U.S. patent application number 10/682722 was filed with the patent office on 2004-09-23 for cyclic amp phosphodiesterase isoforms and methods of use.
Invention is credited to Hu, Yinghe, Unterbeck, Axel, Xin, Xiaonan.
Application Number | 20040185465 10/682722 |
Document ID | / |
Family ID | 22494603 |
Filed Date | 2004-09-23 |
United States Patent
Application |
20040185465 |
Kind Code |
A1 |
Xin, Xiaonan ; et
al. |
September 23, 2004 |
Cyclic AMP phosphodiesterase isoforms and methods of use
Abstract
Human and rat cAMP phosphodiesterase isoforms (denoted PDE4Ds),
as well as the DNA (RNA) encoding such polypeptides, are disclosed.
Also disclosed are methods for utilizing such polypeptides in
diagnostic assays for identifying mutations in nucleic acid
sequences encoding the polypeptides of the present invention, for
detecting altered levels of the polypeptide of the present
invention as a means of detecting diseases and methods of screening
potential modulators, especially inhibitors, of the novel PDE4Ds
(denoted PDE4D6) disclosed herein as a means of increasing cyclic
AMP in neurons and thus treating neurological problems, such as
long term memory loss, if not preventing such maladies entirely.
Transgenic animals expressing polypeptides disclosed herein are
also described.
Inventors: |
Xin, Xiaonan; (West
Hartford, CT) ; Unterbeck, Axel; (Madison, CT)
; Hu, Yinghe; (San Diego, CA) |
Correspondence
Address: |
MILLEN, WHITE, ZELANO & BRANIGAN, P.C.
2200 CLARENDON BLVD.
SUITE 1400
ARLINGTON
VA
22201
US
|
Family ID: |
22494603 |
Appl. No.: |
10/682722 |
Filed: |
October 10, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10682722 |
Oct 10, 2003 |
|
|
|
09602735 |
Jun 23, 2000 |
|
|
|
6656717 |
|
|
|
|
60141196 |
Jun 25, 1999 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
435/196; 435/320.1; 435/325; 435/6.16; 435/69.1; 536/23.2 |
Current CPC
Class: |
A01K 2217/05 20130101;
C12N 9/16 20130101; A01K 2217/075 20130101 |
Class at
Publication: |
435/006 ;
435/069.1; 435/196; 435/320.1; 435/325; 536/023.2 |
International
Class: |
C12Q 001/68; C07H
021/04; C12N 009/16 |
Claims
What is claimed is:
1. An isolated polypeptide comprising a segment having an amino
acid sequence at least 65% identical to SEQ ID NO: 5.
2. The isolated polypeptide of claim 1 wherein the segment is at
least 80% identical to SEQ ID NO: 5.
3. The isolated polypeptide of claim 1 wherein the segment is at
least 95% identical to SEQ ID NO: 5.
4. The isolated polypeptide of claim 1 wherein the segment is the
sequence of SEQ ID NO: 5.
5. An isolated polypeptide comprising a segment of SEQ ID NO: 5 and
containing at least 10 amino acids.
6. The isolated polypeptide of claim 5 wherein the segment contains
at least 12 amino acids.
7. The isolated polypeptide of claim 6 wherein the segment contains
at least 14 amino acids.
8. The isolated polypeptide of claim 7 wherein the segment contains
at least 15 amino acids.
9. A phosphodiesterase comprising a polypeptide selected from the
group consisting of the polypeptides of claims 1, 2, 3, 4, 5, 6, 7,
and 8.
10. An isolated polypeptide selected from the group consisting of
the polypeptides of claims 1, 2, 3, 4, 5, 6, 7, and 8.
11. The isolated polypeptide of claim 10 wherein said polypeptide
is purified.
12. An isolated 15-mer containing a segment of at least 12 amino
acid residues of SEQ ID NO:5.
13. The isolated 15-mer of claim 12 wherein the segment contains at
least 14 amino acid residues of SEQ ID NO:5.
14. An isolated polynucleotide coding for a polypeptide selected
from the group consisting of the polypeptides of claims 1, 2, 3, 4,
5, 6, 7, and 8.
15. The polynucleotide of claim 14 wherein the polynucleotide is a
DNA.
16. The polynucleotide of claim 15 wherein the DNA is a cDNA.
17. The polynucleotide of claim 14 wherein the polynucleotide is
RNA.
18. The complement of the polynucleotide of claim 15.
19. An antibody specific for a polypeptide only when said
polypeptide contains the segment of claims 1, 2, 3, 4, 5, 6, 7, or
8.
20. The antibody of claim 19 wherein said antibody is a monoclonal
antibody.
21. A method of making a recombinant vector comprising inserting
the polynucleotide of claim 15 into a vector.
22. A recombinant vector comprising the polynucleotide of claim
15.
23. A recombinant cell containing the polynucleotide of claim
14.
24. A method for producing a polypeptide comprising expressing from
the recombinant cell of claim 23 the polypeptide encoded by said
polynucleotide.
25. A process for diagnosing a disease in an animal afflicted
therewith, or diagnosing a susceptibility to a disease in an animal
at risk thereof, wherein said disease is related to an
over-expression of a phosphodiesterase of claim 9 comprising
determining the level of said phosphodiesterase activity in a cell
from said animal.
26. The process of claim 25 wherein said animal is a human.
27. The method of claim 25 wherein the cell is a neuron.
28. The method of claim 25 wherein said disease involves the loss
of memory.
29. The method of claim 28 wherein said loss of memory is a loss of
long term memory.
30. A process for diagnosing a disease in an animal afflicted
therewith, or a susceptibility to a disease in an animal at risk
thereof, comprising determining a mutation in the genome of a
neuron from said animal and wherein the mutation occurs in a
nucleotide sequence coding for the 15-mer of SEQ ID NO:5.
31. The process of claim 30 wherein said animal is a human.
32. The process of claim 30 wherein said disease involves a loss of
memory.
33. The process of claim 32 wherein said loss of memory is a loss
of long term memory.
34. A process for screening chemical agents for phosphodiesterase
modulating activity comprising: contacting a cell expressing a
polypeptide coded for by the polynucleotide of claim 10 with a
chemical agent having potential phosphodiesterase inhibitory
activity and measuring the level of total cyclic adenosine
monophosphate (cAMP) in said cell following said exposure wherein
an altered level of cAMP in said cell following said exposure is an
indicator of such moderating activity.
35. The method of claim 34 wherein the modulating activity is
inhibitory activity.
36. A transgenic animal comprising within its genome one or more
copies of the polynucleotide of claim 15.
37. The transgenic animal of claim 36 wherein said animal
overproduces the expression product of said polynucleotide relative
to a non-transgenic animal.
38. The transgenic animal of claim 37 wherein said animal is a
mouse.
39. A transgenic animal whose genome lacks a gene expressing a
functional PDE4D6 isoform or functional analog thereof.
40. The transgenic animal of claim 39 wherein said animal is a
mouse.
41. A transgenic non-human animal whose genome comprises one or
more genes coding for the human isoform of PDE4D6 in place of the
mammalian gene otherwise coding for said isoform.
42. The transgenic animal of claim 41 wherein said animal is a
mouse.
Description
[0001] This application claims priority of U.S. Provisional
Application Serial No. 60/141,196, filed 25 Jun. 1999, the
disclosure of which is hereby incorporated by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0002] This invention relates to newly identified polynucleotides,
polypeptides is encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides, and polypeptides. More particularly, the
polypeptides of the present invention are cAMP (cyclic adenosine
5'-monophosphate) phosphodiesterases, and fragments thereof derived
from mammals, especially humans, rats, and mice, and most
especially from the brains, for example, the hippocampal and other
memory related regions. Both human and rat isoforms are
specifically disclosed herein. The methods according to the present
invention disclose uses of this polypeptide in diagnostic assays
and for screening potential therapeutic agents, as well as other
potential uses.
[0003] The phosphodiesterases (PDEs) represent a family of enzymes
that catalyze the hydrolysis of the various cyclic nucleoside
monophosphates (including cAMP). These cyclic nucleotides have been
found to act as second messengers within the cells, which
messengers carry impulses from cell surface receptors having bound
various hormones and neurotransmitters. The job of
phosphodiesterases is to degrade these cyclic mononucleotides once
their messenger role is completed (thereby regulating the level of
cyclic nucleotides within the cells and maintaining cyclic
nucleotide homeostasis).
[0004] A number of different families of such phosphodiesterases
have been identified, with the predominant family having been
designated PDE4, as distinguished by various kinetic properties
(such as low Michaelis constant for cAMP and sensitivity to certain
drugs). [See: Wang et al., Expression, Purification, and
Characterization of human cAMP-Specific Phosphodiesterase (PDE4)
Subtypes A, B, C, and D, Biochem. Biophys. Res. Comm., 234, 320-324
(1997)] Since the PDEs have been found to possess distinct
biochemical properties it is likely that they are subject to a
variety of different forms of regulation.
[0005] The phosphodiesterases disclosed according to the present
invention exist in mammals in the form of isoenzymes (which
represent different molecular forms of the same enzyme
polypeptide). These phosphodiesterases (denoted PDE4D) are
localized in the cytosol of the cell and are unassociated with any
known membranous structures. The PDE4D isoenzymes specifically
degrade cAMP and are a common target for such pharmacological
agents as antidepressants (for example, rolipram). Also, inhibitors
of PDE4 isoenzymes are powerful anti-inflammatory agents and may
also be useful as anti-asthmatics.
[0006] In the past, attempts at isolation of such proteins have
proven difficult since they are commonly present at very low
concentration and have shown a tendency toward instability on
purification. [See: Salanova et al., Heterologous Expression and
Purification of Recombinant Rolipram-Sensitive Cyclic AMP-Specific
Phosphodiesterases, Methods: A Companion to Methods in Enzymology
14, 55-64 (1998)]
[0007] Cloning of the isoenzymes of PDE4 have shown that mammals
have up to 4 genes for PDE4, and this is true of rats, mice and
humans. Further, each such gene has been found to code for several
different protein variants. Thus, each PDE4 gene has been found to
code for at least 2 or more polypeptides. The physiological roles
for this plethora of forms of PDE4 is beginning to be understood
with the advent of Recombinant DNA technology and the use of cDNAs
to clone the various polypeptide forms of these enzymes. Such
methodology is essential to the successful screening of drugs
having, for example, anti-inflammatory activity.
BRIEF SUMMARY OF THE INVENTION
[0008] The present invention is directed to novel polypeptides,
with or without associated phosphodiesterase activity, and
containing a novel amino acid sequence as part of the overall
sequence. The present invention is also directed to novel cDNA
clones coding for such polypeptides and sequences of DNA contained
within the genome and which may code for such novel polypeptide
sequences.
[0009] The present invention is also directed to novel cells and
cell lines containing polynucleotides that make them capable of
expressing the novel polypeptides disclosed herein.
[0010] It is one object of the present invention to provide methods
of forming such cell lines by incorporating novel DNA sequences of
the invention, in vectors that can be used to transform cells into
cells that express the polypeptides containing the novel sequences
disclosed herein. Such polypeptides will often have
phosphodiesterase activity that will affect the level of cAMP
within the transformed cells so that the cAMP level will provide an
indicator of the level of phosphodiesterase within such cells.
[0011] It is a further object of the present invention to provide
such vectors, containing the novel DNAs disclosed herein, and
genetically transformed cells capable of expressing the
polypeptides coded for by said novel DNAs.
[0012] In the brain, the level of cAMP within neurons is believed
to be related to the quality of memory, especially long term
memory. Thus, since PDE4D degrades cAMP, the level of this enzyme
could have effects on memory in animals, for example, in
humans.
[0013] It is therefore another object of the present invention to
monitor the levels of the novel polypeptides disclosed herein as a
means of determining the presence of a disease condition or
susceptibility to such condition, especially where such condition
involves loss of memory, most especially long term memory.
[0014] It is a still further object of the present invention to
provide novel DNA sequences present in cells, especially brain
cells, that can serve as the target for probes capable of
disclosing the presence of a mutation in said novel DNA sequences,
whereby the presence of such a mutation indicates a possible cause
for over- or under-activity of a novel phosphodiesterase as
disclosed herein.
[0015] It is also a further object of the present invention to
provide a method of using the transformed cells disclosed herein as
a means of screening potential chemical agents, either small
molecules or otherwise, for ability to inhibit the actions of
phosphodiesterase polypeptides disclosed herein and thereby provide
novel therapeutic agents for the treatment of diseases, for
example, impairment of memory, especially long term memory, or as
prophylactic agents to be used in anticipation of such conditions,
perhaps as secondary conditions incident to already existing
diseases.
[0016] Finally, it is an additional object of the present invention
to provide transgenic animals, especially transgenic mice, into
whose genome has been inserted a gene, present as one or more
copies thereof, coding for the human isoform of the PDE4D6 of the
invention, especially where this gene replaces the mouse gene
otherwise coding for any corresponding isoform, and most especially
where the effect of such humanization is the overproduction of the
human PDE4D6 isoform in said mouse. The invention also relates to
the production of "knock-out" animals, especially "knock-out" mice,
whose genes for PDE4D6 isoforms have been rendered non-functional
so that said mice produce no PDE4D6 phosphodiesterase. Such mice
thereby provide means of studying the effects of over-production,
or no production, of the PDE4D6 isoforms disclosed according to the
invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1 shows the results of expression of recombinant
PDE-4D6 using a baculovirus/SF9 insect expression system.
Phosphodiesterase activity was measured in a cell-free system by
measuring the decrease in the cAMP hydrolysis product (5'-AMP)
after incubation with the recombinant enzyme and in the presence of
the indicated concentrations of the phosphodiesterase inhibitor,
rolipram. Sensitivity to rolipram is a well-known and
distinguishing characteristic of the PDE4 class of
phosphodiesterases.
[0018] FIG. 2 shows binding of .sup.3H-rolipram to the expressed
recombinant PDE-4D6. The indicated concentrations of labeled
rolipram were incubated with insect lysates containing recombinant
PDE-4D6 and binding of rolipram was measured after rapid filtration
on glass fiber filters. Here, RBS stands for rolipram binding
sites; K.sub.d refers to the dissociation constant.
[0019] FIG. 3 shows that expression of recombinant PDE-4D6 in
mammalian cells reduces cAMP levels. Here, Chinese hamster ovary
(CHO) cells were transfected with PDE-4D6 and a CRE-luciferase
reporter system that responds to cAMP levels. Basal cAMP levels are
reduced and incubation with PDE-4 inhibitors causes an increase in
cAMP accumulation as detected by an increase in the activity of the
CRE-luciferase reporter gene.
DETAILED SUMMARY OF THE INVENTION
[0020] The present invention relates to oligopeptides and
polypeptides that contain novel amino acid sequences as shown in
SEQ ID NOS: 2 and 4, for the human and rat, respectively), and
polynucleotides that encode such polypeptides, e.g., the
polynucleotide sequences of SEQ ID NOS: 1 and 3, respectively, as
well as segments, fragments, analogs and derivatives of such
polypeptides.
[0021] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of SEQ ID NOS: 2 or 4 mean a
polypeptide which retains essentially the same biological function
or activity as such polypeptide, which can include ability to react
with an antibody. Thus, an analog includes a proprotein that can be
activated by cleavage of the proprotein portion to produce an
active mature polypeptide. Such fragments, derivatives and analogs
must have sufficient similarity to the polypeptide of SEQ ID NOS: 2
and 4 so that activity of the native polypeptide is retained.
[0022] The polypeptide of the present invention may be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0023] The fragment, derivative or analog of the polypeptide of SEQ
ID NO:2 and 4 may be (i) one in which one or more of the amino acid
residues are substituted with a conserved or non-conserved amino
acid residue (preferably a conserved amino acid residue) and such
substituted amino acid residue may or may not be one encoded by the
genetic code, or (ii) one in which one or more of the amino acid
residues includes a substituent group, or (iii) one in which the
mature polypeptide is fused with another compound, such as a
compound to increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptide, such as a leader or
secretory sequence or a sequence which is employed for purification
of the mature polypeptide or a proprotein sequence, commonly for
the purpose of creating a genetically engineered form of the
protein that is susceptible to secretion from a cell, such as a
transformed cell. Such fragments, derivatives and analogs are
deemed to be within the scope of those skilled in the art from the
teachings herein.
[0024] The polypeptides of the present invention are preferably
provided in an isolated form, and may even be purified to
homogeneity, and most commonly will be produced by recombinant
expression using any of a large number of such expression systems
well known to those of skill in the art.
[0025] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally occurring
polypeptide present in a living animal is not isolated, but the
same polypeptide, separated from some or all of the coexisting
materials in the natural system, is isolated. Such polypeptides
could be part of a composition, and still be isolated in that such
composition is not part of its natural environment.
[0026] The polypeptides of the present invention include the
polypeptide of SEQ ID NO: 2 and 4 (in particular the mature
polypeptide) as well as polypeptides which have varying degrees of
sequence homology thereto so long as such oligopeptides or
polypeptides contain a sequence that is also homologous to the
novel 15-mer sequence of SEQ ID NO: 5).
[0027] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0028] More particularly, the polypeptides of the invention include
isolated polypeptides, and fragments thereof, comprising an
unbroken sequence of at least 15 amino acids (referred to herein as
the novel 15-mer (SEQ ID NO: 5), or just as a 15-mer when used
generically) having the sequence of the N-terminal 15 amino acids
(the N-terminal 15-mer) of the sequences of SEQ ID NOS: 2 and 4)
and also given as SEQ ID NO: 5.
[0029] In addition to such polypeptides, and fragments thereof,
containing the novel 15-mer disclosed according to the invention,
there are also disclosed within the present invention polypeptides,
and fragments thereof, comprising a 15-mer (i.e., an unbroken
sequence of amino acids 15 residues in length) wherein such 15-mer
shows sequence homology to the novel 15-mer disclosed herein. Thus,
polypeptides, and fragments thereof, within the present invention
will contain 15-mer amino acid sequences (i.e., uninterrupted
stretches of 15 consecutive amino acids) wherein said 15-mers show
at least 65% identity with the novel 15-mer (SEQ ID NO: 5) of the
invention, preferably 80% sequence identity thereto, and most
preferably 95% sequence identity thereto. Most preferably, such
polypeptides, and fragments thereof, will contain the novel 15-mer
(SEQ ID NO: 5)(for example, residue 5 of the 15-mer could be Asn or
Phe).
[0030] In accordance with the present invention, the term "percent
identity" or "percent identical," when referring to a sequence,
means that a sequence is compared to a claimed or described
sequence after alignment of the sequence to be compared (the
"Compared Sequence") with the described or claimed sequence (the
"Reference Sequence"). The Percent Identity is then determined
according to the following formula:
Percent Identity=100 [1-(C/R)]
[0031] wherein C is the number of differences between the Reference
Sequence and the Compared Sequence over the length of alignment
between the Reference Sequence and the Compared Sequence wherein
(i) each base or amino acid in the Reference Sequence that does not
have a corresponding aligned base or amino acid in the Compared
Sequence and (ii) each gap in the Reference Sequence and (iii) each
aligned base or amino acid in the Reference Sequence that is
different from an aligned base or amino acid in the Compared
Sequence, constitutes a difference; and R is the number of bases or
amino acids in the Reference Sequence over the length of the
alignment with the Compared Sequence with any gap created in the
Reference Sequence also being counted as a base or amino acid.
[0032] If an alignment exists between the Compared Sequence and the
Reference Sequence for which the percent identity as calculated
above is about equal to or greater than a specified minimum Percent
Identity then the Compared Sequence has the specified minimum
percent identity to the Reference Sequence even though alignments
may exist in which the hereinabove calculated Percent Identity is
less than the specified Percent Identity.
[0033] The above description for percent identity or percent
homology is intended to apply equally to nucleotide or amino acid
sequences
[0034] The polypeptides, and fragments and segments thereof, within
the present invention may possess enzyme activity, commonly
phosphodiesterase activity, especially where polypeptides similar
in length to those of SEQ ID NOS: 2 and 4, or very large fragments
thereof, are involved. Such phosphodiesterases will also include as
part of their structure sequences of amino acids possessing
sequence homology, or sequence identity, to the novel 15-mer of SEQ
ID NO: 5. Thus, phosphodiesterases within the present invention
will commonly contain at least one continuous sequence of amino
acids having at least 65% sequence identity to the novel 15-mer
(SEQ ID NO: 5), preferably 80% sequence identity thereto, and most
preferably 95% or 97% sequence identity thereto, with the preferred
embodiment of such phosphodiesterase containing the novel 15-mer
(SEQ ID NO: 5) within its amino acid sequence.
[0035] Polypeptides, and fragments or segments thereof, within the
present invention may also contain unbroken stretches of amino
acids containing less than the full 15 amino acids of the novel
15-mer (SEQ ID NO: 5) disclosed herein. Thus, polypeptides, and
fragments thereof, within the present invention may also contain an
unbroken sequence of as few as 10 amino acids (a 10-mer), said
10-mer being identical to an unbroken 10-mer wholly within the
novel 15-mer disclosed herein (SEQ ID NO: 5). Preferably, said
polypeptides, and fragments thereof, will contain at least a
12-mer, or an unbroken sequence of 12 amino acids also found as an
unbroken sequence within the novel 15-mer disclosed according to
the invention. Further, polypeptides, and fragments thereof, will
most preferably contain within their sequences at least one
unbroken sequence of 15 amino acids identical to the novel 15-mer
(SEQ ID NO: 5) disclosed herein, such 15-mer thereby showing 100%
sequence identity to the novel 15-mer of the invention SEQ ID NO:
5).
[0036] As used with respect to the polypeptides (and
polynucleotides) of the present invention, the term segment refers
to a sequence that is a subset of a larger sequence (i.e., a
continuous or unbroken sequence of residues within a larger
sequence). Thus, for example, the 15 residues of SEQ ID NO: 5
(referred to herein as the novel 15-mer) can contain a total of 6
segments of 10 residues each (e.g. 1-10, 2-11, 3-12, 4-13, 5-14,
and 6-15).
[0037] Consequently, in terms of the subset of segments within the
novel 15-mer of SEQ ID NO: 5, the polypeptides of the present
invention include polypeptides comprising a 15 amino acid segment
having a sequence at least 65% identical, preferably 80% identical,
more preferably 95% identical, and most preferably 100% identical
to SEQ ID NO: 5.
[0038] Alternatively, the polypeptides of the present invention
include polypeptides comprising a segment within SEQ ID NO: 5, said
segment containing at least 10 amino acids, preferably 12 amino
acids, and more preferably 14 amino acids, and most preferably 15
amino acids (the latter being equal to SEQ ID NO: 5).
[0039] In addition, the polypeptides, and fragments thereof, of the
present invention may be found in the cells and tissues of any
species of animal, but will preferably be found in cells from
mammals, especially the cells of humans. In any given animal, the
polypeptides, and fragments thereof, within the present invention
may be found in a variety of tissues, especially the nervous
system, most especially the brain, for example, in the hippocampal
region.
[0040] The present invention also includes novel polynucleotides,
especially novel cDNAs derived from mRNAs found in the cells of
animals and which code for the polypeptides of the invention. The
polynucleotides of the present invention may be in the form of RNA
or in the form of DNA, which DNA includes cDNA, genomic DNA, and
synthetic DNA. The DNA may be double-stranded or single-stranded,
and if single stranded may be the coding strand or non-coding
(anti-sense) strand. The coding sequence which encodes the mature
polypeptide may be identical to the coding sequence shown in SEQ ID
NO:1 or 3, or may be a different coding sequence, which coding
sequence, as a result of the redundancy or degeneracy of the
genetic code, encodes the same mature polypeptide as the DNA of SEQ
ID NO: 1 or 3.
[0041] The term "polynucleotide" as used for the present invention
encompasses a polynucleotide, which includes only coding sequence
for the polypeptide, as well as a polynucleotide that includes
additional coding and/or non-coding sequence.
[0042] The polynucleotides of the present invention (SEQ ID NOS: 1,
and 3) contain open reading frames available for the coding of
polypeptide amino acid sequences. For the sequence of SEQ ID NO: 1,
the open reading frame (or ORF) coding for the polypeptide of SEQ
ID NO: 2 (the human hippocampal PDE4D6 isoform) is found at
nucleotides 357-1991 (with nucleotides 1912-1914 representing the
"taa" terminating codon) while for the rat isoform, the sequence of
SEQ ID NO: 3 contains an open reading frame at nucleotides 332-1882
(with nucleotides 1883-1885 representing the "taa" terminating
codon).
[0043] The present invention further relates to variants of such
polynucleotides which encode for fragments, analogs and derivatives
of the polypeptide having the amino acid sequence of SEQ ID NO: 2
and 4. Variants of the polynucleotide may be naturally occurring
allelic variants of the polynucleotide or a non-naturally occurring
variant of the polynucleotide.
[0044] Thus, the present invention includes polynucleotides
encoding all of the polynucleotides, and fragments thereof, as
disclosed hereinabove provided that they incorporate therein a
close homolog of the novel 15-mer of SEQ ID NO: 5, such as a 15-mer
having at least a 65% sequence identity to the novel 15-mer of SEQ
ID NO: 5. The present invention also includes the novel
oligonucleotide sequence coding for the novel-15 mer polypeptide
(SEQ ID NO: 5) disclosed herein.
[0045] Such polynucleotides may have a coding sequence which is a
naturally occurring allelic variant of the coding sequence shown in
SEQ ID NO: 1 and 3. As known in the art, an allelic variant is an
alternate form of a polynucleotide sequence which may have a
substitution, deletion or addition of one or more nucleotides,
which does not substantially alter the function of the encoded
polypeptide.
[0046] The present invention also includes polynucleotides, wherein
the coding sequence for the mature polypeptide may be fused in the
same reading frame to a polynucleotide sequence which aids in
expression and secretion of a polypeptide from a host cell, for
example, a leader sequence which functions as a secretory sequence
for controlling transport of a polypeptide from the cell and a
transmembrane anchor which facilitates attachment of the
polypeptide to a cellular membrane. The polypeptide having a leader
sequence is a proprotein and may have the leader sequence cleaved
by the host cell to form the mature form of the polypeptide. The
polynucleotides may also encode for a proprotein which is the
mature protein plus additional N-terminal amino acid residues. A
mature protein having a prosequence is a proprotein and is an
inactive form of the protein. Once the prosequence is cleaved an
active mature protein remains.
[0047] Thus, for example, a polynucleotide of the present invention
may encode for a mature protein, for a protein having a
prosequence, for a protein having a transmembrane anchor or for a
polypeptide having a prosequence, a presequence (leader sequence)
and a transmembrane anchor.
[0048] Polynucleotides of the present invention may also have the
coding sequence fused in frame to a marker sequence that allows for
purification of the polypeptide of the present invention. The
marker sequence may be a hexa-histidine tag (possibly supplied by a
pQE-9 vector) to provide for purification of the mature polypeptide
fused to the marker in the case of a bacterial host, or, for
example, the marker sequence may be a hemagglutinin (HA) tag when a
mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds
to an epitope derived from the influenza hemagglutinin protein
(Wilson, I., et al., Cell, 37:767 (1984)).
[0049] As used herein, the term "gene" means the segment of DNA
involved in producing a polypeptide chain; it includes regions
preceding and following the coding region (leader and trailer) as
well as intervening sequences (introns) between individual coding
segments (exons). Of course, cDNAs will lack the corresponding
introns.
[0050] Fragments of the full-length polynucleotide of the present
invention may be used as a hybridization probe for a cDNA library
to isolate the full-length cDNA and to isolate other cDNAs, which
have a high sequence similarity to the gene or similar biological
activity. Probes of this type preferably have at least 30 bases and
will be homologous to the sequence coding for the novel 15-mer
disclosed in SEQ ID NO: 5. Such probes may also have 45 or more
bases but will again contain sequences homologous to a sequence
coding for the novel 15-mer of SEQ ID NO: 5, or a variant thereof
within the invention. Because of the degeneracy of the genetic
code, many such sequences will be found to be homologous to
sequences coding for the novel 15-mer disclosed herein. The set of
such sequences will also include those that code for amino acid
sequences that are themselves homologous to the novel 15-mer (SEQ
ID NO: 5).
[0051] The polynucleotides of the invention, in particular the
polynucleotide coding for the novel 15-mer (SEQ ID NO: 5) disclosed
herein, may also serve as a site for study of possible mutation of
said sequence, especially where mutations occurring in disease
conditions are related to excess amounts of intracellular
phosphodiesterase activity. Thus, the polynucleotide sequence
coding for the novel 15-mer may act as a reference for the
development of probes, possibly as long as 30 to 45 nucleotides, or
longer, that can be used to probe the genome of animals suspected
of being at risk for disease, or possibly having such disease,
especially where such disease may involve altered levels of cAMP
within the cells of such animals, such as rats and mice, and
especially humans, and most especially where this occurs within
neurons of the brain, most especially those areas of the brain
involved in memory, such as long term memory, for example, the
hippocampal region. Thus, such stretches of nucleotides will serve
as sites for the binding of probes that will identify possible
causes of such diseases, especially diseases involving loss of
memory, most especially long-term memory.
[0052] The present invention also relates to vectors which contain
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention, especially
where such cells result in a cell line that can be used for assay
of PDE-4D, especially PDE-4D6, activity and production of
polypeptides of the invention by recombinant techniques.
[0053] Host cells, preferably insect cells of Spodoptera species,
most especially SF9 cells, are genetically engineered (transduced
or transformed or transfected) with the vectors, especially
baculovirus) of this invention which may be, for example, a cloning
vector or an expression vector. Such vectors can include plasmids,
viruses and the like. The engineered host cells are cultured in
conventional nutrient media modified as appropriate for activating
promoters, selecting transformants or amplifying the genes of the
present invention. The culture conditions, such as temperature, pH
and the like, are those previously used with the host cell selected
for expression, and will be apparent to the ordinarily skilled
artisan.
[0054] The polynucleotides of the present invention may be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide may be included in any one of a variety
of expression vectors for expressing a polypeptide. Such vectors
include chromosomal, nonchromosomal and synthetic DNA sequences,
e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from combinations of
plasmids and phage DNA, viral DNA such as vaccinia, adenovirus,
fowl pox virus, and pseudorabies. However, any other vector may be
used as long as it is replicable and viable in the host.
[0055] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0056] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli, lac or trp, the phage lambda PL promoter and other promoters
known to control expression of genes in prokaryotic or eukaryotic
cells or their viruses. The expression vector also contains a
ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0057] In addition, the expression vectors preferably contain one
or more selectable marker genes to provide a phenotypic trait for
selection of transformed host cells such as dihydrofolate reductase
or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin resistance in E. coli.
[0058] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate host
to permit the host to express the protein. Such transformation will
be permanent and thus give rise to a cell line that can be used for
further testing. Such cell lines used for testing will commonly be
mammalian cells whose cAMP levels are to be monitored for
indications of varying phosphodiesterase (PDE4D) activity.
[0059] As representative examples of appropriate hosts, there may
be mentioned: bacterial cells, such as E. coli, Streptomyces,
Salmonella typhimurium; fungal cells, such as yeast; insect cells
such as Drosophila S2 and Spodoptera Sf9 (and other insect
expression systems); animal cells such as CHO, COS or Bowes
melanoma; adenoviruses; plant cells, etc. The selection of an
appropriate host is deemed to be within the knowledge of those
skilled in the art based on the teachings herein.
[0060] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, especially where the Baculovirus/SF9
vector/expression system is used, into which a sequence of the
invention has been inserted, in a forward or reverse orientation.
In a preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10,
phagescript, psiX174, pBluescript SK, pBSKS, pNH8A, pNH16a, pNH18A,
pNH46A (Stratagene); pTRC99a, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharmacia); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0061] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are pKK232-8 and pCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0062] In a further embodiment, the present invention relates to
host cells containing the above-described constructs. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as, a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)). A preferred embodiment utilizes
expression from insect cells, especially SF9 cells from Spodoptera
frugiperda.
[0063] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0064] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), Wu et al, Methods in
Gene Biotechnology (CRC Press, New York, N.Y., 1997), Recombinant
Gene Expression Protocols, in Methods in Molecular Biology, Vol.
62, (Tuan, ed., Humana Press, Totowa, N.J., 1997), and Current
Protocols in Molecular Biology, (Ausabel et al, Eds.,), John Wiley
& Sons, NY (1994-1999), the disclosures of which are hereby
incorporated by reference in their entirety.
[0065] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples include the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0066] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae Trp1 gene, and a promoter derived
from a highly expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and
termination sequences, and preferably, a leader sequence capable of
directing secretion of translated protein into the periplasmic
space or extracellular medium. Optionally, the heterologous
sequence can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics, e.g.,
stabilization or simplified purification of expressed recombinant
product.
[0067] Use of a Baculovirus-based expression system is a preferred
and convenient method of forming the recombinants disclosed herein.
Baculoviruses represent a large family of DNA viruses that infect
mostly insects. The prototype is the nuclear polyhedrosis virus
(ACMNPV) from Autographa californica, which infects a number of
lepidopteran species. One advantage of the baculovirus system is
that recombinant baculoviruses can be produced in vivo. Following
co-transfection with transfer plasmid, most progeny tend to be wild
type and a good deal of the subsequent processing involves
screening. To help identify plaques, special systems are available
that utilize deletion mutants. By way of non-limiting example, a
recombinant AcMNPV derivative (called BacPAK6) has been reported in
the literature that includes target sites for the restriction
nuclease Bsu361 upstream of the polyhedrin gene (and within ORF
1629) that encodes a capsid gene (essential for virus viability).
Bsf361 does not cut elsewhere in the genome and digestion of the
BacPAK6 deletes a portion of the ORF1629, thereby rendering the
virus non-viable. Thus, with a protocol involving a system like
Bsu361-cut BacPAK6 DNA most of the progeny are non-viable so that
the only progeny obtained after co-transfection of transfer plasmid
and digested BacPAK6 is the recombinant because the transfer
plasmid, containing the exogenous DNA, is inserted at the Bsu361
site thereby rendering the recombinants resistant to the enzyme.
[see Kitts and Possee, A method for producing baculovirus
expression vectors at high frequency, Bio Techniques, 14, 810-817
(1993). For general procedures, see King and Possee, The
Baculovirus Expression System: A Laboratory Guide, Chapman and
Hall, New York (1992) and Recombinant Gene Expression Protocols, in
Methods in Molecular Biology, Vol. 62, (Tuan, ed., Humana Press,
Totowa, N.J., 1997), at Chapter 19, pp. 235-246.
[0068] The effect of known inhibitors, such as rolipram, on the
PDE-4D6 of the present invention (using recombinant PDE-4D6 of the
present invention expressed in a Baculovirus/SF9 insect cell
expression system) is shown in FIG. 1. Rolipram is a well known
inhibitor of such enzymes (see, for example, Livi et al, "Cloning
and Expression of cDNA for a human low KM rolipram sensitive cyclic
AMP phosphodiesterase," Molecular and Cellular Biol., 10, 2678-2686
(1990)) Thus, the PDE-4D6 of the present invention is sensitive to
rolipram as are other PDE4 enzymes. Binding of rolipram to the
PDE-4D6 of the present invention is shown in FIG. 2. The results of
the experiments depicted in FIG. 3 show clearly the expression of
the PDE-4D6 of the present invention in mammalian cells distinctly
reduces the levels of cAMP in those cells.
[0069] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0070] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0071] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well known to those skilled in the art.
[0072] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO cells (as utilized in the methods disclosed herein), HeLa
and BHK cell lines. Mammalian expression vectors will comprise an
origin of replication, a suitable promoter and enhancer, and also
any necessary ribosome binding sites, polyadenylation site, splice
donor and acceptor sites, transcriptional termination sequences,
and 5' flanking nontranscribed sequences. DNA sequences derived
from the SV40 splice, and polyadenylation sites may be used to
provide the required nontranscribed genetic elements.
[0073] The invention disclosed herein also relates to a transgenic
animal comprising within its genome one or more copies of the
polynucleotides encoding the novel polypeptides of the invention.
The transgenic animals of the invention may contain within their
genome multiple copies of the polypeptides encoding the
polypeptides of the invention, or one copy of a gene encoding such
polypeptide but wherein said gene is linked to a promoter that will
direct overexpression of said polypeptide within some, or all, of
the cells of said transgenic animal. The transgenic animal of the
invention will preferably be a mammal, most preferably a mouse. The
present invention also relates to a transgenic animal whose genome
lacks a gene expressing a functional PDE4D6 isoform or functional
analog thereof, such animal commonly being referred to as a
"knockout" animal, especially a "knock-out mouse."
[0074] The present invention also relates to a transgenic non-human
animal whose genome comprises one or more genes coding for the
human isoform of PDE4D6 disclosed herein in place of the mammalian
gene otherwise coding for said the non-human isoform. Most
preferably said animal will be a mouse. Such methods of producing
transgenic animals are well within the skill of those in the art
and will not be described in detail herein. [See: Wu et al, Methods
in Gene Biotechnology, CRC 1997, pp.339-366; Jacenko, O.,
Strategies in Generating Transgenic Animals, in Recombinant Gene
Expression Protocols, Vol. 62 of Methods in Molecular Biology,
Humana Press, 1997, pp 399-424]
[0075] The polypeptide can be recovered and purified from
recombinant cell cultures by methods including ammonium sulfate or
ethanol precipitation, acid extraction, anion or cation exchange
chromatography, phosphocellulose chromatography, hydrophobic
interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Protein
refolding steps can be used, as necessary, in completing
configuration of the mature protein. Finally, high performance
liquid chromatography (HPLC) can be employed for final purification
steps. [See: Salanova et al, Heterologous Expression and
Purification of Recombinant Rolipram-Sensitive Cyclic AMP-Specific
Phosphodiesterases, in Methods: A Companion to Methods in
Enzymology 14:55-64 (1998)]
[0076] The polypeptides of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial
methionine amino acid residue.
[0077] The full-length polypeptides of the present invention were
readily cloned from insect cells using the baculovirus expression
vector. Such expression was readily performed using methods well
known in the art. [See: Wang et al, Expression, Purification, and
Characterization of Human cAMP-Specific Phosphodiesterase (PDE4)
Subtypes A, B, C, and D, Biochem. Biophys. Res. Comm. 234, 320-324
(1997), in particular, SF9 cells as in Wang et al. The recombinant
SPD4D6 enzyme is then available for in vitro assay.
[0078] This invention also provides a method of screening compounds
to identify those that block (antagonists) interaction of cAMP with
PDE4Ds of the invention disclosed herein (designated PDE4D6). Such
reaction results in an increased cyclic AMP level within the
subject cells and resultant physiological alterations resulting
therefrom.
[0079] In applying the methods of the invention, it should be kept
in mind that the PDE4D6 isoforms disclosed herein are not merely
general phosphodiesterases but are particular isoforms involved in
the physiological reactions to be monitored. Thus, a given cell
will commonly possess a set of isoforms and the goal of the methods
and disclosure of the invention are to monitor the levels of the
isoforms of the invention (the PDE4D6 isoforms disclosed herein) in
neural cells as a means of correlating such enzyme levels with
memory. The isoforms of the invention are therefore highly selected
isoforms derived from cells in areas of the brain known to be
related to memory.
[0080] The present invention also relates to an assay for
identifying potential antagonists specific for PDE4Ds, in
particular, PDE4D6 isoforms. An example of such an assay combines a
PDE4D of the invention (i.e., a PDE4d6 isoform) and a potential
antagonist (i.e., an inhibitor) under appropriate conditions for a
competitive inhibition assay. Other inhibitory substances may even
enter cells and bind directly to the DNA neighboring the sequences
coding for the polypeptides of the invention, thereby decreasing
their expression and thus increasing intracellular levels of
cAMP.
[0081] Potential antagonists include small chemical compounds or,
in some cases, an antibody that binds specifically to the
polypeptide of the invention. Such antibodies are useful as a means
of detecting the polypeptides, and fragments thereof, of the
present invention.
[0082] Another potential antagonist or inhibitor of the invention
is an antisense construct prepared using antisense technology.
Antisense technology can be used to control gene expression through
triple-helix formation or antisense DNA or RNA, both of which
methods are based on binding of a polynucleotide to DNA or RNA. For
example, the 5' coding portion of the polynucleotide sequence,
which encodes for the mature polypeptides of the present invention,
is used to design an antisense RNA oligonucleotide of from about 10
to 40 base pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
(triple helix--see Lee et al., Nucl. Acids Res., 6:3073 (1979);
Cooney et al, Science, 241:456 (1988); and Dervan et al., Science,
251: 1360 (1991)), thereby preventing transcription and the
production of PDE4D isoforms. The antisense RNA oligonucleotide
hybridizes to the mRNA in vivo and blocks translation of the mRNA
molecule into a PDE4D polypeptide (Antisense--Okano, J. Neurochem.,
56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of
Gene Expression, CRC Press, Boca Raton, Fla. (1988)). The
oligonucleotides described above can also be delivered to cells
such that the antisense RNA or DNA may be expressed in vivo to
inhibit production of PDE4Ds, especially PDE4D6.
[0083] Potential modulators, either inhibitors or even activators,
include small molecules that bind to and occupy the catalytic site
of the polypeptide thereby making the catalytic site inaccessible
to substrate such that normal biological activity is prevented.
Examples of small molecules include but are not limited to small
chemical compounds, especially those having cyclic nucleotide-like
structures. Other potential modulators are peptides, and peptide
analogs. Such modulators, either inhibitors or activators, can be
assayed in vivo using both the knock-out mice already described, as
well as the humanized mice in which a human gene coding for the
human isoform of PDE4D6 disclosed herein is present in place of the
mouse gene otherwise coding for such analog.
[0084] This invention is also related to the use of the genes
coding for the polypeptides of the invention as a diagnostic tool.
Detection of a mutated form of the gene will allow a diagnosis of a
disease or a susceptibility to a disease that results from
expression of a mutated PDE4D polypeptide that may have, for
example, increased activity in degrading cAMP.
[0085] Individuals carrying mutations in the gene of the present
invention may be detected at the DNA level by a variety of
techniques. Nucleic acids for diagnosis may be obtained from a
patient's cells, including but not limited to blood, urine, saliva,
tissue biopsy and autopsy material. The genomic DNA may be used
directly for detection or may be amplified enzymatically by using
PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis.
RNA or cDNA may also be used for the same purpose. As an example,
PCR primers complementary to the nucleic acid encoding the novel
15-mer of SPD4D6 can be used to identify and analyze mutations. For
example, deletions and insertions can be detected by a change in
size of the amplified product in comparison to the normal genotype.
Point mutations can be identified by hybridizing amplified DNA to
radiolabeled RNA or alternatively, radiolabeled antisense DNA
sequences. Perfectly matched sequences can be distinguished from
mismatched duplexes by RNase A digestion or by differences in
melting temperatures.
[0086] Sequence differences between the reference gene and genes
having mutations may be revealed by the direct DNA sequencing
method. In addition, cloned DNA segments may be employed as probes
to detect specific DNA segments. The sensitivity of this method is
greatly enhanced when combined with PCR. For example, a sequencing
primer is used with double-stranded PCR product or a
single-stranded template molecule generated by a modified PCR. The
sequence determination is performed by conventional procedures with
radiolabeled nucleotide or by automatic sequencing procedures with
fluorescent-tags.
[0087] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by
high-resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0088] The methods of the invention thus provide for a process for
diagnosing a disease in an animal afflicted therewith, or a
susceptibility to a disease in an animal at risk thereof,
comprising determining a mutation in the genome of a neuron from
said animal and wherein the mutation occurs in a nucleotide
sequence coding for the 15-mer of SEQ ID NO:5. Such animal is
preferably a mammal and most preferably a human, wherein the
disease to be determined is one involving loss of memory as a
primary or secondary condition, especially loss of long term
memory.
[0089] In addition, sequence changes at specific locations may also
be revealed by nuclease protection assays, such as RNase and S1
protection or the chemical cleavage method (e.g., Cotton et al.,
PNAS, USA, 85:4397-4401 (1985)) and these are deemed within the
methods of the invention.
[0090] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0091] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0092] The sequences of the present invention are also valuable for
chromosome identification. The polynucleotides coding for the novel
15-mer of the invention, and homologs thereof, are specifically
targeted to and can hybridize with a particular location on an
individual human chromosome. Moreover, there is a current need for
identifying particular sites on the chromosome, for example, as
part of the human genome project. Thus, sequences can be mapped to
chromosomes by preparing PCR primers (preferably 15-25 bp) from the
cDNA.
[0093] Fluorescence in-situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can likewise be used to provide a
precise chromosomal location in one step. This technique can be
used with cDNA having at least 50 or 60 bases. For a review of this
technique, see Verma et al., Human Chromosomes: a Manual of Basic
Techniques, Pergamon Press, New York (1988). The chromosomal
location of PDE genes (including PDE4D) is known to those skilled
in the art.
[0094] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0095] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0096] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0097] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can also be used as
immunogens to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0098] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a non-human. The antibody
so obtained will then bind the polypeptide itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0099] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0100] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0101] Such antibodies find use in assays to detect the presence of
aberrant forms of the polypeptides disclosed herein, especially
where the sequences differ from that found in the novel 15-mer (SEQ
ID NO: 5) disclosed according to the invention, which sequence may
be unique to PDE4D enzymes found in cells of the hippocampal region
(a region known to be involved in memory).
[0102] As already described, in the brain the level of cAMP within
neurons is believed to be related to the quality of memory,
especially long-term memory. Thus, since PDE4D degrades cAMP, the
level of this enzyme could have effects on memory in animals, for
example, in humans. Briefly, a compound that inhibits cAMP
phosphodiesterase (PDE) will thereby increase intracellular levels
of cAMP, which in turn activate a protein kinase that
phosphorylates a transcription factor (cAMP response binding
protein), which transcription factor then binds to a DNA promoter
sequence to activate genes that are important in long term memory.
The more active such genes are, the better is long term memory.
Thus, by inhibiting the phosphodiesterase, long term memory can be
enhanced.
[0103] The present invention also provides for a means of examining
actual or potential disease conditions involving altered levels of
cAMP by determining the presence or absence of novel polypeptides
of the invention in an animal suspected of having such a disease
condition or being at risk therefor. Thus, the methods of the
invention provide a process for diagnosing a disease in an animal
afflicted therewith, or diagnosing a susceptibility to a disease in
an animal at risk thereof, wherein said disease is related, for
example, to an over-expression of a phosphodiesterase according to
the invention (i.e., one incorporating in its structure a sequence
homologous to the novel 15-mer of SEQ ID NO: 5 comprising
determining the level of said phosphodiesterase activity in a cell
from said animal, wherein said animal is preferably a mammal and
most preferably a human. The disease conditions to be so determined
will often involve loss of memory as a primary or secondary effect
thereof, especially loss of long term memory, and the cells to be
tested will commonly be neurons, especially those of the brain, for
example, neurons of the hippocampal region.
[0104] The methods of the present invention are also directed to
facilitating the development of potentially useful therapeutic
agents that may be effective in combating loss of memory,
especially long term memory, or which may be effective in restoring
memory, especially long term memory, or which may play a role in
causing the loss of memory, especially long term memory, perhaps by
activating brain, especially hippocampal, neuronal cAMP
phosphodiesterase, particularly the PDE4D6 activity disclosed
herein and thereby decreasing levels of cAMP in such cells.
[0105] In keeping with this objective, the present invention
provides a means of screening small compounds for the ability to
inhibit PDE4D isoforms, especially those disclosed herein. Such
screening is conveniently done either in vitro in whole cells in
culture by first preparing cells into which have been inserted the
appropriate DNAs to form a cell line expressing the polypeptides of
the present invention.
[0106] Using the methods disclosed herein the polynucleotides
coding for the novel phosphodiesterases of the invention can be
inserted into an appropriate vector and said vector transfected
into an appropriate host cell, such as CHO cells, to create a
stable cell line. The cAMP levels of such cells, and thereby the
level of PDE4D phosphodiesterase activity in such cells, can be
used to monitor the effects of various chemical agents on
phosphodiesterase activity.
[0107] More specifically, CHO cells, stably expressing
phosphodiesterase, such as the PDE4D isoforms of the present
invention, can be readily utilized for assays of cAMP. [See: Pon et
al, Characterization of CHO-K1 Cells Stably Expressing PDE-IV
Enzymes, Cell Biochemistry and Biophysics 29:159-178 (1998) the
disclosure of which is incorporated herein] Such cells have been
shown to readily express recombinant full-length cAMP
phosphodiesterases.
[0108] Measurements of whole cell cyclic AMP in response to the
presence of potential PDE inhibitory substances in the medium have
been described. [See Pon et al (1998)] Briefly, CHO cells
expressing the PDE isoform are lysed by sonication for 10 seconds
in ice-cold solution containing Tris pH 7.5 buffer (50 mM Tris, 1
mM EDTA) and protease inhibitor added along with 200 .mu.M
.beta.-mercaptoethanol. Centrifugation at 100,000g for 90 minutes
at 4.degree. C. yields soluble and particulate fractions containing
phosphodiesterase activity. The phosphodiesterase activity is then
measured in a solution containing 50 mM Tris (pH 7.5), 10 mM
MgCl.sub.2, 1 mM EDTA and 100 nM .sup.3H-cAMP (with final volume of
100 .mu.L) and containing varying concentrations of inhibitors to
be screened. After incubation at 30.degree. C. for periods up to 10
minutes, the reaction was terminated by addition of about 50 .mu.L
PDE scintillation proximity assay (SPA) beads (from Amersham)
containing 18 mM ZnSO.sub.4. Scintillation counting then gave the
amount of hydrolysis of .sup.3H-cAMP. This represents an in vitro
assay for cAMP.
[0109] In the same way, the cells can also be grown in a culture
medium containing potential inhibitory agents of phosphodiesterase
isoforms and the cellular cAMP measured in a similar fashion after
the cells are removed from the inhibitory medium. This may be
necessary because Pon et al have found that cAMP phosphodiesterases
demonstrate differences in activity when assayed in whole cell as
opposed to lysed cells.
[0110] The overall screening process for phosphodiesterase
inhibitory activity would be one comprising: contacting a cell
expressing a polypeptide coded for by a polynucleotide of the
invention with a chemical agent having potential phosphodiesterase
moderating, either activating or inhibiting, activity and measuring
the level of total cyclic adenosine monophosphate (cAMP) in said
cell following said exposure wherein an altered level of cAMP in
said cell following said exposure is an indicator of such
moderating activity.
[0111] More specifically, an increase in cAMP level indicates an
inhibitory activity by the agent being tested while a decrease in
cAMP level indicates an activating effect by the agent being
tested.
[0112] Thus, using the novel polypeptides of the invention
disclosed herein, together with the methods disclosed herein, it is
a straightforward procedure to screen potential agents for their
ability to alleviate the effects of, or possibly prevent entirely,
the effects of memory loss, especially the effects of long term
memory loss.
EXAMPLE 1
[0113] Isolation of Rat and Human PDE4D6 cDNA Using 5'-RACE
Technique
[0114] Three nested reverse primers were designed based on the rat
PDE4D2 sequence from Genbank (Accession No. u09456) and on the
human PDE4D sequence from Genbank (Accession No. u79571). Here, the
primer sequences were:
1 For rat: RatPDE4DR1: 5'-ATGCAGAGGCCGGTTGCCAGAC-
AGCTCCGCTATTCGG-3' SEQ ID NO: 6 RatPDE4DR2:
5'-TGGCCAGGACATCTTCCTGCTCTGTTTTAACC-3' SEQ ID NO: 7 RatPDE4DR3:
5'-GTCAGGCTGGAGCTGTGCATCAACTTCTTGACC-3' SEQ ID NO: 8 Human primer
sequences are: HuPDE4DR1: 5'-CCGGTTACCAGACAACTCTGC-3' SEQ ID NO: 9
HuPDE4DR2: 5'-TGGCAAGGACATCTTCTTGTTCA-3' SEQ ID NO: 10 HuPDE4DR3:
5'-GACTCCACTGATCTGAGACATTGGTCT-3' SEQ ID NO: 11
[0115] The polymerase chain reaction was performed using a 5' RACE
kit (GIBCO-BRL) for searching novel PDE4D cDNA isoforms in 5' ends
from rat and human brain tissues. Total RNA from rat hippocampal
CA1 region and mRNA from human hippocampus (Clontech) were used as
templates. 1 .mu.g of RNA samples was used for reverse
transcription. The primers used for the first strand cDNA synthesis
were ratPDE4DR1 (SEQ ID NO: 6) and huPDE4DR1 (SEQ ID NO: 9). The
reverse transcription reaction was carried out with Superscript II
RT (GIBCO-BRL) at 42.degree. C. for 1 hour. The cDNA was purified
and tailed with poly (C) according to the standard protocol from
the 5' RACE kit. The poly (C) tailed cDNA samples were used for PCR
with Taq DNA polymerase (GIBCO-BRL). The primers for the PCR
reaction were the forward anchor primer (GIBCO-BRL) and rat or
human reverse primers (RatPDE4DR2 (SEQ ID NO: 7) or HuPDE4DR2 (SEQ
ID NO: 10). The product from the PCR reaction was diluted
1000.times. and subjected to a second round of PCR with forward
primer UAP (GIBCO-BRL) and ratPDE4DR3 (SEQ ID NO: 8) or huPDE4DR3
(SEQ ID NO: 11) nested reverse primers. The PCR products were
subcloned using the TA cloning system (Invitrogen) and sequenced.
We have also used the rat total brain Marathonma cDNA (Clontech) as
template for the 5'RACE and isolated the identical novel PDE4D
isoforms.
[0116] Full Length Cloning of Rat and Human PDE4D6
[0117] Reverse transcription and PCR (RT-PCR) were used to isolate
the cDNA encoding the full-length of novel rat and human PDE4D6.
Rat hippocampal CA1 and human hippocampal RNA was used as
templates. The primers used for the reverse transcription were:
2 Rat reverse primer 5'AGGTGTGACAGCCTTTACACTGTTACGT3' SEQ ID NO: 12
Human reverse primer 5'GCACTGTTACGTGTCAGGAGAA3' SEQ ID NO: 13 The
PCR reaction was performed using Pfu DNA polymerase (Strategene)
for 30 cycles using the following primers: Rat forward primer:
RatPDE4DFS 5'-GACACATAATCTATCAAAAATGCCTGAAGC-3' (SEQ ID NO: 14) Rat
reverse primer: RatPDE4DFA 5'GACAGCCTTTACACTGTTACGTGTCAGG3' (SEQ ID
NO: 15) Human forward primer: HuPDE4DFS
5'-TACATATAATCAATCAAAAATGCCTGAAGCAA-3' (SEQ ID NO: 16 Human reverse
primer: HuPDE4DFA 5'CTGTTACGTGTCAGGAGAACGATCA3'. (SEQ ID NO:
17)
[0118] The PCR products were subcloned into the pCR-Blunt II vector
(Invitrogen) and sequenced.
[0119] Northern Blot Analysis
[0120] Rat and human multiple tissue mRNA blots (Clontech) were
prehybridized at 68.degree. C. in buffer containing 6.times.SSC,
5.times. Denhardt's solution (0.5% SDS, 0.2% denatured salmon sperm
DNA, and 50% formamide) for 2 hours. The N-terminal 200 base pairs
of rat and human PDE4D6 cDNA clones were amplified by PCR and used
for probes. This region of the cDNA clone represents the novel
sequence of PDE4D6. The sequences of rat forward and reverse
primers are:
3 5'-TGGAAAGACGGCTGGATGGG-3' (SEQ ID NO: 18)
5'-TGTAGCCCCAAGACACTGACAA-3' (SEQ ID NO: 19)
[0121] respectively.
[0122] The sequences of human forward and reverse primers are:
4 5'-TGGGAAGACGGCTGGATGGG-3' (SEQ ID NO: 20)
5'-ATGTAGCCCCAAGACACTGACAGT-3', (SEQ ID NO: 21)
[0123] respectively.
[0124] The PCR products were subcloned into TA cloning vector
(Invitrogen). Plasmid DNA was linearized with EcoRV and transcribed
with SP6 RNA polymerase and .sup.32P-UTP using standard procedure.
Approximately 10.sup.7 cpm of the .sup.32P-labeled riboprobe was
hybridized with the Northern blot in 10 ml of the prehybridyzation
buffer at 68.degree. C. overnight. After hybridization, the blot
was washed three times, 20 minutes each time, with 1.times.ssc
buffer at 68.degree. C. and then exposed to X-ray film (Kodak).
[0125] Antiserum Production
[0126] Antisera against the novel 15-mer of the invention (for both
rat and human isoforms) can be readily generated. Antisera against
a conserved catalytic domain of the PDE4D family can also be
generated. The peptides were synthesized, conjugated with KLH
protein, and used for production of rabbit polyclonal antiserum
(Research Genetics Inc.).
EXAMPLE 2
[0127] Expression of Rat and Human PDE4D6
[0128] The PCR products from Example 1 were then inserted by
ligation into a Baculovirus expression system (pBlueBacHis2 from
Invitrogen, San Diego, Calif.) in the same way as described above
using standard molecular biology procedures.
[0129] SF9 cells are then co-transfected with the expression
vectors (including the linear AcMNPV DNA (also from Invitrogen).
Subsequent steps of cell culturing, recombinant virus purification
and titration of viruses are performed by standard methods. [See:
O'Reilly, D. R. (1997), Use of Baculovirus Expression Protocols, in
Methods in Molecular Biology, Vol. 62, Humana Press, NJ). Cells are
then grown to a density of about 2 million cells per ml before
infecting with recombinant virus at an MOI of about 5. The cells
are then cultured for at least 3 days.
[0130] The culture media are then pooled and centrifuged to give a
pellet that is washed once with PBS and subsequently resuspended in
lysis buffer (50 mM Tris-HCl, pH 8.5, 10 mM 2-mercaptoethanol, 1 mM
PMSF (phenylmethylsulfonyl chloride) and 1% NP-40) at about 1 ml
per 10 million cells, total of about a billion cells. The cells are
then sonicated and the homogenate centrifuged for 20 minutes at
10.sup.4 g, whereupon the supernatant (containing at least 2 mg of
PDE4D6 protein) is collected and mixed at a ratio of 5:2 (v/v) with
NiNTA resin (Qiagen, Chatsworth, Calif.) (the resin already
equilibrated with equilibration buffer consisting of 20 mM
Tris-HCl, pH 8.0, 500 mM KCl, 20 mM imidazole, 10 mM
2-mercaptoethanol, 10% (v/v) glycerol. The mix is incubated at
4.degree. C. for 30 min with rotation, the resin is packed into a
column).
[0131] The column is washed with the equilibration buffer until
absorption at 280 nm for the eluate is <0.01, then with 2
volumes of wash buffer (20 mM Tris-HCl, pH 8.0, 1 M KCl, 10 mM
imidazole, 10 mM 2-mercaptoethanol, 10% (v/v) glycerol) until
absorbance of the eluate at 280 nm is <0.01.
[0132] The recombinant PDE4D6 is then eluted (at a flow rate of
about 1 ml/min) with eluting buffer (20 mM Tris-HCl, pH 8.5, 100 mM
KCl, 100 mM imidazole, 10 mM 2-mercaptoethanol, 10% (v/v)
glycerol.
[0133] The fractions (1 ml each) are collected for subsequent
analysis. The fractions are assayed for protein using the BioRad
procedure with human serum albumin as standard. In addition,
SDS-polyacrylamide gel electrophoresis was run on the fractions.
The fractions are also assayed using Western blotting and
antibodies already available for PDE4D proteins using C-terminal
oligopeptides (see Wang et al, 1997) (conjugated to KLH for
immunization in rabbits).
[0134] Enzyme activity is assayed by standard procedures
[Amersham's PDE[.sup.3H]cAMP SPA (Scintillation Proximity Assay)
Enzyme Assay kit. Here, the enzyme activity is measured in a
reaction mixture containing 50 mM Tris, pH 7.5, 10 mM MgCl.sub.21 1
mM EDTA, and appropriate concentration of [.sup.3H]cAMP (as
indicated in the kit) to final volume of 100 .mu.L (with varying
samples of enzyme solution (i.e., column fractions). The reaction
mixture containing enzyme is then incubated for 10 minutes at
30.degree. C. in 96-well plates. The reaction is terminated by the
addition of 50 .mu.L of the SPA beads (containing 18 mM
ZnSO.sub.4). The amount of [.sup.3H]cAMP hydrolyzed is measured
using a scintillation counter.
[0135] This assay is also employed for screening potential
modulators of the disclosed cAMP phosphodiesterase by including in
the reaction mixture the appropriate dilutions of a potential
modulator to be screened. Of course, such modulator can be either
an inhibitor or an activator of the phosphodiesterase.
* * * * *