U.S. patent application number 10/649547 was filed with the patent office on 2004-09-16 for methods for transfer of dna segments.
This patent application is currently assigned to Stratagene. Invention is credited to Carstens, Carsten-Peter.
Application Number | 20040180443 10/649547 |
Document ID | / |
Family ID | 25159767 |
Filed Date | 2004-09-16 |
United States Patent
Application |
20040180443 |
Kind Code |
A1 |
Carstens, Carsten-Peter |
September 16, 2004 |
Methods for transfer of DNA segments
Abstract
The present invention provides a method of transfer of a gene of
interest from a first vector to a product vector comprising
contacting a first and second vector in vitro with a site-specific
recombinase so as to generate a co-integrate vector comprising the
components of the first and second vector, and introducing the
co-integrate vector to a prokaryotic host cell so as to generate a
product vector by rolling circle replication, comprising the gene
of interest.
Inventors: |
Carstens, Carsten-Peter;
(LaJolla, CA) |
Correspondence
Address: |
PALMER & DODGE, LLP
KATHLEEN M. WILLIAMS / STR
111 HUNTINGTON AVENUE
BOSTON
MA
02199
US
|
Assignee: |
Stratagene
|
Family ID: |
25159767 |
Appl. No.: |
10/649547 |
Filed: |
August 27, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10649547 |
Aug 27, 2003 |
|
|
|
09793372 |
Feb 26, 2001 |
|
|
|
6696278 |
|
|
|
|
Current U.S.
Class: |
435/488 |
Current CPC
Class: |
C12N 15/66 20130101;
C12N 15/64 20130101; C12N 15/70 20130101; C12N 15/10 20130101 |
Class at
Publication: |
435/488 |
International
Class: |
C12N 015/74 |
Claims
1. A method of transfer of a gene of interest to a product vector
comprising: a) introducing into a prokaryotic host cell which
expresses a gene encoding a site-specific recombinase: a first
vector comprising: a gene of interest, a gene encoding a first
selectable marker, a double-stranded origin of replication of a
rolling circle replicon; and a site-specific recombination
recognition site, wherein said gene of interest is interposed
between said double-stranded origin of replication of a rolling
circle replicon and said site-specific recombination recognition
site; and a second vector comprising: a negative selectable marker,
a double-stranded origin of replication of a rolling circle
replicon, a site-specific recombination recognition site, a
single-stranded origin of replication, and a gene encoding a second
selectable marker, wherein said negative selectable marker is
interposed between said double-stranded origin of replication of a
rolling circle replicon and said site-specific recombination
recognition site; wherein said host cell further expresses a gene
encoding a rep protein that can initiate replication as said double
stranded origins of replication, and wherein said introducing
permits formation of a product vector comprising said gene of
interest interposed between said double-stranded origin of
replication of said second vector and said site-specific
recombination recognition site, said single-stranded origin of
replication of said second vector, and said gene encoding said
second selectable marker, said product vector not including both of
said negative selectable marker and said gene encoding said first
selectable marker.
2. The method of claim 1, wherein said prokaryotic host cell is
grown under conditions which permit said first and second vectors
to recombine to form a co-integrate vector.
3. The method of claim 1, wherein said product vector is isolated
from said prokaryotic host cell.
4. A pair of vectors comprising: (a) a first vector comprising: a
gene of interest, a gene encoding a first selectable marker, a
double-stranded origin of replication of a rolling circle replicon;
and a site-specific recombination recognition site, wherein said
gene of interest is interposed between said double-stranded origin
of replication of a rolling circle replicon and said site-specific
recombination recognition site; and (b) a second vector comprising:
a negative selectable marker, a double-stranded origin of
replication of a rolling circle replicon, a site-specific
recombination recognition site, a single-stranded origin of
replication, and a gene encoding a second selectable marker,
wherein said gene encoding said negative selectable marker is
interposed between said double-stranded origin of replication of a
rolling circle replicon and said site-specific recombination
recognition site, wherein in one or both of said first and second
vectors there is no second site-specific recombinase recognition
site between said double-stranded origin of replication and said
site-specific recombinase recognition site.
5. The vectors of claim 4, wherein said first selectable marker and
said second selectable marker are different.
6. The vectors of claim 4, wherein said site-specific recombinase
recognition site is selected from the group consisting of: loxP,
loxP2, loxP3, loxP23, loxP511, loxB, loxC2, loxL, loxR,
lox.DELTA.86, lox.DELTA.117, frt, dif, .lambda.-phage att sites,
and .PHI.C31 att sites.
7. The vectors of claim 4, wherein said double-stranded origin of
replication is the double-stranded origin of replication of the
filamentous bacteriophage f1.
8. The vectors of claim 4, wherein said double-stranded origin of
replication is the double-stranded origin of replication of the
plasmid pKym.
9. The vectors of claim 4, wherein said negative selectable marker
is selected from the group consisting of: rpsL and sacB.
10. The vectors of claim 4, wherein said gene encoding one of said
first or second selectable markers, independently, is selected from
the group consisting of: kanamycin resistance gene, the ampicillin
resistance gene, the spectinomycin resistance gene, the gentamycin
resistance gene, the tetracycline resistance gene, the
chloramphenicol resistance gene, the streptomycin resistance gene,
the strA gene, and the sacB gene.
11. A product vector comprising: a gene of interest; a
double-stranded origin of replication of a rolling circle replicon
a site-specific recombination recognition site a single-stranded
origin of replication; and a nucleic acid sequence encoding a
second selectable marker; wherein said gene of interest is
interposed between said double-stranded origin of replication of a
rolling circle replicon and said site-specific recombination
recognition site.
12. A kit for the transfer of a gene of interest to a product
vector comprising: (a) a first vector comprising: a gene of
interest, a gene encoding a first selectable marker, a
double-stranded origin of replication of a rolling circle replicon;
and a site-specific recombination recognition site, wherein said
gene of interest is interposed between said double-stranded origin
of replication of a rolling circle replicon and said site-specific
recombination recognition site; and (b) a second vector comprising:
a negative selectable marker, a double-stranded origin of
replication of a rolling circle replicon, a site-specific
recombination recognition site, a single-stranded origin of
replication, and a gene encoding a second selectable marker,
wherein said negative selectable marker is interposed between said
double-stranded origin of replication of a rolling circle replicon
and said site-specific recombination recognition site; and
packaging materials therefore, wherein in one or both of said first
and second vectors there is no second site-specific recombinase
recognition site between said double-stranded origin of replication
and said site-specific recombinase recognition site.
13. A kit for the transfer of a gene of interest to a product
vector comprising: (a) a first vector comprising: a cloning site
for insertion of a gene of interest, a gene encoding a first
selectable marker, a double-stranded origin of replication of a
rolling circle replicon; and a site-specific recombination
recognition site, wherein said cloning site for insertion of a gene
of interest is interposed between said double-stranded origin of
replication of a rolling circle replicon and said site-specific
recombination recognition site; and (b) a second vector comprising:
a negative selectable marker, a double-stranded origin of
replication of a rolling circle replicon, a site-specific
recombination recognition site, a single-stranded origin of
replication, and a gene encoding a second selectable marker,
wherein said negative selectable marker is interposed between said
double-stranded origin of replication of a rolling circle replicon
and said site-specific recombination recognition site; and
packaging materials therefore, wherein in one or both of said first
and second vectors there is no second site-specific recombinase
recognition site between said double-stranded origin of replication
and said site-specific recombinase recognition site.
14. The kit of claim 12 or 13, wherein said kit further comprises a
primary host cell which supports replication of a vector having a
rolling circle double-stranded origin of replication and which
possesses a site-specific recoinbinase specific for said
site-specific recombination site.
15. The kit of claim 12 or 13, wherein said kit further comprises a
site-specific recombinase.
16. The kit of claim 14, said host cell being transfectable.
17. The kit of claim 12 or 13, further comprising a secondary host
cell.
18. The kit of claim 12 or 13, further comprising in vitro
recombination buffer.
19. A pair of vectors comprising: (a) a first vector comprising: a
cloning site for insertion of a gene of interest, a gene encoding a
first selectable marker, a double-stranded origin of replication of
a rolling circle replicon; and a site-specific recombination
recognition site, wherein said cloning site for insertion of a gene
of interest is interposed between said double-stranded origin of
replication of a rolling circle replicon and said site-specific
recombination recognition site; and (b) a second vector comprising:
a negative selectable marker, a double-stranded origin of
replication of a rolling circle replicon, a site-specific
recombination recognition site, a single-stranded origin of
replication, and a gene encoding a second selectable marker,
wherein said negative selectable marker is interposed between said
double-stranded origin of replication of a rolling circle replicon
and said site-specific recombination recognition site, wherein in
one or both of said first and second vectors there is no second
site-specific recombinase recognition site between said
double-stranded origin of replication and said site-specific
recombinase recognition site.
Description
BACKGROUND OF THE INVENTION
[0001] The most common manipulation of vectors in molecular biology
laboratories is the transfer of a gene of interest into a vector of
choice. The resulting recombinant vectors allow specialized
applications such as expression in mammalian cells, expression in
bacterial hosts, purification of the native protein through
employment of specialized (vector provided) purification tags or
detection of interaction with other proteins (two-hybrid systems).
Typically, cloning is achieved through restriction digestion,
isolation of the desired fragments and reconstitution of the
desired plasmid by ligation. Although this technique has been
routinely employed for approximately 20 years, it is still
error-prone and cumbersome.
[0002] There is a need in the art for a method of transferring a
desired coding region to a vector of interest without the use of
restriction enzyme recognition sites and restriction enzymes. In
prior art methods, multiple restriction enzymes are employed for
the removal of the desired coding region and the reaction
conditions used for each enzyme may differ such that it is
necessary to perform the excision reactions in separate steps. In
addition, it may be necessary to remove a particular enzyme used in
an initial restriction enzyme reaction prior to completing all
restriction enzyme digestions. This requires a time-consuming
purification of the subcloning intermediate. More recently,
recombinase-based cloning methods have been developed. However, the
current methods require multiple recombination events.
[0003] There is a need in the art for cloning of newly discovered
sequences, such as new genes. Thus there is a need in the art for
more efficient techniques for transfer of the genes of interest
into a vector of choice. It is desirable that such a technique
permits high fidelity, high efficiency and a minimum number of
handling steps to allow adaptation to automated procedures.
[0004] There is a need in the art for a method for the cloning of a
DNA molecule which permits rapid transfer of the DNA molecules from
one vector to another without the need to rely upon restriction
enzyme digestions.
SUMMARY OF THE INVENTION
[0005] The present invention provides a method of transfer of a
gene of interest to a product vector comprising: contacting in
vitro (1) a first vector comprising (a) a gene of interest, (b) a
gene encoding a first selectable marker, (c) a double-stranded
origin of replication of a rolling circle replicon, and (d) a
site-specific recombination recognition site, wherein the gene of
interest is interposed between the double-stranded origin of
replication of a rolling circle replicon and the site-specific
recombination recognition site; (2) a second vector comprising (a)
a negative selectable marker, (b) a double-stranded origin of
replication of a rolling circle replicon, (c) a site-specific
recombination recognition site, (d) a single-stranded origin of
replication, and (e) a gene encoding a second selectable marker,
wherein the gene encoding the negative selectable marker is
interposed between the double-stranded origin of replication of a
rolling circle replicon and the site-specific recombination
recognition site; and (3) a site-specific recombinase, wherein the
contacting permits formation of a co-integrate vector comprising
the first and the second vector. The co-integrate vector is
subsequently introduced into a prokaryotic host cell so as to
permit the formation of a product vector comprising the gene of
interest interposed between the double-stranded origin of
replication of the second vector and the site-specific
recombination recognition site, the single-stranded origin of
replication of the second vector, and the gene encoding the second
selectable marker, wherein the product vector does not include both
of the gene encoding the negative selectable marker and the gene
encoding the first selectable marker.
[0006] The present invention further provides a method of transfer
of a gene of interest to a co-integrate vector comprising
contacting in vitro (1) a first vector comprising (a) a gene of
interest, (b) a gene encoding a first selectable marker, (c) a
double-stranded origin of replication of a rolling circle replicon;
and (c) a site-specific recombination recognition site, wherein the
gene of interest is interposed between the double-stranded origin
of replication of a rolling circle replicon and the site-specific
recombination recognition site; (2) a second vector comprising (a)
a negative selectable marker, (b) a double-stranded origin of
replication of a rolling circle replicon, (c) a site-specific
recombination recognition site, (d) a single-stranded origin of
replication, and (e) a gene encoding a second selectable marker,
wherein the gene encoding the negative selectable marker is
interposed between the double-stranded origin of replication of a
rolling circle replicon and the site-specific recombination
recognition site; and (3) a site-specific recombinase, wherein the
contacting permits formation of a co-integrate vector comprising
the first and the second vector.
[0007] In one embodiment, the co-integrate vector is introduced
into a prokaryotic host cell.
[0008] The present invention further provides a method of transfer
of a gene of interest to a product vector comprising introducing
into a prokaryotic host cell which expresses a gene encoding a
site-specific recombinase (1) a first vector comprising (a) a gene
of interest, (b) a gene encoding a first selectable marker, (c) a
double-stranded origin of replication of a rolling circle replicon;
and (d) a site-specific recombination recognition site, wherein the
gene of interest is interposed between the double-stranded origin
of replication of a rolling circle replicon and the site-specific
recombination recognition site; and (2) a second vector comprising
(a) a negative selectable marker, (b) a double-stranded origin of
replication of a rolling circle replicon, (c) a site-specific
recombination recognition site, (d) a single-stranded origin of
replication, and (e) a gene encoding a second selectable marker,
wherein the negative selectable marker is interposed between the
double-stranded origin of replication of a rolling circle replicon
and the site-specific recombination recognition site, and wherein
said prokaryotic host cell further expresses a gene encoding a rep
protein which can initiate replication at the double stranded
origin of replication. The introduction of the first and second
vector to the prokaryotic host cell permits formation of a product
vector comprising the gene of interest interposed between the
double-stranded origin of replication of the second vector and the
site-specific recombination recognition site, the single-stranded
origin of replication of the second vector, and the gene encoding
the second selectable marker, the product vector not including both
of the negative selectable marker and the gene encoding the first
selectable marker.
[0009] The present invention further provides a method of transfer
of a gene of interest to a co-integrate vector comprising
introducing into a prokaryotic host cell which expresses a gene
encoding a site-specific recombinase a first vector and a second
vector so as to permit recombination of the first and second
vectors to produce a co-integrate vector, wherein the first vector
comprises (a) a gene of interest, (b) a gene encoding a first
selectable marker, (c) a double-stranded origin of replication of a
rolling circle replicon, and (d) a site-specific recombination
recognition site, wherein the gene of interest is interposed
between the double-stranded origin of replication of a rolling
circle replicon and the site-specific recombination recognition
site; and the second vector comprises (a) a negative selectable
marker, (b) a double-stranded origin of replication of a rolling
circle replicon, (c) a site-specific recombination recognition
site, (d) a single-stranded origin of replication, and (e) a gene
encoding a second selectable marker, wherein the gene encoding the
negative selectable marker is interposed between the
double-stranded origin of replication of a rolling circle replicon
and the site-specific recombination recognition site.
[0010] In one embodiment the introduction of the first and second
vector to the host cell permits formation of a product vector
comprising the gene of interest interposed between the
double-stranded origin of replication of the second vector and the
site-specific recombination recognition site, the single-stranded
origin of replication of the second vector, and the gene encoding
the second selectable marker, wherein said host cell expresses a
gene encoding a rep protein which can initiate replication at the
double stranded origin of replication of the first and second
vector. The product vector does not include both of the negative
selectable marker and the gene encoding the first selectable
marker.
[0011] In a preferred embodiment, the prokaryotic host cell is
grown under conditions which permit the first and second vectors to
recombine to form a co-integrate vector.
[0012] In a further embodiment, following introduction of either
the first and second vectors, or the co-integrate vector into the
prokaryotic host cell, the product vector is isolated from the host
cell.
[0013] In a still further embodiment, the first and second
selectable markers are different.
[0014] In one embodiment, the site-specific recombinase recognition
site is selected from the group consisting of: loxP, loxP2, loxP3,
loxP23, loxP511, loxB, loxC2, loxL, loxR, lox.DELTA.86,
lox.DELTA.117, frt, dif, Kw, .lambda.-att, and .PHI.C31 att
sites.
[0015] In one embodiment, the double-stranded origin of replication
is the double-stranded origin of replication of the filamentous
bacteriophage f1.
[0016] In a further embodiment, the double-stranded origin of
replication is the double-stranded origin of replication of the
plasmid pKym.
[0017] In one embodiment, the negative selectable marker is one of
rpsL and sacB.
[0018] In one embodiment, the gene encoding one of the first or
second selectable marker, independently, is selected from the group
consisting of: kanamycin resistance gene, the ampicillin resistance
gene, the tetracycline resistance gene, the chloramphenicol
resistance gene, spectinomycin resistance gene, gentamycin
resistance gene, and the streptomycin resistance gene.
[0019] The present invention further provides a vector comprising
(a) a negative selectable marker, (b) a double-stranded origin of
replication, (c) a site-specific recombination recognition site,
and (d) a gene encoding a selectable marker, wherein the negative
selectable marker is interposed between the double-stranded origin
of replication and the site-specific recombination recognition
site.
[0020] The invention still further provides a pair of vectors
comprising a first vector comprising (a) a gene of interest, (b) a
gene encoding a first selectable marker, (c) a double-stranded
origin of replication of a rolling circle replicon and (d) a
site-specific recombination recognition site, wherein the gene of
interest is interposed between the double-stranded origin of
replication of a rolling circle replicon and the site-specific
recombination recognition site; and a second vector comprising (a)
a negative selectable marker, (b) a double-stranded origin of
replication of a rolling circle replicon, (c) a site-specific
recombination recognition site, (d) a single-stranded origin of
replication, and (e) a gene encoding a second selectable marker,
wherein the negative selectable marker is interposed between the
double-stranded origin of replication of a rolling circle replicon
and the site-specific recombination recognition site.
[0021] The present invention also provides a product vector
comprising (a) a gene of interest, (b) a double-stranded origin of
replication of a rolling circle replicon, (c) a site-specific
recombination recognition site, (d) a single-stranded origin of
replication, and (e) a nucleic acid sequence encoding a second
selectable marker, wherein the gene of interest is interposed
between the double-stranded origin of replication of a rolling
circle replicon and the site-specific recombination recognition
site, and wherein the vector does not include both of the gene
encoding the negative selectable marker and the gene encoding the
first selectable marker.
[0022] In addition, the present invention provides a kit for the
transfer of a gene of interest to a product vector comprising (1) a
first vector comprising (a) a gene of interest, (b) a gene encoding
a first selectable marker, (c) a double-stranded origin of
replication of a rolling circle replicon, and (d) a site-specific
recombination recognition site, wherein the gene of interest is
interposed between the double-stranded origin of replication of a
rolling circle replicon and the site-specific recombination
recognition site; and (2) a second vector comprising (a) a negative
selectable marker, (b) a double-stranded origin of replication of a
rolling circle replicon, (c) a site-specific recombination
recognition site, (d) a single-stranded origin of replication, and
(e) a gene encoding a second selectable marker, wherein the gene
encoding the negative selectable marker is interposed between the
double-stranded origin of replication of a rolling circle replicon
and the site-specific recombination recognition site; and (3)
packaging materials therefore.
[0023] The invention still further provides a kit for the transfer
of a gene of interest to a product vector comprising (1) a first
vector comprising (a) a cloning site for insertion of a gene of
interest, (b) a gene encoding a first selectable marker, (c) a
double-stranded origin of replication of a rolling circle replicon,
and (c) a site-specific recombination recognition site, wherein the
cloning site for insertion of a gene of interest is interposed
between the double-stranded origin of replication of a rolling
circle replicon and the site-specific recombination recognition
site; and (2) a second vector comprising (a) a negative selectable
marker, (b) a double-stranded origin of replication of a rolling
circle replicon, (c) a site-specific recombination recognition
site, (d) a single-stranded origin of replication, and (e) a gene
encoding a second selectable marker, wherein the negative
selectable marker is interposed between the double-stranded origin
of replication of a rolling circle replicon and the site-specific
recombination recognition site; and (3) packaging materials
therefore.
[0024] In one embodiment, the kit further comprises a host cell
capable of supporting a rolling circle double-stranded origin of
replication.
[0025] In a further embodiment, the kit further comprises a
site-specific recombinase.
[0026] In a still further embodiment, the kit comprises a host cell
comprising a site-specific recombinase specific for the
site-specific recombination site.
[0027] In a still further embodiment of the invention, the host
cell is transfectible.
[0028] As used herein, "interposed" refers to a nucleic acid
molecule which has, immediately adjacent to its 5' most end, either
a double-stranded origin of replication of a rolling circle
replicon or a site-specific recombination recognition site, and
has, immediately adjacent to its 3' most end whichever of the
double-stranded origin of replication of a rolling circle replicon
or site-specific recombination recognition site that is not
immediately adjacent to the 5' most end. As used herein,
"immediately adjacent" means that there are between 0 and 500
nucleotides between the 5' end of the nucleic acid molecule and the
3' nucleotide of a sequence consisting of either a double-stranded
origin of replication of a rolling circle replicon or a
site-specific recombination recognition site, and between 0 and 500
nucleotides between the 3' end of the nucleic acid molecule and the
5' nucleotide of a sequence consisting of whichever of the a
double-stranded origin of replication of a rolling circle replicon
or site-specific recombination recognition site is not adjacent to
the 5' end of the nucleic acid molecule.
[0029] As used herein, "double-stranded origin of replication of a
rolling circle replicon" refers to a nucleic acid sequence which
contains the physical and functional elements required in cis for
the initiation of the first strand synthesis. A "double-stranded
origin of replication of a rolling circle replicon" may be isolated
from plasmids of both gram-positive and gram-negative bacteria,
bacteriophage or any organism which can support replication by a
rolling circle mechanism. Such organisms include, but are not
limited to Staphylococcus aureus, Bacillus subtilis, Clostridium
butyricum, Brevibacterium lactofermentum, Streptococcus agalactiae,
Lactococcus lactis, Leuconostoc lactis, Streptomyces,
Actinobacillus actinobycetemcomitans, Bacteroides, cyanobacteria,
Helobacter pylori, Selnomonas ruminatium, Shigella sonnei,
Zymomonas mobilis, Mycoplasma mycoides, or Treponema denticola,
Bacillus thuringiensis, Staphlococcus lugdunensis, Leuconostoc
oenos, Corynebacterium xerosis, Lactobacillus plantarum,
Streptococcus faecalis, Bacillus coagulans, Bacillus ceretus,
Bacillus popillae, Synechocystis strain PCC6803, Bacillus
liquefaciens, Pyrococcus abyssi, Selenomonas nominantium,
Lactobacillus hilgardii, Streptococcus ferus, Lactobacillus
pentosus, Bacteroides fragilis, Staphylococcus epidermidis,
Staphylococcus epidermidis, Zymomonas mobilis, Streptomyces
phaechromogenes, Streptomyces ghanaenis, Escherichia coli,
Halobacterium strain GRB, and Halobaferax sp. strain Aa2.2.
Examples of plasmids which possess a "double-stranded origin of
replication of a rolling circle replicon" useful in the present
invention include, but are not limited to the following: pT181,
pC221, pC223, pCW7, pHD2, pLUG10, pOg32, pS194, pT127, pTZ12,
pUB112, pE194, pA1, pC1305, pCI411, pFX2, pKMK1, pLS1, pSH71,
pWV01, pC194, pAM.alpha.1, pA, pPL, pSSU1, p1414, pDC123, pBAA1,
pBC1, pBC16, pBP614, pBS2, pC300, pCA2.4, pCB101, pCB2.4, pCC5.2,
pFTB14, pGT5, pJDB21, pKYM, pLAB1000, pLot3, pLP1, pOX6, pRF1,
pRBH1, pSH1451, pSN1981, pTA1060, pTD1, pTHT15, pUB110, pUH1,
pVA380-1, pWC1, pEGB32, p353-2, pSN2, pBI143, pE5, pE12, pIM13,
pNE131, pT48, pTCS1, pZMO2, pIJ101, pBL1, pJV1, pSG5, pSN22,
pC1305, pG12, pGRB1, pHK2, pHPK2255, pTX14-1, pTX14-3, or
pVT736-1.
[0030] As used herein, a "single-stranded origin of replication"
refers to a nucleic acid sequence at which replication of
single-stranded DNA is initiated. A "single-stranded origin of
replication" is strand and orientation specific and must be present
in a single-stranded form to actively initiate replication. A
"single-stranded origin of replication" useful in the present
invention may include any single-stranded origin of replication
known to those of skill in the art, or may be selected from ssos,
ssoA, ssoT, ssoW, ssoUtypes of single-stranded origins of
replication, or may be selected from the single-stranded origins of
replication present in the following plasmids: pT181, pC221, pC223,
pCW7, pHD2, pLUG10, pOg32, pS194, pT127, pTZ12, pUB112, pE194, pA1,
pC1305, pCI411, pFX2, pKMK1, pLS1, pSH71, pWV01, pC194,
pAM.alpha.1, pBAA1, pBC1, pBC16, pBP614, pBS2, pA, pPL, pSSU1,
p1414, pDC123, pC300, pCA2.4, pCB101, pCB2.4, pCC5.2, pFTB14, pGT5,
pJDB21, pKYM, pLAB1000, pLot3, pLP1, pOX6, pRF1, pRBH1, pSH1451,
pSN1981, pTA1060, pTD1, pTHT15, pUB110, pUH1, pVA380-1, pWC1,
pEGB32, p353-2, pSN2, pBI143, pE5, pE12, pIM13, pNE131, pT48,
pTCS1, pZMO2, pIJ101, pBL1, pJV1, pSG5, pSN22, pC1305, pG12, pGRB1,
pHK2, pHPK255, pTX14-1, pTX14-3, PCR-ScriptAmpSK.sup.+, filamentous
phage (f1), .PHI.X174, pB#322, or pVT736-1
[0031] As used herein, "rolling circle replication" refers to a
mode of replication utilized by some DNA molecules including
certain bacteriophage genomes and also found in Xenopus oocytes
during amplification of extrachromosomal ribosomal DNA. DNA
synthesis initiates at a double-stranded origin of replication from
which a sole replication fork proceeds around the template nucleic
acid. As the fork revolves, the newly synthesized strand displaces
the previously synthesized strand from the template, producing a
characteristic tail comprised of single-stranded DNA. The displaced
strand is released from the plasmid once the replication fork
encounters the double-stranded origin of replication,
recircularized and may then be made double-stranded via DNA
synthesis which initiates from the single-stranded origin of
replication and processed into single or multimeric copies of the
original DNA.
[0032] As used herein, a "site-specific recombinase" refers to an
enzyme that binds a specific DNA recognition sequence within a
first DNA molecule and, upon forming a protein DNA complex at this
specific recognition site, promotes strand exchange with a second
protein DNA complex which includes a second molecule of the same
"site-specific recombinase" bound to a different site on the first
DNA molecule or a second DNA molecule having the same recognition
sequence, recombining the first and second DNA sequences adjacent
to each recombinase recognition site to form a recombined DNA which
includes sequences of both the first and second DNA molecules.
[0033] As used herein, a "site-specific recombination recognition
site" refers to a nucleic acid sequence (i.e., site) which is
recognized by a sequence-specific recombinase and which becomes, or
is adjacent to the crossover region during the site-specific
recombination event. Examples of site-specific recombination sites
include, but are not limited to loxP, loxP2, loxP3, loxP23,
loxP511, loxB, loxC2, loxL, loxR, lox.DELTA.86, or lox.DELTA.117
sites, frt sites, .PHI.C31 att sites, Kw sites, and dif sites.
[0034] As used herein, "vector" refers to a nucleic acid molecule
that is able to replicate in a host cell. A "vector" is also a
"nucleic acid construct". The terms "vector" or "nucleic acid
construct" includes circular nucleic acid constructs such as
plasmid constructs, cosmid vectors, etc. as well as linear nucleic
acid constructs (e.g., PCR products, N15 based linear plasmids form
E. coli). The nucleic acid construct may comprise expression
signals such as a promoter and/or enhancer (in such a case it is
referred to as an expression vector). Alternatively, a "vector"
useful in the present invention can refer to an exogenous nucleic
acid molecule which is integrated in the host chromosome, providing
that the integrated nucleic acid molecule, in whole, or in part,
can be converted back to an autonomously replicating form.
[0035] As used herein, "selectable marker" refers to any one of
numerous markers which permit selection of a cell containing a
vector expressing the marker known in the art. For example, a gene
coding for a product which confers antibiotic resistance to the
cell, which confers prototrophy to an auxotrophic strain, or which
complements a defect of the host. A "selectable marker" may be a
protein necessary for the survival or growth of a transformed host
cell grown in a selective culture medium. Host cells not
transformed with the vector containing the selectable marker will
not survive in the selective culture medium. Typical selectable
markers are proteins that confer resistance to antibiotics or other
toxins, such as ampicillin, neomycin, kanamycin, chloramphenicol,
streptomycin, spectinomycin, gentamycin, or tetracycline.
Alternatively, selectable markers may encode proteins that
complement auxotrophic deficiencies or supply critical nutrients
not available from complex media, e.g., the gene encoding D-alanine
racemase for Bacilli. Alternative selectable markers, useful in the
present invention are suppressor tRNAs. A number of selectable
markers are known to those of skill in the art and are described
for instance in Sambrook et al., Molecular Cloning: A Laboratory
Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y., 1989.
[0036] As used herein, a "negative selectable marker" refers to a
protein which, when expressed by a host cell confers susceptibility
of that host cell to agents such as one of the selectable markers
referred to above, e.g., an antibiotic or toxin. Genes encoding
"negative selectable markers" useful in the present invention
include, but are not limited to rpsL, sacB, hsv-tk, GLUT-2, or gpt.
Alternatively, promoters or other functional elements required for
the efficient expression of a negative selectable marker gene also
can function as negative selectable markers. Alternatively, a
negative selectable marker may be a restriction site, recognized by
a host restriction system which would lead to cleavage of a plasmid
containing the sequence, thus eliminating the functionality of the
plasmid. An additional example of a negative selectable marker,
useful in the present invention is the so called kill genes derived
from low copy number plasmids such as the F' derived ccd gene (Boe
et al., 1987 J. Bacteriol 169:4646). Insertion of a "negative
selectable marker" into a vector of the present invention would
permit one of skill in the art to selectively eliminate that
vector.
[0037] As used herein, "introducing" refers to the transfer of a
nucleic acid molecule from outside a host cell to inside a host
cell. Nucleic acid molecules may be "introduced" into a host cell
by any means known to those of skill in the art, or taught in
numerous laboratory texts and manuals such as Sambrook et al.
Molecular Cloning: A Laboratory Manual, 2.sup.nd Ed., Cold Spring
Harbor Laboratory Press, New York (1989). Means of "introducing"
nucleic acid into a host cell include, but are not limited to heat
shock, calcium phosphate transfection, electroporation,
lippofection, and viral mediated gene transfer.
[0038] As used herein, a "prokaryotic host cell" refers to any
organism which can replicate plasmid DNA by a rolling circle
mechanism, including, but not limited to gram-positive bacteria,
and gram-negative bacteria. Alternatively a "prokaryotic host cell"
refers to any organism which is capable of supporting replication
from a single-stranded origin of replication. As used herein, a
"prokaryotic host cell" also refers to any organism which is
capable of supporting nucleic acid replication from both double-
and single-stranded origins of replication. More specifically, a
"prokaryotic host cell" useful in the present invention may be
selected from the group including, but not limited to
Staphylococcus aureus, Escherichia coli, Bacillus subtilis,
Clostridium butyricum, Brevibacterium lactofermentum, Streptococcus
agalactiae, Lactococcus lactis, Leuconostoc lactis, Streptomyces,
Actinobacillus actinobycetemcomitans, Bacteroides, cyanobacteria,
Escherichia coli, Helobacter pylori, Selnomonas ruminatium,
Shigella sonnei, Zymomonas mobilis, Mycoplasma mycoides, or
Treponema denticola, Bacillus thuringiensis, Staphlococcus
lugdunensis, Leuconostoc oenos, Corynebacterium xerosis,
Lactobacillus plantarum, Streptococcus faecalis, Bacillus
coagulans, Bacillus ceretus, Bacillus popillae, Synechocystis
strain PCC6803, Bacillus liquefaciens, Pyrococcus abyssi,
Selenomonas nominantium, Lactobacillus hilgardii, Streptococcus
ferus, Lactobacillus pentosus, Bacteroides fragilis, Staphylococcus
epidermidis, Staphylococcus epidermidis, Zymomonas mobilis,
Streptomyces phaechromogenes, Streptomyces ghanaenis, Halobacterium
strain GRB, and Halobaferax sp. strain Aa2.2.
[0039] An advantage of the present invention is that it provides a
method for the improved transfer of a gene of interest from one
vector to another, without the need for the traditional steps of
restriction enzyme digestion, purification, and ligation. A further
advantage of the present invention is that it provides a method of
transfer of genes of interest into a vector of choice with high
fidelity, high efficiency, and a minimal number of handling steps
which would allow for the adaptation of the present invention to
automated procedures.
[0040] Further features and advantages of the invention will become
more fully apparent in the following description of the embodiments
and drawings thereof, and from the claims
BRIEF DESCRIPTION OF THE FIGURES
[0041] FIG. 1 is a schematic diagram showing the first, second,
co-integrate, and product plasmids of the present invention,
wherein A represents a site-specific recombinase recognition
sequence and B represents a double-stranded origin of
replication.
[0042] FIG. 2 is a schematic diagram, adapted from Kronberg and
Baker, DNA Replication, 2.sup.nd Ed. 1992, and shows the process of
rolling circle replication of plasmid .PHI.174.
[0043] FIG. 3 is a schematic diagram showing the minimum components
of the first vector of the present invention.
[0044] FIG. 4 is a schematic diagram showing the minimum components
of the second vector of the present invention.
[0045] FIG. 5 shows the nucleotide sequence of plasmid pBC SK.sup.+
(SEQ ID NO: 1) which was used to construct the first and second
vectors of FIGS. 4 and 5 respectively.
DETAILED DESCRIPTION
[0046] The present invention provides a method of transfer of a
gene of interest from a first vector to a product vector comprising
contacting a first vector comprising (a) a gene of interest
interposed between a double-stranded origin of replication of a
rolling circle replicon, and a site-specific recombination
recognition site, and (b) a gene encoding a first selectable
marker; and a second vector comprising (a) a negative selectable
marker interposed between a double-stranded origin of replication
of a rolling circle replicon and a site-specific recombinase
recognition site, (b) a single-stranded origin of replication and
(c) a gene encoding a second selectable marker in vitro with a
site-specific recombinase so as to generate a co-integrate vector.
The method subsequently provides for the introduction of the
co-integrate vector into a prokaryotic host cell so as to permit
the production of the product vector comprising (a) the gene of
interest from the first vector interposed between a double-stranded
origin of replication and a site-specific recombination recognition
site, (b) the single-stranded origin of replication of the second
vector, and (c) the gene encoding the selectable marker of the
second vector.
[0047] Vector Components
[0048] The present invention is based, in part, on the construction
of two vectors, a first vector and a second vector, and subsequent
fusion of the two vectors into a co-integrate vector. The first
vector necessarily contains a site-specific recombinase recognition
site which dictates where the subsequent recombination event to
form the co-integrate vector will occur, a selectable marker gene,
a double-stranded origin of replication derived from a plasmid
vector which replicates by a rolling circle mechanism, and a gene
of interest which is ultimately to be transferred to a product
vector. The second vector contains a second selectable marker, a
negative selectable marker, a double-stranded origin of
replication, and a single-stranded origin of replication. Using a
sequence-specific recombinase which acts at the sites dictated by
the recombinase recognition sites of the first and second vectors,
a precise fusion of the first and second vectors is catalyzed. An
advantage of the invention is that transfer of the gene of interest
to a product vector occurs without the need to use restriction
enzymes.
[0049] Double-Stranded Origin of Replication of a Rolling Circle
Replicon
[0050] The formation of a product vector of the present invention
depends upon the replication of the co-integrate, by a rolling
circle mechanism. Accordingly, both of the first and second vectors
which are recombined to generate the co-integrate vector must
contain a double-stranded origin of replication. The
double-stranded origin of replication of a rolling circle replicon
contains the physical and function elements required in cis for the
initiation of the leading strand synthesis in the process of
rolling circle replication. A double-stranded origin of replication
of a rolling circle replicon, useful in the present invention, may
be isolated from any plasmid vector, known to those of skill in the
art, which replicates by a rolling circle mechanism. Plasmids from
which double-stranded origins of replication of a rolling circle
replicon may be obtained include, but are not limited to the
following: pT181, pC221, pC223, pCW7, pHD2, pLUG10, pOg32, pS194,
pT127, pTZ12, pUB112, pE194, pA1, pC1305, pCI411, pFX2, pKMK1,
pLS1, pSH71, pWV01, pC194, pAM.alpha.1, pBAA1, pBC1, pBC16, pBP614,
pBS2, pC300, pCA2.4, pCB101, pCB2.4, pCC5.2, pFTB14, pA, pPL,
pSSU1, p1414, pDC123, pGT5, pJDB21, pKYM, pLAB1000, pLot3, pLP1,
pOX6, pRF1, pRBH1, pSH1451, pSN1981, pTA1060, pTD1, pTHT15, pUB110,
pUH1, pVA380-1, pWC1, pEGB32, p353-2, pSN2, pBI143, pE5, pE12,
pIM13, pNE131, pT48, pTCS1, pZMO2, pIJ101, pBL1, pJV1, pSG5, pSN22,
pC1305, pG12, pGRB1, pHK2, pHPK255, pTX14-1, pTX14-3, pVT736-1, and
E. coli phages such as f1 and .PHI.174. The fully functional
double-stranded origin of replication generally consists of less
than 100 base pairs, and is comprised of two general regions, one
which is involved in sequence-specific, non-covalent binding to the
protein which initiates replication, and the second which contains
the site at which a nick is produced in the plasmid vector DNA for
the start of replication. Replication is generally initiated by the
introduction of a nick within a sequence which is generally
conserved in all rolling circle replication plasmids except in
pKMK1, which has an extra C residue.
[0051] Although any rolling circle plasmid double-stranded origin
of replication may be used for production of the product plasmid,
its usefulness is often diminished by the minimal size required for
its function. The double-stranded origin of replication of a
rolling circle replicon is transferred to the product vector along
with the gene of interest as described hereinbelow. The small size
of the double stranded origin of replication is advantageous for
applications which require the translational fusion of open reading
frames contained within the transferred gene of interest to
sequences contained within the second vector (such as epitope tags,
or purification tags). The minimal sequence of the double-stranded
origin required to support replication is often poorly defined. An
origin of replication useful in the invention is the
double-stranded origin of replication of the bacteriophage
.PHI.X174. The minimal sequence for the double-stranded origin of
replication is 30 bases long, consisting of the sequence
caacttgatattaataacactatagaccac (SEQ ID NO: 2), which initiates
replication of the (+) strand (Brown et al. (1983) J. Biol. Chem.
13:8402). The underlined nucleotides show the minimal sequence
required for incision by the replication proteins (Fluit et al.
(1984) Virology 154:357). The bold sequence is required for binding
of the replication proteins to the double-stranded origin (Van
Mansfield et al. (1984) Adv. Exp. Med. Biol. 179:221). This origin
contains 3 reading frames lacking stop codons (1 in the orientation
shown, 2 on the complementary strand), thus allowing formation of
translational fusions. In a preferred embodiment, the double
stranded origin of replication is the double stranded origin from
bacteriophage f1 which comprises the sequence
gagtccacgttctttaatagtggactcttgttccaaactggaac- aa (SEQ ID NO: 3). A
key feature of the present invention is that in vitro and in vivo
replication of a plasmid containing two double-stranded origins of
replication on the same strand lead to the formation of two smaller
plasmids corresponding to the sequences located between the two
double-stranded origins of replication (Fluit et al. Virology
154:357; Goetz and Hurwitz (1988) J. Biol. Chem. 263:16443).
[0052] An alternative double-stranded origin of replication useful
in the present invention is the double-stranded origin of the
rolling circle plasmid pKYM, originally isolated from Shigella
sonnei (Sugiura et al. (1984) J. Biochem. 96:1193). pKYM is a
plasmid that replicates by the rolling circle mechanism in E. coli
(Yasukawa et al. (1991) Proc. Natl. Acad. Sci. USA 88:10282). When
certain mutants of the plasmid encoded replication protein are
used, the minimal sequences required for double-stranded origin of
replication function is 5'-TTGTATTTATACTTAAGGGA-
TAAATGGCGGATATGAAATAGT-3' (SEQ ID NO: 4).
[0053] In addition to the double stranded origins of replication
from .PHI.X174 and pKYM, sequences the double stranded origin of
replication from other plasmids which replicate by a rolling circle
mechanism may also be used. Additional double stranded origins of
replication useful in the present invention include, but are not
limited to the double stranded origins of replication from: pA
(5'-CAGGTATGCGGAAAACTTTAGGAACAAGG-3'; SEQ ID NO: 5; GenBank
Accession No: 10956566), pBL (5'-ACTTATCTTGATAATAAGGGTA-
ACTATTTACGGCG-3'; SEQ ID NO: 6; GenBank Accession No: 10956242),
pSSU1 (5'-GGGGGCGTACTACGACCCCCC-3'; SEQ ID NO: 7; GenBank Accession
No: 10956187), p1414
(5'-GTTTTAAAAAAGCCGGCTGTTTTCAGCCGGCTTTTTTTCGATTTTGGCGGGG-
GTCTTTTCTTATCTTGATACTATATAGAAACACCAAGATTTTTTAAAAGCCTTG
CGTGTCAAGGCTT-3'; SEQ ID NO: 8; GenBank Accession No: 10956512),
and pDC123
(5'-TTTCTCCGAAAAAATCTAAAATATGGGGGGGCTACTACGACCCCCCCTATGCCAAAATCAAAAAAAAAA-
CG-3'; SEQ ID NO: 9; GenBank Accession No: AF 167172).
[0054] Single-Stranded Origin of Replication
[0055] Replication of the co-integrate plasmid of the invention
from the double-stranded origin of replication produces a
single-stranded nucleic acid (DNA) as described in more detail
below. Replication of the single-stranded DNA released upon
completion of leading strand synthesis initiates from the plasmid
single-stranded origin of replication and is carried out solely by
the proteins present in the host cell (Khan (1997) Microbiol. Mol.
Biol. Rev. 61:442; delSolar et al. (1998) Microbiol. Mol. Biol.
Rev. 62:434). Sequence and structural similarities has led to the
identification of at least four main types of single-stranded
origins of replication, termed ssos, ssoA, ssoT, sso W, and ssoU.
While some single-stranded origins of replication function
effectively only in their native host organisms, such as ssoA and
ssoW, others, such as ssoU and ssoT can support single-stranded to
double-stranded DNA synthesis in a broad range of bacterial hosts.
Accordingly, single-stranded origins of replication, useful in the
present invention are preferable selected from either ssoU or ssoT.
The single-stranded origins of replication are strand and
orientation specific and must be present in a single-stranded form
in order to be active. All single-stranded origins that have been
analyzed to date contain single-stranded DNA promoters that are
recognized by the host cell RNA polymerase that synthesizes a short
RNA primer for DNA synthesis (Kramer et al. (1997) EMBO J. 16:5784;
Kramer (1998) Proc. Natl. Acad. Sci. USA 95:10505).
[0056] In addition to the general categories of single-stranded
origins of replication (i.e., ssoU, ssoT), single-stranded origins
of replication, useful in the present invention may be selected
from any plasmid which replicates by a rolling circle mechanism
including, but not limited to the following: pT181, pC221, pC223,
pCW7, pHD2, pLUG10, pOg32, pS194, pT127, pTZ12, pUB112, pE194, pA1,
pC1305, pCI411, pFX2, pKMK1, pLS1, pSH71, pWV01, pC194,
pAM.alpha.1, pBAA1, pBC1, pBC16, pBP614, pA, pPL, pSSU1, p1414,
pDC123, pBS2, pC300, pCA2.4, pCB101, pCB2.4, pCC5.2, pFTB14, pGT5,
pJDB21, pKYM, pLAB1000, pLot3, pLP1, pOX6, pRF1, pRBH1, pSH1451,
pSN1981, pTA1060, pTD1, pTHT15, pUB110, pUH1, pVA380-1, pWC1,
pEGB32, p353-2, pSN2, pBI143, pE5, pE12, pIM13, pNE131, pT48,
pTCS1, pZMO2, pIJ101, pBL1, pJV1, pSG5, pSN22, pC1305, pG12, pGRB1,
pHK2, pHPK255, pTX14-1, pTX14-3, PCR-ScriptAmpSK.sup.+, filamentous
phage (f1), .PHI.X174, or pVT736-1. In addition, a single-stranded
origin of replication may be derived from a plasmid isolated from a
host organism capable of replicating nucleic acid by a rolling
circle mechanism including but not limited to Staphylococcus
aureus, Bacillus subtilis, Clostridium butyricum, Brevibacterium
lactofermentum, Streptococcus agalactiae, Lactococcus lactis,
Leuconostoc lactis, Streptomyces, Actinobacillus
actinobycetemcomitans, Bacteroides, cyanobacteria, Helobacter
pylori, Selnomonas ruminatium, Shigella sonnei, Zymomonas mobilis,
Mycoplasma mycoides, or Treponema denticola, Bacillus
thuringiensis, Staphlococcus lugdunensis, Leuconostoc oenos,
Corynebacterium xerosis, Lactobacillus plantarum, Streptococcus
faecalis, Bacillus coagulans, Bacillus ceretus, Bacillus popillae,
Synechocystis strain PCC6803, Bacillus liquefaciens, Pyrococcus
abyssi, Selenomonas nominantium, Lactobacillus hilgardii,
Streptococcus ferus, Lactobacillus pentosus, Bacteroidesfragilis,
Staphylococcus epidermidis, Staphylococcus epidermidis, Zymomonas
mobilis, Streptomyces phaechromogenes, Escherichia coli,
Streptomyces ghanaenis, Halobacterium strain GRB, and Halobaferax
sp. strain Aa2.2.
[0057] Examples of plasmid single stranded origins of replication
useful in the present invention, include but are not limited to the
single stranded origin of replication of the following plasmids: pA
(5'-AACAAGGGTTGTTCGCGGGGACAAAACTAGCCCCAAGCTCGCGTTTCCGCCGTTAGTACCTTGACGCGG-
CTTTACCCAGCGCGCCTACGCGCCGAGATTT-3'; SEQ ID NO: 10; GenBank
Accession No: 10956566), pPL
(5'-GTCAACGATAAGCGGACTTCGGCGTTAGCCGATGGAGCATTAAGGAGTTGATGG-
TTTCCAGGCTCTTGGCGACAGCAAA
AAGGAAAAACACTTTTTCCCTTCCTCGACAGAGCCACCGGACCTAGAA- AGAAAGTTT
TTGGCTGCCCCTTTGGGCGGTCTTTTTTTGGCCATGCGGAGCATGGCTCGGCGGAGC
CGACGGC-3'; SEQ ID NO: 1; GenBank Accession No: 10956242), pSSU1
(5'-GCGATTTATGCCGAGAAAACTCTTGCTAGGAAGCTATGCGAAATAGACTAAGTCGACAGG
CTGAAAGCTTGCCGACCGAACACGACAGTCAGATTTCAGCTCCTAGCAAGAGGAAA
TTGGAATAA-3'; SEQ ID NO: 12; GenBank Accession No: 10956187), p1414
(5'-TGGGGGTGAGTCAACGGTAACCGGACCGTAGGGAGGATTAAGGAGTTGACCCACCCGAACC
CTTTCAGCACTCAAACAAACCCGTTTGTTTGACGCCAACGCCCCCCGAAGATGCGGG
GGGTTGGGGGGATTGAATGCTGGCATCCAACG-3'; SEQ ID NO: 13; GenBank
Accession No: 10956512), pDC 123
(5'-TATTTGACAACAAGTAACCAAGTGACTGCCGTCCTTTGTCCGTGTCCGTC-
CAGCCTTTCGGCTCGGCACGTCCTAGCGTACTCTGTCACTGC TTATTGTCA-3'; SEQ ID NO:
14; GenBank Accession No: AF167172), and f1
(5'-AAAAACCGTCTACAGGGCGATGGCCCACT- ACGTGAACCATCACCCTAATCAAGTTTT
TTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGG- AGCCCCCGATT TAGAGCT;
SEQ ID NO: 15; GenBank Accession No. AF305698).
[0058] Selectable Markers
[0059] The first and second plasmids of the present invention also
comprise a gene encoding a selectable marker which may be any
marker known in the art, for instance a gene coding for a product
which confers antibiotic resistance to the cell, which confers
prototrophy to an auxotrophic strain, or which complements a defect
of the host. Selectable markers, useful in the present invention,
may be a protein necessary for the survival or growth of
transformed host cells grown in a selective culture medium. Host
cells not transformed with the vector containing the selectable
marker will not survive in the culture medium. Typical selectable
markers are proteins that confer resistance to antibiotics or other
toxins, such as ampicillin (GenBank Accession No: AF307748),
neomycin (GenBank Accession No: U89929), kanamycin (GenBank
Accession No: AF292560), chloramphenicol (GenBank Accession No:
11061044), or tetracycline (GenBank Accession No: U49939).
Alternatively, selectable markers may encode proteins that
complement auxotrophic deficiencies or supply critical nutrients
not available from complex media, e.g., the gene encoding D-alanine
racemase for Bacilli. Alternatively, a selectable marker, useful in
the present invention, can be a suppressor tRNA. A number of
selectable markers are known to those of skill in the art and are
described for instance in Sambrook et al., Molecular Cloning: A
Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y., 1989. According to the
methods of the present invention, it is preferred that the
selectable marker of the first vector is different from the
selectable marker of the second plasmid, thus allowing for the
independent selection of either the first or second plasmid.
[0060] Negative Selectable Marker
[0061] One or more plasmids of the present invention further
comprises a negative selectable marker which provides a mechanism
by which plasmids that express the negative selectable marker may
be selected against. Negative selectable markers useful in the
present invention are proteins which, when expressed by a host cell
confers susceptibility of that host cell to agents such as
antibiotics or toxins. Genes encoding negative selectable markers
useful in the present invention include, but are not limited to
rpsL (GenBank Accession No: AF316617), hsv-tk (U.S. Pat. No.
6,146,888, incorporated herein by reference), gpt (U.S. Pat. No.
6,063,630, incorporated herein by reference), GLUT-2 (U.S. Pat. No.
6,110,707, incorporated herein by reference), and sacB (GenBank
Accession No: U75992). Alternatively, promoters or other functional
elements required for the efficient expression of a negative
selectable marker gene also can function as negative selectable
markers. Alternatively, a negative selectable marker may be a
restriction site, recognized by a host restriction system which
would leas to cleavage of a plasmid containing the sequence, thus
eliminating the functionality of the plasmid. An additional example
of a negative selectable marker, useful in the present invention is
the so called kill genes derived from low copy number plasmids such
as the F' derived ccd gene (Boe et al., 1987 J. Bacteriol
169:4646). In preferred embodiments of the present invention the
negative selectable marker is the protein encoded by the E. coli
rpsL gene. Expression of the wild type rpsL gene confers
streptomycin sensitivity to a streptomycin host strain and thus
cells which express rpsL may be selected against by treating the
cells with streptomycin.
[0062] Site-Specific Recombination Recognition Sites
[0063] The plasmids of the present invention comprise either a gene
of interest or a negative selectable marker interposed between a
double-stranded origin or replication and a site-specific
recombination recognition site. The precise fusion between the
first and second vector is catalyzed by a site-specific
recombinase. Site-specific recombinases are enzymes that recognize
a specific DNA site or sequence termed a site-specific
recombination recognition site, and catalyzes the recombination of
DNA in relation to these sites. Conversely, site-specific
recombination recognition sequences are short nucleic acid sequence
or site which is recognized by a sequence-or site-specific
recombinase and which become the crossover regions during the
site-specific recombination event. Examples of site-specific
recombination sites include, but are not limited to loxP sites (SEQ
ID NO: 16), loxP2 sites, loxP3 sites, loxP23 sites, loxP511 sites
(SEQ ID NO: 17), loxB sites (GenBank Accession No: M10512), loxC2
sites (SEQ ID NO: 18), loxL sites (GenBank Accession No: M10511),
loxR sites (GenBank Accession No: M10510), lox.DELTA.86 sites,
lox.DELTA.117 sites, frt sites (GenBank Accession No: 1769877),
.lambda.-phage att sites (GenBank Accession No: NC001416), and
difsites (GenBank Accession No: S62735). Site-specific
recombination recognition sites, and site-specific recombination
are described in further detail below. In preferred embodiments,
the site-specific recombinase recognition sites are loxP sites, or
the attP and attB sites recognized by the integrase from .phi.C31
(GenBank Accession No. AJ006598; Groth, 2000 Proc. Natl. Acad. Sci.
USA, 97: 5995).
[0064] First and Second Vector Recombination
[0065] The present invention the transfer of a gene of interest
from a first vector to a product vector is achieved by first
forming a co-integrate vector through the recombination of the
first and second vector at the site-specific recombination
recognition site (FIG. 1, Site A), preferably by site-specific
recombination. Subsequently, selective rescue of the sequences
between the double-stranded origins of replication (FIG. 1, Site B)
containing the original second vector sequences and the gene of
interest is achieved using the double-stranded origin of
replication in a rolling circle host cell.
[0066] As described above, and shown in FIG. 1, formation of the
co-integrate vector comprised of the source and the acceptor can be
achieved by a variety of methods including ligation of restriction
digested fragments, ligation independent cloning and recombination.
Due to the efficiency, speed, and the low number of handling steps
required, the preferred method of co-integrate vector formation is
by recombination. Ideally, formation of the co-integrate vector
would occur in vivo (i.e., within a bacterial host strain), since
this would allow the minimal number of handling steps. This could
be achieved either by homologous recombination, or site-specific
recombination. However, relatively large regions of homology are
required for efficient homologous recombination (Zhang et al.
(1998) Nature Genetics 20: 123). Most site-specific recombination
systems require only relatively short specific sequences of
typically 30-40 bases (Craig (1988) Ann. Rev. Gen. 22:77). However,
in vivo site-specific recombinases act mainly as resolvases (i.e.,
they excise rather than insert), due to the reversibility of most
site-specific recombination reactions (Adams et al. (1992) J. Mol.
Biol. 226:661). Thus, the preferred method of co-integrate vector
formation is by in vitro site-specific recombination. This may be
achieved using systems such as Cre/loxP (Abremski et al. (1983)
Cell 32:1301), Flp/Frt (Broach et al. (1982) Cell 29:227), or
.lambda.-int/attP (Landy (1989) Ann. Rev. Biochem. 58:913).
[0067] Sequence Specific Recombinases and Recognition Sites
[0068] The precise fusion between the first vector and the second
vector is preferably catalyzed by a site-specific recombinase.
Site-specific recombinases are enzymes that recognize a specific
DNA site or sequence (referred to herein generically as a
"site-specific recombinase recognition site") and catalyzes the
recombination of DNA in relation to these sites. Site-specific
recombinases are employed for the recombination of DNA in both
prokaryotes and eukaryotes. Examples of site-specific recombination
include 1) chromosomal rearrangements which occur in Salmonella
typhimurium during phase variation, inversion of the FLP sequence
during the replication of the yeast 2 .mu.m circle and in the
rearrangement of immunoglobulin and T cell receptor genes in
vertebrates, and 2) integration of bacteriophages into the
chromosome of prokaryotic host cells to form a lysogen.
[0069] The present invention is illustrated but not limited by the
use of vectors containing loxP sites and the recombination of these
vectors using the Cre recombinase of bacteriophage Pl. The Cre
protein catalyzes recombination of DNA between two loxP sites
(Stemberg et al. (1981) Cold Spring Harbor Symp. Quant. Biol.
45:297). The loxP sites may be present on the same DNA molecule or
they may be present on different DNA molecules; the DNA molecules
may be linear or circular or a combination of both. The loxP site
consists of a double-stranded 34 bp sequence (SEQ ID NO: 16) which
comprises two 13 bp inverted repeat sequences separated by an 8 bp
spacer region (Hoess et al. (1982) Proc. Natl. Acad. Sci. USA
79:3398 and U.S. Pat. No. 4,959,317, the disclosure of which is
herein incorporated by reference). The internal spacer sequence of
the loxP site is asymmetrical and thus, two loxP sites can exhibit
directionality relative to one another (Hoess et al. (1984) Proc.
Natl. Acad. Sci. USA 81:1026). When two loxP sites on the same DNA
molecule are in a directly repeated orientation, Cre excises the
DNA between these two sites leaving a single loxP site on the DNA
molecule (Abremski et al. (1983) Cell 32:1301). If two loxP sites
are in opposite orientation on a single DNA molecule, Cre inverts
the DNA sequence between these two sites rather than removing the
sequence. Two circular DNA molecules each containing a single loxP
site will recombine with another to form a mixture of monomer,
dimer, trimer, etc. circles. The concentration of the DNA circles
in the reaction can be used to favor the formation of monomer
(lower concentration) or multimeric circles (higher
concentration).
[0070] Circular DNA molecules having a single loxP site will
recombine with a linear molecule having a single loxP site to
produce a larger linear molecule. Cre interacts with a linear
molecule containing two directly repeating loxP sites to produce a
circle containing the sequences between the loxP sites and a single
loxP site and a linear molecule containing a single loxP site at
the site of the deletion.
[0071] The Cre protein has been purified to homogeneity (Abremski
et al. (1984) J. Mol. Biol. 259:1509) and the cre gene has been
cloned and expressed in a variety of host cells (Abremski et al.
(1983), supra). Purified Cre protein is available from a number of
suppliers (e.g., Stratagene, Novagen and New England Nuclear/Du
Pont).
[0072] The Cre protein also recognizes a number of variant or
mutant lox sites (variant relative to the loxP sequence), including
the loxB, loxL, loxR, loxA86, and lox.DELTA.117 sites which are
found in the E. coli chromosome (Hoess et al. (1982), supra). Other
variant lox sites include loxP511
(5'-ATAACTTCGTATAGTATACATTATACGAAGTTAT-3' (SEQ ID NO:17); spacer
region underlined; Hoess et al. (1986), supra), loxC2 (5'-ACAAC
TTCGTATAATGTATGCTATACGAAGTTAT-3' (SEQ ID NO:18); spacer region
underlined; U.S. Pat. No. 4,959,317). Cre catalyzes the cleavage of
the lox site within the spacer region and creates a six base-pair
staggered cut (Hoess and Abremski (1985) J. Mol. Biol. 181:351).
The two 13 bp inverted repeat domains of the lox site represent
binding sites for the Cre protein. If two lox sites differ in their
spacer regions in such a manner that the overhanging ends of the
cleaved DNA cannot reanneal with one another, Cre cannot
efficiently catalyze a recombination event using the two different
lox sites. For example, it has been reported that Cre cannot
recombine (at least not efficiently) a loxP site and a loxP511
site; these two lox sites differ in the spacer region. Two lox
sites which differ due to variations in the binding sites (ie., the
13 bp inverted repeats) may be recombined by Cre provided that Cre
can bind to each of the variant binding sites; the efficiency of
the reaction between two different lox sites (varying in the
binding sites) may be less efficient that between two lox sites
having the same sequence (the efficiency will depend on the degree
and the location of the variations in the binding sites). For
example, the loxC2 site can be efficiently recombined with the loxP
site; these two lox sites differ by a single nucleotide in the left
binding site.
[0073] A variety of other site-specific recombinases may be
employed in the methods of the present invention in place of the
Cre recombinase. Alternative site-specific recombinases
include:
[0074] 1) the FLP recombinase of the 2pi plasmid of Saccharomyces
cerevisiae (Cox (1983) Proc. Natl. Acad. Sci. USA 80:4223) which
recognize the frt site which, like the loxP site, comprises two 13
bp inverted repeats separated by an 8 bp spacer
(5'-GAAGTTCCTATTCTCTAGAAAGT ATAGGAACTTC-3'(SEQ ID NO:19); spacer
underlined). The FLP gene has been cloned and expressed in E. coli
(Cox, supra) and in mammalian cells (PCT International Patent
Application PCT/US92/01899, Publication No.: WO 92/15694, the
disclosure of which is herein incorporated by reference) and has
been purified (Meyer-Lean et al. (1987) Nucleic Acids Res. 15:6469;
Babineau et al (1985) J. Biol. Chem. 260:12313; Gronostajski and
Sadowski (1985) J. Biol. Chem. 260:12328);
[0075] 2) the integrase of Streptomyces phage .PHI.C31 that carries
out efficient recombination between the attP site of the phage
genome and the attB site of the host chromosome (Groth et al., 2000
Proc. Natl. Acad. Sci. USA, 97: 5995);
[0076] 3) the Int recombinase of bacteriophage lambda
(lambda-int/attP) (with or without Xis) which recognizes att sites
(Weisberg et al. In: Lambda II, supra, pp. 211-250);
[0077] 4) the xerC and xerD recombinases of E. coli which together
form a recombinase that recognizes the 28 bp dif site (Leslie and
Sherratt (1995) EMBO J. 14:1561);
[0078] 5) the Int protein from the conjugative transposon Tn916 (Lu
and Churchward (1994) EMBO J. 13:1541);
[0079] 6) TpnI and the .beta.-lactamase transposons (Levesque
(1990) J. Bacteriol. 172:3745);
[0080] 7) the Tn3 resolvase (Flanagan et al. (1989) J. Mol. Biol.
206:295 and Stark et al. (1989) Cell 58:779);
[0081] 8) the SpoIVC recombinase of Bacillus subtilis (Sato et al.
J. Bacteriol. 172:1092);
[0082] 9) the Hin recombinase (Galsgow et al. (1989) J. Biol. Chem.
264:10072);
[0083] 10) the Cin recombinase (Hafter et al. (1988) EMBO J.
7:3991);
[0084] 11) the immunoglobulin recombinases (Malynn et al. Cell
(1988) 54:453); and
[0085] 12) the FIMB and FIME recombinases (Blomfield et al., 1997
Mol. Microbiol. 23:705)
[0086] In Vitro Recombination
[0087] In preferred embodiments of the present invention, the
fusion of a first vector and a second vector is accomplished in
vitro using a purified preparation of a site-specific recombinase
(e.g., Cre recombinase). The first vector and the second vector are
placed in reaction vessel (e.g., a microcentrifuge tube) in a
buffer compatible with the site-specific recombinase to be used.
For example, when a Cre recombinase (native or a fusion protein
form) is employed, the reaction buffer may comprise 50 mM Tris-HCl
(pH 7.5), 10 mM MgCl.sub.2, 30 mM NaCl and 1 mg/ml BSA. When a FLP
recombinase is employed, the reaction buffer may comprise 50 mM
Tris-HCl (pH 7.4), 10 mM MgCl.sub.2, 100 .mu.g/ml BSA (Gronostajski
and Sadowski (1985) 260:12320). The concentration of the first
vector and the second vector may vary between 100 ng to 1.0 .mu.g
of each vector per 20 .mu.l reaction volume with about 0.1 .mu.g of
each nucleic acid construct (0.2 .mu.g total) per 20 .mu.l reaction
being preferred. The concentration of the site-specific recombinase
may be titered under a standard set of reaction conditions to find
the optimal concentration of enzyme to be used.
[0088] Host cells, useful in the present invention, are
subsequently transformed or transfected with the recombination
reaction product containing the co-integrate vector, and can
include any host cell which is capable of supporting replication of
a rolling circle origin of replication, such as gram-positive
bacteria. Other organisms which may be transformed or transfected
with the vectors of the present invention include, but are not
limited to the following: Staphylococcus aureus, Bacillus subtilis,
Clostridium butyricum, Brevibacterium lactofermentum, Streptococcus
agalactiae, Lactococcus lactis, Leuconostoc lactis, Streptomyces,
Actinobacillus actinobycetemcomitans, Bacteroides, cyanobacteria,
Escherichia coli, Helobacter pylori, Selnomonas ruminatium,
Shigella sonnei, Zymomonas mobilis, Mycoplasma mycoides, or
Treponema denticola, Bacillus thuringiensis, Staphlococcus
lugdunensis, Leuconostoc oenos, Corynebacterium xerosis,
Lactobacillus planta rum, Streptococcus faecalis, Bacillus
coagulans, Bacillus ceretus, Bacillus popillae, Synechocystis
strain PCC6803, Bacillus liquefaciens, Pyrococcus abyssi,
Selenomonas nominantium, Lactobacillus hilgardii, Streptococcus
ferus, Lactobacillus pentosus, Bacteroides fragilis, Staphylococcus
epidermidis, Staphylococcus epidermidis, Zymomonas mobilis,
Streptomyces phaechromogenes, Streptomyces ghanaenis, Halobacterium
strain GRB, and Halobaferax sp. strain Aa2.2.
[0089] In one embodiment, the host cell further comprises a gene
encoding a rep protein which is capable of initiating replication
at the double-stranded origin of replication of the co-integrate
vector. In a preferred embodiment, the rep protein is provided in
trans by subsequent infection of the host cell with a recombinant
bacteriophage.
[0090] In one embodiment, as described below, following first
strand synthesis in the host cell described above, the single
stranded product plasmid is packaged into a viral vector and
introduced into a secondary host. In this instance, the primary
host cell described above does not have to be able to support
replication from the single-stranded origin of replication, as this
function is performed by the secondary host.
[0091] Recombination in Prokaryotic Host Cells
[0092] In an alternative embodiment, the fusion of a first vector
and a second vector may be accomplished in vivo using a host cell
that expresses the appropriate site-specific recombinase (e.g.,
.PHI.C31-att).
[0093] The first vector and the second vector are cotransformed
into the host cell using a variety of methods known to the art. A
variety of ways have been developed to introduce vectors into cells
in culture, and into cells and tissues of an animal or a human
patient. Methods for introducing vectors into cells include, for
example, heat shock, wherein competent cells are mixed with nucleic
acid, incubated on ice for approximately 20 minutes, then placed at
42.degree. C. for 45 seconds, and calcium phosphate-mediated uptake
of nucleic acids by a host cell. These techniques are well known to
those of skill in the art, and are described in many readily
available publications and have been extensively reviewed. Some of
the techniques are reviewed in Transcription and Translation, A
Practical Approach, Hames, B. D. and Higgins, S. J., eds., IRL
Press, Oxford (1984), herein incorporated by reference in its
entirety, and Molecular Cloning, Second Edition, Maniatis et al,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989), herein incorporated by reference in its entirety.
Alternatively, plasmids may be introduced into host cells by
infection with, for example, adenovirus, or by the mating of host
cells provided the plasmid to be transferred comprises an origin of
transfer (Guiney (1988) Plasmid 20:259; Frost et al. (1994)
Microbiol. Rev. 58:162).
[0094] Host cells, useful in the present invention, which may be
transformed with the first and second vectors, include any host
cell which is capable of supporting the rolling circle origin of
replication used in the first and second vectors, such as
gram-positive bacteria. Other organisms which may be transformed or
transfected with the vectors of the present invention include, but
are not limited to the following: Staphylococcus aureus, Bacillus
subtilis, Clostridium butyricum, Brevibacterium lactofermentum,
Streptococcus agalactiae, Lactococcus lactis, Leuconostoc lactis,
Streptomyces, Actinobacillus actinobycetemcomitans, Bacteroides,
cyanobacteria, Escherichia coli, Helobacter pylori, Selnomonas
ruminatium, Shigella sonnei, Zymomonas mobilis, Mycoplasma
mycoides, or Treponema denticola, Bacillus thuringiensis,
Staphlococcus lugdunensis, Leuconostoc oenos, Corynebacterium
xerosis, Lactobacillus plantarum, Streptococcus faecalis, Bacillus
coagulans, Bacillus ceretus, Bacillus popillae, Synechocystis
strain PCC6803, Bacillus liquefaciens, Pyrococcus abyssi,
Selenomonas nominantium, Lactobacillus hilgardii, Streptococcus
ferus, Lactobacillus pentosus, Bacteroides fragilis, Staphylococcus
epidermidis, Staphylococcus epidermidis, Zymomonas mobilis,
Streptomyces phaechromogenes, Streptomyces ghanaenis, Halobacterium
strain GRB, and Halobaferax sp. strain Aa2.2.
[0095] In one embodiment, the host cell further comprises a gene
encoding a rep protein which is capable of initiating replication
at the double-stranded origin of replication of the co-integrate
vector. In a preferred embodiment, the rep protein is provided in
trans by subsequent infection of the host cell with a
bacteriophage.
[0096] In one embodiment, as described below, following first
strand synthesis in the host cell described above, the single
stranded product plasmid is packaged into a viral vector and
introduced into a secondary host. In this instance, the primary
host cell described above does not have to be able to support
replication from the single-stranded origin of replication, as this
function is performed by the secondary host.
[0097] Rescue of the Product Plasmid
[0098] The present invention provides a method of transfer of a
gene of interest from a first vector to a product vector comprising
generating a fused vector (the co-integrate vector, described
hereinabove) comprising the first vector and a second vector,
followed by rescue of the product vector from the fused vector by
rolling circle replication.
[0099] Replication by the rolling circle mechanism is utilized in a
variety of plasmids from gram positive bacteria, some plasmids from
gram-negative bacteria and single-stranded bacteriophages (Kornberg
and Baker (1992) DNA Replication 2.sup.nd Ed., Freeman and Company,
NY; del Solar et al. (1993) Mol. Microbiol. 8:789; Khan (1997)
Microbiol. Mol. Biol. Rev. 61:442). Replication of these replicons
involves three steps (FIG. 2). First, an incision is made by a
vector encoded protein termed Rep, at the double-stranded origin of
replication or (+) origin of replication. The incising protein
typically becomes attached to the incised strand 3' to the excision
site, often by covalent attachment to the 5' phosphate at the nick
site through a tyrosine residue present in the Rep active site.
Nicking of the double-stranded origin of replication is followed by
recruitment of a DNA helicase and other proteins, such as the
single-stranded DNA binding protein and DNA polymerase III. Second,
the 5' end of the incision site serves as the priming site for DNA
synthesis, progressively replacing the strand with the covalently
attached incising protein. When the replication fork reaches the
double-stranded origin again, an incision is made in the displaced
strand followed by circularization of the ends by ligation. The
result is a relaxed, closed circular double-stranded DNA molecule
containing the newly synthesized leading strand, and a
single-stranded circular molecule consisting of the displaced
strand. The nick is then sealed by the host cell DNA ligase, and
the double-stranded DNA is then supercoiled by DNA gyrase. In a
third step, DNA synthesis is initiated at a site on the
single-stranded molecule referred to as the single-stranded origin
of replication, or (-) origin of replication, thus converting the
single-stranded plasmid into a double-stranded form utilizing only
host cell replication factors, proteins, enzymes, etc. It is known
that RNA polymerase generally synthesizes an RNA primer from the
single-stranded origin, and DNA polymerase I extends this primer,
followed by replication by DNA polymerase III. Finally, the DNA
ends are joined by DNA ligase, and the resultant double-stranded
DNA is supercoiled by DNA gyrase. As a consequence, any sequence
located between two double-stranded origins of replication can be
converted into a circular plasmid in a host strain providing the
incising protein described above, providing a single-stranded
origin or replication is present on the (+) strand (Komberg and
Baker (1992) DNA Replication 2.sup.nd Ed., Freeman and Company, NY;
del Solar et al. (1993) Mol. Microbiol. 8:789; Khan (1997)
Microbiol. Mol. Biol. Rev. 61:442).
[0100] Host cells, useful in the present invention, which may be
transformed or transfected with the fused, co-integrate vector, or
in alternative embodiments, with the first and second vector are
cells which can support rolling circle replication, include
gram-positive bacteria, some gram-negative bacteria. Examples of
host cells useful in the present invention include, but are not
limited to the following: Staphylococcus aureus, Bacillus subtilis,
Clostridium butyricum, Brevibacterium lactofermentum, Streptococcus
agalactiae, Lactococcus lactis, Leuconostoc lactis, Streptomyces,
Actinobacillus actinobycetemcomitans, Bacteroides, cyanobacteria,
Helobacter pylori, Selnomonas ruminatium, Shigella sonnei,
Zymomonas mobilis, Mycoplasma mycoides, or Treponema denticola,
Bacillus thuringiensis, Staphlococcus lugdunensis, Leuconostoc
oenos, Corynebacterium xerosis, Lactobacillus plantarum,
Streptococcus faecalis, Bacillus coagulans, Bacillus ceretus,
Bacillus popillae, Synechocystis strain PCC6803, Bacillus
liquefaciens, Pyrococcus abyssi, Selenomonas nominantium,
Lactobacillus hilgardii, Streptococcus ferus, Lactobacillus
pentosus, Bacteroides fragilis, Staphylococcus epidermidis,
Staphylococcus epidermidis, Zymomonas mobilis, Streptomyces
phaechromogenes, Streptomyces ghanaenis, Halobacterium strain GRB,
and Halobaferax sp. strain Aa2.2.
[0101] Selection of the Product Vector
[0102] The procedure outlined above and in FIG. 1 would involve the
use and formation of four plasmid vectors: the first and second
vector, the co-integrate vector, and the product vector. Following
introduction of the co-integrate vector into a host cell which
supports rolling circle replication of the co-integrate vector, or,
alternatively, introduction of the first and second vectors into a
host cell which supports rolling circle replication, it is
advantageous to either selectively eliminate the first, second, and
co-integrate vectors, or selectively isolate the product
vector.
[0103] In preferred embodiments the site-specific recombination
reaction occurs in vitro and thus, subsequent transformation of
host cells useful in the present invention with the recombination
reaction mixture will result in cells which take up the first
vector, cells which take up the second vector, and cells which take
up the co-integrate vector. One consequence of using a
double-stranded origin of replication as a method of retrieving the
product vector from the co-integrate vector is that the
co-integrate vector remains intact and is maintained in the same
host cell with the product vector. This may potentially cause
problems in isolation of the product vector due to interference
between the two plasmids. It is therefore preferable to prevent
this competition. This may be accomplished by either transferring
the vectors from original, rolling circle replication host to a new
(secondary) host (thereby segregating the product vector from the
co-integrate vector) or by generating a co-integrate vector that is
replication-incompetent in the host cell.
[0104] Plasmid Transfer
[0105] Transfer of vectors can be achieved by a variety of methods
but is most effectively achieved by mating using an origin of
transfer to be included on the second vector. If the host cell
contains all genes required for conjugal mating of plasmids, DNA
molecules containing this sequence will be efficiently transferred
to a new host strain (Guiney (1988) Plasmid 20:259; Frost et al.
(1994) Microbiol. Rev. 58:162). The oriT element, which typically
is 100-200 bases in length, can be located anywhere in the
transferred plasmid and contains the site where nicking of the
plasmid occurs and where transfer of single-stranded DNA is
initiated. One potential oriT element which may be utilized in the
present invention to initiate transfer of the product vector to a
secondary host is that encoded by the nucleotide sequence
5'-AGGCTCAACAGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTT
TTGCTGATTTTTCTTTATAAATAGAGTGTTATGAAAAATTAGTTTCTCTTACTCTCTTT
ATGATATTTAAAAAAGCGGTGTCGGCGCGGCTACAACAACGCGCCGACACCGTTTT
GTAGGGGTGGTACTGACTATTTTTATAAAAAACATTATTTTATATTAGGGGTGCTGC
TAGCGGCGCGGTGTGTTTTTTTATAGGATACCGCTAGGGGCGCTGCTAGCGGTGCG-3' (SEQ ID
NO: 20; GenBank Accession No: 9507713), and is the oriT element
from the F plasmid (Frost et al. (1994) Microbiol. Rev. 58:162).
Transfer events may be selected for by co-selection for the marker
contained on the transferred plasmid and a marker specific for the
new (secondary) host strain.
[0106] An alternative method for transfer employs packaging of
single-stranded plasmid molecules into phage particles of
filamentous phages (Ff phages) such as M13 or F1. Single-stranded
DNA molecules will be packaged by Ff phages if a specific,
well-defined recognition sequence is present on the single-stranded
plasmid (GenBank Accession No: K00967; Dotto and Zinder (1983)
Viology 154:357; Lopez and Webster (1983) Virology 127:177). Thus,
infection of the co-integrate vector containing host cells with a
non-lytic variant of a filamentous phage such as the M13 derived
704 helper phage (Stratagene, LaJolla, Calif.) will result in
formation of infectious particles containing the single-stranded,
rescued product vector. Infection of a secondary host will result
in effective transfer of the product vector. One advantage of this
approach is that only the product vector and not the co-integrate
vector will be transferred.
[0107] Viral infection of host cell is a technique which is well
established in the art and may be found in a number of laboratory
texts and manuals such as Sambrook et al., Molecular Cloning: A
Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y., 1989. Briefly, in preferred
embodiments wherein the host cell is transformed with the in vitro
recombination reaction mixture described above, following
transformation, the host cells are mixed with a transfer virus,
such as the helper phage Exassist (Stratagene, LaJolla, Calif.) and
a fresh stationary culture of secondary host cells such as
XLOLR-S.sup.R for several hours at 37.degree. C. The helper phage
will infect the primary host cell and, due to the packaging signal
present in the on the product vector, package the product vector
into viral particles. The product-containing viral particles may
then infect the secondary host cells, thus transferring the product
vector to the secondary host cells. The secondary host cell may
then be selected for with, for example, streptomycin, which will
selectively eliminate the primary host and the secondary host
containing the second vector which contains the wt-rpsL gene that
confers streptomycin sensitivity to the otherwise streptomycin
resistant secondary host.
[0108] Generation of Replication Incompetent Vectors
[0109] As an alternative to transfer of the product plasmid into a
secondary host, co-integrate vectors may be generated which are
replication incompetent in the host cell used for rescue of the
product plasmid. Such replication-incompetent co-integrate plasmids
may be generated by using N15-based linear plasmids (Rybchin and
Svarchevsky (1999) Mol. Microbiol. 33:895). These plasmids are
based on the lysogenic form of the N15 bacteriophage. They require
a plasmid-encoded replication protein and a telomere generating
gene product (tel) for replication. If one or both genes are
deleted from the plasmid, replication can only occur in strains
providing both products in trans. Accordingly, vectors useful in
the present invention may be constructed on an N15 backbone, and
rendered replication incompetent by introducing them into, for
example, tel deficient host cells. Although, the N15-based vector
will retain its ability to replicate given the appropriate
conditions.
[0110] Isolation of the Product Vector
[0111] Following selection of host cells comprising the rescued
product vector using any of the methods described hereinabove, the
product vector may be isolated from either the primary or secondary
host cell by any means known in the art, or described in numerous
laboratory texts and manuals including Sambrook et al., Molecular
Cloning: A Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y., 1989. Briefly, the
host cell containing the product vector is grown overnight in
appropriate medium such as Luria Broth with antibiotics appropriate
for the selectable marker expressed by the product vector at
37.degree. C. The host cells are then centrifuged to separate them
from the growth medium, and lysed under alkaline conditions.
Plasmid DNA may subsequently be purified by cesium chloride high
speed centrifugation, followed by ethanol precipitation, or may be
purified using commercially available kits such as StrataPrep.RTM.
(Stratagene, La Jolla, Calif.). Conformation of the identity of the
product vector may be performed by any technique known in the art
including restriction endonuclease digestion, or Southern
analysis.
EXAMPLE 1
[0112] Transfer of inserts of interest from a first vector to a
product vector is a two step process. The first step is the
formation of a fused, co-integrate vector between the first vector
and a second vector. The second step is the in vivo rescue of the
product vector containing the insert of interest in the second
vector using the Double strand origin of replication of a rolling
circle replicon. Due to potential problems arising for the
co-existence of the co-integrate vector and the rescued product
vector in the same host cell, an additional step of transferring
the product into a secondary host prior to selection is
required.
[0113] First Vector Construction
[0114] In order to test the feasibility of insert transfer by the
above method, a first vector containing a LoxP site and a 46 bp
fragment containing the filamentous bacteriophage f1 double strand
origin of replication flanking the insert of interest was
constructed (FIG. 3). The vector is based on a colE1 (pUC) replicon
and confers ampicillin resistance. It does not contain a single
strand origin or a packaging signal for packaging by f1 helper
phages. As a test insert the .beta.-galactosidase gene of pCH110
was inserted between the LoxP site and the f1-DS origin since its
presence can be easily monitored by the appearance of blue colonies
in the presence of the chromogenic substrate X-gal.
[0115] The 46 bp constituting the f1 double-stranded origin of
replication
(5'-CGTCGACCTCGATTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACT
CGTACCC-3' [SEQ ID NO: 21]; the double-stranded origin is
underlined; the incised strand is complementary to the sequence
shown) was inserted as a synthetic 46 bps oligomer between the KpnI
and XhoI sites of pBC SK.sup.+ (FIG. 6, SEQ ID NO:1). The wild type
LoxP site (5'-CGAATTGGAGCTATAACTTCGT-
ATAATGTATGCTATACGAAGTTATCATATGGCGGT GGCGGCCGCTCTAGAAC-3' [SEQ ID
NO: 16]; the LoxP site is underlined) was inserted as a 34 bps
oligomer between the SacI and SacII sites of pBC SK.sup.+. A
plasmid containing both elements was generated by combining the
appropriate ScaI-EcoRI fragments. The resulting cassette containing
the LoxP and f1 double-stranded origin inserted into the polylinker
was then transferred as a BssHII fragment to the BluescriptII
SK.sup.+ from which the function elements of the f1 origin located
between nucleotides 90 and 583 has been deleted by PCR. Finally,
the .beta.-gal gene was inserted as a BamHI-SaII fragment from
pCH110 (Pharmacia Biotech) between the BamHI and HindIII sites.
[0116] Second Vector Construction
[0117] The second vector contains the same LoxP sites and f1 double
strand origin of replication as the first vector. The second vector
also contains the same origin of replication as the first vector
but confers chloramphenicol resistance In addition, the f1 single
strand origin of replication and the f1 packaging signal was
included in the vector backbone matching the f1 double strand
origin in orientation. The E. coli rpsL gene was inserted between
the LoxP site and the f1 double strand origin of replication.
Expression of the wild type rpsL gene confers streptomycin
sensitivity to a streptomycin resistant host strain containing a
mutation of the rpsL gene and can thus be selected against.
[0118] The 46 bp constituting the f1 double-stranded origin of
replication was inserted as a synthetic 46 bps oligomer between the
KpnI and XhoI cites of pBC SK.sup.+. The wild type LoxP site was
inserted as a 34 bps oligomer between the SacI and SacII sites of
pBC SK.sup.+. A plasmid containing both elements was generated by
combining the appropriate ScaI-EcoRI fragments. Into this vector
the wild type E. coli rpsL gene was inserted as a PCR amplified
fragment from E. coli K12 (nt 7890-7421 of GenBank Accession No
AE00410) between the EcoRI and HindIII sites. The EcoRI and HindIII
restriction sites were added to the primer used for amplification
of the rpsL gene. The resulting cassette containing the LoxP, wild
type rpsL gene and f1 double-stranded origin was then transferred
as a BssHII fragment to the BssHII digested pBC KS+from which the
f1 double-stranded origin containing sequences located between
nucleotides 135 and 178 had been deleted by PCR.
[0119] Recombination and Rescue
[0120] A co-integrate vector comprising the first vector and the
second vector was formed by site-specific recombination using
Cre-recombinase. This was achieved by mixing 100 ng of each vector
with 1 .mu.g of Cre-recombinase (Stratagene, La Jolla, Calif.) in
101 .mu.l of 50 mM Tris HCL pH 7.5, 10 mM MgCl.sub.2 and 30 mM NaCl
and subsequent incubation at 37.degree. C. for 45 minutes. The
reaction was stopped by heat-inactivation for 15 minutes at
65.degree. C.
[0121] To rescue the product vector from the co-integrate vector,
chemically competent XL1-blue or XL10 gold (kanR) (both strains
from Stratagene, LaJolla, Calif.) were transformed with the above
recombination reaction. Either strain has high transformation
efficiencies and carries the F' plasmid required to render the host
infectable by filamentous phages such as f1. Transformation was
performed by mixing 2.5 .mu.l of the recombination reaction with
100 .mu.l of competent cells, incubation on ice for 20 minutes and
subsequent hear shock at 42.degree. C. for 45 seconds. After the
heat shock, 1 ml of 1.times.NZY, 10 .mu.l of Exassist helper phage
(10.sup.8 pfu; Stratagene, LaJolla, Calif.) and 100 .mu.l of a
fresh stationary culture of XLOLR-S.sup.R were added and incubated
for 2 hours at 37.degree. C. while shaking. The XLOLR-S.sup.R
strain serves as the secondary host. The secondary host can be
selected for with Streptomycin. Exassist is used as a helper phage
allowing packaging of the rescued single-stranded product vector.
The helper phage is replication competent in the primary host
(XL1-blue or XL10 gold) which contains the suppressor mutation supE
but not in the secondary host (XLOLR-S.sup.R) that contains no
suppressor mutations. The rescued product plasmid was selected for
by plating 100 or 200 .mu.l on LB plates supplemented with
Chloramphenicol (34 .mu.g/ml), Streptomycin (75 .mu.g/ml) and
X-gal. Successful insert transfer should result in chloramphenicol
resistant colonies expressing b-galactosidase activity, evidenced
by formation of blue colonies on X-gal containing plates.
1TABLE 1 Transfer of .beta.-gal from a first vector to a product
vector Transfer Efficiency.sup.b Transfer (colonies/ Error Rate
.mu.g target (white colonies/ Input Colony Count.sup.a plasmid)
total colonies) first vector- expt.1.sup.c -- N/A .beta.gal expt
2.sup.d -- N/A second vector expt. 1 1 (1 w) 2 .times. 10.sup.7 N/A
expt. 2 17 (17 w) 3.4 .times. 10.sup.2 N/A first vector- expt. 1
488 (0 w) 1.2 .times. 10.sup.4 <2 .times. 10.sup.-3 (<0.2%)
.beta.gal + expt. 2 4.1 .times. 8.2 .times. 10.sup.5 1.4 .times.
10.sup.-3 (0.146%) second vector 10.sup.3 (6 w) .sup.a200 .mu.l of
1.1 ml transformation mix plated .sup.bthe transfer efficiency is
dependent on the concentration of either reaction partner and has
been arbitrarily referred to the second vector .sup.cXL1 blue has
been used as primary host in experiment 1 .sup.dXL10 gold
(kan.sup.R) has been used as primary host in experiment 2
[0122] Results of the transfer experiment described above are shown
in table 1. Plasmid DNA of 18 blue colonies were analyzed by
restriction digestion. All vectors displayed the restriction
pattern expected for successful transfer. All white colonies
analyzed by restriction digestion were indistinguishable from the
second vector and presumably resulted form mutations in the rpsL
insert serving as the negative selectable marker. The differences
in the transfer efficiency between experiment 1 and experiment 2 is
probably due to the different transformation efficiencies of the
primary hosts used.
EXAMPLE 2
[0123] In an alternative embodiment the present invention provides
a method of transfer of a gene of interest from a first vector to a
product vector comprising introducing to a host cell the first and
second vectors described above, wherein the host cell expresses a
site-specific recombinase which can catalyze the recombination of
the first and second vectors, thus generating a co-integrate
vector, and wherein the gene of interest may be rescued from the
co-integrate vector by rolling circle replication.
[0124] First Vector Construction
[0125] In order to test the feasibility of insert transfer by the
above method, a first vector containing a .PHI.C31 attP site and a
46 bp fragment containing the filamentous bacteriophage f1 double
strand origin of replication flanking the insert of interest was
constructed (FIG. 3). The vector is based on a colE1 (pUC) replicon
and confers ampicillin resistance. It does not contain a single
strand origin or a packaging signal for packaging by f1 helper
phages. As a test insert the .beta.-galactosidase gene of pCH110
was inserted between the .PHI.C31 attP site and the f1-DS origin
since its presence can be easily monitored by the appearance of
blue colonies in the presence of the chromogenic substrate
X-gal.
[0126] The 46 bp constituting the f1 double-stranded origin of
replication
(5'-CGTCGACCTCGATTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACT
CGTACCC-3' [SEQ ID NO: 21]; the double-stranded origin is
underlined; the incised strand is complementary to the sequence
shown) was inserted as a synthetic 46 bps oligomer between the KpnI
and XhoI sites of pBC SK.sup.+ (SEQ ID NO:1). The .PHI.C31 attP
site was inserted between the SacI and SacII sites of pBC SK.sup.+.
A plasmid containing both elements was generated by combining the
appropriate ScaI-EcoRI fragments. The resulting cassette containing
the attP site and f1 double-stranded origin inserted into the
polylinker was then transferred as a BssHII fragment to the
BluescriptII SK.sup.+ from which the function elements of the f1
origin located between nucleotides 90 and 583 has been deleted by
PCR. Finally, the .beta.-gal gene was inserted as a BamHI-SalI
fragment from pCH110 (Pharmacia Biotech) between the BamHI and
HindIII sites.
[0127] Second Vector Construction
[0128] The second vector contains a .PHI.C31 attB site and f1
double strand origin of replication as the first vector. The second
vector also contains the same origin of replication as the first
vector but confers chloramphenicol resistance In addition, the f1
single strand origin of replication and the f1 packaging signal was
included in the vector backbone matching the f1 double strand
origin in orientation. The E. coli rpsL gene was inserted between
the .PHI.C31 attB site and the f1 double strand origin of
replication. Expression of the wild type rpsL gene confers
streptomycin sensitivity to a streptomycin resistant host strain
containing a mutation of the rpsL gene and can thus be selected
against.
[0129] The 46 bp constituting the f1 double-stranded origin of
replication was inserted as a synthetic 46 bps oligomer between the
KpnI and XhoI cites of pBC SK.sup.+. The .PHI.C31 attB site was
inserted between the SacI and SacII sites of pBC SK.sup.+. A
plasmid containing both elements was generated by combining the
appropriate ScaI-EcoRI fragments. Into this vector the wild type E.
coli rpsL gene was inserted as a PCR amplified fragment from E.
coli K12 (nt 7890-7421 of GeneBank Accession No AE00410) between
the EcoRI and HindIII sites. The EcoRI and HindIII restriction
sites were added to the primer used for amplification of the rpsL
gene. The resulting cassette containing the attB site, wild type
rpsL gene and f1 double-stranded origin was then transferred as a
BssHII fragment to the BssHII digested pBC KS.sup.+ from which the
f1 double-stranded origin containing sequences located between
nucleotides 135 and 178 had been deleted by PCR.
[0130] In Vivo Recombination
[0131] To generate the co-integrate vector, the first and second
vectors are co-transformed into E. coli. with plasmid pInt (Groth
et al., 2000, Proc Natl Acad Sci USA, 97:5995) from which .PHI.C31
integrase is expressed, thus supporting the recombination of
plasmid vectors bearing attP/B sites. Transformation is performed
by mixing between 0.1 and 50 ng each of the first and second
vectors with 100 .mu.l of competent XL1-blue or XL10 gold cells
comprising an integrase expression vector (comprising the
.PHI.C31-integrase gene cloned into pGM4 containing a gentamycin
resistance marker). The mixture is incubated on ice for 20 minutes
and subsequently heat shocked at 42.degree. C. for 45 seconds.
After the heat shock, cells are incubated at 37.degree. C. for 2-4
hours. Subsequently, 1 ml of NYZ, 10 .mu.l of Exassist helper phage
(10.sup.8 pfu; Stratagene LaJolla, Calif.) and 100 .mu.l of a fresh
stationary culture of XLOLR-S.sup.R cells were added and incubated
for 2 hours at 37.degree. C. while shaking. The XLOLR-S.sup.R
strain serves as the secondary host. The secondary host may be
selected for with streptomycin, as the presence of the rpsL gene in
the first, second and co-integrate vectors will confer streptomycin
sensitivity to cell bearing these vectors, whereas secondary host
cells bearing the product vector will be selected for. Exassist is
used as a helper phage allowing packaging of the rescued
single-stranded product vector. The rescued product plasmid is
selected for by plating 100 to 200 .mu.l on LB plates supplemented
with chloramphenicol (34 .mu.g/ml), streptomycin (75 .mu.g/ml) and
X-gal. Successful gene of interest transfer should result in
chloramphenicol resistant colonies expressing .beta.-galactosidase
activity, evidenced by formation of blue colonies on X-gal
containing plates.
Other Embodiments
[0132] Other embodiments will be evident to those of skill in the
art. It should be understood that the foregoing detailed
description is provided for clarity only and is merely exemplary.
The spirit and scope of the present invention are not limited to
the above examples, but are encompassed by the following claims.
Sequence CWU 1
1
21 1 3400 DNA Artificial plasmid pBC SK+ 1 ctaaattgta agcgttaata
ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac
caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120
gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc
180 caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg
aaccatcacc 240 ctaatcaagt tttttggggt cgaggtgccg taaagcacta
aatcggaacc ctaaagggag 300 cccccgattt agagcttgac ggggaaagcc
ggcgaacgtg gcgagaaagg aagggaagaa 360 agcgaaagga gcgggcgcta
gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac 420 cacacccgcc
gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg 480
caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg
540 gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt
cacgacgttg 600 taaaacgacg gccagtgagc gcgcgtaata cgactcacta
tagggcgaat tgggtaccgg 660 gccccccctc gaggtcgacg gtatcgataa
gcttgatatc gaattcctgc agcccggggg 720 atccactagt tctagagcgg
ccgccaccgc ggtggagctc cagcttttgt tccctttagt 780 gagggttaat
tgcgcgcttg gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt 840
atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa gcctggggtg
900 cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct
ttccagtcgg 960 gaaacctgtc gtgccagctg cattaatgaa tcggccaacg
cgcggggaga ggcggtttgc 1020 gtattgggcg ctcttccgct tcctcgctca
ctgactcgct gcgctcggtc gttcggctgc 1080 ggcgagcggt atcagctcac
tcaaaggcgg taatacggtt atccacagaa tcaggggata 1140 acgcaggaaa
gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 1200
cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct
1260 caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt
ccccctggaa 1320 gctccctcgt gcgctctcct gttccgaccc tgccgcttac
cggatacctg tccgcctttc 1380 tcccttcggg aagcgtggcg ctttctcata
gctcacgctg taggtatctc agttcggtgt 1440 aggtcgttcg ctccaagctg
ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg 1500 ccttatccgg
taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg 1560
cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct
1620 tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc
tgcgctctgc 1680 tgaagccagt taccttcgga aaaagagttg gtagctcttg
atccggcaaa caaaccaccg 1740 ctggtagcgg tggttttttt gtttgcaagc
agcagattac gcgcagaaaa aaaggatctc 1800 aagaagatcc tttgatcttt
tctacggggt ctgacgctca gtggaacgaa aactcacgtt 1860 aagggatttt
ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttcgaccgaa 1920
taaatacctg tgacggaaga tcacttcgca gaataaataa atcctggtgt ccctgttgat
1980 accgggaagc cctgggccaa cttttggcga aaatgagacg ttgatcggca
cgtaagaggt 2040 tccaactttc accataatga aataagatca ctaccgggcg
tattttttga gttgtcgaga 2100 ttttcaggag ctaaggaagc taaaatggag
aaaaaaatca ctggatatac caccgttgat 2160 atatcccaat ggcatcgtaa
agaacatttt gaggcatttc agtcagttgc tcaatgtacc 2220 tataaccaga
ccgttcagct ggatattacg gcctttttaa agaccgtaaa gaaaaataag 2280
cacaagtttt atccggcctt tattcacatt cttgcccgcc tgatgaatgc tcatccggaa
2340 ttacgtatgg caatgaaaga cggtgagctg gtgatatggg atagtgttca
cccttgttac 2400 accgttttcc atgagcaaac tgaaacgttt tcatcgctct
ggagtgaata ccacgacgat 2460 ttccggcagt ttctacacat atattcgcaa
gatgtggcgt gttacggtga aaacctggcc 2520 tatttcccta aagggtttat
tgagaatatg tttttcgtct cagccaatcc ctgggtgagt 2580 ttcaccagtt
ttgatttaaa cgtggccaat atggacaact tcttcgcccc cgttttcacc 2640
atgggcaaat attatacgca aggcgacaag gtgctgatgc cgctggcgat tcaggttcat
2700 catgccgttt gtgatggctt ccatgtcggc agaatgctta atgaattaca
acagtactgc 2760 gatgagtggc agggcggggc gtaatttttt taaggcagtt
attggtgccc ttaaacgcct 2820 ggttgctacg cctgaataag tgataataag
cggatgaatg gcagaaattc gaaagcaaat 2880 tcgacccggt cgtcggttca
gggcagggtc gttaaatagc cgcttatgtc tattgctggt 2940 ttaccggttt
attgactacc ggaagcagtg tgaccgtgtg cttctcaaat gcctgaggcc 3000
agtttgctca ggctctcccc gtggaggtaa taattgacga tatgatcctt tttttctgat
3060 caaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg
atcttaccgc 3120 tgttgagatc cagttcgatg taacccactc gtgcacccaa
ctgatcttca gcatctttta 3180 ctttcaccag cgtttctggg tgagcaaaaa
caggaaggca aaatgccgca aaaaagggaa 3240 taagggcgac acggaaatgt
tgaatactca tactcttcct ttttcaatat tattgaagca 3300 tttatcaagg
gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa 3360
caaatagggg ttccgcgcac atttccccga aaagtgccac 3400 2 30 DNA
artificial from Bacteriophage phi-X174 2 caacttgata ttaataacac
tatagaccac 30 3 46 DNA artificial from Bacteriophage f1 3
gagtccacgt tctttaatag tggactcttg ttccaaactg gaacaa 46 4 42 DNA
artificial from Shigella sonnei 4 ttgtatttat acttaaggga taaatggcgg
atatgaaata gt 42 5 29 DNA artificial Double stranded origin of
replication of plasmid pA 5 caggtatgcg gaaaacttta ggaacaagg 29 6 35
DNA artificial Double stranded origin of replication for plasmid
pBL 6 acttatcttg ataataaggg taactattta cggcg 35 7 21 DNA Artificial
Double stranded origin of replication from plasmid pSSU1 7
gggggcgtac tacgaccccc c 21 8 119 DNA artificial Double stranded
origin of replication from plasmid p1414 8 gttttaaaaa agccggctgt
tttcagccgg ctttttttcg attttggcgg gggtcttttc 60 ttatcttgat
actatataga aacaccaaga ttttttaaaa gccttgcgtg tcaaggctt 119 9 71 DNA
artificial Double stranded origin of replication from plasmid
pDC123 9 tttctccgaa aaaatctaaa atatgggggg gctactacga ccccccctat
gccaaaatca 60 aaaaaaaaac g 71 10 100 DNA artificial Single stranded
origin of replication from plasmid pA 10 aacaagggtt gttcgcgggg
acaaaactag ccccaagctc gcgtttccgc cgttagtacc 60 ttgacgcggc
tttacccagc gcgcctacgc gccgagattt 100 11 200 DNA Artificial Single
stranded origin of replication from plasmid pPL 11 gtcaacgata
agcggacttc ggcgttagcc gatggagcat taaggagttg atggtttcca 60
ggctcttggc gacagcaaaa aggaaaaaca ctttttccct tcctcgacag agccaccgga
120 cctagaaaga aagtttttgg ctgccccttt gggcggtctt tttttggcca
tgcggagcat 180 ggctcggcgg agccgacggc 200 12 125 DNA Artificial
Single stranded origin of replication from plasmid pSSU1 12
gcgatttatg ccgagaaaac tcttgctagg aagctatgcg aaatagacta agtcgacagg
60 ctgaaagctt gccgaccgaa cacgacagtc agatttcagc tcctagcaag
aggaaattgg 120 aataa 125 13 150 DNA Artificial Single stranded
origin of replication from plasmid p1414 13 tgggggtgag tcaacggtaa
ccggaccgta gggaggatta aggagttgac ccacccgaac 60 cctttcagca
ctcaaacaaa cccgtttgtt tgacgccaac gccccccgaa gatgcggggg 120
gttgggggga ttgaatgctg gcatccaacg 150 14 101 DNA Artificial Single
stranded origin of replication from plasmid pDC123 14 tatttgacaa
caagtaacca agtgactgcc gtcctttgtc cgtgtccgtc cagcctttcg 60
gctcggcacg tcctagcgta ctctgtcact gcttattgtc a 101 15 120 DNA
Artificial from Bacteriophage f1 15 aaaaaccgtc tacagggcga
tggcccacta cgtgaaccat caccctaatc aagttttttg 60 gggtcgaggt
gccgtaaagc actaaatcgg aaccctaaag ggagcccccg atttagagct 120 16 74
DNA Artificial Sequence encoding loxP site 16 cgaattggag ctataacttc
gtataatgta tgctatacga agttatcata tggcggtggc 60 ggccgctcta gaac 74
17 34 DNA Artificial Variant lox site loxP511 17 ataacttcgt
atagtataca ttatacgaag ttat 34 18 34 DNA Artificial Variant lox site
loxC2 18 acaacttcgt ataatgtatg ctatacgaag ttat 34 19 34 DNA
Artificial from Saccharomyces cerevisiae 19 gaagttccta ttctctagaa
agtataggaa cttc 34 20 290 DNA Artificial from Escherichia coli 20
aggctcaaca ggttggtggt tctcaccacc aaaagcacca caccccacgc aaaaacaagt
60 ttttgctgat ttttctttat aaatagagtg ttatgaaaaa ttagtttctc
ttactctctt 120 tatgatattt aaaaaagcgg tgtcggcgcg gctacaacaa
cgcgccgaca ccgttttgta 180 ggggtggtac tgactatttt tataaaaaac
attattttat attaggggtg ctgctagcgg 240 cgcggtgtgt ttttttatag
gataccgcta ggggcgctgc tagcggtgcg 290 21 64 DNA Artificial from
Bacteriophage f1 21 cgtcgacctc gattgttcca gtttggaaca agagtccact
attaaagaac gtggactcgt 60 accc 64
* * * * *