.4 NO: 179) 332674-1
KKGKKGKK (SEQ ID K 59 n.d. NO: 180) 313685-1 K.sub.7-Ci K 65 n.d.
313686-1 K.sub.6-Ci-K K 59 n.d. 313687-1 K.sub.5-Ci-K.sub.2 K 53
n.d. 313688-1 K.sub.4-Ci-K.sub.3 K 52 n.d. 313689-1
K.sub.3-C-K.sub.4 K 57 n.d. 313690-1 K.sub.2-Ci-K.sub.5 K 55 n.d.
313691-1 K-Ci-K.sub.6 K 57 n.d. 313692-1 Ci-K.sub.7 K 52 n.d.
313693-1 KK-Ci-KK-Ci-KK K 65, 67 n.d. 310755-1 K.sub.8-.beta.A K 43
n.d. 310756-1 K.sub.8-aca K 48 n.d. 310757-1 K.sub.8-aoc K 54 n.d.
310758-1 K.sub.8-adc K 68 n.d. 291335-2 K.sub.8-aoc-aoc K 62 n.d.
310753-1 K.sub.8-O K 44 n.d. 310754-1 K.sub.8-O-O K 46 n.d.
330775-1 (dK).sub.8-FRGO K 46 2.8 0.7 330776-1 (dK).sub.8-dF-dRGO K
54 n.d. 330777-1 (dK).sub.8-ALALGO K 37 8.7 2.2 330778-1
(dK).sub.8-dA-dLdAdLGO K 36 n.d. 335296-1 (dK).sub.8-WEHDLO K 59
>48 .12 335299-1 (dK).sub.8-dW-dE-dH-dD- K 64 n.d. dL-O 335297-1
(dK).sub.8-D-E-V-D-L-O K 90 >48 >12 335300-1
(dK).sub.8-dD-dE-dV-dD- K 89 n.d. dL-O 330781-1
(dK).sub.8-G-F-L-G-O K 38 >48 >12 330782-1
(dK).sub.8-G-dF-dL-G-O K 39 n.d. 339746-1 dK.sub.8-Cys-disulfide--
Cys-O K 41 17 4.25 339747-1 dK.sub.8-Cys-disulfide-Pen-O K 35 30
7.5
[0231] The Branch conjugates have the following structures: 23
Example 36
Design of Phenotypic Assays for the use of CD40 Inhibitors
[0232] Once CD40 inhibitors have been identified by the methods
disclosed herein, the compounds are further investigated in one or
more phenotypic assays, each having measurable endpoints predictive
of efficacy in the treatment of a particular disease state or
condition.
[0233] Phenotypic assays, kits and reagents for their use are well
known to those skilled in the art and are herein used to
investigate the role and/or association of CD40 in health and
disease. Representative phenotypic assays, which can be purchased
from any one of several commercial vendors, include those for
determining cell viability, cytotoxicity, proliferation or cell
survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston,
Mass.), protein-based assays including enzymatic assays (Panvera,
LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene
Research Products, San Diego, Calif.), cell regulation, signal
transduction, inflammation, oxidative processes and apoptosis
(Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation
(Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube
formation assays, cytokine and hormone assays and metabolic assays
(Chemicon International Inc., Temecula, Calif.; Amersham
Biosciences, Piscataway, N.J.).
[0234] In one non-limiting example, cells determined to be
appropriate for a particular phenotypic assay (i.e., MCF-7 cells
selected for breast cancer studies; adipocytes for obesity studies)
are treated with CD40 inhibitors identified from the in vitro
studies as well as control compounds at optimal concentrations
which are determined by the methods described above. At the end of
the treatment period, treated and untreated cells are analyzed by
one or more methods specific for the assay to determine phenotypic
outcomes and endpoints.
[0235] Phenotypic endpoints include changes in cell morphology over
time or treatment dose as well as changes in levels of cellular
components such as proteins, lipids, nucleic acids, hormones,
saccharides or metals. Measurements of cellular status which
include pH, stage of the cell cycle, intake or excretion of
biological indicators by the cell, are also endpoints of
interest.
[0236] Analysis of the genotype of the cell (measurement of the
expression of one or more of the genes of the cell) after treatment
is also used as an indicator of the efficacy or potency of the CD40
inhibitors. Hallmark genes, or those genes suspected to be
associated with a specific disease state, condition, or phenotype,
are measured in both treated and untreated cells.
Sequence CWU 0
0
* * * * *
References