U.S. patent application number 10/643434 was filed with the patent office on 2004-09-16 for transgenic plants expressing a mapkkk protein kinase domain.
Invention is credited to Chiu, Wan-Ling, Kovtun, Yelena V., Sheen, Jen.
Application Number | 20040181829 10/643434 |
Document ID | / |
Family ID | 22254276 |
Filed Date | 2004-09-16 |
United States Patent
Application |
20040181829 |
Kind Code |
A1 |
Sheen, Jen ; et al. |
September 16, 2004 |
Transgenic plants expressing a MAPKKK protein kinase domain
Abstract
The invention features plants including a recombinant transgene
capable of expressing a kinase domain of a mitogen-activated
protein kinase kinase kinase (MAPKKK) or a kinase domain thereof,
wherein the transgene is expressed in said plant under the control
of a promoter that is functional in a plant cell.
Inventors: |
Sheen, Jen; (Boston, MA)
; Kovtun, Yelena V.; (Winchester, MA) ; Chiu,
Wan-Ling; (Richmond, VA) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Family ID: |
22254276 |
Appl. No.: |
10/643434 |
Filed: |
August 19, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10643434 |
Aug 19, 2003 |
|
|
|
09371338 |
Aug 10, 1999 |
|
|
|
6613959 |
|
|
|
|
60095938 |
Aug 10, 1998 |
|
|
|
Current U.S.
Class: |
800/288 ;
435/194; 435/468 |
Current CPC
Class: |
C12N 15/8271 20130101;
C12N 9/1205 20130101; C12N 9/16 20130101; C12N 15/827 20130101;
C12N 15/8294 20130101; C12N 15/8287 20130101; C12N 15/8266
20130101 |
Class at
Publication: |
800/288 ;
435/194; 435/468 |
International
Class: |
A01H 001/00; C12N
015/82; C12N 009/12 |
Claims
What is claimed is:
1. A plant comprising a recombinant transgene capable of expressing
a kinase domain of a mitogen-activated protein kinase kinase kinase
(MAPKKK) or a kinase domain thereof, wherein said transgene is
expressed in said plant under the control of a promoter that is
functional in a plant cell.
2. The plant of claim 1, wherein said transgene comprises a kinase
domain which is obtained from a fungus.
3. The plant of claim 1, wherein said transgene comprises a kinase
domain which is obtained from an animal.
4. The plant of claim 1, wherein said transgene comprises a kinase
domain which is obtained from a plant.
5. The plant of claim 1, wherein said transgene consists
essentially of said kinase domain.
6. The plant of claim 1, wherein said plant is a dicot.
7. The plant of claim 1, wherein said plant is a monocot.
8. A seed from a plant of claim 1.
9. A cell from a plant of claim 1.
10. A vector comprising a promoter functional in plant cells
operably linked to a gene encoding a MAPKKK polypeptide or kinase
domain thereof.
12. The vector of claim 10, wherein said vector comprises a gene
encoding MAPKKK kinase domain.
13. The vector of claim 11, wherein said kinase domain is obtained
from a plant MAPKKK.
14. A cell comprising the vector of claim 10.
15. The cell of claim 14, wherein said cell is a plant cell.
Description
BACKGROUND OF THE INVENTION
[0001] This application is a continuation of 09/371,338 filed Aug.
10, 1999, and claims the benefit of U.S. provisional application
Ser. No. 60/095,938 filed on Aug. 10, 1998.
[0002] This invention relates to the manipulation of plant gene
expression and the production of transgenic plants.
[0003] Auxin is an essential plant hormone that regulates diverse
processes, such as cell division and elongation, root and leaf
development, apical dominance, tropism, and reproduction (Davies,
P. J., In: Plant hormones, ed., Davies, P. J., pp. 1-12, Kluwer,
Dordrecht, Netherlands, 1995. ). The auxin response is regulated by
a complex signaling network, and reflects a balance between auxin
and other synergistical or antagonistical signaling pathways in
plant cells (Bellincampi et al., Plant Cell 8: 477-487, 1996;
Coenen et al., Trends Plant Sci. 2: 351-356, 1997). A primary event
of auxin action is the activation of many early response genes.
Extensive studies of the early response gene promoters have
identified several auxin responsive cis-elements and trans-acting
factors (Abel et al., Plant Physiol. 111: 9-17, 1996; Ulmasov et
al., Science 276: 1865-1868, 1997). Although genetic approaches
have significantly advanced our understanding of auxin action
(Walden et al., Trends Plant Sci. 1: 335-339, 1996; Leyser, Curr.
Biol. 8: R305-R307, 1998; Guilfoyle, Trends Plant Sci. 3: 205-207,
1998), the molecular mechanisms underlying signal transduction
pathways that control auxin responsive transcription remain largely
unknown.
[0004] In yeast, worms, insects, and mammals, the primary responses
to hormone, growth, and stress signals are mediated by a conserved
signaling cascade consisting of three protein kinases, the
mitogen-activated protein kinase (MAPK), mitogen-activated protein
kinase kinase (MAPKK), and mitogen-activated protein kinase kinase
kinase (MAPKKK). MAPKKK phosphorylates and activates MAPKK that, in
turn, phosphorylates and activates MAPK. The activated MAPK can be
translocated into the nucleus where it phosphorylates transcription
factors that control gene expression (Herskowitz, Cell 80: 187-197,
1995; Kyriakis et al., J. Biol. Chem. 271: 24313-24316, 1996).
Although many plant MAPK, MAPKK, and MAPKKK homologues have been
identified based on sequence conservation and functional
complementation in yeast, their precise physiological functions in
plants are largely unknown (Hirt, Trends Biol. Sci. 2: 11-15,
1997). It also remains unclear whether and how these homologues
constitute specific MAPK kinase cascades (Mizoguchi et al., Trends
Biotech. 15: 15-19, 1997).
[0005] Plants are constantly exposed to environmental stimuli that
influence their growth and development. Adverse environmental
conditions, including heat, salinity, freezing, and drought,
greatly compromise plant productivity and reduce crop yield.
Genetic approaches have been taken to enhance plant tolerance to
stresses through alteration of osmolytes, osmoprotectants, membrane
fatty acids, channels, transcription factors, and enzymes that
scavenge active oxygen species by transferring or mutating
individual stress target genes. A need in the art therefore exists
for developing molecular strategies that enable plants to have
resistance or tolerance to adverse environmental conditions.
SUMMARY OF THE INVENTION
[0006] The invention is based on applicants' discovery that a
mitogen-activated protein kinase kinase kinase (MAPKKK)
polypeptide, such as NPK1 of tobacco and the ANPs of Arabidopsis,
is involved in signaling the activation of stress protective gene
transcription, repression of early auxin response gene
transcription, and the alteration of seed development. Accordingly,
the invention involves methods of genetically engineering plants to
produce altered, agronomic, physiological, or developmental changes
in plants by expressing a transgene including DNA encoding a kinase
domain of a MAPKKK within the tissues of the plants. In particular,
it has been found that it is possible to engineer plants that
express a recombinant MAPKKK that are resistant to a broad spectrum
of stresses (e.g., drought, increased salinity, heat shock, and
freezing temperature), that have repressed early auxin gene
expression, or that have altered seed development.
[0007] In one aspect, the invention therefore features a method for
increasing stress resistance or tolerance in a plant. The method,
in general, includes the steps of: (a) introducing into plant cells
a transgene including DNA encoding a kinase domain of a MAPKKK
operably linked to a promoter functional in plant cells to yield
transformed plant cells; and (b) regenerating a transgenic plant
from the transformed cells, wherein the kinase domain of the MAPKKK
is expressed in the cells of the transgenic plant, thereby
increasing the level of stress resistance or tolerance in the
transgenic plant. In preferred embodiments, the expression of the
DNA encoding the kinase domain activates the expression of a
stress-inducible gene (e.g., a gene encoding a glutathione
S-transferase, an asparagine synthetase, or a heat shock protein).
In particular applications, the method is especially useful for
providing to a plant resistance or tolerance to an environmental
stress. Exemplary environmental stresses include, without
limitation, those which occur upon exposure of the transgenic plant
to limited or inadequate water availability (e.g., drought
conditions), excess salt or osmotic conditions, excess temperature
conditions (e.g., heat, cold, or frost), excess light, a pathogen,
a chemical (e.g. a metal, herbicides, and pollutants), an oxidative
stress, UV light, and wounding. In preferred embodiments, the plant
is protected against-multiple stress conditions.
[0008] In another aspect, the invention features a method for
reducing the action of an auxin in a plant. The method includes the
steps of: (a) introducing into plant cells a transgene including
DNA encoding a kinase domain of a MAPKKK operably linked to a
promoter functional in plant cells to yield transformed plant
cells; and (b) regenerating a transgenic plant from the transformed
cells, wherein the kinase domain of the MAPKKK is expressed in the
cells of the transgenic plant, thereby reducing the action of the
auxin in the transgenic plant. In preferred embodiments, the
expression of the DNA encoding the kinase domain represses the
expression of an early-auxin gene (e.g., those which are under the
control of a promoter which is substantially identical to the GH3
promoter or a promoter which includes the ER7 element).
[0009] In still another aspect, the invention features a method for
altering seed development. In particular, the method includes the
steps of: (a) introducing into plant cells a transgene including
DNA encoding a kinase domain of a MAPKKK operably linked to a
promoter functional in plant cells to yield transformed plant
cells; and (b) regenerating a transgenic plant from the transformed
cells, wherein the kinase domain of the MAPKKK is expressed in the
cells of the transgenic plant, thereby altering the development of
a seed in the transgenic plant. In preferred embodiments, the
expression of the DNA encoding the kinase domain enriches endosperm
development, enriches embryo development, or attenuates seed
development. In yet other preferred embodiments, the attenuation of
the seed development results in a seedless plant (e.g., a seedless
fruit or vegetable).
[0010] In yet another aspect, the invention features a method for
increasing the yield or productivity of a transgenic plant. The
method generally includes the steps of: (a) introducing into plant
cells a transgene including DNA encoding a kinase domain of a
MAPKKK operably linked to a promoter functional in plant cells to
yield transformed plant cells; and (b) regenerating a transgenic
plant from the transformed cells, wherein the kinase domain of the
MAPKKK is expressed in the cells of the transgenic plant, thereby
increasing the yield of the transgenic plant.
[0011] In related aspects of the invention, the invention features
a plant (or plant cell, plant tissue, plant organ, or plant
component) including a recombinant transgene capable of expressing
a kinase domain of a MAPKKK, wherein the transgene is expressed in
the transgenic plant under the control of a promoter that is
functional in a plant cell. In preferred embodiments, the transgene
includes a kinase domain which is obtained from a plant. In yet
other preferred embodiments, the invention features a kinase domain
which is obtained from a fungus (e.g., a yeast) or an animal (e.g.,
a mammal). In still other preferred embodiments, the transgene
consists essentially of the kinase domain.
[0012] In related aspects, the invention features seeds and cells
from a plant which include a recombinant transgene capable of
expressing a kinase domain of a MAPKKK.
[0013] In still other related aspects, the invention features a
vector (e.g., an expression vector) including a promoter functional
in plant cells operably linked to a gene encoding a MAPKKK
polypeptide and a cell (e.g., a plant cell or a prokaryotic cell
such as Agrobacterium) that includes the vector. In preferred
embodiments, the gene encodes a polypeptide that consists
essentially of a kinase domain of a MAPKKK (e.g., a kinase domain
from a plant MAPKKK such as NPK1 or an ANP) or a genetically
engineered chimeric polypeptide that includes such a kinase
domain.
[0014] In general, the kinase domain used in the methods or plants
(e.g., transgenic plants or plants that are bred using a transgenic
plant) of the invention is generally expressed by itself, as a
MAPKKK polypeptide or kinase domain-containing fragment thereof, or
as part of a genetically engineered chimeric polypeptide. Useful
kinase domains include those that are capable of activating a gene
involved in a stress response, repressing early auxin gene
expression, or altering seed development. Exemplary kinase domains
include, without limitation, those that are substantially identical
to the kinase domains of NPK1 or an ANP (e.g., ANP1, ANP2, or ANP3)
or AtMEKK1. Preferably, the methods and plants of the invention
specifically utilize the kinase domain of NPK1 or ANP1. In other
preferred embodiments, a full-length MAPKKK polypeptide or a kinase
domain-containing fragment thereof that is substantially identical
to any one of NPK1, ANP1, ANP2, or ANP3 is utilized.
[0015] The DNA encoding the kinase domain is, in general,
constitutively expressed. However, if desired, the kinase domain is
inducibly expressed, or such a domain is expressed in a
cell-specific, tissue-specific, or organ-specific manner. Moreover,
the kinase domain can also be expressed under cycling conditions
(e.g., cell cycle or circadian conditions).
[0016] Exemplary plants which are useful in the methods of the
invention, as well as for generating the transgenic plants (or
plant cells, plant components, plant tissues, or plant organs) of
the invention, include dicots and monocots, such as sugar cane,
wheat, rice, maize, sugar beet, barley, manioc, crucifer, mustard,
potato, soybean, sorghum, cassava, banana, grape, oats, tomato,
millet, coconut, orange, rye, cabbage, apple, eggplant, watermelon,
canola, cotton, carrot, garlic, onion, pepper, strawberry, yam,
papaya, peanut, onion, legume, bean, pea, mango, and sunflower.
[0017] By "polypeptide" is meant any chain of amino acids,
regardless of length or post-translational modification (for
example, glycosylation or phosphorylation).
[0018] By "substantially identical" is meant a polypeptide or
nucleic acid exhibiting at least 40%, preferably 50%, more
preferably 80%, and most preferably 90%, or even 95% sequence
identity to a reference sequence (for example, the amino acid
sequences of the kinase domains or full-length MAPKKK polypeptides
of NPK1, ANP1, ANP2, or ANP3 or to their respective nucleic acid
sequences (FIGS. 11, 12, 13, 14, 15, and 16; SEQ ID NOS: 7-22). For
polypeptides, the length of comparison sequences will generally be
at least 16 amino acids, preferably at least 20 amino acids, more
preferably at least 25 amino acids, and most preferably 35 amino
acids or greater. For nucleic acids, the length of comparison
sequences will generally be at least 50 nucleotides, preferably at
least 60 nucleotides, more preferably at least 75 nucleotides, and
most preferably 110 nucleotides or greater.
[0019] Sequence identity is typically measured using sequence
analysis software (for example, Sequence Analysis Software Package
of the Genetics Computer Group, University of Wisconsin
Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705,
BLAST, FastA, or PILEUP/PRETTYBOX programs). Such software matches
identical or similar sequences by assigning degrees of homology to
various substitutions, deletions, and/or other modifications.
Conservative substitutions typically include substitutions within
the following groups: glycine alanine; valine, isoleucine, leucine;
aspartic acid, glutamic acid, asparagine, glutamine; serine,
threonine; lysine, arginine; and phenylalanine, tyrosine.
[0020] By "obtained from" is meant isolated from or having the
sequence of a naturally-occurring sequence (e.g., a cDNA, genomic
DNA, synthetic DNA, or combination thereof).
[0021] By "recombinant" is meant a nucleic acid (e.g., DNA) that,
is free of the genes which, in the naturally-occurring genome of
the organism from which the nucleic acid of the invention is
derived, flank the gene. The term therefore includes, for example,
a gene or fragment thereof that is incorporated into a vector; into
an autonomously replicating plasmid or virus; or into the genomic
DNA of a prokaryote or eukaryote; or that exists as a separate
molecule (for example, a cDNA or a genomic or cDNA fragment
produced by PCR or restriction endonuclease digestion) independent
of other sequences. It also includes a nucleic acid which is part
of a hybrid gene encoding additional polypeptide sequence.
[0022] By "transformed cell" is meant a cell into which (or into an
ancestor of which) has been introduced, by means of recombinant DNA
techniques, a DNA molecule encoding (as used herein) a MAPKKK
kinase domain (e.g., NPK1, ANP1, ANP2, or ANP3).
[0023] By "reporter gene" is meant a gene whose expression may be
assayed; such genes include, without limitation,
.beta.-glucuronidase (GUS), luciferase (LUC), chloramphenicol
transacetylase (CAT), green fluorescent protein (GFP), and
.beta.-galactosidase.
[0024] By "a promoter functional in a plant cell" is meant any
minimal sequence sufficient to direct transcription in a plant
cell. Included in the invention are promoter elements that are
sufficient to render promoter-dependent gene expression
controllable for cell-, tissue-, or organ-specific gene expression,
or elements that are inducible by external signals or agents (for
example, light-, pathogen-, wound-, stress-, or hormone-inducible
elements or chemical inducers) or elements that are capable of
cycling gene transcription; such elements may be located in the 5'
or 3' regions of the native gene or engineered into a transgene
construct.
[0025] By "operably linked" is meant that a gene and a regulatory
sequence(s) are connected in such a way as to permit gene
expression when the appropriate molecules (for example,
transcriptional activator proteins) are bound to the regulatory
sequence(s).
[0026] By "plant cell" is meant any self-propagating cell bounded
by a semi-permeable membrane and containing a plastid. Such a cell
also requires a cell wall if further propagation is desired. Plant
cell, as used herein, includes, without limitation, algae,
cyanobacteria, seeds, suspension cultures, embryos, meristematic
regions, callus tissue, leaves, roots, shoots, gametophytes,
sporophytes, pollen, and microspores.
[0027] By "transgene" is meant any piece of DNA which is inserted
by artifice into a cell, and becomes part of the genome of the
organism which develops from that cell. Such a transgene may
include a gene which is partly or entirely heterologous (i.e.,
foreign) to the transgenic organism, or may represent a gene
homologous to an endogenous gene of the organism.
[0028] By "transgenic" is meant any cell which includes a nucleic
acid sequence (e.g., a recombinant DNA sequence) which is inserted
by artifice into a cell and becomes part of the genome of the
organism which develops from that cell. As used-herein, the
transgenic organisms are generally transgenic plants and the DNA
(transgene) is inserted by artifice into the nuclear or plastidic
genome.
[0029] By "increasing stress resistance or tolerance" is meant
mediating a level of endurance, adaptability, or durability to a
stress (e.g., a man-made stress, such as pollution, or an
environmental stress, such as drought, salinity, and oxidative and
temperature stresses) in a transgenic plant which is greater than
that exhibited by a control plant (for example, a non-transgenic
plant). Preferably, the level of stress resistance or tolerance in
a transgenic plant (or transformed plant cell, plant component,
plant tissue, or plant organ) of the invention is at least 5%, 10%,
or 20% (and preferably 30% or 40%) greater than the tolerance to a
stress exhibited in a non-transgenic control plant (or control
plant cell, plant component, plant tissue, or plant organ). In
other preferred embodiments, the level of stress resistance or
tolerance to a stress is 50% greater, 60% greater, and more
preferably even 75% or 90% greater than a control plant, with up to
100% above the level of tolerance as compared to a control plant
being most preferred. The level of stress resistance or tolerance
is measured by conventional methods used to determine plant growth
and response to stress. For example, the level of stress tolerance
to salinity may be determined by comparing physical features and
characteristics (for example, plant height and weight, leaf area,
plant water relations, ability to flower, ability to generate
seeds, and yield/productivity) of transgenic plants and
non-transgenic control plants.
[0030] The invention provides a number of important advances and
advantages for the protection of plants against environmental
stress, such as drought, salt, oxidative damage, and temperature.
In addition, the invention provides a means for blocking
auxin-inducible gene expression and its concomitant responses
affecting plant growth and development. Furthermore, the invention
is useful for altering seed development (e.g., for the production
of seedless fruits or vegetables), as well as for manipulating
endosperm or embryo development. Furthermore, the methods of the
invention are advantageous because a kinase domain of MAPKKK is
relatively unstable which allows for convenient transgene
manipulation, thereby avoiding undesirable side effects
[0031] Moreover, the invention facilitates an effective and
economical means to improve agronomically important traits of
plants for tolerating the effects of dehydration, salinity, cold,
and heat. The invention provides for increased production
efficiency, as well as for improvements in quality and yield of
crop plants and ornamentals. Thus, the invention contributes to the
production of high quality and high yield agricultural products;
for example, fruits, ornamentals, vegetables, cereals, and field
crops. Genetically-improved seeds and other plant products that are
produced using plants expressing the genes and methods described
herein also render farming possible in areas previously unsuitable
for agricultural production. The invention further provides a means
for mediating the expression of stress-related protective proteins
(e.g., glutathione S-transferase, asparagine synthetase, or a heat
shock protein) that enable a plant to tolerate the effects of
environmental stress. For example, transgenic plants constitutively
expressing a kinase domain of a MAPKKK are capable of turning on a
plant's stress signal transduction pathway by activating the
expression of multiple stress-related proteins, which, in turn,
enhances the plant's tolerance to multiple stress conditions.
Expression of these gene products therefore obviates the need to
express individual stress-related genes as a means to promote plant
defense mechanisms against adverse environmental conditions.
[0032] Other features and advantages of the invention will be
apparent from the following description of the preferred
embodiments thereof, and from the claims.
DETAILED DESCRIPTION
[0033] The drawings will first be described.
DRAWINGS
[0034] FIG. 1A is a panel of photomicrographs showing auxin
responses in maize protoplasts. The protoplasts were transfected
with plasmid DNA carrying either the "GH3-sGFP" or "CAB5-sGFP"
auxin-response reporter construct and incubated without or with
auxin. Protoplasts expressing GFP were bright green under UV light.
Untransfected and uninduced protoplasts showed only blue and pink
autofluorescence.
[0035] FIG. 1B is a histogram showing that the GH3 promoter and the
ER7 auxin responsive element are regulated in maize protoplasts.
The protoplasts were transfected with plasmid DNA carrying GH3-GUS
(designated "GH3"), ER7-GUS (designated "ER7"), mutated ER7-GUS
(designated "mER7"), or a GUS construct under the transcriptional
control of the CaMV 35S minimal (-72) promoter (designated
"35Smin"). A construct carrying the maize CAB5 promoter (Ulmasov et
al., Science 276: 1865-1868, 1997) fused to the luciferase gene
(designated "CAB-LUC") was used as an internal control in each
transfection. The protoplasts were incubated without or with auxin.
In each treatment the GUS activity of the cell lysate was divided
by the LUC activity, thereby normalizing the data for variation in
experimental conditions (that is, number of cells, transformation
efficiency, and cell viability). Because of differences in the
basal level of expression, GUS/LUC activity of the protoplasts
transfected with each construct and incubated without auxin was set
to 1. The results shown were the means of triplicate samples.+-.SD.
All experiments were repeated two to three times with similar
results.
[0036] FIG. 2A is a photograph of an autoradiogram showing the
expression of different protein kinases in maize protoplasts.
[0037] FIG. 2B is a photograph of an autoradiogram showing the
phosphorylation activity of different protein kinases.
[0038] FIG. 2C is a photomicrograph showing that constitutively
active NPK1 represses the auxin-inducible GH3 promoter. Maize
protophasts were co-transfected with the GH3-sGFP reporter and an
effector construct carrying various protein kinases as indicated or
vector DNA (control), and incubated with auxin to induce the GH3
promoter.
[0039] FIG. 2D is a histogram showing that constitutively active
NPK1 represses auxin responsive promoters. Maize protoplasts were
co-transfected with GH3-GUS (designated "GH3") or ER7-GUS
(designated "ER7") reporter and an effector construct carrying the
wild-type (designated "NPK1") or mutated (designated "NPK1mut")
kinase domain of NPK1, or vector mutated DNA (designated
"control"), and incubated with auxin. A CAB-LUC construct was used
as an internal control in each transfection to normalize the GUS
activity. The GUS/LUC activity of the control protoplasts induced
by auxin was set to 100%. The results shown were the means of
triplicate samples.+-.SD.
[0040] FIG. 2E is a panel showing a photograph of the expression
levels of NPK protein and the null mutation of NPK1 at various
times during heat shock (upper panel) and a histogram showing the
activation of the GH3 promoter in the presence or absence or auxin
(lower panel). The wild-type (NPK1) or mutated (NPK1mut) kinase
domain of NPK1 was fused to a DHA tag (Sheen, Science 274:
1900-1902, 1996) and inserted into a plant expression vector with a
heat shock inducible promoter (designated "HSP") (Sheen et al.,
Plant J. 8: 777-784, 1995). Protoplasts were co-transfected with
the GH3-GUS reporter and HSP-NPK1 or HSP-NPK1mut effector. CAB-LUC
was used as an internal control in each co-transfection to
normalize the GUS activity. The expression of the NPK1 or NPK1mut
protein was induced at 40.degree. C. for 10, 20, or 60 minutes. The
protoplasts from each treatment were divided equally for protein
labeling and immunoprecipitation, and for incubation without or
with auxin to measure GUS/LUC activity. The GUS/LUC activity of the
transfected protoplasts incubated with auxin without heat shock was
set to 100%. The results shown were the means of triplicate
samples.+-.SD. All experiments were repeated three times with
similar results.
[0041] FIG. 3A is a schematic diagram showing different NPK1
constructs. The constructs carry the coding region of (1) kinase
domain only, (2) NH.sub.2-terminus and kinase domain, (3) kinase
domain and COOH-terminus, and (4) full-length NPK1 protein.
[0042] FIG. 3B is a photograph of an analysis showing the levels of
protein expression of the NPK1 constructs (1, 2, 3, and 4) in maize
protoplasts.
[0043] FIG. 3C is a histogram showing the effect of various NPK1s
on the GH3 promoter activity. Maize protoplasts were co-transfected
with the GH3-GUS reporter construct and one of the NPK1 constructs
(1, 2, 3 or 4) shown in FIG. 3A or vector DNA (control). CAB-LUC
was used as an internal control in each transfection to normalize
the GUS activity. The GUS/LUC activity of the control protoplasts
in the presence of auxin was set to 100%. The results shown were
the means of triplicate samples.+-.SD. All experiments were
repeated three times with similar results.
[0044] FIG. 4A is a panel showing the results of a MAPK in-gel
assay (upper panel) and a histogram showing kinase activity (lower
panel) of maize protoplasts expressing different MAPKKKs.
Protoplasts were transfected with (1) vector DNA for background
control; (2) NPK1 kinase domain construct; (3) NPK1 kinase domain
mutant construct; (4) full-length NPK1 construct; and (5) CTR1
kinase domain construct. The radioactivity of the 44 kDa putative
MAPK band was quantified using a Phosphorimager and normalized to
the signal from the background control.
[0045] FIG. 4B is a photograph of a gel electrophoretic analysis
showing the activity of anti-MAPK immunoprecipitated proteins.
Protoplasts were transfected with (1) vector DNA for background
control; (2) NPK1 kinase domain construct; and (3) NPK1 kinase
domain mutant construct.
[0046] FIG. 4C is a panel of gel electrophoretic analyses showing
that MAPK phosphatase (MKP1) inactivates NPK1-induced MAPK.
Protoplasts were co-transfected with NPK1 and various protein
phosphatase (PP) constructs. The transfected protoplasts were
divided to determine protein expression level (upper panel), and to
perform the kinase in-gel assay (lower panel).
[0047] FIG. 4D is a panel of photomicrographs of maize protoplasts
showing that MKP1 abolishes the NPK1 repression of the
auxin-inducible transcription. Protoplasts were co-transfected with
the GH3-sGFP reporter and NPK1, NPK1+MKP1, NPK1+PP1, NPK1+PP2A, or
NPK1+PP2C, and incubated in a medium with auxin. All experiments
were repeated two to three times with similar results.
[0048] FIG. 5A is a histogram showing the H.sub.2O.sub.2, heat
shock, and ABA responses in designated Arabidopsis protoplasts.
Protoplasts were transfected with GST6-LUC (designated "GST6"),
USP18.2-LUC (designated "HSP18.2"), or RD29A-LUC (designated
"RD29A") reporter constructs. The transfected protoplasts were
divided (10.sup.5 per sample) and incubated at 23.degree. C.
without (-) or with (+) 200 .mu.M of H.sub.2O.sub.2, 38.degree. C.
(heat), or 100 .mu.M ABA for 3 hours. The CaMV35S-GUS reporter
construct was used as an internal control in each transfection to
normalize data for differences in transfection efficiency and cell
viability. LUC/GUS was measured as an indicator of the promoter
activities. The induction of the HSP18.2 promoter was about 1000
fold, due to extremely low basal expression level. Data are the
results of triplicate samples and three independent
experiments.
[0049] FIG. 5B is a histogram showing that H.sub.2O.sub.2 and heat
shock suppress the auxin responsive GH3 promoter. Arabidopsis
protoplasts were transfected with the GH3-GUS reporter construct,
divided (10.sup.5 protoplasts per sample), and incubated in the
absence (-auxin) or presence of 1 .mu.M NAA (+auxin) and 200 .mu.M
of H.sub.2O.sub.2, or 100 .mu.M ABA at room temperature or at
38.degree. C. (heat) for 3 hours. CaMV35S-LUC reporter construct
was used as an internal control. GUS/LUC was measured as an
indicator of GH3 promoter activity. Data are the results of
triplicate samples and three independent experiments. Similar
results were obtained when GH3-LUC reporter was used.
[0050] FIG. 6A is a photograph of an autoradiogram showing the
expression of the ANP kinases. Arabidopsis protoplasts were
transfected with an effector construct expressing one of the
HA-tagged protein kinases: kinase domain of ANP1 (designated
".DELTA.ANP1"), kinase domain of ANP2 (designated ".DELTA.ANP2"),
kinase domain of ANP3 (designated ".DELTA.ANP3"), kinase domain of
ANP1 mutated in the ATP binding site (designated ".DELTA.ANP1m"),
and full-length ANP1 (ANP1). The transfected protoplasts were
incubated in the presence of [.sup.35S]-methionine for 4 hours to
allow expression and labeling of the effector proteins. The
HA-tagged kinases were immunoprecipitated, separated by SDS-PAGE,
and detected.
[0051] FIG. 6B is a photograph of an autoradiogram showing that
ANPs activate two endogenous MAPKs in Arabidopsis. Arabidopsis
protoplasts were transfected with the ANP constructs described in
FIG. 6A or with a vector (control) and incubated for 4 hours to
allow expression. Activity of endogenous MAPKs in the transfected
cells was detected by an in-gel assay using myelin basic protein
(MBP) as a substrate.
[0052] FIG. 6C is a photograph of an autoradiogram showing that
ANP1 induced AtMPK3 and AtMPK6 in vivo. Arabidopsis protoplasts
were transfected with constructs expressing one of the HA-tagged
Arabidopsis MAPKs (designated "AtMPK2 to 7") alone, or
co-transfected with another construct expressing HA-tagged ANP1
kinase domain (designated ".DELTA.ANP1"). The transfected cells
were divided (10.sup.5 each) to detect protein levels (upper panel)
or to assay the MAPK activity after immunoprecipitation by using
MBP as a substrate (lower panel). Stars indicate non-specific bands
seen after immunoprecipitation.
[0053] FIG. 6D is a photograph of an autoradiogram showing that
stresses activate AtMPK3 and ANP1. Arabidopsis protoplasts were
transfected with AtMPK3 construct alone or co-transfected with
full-length ANP1 (designated "AtMPK3+ANP1") or active ANP1
(designated "AtMPK3+.DELTA.ANP1"). Cells were incubated for 4 hours
to allow protein expression. The protoplasts (10.sup.5 each) were
treated with 200 .mu.M of H.sub.2O.sub.2, 38.degree. C. (designated
"heat"), 4.degree. C. (designated "cold"), 1 .mu.M NAA (designated
"auxin"), or 100 .mu.M ABA for 15 minutes The AtMPK3 was
immunoprecipitated using an anti-HA antibody and assayed for
activity by using MBP as a substrate. All data presented in the
figure were repeated at least three times with similar results.
[0054] FIG. 7A is a histogram showing the response of different
dicot promoters to the constitutive expression of the ANP1 kinase
domain in Arabidopsis protoplasts. Protoplasts were co-transfected
with either the NR2-LUC (designated "NR2"), AS 1-LUC (designated
"AS1"), RD29A-LUC (designated "RD29A), HSP-LUC (designated "HSP"),
CAB2-LUC (designated "Cab2"), CHSP-LUC (designated "CHSP"), or
GST6-LUC (designated "GST6") reporter gene constructs and an
effector construct carrying the wild-type (kANP1) kinase domain,
mutated (NPK1mut) kinase domain of NPK1, or the kinase domain of
CTR1 (designated "kCTR1"). A 35S NPKmut-GUS construct was used as
an internal control in each transfection to normalize the LUC
activity. The LUC/GUS activity of the NPK1mut was set to 1. The
results shown were the means of triplicate samples.+-.SD.
[0055] FIG. 7B is a histogram showing that ANP1 activates
stress-inducible promoters. Arabidopsis protoplasts were
co-transfected with one of the reporter constructs: GST6-LUC
(designated "GST6"), HSP18.2-LUC (designated "HSP18.2"), or
RD29A-LUC (designated "RD29A") and one of the effector constructs
as described in FIG. 6A, kinase domain of CTR1 (desingated
".DELTA.CTR1"), kinase domain of ASK1 (designated ".DELTA.ASK1"),
full-length CK1-1 (designated "CK1-1"), or a vector ("control").
The CaMV35S-GUS reporter construct was used as an internal control.
Transfected cells were incubated for 6 hours before LUC/GUS was
measured as an indicator of the promoter activity. Data are the
results of triplicate samples and three independent
experiments.
[0056] FIG. 7C is a histogram showing that ANPs repress the auxin
response. Arabidopsis protoplasts were co-transfected with the
GH3-GUS reporter construct and one of the effector constructs as
described in FIG. 6A, kinase domain of CTR1 (designated
".DELTA.CTR1"), kinase domain of ASK1 (designated ".DELTA.ASK1"),
full-length CK1-1 (designated "CK1-1"), or a vector (designated
"control"). The CaMV35S-LUC reporter construct was used as an
internal control. The transfected protoplasts were incubated for 3
hours to allow effector expression before the induction by 1 .mu.M
NAA for 3 hours. GUS/LUC was measured as an indicator of the GH3
promoter activity. Data are the results of triplicate samples and
three independent experiments.
[0057] FIG. 8A is a histogram showing the seed germination
frequencies of different transgenic lines of tobacco expressing
NPK1. Wild-type (wt) and three independent transgenic lines (2A,
3B, 4A) were examined. The results shown are the means of
triplicate samples, 100 seeds each, .+-.SD.
[0058] FIG. 8B is a panel of photomicrographs showing the
morphological analysis of wild-type and line 4A transgenic seeds.
The wild type (upper panel, labeled 1, 2, 3, and 4) and 4A (lower
panel, labeled 5, 6, 7, and 8) seeds were soaked for 24 hours in
water. The seeds are shown as a population (1,5), typical single
seed (2,6), dissected (3,7), and used for the embryo isolation
(4,8). The wild type (3), but not the transgenic (7) seeds, showed
abundant endosperm, noticeable after the dissection. At least 10
seeds from each population were analyzed in this study.
[0059] FIG. 8C is a photograph of an RNA blot analysis of the NPK1
transgene expression in wild-type and transgenic tobacco. RNA was
isolated from two week-old seedlings. The NPK1 probe hybridized
with the transgene RNA only. The endogenous NPK1 mRNA was not
detected. Ubiqutin (designated "UBQ") expression was used as a
control.
[0060] FIG. 8D is a photograph of a protein blot analysis of
transgene expression. The same amount of proteins (50 mg per lane),
extracted from two week-old seedlings, were fractionated in the 12%
SDS-PAGE gel and blotted. HA antibody was used to detect HA-tagged
transgene proteins. A tobacco transgenic line overexpressing a
HA-tagged MEK protein (MEK) was used as a positive control.
[0061] FIG. 9 is a photograph showing the drought resistance of
transgenic tobacco plants expressing the NPK1 transgene. Wild type
tobacco seedlings are shown on the left; seedlings of transgenic
tobacco, line NPK1-A4, are shown on the right.
[0062] FIG. 10A is a photograph showing the stress tolerance of
transgenic tobacco plants expressing NPK1. Wild type (WT) and
transgenic (2A, 3B, 4A) plants were germinated and grown on a 1/4
MS medium for 3 weeks.
[0063] FIG. 10B is a photograph showing the tolerance of transgenic
tobacco plants expressing NPK1 to freezing temperature. Wild type
(WT) and the transgenic (2A, 3B, 4A) plants were grown on plates
for 10 days before freezing termperature treatment (-10.degree. C.,
3 hours). The photograph was taken 11 days after treatment.
[0064] FIG. 10C is a photograph showing salt stress tolerance of
transgenic tobacco plants expressing NPK1. Wild type (WT) and
transgenic plants (2A, 3B, 4A) were germinated on 1/4 MS medium for
6 days, and then transferred to plates containing 300 mM of NaCl
for 3 days. The photograph was taken 11 days after the plants were
transferred back to the MS plates without NaCl. The graph
represents data from five plates (each plate had 10 plants of each
genotype).
[0065] FIG. 10D is a photograph showing the tolerance of transgenic
tobacco plants expressing NPK1 to heat shock. Wild type (WT) and
transgenic (2A, 3B, 4A) plants were grown on plates for 10 days
before heat treatment (48.degree. C., 45 minutes). The photograph
was taken 18 days after treatment. The graph represents the data
from five plates (each plate had 10 plants of each genotype).
[0066] FIG. 11 is a diagram showing the alignment of the predicted
amino acid sequences of the MAPKKKs: ANP1L, ANP1S, ANP2, ANP3, and
NPK1. Kinase domains of these proteins are double-underlined, and
are about 268 amino acids in length. Residues that are conserved in
three out of the four proteins except (ANP1S) are shown in white
letters on a black background. Short conserved stretches (regions
A-E) in the four proteins are underlined. Asterisks indicate the
consensus sites of phosphorylation by Cdc2 kinase. Only the most
carboxy-terminal five amino acid residues of ANP1S that differ from
the amino-acid sequence of ANP1L are shown above it (Nishihama et
al., Plant J. 12:39-48, 1997).
[0067] FIG. 12 shows the amino acid sequence and corresponding
nucleotide sequence of ANP1 (SEQ ID NOS: 7 and 8).
[0068] FIG. 13 shows the amino acid sequence and corresponding
nucleotide sequence of ANP2 (SEQ ID NOS: 11 and 12).
[0069] FIG. 14 shows the amino acid sequence and corresponding
nucleotide sequence of ANP3 (SEQ ID NOS: 15 and 16).
[0070] FIG. 15 shows the amino acid sequence and corresponding
nucleotide sequence of NPK1 (SEQ ID NOS: 19 and 20). FIG. 16 shows
the amino acid sequences of the kinase domains of ANP1 (SEQ ID NO:
9), ANP2 (SEQ ID NO: 13), ANP3 (SEQ ID NO: 15), and NPK1 (SEQ ID
NO: 21), as well as their corresponding nucleotide sequences (SEQ
ID NOS: 10, 14, 16, 22, respectively).
OVERVIEW
[0071] As is discussed above, the plant hormone auxin is known to
activate many early response genes that are likely responsible for
diverse aspects of plant growth and development (Davies, P. J., In:
Plant hormones, ed., Davies, P. J., pp. 1-12, Kluwer, Dordrecht,
Netherlands, 1995; Abel et al., Plant Physiol. 111: 9-17, 1996;
Walden et al., Trends Plant Sci. 1: 335-339, 1996). Here we present
surprising evidence that a plant MAPK kinase kinase (MPKKK), NPK1
(Banno et al., Mol. Cell Biol. 13: 4745-4752. 1993), which
possesses similar structure to the mammalian TAK1 (Yamaguchi et
al., Science 270: 2008-2011, 1995) and fly PK92B (Wassarman et al.,
Gene 169: 283-284, 1996), activates a MAPK cascade that leads to
the repression of early auxin response gene transcription. In
addition, we show that a mutation in the kinase domain abolished
NPK1 activity, and the presence of the COOH-terminal domain
diminished the kinase activity. Moreover, the NPK1 effects on the
activation of a MAPK and the repression of early auxin response
transcription were specifically eliminated by a MAPK phosphatase
(Sun et al., Cell 75: 487-493, 1993). We also found that transgenic
tobacco plants overexpressing constitutively active NPK1 produced
seeds defective in embryo and endosperm development. These results
indicated that auxin sensitivity could be balanced by
antagonistical signaling pathways (Bellincampi et al., Plant Cell
8: 477-487, 1996; Coenen et al., Trends Plant Sci. 2: 351-356,
1997) that employ a distinct MAPK cascade in higher plants.
[0072] In addition, we provide results showing that constitutively
active ANP kinase domains (e.g., ANP1, ANP2, and ANP3) induced the
expression of a number of plant stress-inducible gene promoters.
Moreover, we provide evidence that transgenic tobacco plants having
constitutively active NPK1 produced seedlings that were
drought-resistant, as well as resistant to the effects of salt.
Such plants were also found to be resistant to other stresses such
as heat shock and freezing temperatures.
[0073] The examples provided below are for the purpose of
illustrating the invention, and should not be construed as
limiting.
[0074] Auxin Responses in Maize Protoplasts
[0075] A transient expression system using freshly isolated maize
mesophyll protoplasts has been developed to elucidate the molecular
mechanisms of intracellular signal transduction and gene expression
in higher plants (Sheen, Plant Cell 2: 1027-1038, 1990). This
system has been used successfully to study signal transduction
pathways stimulated by sugars, light, and the plant hormone
abscisic acid (Sheen, EMBO J. 12: 3497-3505, 1993; Jang et al.,
Plant Cell 6: 1665-1679, 1994; Sheen, Science 274: 1900-1902, 1996;
Sheen, Proc. Natl. Acad. Sci. USA 95: 975-980, 1998). To determine
whether this system is suitable for the investigation of auxin
signaling, we have tested the auxin inducibility of a
well-characterized early response gene promoter, GH3 (Hagen et al.
Plant Mol. Biol. 17: 567-579, 1991),in maize mesophyll protoplasts.
Maize protoplasts transfected with a construct carrying the coding
region of a synthetic green-fluorescent protein (sGFP) (Chiu et
al., Curr. Biol. 6: 325-330, 1996) driven by the GH3 promoter
("GH3-sGFP") showed bright fluorescence upon induction with
different active auxin forms, NAA (FIG. 1A) or IAA (data not shown)
at 1 mM, a physiologically relevant concentration. In contrast, we
observed that auxin did not affect the expression of a GFP
construct ("CAB-sGFP") that was controlled by the maize chlorophyll
a/b binding protein gene promoter (CAB5) (Sheen, Supra 2:
1027-1038, 1990) (FIG. 1A).
[0076] To confirm the auxin inducibility of the GH3 promoter, we
also tested the effect of auxin on the promoter fused to another
reporter gene encoding the E. coli .beta.-glucuronidase (GUS) in
transfected maize protoplasts. The results from these experiments
showed that GUS activity that was controlled by the GH3 promoter
was also induced by auxin (FIG. 1B), although the GUS reporter gene
generated higher background than the GFP reporter gene in maize
cells.
[0077] To support the idea that the early auxin responses are
conserved in higher plants, we tested an auxin responsive DNA
element, ER7 (Ulmasov et al., Science 276: 1865-1868, 1997), which
has been found in the majority of early auxin response gene
promoters (Abel et al., Plant Physiol. 111: 9-17, 1996; Ulmasov et
al., supra, 1997). A complementary pair of synthetic
oligonucleotides containing the ER7 element was fused upstream of
the GUS gene driven by a 35S minimal promoter. This ER7-GUS
construct showed auxin inducibility in maize protoplasts, whereas
the 35S minimal promoter was found not to be induced by auxin (FIG.
1B). Moreover, when the ER7 element was mutated, it lost its auxin
inducibility completely (FIG. 1B), as previously shown in
transfected carrot protoplasts (Ulmasov et al., supra, 1997). These
data clearly demonstrated that maize mesophyll protoplasts
responded to physiological levels of auxin and that the early auxin
responses are likely conserved in monocot and dicot plants.
[0078] Constitutively Active NPK1 Represses Auxin-Inducible
Promoters
[0079] To determine whether NPK1 (Banno et al., supra) is involved
in auxin signal transduction, we tested the effect of a
constitutively active NPK1 on the activity of the GH3 promoter. It
has been shown that MAPKKKs consist of a well-conserved kinase
domain and putative regulatory domains. Truncated or naturally
occurring MAPKKKs carrying only the kinase domain have been shown
to have constitutive kinase activity (Banno, supra; Nishihama et
al., Plant J. 12: 39-48, 1997). The structure of NPK1 is unique as
a MAPKKK with the kinase domain located at the NH.sub.2-terminus. A
similar structure has also been found in the mammalian TAK1
involved in TGF-.beta. signaling (Yamaguchi et al., Science 270:
2008-2011, 1995), and the fly PK92B with an unknown function
(Wassarman et al., Gene 169: 283-284, 1996). The kinase domain of
NPK1 was tagged with two copies of a hemagglutinin (DHA) epitope
(Sheen, supra, 1996) and cloned into a plant expression vector with
a derivative of the CaMV35S promoter (this promoter is not affected
by auxin) and the nos terminator (Sheen, supra, 1993; Sheen, supra,
1996; Sheen, supra, 1998). The NPK1 construct was co-transfected
with the GH3-sGFP or GH3-GUS construct into maize protoplasts. The
expression of the NPK1kinase domain in transfected maize
protoplasts was confirmed by .sup.35S-methionine labeling and
immunoprecipitation with an anti-HA antibody (FIG. 2A). The kinase
activity of the expressed protein was assayed using casein as a
universal substrate (FIG. 2B). Surprisingly, the constitutively
active NPK1 was found to block auxin activation of the GH3 promoter
(FIGS. 2C and 2D).
[0080] To show that the kinase activity of NPK1 is necessary for
this repression, a null mutation (K109M) was created by
site-directed mutagenesis to eliminate the ATP binding site
conserved among protein kinases (Sheen, supra, 1996). This mutation
was found not to affect the expression of the NPK1 protein (FIG.
2A), but completely abolished the protein kinase activity (FIG. 2B)
and the negative effect of NPK1 on the GH3 promoter in the presence
of auxin (FIGS. 2C and 2D).
[0081] To demonstrate-that-the inhibitory effect was specific to
NPK1, we next tested the effect of another plant MAPKKK,
Arabidopsis CTR1, that has been shown to act as a negative
regulator of ethylene responses (Kieber et al., Cell 72: 427-441,
1993). The kinase domain of CTR1 was expressed and displayed
protein kinase activity in maize protoplasts (FIGS. 2A and 2B), but
did not block auxin signaling (FIG. 2C). In addition, because NPK1
is a serine/threonine protein kinase, we expressed other
constitutively active serine/threonine protein kinases that belong
to four different classes (FIG. 2A), and tested their effect on the
GH3 promoter. Unlike NPK1, none of the tested protein kinases
repressed the auxin-regulated gene expression (FIG. 2C) although
they all exhibited protein kinase activities in the system (FIG.
2B). Thus, the effect of NPK1 on auxin signaling was not due to
non-specific phosphorylation in plant cells.
[0082] In addition to the GH3 promoter, we examined the effect of
the constitutively active NPK1 on the well-established auxin
responsive DNA element, ER7, that has been described by Ulmasov et
al. (supra, 1997). NPK1 was found to completely suppress the auxin
inducibility of the auxin responsive element (FIG. 2D). However,
the activities of many auxin-insensitive promoters, including the
promoters of CAB, actin, ubiquitin, and CaMV35S genes, were not
affected by NPK1 (data not shown). Taken together, these results
indicated that NPK1 plays an important and specific role in the
negative regulation of the auxin response genes.
[0083] It remained possible that NPK1 was a positive regulator in
auxin signaling and that the overexpression of NPK1 mimicked the
repression of the auxin response genes by very high levels of auxin
(Hagen et al., supra). To exclude this possibility, we tested the
effect of different NPK1 protein levels on the GH3 promoter
activity in the absence or presence of auxin. We used a heat shock
promoter (Sheen et al., supra, 1995) to control the amount of the
NPK1 protein produced by varying the time of heat shock. The null
mutation of NPK1 served as a control for the effect of the heat
shock. As is shown in FIG. 2E, the expression levels of the
constitutively active NPK1 and the null mutant correlated well with
the duration of heat shock. The activation of the GH3 promoter was
not observed at any level of NPK1 in the absence of auxin, ruling
out the possibility that NPK1 could be a positive regulator in
auxin signaling. In the auxin treated protoplasts, the reverse
correlation between the NPK1 protein levels and the GH3 promoter
activity supports the idea that NPK1 acts as a negative regulator
in auxin signal transduction (FIG. 2E).
[0084] Analysis of the Putative Regulatory Domains of NPK1
[0085] One distinct feature of NPK1 is the presence of a short
NH.sub.2-terminal sequence and a long COOH-terminal region outside
the kinase catalytic domain (Banno et al., supra). To investigate
the function of regions outside the kinase domain in the NPK1
protein, we created several NPK1 deletions (FIG. 3A) and tested
their effect on the GH3 promoter activity. Various deletions of the
full-length NPK1, as well as the full-length NPK1, showed similar
levels of protein expression in transfected maize protoplasts (FIG.
3B). Deletion of the kinase region alone or the kinase domain plus
the short NH.sub.2-terminus was found to inhibit the GH3 promoter
more strongly than the deletion carrying the kinase domain with the
long COOH-terminus or the full-length NPK1 (FIG. 3C).
[0086] NPK1 Activates a MAPK
[0087] NPK1, as a MAPKKK , is expected to induce a protein
phosphorylation cascade resulting in the activation of a MAPK.
Although several plant MAPKs have been shown to be induced by
stress, hormone, and elicitor signals (Hirt, Trends Biol Sci. 2:
11-15, 1997; Mizoguchi et al., Trends Biotech. 15: 15-19, 1997),
their activation by a phosphorylation cascade has never been
demonstrated in plant cells. To determine whether the expression of
the constitutively active NPK1 activates an endogenous MAPK in
maize protoplasts, we performed a standard MAPK activity assay
(Mizoguchi et al., Plant J. 5: 111-122, 1994; Zhang et al., Plant
Cell 9: 809-824, 1997; Bogre et al., Plant Cell 9: 75-83, 1997)
with extracts prepared from protoplasts transfected with NPK1 using
myelin basic protein (MBP) as a substrate. As shown in FIG. 4A,
protoplasts which were transfected with the constitutively active
NPK1 had about eight-fold higher 44 kDa kinase activity than
protoplasts transfected with the NPK1 null mutation or plasmid DNA
carrying no plant genes. This result suggested that the expression
of the constitutively active NPK1 resulted in activation of a MAPK.
Apparently, a MAPKK was already present in maize protoplasts and
sufficient to relay phosphorylation from MAPKKK (NPK1) to the 44
kDa MAPK. The expression of the full-length NPK1 increased the
putative MAPK activity only three fold (FIG. 4A). These results are
consistent with the observation that the full-length NPK1 has less
effect and the null NPK1 protein has no effect on the repression of
the GH3 promoter in the presence of auxin (FIGS. 2C, 2D, and 2E;
FIG. 3C). As a control, the constitutively active CTRL also
activated an endogenous kinase (FIG. 4A), suggesting the existence
of another unrelated MAPK cascade in maize protoplasts. We also
observed that the constitutively active CTR1, but not NPK1, could
repress ethylene responsive GCC1 enhancer activity more than ten
fold in Arabidopsis protoplasts, consistent with the proposed role
of CTR1 as a negative regulator in the ethylene signaling pathway
(Kieber et al., Cell 72: 427-441, 1993; Sheen, unpublished).
[0088] To verify that NPK1 expression resulted in the activation of
a MAPK, we performed kinase activity assays with the proteins
immunoprecipitated with an antibody raised against two conserved
domains of a mammalian MAPK. The MAPK activity of the protoplasts
transfected with the constitutively active NPK1 was significantly
higher than that of the cells transfected with the NPK1 null mutant
(FIG. 4B). These data are consistent with the results of the MAPK
in-gel assay (FIG. 4A), and demonstrate that tobacco NPK1 can
induce a kinase cascade in maize protoplasts that activates an
endogenous maize MAPK.
[0089] To determine whether the 44 kDa MAPK is involved in the
repression of early auxin response genes, we tested the effect of a
specific MAPK-phosphatase (MKP) that can inactivate MAPKs. Protein
phosphatases that can specifically dephosphorylate/inactivate MAPKs
have been reported in a variety of eukaryotes and are
evolutionarily conserved (Tonks et al., Cell 87: 365-368, 1996). A
mouse MKP1 (Sun et al., supra), highly specific to MAPKs, was
cloned into the plant expression vector and expressed in maize
protoplasts (FIG. 4C). The expression of MKP1 resulted in the
complete elimination of the NPK1 effects, including the
NPK1-dependent activation of a MAPK (FIG. 4C) and the repression of
the auxin-inducibility of the GH3 promoter (FIG. 4D). The results
suggest that the activation of the 44 kDa MAPK is necessary for the
NPK1 dependent repression of transcription. As controls, the
expression of other plant protein phosphatases (PP) that belong to
the three serine/threonine classes, PP1, PP2A, and PP2C, did not
abolish the activation of MAPK by NPK1 (FIG. 4C) or the repression
of the GH3 promoter by NPK1 (FIG. 4D), despite the detection of
enhanced PP activities in transfected maize protoplasts (Sheen,
supra, 1993; Sheen, supra, 1998) (data not shown). The fact that
MKP1 alone does not affect the GH3 promoter (data not shown)
supports our current model that a signal(s), antagonizing auxin
responses, induces NPK1-like MAPKKKs and leads to the repression of
the auxin-inducible transcription.
[0090] Stress and Auxin Responses in Arabidopsis Protoplasts
[0091] To further elucidate the molecular basis of oxidative stress
signaling in plants, we have also showed that an Arabidopsis
protoplast transient expression system is useful to investigate
multiple stress responses. Three Arabidopsis stress responsive
promoters, glutathione S-transferase GST6 (Chen et al., Plant J.
10: 995-966, 1996), heat shock HSP18.2 (Takahashi and Komeda, Mol.
Gen. Genet. 219: 365-372, 1989), and the abscisic acid (ABA)
responsive promoter RD29A (Yamaguchi-Shinozaki et al., Plant
Physiol. 101: 1119-1120, 1993; Ishitani et al., Plant Cell 9:
1935-1949, 1997), were fused to the luciferase (LUC) reporter and
tested for their responses in transfected mesophyll protoplasts.
The GST6, BSP18.2, and RD29A promoters were activated by
H.sub.2O.sub.2, heat, and ABA, respectively, in protoplasts (FIG.
5A) as demonstrated previously in intact plants (Chen et al.,
supra; Takahashi and Komeda, supra; Yamaguchi-Shinozaki et al.,
supra; Ishitani et al., supra). Several GST genes, including GST6,
have been shown to be induced by high and toxic concentrations of
plant growth hormone auxin, as well as by physiologically inactive
auxin analogs, heavy metals, and numerous stresses (Chen et al.,
supra; Ulmasov et al., Plant Mol. Biol. 26: 1055-1064, 1994; Abel
and Theologis, Plant Physiol. 111: 9-17, 1996; Sitbon and
Perrot-Rechenmann, Physiol Plantarum 100: 443-455, 1997; Guilfoyle
et al., Plant Physiol., 118: 341-347, 1998, Marrs, Annu. Rev. Plant
Physiol. Plant Mol. Biol. 47: 127-158, 1996). This non-specific
induction of GSTs separates them from other auxin responsive genes
that are only induced by low physiological levels of active auxin,
and indicates that stress rather than auxin is responsible for the
activation of the GST genes.
[0092] H.sub.2O.sub.2 and Heat Shock Suppress the Auxin Responsive
GH3 Promoter
[0093] H.sub.2O.sub.2, heat, and ABA can arrest cell cycle and
plant growth (Inz and Van Montagu, supra; Bolwell and Wojtaszek,
supra; Lamb and Dixon, supra; Noctor and Foyer, supra; Leung et
al., supra; Cheikh and Jones, Plant Physiol. 106, 45-51, 1994;
Reichheld et al., Plant J. 17: 647-656, 1999), the processes
promoted by auxin (Key, BioEssays 11: 52-58, 1989; Garbers and
Simmons, Trend Cell Biol. 4: 245-250, 1994; Walker and Estelle,
Curr. Opinion Plant Biol. 1: 434-439, 1998; Leyser, Curr. Biol. 8:
R305-R307, 1998). This suggests a connection between stress and
auxin signaling; however, a molecular basis of the crosstalk is
unknown. We tested the effects of these stresses on the activity of
the auxin responsive promoter, GH3 (Hagen et al., supra; Liu et
al., supra). In Arabidopsis protoplasts, physiological
concentrations of auxin, 1 .mu.M NAA (FIG. 5B) or 1 .mu.M IAA (data
not shown), dramatically increased GH3 promoter activity. The
kinetics and magnitude of GH3 promoter activation in Arabidopsis
protoplasts were comparable to those previously reported in other
systems (Hagen et al., supra; Liu et al., supra). Both
H.sub.2O.sub.2 and heat, but not ABA, severely abolished the auxin
response (FIG. 5B). The same stress treatments had no significant
effects on the CaMV35S promoter activity as an internal control or
on ubiquitin promoter UBQ10 activity as a parallel control (data
not shown). The repression of the auxin early response gene
promoter is therefore likely due to the activation of a specific
stress signaling pathway that is common to H.sub.2O.sub.2 and heat,
two representative oxidative stress signals (Inze and Van Montagu,
supra; Bolwell and Wojtaszek, supra; Lamb and Dixon, supra; Noctor
and Foyer, supra). In contrast, the stress hormone ABA did not
appear to interfere with auxin signaling in leaf cells.
[0094] ANP1 Initiates a Stress MAPK Cascade
[0095] In many eukaryotes, the transduction of H.sub.2O.sub.2 and
heat stress signals is controlled by protein phosphorylation
involving MAPKs (Kyriakis and Avruch, J. Biol. Chem. 271:
24313-24316, 1996; Tuomainan et al., Plant J. 12: 1151-1162, 1997;
Gustin et al., Microbiol. Mol. Biol. Review 62: 1264-1300, 1998;
Morimoto, Genes Develpm. 12: 3788-3796, 1998; Morimoto and Santoro,
Nature BioTech. 16: 833-838, 1998; Schoffl et al., Plant Physiol.
117: 1135-1141, 1998). MAPK and immediate upstream activators,
MAPKK and MAPKKK, constitute a functionally interlinked MAPK
cascade (Kyriakis and Avruch, supra; Tuomainan et al., supra;
Gustin et al., supra). Since the activated tobacco MAPKKK, NPK1
(Banno et al., supra), initiated a MAPK cascade that represses
auxin early response gene expression (as described herein), we
reasoned that this MAPK cascade could also represent a molecular
link between oxidative stress and auxin signal transduction. Three
Arabidopsis NPK1-like MAPKKKs, ANP1-3, share high homology in both
their kinase and regulatory domains (Nishihama et al., Plant J. 12:
39-48,1997). The regulatory domains of MAPKKKs interact mostly with
upstream regulators, whereas the kinase domain forms a complex with
the substrate, a specific MAPKK (Xu et al., Proc. Natl. Acad. Sci.
USA 92: 6808-6812, 1995; Shibuya et al., Science 272: 1179-1182,
1996; Clark et al., Proc. Natl. Acad. Sci. USA 95: 5401-5406, 1998;
Ichimura et al., Biochem. Biophys. Res. Comm. 253: 532-543, 1998;
Posas and Saito, EMBO J. 17: 1385-1394, 1998; Saitoh et al., EMBO
J. 17: 2596-2606, 1998; Xia et al., Genes Develop. 12: 3369-3381,
1998; Yuasa et al., J. Biol. Chem. 273: 22681-22692, 1998).
Deletions of the regulatory domains, as a result of genetic
manipulations, naturally occurred alternative splicing, or
proteolytic cleavage, increase MAPKKK activity (Banno et al.,
supra; Xu et al., supra, 1995; Shibuya et al., supra, 1996; Clark
et al., supra; Ichimura et al., supra. 253: 532-543, 1998; Posas
and Saito, supra; Saitoh et al., supra; Xia et al., supra; Yuasa et
al., supra; Deak et al., supra).
[0096] ANPs Activate Two Endogenous MAPKs
[0097] We first verified that ANPs could activate endogenous MAPKs
in Arabidopsis. Coding regions of full length (repressed), kinase
domain (constitutively active), or mutated (kinase-inactive) ANPs
were fused to the haemagglutinin (HA) epitope tag and expressed in
Arabidopsis protoplasts (FIG. 6A).
[0098] Constitutively active ANPs activated two putative endogenous
MAPKs in transfected protoplasts (FIG. 6B). Moreover, a mutation in
the ATP binding site abolished, and the presence of the regulatory
domains diminished, the ability of ANP1 to activate the putative
MAPKs. The sizes of the ANP-activated kinases are similar to those
reported for plant MAPKs (Hirt, Trends Biol. Sci. 2: 11-15, 1997;
Machida et al., Critic Rev. Plant Sciences 16: 481-496, 1997; Zhang
and Klessig, Plant Cell 9: 809-824, 1997; Mizoguchi et al., Trends
BioTech. 15: 15-19, 1997; Jonak et al., Cell Mol. Life Sci. 55:
204-213,1999).
[0099] ANPs1 Induce AtMKP3 and AtMPK6 in vivo
[0100] To identify downstream MAPKs of the ANP-mediated MAPK
cascade, constitutively active ANP1 was co-transfected with one of
six Arabidopsis MAPKs (AtMPKs), representing three different
classes (Hirt, supra; Machida et al., supra; Zhang and Klessig,
supra; Mizoguchi et al., supra; Jonak et al., supra). The active
ANP1 initiated a MAPK cascade that could be assayed by measuring
the activity of an individual epitope-tagged AtMPK after
immunoprecipitation (FIG. 6C). Constitutively active ANP1 slightly
changed the mobility of AtMPK3 and AtMPK6 detected by SDS-PAGE,
suggesting phosphorylation of these MAPKs (FIG. 6C, upper panel).
Notably, active ANP1 dramatically increased the activity of only
these two MAPKs (FIG. 6C, lower panel). Active ANP2 and ANP3, but
not another MAPKKK, CTR1 (Kieber et al., Cell 72: 427-441, 1993),
also induced AtMPK3 and AtMPK6 activity (data not shown),
indicating that CTR1 and ANPs activate different MAPK cascades.
AtMPK3 and AtMPK6 belong to the class of MAPKs implicated in both
stress and pathogen signal transduction in many different plant
species (Hirt, supra; Machida et al., supra; Zhang and Klessig,
supra; Mizoguchi et al., supra; Jonak et al., supra). The ability
of ANPs to activate stress-related MAPKs indicates that
ANP-mediated MAPK cascade is involved in stress signaling.
[0101] Stresses Activate AtMKP3 and ANP1
[0102] To define the stress signals that can regulate the MAPK
cascade, HA epitope-tagged AtMPK3 was transfected into Arabidopsis
protoplasts, and the protoplasts were then challenged with
different stresses. Phosphorylation activity of AtMPK3 was measured
after immunoprecipitation with an anti-HA antibody. Several stress
signals, including H.sub.2O.sub.2 or heat, but not auxin, activated
AtMPK3 (FIG. 6D, left). H.sub.2O.sub.2 or heat also activated
AtMPK6 (data not shown). However, when the full-length ANP1 protein
was ectopically expressed, only these two stresses, but not other
stress stimuli, could further enhance the activation of AtMPK3
(FIG. 6D, center). The fact that H.sub.2O.sub.2 and heat each
induced the full-length ANP1 activity to the level of the
constitutively active ANP1 (FIG. 6D, right) indicates that ANP1
functions in mediating H.sub.2O.sub.2 and beat stress signal
transduction. Induction of AtMPK3 by stimuli unrelated to oxidative
stress is probably mediated by an ANP-independent pathway (FIG. 6D,
left).
[0103] ANP1 Activates Stress-Inducible Promoters
[0104] To determine whether a plant MAPKKK, such as ANP1 (Nishihama
et al. Plant J. 12: 39-48, 1997), is involved in stress signal
transduction, we have tested the effect of a constitutively active
ANP1 kinase domain on the activity of several different dicot
promoters. This was achieved by introducing into Arabidopsis
protoplasts a transgene construct consisting of the firefly
luciferase coding sequence (LUC) under the control of different
dicot promoters. The promoters tested were the nitrate reductase,
NR2, promoter from Arabidopsis (Lin et al., Plant Physiol. 106:
477-484, 1994); the asparagine synthetase, AS1, promoter (Neuhaus
et al., EMBO J. 16: 2554-2564, 1997); the RD29A Arabidopsis
stress-responsive promoter (Ishitani et al., Plant Cell 9:
1935-1949, 1997); the Arabidopsis HSP heat shock promoter (Sheen et
al., Plant Journal 9: 777-784, 1995; Takahashi et al., Plant J. 2:
751-761, 1992); the Cab2 promoter (Mitra et al. Plant Mol. Biol.
12: 169-179, 1989); the chalcone synthase gene promoter (Feinbaum
et al., Mol. Cell Biol. 8: 1985-1992, 1988); and the
H.sub.2O.sub.2-inducible glutathione S-transferase promoter (GST)
from Arabidopsis (Chen et al., Plant J. 10: 955-966, 1996). The
kinase domain of ANP1 was cloned into a plant expression vector
with a derivative of the 35S promoter and the nos terminator
(Sheen, Science 274: 1900-1902, 1996). The ANP1 construct was
co-transfected with one of the dicot promoter reporter gene
construct and assayed according to standard methods. Surprisingly,
the constitutively active ANP1 kinase domain was found to activate
the expression of the AS1, HSP, and GST6 promoters (FIG. 7A).
Constitutive expression of either the mutated NPK1 kinase domain or
the CTR1 kinase domain had no effect on the expression of the dicot
reporter genes.
[0105] To provide further evidence for the involvement of ANPs in
specific stress signaling, we tested the effect of the
constitutively active ANP1 on the activity of the GST6, HSP18.2,
and RD29A promoters. The active ANP1 could substitute for
H.sub.2O.sub.2 and heat to induce the GST6 and HSP18.2 promoters
respectively, but did not change the expression of the ABA, cold,
or drought responsive RD29A promoter (FIG. 7B). The activation of
the GST6 and HSP18.2 promoters required ANP kinase activity since a
single amino acid mutation in the ATP binding site completely
abolished the ANP1 effect on the promoters. However, the activation
was not due to non-specific protein phosphorylation because three
other Arabidopsis protein kinases, including another constitutively
active MAPKKK, CTR1 (Kieber et al., supra), did not affect the
promoters' activities. The tested protein kinases were expressed
equally well and were at least as active as ANP-like MAPKKKs in
transfected cells (as described herein). These results reinforce a
role of ANP1 in H.sub.2O.sub.2 and heat signal transduction.
However, since ANP1-mediated induction of the HSP18.2 promoter was
lower than that obtained by heat shock (FIG. 5A), both
ANP-dependent and ANP-independent pathways are probably required to
fully activate the heat shock promoter. Since oxidative stress can
induce heat shock responsive genes (Morimoto, supra; Morimoto and
Santoro, supra; Schoffl et al., supra; Banzet et al., Plant J. 13:
519-527, 1998; Storozhenko et al., Plant Physiol. 118: 1005-1014,
1998; Zhong et al., Mol. Cell 2: 101-108, 1998; Landry and Huot,
Biochem Soc. Symp. 64: 79-89, 1999), active oxygen species
generated by heat shock (Inze and Van Montagu, supra; Bolwell and
Wojtaszek, supra; Lamb and Dixon, supra; Noctor and Foyer, supra)
might be responsible for ANP-dependent activation of the
promoter.
[0106] ANPs Repress the Auxin Response
[0107] To determine whether ANPs can mimic H.sub.2O.sub.2 and heat
to repress auxin signaling, we tested the effect of the kinases on
GH3 promoter activity. Constitutively active ANP1, ANP2, and ANP3,
but not other tested protein kinases, effectively suppressed the
GH3 promoter induction by auxin (FIG. 7C). The results suggest that
Arabidopsis ANPs are orthologs of the tobacco NPK1 that can
suppress auxin signaling (as described herein). Thus, similar to
H.sub.2O.sub.2 and heat, the constitutively active ANPs can repress
the auxin inducible promoter and induce expression of the GST and
HSP genes (FIGS. 5A, B and FIGS. 7B, C).
[0108] Analyses of Transgenic Tobacco Plants Expressing NPK1
[0109] To assess the function of NPK1 at a whole plant level, we
generated transgenic tobacco plants ectopically overexpressing the
constitutively active NPK1. It was anticipated that overexpression
of NPK1, as an auxin antagonist, could be lethal. We obtained
transgenic plants through three independent transformation
experiments. We observed that some seeds from several independent
NPK1 transgenic lines never germinated, whereas seeds from the wild
type control (FIG. 8A) and many other tobacco lines carrying other
transgenes (data not shown) germinated normally. In one line,
designated 4A, more than 75% of the seeds did not germinate under
any conditions. A closer examination revealed that some transgenic
seeds exhibited underdeveloped embryo and endosperm (FIG. 8B).
Importantly, the number of defective seeds in each line correlated
with the level of transgene expression (FIG. 8D), suggesting that
the seed phenotype was due to transgene expression. Although the
majority of the transgenic seeds that survived expressed the NPK1
mRNA (FIG. 8C), they produced mostly wild-type looking plants.
However, we could not detect the ectopic HA-tagged NPK1 protein in
these normal-looking transgenic plants after numerous protein blot
analyses, while the control transgenic line expressing the
HA-tagged MEK1 showed a strong signal (FIG. 8D). We hypothesize
that the truncated NPK1 protein is unstable and cannot accumulate
to a level required for causing grossly abnormal growth. This is in
agreement with a recent report that a mammalian MAPKKK MEKK1 is
degraded rapidly after processing and activation (Widmann et al.,
Mol. Cell. Biol. 18: 2416-2429, 1998). In addition, it was reported
that in tobacco cells the NPK1 protein is subjected to a fast
turn-over after activation specifically at the end of M phase in
the cell cycle (Machida et al., 40th NIBB Conference "Stress
responses", 1998), and is detectable at low levels only in
fast-growing tissues (Banno et al., supra). Thus, accumulation of
NPK1 protein might be tightly regulated in plants. This likely
explains why the most dramatic effect of NPK1 during embryogenesis
and seed development were observed when rapid cell division occurs
and more NPK1 proteins may accumulate to block cell cycle progress.
The auxin requirement for embryogenesis in plants has been
demonstrated (Mordhorst et al., Genetics 149: 549-563 1998).
Similarly, ectopic activation of a MAPK cascade disrupts Xenopus
embryo development by inducing mitotic arrest specifically at the M
phase (Takenaka et al., Science 280: 599-602, 1998).
[0110] Transgenic Tobacco Plants Expressing NPK1 Are Resistant to
Drought and Excess Salt
[0111] Transgenic tobacco plants overexpressing the constitutively
active NPK1 were found to be resistant to limited water
availability when compared to non-transgenic plants (FIG. 9). In
addition, transgenic tobacco seeds constitutively expressing the
NPK1 gene were also observed to germinate and grow under high salt
conditions (150 mM NaCl), as well as to thrive after exposure to
oxidative and heat stresses.
[0112] Stress Tolerance of Transgenic Tobacco Plants Ectopically
Expressing Active NPK1
[0113] GSTs and HSPs encode conjugation enzymes and molecular
chaperones, respectively. They play essential roles in
detoxification and stabilization of damaged proteins and assisting
cell recovery from stresses (Marrs, supra; Morimoto, supra;
Morimoto and Santoro, supra; Schoffl et al., supra). Constitutive
expression of GSTs or HSPs in transgenic tobacco and Arabidopsis
can make plants more resistant to different stresses, such as salt
and heat (Tarczynski et al., Science 259: 508-510, 1993; Kishor et
al. Plant Physiol. 108: 1387-1394,1995; Lee et al. Plant J. 8:
603-612,1995; Ishizaki-Nishizawa et al., Nature BioTech. 14:
1003-1006, 1996; Roxas et al., Nature BioTech. 15: 988-991, 1997;
Prandl et al., Mol. Gen. Genet. 258: 269-278, 1998; Jaglo-Otosen et
al., Science 280: 104-106,1998; Liu et al. Plant Cell 10:
1391-1406, 1998; Pardo etal., Proc. Natl. Acad. Sci. USA 95:
9681-9686,1998; Pei et al., Science 282: 287-290, 1998). Since
constitutively active ANP1 induces expression of GST6 and HSP18.2
(FIG. 7B), it is possible that transgenic plants ectopically
expressing the active ANP-like protein might be more tolerant to
such stresses.
[0114] Several transgenic tobacco lines (2A, 3B, 4A), expressing
different levels of the constitutively active tobacco ANP ortholog,
NPK1 (as described herein), were examined. Phenotypically, the
transgenic plant did not differ from wild type plants under normal
growth conditions (FIG. 10A). However, transgenic plants grew more
vigorously than did the wild type plants in the presence of 150 mM
NaCl. In addition, only 12% of the wild type, but 46%, 68%, and 80%
of 2A, 3B, and 4A plants, respectively, survived a three-day
exposure to high salt (300 mnM NaCl) (FIG. 10C). NPK1 Transgenic
plants were also observed to be tolerant to a 3 hour freezing
temperature treatment of -10.degree. C. (FIG. 10B). We have also
tested the sensitivity of NPK1 transgenic plants to heat shock.
Exposure to 48.degree. C. heat shock killed all the wild type
plants, but 24% of 2A, 68% of 3B, and 74% of 4A plants survived
(FIG. 10D). The stress tolerance of these NPK1 transgenic plants
was proportional to the level of NPK1 transgene expression (as
discussed herein). Thus, similar to tobacco and Arabidopsis
overproducing GSTs and HSPs (Tarczynski et al., supra; Kishor et
al. supra; Lee et al., supra; Ishizaki-Nishizawa et al., supra;
Roxas et al., supra; Prandl et al., supra; Jaglo-Ottosen et al.,
supra; Liu et al., supra; Pardo et al., supra; Pei et al., supra),
the NPK1 transgenic plants were more tolerant to salt and heat than
were wild type plants. Although some of the NPK1 transgenic seeds
are defective during embryogenesis (as discussed herein) when auxin
signaling plays a crucial role (Michalczuk et al., Phytochem. 31:
1097-1103, 1992; Ribnicky et al., Plant Physiol. 112: 549-558,
1996; Hardtke and Berleth, EMBO J. 17: 1405-1411, 1998; Mordhorst
et al., Genetics 149: 549, 1998; McGovern et al., 9.sup.th
Arabidopsis Converence, Madison, USA 1998), the absence of obvious
growth defects in post-embryonic development of the trahsgenic
plants suggests that the level of NPK1 expression achieved is not
deleterious, but rather beneficial in vegetative tissues. The
manipulation of this oxidative stress signaling regulator can
protect plant cells from diverse environmental stresses, such as
heat and high salt. This approach may even be applied for
protection from other environmental stresses, such as UV-B, ozone,
photooxidation, herbicide, pathogen, drought, and chilling that
also involve oxidative stress damage (Green and Fluhr, Plant Cell
7: 203-212, 1995; Prasad, Plant J. 10: 1017-1026, 1996; Willekens
et al., EMBO J. 16: 4806-4816, 1997; Chamnongpol et al., Proc.
Natl. Acad. Sci USA 95: 5818-5823, 1998; Schraudner et al., Plant
J. 16: 235-245, 1998; Karpinski et al., Science 284: 654-657,1999).
Thus, modulation of MAPKKK activity, such as ANP activity, in
vegetative tissues provides a novel strategy for cross protection
from multiple stresses in agriculturally important plants.
[0115] Role of MAPKKKs
[0116] Recently, the analysis of auxin resistant mutants in
Arabidopsis suggested a crucial role of protein degradation in
auxin signaling and cell cycle control. For example, several auxin
resistant mutants (axr1, tir1) seemed to be caused by defects in
protein degradation processes (Leyser, Curr. Biol. 8: R305-R307,
1998). Many auxin-inducible proteins, e.g. SAUR, Aux/IAA, are
highly unstable, and some of them function as negative regulators
of auxin mediated transcription (Abel et al., Plant Physiol. 111:
9-17, 1996; Guilfoyle, Trends Plant Sci. 3: 205-207, 1998; Ulmasov
et al., Plant Cell 9: 1963-1971, 1997). The experiments described
herein provide another indication that cell cycle, protein
turn-over, and auxin signaling are interconnected.
[0117] It has been shown that conserved MAPK cascades mediate
numerous vital functions in mammals and yeast, e.g., cell
proliferation, cell death, stress responses, through the regulation
of gene expression (Herskowitz. Cell 80: 187-197, 1995; Kyriakis et
al., J. Biol Chem. 271: 24313-24316, 1996). Here, we have presented
the first demnonstration that, in plant cells, a MAPKKK can
activate a MAPK cascade involved in specific regulation of gene
expression, and act as a negative regulator in the auxin signal
transduction pathway. The recent finding of three NPK1-like protein
kinases in Arabidopsis (ANPs) (Nishihama et al., Plant J. 12:
39-48, 1997) suggests that this distinct MAPKKK is likely conserved
in higher plants. In fact, like NPK1, we have found that the kinase
domain of ANP1 specifically suppressed the auxin-inducible GH3
promoter in both maize and Arabidopsis protoplasts.
[0118] Moreover, we have presented evidence indicating that
ANP-like MPKKKs mediate oxidative stress signal transduction in
plants. For example, oxidative stress signals, H.sub.2O.sub.2 or
heat, can activate the MAPKKK. The active ANPs mimic the oxidative
stress signals in inducing stress MAPKs and stress response genes,
as well as repressing auxin responsive promoter. Therefore,
ANP-mediated MAPK cascade links stress and auxin signaling. The
activated cascade might help stressed plants to limit
auxin-dependent cell division and cell expansion in order to
concentrate on survival needs. ANP proteins are found at high
levels in meristematic cells and thought to be involved in cell
cycle control (Banno et al., supra; Nishihama et al., supra;
Nakashima et al., Plant Cell Physiol. 39: 690-700, 1998; Machida et
al., 40.sup.th NIBB Conference "Stress responses", 1998). Since
activation of the stress-induced MAPK cascades usually leads to
stress tolerance, a physiological significance of the ANP-related
MAPKKKs might be to protect young dividing cells from harsh
environmental conditions that plants face during their lifespan.
The protection of dividing tissue from stress damage is crucial for
survival because continuous organogenesis from the meristems allows
reestablishment of plant life.
[0119] Materials and Methods
[0120] The above-described results were obtained using the
following methods.
[0121] Reporter Constructs
[0122] The 749 bp soybean GH3 promoter (Hagen et al., Plant Mol.
Biol. 17: 567-579, 1991) was fused to a synthetic gene encoding
green-fluorescent protein (sGFP) (Chiu et al., Curr. Biol. 6:
325-330, 1996) to visualize the promoter activity. Synthetic ER7
element, TTGTCTCCCAAAGGGAGACAA (SEQ ID NO:1), or mutated ER7,
TTGTCTCCCAAAGGGAGAtAA (SEQ ID NO:2) (Ulmasov et al., Science 276:
865-1868, 1997), was inserted in front of the CaMV 35S minimal
promoter (-72) (Sheen, EMBO J. 12: 3497-3505, 1993). The synthetic
promoters were fused to a GUS-nos gene to create ER7-GUS and
mER7-GUS reporter constructs. Three clones of each construct were
tested for auxin induction and gave identical results.
[0123] Arabidopsis MAPKKKs (ANP1, ANP2, ANP3, and CTR1), MAPKs
(AtMPK2 to 7), and serine-threonine protein kinases, ASK1 and
CK1-1, were obtained by PCR from an Arabidopsis cDNA library. The
kinase-inactive ANP1 mutant (K98M) was generated by PCR using the
following primers:
[0124] TCTCGCCGTCAtgCAGGTTCTGATTGC (SEQ ID NO:3) and
[0125] GCAATCAGAACCTGcaTGACGGCGAGAAG (SEQ ID NO:4). The mutation
was confirmed by DNA sequencing. All PCR products were tagged with
two copies of the hemagglutinin (DHA) epitope, and inserted into a
plant expression vector containing the 35SC4PPDK promoter and the
nos terminator (as described herein). Three to four independent
effector clones were tested and gave identical results.
[0126] Effector Constructs
[0127] NPK1 and CTR1 were obtained by PCR from tobacco cDNA and an
Arabidopsis cDNA library, respectively. NPK1 deletions were
generated by PCR. The null NPK1 mutant (K109M) was generated by PCR
using the following primers:
[0128] TACTCGCTATAAtGGAGGTTTCGAT (SEQ ID NO:5) and
[0129] CGCAATCGAAACCTCCaTTATAGCGAGTA (SEQ ID NO:6). The mutation
was confirmed by DNA sequencing. The PCR products, the coding
regions of the constitutively active protein kinases from
Arabidopsis (CDPK, APK2, ASK2 (Sheen, Science 274: 1900-1902,
1996), CK1-1 (Klimczal et al., Plant Physiol. 109: 687-696, 1995)),
and the coding regions of protein phosphatases (mouse MKP1 (Sun et
al., Cell 75: 487-493, 1993), maize PP1 (Smith et al., Plant
Physiol. 97: 677-683, 1991), maize PP2A (Sheen, EMBO J. 12:
3497-3505, 1993), and Arabidopsis PP2C (Sheen, Proc. Natl. Acad.
Sci. USA 95: 975-980, 1998)) were inserted into a plant expression
vector containing the 35SC4PPDK promoter, nos terminator, and DHA
tag (Sheen, Science 274: 1900-1902, 1996; Sheen, Proc. Natl. Acad.
Sci. USA 95: 975-980, 1998). Three to four independent clones were
tested in co-transfection experiments with identical results.
[0130] Arabidopsis GST6 (Chen et al., supra), HSP18.2 (Takahashi
and Komeda, supra), and RD29A (Yamaguchi-Shinozaki and Shinozaki,
supra; Ishitani et al., supra), as well as soybean GH3 (Key, supra;
Garbers and Simmons, supra; Walker and Estelle, supra; Leyser,
supra) promoters were fused to the luciferase gene to create
GST6-LUC, HSP18.2-LUC, RD29-LUC, and GH3-LUC reporter constructs,
respectively.
[0131] Protoplast Transient Expression
[0132] The preparation, electroporation, and incubation of
etiolated maize mesophyll protoplasts were as described previously
(Sheen, Plant Cell 2: 1027-1038, 1990; Sheen, EMBO J. 12:
3497-3505, 1993). In each electroporation, 2.times.10.sup.5
protoplasts were transfected with 30 mg of plasmid DNA carrying a
reporter construct alone or with 30 mg of plasmid DNA carrying an
effector construct or a vector DNA control. The transfected
protoplasts were incubated in medium (5.times.10.sup.4/ml) without
(-auxin) or with (+auxin) 1 mM NAA for 14 hours in the dark. GFP
fluorescence was observed using UV light as described previously
(Sheen et al., Plant J. 8: 777-784, 1995). The GUS (Sheen, Plant
Cell 2: 1027-1038, 1990) and luciferase (Sheen, Science 274:
1900-1902, 1996) assays were carried out with cell lysates from
10.sup.4 protoplasts.
[0133] Arabidopsis thaliana, ecotype Bensheim, was grown on B5
medium for 4 weeks. The third pair of leaves were cut into 1.0 mm
strips and digested overnight in 1% Cellulase R-10, 0.25%
Macerozyme R-10, 0.5 M mannitol, 10 mM CaCl.sub.2, 20 mM KCl, 10 mM
MES, pH 5.7, and 0.1% BSA. Protoplasts were released by gentle
shaking, filtered through a 75 .mu.m Nylon mesh, collected by
centrifugation, and resuspended in W5 solution (Damm et al., Mol.
Gen. Genet. 217:6, 1989; Abel and Theologis, supra). Before
transfection, protoplasts were resuspended in 0.4 M Mannitol, 15 mM
MgCl.sub.2 and 4 mM MES, pH 5.7, to a density of 10.sup.6
protoplasts/ml. Typically 0.2 ml of the protoplast suspension was
mixed with 30 to 50 .mu.g of plasmid DNA containing reporter and
effector constructs and equal volume of 40% PEG solution (Darun et
al., Mol. Gen. Genet. 217:6, 1989; Abel and Theologis, supra). The
transfected protoplasts were diluted with W5 solution, collected by
centrifugation, and resuspended in the incubation solution (0.5 M
Mannitol, 20 mM KCl, 4 mM MES, pH 5.7).
[0134] Determination of Effector Expression
[0135] Transfected maize protoplasts (10.sup.5) were incubated for
hours with [.sup.35S]-methionine (200 mCi/ml) before harvesting.
The NPK1 protein was less stable than other expressed proteins
after long incubation (data not shown). Immunoprecipitation with an
anti-HA antibody was performed as described previously (Sheen,
Science 274: 1900-1902, 1996). The proteins were separated by
SDS-PAGE (10%) and visualized by fluorography.
[0136] In-Gel Kinase Activity Assay
[0137] The transfected protoplasts (10.sup.5) were incubated for
hours before harvesting. The kinase in-gel assay was performed as
described previously (Zhang et al., Plant Cell 9: 809-824,
1997).
[0138] Immunooprecipitation Kinase Activity Assay
[0139] Cell lysates from 10.sup.5 transfected protoplasts were used
for immunoprecipitation with an anti-ERK (PAC) antibody
(Transduction Laboratory) (Sheen, Science 274: 1900-1902, 1996).
The immunoprecipitated proteins were assayed for MAPK activity
using MBP as substrate (Bogre et al., Plant Cell 9: 75-83, 1997).
The [.sup.32P]-MBP was separated by SDS-PAGE (15%) and visualized
by autoradiography.
[0140] Protein Kinase and Phosphatase Activity Assays
[0141] Cell lysates from 10.sup.5 transfected protoplasts were used
for immunoprecipitation with an anti-HA antibody (Sheen, Science
274: 1900-1902, 1996) to bring down the HA-tagged protein kinases.
The immunoprecipitated proteins were assayed using casein as
substrate. The [.sup.32P]-casein was separated by SDS-PAGE (10%)
and visualized by autoradiography. PP1, PP2A, and PP2C activity
assays using transfected maize cell extracts were described
previously (Sheen, EMBO J. 12: 3497-3505, 1993; Sheen, Proc. Natl.
Acad. Sci. USA 95: 975-980, 1998).
[0142] Transgenic Plants
[0143] A construct including the 35SC4PPDK promoter (Sheen, EMBO J.
12: 3497-3505, 1993; Sheen, Science 274: 1900-1902, 1996; Sheen,
Proc. Natl. Acad. Sci. USA 95: 975-980, 1998), kinase domain of
NPK1, DHA tag, and nos terminator was inserted into pART27 binary
vector (Gleave, Plant Mol. Biol. 20: 1203-1207, 1992). The
resulting plasmid was introduced into Agrobacterium tumefaciens
EHA105, and the transformation was performed with Nicotiana tabacum
SR1 leaf discs (Chiu et al., Curr. Biol. 6: 325-330, 1996). Several
kanamycin-resistant plants were selected from three independent
transformation experiments. The kanamycin resistance of T1 progeny
plants revealed that the three analyzed independent parental
transformants contained more than one copy of the transgene. The
seeds were examined under a light microscope. RNA blot and protein
blot analyses were performed as described previously (Jang et al.,
Plant Cell 9: 5-19, 1997).
[0144] Isolation of Sequences Encoding MAPKKK Kinase Domains
[0145] The isolation of additional MAPKKK coding sequences, as well
as MAPKKK kinase domains, having the ability to regulate auxin
responses (or activate stress responses, or alter seed development)
in plants is accomplished using standard strategies and techniques
that are well known in the art.
[0146] In one particular example, the tobacco NPK1 sequences (or
Arabidopsis ANP1, ANP2, or ANP3 sequences) described herein may be
used, together with conventional screening methods of nucleic acid
hybridization screening, to isolate additional sequences encoding
MAPKKK polypeptides (or kinase domain-containing fragements
thereof), as well as kinase domains of MAPKKK (FIGS. 11, 12, 13,
14, 15, and 16; SEQ ID NOS: 7-22). Such hybridization techniques
and screening procedures are well known to those skilled in the art
and are described, for example, in Benton and Davis, Science 196:
180, 1977; Grunstein and Hogness, Proc. Natl. Acad. Sci., USA 72:
3961, 1975; Ausubel et al. Current Protocols in Molecular Biology,
Wiley Interscience, New York; Berger and Kimmel, Guide to Molecular
Cloning Techniques, 1987, Academic Press, New York.; and Sambrook
et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, New York. In one particular example, all or part
of the NPK1 gene (described herein) may be used as a probe to
screen a recombinant plant DNA library for genes having sequence
identity or similarity to the NPK1 gene or its kinase domain (FIGS.
11, 15, and 16). Hybridizing sequences are detected by plaque or
colony hybridization according to the methods described below.
[0147] Alternatively, using all or a portion of the amino acid
sequence of the kinase domain, one may readily design kinase
domain-specific oligonucleotide probes, including kinase domain
degenerate oligonucleotide probes (i.e., a mixture of all possible
coding sequences for a given amino acid sequence). These
oligonucleotides may be based upon the sequence of either DNA
strand and any appropriate portion of the kinase domain sequence.
General methods for designing and preparing such probes are
provided, for example, in Ausubel et al., Current Protocols in
Molecular Biology, Wiley lnterscience, New York; and Berger and
Kimmel, Guide to Molecular Cloning Techniques, 1987, Academic
Press, New York. These oligonucleotides are useful for kinase
domain sequence isolation, either through their use as probes
capable of hybridizing to kinase complementary sequences or as
primers for various amplification techniques, for example,
polymerase chain reaction (PCR) cloning strategies. If desired, a
combination of different oligonucleotide probes may be used for the
screening of a recombinant DNA library. The oligonucleotides may be
detectably-labeled using methods known in the art and used to probe
filter replicas from a recombinant DNA library. Recombinant DNA
libraries are prepared according to methods well known in the art,
for example, as described in Ausubel et al. (supra), or they may be
obtained from commercial sources.
[0148] As discussed above, kinase domain-specific oligonucleotides
may also be used as primers in amplification cloning strategies,
for example, using PCR. PCR methods are well known in the art and
are described, for example, in PCR Technology, Erlich, ed.,
Stockton Press, London, 1989; PCR Protocols: A Guide to Methods and
Applications, Innis et al., eds., Academic Press, Inc., New York,
1990; and Ausubel et al. (supra). Primers are optionally designed
to allow cloning of the amplified product into a suitable vector,
for example, by including appropriate restriction sites at the 5'
and 3' ends of the amplified fragment (as described herein). If
desired, kinase domain sequences may be isolated using the PCR
"RACE" technique, or Rapid Amplification of cDNA Ends (see, e.g.,
Innis et al. (supra)). By this method, oligonucleotide primers
based on an kinase domain sequence are oriented in the 3' and 5'
directions and are used to generate overlapping PCR fragments.
These overlapping 3'- and 5'-end RACE products are combined to
produce an intact full-length cDNA. This method is described in
Inhis et al. (supra); and Frohman et al., Proc. Natl. Acad. Sci.
USA 85: 8998, 1988.
[0149] Confirmation of a sequence's relatedness to the kinase
domains of the NPK and ANP MAPKKKs may be accomplished by a variety
of conventional methods including, but not limited to, sequence
comparison of the gene and its expressed product. In addition, the
activity of the gene product may be evaluated according to any of
the techniques described.
[0150] Once a MAPKKK gene or its kinase domain is identified, it is
cloned according to standard methods and used for the construction
of plant expression vectors as described below.
[0151] Expression Constructs
[0152] Those skilled in the field of molecular biology will
understand that any of a wide variety of expression systems may be
used to provide the recombinant protein. The precise host cell used
is not critical to the invention. A MAPKKK polypeptide or its
kinase domain may be produced in a prokaryotic host, for example,
E. coli, or in a eukaryotic host, for example, Saccharomyces
cerevisiae, mammalian cells (for example, COS 1 or NIH 3T3 cells),
or any of a number of plant hosts including, without limitation,
algae, tree species, ornamental species, temperate fruit species,
tropical fruit species, vegetable species, legume species, crucifer
species, monocots, dicots, or in any plant of commercial or
agricultural significance. Particular examples of suitable plant
hosts include, but are not limited to, Conifers, Petunia, Tomato,
Potato, Tobacco, Arabidopsis, Lettuce, Sunflower, Oilseed rape,
Flax, Cotton, Sugarbeet, Celery, Soybean, Alfalfa, Medicago, Lotus,
Vigna, Cucumber, Carrot, Eggplant, Cauliflower, Horseradish,
Morning Glory, Poplar, Walnut, Apple, Grape, Asparagus, Rice,
Maize, Millet, Onion, Barley, Orchard grass, Oat, Rye, and Wheat.
In addition, as is discussed below, expression constructs may be
expressed in a transgenic plant to turn on the stress signal
transduction pathway to enhance plant tolerance to multiple stress
conditions.
[0153] Materials for expressing these genes are available from a
wide range of sources including the American Type Culture
Collection (Rockland, Md.); or from any of a number seed companies,
for example, W. Atlee Burpee Seed Co. (Warminster, Pa.), Park Seed
Co. (Greenwood, S.C.), Johnny Seed Co. (Albion, Me.), or Northrup
King Seeds (Barstville, S.C.). Descriptions and sources of useful
host cells are also found in Vasil I. K., Cell Culture and Somatic
Cell Genetics of Plants, Vol I, II, III Laboratory Procedures and
Their Applications Academic Press, New York, 1984; Dixon, R. A.,
Plant Cell Culture--A Practical Approach, IRL Press, Oxford
University, 1985; Green et al., Plant Tissue and Cell Culture,
Academic Press, New York, 1987; and Gasser and Fraley, Science 244:
1293, 1989.
[0154] The method of transformation or transfection and the choice
of vehicle for expression of the MAPKKK polypeptide or its kinase
domain will depend on the host system selected. Transformation and
transfection methods are described, e.g., in Ausubel et al.
(supra); Weissbach and Weissbach, Methods for Plant Molecular
Biology, Academic Press, 1989; Gelvin et al., Plant Molecular
Biology Manual, Kluwer Academic Publishers, 1990; Kindle, K., Proc.
Natl. Acad. Sci., U.S.A 87: 1228, 1990; Potrykus, I., Annu. Rev.
Plant Physiol. Plant Mol. Biology 42: 205, 1991; and BioRad
(Hercules, Calif.) Technical Bulletin #1687 (Biolistic Particle
Delivery Systems). Expression vehicles may be chosen from those
provided, e.g., in Cloning Vectors: A Laboratory Manual (P. H.
Pouwels et al., 1985, Supp. 1987); Gasser and Fraley (supra);
Clontech Molecular Biology Catalog (Catalog 1992/93 Tools for the
Molecular Biologist, Palo Alto, Calif.); and the references cited
above. Other expression constructs are described by Fraley et al.
(U.S. Pat. No. 5,352,605).
[0155] Most preferably, a MAPKKK polypeptide or its kinase domain
is produced by a stably-transfected plant cell line, a
transiently-transfected plant cell line, or by a transgenic plant.
A number of vectors suitable for stable transfection of plant cells
or for the establishment of transgenic plants are available to the
public; such vectors are described in Pouwels et al. (supra),
Weissbach and Weissbach (supra), and Gelvin et al. (supra). Methods
for constructing such cell line s are described in, e.g. Weissbach
and Weissbach (supra), and Gelvin et al. (supra). Typically, plant
expression vectors include (1) a cloned plant gene under the
transcriptional control of 5' and 3' regulatory sequences and (2) a
dominant selectable marker. Such plant expression vectors may also
contain, if desired, a promoter regulatory region (for example, one
conferring inducible or constitutive, pathogen- or wound-induced,
environmentally- or developmentally-regulated, or cell- or
tissue-specific expression), a transcription initiation start site,
a ribosome binding site, an RNA processing signal, a transcription
termination site, and/or a polyadenylation signal.
[0156] Once the desired nucleic acid sequence encoding a MAPKKK
polypeptide or its kinase domain is obtained as described above, it
may be manipulated in a variety of ways known in the art. For
example, where the sequence involves non-coding flanking regions,
the flanking regions may be subjected to mutagenesis.
[0157] The kinase domain sequence (or a MAPKKK polypeptide or
kinase domain-containing fragment thereof), if desired, may be
combined with other DNA sequences in a variety of ways. Such a
sequence may be employed with all or part of the gene sequences
normally associated with itself. In its component parts, a DNA
sequence encoding a MAPKKK polypeptide or its kinase domain is
combined in a DNA construct having a transcription initiation
control region capable of promoting transcription and translation
in a host cell.
[0158] In general, the constructs will involve regulatory regions
functional in plants which provide for modified production of the
regulator protein as discussed herein. The open reading frame
coding for the regulator protein or functional fragment thereof
will be joined at its 5' end to a transcription initiation
regulatory region such as the sequence naturally found in the 5'
upstream region of the MAPKKK polypeptide or its kinase domain.
Numerous other transcription initiation regions are available which
provide for constitutive or inducible regulation.
[0159] For applications where developmental, cell, tissue,
hormonal, or environmental expression is desired, appropriate 5'
upstream non-coding regions are obtained from other genes, for
example, from genes regulated during meristem development, seed
development, embryo development, or leaf development.
[0160] Regulatory transcript termination regions may also be
provided in DNA constructs of this invention as well. Transcript
termination regions may be provided by the DNA sequence encoding
the MAPKKK polypeptide or any convenient transcription termination
region derived from a different gene source. The transcript
termination region will contain preferably at least 1-3 kb of
sequence 3' to the structural gene from which the termination
region is derived. Plant expression constructs having, for example,
a MAPKKK protein kinase domain (e.g., the NPK1 kinase domain) as
the DNA sequence of interest for expression may be employed with a
wide variety of plant life. Such genetically-engineered plants are
useful for a variety of industrial and agricultural applications as
discussed herein. Importantly, this invention is applicable to
dicotyledons and monocotyledons, and will be readily applicable to
any new or improved transformation or regeneration method.
[0161] An example of a useful plant promoter according to the
invention is a caulimovirus promoter, for example, a cauliflower
mosaic virus (CaMV) promoter. These promoters confer high levels of
expression in most plant tissues, and the activity of these
promoters is not dependent on virally encoded proteins. CaMV is a
source for both the 35S and 19S promoters. In most tissues of
transgenic plants, the CaMV 35S promoter is a strong promoter (see,
e.g., Odell et al., Nature 313: 810, 1985). The CaMV promoter is
also highly active in monocots (see, e.g., Dekeyser et al., Plant
Cell 2: 591, 1990; Terada and Shimamoto, Mol. Gen. Genet. 220: 389,
1990). Moreover, activity of this promoter can be further increased
(i.e., between 2-10 fold) by duplication of the CaMV 35S promoter
(see e.g., Kay et al., Science 236: 1299, 1987; Ow et al., Proc.
Natl. Acad. Sci., U.S.A. 84: 4870, 1987; and Fang et al., Plant
Cell 1: 141, 1989). In addition, the a minimal 35S promoter may
also be as is described herein.
[0162] Other useful plant promoters include, without limitation,
the nopaline synthase promoter (An et al., Plant Physiol. 88: 547,
1988) and the octopine synthase promoter (Fromm et al., Plant Cell
1: 977, 1989).
[0163] For certain applications, it may be desirable to produce the
MAPKKK polypeptide or its kinase domain in an appropriate tissue,
at an appropriate level, or at an appropriate developmental time.
For this purpose, there are an assortment of gene promoters, each
with its own distinct characteristics embodied in its regulatory
sequences, shown to be regulated in response to the environment,
hormones, and/or developmental cues. These include gene promoters
that are responsible for heat-regulated gene expression (see, e.g.,
Callis et al., Plant Physiol. 88: 965, 1988; Takahashi and Komeda,
Mol. Gen. Genet. 219: 365, 1989; and Takahashi et al., Plant J. 2:
751, 1992), light-regulated gene expression (e.g., the Arabidopisis
Cab2 photosynthetic, leaf specific promoter described by Mitra at
el., Plant Mol. Biol. 12: 169-179, 1989; the pea rbcS-3A described
by Kuhlemeier et al., Plant Cell 1: 471, 1989; the maize rbcS
promoter described by Schffner and Sheen, Plant Cell 3: 997, 1991;
or the cholorphyll a/b-binding protein gene found in pea described
by Simpson et al., EMBO J. 4: 2723, 1985), hormone-regulated gene
expression (for example, the abscisic acid (ABA) responsive
sequences from the Em gene of wheat described by Marcotte et al.,
Plant Cell 1: 969, 1989; the ABA-inducible HVA1 and HVA22, and
rd29A promoters described for barley and Arabidopsis by Straub et
al., Plant Cell 6: 617, 1994, Shen et al., Plant Cell 7: 295, 1995;
and wound-induced gene expression (for example, of wunI described
by Siebertz et al., Plant Cell 1: 961, 1989), organ-specific gene
expression (for example, of the tuber-specific storage protein gene
described by Roshal et al., EMBO J. 6: 1155, 1987; the 23-kDa zein
gene from maize described by Schernthaner et al., EMBO J. 7: 1249,
1988; or the French bean .beta.-phaseolin gene described by Bustos
et al., Plant Cell 1: 839, 1989; the vegetative storage protein
promoter (soybean vspB) described by Sadka et al (Plant Cell 6:
737-749, 1994)), cycling promoters (e.g., the Arabidopsis cdc2a
promoter described by Hemerly et al., Proc Natl Acad Sci USA 89:
3295-3299, 1992), senescence-specific promoters (e.g., the
Arabidopsis SAG12 promoter described by Gan et al, Science: 270,
1986-1988, 1995), seed-specific promoters (for example,
endosperm-specific or embryo-specific promoters), or
pathogen-inducible promoters (for example, PR-1 or .beta.-1,3
glucanase promoters).
[0164] Plant expression vectors may also optionally include RNA
processing signals, e.g, introns, which have been shown to be
important for efficient RNA synthesis and accumulation (Callis et
al., Genes and Dev. 1: 1183, 1987). The location of the RNA splice
sequences can dramatically influence the level of transgene
expression in plants. In view of this fact, an intron may be
positioned upstream or downstream of a MAPKKK polypeptide or its
kinase-domain encoding sequence in the transgene to modulate levels
of gene expression.
[0165] In addition to the aforementioned 5' regulatory control
sequences, the expression vectors may also include regulatory
control regions which are generally present in the 3' regions of
plant genes (Thornburg et al., Proc. Natl. Acad. Sci. U.S.A. 84:
744, 1987; An et al., Plant Cell 1: 115, 1989). For example, the 3'
terminator region may be included in the expression vector to
increase stability of the mRNA. One such terminator region may be
derived from the PI-II terminator region of potato. In addition,
other commonly used terminators are derived from the octopine or
nopaline synthase signals.
[0166] The plant expression vector also typically contains a
dominant selectable marker gene used to identify those cells that
have become transformed. Useful selectable genes for plant systems
include genes encoding antibiotic resistance genes, for example,
those encoding resistance to hygromycin, kanamycin, bleomycin,
G418, streptomycin, or spectinomycin. Genes required for
photosynthesis may also be used as selectable markers in
photosynthetic-deficient strains. Finally, genes encoding herbicide
resistance may be used as selectable markers; useful herbicide
resistance genes include the bar gene encoding the enzyme
phosphinothricin acetyltransferase and conferring resistance to the
broad spectrum herbicide Basta.RTM. (Hoechst A G, Frankfurt,
Germany).
[0167] Efficient use of selectable markers is facilitated by a
determination of the susceptibility of a plant cell to a particular
selectable agent and a determination of the concentration of this
agent which effectively kills most, if not all, of the transformed
cells. Some useful concentrations of antibiotics for tobacco
transformation include, e.g., 75-100 .mu.g/mL (kanamycin), 20-50
.mu.g/mL (hygromycin), or 5-10 .mu.g/mL (bleomycin). A useful
strategy for selection of transformants for herbicide resistance is
described, e.g., by Vasil et al., supra.
[0168] It should be readily apparent to one skilled in the art of
molecular biology, especially in the field of plant molecular
biology, that the level of gene expression is dependent, not only
on the combination of promoters, RNA processing signals, and
terminator elements, but also on how these elements are used to
increase the levels of selectable marker gene expression.
[0169] Plant Transformation
[0170] Upon construction of the plant expression vector, several
standard methods are available for introduction of the vector into
a plant host, thereby generating a transgenic plant. These methods
include (1) Agrobacterium-mediated transformation (A. tumefociens
or A. rhizogenes) (see, e.g., Lichtenstein and Fuller, In: Genetic
Engineering, vol 6, P W J Rigby, ed, London, Academic Press, 1987;
and Lichtenstein, C. P., and Draper, J,. In: DNA Cloning, Vol II,
D. M. Glover, ed, Oxford, IRI Press, 1985)), (2) the particle
delivery system (see, e.g., Gordon-Kamm et al., Plant Cell 2:
603,1990); or BioRad Technical Bulletin 1687, supra), (3)
microinjection protocols (see, e.g., Green et al., supra), (4)
polyethylene glycol (PEG) procedures (see, e.g., Draper et al.,
Plant Cell Physiol. 23: 451, 1982; or e.g., Zhang and Wu, Theor.
Appl. Genet. 76: 835, 1988), (5) liposome-mediated DNA uptake (see,
e.g., Freeman et al., Plant Cell Physiol. 25: 1353, 1984), (6)
electroporation protocols (see, e.g., Gelvin et al., supra;
Dekeyser et al., supra; Fromm et al., Nature 319: 791, 1986; Sheen,
Plant Cell 2: 1027, 1990; or Jang and Sheen, Plant Cell 6: 1665,
1994), and (7) the vortexing method (see, e.g., Kindle supra). The
method of transformation is not critical to the invention. Any
method which provides for efficient transformation may be employed.
As newer methods are available to transform crops or other host
cells, they may be directly applied.
[0171] The following is an example outlining one particular
technique, an Agrobacterium-mediated plant transformation. By this
technique, the general process for manipulating genes to be
transferred into the genome of plant cells is carried out in two
phases. First, cloning and DNA modification steps are carried out
in E. coli, and the plasmid containing the gene construct of
interest is transferred by conjugation or electroporation into
Agrobacterium. Second, the resulting Agrobacterium strain is used
to transform plant cells. Thus, for the generalized plant
expression vector, the plasmid contains an origin of replication
that allows it to replicate in Agrobacterium and a high copy number
origin of replication functional in E. coli. This permits facile
production and testing of transgenes in E. coli prior to transfer
to Agrobacterium for subsequent introduction into plants.
Resistance genes can be carried on the vector, one for selection in
bacteria, for example, streptomycin, and another that will function
in plants, for example, a gene encoding kanamycin resistance or
herbicide resistance. Also present on the vector are restriction
endonuclease sites for the addition of one or more transgenes and
directional T-DNA border sequences which, when recognized by the
transfer functions of Agrobacterium, delimit the DNA region that
will be transferred to the plant.
[0172] In another example, plant cells may be transformed by
shooting into the cell tungsten microprojectiles on which cloned
DNA is precipitated. In the Biolistic Apparatus (Bio-Rad) used for
the shooting, a gunpowder charge (22 caliber Power Piston Tool
Charge) or an air-driven blast drives a plastic macroprojectile
through a gun barrel. An aliquot of a suspension of tungsten
particles on which DNA has been precipitated is placed on the front
of the plastic macroprojectile. The latter is fired at an acrylic
stopping plate that has a hole through it that is too small for the
macroprojectile to pass through. As a result, the plastic
macroprojectile smashes against the stopping plate, and the
tungsten microprojectiles continue toward their target through the
hole in the plate. For the instant invention the target can be any
plant cell, tissue, seed, or embryo. The DNA introduced into the
cell on the microprojectiles becomes integrated into either the
nucleus or the chloroplast.
[0173] In general, transfer and expression of transgenes in plant
cells are now routine practices to those skilled in the art, and
have become major tools to carry out gene expression studies in
plants and to produce improved plant varieties of agricultural or
commercial interest.
[0174] Transgenic Plant Regeneration
[0175] Plant cells transformed with a plant expression vector can
be regenerated, for example, from single cells, callus tissue, or
leaf discs according to standard plant tissue culture techniques.
It is well known in the art that various cells, tissues, and organs
from almost any plant can be successfully cultured to regenerate an
entire plant; such techniques are described, e.g., in Vasil supra;
Green et al., supra; Weissbach and Weissbach, supra; and Gelvin et
al., supra.
[0176] In one particular example, a cloned kinase domain of a
MAPKKK (or a MAPKKK polypeptide or a kinase-containing fragment
thereof) construct under the control of the nos promoter and the
nopaline synthase terminator and carrying a selectable marker (for
example, kanamycin resistance) is transformed into Agrobacterium.
Transformation of leaf discs (for example, of tobacco or potato
leaf discs), with vector-containing Agrobacterium is carried out as
described by Horsch et al. (Science 227: 1229, 1985). Putative
transformants are selected after a few weeks (for example 3 to 5
weeks) on plant tissue culture media containing kanamycin (e.g. 100
.mu.g/mL). Kanamycin-resistant shoots are then placed on plant
tissue culture media without hormones for root initiation.
Kanamycin-resistant plants are then selected for greenhouse growth.
If desired, seeds from self-fertilized transgenic plants can then
be sowed in a soil-less medium and grown in a greenhouse.
Kanamycin-resistant progeny are selected by sowing surfaced
sterilized seeds on hormone-free kanamycin-containing media.
Analysis for the integration of the transgene is accomplished by
standard techniques (see, for example, Ausubel et al. Supra; Gelvin
et al. Supra).
[0177] Transgenic plants expressing the selectable marker are then
screened for transmission of the transgene DNA by standard
immunology and DNA detection techniques. Each positive transgenic
plant and its transgenic progeny are unique in comparison to other
transgenic plants established with the same transgene. Integration
of the transgene DNA into the plant generic DNA is in most cases
random, and the site of integration can profoundly affect the
levels and the tissue and developmental patterns of transgene
expression. Consequently, a number of transgenic lines are usually
screened for each transgene to identify and select plants with the
most appropriate expression profiles.
[0178] Transgenic lines are evaluated for levels of transgene
expression. Expression at the RNA level is determined initially to
identify and quantitate expression-positive plants. Standard
techniques for RNA analysis are employed and include PCR
amplification assays using oligonucleotide primers designed to
amplify only transgene RNA templates and solution hybridization
assays using transgene-specific probes (see, e.g., Ausubel et al.,
supra). The RNA-positive plants are then analyzed for protein
expression by Western immunology analysis using specific antibodies
(see, e.g., Ausubel et al., supra). In addition, in situ
hybridizations and immunocytochemistry according to standard
protocols can be done using transgene-specific nucleotide probes
and antibodies, respectively, to localize sites of expression
within transgenic tissue.
[0179] In addition, if desired, once the recombinant MAPKKK
polypeptide or its kinase domain is expressed in any cell or in a
transgenic plant (for example, as described above), it may be
isolated, e.g., using affinity chromatography. In one example, an
anti-MAPKKK polypeptide antibody (e.g., produced as described in
Ausubel et al., supra, or by any standard technique) may be
attached to a column and used to isolate the polypeptide. Lysis and
fractionation of MAPKKK-producing cells prior to affinity
chromatography may be performed by standard methods (see, e.g.,
Ausubel et al., supra). Once isolated, the recombinant protein can,
if desired, be further purified, for example, by high performance
liquid chromatography (see, e.g., Fisher, Laboratory Techniques In
Biochemistry And Molecular Biology, eds., Work and Burdon,
Elsevier, 1980).
[0180] Engineering Stress-Protected Transgenic Plants
[0181] As discussed above, because constitutive MAPKKK activity has
been found to activate stress-inducible gene promoters such as GST6
(Chen et al., Plant J. 10: 955-966, 1996), HSP 18.2 (Sheen et al.,
Plant Journal 9: 777-784, 1995; Takahashi et al., Plant J. 2:
751-761, 1992), and AS1 (Neuhaus et al., EMBO J. 16: 2554-2564,
1997), constructs designed for the expression of a kinase domain of
a MAPKKK are useful for generating transgenic plants having an
increased level of tolerance to environmental stress. To achieve
such tolerance, it is important to express a kinase domain at an
effective level. For example, the Cab and RbcS gene promoters are
especially useful for the expression of a kinase domain in leaves;
and the 35S CaMV(-90) promoter is useful for the expression of the
kinase domain in the roots of a plant. Evaluation of the level of
stress protection conferred to a plant by expression of a DNA
sequence expressing a kinase domain of a MAPKKK polypeptide is
determined according to conventional methods and assays, for
example, as described below.
[0182] Salt or Osmotic Stresses
[0183] In one working example, tissue-specific expression of a
kinase domain of a MAPKKK, for example, the NPK1 kinase doain gene,
is used in tomato to enhance salt stress tolerance. For example, a
plant expression vector is constructed that contains an NPK1
protein kinase domain sequence expressed under the control of a
root specific promoter (for example, the 35S CaMV minimal
promoter). This expression vector is then used to transform tomato
according to standard methods (for example, those described
herein). To assess salt tolerance, transformed tomato plants and
appropriate controls are evaluated according to methods described
in Lilus et al. (BioTechnology 14: 177, 1996) and Tarczynski et al.
(Science 259: 508, 1993). Transgenic seeds containing the gene are
germinated in the presence of various salt or osmotically active
solutions to determine whether transgenic seeds demonstrate
increased tolerance or resistance to salt stress. Seedlings can
also be grown in hydroponic systems and challenged with salt or
agents of differing osmotic potentials at different, or all,
developmental stages in order to assess the response of a MAPKKK
kinase domain-expressing plants to these stresses. Growth and
physiological measurements are used to document the differences.
Transformed tomato plants having an increased level of salt
tolerance relative to control plants are taken as being useful in
the invention.
[0184] Drought
[0185] Transgenic plants expressing a recombinant MAPKKK kinase
domain are also assayed for tolerance to drought. Such analyses are
preferably done in artificial environments to simulate drought or
limited water conditions. In addition, transgenic seeds may be
planted outside during times when the natural environment would
impose the stress.
[0186] Cold
[0187] To demonstrate whether kinase domain expression can confer
increased germination ability under cool conditions, transgenic
seeds expressing a recombinant kinase domain of a MAPKKK
polypeptide are germinated under conditions similar to the standard
cold germination tests used in the seed industry. Alternatively,
transgenic seeds expressing such a kinase domain are planted under
cool seed bed conditions made cool by artificial environments or
naturally cool seed beds in the field. Additionally, plants
expressing the kinase domain are challenged during the seed
development period for cool night time temperatures to demonstrate
decreased inhibition of leaf or canopy activity as a result of cold
stress during this time of crop development. Young transgenic
seedlings are grown at low temperature, such as about 15.degree.
C., during the light and dark period. The expression of a
recombinant kinase domain in these seedlings not only allows for
increased growth, but also allows the seedlings to become
photosynthetic under such conditions, as well as to survive and
grow.
[0188] Frost or Freeze
[0189] Transgenic plants expressing a recombinant MAPKKK kinase
domain are also assayed for increased freezing tolerance at the
seedling stage as well as late season periods. These assays are
preferably done in artificial environments to simulate frost or
freeze events. In addition, transgenic seeds may be planted outside
during times when the natural environment would impose the stress,
e.g., at times when frost is present.
[0190] High Heat
[0191] Transgenic plants expressing a recombinant MAPKKK kinase
domain are also assayed in artificial environments or in the field
in order to demonstrate that the transgene confers resistance or
tolerance to heat.
[0192] Oxidative Stress
[0193] Oxidative stress is a major cause of damage in plants
exposed to stressful environmental conditions. Oxidative stress
results from the cellular damage caused by reactive oxygen species
that are generated in cells. These reactive oxygen molecules can
damage membranes, proteins, and nucleic acids. Transgenic plants
that express a recombinant kinase domain of a MAPKKK are analyzed
for the ability to improve resistance to oxidative stress.
[0194] Chemical Stress
[0195] Transgenic plants expressing a recombinant kinase domain of
a MAPKKK are assayed in artificial environments or in the field to
demonstrate that the transgene confers resistance or tolerance to
chemicals (e.g., herbicides, ozone, or pollutants) or metals (e.g.,
copper or zinc). Transgenic plants having an increased ability to
grow in the presence of higher concentrations of the toxic
compound, as compared to non-transgenic plants, are useful in the
invention.
[0196] Engineering Transgenic Plants Having Increased
Yield/Productivity
[0197] To test the ability of the genes and domains described
herein to improve crop yield or productivity, seeds of transgenic
plants expressing a recombinant kinase domain of a MAPKKK are
planted in test plots, and their agronomic performance is compared
to standard plants using techniques familiar to those of skill in
the art. Optionally included in this comparison are plants of
similar genetic background without the transgene. A yield benefit
is observed and plants exhibiting the increased yield are advanced
for commercialization.
[0198] In addition, transgenic plants expressing a recombinant
kinase domain are field tested for agronomic performance under
conditions, including, but not limited to, limited or inadequate
water availability. When compared to nontransgenic plants,
transgenic plants expressing the kinase domain exhibit higher yield
than their non-transgenic counterparts under non-optimal growing
conditions.
[0199] Engineering Transgenic Plants Having Altered Seed
Development
[0200] Constitutive expression of a recombinant kinase domain of a
MAPKKK is useful for the production of seedless fruits and
vegetables (e.g. watermelon, grape, tomato, and eggplant).
Alternatively, by using a cycling promoter (e.g., a cyclin A or
cyclin D promoter), expression of a recombinant MAPKKK or its
kinase domain can be used to promote cell division resulting in the
production of larger seeds. Furthermore, expression of a kinase
domain under the control of an embryo- or endosperm-specific
promoter can be used to control embryo or endosperm development
(for example, the production of more endosperm and little or no
embryo; or for the production of a larger embryo, but little or no
endosperm).
[0201] Use
[0202] The invention described herein is useful for a variety of
agricultural and commercial purposes including, but not limited to,
improving resistance or tolerance to stress, increasing crop
yields, improving crop and ornamental quality, and reducing
agricultural production costs. In particular, ectopic expression of
a kinase domain of a MAPKKK polypeptide (or a MAPKKK polypeptide or
a kinase domain-containing fragment thereof) (FIGS. 11, 12, 13, 14,
15, and 16; SEQ ID NOS: 7-22) in a plant cell provides resistance
to environmental stress and can be used to protect plants from
adverse conditions that reduces plant productivity and viability.
The invention therefore provides resistance to a variety of adverse
environmental stresses to plants, especially crop plants, most
especially crop plants such as tomato, potato, cotton, pepper,
maize, wheat, rice, and legumes such as soybean, or any crop plant
that is susceptible to an adverse stress. For example, transgenic
maize and soybean may be genetically engineered to express a kinase
domain of a MAPKKK (e.g., NPK1 or an ANP such as ANP1, ANP2, or
ANP3) according to standard methods, such as those described in
Adams et al. (U.S. Pat. No. 5,550,318) and Collins et al. (U.S.
Pat. No. 5,024,944). Methods for transforming wheat with such genes
are described in Fry et al. (U.S. Pat. No. 5,631,152).
Other Embodiments
[0203] The invention further includes the use of analogs of any
naturally-occurring MAPKKK polypeptide. Analogs can differ from the
naturally-occurring kinase domain by amino acid sequence
differences, by post-translational modifications, or by both.
Analogs of the invention will generally exhibit at least 40%, more
preferably 50%, and most preferably 60% or even having 70%, 80%, or
90% identity with all or part of a naturally-occurring kinase
domain amino acid sequence. The length of sequence comparison is at
least 15 amino acid residues, preferably at least amino acid
residues, and more preferably more than 35 amino acid residues.
Modifications include in vivo and in vitro chemical derivatization
of polypeptides, e.g., acetylation, carboxylation, phosphorylation,
or glycosylation; such modifications may occur during polypeptide
synthesis or processing or following treatment with isolated
modifying enzymes. Analogs can also differ from the
naturally-occurring kinase domain polypeptide by alterations in
primary sequence. These include genetic variants, both natural and
induced (for example, resulting from random mutagenesis by
irradiation or exposure to ethyl methylsulfate or by site-specific
mutagenesis as described in Sambrook, Fritsch and Maniatis,
Molecular Cloning: A Laboratory Manual (2d ed.), CSH Press, 1989,
or Ausubel et al., supra). Also included are cyclized peptides,
molecules, and analogs which contain residues other than L-amino
acids, e.g., D-amino acids or non-naturally occurring or synthetic
amino acids, e.g., .beta. or .gamma. amino acids.
[0204] In addition, the invention also includes kinase domain
fragments. As used herein, the term "fragment," means at least 50
contiguous amino acids, preferably at least 130 contiguous amino
acids, more preferably at least 160 contiguous amino acids, and
most preferably at least 190 to 230 or more contiguous amino acids.
Fragments of kinase domain polypeptides can be generated by methods
known to those skilled in the art or may result from normal protein
processing (e.g., removal of amino acids from the nascent
polypeptide that are not required for biological activity or
removal of amino acids by alternative mRNA splicing or alternative
protein processing events). In preferred embodiments, a kinase
domain fragment (e.g., a fragment of NPK1, ANP1, ANP2, or ANP3) is
capable of activating the transcription of a stress protective
gene, repressing the transcription of an early auxin response gene
transcription, or altering seed development. Methods for evaluating
such activity are described herein.
[0205] All publications and patent applications mentioned in this
specification are herein incorporated by reference to the same
extent as if each independent publication or patent application was
specifically and individually indicated to be incorporated by
reference.
Sequence CWU 1
1
22 1 21 DNA Artificial Sequence Oligonucleotide primer 1 ttgtctccca
aagggagaca a 21 2 21 DNA Artificial Sequence Oligonucleotide primer
2 ttgtctccca aagggagata a 21 3 27 DNA Artificial Sequence
Oligonucleotide primer 3 tctcgccgtc atgcaggttc tgattgc 27 4 29 DNA
Artificial Sequence Oligonucleotide primer 4 gcaatcagaa cctgcatgac
ggcgagaag 29 5 25 DNA Artificial Sequence Oligonucleotide primer 5
tactcgctat aatggaggtt tcgat 25 6 29 DNA Artificial Sequence
Oligonucleotide primer 6 cgcaatcgaa acctccatta tagcgagta 29 7 661
PRT Arabidopsis thaliana 7 Gly Ser Val Arg Arg Ser Leu Val Phe Arg
Pro Ser Ser Asp Asp Asp 1 5 10 15 Asn Gln Glu Asn Gln Pro Pro Phe
Pro Gly Val Leu Ala Asp Lys Ile 20 25 30 Thr Ser Cys Ile Arg Lys
Ser Lys Ile Phe Ile Lys Pro Ser Phe Ser 35 40 45 Pro Pro Pro Pro
Ala Asn Thr Val Asp Met Ala Pro Pro Ile Ser Trp 50 55 60 Arg Lys
Gly Gln Leu Ile Gly Arg Gly Ala Phe Gly Thr Val Tyr Met 65 70 75 80
Gly Met Asn Leu Asp Ser Gly Glu Leu Leu Ala Val Lys Gln Val Leu 85
90 95 Ile Ala Ala Asn Phe Ala Ser Lys Glu Lys Thr Gln Ala His Ile
Gln 100 105 110 Glu Leu Glu Glu Glu Val Lys Leu Leu Lys Asn Leu Ser
His Pro Asn 115 120 125 Ile Val Arg Tyr Leu Gly Thr Val Arg Glu Asp
Asp Thr Leu Asn Ile 130 135 140 Leu Leu Glu Phe Val Pro Gly Gly Ser
Ile Ser Ser Leu Leu Glu Lys 145 150 155 160 Phe Gly Pro Phe Pro Glu
Ser Val Val Arg Thr Tyr Thr Arg Gln Leu 165 170 175 Leu Leu Gly Leu
Glu Tyr Leu His Asn His Ala Ile Met His Arg Asp 180 185 190 Ile Lys
Gly Ala Asn Ile Leu Val Asp Asn Lys Gly Cys Ile Lys Leu 195 200 205
Ala Asp Phe Gly Ala Ser Lys Gln Val Ala Glu Leu Ala Thr Met Thr 210
215 220 Gly Ala Lys Ser Met Lys Gly Thr Pro Tyr Trp Met Ala Pro Glu
Val 225 230 235 240 Ile Leu Gln Thr Gly His Ser Phe Ser Ala Asp Ile
Trp Ser Val Gly 245 250 255 Cys Thr Val Ile Glu Met Val Thr Gly Lys
Ala Pro Trp Ser Gln Gln 260 265 270 Tyr Lys Glu Val Ala Ala Ile Phe
Phe Ile Gly Thr Thr Lys Ser His 275 280 285 Pro Pro Ile Pro Asp Thr
Leu Ser Ser Asp Ala Lys Asp Phe Leu Leu 290 295 300 Lys Cys Leu Gln
Glu Val Pro Asn Leu Arg Pro Thr Ala Ser Glu Leu 305 310 315 320 Leu
Lys His Pro Phe Val Met Gly Lys His Lys Glu Ser Ala Ser Thr 325 330
335 Asp Leu Gly Ser Val Leu Asn Asn Leu Ser Thr Pro Leu Pro Leu Gln
340 345 350 Ile Asn Asn Thr Lys Ser Thr Pro Asp Ser Thr Cys Asp Asp
Val Gly 355 360 365 Asp Met Cys Asn Phe Gly Ser Leu Asn Tyr Ser Leu
Val Asp Pro Val 370 375 380 Lys Ser Ile Gln Asn Lys Asn Leu Trp Gln
Gln Asn Asp Asn Gly Gly 385 390 395 400 Asp Glu Asp Asp Met Cys Leu
Ile Asp Asp Glu Asn Phe Leu Thr Phe 405 410 415 Asp Gly Glu Met Ser
Ser Thr Leu Glu Lys Asp Cys His Leu Lys Lys 420 425 430 Ser Cys Asp
Asp Ile Ser Asp Met Ser Ile Ala Leu Lys Ser Lys Phe 435 440 445 Asp
Glu Ser Pro Gly Asn Gly Glu Lys Glu Ser Thr Met Ser Met Glu 450 455
460 Cys Asp Gln Pro Ser Tyr Ser Glu Asp Asp Asp Glu Leu Thr Glu Ser
465 470 475 480 Lys Ile Lys Ala Phe Leu Asp Glu Lys Ala Ala Asp Leu
Lys Lys Leu 485 490 495 Gln Thr Pro Leu Tyr Glu Glu Phe Tyr Asn Ser
Leu Ile Thr Phe Ser 500 505 510 Pro Ser Cys Met Glu Ser Asn Leu Ser
Asn Ser Lys Arg Glu Asp Thr 515 520 525 Ala Arg Gly Phe Leu Lys Leu
Pro Pro Lys Ser Arg Ser Pro Ser Arg 530 535 540 Gly Pro Leu Gly Gly
Ser Pro Ser Arg Ala Thr Asp Ala Thr Ser Cys 545 550 555 560 Ser Lys
Ser Pro Gly Ser Gly Gly Ser Arg Glu Leu Asn Ile Asn Asn 565 570 575
Gly Gly Asp Glu Ala Ser Gln Asp Gly Val Ser Ala Arg Val Thr Asp 580
585 590 Trp Arg Gly Leu Val Val Asp Thr Lys Gln Glu Leu Ser Gln Cys
Val 595 600 605 Ala Leu Ser Glu Ile Glu Lys Lys Trp Lys Glu Glu Leu
Asp Gln Glu 610 615 620 Leu Glu Arg Lys Arg Gln Glu Ile Met Arg Gln
Ala Gly Leu Gly Ser 625 630 635 640 Ser Pro Arg Asp Arg Gly Met Ser
Arg Gln Arg Glu Lys Ser Arg Phe 645 650 655 Ala Ser Pro Gly Lys 660
8 2155 DNA Arabidopsis thaliana 8 cggctccgtt cgtcgatcgc ttgttttccg
tccttcttcc gacgacgata accaggagaa 60 ccagcctccg tttcccggtg
ttctcgccga taagatcacc tcttgcatcc gcaaatcgaa 120 gatttttatc
aaaccctcct tctcgcctcc tcctcctgct aacactgtag acatggcacc 180
tccgatttcg tggaggaaag gtcagttaat tggtcgcggc gcgtttggta cggtgtacat
240 gggtatgaat cttgactccg gggagcttct cgccgtcaaa caggttctga
ttgcagccaa 300 ttttgcttcc aaggaaaaga ctcaggctca tattcaggag
cttgaagaag aagttaagct 360 tcttaaaaat ctctcccatc ctaatatagt
tagatatttg ggtacagtga gggaagatga 420 taccctgaat atccttctcg
agtttgttcc cggtggatcg atatcatcgc tcttggagaa 480 atttggacct
tttcctgaat cagttgtccg gacatacaca aggcaactgc ttttagggtt 540
ggagtacctg cacaatcatg caattatgca cagagacatt aagggggcta atatccttgt
600 ggataataaa ggatgcatta agcttgctga ttttggtgca tccaaacaag
tagctgagtt 660 ggctacgatg actggtgcaa aatctatgaa agggacacca
tattggatgg ctccggaagt 720 tatccttcaa actggacata gcttctctgc
tgacatatgg agcgtcggct gtacagttat 780 tgaaatggtg actgggaagg
ctccttggag tcagcagtat aaagaggttg ctgctatctt 840 cttcatagga
acaacaaaat cacatcctcc aatacctgat actctctcct ctgatgcaaa 900
agattttctg ctcaagtgtc tgcaggaggt accaaatctg cggccaaccg catctgagct
960 actaaagcat ccttttgtta tggggaaaca caaggagtct gcttctactg
atcttggttc 1020 tgtcctgaac aatcttagca ctccactacc gttacagata
aataacacca agagcactcc 1080 agattctact tgcgacgatg taggtgacat
gtgtaacttt ggcagtttga attattcact 1140 tgtagatcct gtgaaatcaa
tccaaaacaa aaatttatgg caacaaaatg ataatggagg 1200 tgatgaagac
gatatgtgtt tgatagatga tgagaatttc ttgacatttg acggagaaat 1260
gagttctacc cttgaaaaag attgtcatct gaagaagagc tgtgatgaca taagtgatat
1320 gtccattgct ttgaagtcca aatttgacga aagtcctggt aatggagaga
aagagtctac 1380 aatgagcatg gaatgtgacc aaccttcata ctcagaggat
gatgatgagc tgaccgagtc 1440 aaaaattaaa gctttcttag atgagaaggc
tgcagatcta aagaagttac agactcctct 1500 ctatgaagaa ttctacaata
gtttgatcac attctctccc agttgtatgg agagtaattt 1560 aagtaacagt
aaaagagagg acactgctcg tggtttcctg aaactgcctc caaaaagcag 1620
gtcaccgagt cggggccctc ttggtggttc accttcaaga gcaacagacg caactagttg
1680 ttccaagagc ccaggaagtg gaggtagtcg tgaattgaat attaacaatg
gaggtgatga 1740 agcttcacag gatggtgtat cagcacgggt cacagactgg
aggggcctcg ttgttgacac 1800 taagcaggaa ttaagccagt gtgttgcttt
gtcagagata gagaagaagt ggaaggaaga 1860 gcttgatcaa gaactggaaa
gaaagcgaca agaaatcatg cgccaagcag ggttgggatc 1920 atccccaaga
gacagaggca tgagccgaca gagagagaag tcgaggtttg catcaccagg 1980
aaaatgactt gcacaaaaag tctccggctt tttgattttt gattgctcaa ctagtatata
2040 tatctgtaac tcttatctcg ctgtgatgaa aagtagacac gaggtttggt
ctgaatatat 2100 gattctgaac tggttgttga aggtattaga tgtgtgtaat
gtgagtgtcg ggtgc 2155 9 268 PRT Arabidopsis thaliana 9 Pro Pro Ile
Ser Trp Arg Lys Gly Gln Leu Ile Gly Arg Gly Ala Phe 1 5 10 15 Gly
Thr Val Tyr Met Gly Met Asn Leu Asp Ser Gly Glu Leu Leu Ala 20 25
30 Val Lys Gln Val Leu Ile Ala Ala Asn Phe Ala Ser Lys Glu Lys Thr
35 40 45 Gln Ala His Ile Gln Glu Leu Glu Glu Glu Val Lys Leu Leu
Lys Asn 50 55 60 Leu Ser His Pro Asn Ile Val Arg Tyr Leu Gly Thr
Val Arg Glu Asp 65 70 75 80 Asp Thr Leu Asn Ile Leu Leu Glu Phe Val
Pro Gly Gly Ser Ile Ser 85 90 95 Ser Leu Leu Glu Lys Phe Gly Pro
Phe Pro Glu Ser Val Val Arg Thr 100 105 110 Tyr Thr Arg Gln Leu Leu
Leu Gly Leu Glu Tyr Leu His Asn His Ala 115 120 125 Ile Met His Arg
Asp Ile Lys Gly Ala Asn Ile Leu Val Asp Asn Lys 130 135 140 Gly Cys
Ile Lys Leu Ala Asp Phe Gly Ala Ser Lys Gln Val Ala Glu 145 150 155
160 Leu Ala Thr Met Thr Gly Ala Lys Ser Met Lys Gly Thr Pro Tyr Trp
165 170 175 Met Ala Pro Glu Val Ile Leu Gln Thr Gly His Ser Phe Ser
Ala Asp 180 185 190 Ile Trp Ser Val Gly Cys Thr Val Ile Glu Met Val
Thr Gly Lys Ala 195 200 205 Pro Trp Ser Gln Gln Tyr Lys Glu Val Ala
Ala Ile Phe Phe Ile Gly 210 215 220 Thr Thr Lys Ser His Pro Pro Ile
Pro Asp Thr Leu Ser Ser Asp Ala 225 230 235 240 Lys Asp Phe Leu Leu
Lys Cys Leu Gln Glu Val Pro Asn Leu Arg Pro 245 250 255 Thr Ala Ser
Glu Leu Leu Lys His Pro Phe Val Met 260 265 10 802 DNA Arabidopsis
thaliana 10 tccgatttcg tggaggaaag gtcagttaat tggtcgcggc gcgtttggta
cggtgtacat 60 gggtatgaat cttgactccg gggagcttct cgccgtcaaa
caggttctga ttgcagccaa 120 ttttgcttcc aaggaaaaga ctcaggctca
tattcaggag cttgaagaag aagttaagct 180 tcttaaaaat ctctcccatc
ctaatatagt tagatatttg ggtacagtga gggaagatga 240 taccctgaat
atccttctcg agtttgttcc cggtggatcg atatcatcgc tcttggagaa 300
atttggacct tttcctgaat cagttgtccg gacatacaca aggcaactgc ttttagggtt
360 ggagtacctg cacaatcatg caattatgca cagagacatt aagggggcta
atatccttgt 420 ggataataaa ggatgcatta agcttgctga ttttggtgca
tccaaacaag tagctgagtt 480 ggctacgatg actggtgcaa aatctatgaa
agggacacca tattggatgg ctccggaagt 540 tatccttcaa actggacata
gcttctctgc tgacatatgg agcgtcggct gtacagttat 600 tgaaatggtg
actgggaagg ctccttggag tcagcagtat aaagaggttg ctgctatctt 660
cttcatagga acaacaaaat cacatcctcc aatacctgat actctctcct ctgatgcaaa
720 agattttctg ctcaagtgtc tgcaggaggt accaaatctg cggccaaccg
catctgagct 780 actaaagcat ccttttgtta tg 802 11 642 PRT Arabidopsis
thaliana 11 Arg Ser Leu Val Phe Arg Ser Thr Thr Asp Asp Glu Asn Gln
Glu Asn 1 5 10 15 His Pro Pro Pro Phe Pro Ser Leu Leu Ala Asp Lys
Ile Thr Ser Cys 20 25 30 Ile Arg Lys Ser Met Val Phe Ala Lys Ser
Gln Ser Pro Pro Asn Asn 35 40 45 Ser Thr Val Gln Ile Lys Pro Pro
Ile Arg Trp Arg Lys Gly Gln Leu 50 55 60 Ile Gly Arg Gly Ala Phe
Gly Thr Val Tyr Met Gly Met Asn Leu Asp 65 70 75 80 Ser Gly Glu Leu
Leu Ala Val Lys Gln Ala Leu Ile Thr Ser Asn Cys 85 90 95 Ala Ser
Lys Glu Lys Thr Gln Ala His Ile Gln Glu Leu Glu Glu Glu 100 105 110
Val Lys Leu Leu Lys Asn Leu Ser His Pro Asn Ile Val Arg Tyr Leu 115
120 125 Gly Thr Val Arg Glu Asp Glu Thr Leu Asn Ile Leu Leu Glu Phe
Val 130 135 140 Pro Gly Gly Ser Ile Ser Ser Leu Leu Glu Lys Phe Gly
Ala Phe Pro 145 150 155 160 Glu Ser Val Val Arg Thr Tyr Thr Asn Gln
Leu Leu Leu Gly Leu Glu 165 170 175 Tyr Leu His Asn His Ala Ile Met
His Arg Asp Ile Lys Gly Ala Asn 180 185 190 Ile Leu Val Asp Asn Gln
Gly Cys Ile Lys Leu Ala Asp Phe Gly Ala 195 200 205 Ser Lys Gln Val
Ala Glu Leu Ala Thr Ile Ser Gly Ala Lys Ser Met 210 215 220 Lys Gly
Thr Pro Tyr Trp Met Ala Pro Glu Val Ile Leu Gln Thr Gly 225 230 235
240 His Ser Phe Ser Ala Asp Ile Trp Ser Val Gly Cys Thr Val Ile Glu
245 250 255 Met Val Thr Gly Lys Ala Pro Trp Ser Gln Gln Tyr Lys Glu
Ile Ala 260 265 270 Ala Ile Phe His Ile Gly Thr Thr Lys Ser His Pro
Pro Ile Pro Asp 275 280 285 Asn Ile Ser Ser Asp Ala Asn Asp Phe Leu
Leu Lys Cys Leu Gln Gln 290 295 300 Glu Pro Asn Leu Arg Pro Thr Ala
Ser Glu Leu Leu Lys His Pro Phe 305 310 315 320 Val Thr Gly Lys Gln
Lys Glu Ser Ala Ser Lys Asp Leu Thr Ser Phe 325 330 335 Met Asp Asn
Ser Cys Ser Pro Leu Pro Ser Glu Leu Thr Asn Ile Thr 340 345 350 Ser
Tyr Gln Thr Ser Thr Ser Asp Asp Val Gly Asp Ile Cys Asn Leu 355 360
365 Gly Ser Leu Thr Cys Thr Leu Ala Phe Pro Glu Lys Ser Ile Gln Asn
370 375 380 Asn Ser Leu Cys Leu Lys Ser Asn Asn Gly Tyr Asp Asp Asp
Asp Asp 385 390 395 400 Asn Asp Met Cys Leu Ile Asp Asp Glu Asn Phe
Leu Thr Tyr Asn Gly 405 410 415 Glu Thr Gly Pro Ser Leu Asp Asn Asn
Thr Asp Ala Lys Lys Ser Cys 420 425 430 Asp Thr Met Ser Glu Ile Ser
Asp Ile Leu Lys Cys Lys Phe Asp Glu 435 440 445 Asn Ser Gly Asn Gly
Glu Thr Glu Thr Lys Val Ser Met Glu Val Asp 450 455 460 His Pro Ser
Tyr Ser Glu Asp Glu Asn Glu Leu Thr Glu Ser Lys Ile 465 470 475 480
Lys Ala Phe Leu Asp Asp Lys Ala Ala Glu Leu Lys Lys Leu Gln Thr 485
490 495 Pro Leu Tyr Glu Glu Phe Tyr Asn Gly Met Ile Thr Cys Ser Pro
Ile 500 505 510 Cys Met Glu Ser Asn Ile Asn Asn Asn Lys Arg Glu Glu
Ala Pro Arg 515 520 525 Gly Phe Leu Lys Leu Pro Pro Lys Ser Arg Ser
Pro Ser Gln Gly His 530 535 540 Ile Gly Arg Ser Pro Ser Arg Ala Thr
Asp Ala Ala Cys Cys Ser Lys 545 550 555 560 Ser Pro Glu Ser Gly Asn
Ser Ser Gly Ala Pro Lys Asn Ser Asn Ala 565 570 575 Ser Ala Gly Ala
Glu Gln Glu Ser Asn Ser Gln Ser Val Ala Leu Ser 580 585 590 Glu Ile
Glu Arg Lys Trp Lys Glu Glu Leu Asp Gln Glu Leu Glu Arg 595 600 605
Lys Arg Arg Glu Ile Thr Arg Gln Ala Gly Met Gly Ser Ser Pro Arg 610
615 620 Asp Arg Ser Leu Ser Arg His Arg Glu Lys Ser Arg Phe Ala Ser
Pro 625 630 635 640 Gly Lys 12 2193 DNA Arabidopsis thaliana 12
cgctcacttg tcttccgttc taccaccgac gatgagaatc aagagaatca tcctcctccg
60 tttccttctc tcctcgccga taaaatcact tcctgtatcc gcaaatcaat
ggttttcgcc 120 aaatcccagt cacctccgaa taactccacc gtacaaatca
aacctccgat tcggtggcgg 180 aaaggtcagt taattggccg tggcgctttt
ggtactgtgt atatgggtat gaatctcgat 240 tccggtgagc ttctcgccgt
taaacaggct ctgattacat ctaattgtgc atccaaggaa 300 aaaactcagg
ctcatattca ggagcttgaa gaggaagtga agctactcaa gaatctctct 360
catccaaata tagttagata tttgggtacg gtgagggaag atgaaacttt gaatatcttg
420 cttgaatttg ttcctggtgg atctatatct tcactcttgg agaaatttgg
agcctttcct 480 gaatctgttg ttcggacata cacgaaccaa ctgcttttgg
gattggagta ccttcataat 540 catgccatta tgcaccgtga cattaagggt
gctaatatcc ttgtggataa tcaaggatgc 600 attaaacttg ctgattttgg
tgcgtccaaa caggtagcgg agttggctac tatttcgggt 660 gccaaatcta
tgaaaggaac tccctattgg atggctccag aagttattct tcaaaccggg 720
catagctttt ctgctgatat ttggagtgta ggatgcacag tgattgaaat ggtgactgga
780 aaagctcctt ggagccagca atataaagag attgctgcta ttttccacat
tggaacgacg 840 aaatcgcatc ctccaatccc tgacaatatc tcctctgacg
caaatgattt tttgctcaag 900 tgtctgcagc aggaaccaaa tctgcggcca
accgcttctg agctgctaaa gcatccattt 960 gttacgggca aacagaagga
atctgcgtct aaagatctta cttcatttat ggacaattca 1020 tgcagtcctt
taccatcaga gttgactaac attacgagct atcaaacatc tacgagtgac 1080
gatgtaggag acatctgtaa cttgggtagt ctgacttgta cacttgcttt ccctgagaaa
1140 tcaatccaaa ataacagttt gtgtctgaaa agtaataacg ggtatgatga
cgatgatgat 1200 aatgatatgt gtttgattga cgatgagaat ttcttgacat
ataatggaga gactggccct 1260 agtcttgaca ataatactga tgccaagaag
agctgtgata ccatgagtga gatctctgat 1320 attttgaagt gcaaatttga
cgaaaattct ggaaacggag aaacagagac gaaagttagt 1380 atggaagttg
accatccatc atactcggag gatgaaaatg agctgactga gtcgaaaatc 1440
aaagctttct tagatgacaa ggctgcagag ttaaagaagt tacagacgcc tctgtacgaa
1500 gaattctaca acggtatgat cacatgctcc cccatctgca tggagagtaa
catcaataac 1560 aataaacgag aggaggcacc tcgtggtttc
ttgaaactgc ctccaaaaag tcggtctccg 1620 agtcagggcc atattggtcg
atcaccttct agagcaacag atgcagcctg ttgttccaag 1680 agtccagaaa
gtggtaatag ctctggtgcc ccgaagaata gcaatgcaag tgctggtgct 1740
gaacaagaat caaacagtca aagtgtcgcg ctgtcggaga tagagaggaa gtggaaggaa
1800 gagcttgatc aagaacttga aagaaagcga agagagatta cacggcaagc
agggatggga 1860 tcatccccga gagatagaag cttgagccga catagagaga
agtcaagatt tgcatctcca 1920 ggcaaatgat ctgtacaaaa gaaaagcagc
caattttgca cttttgtctg taaggcttgt 1980 attgcttttg atctttcgat
ttgctcatct agtatatatg atatagacat aaaattgtgc 2040 caacttaaag
tttgaatata tatagatagc taaactattt gcttaagtag ggtgtgatgt 2100
gagaatgttg gtgcatattg agtgttaagc caaccacaga acaaatattt tcgagaaatt
2160 atcgaaagct ttgtttactt tcggtccggt ccg 2193 13 268 PRT
Arabidopsis thaliana 13 Pro Pro Ile Arg Trp Arg Lys Gly Gln Leu Ile
Gly Arg Gly Ala Phe 1 5 10 15 Gly Thr Val Tyr Met Gly Met Asn Leu
Asp Ser Gly Glu Leu Leu Ala 20 25 30 Val Lys Gln Ala Leu Ile Thr
Ser Asn Cys Ala Ser Lys Glu Lys Thr 35 40 45 Gln Ala His Ile Gln
Glu Leu Glu Glu Glu Val Lys Leu Leu Lys Asn 50 55 60 Leu Ser His
Pro Asn Ile Val Arg Tyr Leu Gly Thr Val Arg Glu Asp 65 70 75 80 Glu
Thr Leu Asn Ile Leu Leu Glu Phe Val Pro Gly Gly Ser Ile Ser 85 90
95 Ser Leu Leu Glu Lys Phe Gly Ala Phe Pro Glu Ser Val Val Arg Thr
100 105 110 Tyr Thr Asn Gln Leu Leu Leu Gly Leu Glu Tyr Leu His Asn
His Ala 115 120 125 Ile Met His Arg Asp Ile Lys Gly Ala Asn Ile Leu
Val Asp Asn Gln 130 135 140 Gly Cys Ile Lys Leu Ala Asp Phe Gly Ala
Ser Lys Gln Val Ala Glu 145 150 155 160 Leu Ala Thr Ile Ser Gly Ala
Lys Ser Met Lys Gly Thr Pro Tyr Trp 165 170 175 Met Ala Pro Glu Val
Ile Leu Gln Thr Gly His Ser Phe Ser Ala Asp 180 185 190 Ile Trp Ser
Val Gly Cys Thr Val Ile Glu Met Val Thr Gly Lys Ala 195 200 205 Pro
Trp Ser Gln Gln Tyr Lys Glu Ile Ala Ala Ile Phe His Ile Gly 210 215
220 Thr Thr Lys Ser His Pro Pro Ile Pro Asp Asn Ile Ser Ser Asp Ala
225 230 235 240 Asn Asp Phe Leu Leu Lys Cys Leu Gln Gln Glu Pro Asn
Leu Arg Pro 245 250 255 Thr Ala Ser Glu Leu Leu Lys His Pro Phe Val
Thr 260 265 14 804 DNA Arabidopsis thaliana 14 cctccgattc
ggtggcggaa aggtcagtta attggccgtg gcgcttttgg tactgtgtat 60
atgggtatga atctcgattc cggtgagctt ctcgccgtta aacaggctct gattacatct
120 aattgtgcat ccaaggaaaa aactcaggct catattcagg agcttgaaga
ggaagtgaag 180 ctactcaaga atctctctca tccaaatata gttagatatt
tgggtacggt gagggaagat 240 gaaactttga atatcttgct tgaatttgtt
cctggtggat ctatatcttc actcttggag 300 aaatttggag cctttcctga
atctgttgtt cggacataca cgaaccaact gcttttggga 360 ttggagtacc
ttcataatca tgccattatg caccgtgaca ttaagggtgc taatatcctt 420
gtggataatc aaggatgcat taaacttgct gattttggtg cgtccaaaca ggtagcggag
480 ttggctacta tttcgggtgc caaatctatg aaaggaactc cctattggat
ggctccagaa 540 gttattcttc aaaccgggca tagcttttct gctgatattt
ggagtgtagg atgcacagtg 600 attgaaatgg tgactggaaa agctccttgg
agccagcaat ataaagagat tgctgctatt 660 ttccacattg gaacgacgaa
atcgcatcct ccaatccctg acaatatctc ctctgacgca 720 aatgattttt
tgctcaagtg tctgcagcag gaaccaaatc tgcggccaac cgcttctgag 780
ctgctaaagc atccatttgt tacg 804 15 651 PRT Arabidopsis thaliana 15
Met Gln Asp Ile Leu Gly Ser Val Arg Arg Ser Leu Val Phe Arg Ser 1 5
10 15 Ser Leu Ala Gly Asp Asp Gly Thr Ser Gly Gly Gly Leu Ser Gly
Phe 20 25 30 Val Gly Lys Ile Asn Ser Ser Ile Arg Ser Ser Arg Ile
Gly Leu Phe 35 40 45 Ser Lys Pro Pro Pro Gly Leu Pro Ala Pro Arg
Lys Glu Glu Ala Pro 50 55 60 Ser Ile Arg Trp Arg Lys Gly Glu Leu
Ile Gly Cys Gly Ala Phe Gly 65 70 75 80 Arg Val Tyr Met Gly Met Asn
Leu Asp Ser Gly Glu Leu Leu Ala Ile 85 90 95 Lys Gln Val Leu Ile
Ala Pro Ser Ser Ala Ser Lys Glu Lys Thr Gln 100 105 110 Gly His Ile
Arg Glu Leu Glu Glu Glu Val Gln Leu Leu Lys Asn Leu 115 120 125 Ser
His Pro Asn Ile Val Arg Tyr Leu Gly Thr Val Arg Glu Ser Asp 130 135
140 Ser Leu Asn Ile Leu Met Glu Phe Val Pro Gly Gly Ser Ile Ser Ser
145 150 155 160 Leu Leu Glu Lys Phe Gly Ser Phe Pro Glu Pro Val Ile
Ile Met Tyr 165 170 175 Thr Lys Gln Leu Leu Leu Gly Leu Glu Tyr Leu
His Asn Asn Gly Ile 180 185 190 Met His Arg Asp Ile Lys Gly Ala Asn
Ile Leu Val Asp Asn Lys Gly 195 200 205 Cys Ile Arg Leu Ala Asp Phe
Gly Ala Ser Lys Lys Val Val Glu Leu 210 215 220 Ala Thr Val Asn Gly
Ala Lys Ser Met Lys Gly Thr Pro Tyr Trp Met 225 230 235 240 Ala Pro
Glu Val Ile Leu Gln Thr Gly His Ser Phe Ser Ala Asp Ile 245 250 255
Trp Ser Val Gly Cys Thr Val Ile Glu Met Ala Thr Gly Lys Pro Pro 260
265 270 Trp Ser Glu Gln Tyr Gln Gln Phe Ala Ala Val Leu His Ile Gly
Arg 275 280 285 Thr Lys Ala His Pro Pro Ile Pro Glu Asp Leu Ser Pro
Glu Ala Lys 290 295 300 Asp Phe Leu Met Lys Cys Leu His Lys Glu Pro
Ser Leu Arg Leu Ser 305 310 315 320 Ala Thr Glu Leu Leu Gln His Pro
Phe Val Thr Gly Lys Arg Gln Glu 325 330 335 Pro Tyr Pro Ala Tyr Arg
Asn Ser Leu Thr Glu Cys Gly Asn Pro Ile 340 345 350 Thr Thr Gln Gly
Met Asn Val Arg Ser Ser Ile Asn Ser Leu Ile Arg 355 360 365 Arg Ser
Thr Cys Ser Gly Leu Lys Asp Val Cys Glu Leu Gly Ser Leu 370 375 380
Arg Ser Ser Ile Ile Tyr Pro Gln Lys Ser Asn Asn Ser Gly Phe Gly 385
390 395 400 Trp Arg Asp Gly Asp Ser Asp Asp Leu Cys Gln Thr Asp Met
Asp Asp 405 410 415 Leu Cys Asn Ile Glu Ser Val Arg Asn Asn Val Leu
Ser Gln Ser Thr 420 425 430 Asp Leu Asn Lys Ser Phe Asn Pro Met Cys
Asp Ser Thr Asp Asn Trp 435 440 445 Ser Cys Lys Phe Asp Glu Ser Pro
Lys Val Met Lys Ser Lys Ser Asn 450 455 460 Leu Leu Ser Tyr Gln Ala
Ser Gln Leu Gln Thr Gly Val Pro Cys Asp 465 470 475 480 Glu Glu Thr
Ser Leu Thr Phe Ala Gly Gly Ser Ser Val Ala Glu Asp 485 490 495 Asp
Tyr Lys Gly Thr Glu Leu Lys Ile Lys Ser Phe Leu Asp Glu Lys 500 505
510 Ala Gln Asp Leu Lys Arg Leu Gln Thr Pro Leu Leu Glu Glu Phe His
515 520 525 Asn Ala Met Asn Pro Gly Ile Pro Gln Gly Ala Leu Gly Asp
Thr Asn 530 535 540 Ile Tyr Asn Leu Pro Asn Leu Pro Ser Ile Ser Lys
Thr Pro Lys Arg 545 550 555 560 Leu Pro Ser Arg Arg Leu Ser Ala Ile
Ser Asp Ala Met Pro Ser Pro 565 570 575 Leu Lys Ser Ser Lys Arg Thr
Leu Asn Thr Ser Arg Val Met Gln Ser 580 585 590 Gly Thr Glu Pro Thr
Gln Val Asn Glu Ser Thr Lys Lys Gly Val Asn 595 600 605 Asn Ser Arg
Cys Phe Ser Glu Ile Arg Arg Lys Trp Glu Glu Glu Leu 610 615 620 Tyr
Glu Glu Leu Glu Arg His Arg Glu Asn Leu Arg His Ala Gly Ala 625 630
635 640 Gly Gly Lys Thr Pro Leu Ser Gly His Lys Gly 645 650 16 2157
DNA Arabidopsis thaliana 16 tcttcactga tctctctaca cattcaccgt
cggcttctca aatgcaggat attctcggat 60 cggttcgccg atccttggtt
ttccggtcgt ctttggccgg agacgatggt actagcggcg 120 gaggtcttag
cggattcgtc gggaagatta actctagtat ccgtagctct cgaattgggc 180
tcttttctaa gccgcctcca gggcttcctg ctcctagaaa agaagaagcg ccgtcgattc
240 ggtggaggaa aggggaatta atcggttgcg gtgcttttgg aagagtttac
atgggaatga 300 acctcgattc cggcgagctt cttgcaatta aacaggtttt
aatcgctcca agcagtgctt 360 caaaggagaa gactcagggt cacatccgag
agcttgagga agaagtacaa cttcttaaga 420 atctttcaca tccgaacatc
gttagatact tgggtactgt aagagagagt gattcgttga 480 atattttgat
ggagtttgtt cctggtggat caatatcatc tttgttggag aagtttggat 540
cttttcctga gcctgtgatt attatgtaca caaagcaact tctgcttggg ctggaatatc
600 ttcacaacaa tgggatcatg catcgagata ttaagggggc aaatattttg
gtcgataaca 660 aaggttgcat cagactcgca gattttggtg cttccaagaa
agttgtagag ctagctactg 720 taaatggtgc caaatctatg aaggggacgc
cttattggat ggctcctgaa gtcattctcc 780 agactggtca tagcttctct
gctgatatat ggagtgttgg gtgcactgtg attgagatgg 840 ctacggggaa
gcctccctgg agcgagcagt atcagcagtt tgctgctgtc cttcatattg 900
gtagaacaaa agctcatcct ccaattccag aagacctctc accagaggct aaagactttc
960 taatgaaatg cttacacaaa gaaccaagct tgagactctc tgcaaccgaa
ttgcttcagc 1020 acccgtttgt cactggaaag cgccaggaac cttatccagc
ttaccgtaat tctcttacgg 1080 aatgtggaaa cccaataact actcaaggaa
tgaatgttcg gagttcaata aattcgttga 1140 tcaggaggtc gacatgttca
ggcttgaagg atgtctgtga actgggaagc ttgaggagtt 1200 ccattatata
cccacagaag tcaaataact caggatttgg ttggcgagat ggagactctg 1260
atgacctttg tcagaccgat atggatgatc tctgcaacat tgaatcagtc agaaacaatg
1320 ttttgtcaca gtccaccgat ttaaacaaga gttttaatcc catgtgtgat
tccacggata 1380 actggtcttg caagtttgat gaaagcccaa aagtgatgaa
aagcaaatct aacctgcttt 1440 cttaccaagc ttctcaactc caaactggag
ttccatgtga tgaggaaacc agcttaacat 1500 ttgctggtgg ctcttccgtt
gcagaggatg attataaagg cacagagttg aaaataaaat 1560 catttttgga
tgagaaggct caggatttga aaaggttgca gacccctctg cttgaagaat 1620
tccacaatgc tatgaatcca ggaatacccc aaggtgcact tggagacacc aatatctaca
1680 atttaccaaa cttaccaagt ataagcaaga cacctaaacg acttccgagt
agacgactct 1740 cagcaatcag tgatgctatg cccagcccac tcaaaagctc
caaacgtaca ctgaacacaa 1800 gcagagtgat gcagtcagga actgaaccaa
ctcaagtcaa cgagtcgacc aagaagggag 1860 taaataatag ccgttgtttc
tcagagatac gtcggaagtg ggaagaagaa ctctatgaag 1920 agcttgagag
gcatcgagag aatctgcgac acgctggtgc aggagggaag actccattat 1980
caggccacaa aggatagtga acggctaaag agaaactgta tgtttctttc ttatgtttca
2040 aaattacttc ttcgtatttt tttttgttgg tggggtaatt tcatgagcta
gtatgatata 2100 tgtagatagt tcttcaacgg ttacatagta ttattattta
ttattaattt aattgcc 2157 17 268 PRT Arabidopsis thaliana 17 Pro Ser
Ile Arg Trp Arg Lys Gly Glu Leu Ile Gly Cys Gly Ala Phe 1 5 10 15
Gly Arg Val Tyr Met Gly Met Asn Leu Asp Ser Gly Glu Leu Leu Ala 20
25 30 Ile Lys Gln Val Leu Ile Ala Pro Ser Ser Ala Ser Lys Glu Lys
Thr 35 40 45 Gln Gly His Ile Arg Glu Leu Glu Glu Glu Val Gln Leu
Leu Lys Asn 50 55 60 Leu Ser His Pro Asn Ile Val Arg Tyr Leu Gly
Thr Val Arg Glu Ser 65 70 75 80 Asp Ser Leu Asn Ile Leu Met Glu Phe
Val Pro Gly Gly Ser Ile Ser 85 90 95 Ser Leu Leu Glu Lys Phe Gly
Ser Phe Pro Glu Pro Val Ile Ile Met 100 105 110 Tyr Thr Lys Gln Leu
Leu Leu Gly Leu Glu Tyr Leu His Asn Asn Gly 115 120 125 Ile Met His
Arg Asp Ile Lys Gly Ala Asn Ile Leu Val Asp Asn Lys 130 135 140 Gly
Cys Ile Arg Leu Ala Asp Phe Gly Ala Ser Lys Lys Val Val Glu 145 150
155 160 Leu Ala Thr Val Asn Gly Ala Lys Ser Met Lys Gly Thr Pro Tyr
Trp 165 170 175 Met Ala Pro Glu Val Ile Leu Gln Thr Gly His Ser Phe
Ser Ala Asp 180 185 190 Ile Trp Ser Val Gly Cys Thr Val Ile Glu Met
Ala Thr Gly Lys Pro 195 200 205 Pro Trp Ser Glu Gln Tyr Gln Gln Phe
Ala Ala Val Leu His Ile Gly 210 215 220 Arg Thr Lys Ala His Pro Pro
Ile Pro Glu Asp Leu Ser Pro Glu Ala 225 230 235 240 Lys Asp Phe Leu
Met Lys Cys Leu His Lys Glu Pro Ser Leu Arg Leu 245 250 255 Ser Ala
Thr Glu Leu Leu Gln His Pro Phe Val Thr 260 265 18 804 DNA
Arabidopsis thaliana 18 ccgtcgattc ggtggaggaa aggggaatta atcggttgcg
gtgcttttgg aagagtttac 60 atgggaatga acctcgattc cggcgagctt
cttgcaatta aacaggtttt aatcgctcca 120 agcagtgctt caaaggagaa
gactcagggt cacatccgag agcttgagga agaagtacaa 180 cttcttaaga
atctttcaca tccgaacatc gttagatact tgggtactgt aagagagagt 240
gattcgttga atattttgat ggagtttgtt cctggtggat caatatcatc tttgttggag
300 aagtttggat cttttcctga gcctgtgatt attatgtaca caaagcaact
tctgcttggg 360 ctggaatatc ttcacaacaa tgggatcatg catcgagata
ttaagggggc aaatattttg 420 gtcgataaca aaggttgcat cagactcgca
gattttggtg cttccaagaa agttgtagag 480 ctagctactg taaatggtgc
caaatctatg aaggggacgc cttattggat ggctcctgaa 540 gtcattctcc
agactggtca tagcttctct gctgatatat ggagtgttgg gtgcactgtg 600
attgagatgg ctacggggaa gcctccctgg agcgagcagt atcagcagtt tgctgctgtc
660 cttcatattg gtagaacaaa agctcatcct ccaattccag aagacctctc
accagaggct 720 aaagactttc taatgaaatg cttacacaaa gaaccaagct
tgagactctc tgcaaccgaa 780 ttgcttcagc acccgtttgt cact 804 19 690 PRT
Nicotiana tabacum 19 Met Gln Asp Phe Ile Gly Ser Val Arg Arg Ser
Leu Val Phe Lys Gln 1 5 10 15 Ser Gly Asp Phe Asp Thr Gly Ala Ala
Gly Val Gly Ser Gly Phe Gly 20 25 30 Gly Phe Val Glu Lys Leu Gly
Ser Ser Ile Arg Lys Ser Ser Ile Gly 35 40 45 Ile Phe Ser Lys Ala
His Val Pro Ala Leu Pro Ser Ile Ser Lys Ala 50 55 60 Glu Leu Pro
Ala Lys Ala Arg Lys Asp Asp Thr Pro Pro Ile Arg Trp 65 70 75 80 Arg
Lys Gly Glu Met Ile Gly Cys Gly Ala Phe Gly Arg Val Tyr Met 85 90
95 Gly Met Asn Val Asp Ser Gly Glu Leu Leu Ala Ile Lys Glu Val Ser
100 105 110 Ile Ala Met Asn Gly Ala Ser Arg Glu Arg Ala Gln Ala His
Val Arg 115 120 125 Glu Leu Glu Glu Glu Val Asn Leu Leu Lys Asn Leu
Ser His Pro Asn 130 135 140 Ile Val Arg Tyr Leu Gly Thr Ala Arg Glu
Ala Gly Ser Leu Asn Ile 145 150 155 160 Leu Leu Glu Phe Val Pro Gly
Gly Ser Ile Ser Ser Leu Leu Gly Lys 165 170 175 Phe Gly Ser Phe Pro
Glu Ser Val Ile Arg Met Tyr Thr Lys Gln Leu 180 185 190 Leu Leu Gly
Leu Glu Tyr Leu His Lys Asn Gly Ile Met His Arg Asp 195 200 205 Ile
Lys Gly Ala Asn Ile Leu Val Asp Asn Lys Gly Cys Ile Lys Leu 210 215
220 Ala Asp Phe Gly Ala Ser Lys Lys Val Val Glu Leu Ala Thr Met Thr
225 230 235 240 Gly Ala Lys Ser Met Lys Gly Thr Pro Tyr Trp Met Ala
Pro Glu Val 245 250 255 Ile Leu Gln Thr Gly His Ser Phe Ser Ala Asp
Ile Trp Ser Val Gly 260 265 270 Cys Thr Ile Ile Glu Met Ala Thr Gly
Lys Pro Pro Trp Ser Gln Gln 275 280 285 Tyr Gln Glu Val Ala Ala Leu
Phe His Ile Gly Thr Thr Lys Ser His 290 295 300 Pro Pro Ile Pro Glu
His Leu Ser Ala Glu Ser Lys Asp Phe Leu Leu 305 310 315 320 Lys Cys
Leu Gln Lys Glu Pro His Leu Arg His Ser Ala Ser Asn Leu 325 330 335
Leu Gln His Pro Phe Val Thr Ala Glu His Gln Glu Ala Arg Pro Phe 340
345 350 Leu Arg Ser Ser Phe Met Gly Asn Pro Glu Asn Met Ala Ala Gln
Arg 355 360 365 Met Asp Val Arg Thr Ser Ile Ile Pro Asp Met Arg Ala
Ser Cys Asn 370 375 380 Gly Leu Lys Asp Val Cys Gly Val Ser Ala Val
Arg Cys Ser Thr Val 385 390 395 400 Tyr Pro Glu Asn Ser Leu Gly Lys
Glu Ser Leu Trp Lys Leu Gly Asn 405 410 415 Ser Asp Asp Asp Met Cys
Gln Met Asp Asn Asp Asp Phe Met Phe Gly 420 425 430 Ala Ser Val Lys
Cys Ser Ser Asp Leu His Ser Pro Ala Asn Tyr Lys 435 440 445 Ser Phe
Asn Pro Met Cys Glu Pro Asp Asn Asp Trp Pro Cys Lys Phe 450 455 460
Asp Glu Ser Pro Glu Leu Thr Lys Ser Gln Ala Asn Leu His Tyr Asp 465
470 475 480 Gln Ala Thr Ile Lys Pro Thr Asn Asn Pro Ile Met Ser Tyr
Lys Glu 485 490 495 Asp Leu Ala Phe Thr Phe Pro Ser Gly Gln Ser Ala
Ala Glu Asp Asp
500 505 510 Asp Glu Leu Thr Glu Ser Lys Ile Arg Ala Phe Leu Asp Glu
Lys Ala 515 520 525 Met Asp Leu Lys Lys Leu Gln Thr Pro Leu Tyr Glu
Gly Phe Tyr Asn 530 535 540 Ser Leu Asn Val Ser Ser Thr Pro Ser Pro
Val Gly Thr Gly Asn Lys 545 550 555 560 Glu Asn Val Pro Ser Asn Ile
Asn Leu Pro Pro Lys Ser Arg Ser Pro 565 570 575 Lys Arg Met Leu Ser
Arg Arg Leu Ser Thr Ala Ile Glu Gly Ala Cys 580 585 590 Ala Pro Ser
Pro Val Thr His Ser Lys Arg Ile Ser Asn Ile Gly Gly 595 600 605 Leu
Asn Gly Glu Ala Ile Gln Glu Ala Gln Leu Pro Arg His Asn Glu 610 615
620 Trp Lys Asp Leu Leu Gly Ser Gln Arg Glu Ala Val Asn Ser Ser Phe
625 630 635 640 Ser Glu Arg Gln Arg Arg Trp Lys Glu Glu Leu Asp Glu
Glu Leu Gln 645 650 655 Arg Lys Arg Glu Ile Met Arg Gln Ala Val Asn
Leu Ser Pro Pro Lys 660 665 670 Asp Pro Ile Leu Asn Arg Cys Arg Ser
Lys Ser Arg Phe Ala Ser Pro 675 680 685 Gly Arg 690 20 2527 DNA
Nicotiana tabacum 20 ctgaacccta acgcacacaa cttcactctt tgctcctcca
aatctctctc caatgcagga 60 tttcatcggc tccgttcgcc gatctctggt
tttcaagcag tccggagact tcgataccgg 120 cgctgccggt gtcggcagcg
gattcggagg cttcgttgag aaactaggtt cgagcattcg 180 caaatcgagt
attggaatct tctcgaaagc tcatgttcct gctcttccgt ctatttctaa 240
agctgagctg cccgcgaagg ctcggaaaga tgacactccg ccaatccggt ggaggaaagg
300 tgaaatgatt ggatgtggtg cttttggtag ggtttatatg gggatgaatg
ttgattctgg 360 agagttactc gctataaagg aggtttcgat tgcgatgaat
ggtgcttcga gagagcgagc 420 acaagctcat gttagagagc ttgaggaaga
agtgaatcta ttgaagaatc tctcccatcc 480 caacatagtg agatatttgg
gaactgcaag agaggcagga tcattaaata tattgttgga 540 atttgttcct
ggtggctcaa tctcgtcact tttgggaaaa tttggatcct tccctgaatc 600
tgttataaga atgtacacca agcaattgtt attagggttg gaatacttgc ataagaatgg
660 gattatgcac agagatatta agggagcaaa catacttgtt gacaataaag
gttgcattaa 720 acttgctgat ttcggtgcat ccaagaaggt tgttgaattg
gctactatga ctggtgccaa 780 gtcaatgaag ggtactccat actggatggc
tcccgaagtc attctgcaga ctggccatag 840 cttctctgct gacatatgga
gtgtcggatg cactattatc gaaatggcta caggaaaacc 900 tccttggagc
cagcagtatc aggaggttgc tgctctcttc catataggga caaccaaatc 960
ccatcccccc atcccagagc atctttctgc tgaatcaaag gacttcctat taaaatgttt
1020 gcagaaggaa ccgcacctga ggcattctgc atcaaatttg cttcagcatc
catttgttac 1080 agcagaacat caggaagctc gcccttttct tcgctcatcc
tttatgggaa accccgaaaa 1140 catggcggcg caaaggatgg atgttaggac
ctcaatcatt cctgatatga gagcttcctg 1200 caatggtttg aaagatgttt
gtggtgttag cgctgtgagg tgctccactg tatatcccga 1260 gaattcctta
gggaaagagt cactctggaa actaggaaac tctgatgatg acatgtgcca 1320
gatggataat gatgatttta tgtttggtgc atctgtgaaa tgcagttcag atttgcattc
1380 tcctgctaat tataagagtt ttaatcctat gtgtgaacct gataacgatt
ggccatgcaa 1440 atttgatgaa agtcccgagt tgacgaaaag tcaagcaaac
ctgcattatg atcaagcaac 1500 tattaagccc actaataacc ccatcatgtc
atacaaggag gatcttgctt tcacatttcc 1560 aagtgggcaa tctgcagccg
aggatgatga tgaattgaca gagtctaaaa ttagggcatt 1620 ccttgatgaa
aaggcaatgg acttgaagaa gctgcaaaca ccactatatg aaggattcta 1680
caattccttg aatgtttcca gcacaccgag tcccgttggc actgggaaca aggaaaatgt
1740 tccaagtaac ataaacttac caccaaaaag caggtcacca aaacgtatgc
ttagcagaag 1800 gctctctact gccattgaag gtgcttgtgc tcccagccca
gtgactcatt ccaagcgaat 1860 atcaaatatt ggtggcctaa atggtgaagc
tattcaggaa gctcagttgc cgaggcataa 1920 tgaatggaaa gatcttcttg
gttctcaacg tgaagcagtt aattcaagct tctctgagag 1980 gcaaagaagg
tggaaagaag agcttgatga agagttgcaa aggaaacgag agattatgcg 2040
tcaggcagtc aacttatcac caccaaagga tccaattcta aatcgatgta gaagtaaatc
2100 aaggtttgca tctcctggaa gataaatgta tgtacttgtg tccctaaact
aaagtcagtt 2160 tgaagaatat aattaatgat cctgcaaccc cagaacagag
agttagatgt cttgagcagg 2220 tatacgaacg tgaggttttc ttgacccgtt
actacaggaa tatcagcgct tgtcagatag 2280 agtgagctgt tactacagga
atatctgtca acctgttaat catattataa aatgccaata 2340 atttgcgttg
tattcgtttt gatcattctc ctgagagcat tgtaagaaaa atgcaggcct 2400
ttttataacc tatataagtg ctctctcatg gtagttgcca atattaaaac gcagagaaaa
2460 gtcgagttct catctgctga attgtttgta aaatgtgata tattaatgta
tttaccgtct 2520 tacaacc 2527 21 268 PRT Nicotiana tabacum 21 Pro
Pro Ile Arg Trp Arg Lys Gly Glu Met Ile Gly Cys Gly Ala Phe 1 5 10
15 Gly Arg Val Tyr Met Gly Met Asn Val Asp Ser Gly Glu Leu Leu Ala
20 25 30 Ile Lys Glu Val Ser Ile Ala Met Asn Gly Ala Ser Arg Glu
Arg Ala 35 40 45 Gln Ala His Val Arg Glu Leu Glu Glu Glu Val Asn
Leu Leu Lys Asn 50 55 60 Leu Ser His Pro Asn Ile Val Arg Tyr Leu
Gly Thr Ala Arg Glu Ala 65 70 75 80 Gly Ser Leu Asn Ile Leu Leu Glu
Phe Val Pro Gly Gly Ser Ile Ser 85 90 95 Ser Leu Leu Gly Lys Phe
Gly Ser Phe Pro Glu Ser Val Ile Arg Met 100 105 110 Tyr Thr Lys Gln
Leu Leu Leu Gly Leu Glu Tyr Leu His Lys Asn Gly 115 120 125 Ile Met
His Arg Asp Ile Lys Gly Ala Asn Ile Leu Val Asp Asn Lys 130 135 140
Gly Cys Ile Lys Leu Ala Asp Phe Gly Ala Ser Lys Lys Val Val Glu 145
150 155 160 Leu Ala Thr Met Thr Gly Ala Lys Ser Met Lys Gly Thr Pro
Tyr Trp 165 170 175 Met Ala Pro Glu Val Ile Leu Gln Thr Gly His Ser
Phe Ser Ala Asp 180 185 190 Ile Trp Ser Val Gly Cys Thr Ile Ile Glu
Met Ala Thr Gly Lys Pro 195 200 205 Pro Trp Ser Gln Gln Tyr Gln Glu
Val Ala Ala Leu Phe His Ile Gly 210 215 220 Thr Thr Lys Ser His Pro
Pro Ile Pro Glu His Leu Ser Ala Glu Ser 225 230 235 240 Lys Asp Phe
Leu Leu Lys Cys Leu Gln Lys Glu Pro His Leu Arg His 245 250 255 Ser
Ala Ser Asn Leu Leu Gln His Pro Phe Val Thr 260 265 22 804 DNA
Nicotiana tabacum 22 ccgccaatcc ggtggaggaa aggtgaaatg attggatgtg
gtgcttttgg tagggtttat 60 atggggatga atgttgattc tggagagtta
ctcgctataa aggaggtttc gattgcgatg 120 aatggtgctt cgagagagcg
agcacaagct catgttagag agcttgagga agaagtgaat 180 ctattgaaga
atctctccca tcccaacata gtgagatatt tgggaactgc aagagaggca 240
ggatcattaa atatattgtt ggaatttgtt cctggtggct caatctcgtc acttttggga
300 aaatttggat ccttccctga atctgttata agaatgtaca ccaagcaatt
gttattaggg 360 ttggaatact tgcataagaa tgggattatg cacagagata
ttaagggagc aaacatactt 420 gttgacaata aaggttgcat taaacttgct
gatttcggtg catccaagaa ggttgttgaa 480 ttggctacta tgactggtgc
caagtcaatg aagggtactc catactggat ggctcccgaa 540 gtcattctgc
agactggcca tagcttctct gctgacatat ggagtgtcgg atgcactatt 600
atcgaaatgg ctacaggaaa acctccttgg agccagcagt atcaggaggt tgctgctctc
660 ttccatatag ggacaaccaa atcccatccc cccatcccag agcatctttc
tgctgaatca 720 aaggacttcc tattaaaatg tttgcagaag gaaccgcacc
tgaggcattc tgcatcaaat 780 ttgcttcagc atccatttgt taca 804
* * * * *