U.S. patent application number 10/425006 was filed with the patent office on 2004-09-16 for methods and compositions for silencing genes without inducing toxicity.
Invention is credited to Pachuk, Catherine J..
Application Number | 20040180438 10/425006 |
Document ID | / |
Family ID | 32965310 |
Filed Date | 2004-09-16 |
United States Patent
Application |
20040180438 |
Kind Code |
A1 |
Pachuk, Catherine J. |
September 16, 2004 |
Methods and compositions for silencing genes without inducing
toxicity
Abstract
The present invention provides methods of post-transcriptional
gene silencing which involve the use of a first dsRNA having
substantial sequence identity to a target nucleic acid and a short,
second dsRNA which inhibits dsRNA-mediated toxicity. These methods
can be used to prevent or treat a disease or infection by silencing
a gene associated with the disease or infection. The invention also
provides methods for identifying nucleic acid sequences that
modulate a detectable phenotype, including the function of a cell,
the expression of a gene, or the biological activity of a target
polypeptide.
Inventors: |
Pachuk, Catherine J.;
(Lansdale, PA) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Family ID: |
32965310 |
Appl. No.: |
10/425006 |
Filed: |
April 28, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60375636 |
Apr 26, 2002 |
|
|
|
Current U.S.
Class: |
435/455 ;
514/44A |
Current CPC
Class: |
C12N 2310/13 20130101;
C12N 2330/31 20130101; C12N 2320/12 20130101; C12Y 301/03001
20130101; C12N 15/111 20130101; C12N 15/1137 20130101; C12N 2310/53
20130101; C12N 2310/14 20130101; C12N 2320/50 20130101 |
Class at
Publication: |
435/455 ;
514/044 |
International
Class: |
A61K 048/00; C12N
015/85 |
Claims
What is claimed is:
1. A method for inhibiting the expression of a target nucleic acid
in a cell, said method comprising introducing into said cell a
first agent that provides to said cell a first double stranded RNA
(dsRNA) and a second agent that provides to said cell a short,
second dsRNA, wherein said first dsRNA has substantial sequence
identity to a region of said target nucleic acid and specifically
inhibits said expression of said target nucleic acid, and wherein
said short, second dsRNA inhibits dsRNA-mediated toxicity.
2. The method of claim 1, wherein the double stranded region in
said second dsRNA contains between 11 and 30 nucleotides,
inclusive.
3. The method of claim 1, wherein the double stranded region in
said first dsRNA contains between 11 and 30 nucleotides,
inclusive.
4. The method of claim 1, wherein the double stranded region in
said first dsRNA contains over 30 nucleotides.
5. The method of claim 4, wherein the double stranded region in
said first dsRNA contains over 200 nucleotides.
6. The method of claim 1, wherein said first and/or second agent is
a nucleic that encodes a dsRNA.
7. The method of claim 1, wherein said cell is a vertebrate
cell.
8. The method of claim 1, wherein said cell is a mammalian
cell.
9. The method of claim 8, wherein said cell is a human cell.
10. A method for inhibiting the expression of a target nucleic acid
in an animal, said method comprising introducing into said animal a
first agent that provides to said animal a first dsRNA and a second
agent that provides to said animal a short, second dsRNA, wherein
said first dsRNA has substantial sequence identity to region of
said target nucleic acid and specifically inhibits said expression
of said target nucleic acid, and wherein said short, second dsRNA
inhibits dsRNA-mediated toxicity.
11. The method of claim 10, wherein the double stranded region in
said second dsRNA contains between 11 and 30 nucleotides,
inclusive.
12. The method of claim 10, wherein the double stranded region in
said first dsRNA contains between 11 and 30 nucleotides,
inclusive.
13. The method of claim 10, wherein the double stranded region in
said first dsRNA contains over 30 nucleotides.
14. The method of claim 13, wherein the double stranded region in
said first dsRNA contains over 200 nucleotides.
15. The method of claim 10, wherein said first and/or second agent
is a nucleic acid that encodes a dsRNA.
16. The method of claim 10, wherein said animal is a
vertebrate.
17. The method of claim 10, wherein said animal is a mammal.
18. The method of claim 17, wherein said animal is a human.
19. A method for treating, stabilizing, or preventing a disease,
disorder, or infection in an animal, said method comprising
introducing into said animal a first agent that provides to said
animal a first dsRNA and a second agent that provides to said
animal a short, second dsRNA, wherein said first dsRNA has
substantial sequence identity to a region of a target nucleic acid
associated with said disease, disorder, or infection and
specifically inhibits said expression of said target nucleic acid,
and wherein said short, second dsRNA inhibits dsRNA-mediated
toxicity.
20. The method of claim 19, wherein the double stranded region in
said second dsRNA contains between 11 and 30 nucleotides,
inclusive.
21. The method of claim 19, wherein the double stranded region in
said first dsRNA contains between 11 and 30 nucleotides,
inclusive.
22. The method of claim 19, wherein the double stranded region in
said first dsRNA contains over 30 nucleotides.
23. The method of claim 22, wherein the double stranded region in
said first dsRNA contains over 200 nucleotides.
24. The method of claim 19, wherein said first and/or second agent
is a nucleic acid that encodes a dsRNA.
25. The method of claim 19, wherein said animal is a
vertebrate.
26. The method of claim 19, wherein said animal is a mammal.
27. The method of claim 26, wherein said animal is a human.
28. The method of claim 19, wherein said target nucleic acid is
associated with a pathogen.
29. The method of claim 28, wherein said pathogen is a virus,
bacterium, yeast, or infectious agent.
30. A method for identifying a nucleic acid that modulates a
detectable phenotype in a cell, said method comprising said steps
of: (a) transforming a population of cells with a dsRNA expression
library, wherein at least two cells of said population of cells are
each transformed with a different nucleic acid from said dsRNA
expression library; (b) transforming said cells with a short dsRNA
or a nucleic acid encoding a short dsRNA; and (c) assaying for a
modulation in said detectable phenotype, wherein said modulation
identifies a nucleic acid that is associated with said
phenotype.
31. The method of claim 30, wherein said modulation in a detectable
phenotype is a modulation in the function of a cell, a modulation
in the biological activity of a polypeptide, or a modulation in the
expression of a target nucleic acid.
32. The method of claim 30, further comprising: (d) identifying
said nucleic acid by amplifying said nucleic acid and sequencing
said amplified nucleic acid.
33. The method of claim 30, wherein said dsRNA expression library
comprises cDNAs derived from said cells.
34. The method of claim 30, wherein the double stranded region in
said second dsRNA contains between 11 and 30 nucleotides,
inclusive.
35. The method of claim 30, wherein the double stranded region in
said first dsRNA or said dsRNA encoded by said library contains
between 11 and 30 nucleotides, inclusive.
36. The method of claim 30, wherein the double stranded region in
said first dsRNA or said dsRNA encoded by said library contains
over 30 nucleotides.
37. The method of claim 36, wherein the double stranded region in
said first dsRNA or said dsRNA encoded by said library contains
over 200 nucleotides.
38. The method of claim 30, wherein said first and/or second agent
is a nucleic acid which encodes a dsRNA.
39. The method of claim 30, wherein said cell is a vertebrate
cell.
40. The method of claim 30, wherein said cell is a mammalian
cell.
41. The method of claim 40, wherein said cell is a human cell.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/375,636, filed Apr. 26, 2002, which is hereby
incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] In general, the invention relates to novel methods for
silencing genes.
[0003] Desirably, these methods specifically inhibit the expression
of one or more target genes in a cell or animal (e.g., a mammal
such as a human) without inducing toxicity.
[0004] Double stranded RNA (dsRNA) has been shown to induce gene
silencing in a number of different organisms. Gene silencing can
occur through various mechanisms, one of which is
post-transcriptional gene silencing (PTGS). In post-transcriptional
gene silencing, transcription of the target locus is not affected,
but the RNA half-life is decreased. Transcriptional gene silencing
(TGS) is another mechanism by which gene expression can be
regulated. In TGS, transcription of a gene is inhibited. Exogenous
dsRNA has been shown to act as a potent inducer of PTGS in
nematodes, trypanosomes, and insects. Double stranded RNA is also
an inducer of TGS. Some current methods for using dsRNA in
vertebrate cells to silence genes result in undesirable
non-specific cytotoxicity or cell death due to the interferon
response that is induced by dsRNA in vertebrate cells. Some methods
also result in non-specific or inefficient silencing.
[0005] Thus, improved methods are needed for specifically silencing
target genes without inducing toxicity or cell death. Desirably,
these methods may be used to inhibit gene expression in in vitro
samples, cell culture, and intact animals (e.g., vertebrates such
as mammals).
SUMMARY OF THE INVENTION
[0006] In general, the invention features novel methods for
silencing genes that produce few, if any, toxic side-effects. In
particular, these methods involve administerating to a cell or
animal one or more double stranded RNA (dsRNA) molecules that have
substantial sequence identity to a region of a target nucleic acid
and that specifically inhibit the expression of the target nucleic
acid. One or more short dsRNA molecules, which differ from the
dsRNA having substantial identity to the target nucleic acid, are
also administered to inhibit possible toxic effects or non-specific
gene silencing that may otherwise be induced by the former
dsRNA.
[0007] Accordingly, in a first aspect, the invention features a
method for inhibiting the expression of a target nucleic acid in a
cell (e.g., an invertebrate cell, a vertebrate cell such as a
mammalian or human cell, or a pathogen cell). This method involves
introducing into the cell a first agent that provides to the cell a
first dsRNA and introducing a second agent that provides to the
cell a short, second dsRNA. The first dsRNA has substantial
sequence identity to a region of the target nucleic acid and
specifically inhibits the expression of the target nucleic acid.
The short, second dsRNA differs from the first dsRNA and inhibits
the interferon response or dsRNA-mediated toxicity. In some
embodiments, the short, second dsRNA binds PKR and inhibits the
dimerization and activation of PKR. Exemplary pathogens include
bacteria and yeast. In some embodiments, the first dsRNA inhibits
the expression of an endogenous nucleic acid in a vertebrate cell
or a pathogen cell (e.g., a bacterial or yeast cell) or inhibits
the expression of a pathogen nucleic acid in a cell infected with
the pathogen.
[0008] In another aspect, the invention provides a method for
inhibiting the expression of a target nucleic acid in an animal
(e.g., an invertebrate or a vertebrate such as a mammal or human).
This method involves introducing into the animal a first agent that
provides to the animal a first dsRNA and introducing a second agent
that provides to the animal a short, second dsRNA. The first dsRNA
has substantial sequence identity to a region of the target nucleic
acid and specifically inhibits the expression of the target nucleic
acid. The short, second dsRNA differs from the first dsRNA and
inhibits the interferon response or dsRNA-mediated toxicity. In
some embodiments, the short, second dsRNA binds PKR and inhibits
the dimerization and activation of PKR. In some embodiments, the
first dsRNA inhibits the expression of an endogenous nucleic acid
in an animal or inhibits the expression of a pathogen nucleic acid
in an animal infected with a pathogen (e.g., a bacterial or yeast
cell or a virus).
[0009] In yet another aspect, the invention provides a method for
treating, stabilizing, or preventing a disease or disorder in an
animal (e.g., an invertebrate, a vertebrate such as a mammal or
human). This method involves introducing into the animal a first
agent that provides to the animal a first dsRNA and a second agent
that provides to the animal a short, second dsRNA. The first dsRNA
has substantial sequence identity to a region of a target nucleic
acid associated with the disease or disorder and specifically
inhibits the expression of the target nucleic acid. The short,
second dsRNA differs from the first dsRNA and inhibits the
interferon response or dsRNA-mediated toxicity. In some
embodiments, the short, second dsRNA binds PKR and inhibits the
dimerization and activation of PKR. In some embodiments, the target
gene is a gene associated with cancer, such as an oncogene, or a
gene encoding a protein associated with a disease, such as a mutant
protein, a dominant negative protein, or an overexpressed
protein.
[0010] Exemplary cancers that can be treated, stabilized, or
prevented using the above methods include prostate cancers, breast
cancers, ovarian cancers, pancreatic cancers, gastric cancers,
bladder cancers, salivary gland carcinomas, gastrointestinal
cancers, lung cancers, colon cancers, melanomas, brain tumors,
leukemias, lymphomas, and carcinomas. Benign tumors may also be
treated or prevented using the methods of the present invention.
Other cancers and cancer related genes that may be targeted are
disclosed in, for example, WO 00/63364, WO 00/44914, and WO
99/32619.
[0011] Exemplary endogenous proteins that may be associated with
disease include ANA (anti-nuclear antibody) found in SLE (systemic
lupus erythematosis), abnormal immunoglobulins including IgG and
IgA, Bence Jones protein associated with various multiple myelomas,
and abnormal amyloid proteins in various amyloidoses including
hereditary amyloidosis and Alzheimer's disease. In Huntington's
Disease, a genetic abnormality in the HD (huntingtin) gene results
in an expanded tract of repeated glutamine residues. In addition to
this mutant gene, HD patients have a copy of chromosome 4 which has
a normal sized CAG repeat. Thus, methods of the invention can be
used to silence the abnormal gene but not the normal gene. In
various embodiments, a nucleic acid encoding a disease-causing
protein is silenced using long sRNA, and short dsRNA is used to
block the dsRNA stress response that might otherwise be associated
with administration of the long dsRNA.
[0012] In still another aspect, the invention features a method for
treating, stabilizing, or preventing an infection in an animal
(e.g., an invertebrate or a vertebrate such as a mammal or human).
This method involves introducing into the animal a first agent that
provides to the animal a first dsRNA and introducing a second agent
that provides to the animal a short, second dsRNA. The first dsRNA
has substantial sequence identity to a region of a target nucleic
acid in an infectious pathogen (e.g., a virus, bacteria, or yeast)
or cell infected with a pathogen and specifically inhibits the
expression of the target nucleic acid. The short, second dsRNA
differs from the first dsRNA and inhibits the interferon response
or dsRNA-mediated toxicity. In some embodiments, the short, second
dsRNA binds PKR and inhibits the dimerization and activation of
PKR. In various embodiments, the pathogen is an intracellular or
extracellular pathogen. In some embodiments, the target nucleic
acid is a gene of the pathogen that is necessary for replication
and/or pathogenesis.
[0013] In a further embodiment of any of the above aspects, the
methods of administering a dsRNA or a nucleic acid encoding a dsRNA
includes contacting an in-dwelling device with the cell prior to,
concurrent with, or following the administration of the in-dwelling
device to a patient. In-dwelling devices include, but are not
limited to, surgical implants, prosthetic devices, and catheters,
i.e., devices that are introduced to the body of an individual and
remain in position for an extended time. Such devices include, for
example, artificial joints, heart valves, pacemakers, vascular
grafts, vascular catheters, cerebrospinal fluid shunts, urinary
catheters, and continuous ambulatory peritoneal dialysis (CAPD)
catheters. Desirably, the dsRNA prevents the growth of bacteria on
the device. In some embodiments, the first dsRNA inhibits the
expression of a bacterial nucleic acid in a bacterial cell, a cell
infected with a bacteria, or an animal infected with a
bacteria.
[0014] In other desirable embodiments, the bacterial infection is
due to one or more of the following bacteria: Chlamydophila
pneumoniae, C. psittaci, C. abortus, Chlamydia trachomatis,
Simkania negevensis, Parachlamydia acanthamoebae, Pseudomonas
aeruginosa, P. alcaligenes, P. chlororaphis, P. fluorescens, P.
luteola, P. mendocina, P. monteilii, P. oryzihabitans, P.
pertocinogena, P. pseudalcaligenes, P. putida, P. stutzeri,
Burkholderia cepacia, Aeromonas hydrophilia, Escherichia coli,
Citrobacter freundii, Salmonella typhimurium, S. typhi, S.
paratyphi, S. enteritidis, Shigella dysenteriae, S. flexneri, S.
sonnei, Enterobacter cloacae, E. aerogenes, Klebsiella pneumoniae,
K. oxytoca, Serratia marcescens, Francisella tularensis, Morganella
morganii, Proteus mirabilis, Proteus vulgaris, Providencia
alcalifaciens, P. rettgeri, P. stuartii, Acinetobacter
calcoaceticus, A. haemolyticus, Yersinia enterocolitica, Y. pestis,
Y. pseudotuberculosis, Y. intermedia, Bordetella pertussis, B.
parapertussis, B. bronchiseptica, Haemophilus influenzae, H.
parainfluenzae, H. haemolyticus, H. parahaemolyticus, H. ducreyi,
Pasteurella multocida, P. haemolytica, Branhamella catarrhalis,
Helicobacter pylori, Campylobacter fetus, C. jejuni, C. coli,
Borrelia burgdorferi, V. cholerae, V. parahaemolyticus, Legionella
pneumophila, Listeria monocytogenes, Neisseria gonorrhea, N.
meningitidis, Kingella dentrificans, K. kingae, K. oralis,
Moraxella catarrhalis, M. atlantae, M. lacunata, M.
nonliquefaciens, M. osloensis, M. phenylpyruvica, Gardnerella
vaginalis, Bacteroides fragilis, Bacteroides distasonis,
Bacteroides 3452A homology group, Bacteroides vulgatus, B. ovalus,
B. thetaiotaomicron, B. uniformis, B. eggerthii, B. splanchnicus,
Clostridium difficile, Mycobacterium tuberculosis, M. avium, M.
intracellulare, M. leprae, C. diphtheriae, C. ulcerans, C.
accolens, C. afermentans, C. amycolatum, C. argentorense, C. auris,
C. bovis, C. confusum, C. coyleae, C. durum, C. falsenii, C.
glucuronolyticum, C. imitans, C. jeikeium, C. kutscheri, C.
kroppenstedtii, C. lipophilum, C. macginleyi, C. matruchoti, C.
mucifaciens, C. pilosum, C. propinquum, C. renale, C. riegelii, C.
sanguinis, C. singulare, C. striatum, C. sundsvallense, C.
thomssenii, C. urealyticum, C. xerosis, Streptococcus pneumoniae,
S. agalactiae, S. pyogenes, Enterococcus avium, E. casseliflavus,
E. cecorum, E. dispar, E. durans, E. faecalis, E. faecium, E.
flavescens, E. gallinarum, E. hirae, E. malodoratus, E. mundtii, E.
pseudoavium, E. raffinosus, E. solitarius, Staphylococcus aureus,
S. epidermidis, S. saprophyticus, S. intermedius, S. hyicus, S.
haemolyticus, S. hominis, and/or S. saccharolyticus. Preferably, a
dsRNA is administered in an amount sufficient to prevent,
stabilize, or inhibit the growth of a pathogen or to kill the
pathogen. In some embodiments, the first dsRNA inhibits the
expression of a yeast nucleic acid in a yeast cell, a cell infected
with yeast, or an animal infected with yeast.
[0015] In desirable embodiments, the viral infection relevant to
the methods of the invention is an infection by one or more of the
following viruses: Hepatitis B, Hepatitis C, picornarirus, polio,
HIV, coxsacchie, herpes simplex virus Type 1 and 2, St. Louis
encephalitis, Epstein-Barr, myxoviruses, JC, coxsakieviruses B,
togaviruses, measles, paramyxoviruses, echoviruses, bunyaviruses,
cytomegaloviruses, varicella-zoster, mumps, equine encephalitis,
lymphocytic choriomeningitis, rhabodoviruses including rabies,
simian virus 40, human polyoma virus, parvoviruses, papilloma
viruses, primate adenoviruses, coronaviruses, retroviruses, Dengue,
yellow fever, Japanese encephalitis virus and/or BK. In some
embodiments, the first dsRNA inhibits the expression of a viral
nucleic acid in a virus, a cell infected with a virus, or an animal
infected with a virus.
[0016] In another aspect, the invention features method for
reducing or preventing an immune response to a transplant cell,
tissue, or organ. The method involves administering to the
transplant cell, tissue, or organ a first agent that provides a
first dsRNA and a second agent that provides short, second dsRNA.
The first dsRNA attenuates the expression of a target nucleic acid
in the transplant cell, tissue, or organ that can elicit an immune
response in a recipient. The short, second dsRNA differs from the
first dsRNA and inhibits the interferon response or dsRNA-mediated
toxicity. In some embodiments, the short, second dsRNA binds PKR
and inhibits the dimerization and activation of PKR. In some
embodiments, an agent that provides a dsRNA molecule is also
administered to the recipient to inhibit the expression of an
endogenous nucleic acid that would otherwise participate in an
adverse immune response to the transplant.
[0017] In desirable embodiments of any of the above aspects, the
first dsRNA inhibits expression of the target nucleic acid by at
least 20, 40, 60, 80, 90, 95, or 100%. In some embodiments,
multiple first dsRNA molecules that are substantially identical to
different nucleic acids are administered to the cell or animal to
inhibit the expression of multiple target nucleic acids. For
example, multiple oncogenes or multiple pathogen genes may be
simultaneously silenced.
[0018] In various embodiments of any of the above aspects, the
first agent and/or the second agent is a DNA molecule or DNA vector
encoding a dsRNA. In other embodiments, the first agent and/or the
second agent is a dsRNA, a single stranded RNA molecule that
assumes a double stranded conformation inside the cell or animal
(e.g., a hairpin), or a combination of two single stranded RNA
molecules that are administered simultaneously or sequentially and
that assume a double stranded conformation inside the cell or
animal. The first agent may be administered before, during, or
after the administration of the second agent. In some embodiments,
the first and second agents are the same nucleic acid or the same
vector that encodes both dsRNA molecules. In various embodiments,
the first agent provides a short dsRNA or a long dsRNA to the cell
or animal.
[0019] In some embodiments, a cytokine is also administered to the
cell or animal. Exemplary cytokines are disclosed in WO 00/63364,
filed Apr. 19, 2000. In some embodiments, the expression of the
target nucleic acid is increased to promote the amplification of
the dsRNA, resulting in more dsRNA to silence the target gene. For
example, a vector containing the target nucleic acid can be
administered to the cell or animal before, during, or after the
administration of the first and/or second agent.
[0020] The invention also features high throughput methods of using
dsRNA-mediated gene silencing to identify a nucleic acid that
confers or modulates a detectable phenotype. A detectable phenotype
may include, for example, any outward physical manifestation, such
as molecules, macromolecules, structures, metabolism, energy
utilization, tissues, organs, reflexes, and behaviors, as well as
anything that is part of the detectable structure, function, or
behavior of a cell, tissue, or living organism. Particularly useful
in the methods of the invention are dsRNA mediated changes, wherein
the detectable phenotype derives from modulation of the function of
a cell, modulation of expression of a target nucleic acid, or
modulation of the biological activity of a target polypeptide
through dsRNA effects on a target nucleic acid. For example, see
the dsRNA mediated methods of determining gene function in EP
1229134 A2 and WO 00/01846, the teachings of which are hereby
incorporated by reference. The method involves the use of specially
constructed cDNA libraries derived from a cell, for example, a
primary cell or a cell line that has an observable phenotype or
biological activity, (e.g., an activity mediated by a target
polypeptide or altered gene expression), that are transfected into
cells to inhibit gene expression. In addition, a short dsRNA or a
nucleic acid (e.g., a vector) encoding a short dsRNA is
administered to the cell to inhibit potential dsRNA mediated
toxicity, including adverse effects due to the possible induction
of the interferon response by the dsRNA expression library. The
inhibition of gene expression by the present methods alters a
detectable phenotype, e.g., the function of a cell, gene expression
of a target nucleic acid, or the biological activity of a target
polypeptide and allows the nucleic acid responsible for the
modulation of the detectable phenotype to be readily identified.
While less desirable, the method may also utilize randomized
nucleic acid sequences or a given sequence for which the function
is not known, as described, e.g., in U.S. Pat. No. 5,639,595, the
teaching of which is hereby incorporated by reference.
[0021] Accordingly, in one aspect, the invention features a method
for identifying a nucleic acid sequence that modulates the function
of a cell. The method involves (a) transforming a population of
cells with a dsRNA expression library, where at least two cells of
the population of cells are each transformed with a different
nucleic acid from the dsRNA expression library, and where at least
one encoded dsRNA specifically inhibits the expression of a target
nucleic acid in at least one cell (b) transforming the cells with a
short dsRNA or a nucleic acid encoding a short dsRNA; (c)
optionally selecting for a cell in which the nucleic acid is
expressed in the cell; and (d) assaying for a modulation in the
function of the cell, wherein a modulation identifies a nucleic
acid sequence that modulates the function of a cell. The short
dsRNA differs from at least one or all of the dsRNA molecules
produced by the expression library that specifically inhibit the
expression of a target nucleic acid in a cell or differs from all
of the dsRNA molecules produced by the expression library. The
short dsRNA inhibits the interferon response or dsRNA-mediated
toxicity. In some embodiments, the short, dsRNA binds PKR and
inhibits the dimerization and activation of PKR.
[0022] In a desirable embodiment of the above aspect of the
invention, assaying for a modulation in the function of a cell
comprises measuring cell motility, apoptosis, cell growth, cell
invasion, vascularization, cell cycle events, cell differentiation,
cell dedifferentiation, neuronal cell regeneration, or the ability
of a cell to support viral replication.
[0023] In a related aspect, the invention features a method for
identifying a nucleic acid sequence that modulates expression of a
target nucleic acid in a cell. The method involves (a) transforming
a population of cells with a dsRNA expression library, where at
least two cells of the population of cells are each transformed
with a different nucleic acid from the dsRNA expression library,
and where at least one encoded dsRNA specifically inhibits the
expression of a target nucleic acid in at least one cell (b)
transforming the cells with a short dsRNA or a nucleic acid
encoding a short dsRNA; (c) optionally selecting for a cell in
which the nucleic acid is expressed in the cell; and (d) assaying
for a modulation in the expression of a gene in the cell, where a
modulation identifies a nucleic acid sequence that modulates
expression of a target nucleic acid in a cell. The short dsRNA
differs from at least one or all of the dsRNA molecules produced by
the expression library that specifically inhibit the expression of
a target nucleic acid in a cell or differs from all of the dsRNA
molecules produced by the expression library. The short dsRNA
inhibits the interferon response or dsRNA-mediated toxicity. In
some embodiments, the short dsRNA binds PKR and inhibits the
dimerization and activation of PKR. In a desirable embodiment, the
target nucleic acid is assayed using DNA array technology.
[0024] In another related aspect, the invention features a method
for identifying a nucleic acid sequence that modulates the
biological activity of a target polypeptide in a cell. The method
involves (a) transforming a population of cells with a dsRNA
expression library, where at least two cells of the population of
cells are each transformed with a different nucleic acid from the
dsRNA expression library, and where at least one encoded dsRNA
specifically inhibits the expression of a target nucleic acid in at
least one cell (b) transforming the cells with a short dsRNA or a
nucleic acid encoding a short dsRNA; (c) optionally selecting for a
cell in which the nucleic acid is expressed in the cell; and (d)
assaying for a modulation in the biological activity of a target
polypeptide in the cell, wherein a modulation identifies a nucleic
acid sequence that modulates the biological activity of a target
polypeptide. The short dsRNA differs from at least one or all of
the dsRNA molecules produced by the expression library that
specifically inhibit the expression of a target nucleic acid in a
cell or differs from all of the dsRNA molecules produced by the
expression library. The short dsRNA inhibits the interferon
response or dsRNA-mediated toxicity. In some embodiments, the short
dsRNA binds PKR and inhibits the dimerization and activation of
PKR.
[0025] In one embodiment of any of the above aspects of the
invention, in transforming step (a), the nucleic acid is stably
integrated into a chromosome of the cell. Integration of the
nucleic acid may be random or site-specific. Desirably integration
is mediated by recombination or retroviral insertion. In addition,
desirably a single copy of the nucleic acid is integrated into the
chromosome. In another embodiment of any of the above aspects of
the invention, in step (a) at least 50, more desirably 100; 500;
1000; 10,000; or 50,000 cells of the population of cells are each
transformed with a different nucleic acid from the dsRNA expression
library. Desirably, the expression library is derived from the
transfected cells or cells of the same cell type as the transfected
cells. In other embodiments, the population of cells is transformed
with at least 5%, more desirably at least 25%, 50%, 75%, or 90%,
and most desirably at least 95% of the dsRNA expression
library.
[0026] In other embodiments of any of the above aspects of the
invention, the dsRNA expression library contains cDNAs or
randomized nucleic acids. The dsRNA expression library may be a
nuclear dsRNA expression library, in which case the double stranded
nucleic acid is made in the nucleus. Alternatively, the dsRNA
expression library may be a cytoplasmic dsRNA expression library,
in which case the double stranded nucleic acid is made in the
cytoplasm. In addition, the nucleic acid from the dsRNA expression
library may be made in vitro or in vivo. In addition, the
identified nucleic acid sequence may be located in the cytoplasm of
the cell.
[0027] In still another embodiment of any of the above aspects of
the invention, the nucleic acid is contained in a vector, for
example a dsRNA expression vector. The vector may then be
transformed such that it is stably integrated into a chromosome of
the cell, or it may function as an episomal (non-integrated)
expression vector within the cell. In one embodiment, a vector that
is integrated into a chromosome of the cell contains a promoter
operably linked to a nucleic acid encoding a hairpin or dsRNA. In
another embodiment, the vector does not contain a promoter operably
linked to a nucleic acid encoding a dsRNA. In this latter
embodiment, the vector integrates into a chromosome of a cell such
that an endogenous promoter is operably linked to a nucleic acid
from the vector that encodes a dsRNA. Desirably, the dsRNA
expression vector comprises at least one RNA polymerase II
promoter, for example, a human CMV-immediate early promoter
(HCMV-IE) or a simian CMV (SCMV) promoter, at least one RNA
polymerase I promoter, or at least one RNA polymerase III promoter.
The promoter may also be a T7 promoter, in which case, the cell
further comprises T7 polymerase. Alternatively, the promoter may be
an SP6 promoter, in which case, the cell further comprises SP6
polymerase. The promoter may also be one convergent T7 promoter and
one convergent SP6 promoter. A cell may be made to contain T7 or
SP6 polymerase by transforming the cell with a T7 polymerase or an
SP6 polymerase expression plasmid, respectively. In some
embodiments, a T7 promoter or a RNA polymerase III promoter is
operably linked to a nucleic acid that encodes a short dsRNA (e.g.,
a dsRNA that is less than 200, 150, 100, 75, 50, or 25 nucleotides
in length). In other embodiments, the promoter is a mitochondrial
promoter that allows cytoplasmic transcription of the nucleic acid
in the vector (see, for example, the mitochondrial promoters
described in WO 00/63364, filed Apr. 19, 2000). Alternatively, the
promoter is an inducible promoter, such as a lac (Cronin et al.
Genes & Development 15: 1506-1517, 2001), ara (Khlebnikov et
al., J Bacteriol. 2000 December; 182(24):7029-34), ecdysone
(Rheogene, www.rheogene.com), RU48 (mefepristone) (corticosteroid
antagonist) (Wang X J, Liefer K M, Tsai S, O'Malley B W, Roop D R,
Proc Natl Acad Sci USA. 1999 Jul. 20;96(15):8483-8), or tet
promoter (Rendal et al., Hum Gene Ther. 2002 January;13(2):335-42.
and Larnartina et al., Hum Gene Ther. 2002 January;13(2):199-210)
or a promoter disclosed in WO 00/63364, filed Apr. 19, 2000. In
desirable embodiments, the inducible promoter is not induced until
all the episomal vectors are eliminated from the cell. The vector
may also comprise a selectable marker.
[0028] Desirably in a vector for use in any of the above aspects of
the invention, the sense strand and the antisense strand of the
nucleic acid sequence are transcribed from the same nucleic acid
sequence using two convergent promoters. In another desirable
embodiment, in a vector for use in any of the above aspects of the
invention, the nucleic acid sequence comprises an inverted repeat,
such that upon transcription, the nucleic acid forms a dsRNA.
[0029] In still other embodiments of any of the above aspects of
the invention, the cell and the vector each further comprise a loxP
site and site-specific integration of the nucleic acid into a
chromosome of the cell occurs through recombination between the
loxP sites. In addition, step (c) of any of the above aspects of
the invention further involves rescuing the nucleic acid through
Cre-mediated double recombination.
[0030] In still further embodiments of any of the above aspects of
the invention, the identified nucleic acid sequence is located in
the nucleus of the cell. Alternatively, the identified nucleic acid
sequence may be located in the cytoplasm of the cell.
[0031] In yet another embodiment of any of the above aspects of the
invention, the nucleic acid from the dsRNA expression library is at
least 100, 500, 600, or 1000 nucleotides in length. In other
embodiments of any of the above aspects of the invention, the
nucleic acid from the dsRNA expression library is at least 10, 20,
30, 40, 50, 60, 70, 80, or 90 nucleotides in length. In yet other
embodiments, the number of nucleotides in the nucleic acid from the
dsRNA expression library is between 5-100 nucleotides, 15-100
nucleotides, 20-95 nucleotides, 25-90 nucleotides, 35-85
nucleotides, 45-80 nucleotides, 50-75 nucleotides, or 55-70
nucleotides, inclusive. In still other embodiments, the number of
nucleotides in the nucleic acid from the dsRNA expression library
is contained in one of the following ranges: 5-15 nucleotides,
15-20 nucleotides, 20-25 nucleotides, 25-35 nucleotides, 35-45
nucleotides, 45-60 nucleotides, 60-70 nucleotides, 70-80
nucleotides, 80-90 nucleotides, or 90-100 nucleotides, inclusive.
In other embodiments, the nucleic acid contains less than 50,000;
10,000; 5,000; or 2,000 nucleotides. In some embodiments, the dsRNA
encoded by the dsRNA expression library is 20 to 30 nucleotides
(e.g., 20, 21, 22, 23. 24. 25. 26, 27, or 28 nucleotides) in
length. In addition, the nucleic acid from the dsRNA expression
library may contain a sequence that is less than a full length RNA
sequence.
[0032] In some embodiments, the dsRNA encoded by the dsRNA
expression library is 20 to 30 nucleotides (e.g., 20, 21, 22, 23.
24. 25. 26, 27, or 28 nucleotides) in length. In particular
embodiments, the dsRNA encoded by the dsRNA expression library is
between 11 and 40 nucleotides in length and, in the absence of
short dsRNA of the invention, induces toxicity in vertebrate cells
because its sequence has affinity for PKR or another protein in a
dsRNA mediated stress response pathway. The short dsRNA of the
invention inhibits this toxicity.
[0033] In yet another embodiment of any of the above aspects of the
invention, the cell is derived from a parent cell, and is generated
by (a) transforming a population of parent cells with a bicistronic
plasmid expressing a selectable marker and a reporter gene, and
comprising a loxP site; (b) selecting for a cell in which the
plasmid is stably integrated; and (c) selecting for a cell in which
one copy of the plasmid is stably integrated in a transcriptionally
active locus. Desirably the selectable marker is G418 and the
reporter gene is green fluorescent protein (GFP).
[0034] In still another embodiment of the above aspects of the
invention, generation of the double stranded expression library
comprises: (a) isolating RNA from a cell; (b) synthesizing cDNAs
from the RNA of step (a); and (c) cloning each cDNA into a vector.
Desirably cDNA synthesis is optimized and/or size selected for the
generation and/or selection of cDNAs that are at least 100, 500,
600, or 1000 nucleotides in length. In other embodiments, the cDNAs
are least 10, 20, 30, 40, 50, 60, 70, 80, or 90 nucleotides in
length. In yet other embodiments, the number of nucleotides in the
cDNAs is between 5-100 nucleotides, 15-100 nucleotides, 20-95
nucleotides, 25-90 nucleotides, 35-85 nucleotides, 45-80
nucleotides, 50-75 nucleotides, or 55-70 nucleotides, inclusive. In
still other embodiments, the number of nucleotides in the cDNAs is
contained in one of the following ranges: 5-15 nucleotides, 15-20
nucleotides, 20-25 nucleotides, 25-35 nucleotides, 35-45
nucleotides, 45-60 nucleotides, 60-70 nucleotides, 70-80
nucleotides, 80-90 nucleotides, or 90-100 nucleotides, inclusive.
In other embodiments, the cDNAs contain less than 50,000; 10,000;
5,000; or 2,000 nucleotides. In addition, the cDNA may encode an
RNA fragment that is less than full length. Desirably the vector
comprises two convergent T7 promoters, two convergent SP6
promoters, or one convergent T7 promoter and one convergent SP6
promoter, a selectable marker, and/or a loxP site.
[0035] In addition to the above screening methods that utilize a
dsRNA expression library, the invention provides screening methods
that utilize (i) one or more dsRNA molecules with substantial
sequence identity to a target gene to inhibit expression of the
target gene and (ii) one or more short dsRNA molecules to inhibit
the interferon response.
[0036] In one such aspect, the invention features a method for
identifying a nucleic acid sequence that modulates the function of
a cell, involving (a) transforming a population of cells with a
first dsRNA and either a short, second dsRNA or a nucleic acid
encoding a short, second dsRNA, (b) optionally selecting for a cell
in which the nucleic acid is expressed; and (c) assaying for a
modulation in the function of the cell. The first dsRNA has
substantial sequence identity target nucleic acid in the cell and
specifically inhibits the expression of the target nucleic acid.
The short, second dsRNA differs from the first dsRNA and inhibits
the interferon response or dsRNA-mediated toxicity. In some
embodiments, the short, second dsRNA binds PKR and inhibits the
dimerization and activation of PKR. Desirably, the modulation
identifies a nucleic acid sequence that modulates the function of a
cell. Desirably, the method is carried out under conditions that
inhibit or prevent an interferon response dsRNA stress response. In
a desirable embodiment, assaying for a modulation in the function
of a cell comprises measuring cell motility, apoptosis, cell
growth, cell invasion, vascularization, cell cycle events, cell
differentiation, cell dedifferentiation, neuronal cell
regeneration, or the ability of a cell to support viral
replication.
[0037] In a related aspect, the invention features a method for
identifying a nucleic acid sequence that modulates expression of a
target nucleic acid in a cell, involving (a) transforming a
population of cells with a first dsRNA and either a short, second
dsRNA or a nucleic acid encoding a short, second dsRNA; (b)
optionally selecting for a cell in which the nucleic acid is
expressed; and (c) assaying for a modulation in the expression of
the gene in the cell, wherein the modulation identifies a nucleic
acid sequence that modulates expression of a target nucleic acid in
a cell. The first dsRNA has substantial sequence identity to a
target nucleic acid in a cell and specifically inhibits the
expression of the target nucleic acid. The short, second dsRNA
differs from the first dsRNA and inhibits the interferon response
or dsRNA-mediated toxicity. In some embodiments, the short, second
dsRNA binds PKR and inhibits the dimerization and activation of
PKR. Desirably, the method is carried out under conditions that
inhibit or prevent an interferon response or dsRNA stress response.
In a desirable embodiment, the target nucleic acid is assayed using
DNA array technology.
[0038] In another related aspect, the invention features a method
for identifying a nucleic acid sequence that modulates the
biological activity of a target polypeptide in a cell, involving
(a) transforming a population of cells with a first dsRNA and
either a short, second dsRNA or a nucleic acid encoding a short,
second dsRNA; (b) optionally selecting for a cell in which the
nucleic acid is expressed in the cell; and (c) assaying for a
modulation in the biological activity of a target polypeptide in
the cell, wherein the modulation identifies a nucleic acid sequence
that modulates the biological activity of a target polypeptide in a
cell. The first dsRNA has substantial sequence identity to a target
nucleic in the cell and specifically inhibits the expression of the
target nucleic acid. The short, second dsRNA differs from the first
dsRNA and inhibits the interferon response or dsRNA-mediated
toxicity. In some embodiments, the short, second dsRNA binds PKR
and inhibits the dimerization and activation of PKR. Desirably, the
method is carried out under conditions that inhibit or prevent an
interferon response or dsRNA stress response.
[0039] In one embodiment of any of the above aspects of the
invention, in step (a) at least 2, more desirably 50; 100; 500;
1000; 10,000; or 50,000 cells of the population of cells are each
transformed with a different dsRNA. Desirably, at most one long
dsRNA is inserted into each cell. In other embodiments, the
population of cells is transformed with at least 5%, more desirably
at least 25%, 50%, 75%, or 90%, and most desirably, at least 95% of
the dsRNA expression library. In still another embodiment, the
method further involves identifying the nucleic acid sequence by
amplifying and cloning the sequence. Desirably amplification of the
sequence involves the use of the polymerase chain reaction
(PCR).
[0040] In some embodiments, the first dsRNA is 20 to 30 nucleotides
(e.g, 20, 21, 22, 23. 24. 25. 26, 27, or 28 nucleotides) in length.
In particular embodiments, the first dsRNA is between 11 and 40
nucleotides in length and, in the absence of short dsRNA of the
invention, induces toxicity in vertebrate cells because its
sequence has affinity for PKR or another protein in a dsRNA
mediated stress response pathway. The short dsRNA of the invention
inhibits this toxicity.
[0041] In a yet another aspect, the invention features a cell or a
population of cells that expresses a dsRNA that (i) modulates a
function of the cell, (ii) modulates the expression of a target
nucleic acid (e.g., an endogenous or pathogen gene) in the cell,
and/or (iii) modulates the biological activity of a target protein
(e.g., an endogenous or pathogen protein) in the cell. The cell or
population of cells also has one or more short dsRNA molecules
(e.g., 1, 2, 3, 5, 8, 10, 20, 30, or more different short dsRNA
species). Desirably, the cell contains only one molecular species
of long dsRNA or only one copy of a dsRNA expression vector
encoding a long dsRNA (e.g., a stably integrated vector).
Desirably, the cell or population of cells is produced using one or
more methods of the invention. In other embodiments, the dsRNA is
expressed under conditions that inhibit or prevent an interferon
response or a dsRNA stress response.
[0042] In still another aspect, the invention provides a
pharmaceutical composition which includes at least one short dsRNA
(e.g., 1, 2, 3, 5, 8, 10, 20, 30, or more different short dsRNA
species) and at least one long dsRNA (e.g., 1, 2, 3, 5, 8, 10, 20,
30, or more different long dsRNA species) in an acceptable vehicle
(e.g., a pharmaceutically acceptable carrier). Suitable carriers
include, but are not limited to, saline, buffered saline, dextrose,
water, glycerol, ethanol, and combinations thereof. The composition
can be adapted for the mode of administration and can be in the
form of, for example, a pill, tablet, capsule, spray, powder, or
liquid. In some embodiments, the pharmaceutical composition
contains one or more pharmaceutically acceptable additives suitable
for the selected route and mode of administration. These
compositions may be administered by, without limitation, any
parenteral route including intravenous, intra-arterial,
intramuscular, subcutaneous, intradermal, intraperitoneal,
intrathecal, as well as topically, orally, and by mucosal routes of
delivery such as intranasal, inhalation, rectal, vaginal, buccal,
and sublingual. In some embodiments, the pharmaceutical
compositions of the invention are prepared for administration to
vertebrate (e.g., mammalian) subjects in the form of liquids,
including sterile, non-pyrogenic liquids for injection, emulsions,
powders, aerosols, tablets, capsules, enteric coated tablets, or
suppositories.
[0043] In some embodiments, the pharmaceutical composition includes
about 1 ng to about 20 mg of nucleic acids, e.g., RNA, DNA,
plasmids, viral vectors, recombinant viruses, or mixtures thereof,
which provide the desired amounts of the respective dsRNAs (dsRNA
homologous to a target nucleic acid and dsRNA to inhibit toxicity).
In some embodiments, the composition contains about 10 ng to about
10 mg of the nucleic acids, about 0.1 to about 500 mg, about 1 to
about 350 mg, about 25 to about 250 mg, or about 100 mg of the
nucleic acids. If desired, the dosage regimen of the short dsRNA
may be adjusted to achieve the optimal inhibition of PKR and/or
other dsRNA-mediated stress responses, and the dosage regimen of
the other dsRNA (e.g, long dsRNA) may be adjusted to optimize the
desired sequence-specific silencing. Accordingly, a composition of
the invention may contain different amounts of the two dsRNA
molecules. Those of skill in the art of clinical pharmacology can
readily arrive at such dosing schedules using routine
experimentation.
[0044] In a related aspect, the invention provides a kit which
includes at least one short dsRNA (e.g., 1, 2, 3, 5, 8, 10, 20, 30
or more different short dsRNA species) in an acceptable vehicle and
at least one long dsRNA (e.g., 1, 2, 3, 5, 8, 10, 20, 30, or more
different long dsRNA species) in an acceptable vehicle. The kit
allows the short dsRNA to be administered before, simultaneously
with, or after the long dsRNA. In some embodiments, the short dsRNA
is administered using a different route, delivery system, mode,
site, or rate of administration that used for the long dsRNA.
[0045] In other embodiments of any of the above aspects of the
invention, the short or long dsRNA is derived from cDNAs or
randomized nucleic acids. In addition, the dsRNA may be a
cytoplasmic dsRNA, in which case the double stranded nucleic acid
is made in the cytoplasm. The dsRNA may be made in vitro or in
vivo. In addition, the identified nucleic acid sequence may be
located in the cytoplasm of the cell.
[0046] In still another embodiment of any of the various aspects of
the invention, the nucleic acid is contained in a vector, for
example, a dsRNA expression vector that is capable of forming a
dsRNA. Desirably the dsRNA expression vector comprises at least one
promoter. The promoter may be a T7 promoter, in which case, the
cell further comprises T7 polymerase. Alternatively, the promoter
may be an SP6 promoter, in which case, the cell further comprises
SP6 polymerase. The promoter may also be one convergent T7 promoter
and one convergent SP6 promoter. A cell may be made to contain T7
or SP6 polymerase by transforming the cell with a T7 polymerase or
an SP6 polymerase expression plasmid, respectively. The vector may
also comprise a selectable marker, for example hygromycin.
[0047] Desirably, in a vector for use in the methods of the
invention, the sense strand and the antisense strand of the nucleic
acid sequence are transcribed from the same nucleic acid sequence
using two convergent promoters. In another desirable embodiment, in
a vector for use in any of the above aspects of the invention, the
nucleic acid sequence comprises an inverted repeat, such that upon
transcription, the nucleic acid forms a dsRNA.
[0048] In yet another embodiment, the dsRNA is at least 100, 500,
600, or 1000 nucleotides in length. In other embodiments, the dsRNA
is at least 10, 20, 30, 40, 50, 60, 70, 80, or 90 nucleotides in
length. In yet other embodiments, the number of nucleotides in the
dsRNA is between 5-100 nucleotides, 15-100 nucleotides, 20-95
nucleotides, 25-90 nucleotides, 35-85 nucleotides, 45-80
nucleotides, 50-75 nucleotides, or 55-70 nucleotides, inclusive. In
still other embodiments, the number of nucleotides in the dsRNA is
contained in one of the following ranges: 5-15 nucleotides, 15-20
nucleotides, 20-25 nucleotides, 25-35 nucleotides, 35-45
nucleotides, 45-60 nucleotides, 60-70 nucleotides, 70-80
nucleotides, 80-90 nucleotides, or 90-100 nucleotides, inclusive.
In other embodiments, the dsRNA contains less than 50,000; 10,000;
5,000; or 2,000 nucleotides. In addition, the dsRNA may contain a
sequence that is less than a full length RNA sequence. In other
desirable embodiments, the double stranded region in the dsRNA
(e.g., a long dsRNA) contains between 11 and 30 nucleotides,
inclusive; over 30 nucleotides; or over 200 nucleotides. In
desirable embodiments, the double stranded region in the short
dsRNA contains between 11 and 30 nucleotides, inclusive.
[0049] In still further embodiments of any aspect of the invention,
the cell is a plant cell or an animal cell. Desirably the animal
cell is an invertebrate, vertebrate, or mammalian cell, for
example, a human cell. The cell may be ex vivo or in vivo. The cell
may be a gamete or a somatic cell, for example, a cancer cell, a
stem cell, a cell of the immune system, a neuronal cell, a muscle
cell, or an adipocyte.
[0050] In other embodiments, the dsRNA is derived from a cell or a
population of cells and used to transform another cell population
of either the same cell type or a different cell type. In desirable
embodiments, the transformed cell population contains cells of a
cell type that is related to the cell type of the cells from which
the dsRNA was derived (e.g., the transformation of cells of one
neuronal cell type with the dsRNA derived from cells of another
neuronal cell type). In yet other embodiments of any of these
aspects, the dsRNA contains one or more contiguous or
non-contiguous positions that are randomized (e.g., by chemical or
enzymatic synthesis using a mixture of nucleotides that may be
added at the randomized position). In still other embodiments, the
dsRNA is a randomized nucleic acid in which segments of
ribonucleotides and/or deoxyribonucleotides are ligated to form the
dsRNA.
[0051] In other embodiments of any of various aspects of the
invention, the dsRNA (e.g., a long dsRNA) specifically hybridizes
to a target nucleic acid but does not substantially hybridize to
non-target molecules, which include other nucleic acids in the cell
or biological sample having a sequence that is less than 99, 95,
90, 80, or 70% identical or complementary to that of the target
nucleic acid. Desirably, the amount of the these non-target
molecules hybridized to, or associated with, the dsRNA, as measured
using standard assays, is 2-fold, desirably 5-fold, more desirably
10-fold, and most desirably 50-fold lower than the amount of the
target nucleic acid hybridized to, or associated with, the dsRNA.
In other embodiments, the amount of a target nucleic acid
hybridized to, or associated with, the dsRNA, as measured using
standard assays, is 2-fold, desirably 5-fold, more desirably
10-fold, and most desirably 50-fold greater than the amount of a
control nucleic acid hybridized to, or associated with, the dsRNA.
Desirably, the dsRNA only hybridizes to one target nucleic acid
from a cell under denaturing, high stringency hybridization
conditions. In certain embodiments, the dsRNA is substantially
homologous (e.g., at least 80, 90, 95, 98, or 100% homologous) to
only one target nucleic acid from a cell. In other embodiments, the
dsRNA is homologous to multiple RNA molecules, such as RNA
molecules from the same gene family. In yet other embodiments, the
dsRNA is homologous to distinctly different mRNA sequences from
genes that are similarly regulated (e.g., developmental, chromatin
remodeling, or stress response induced). In other embodiments, the
dsRNA is homologous to a large number of RNA molecules, such as a
dsRNA designed to induce a stress response or apoptosis. In other
embodiments, the percent decrease in the expression of a target
nucleic acid is at least 2, 5, 10, 20, or 50 fold greater than the
percent decrease in the expression of a non-target or control
nucleic acid. Desirably, the dsRNA inhibits the expression of a
target nucleic acid but has negligible, if any, effect on the
expression of other nucleic acids in the cell. Examples of control
nucleic acids include nucleic acids with a random sequence or
nucleic acids known to have little, if any, affinity for the
dsRNA.
[0052] Desirably, the long and short dsRNA molecules are
substantially non-homologous to a naturally-occurring essential
mammalian gene or to all the essential mammalian genes (see, for
example, WO 00/63364). In some embodiments, the dsRNA does not
adversely affect the function of an essential gene. In other
embodiments, the dsRNA adversely affects the function of an
essential gene in a cancer cell. Desirably, the short dsRNA
inhibits the dimerization of PKR or another protein in a
dsRNA-mediated stress response pathway by at least 10, 20, 30, 40,
50, 60. 70, 80, 90, or 95% compared to amount of dimerization of
the protein in a control cell or animal not administered the short
dsRNA, as measured using standard methods such as those described
herein.
[0053] In some embodiments, the short dsRNA includes a region of
randomized sequence, or the entire short dsRNA contains randomized
sequence. In various embodiments, the short dsRNA does not
substantially decrease the expression of a nucleic acid in the cell
(e.g., decreases expression by less than 60, 40, 30, 20, or 10%).
In certain embodiments, the sequence of the short dsRNA is less
than 80, 70, 60, 50, 30, 20, or 10% identical to or complementary
to that of a nucleic acid in the cell. In particular embodiments,
multiple short dsRNA molecules or multiple vectors encoding short
dsRNA are administered to the cell and less than 70, 60, 50, 30,
20, or 10% of the short dsRNA molecules have a sequence that is at
least 50, 70, 80, or 90% identical to or complementary to that of a
nucleic acid in the cell.
[0054] In some embodiments, a target gene (e.g., a pathogen or
endogenous target gene) or a region from a target gene (e.g., a
region from an intron, exon, untranslated region, promoter, or
coding region) is introduced into the cell or animal. For example,
this target nucleic acid can be inserted into a vector that
desirably integrates in the genome of a cell and then administered
to the cell or animal. Desirably, the administration of one or more
copies of the target nucleic acid enhances the amplification of the
dsRNA that is homologous to the target nucleic acid or enhances the
amplification of cleavage products from this dsRNA.
[0055] In other embodiments of any of various aspects of the
invention, at most one molecular species of long dsRNA is inserted
into each cell. In other embodiments, at most one vector encoding a
long dsRNA is stably integrated into the genome of each cell. In
various embodiments, the dsRNA is active in the nucleus of the
transformed cell and/or is active in the cytoplasm of the
transformed cell. In various embodiments, at least 1, 10, 20, 50,
100, 500, or 1000 cells or all of the cells in the population are
selected as cells that contain or express a dsRNA (e.g., a long
dsRNA). In some embodiments, at least 1, 10, 20, 50, 100, 500, or
1000 cells or all of the cells in the population are assayed for a
modulation in the function of the cell, a modulation in the
expression of a target nucleic acid (e.g., an endogenous or
pathogen gene) in the cell, and/or a modulation in the biological
activity of a target protein (e.g., an endogenous or pathogen
protein) in the cell.
[0056] In other embodiments, the dsRNA or dsRNA expression vector
is complexed with one or more cationic lipids or cationic
amphiphiles, such as the compositions disclosed in U.S. Pat. No.
4,897,355 (Eppstein et al., filed Oct. 29, 1987), U.S. Pat. No.
5,264,618 (Felgner et al., filed Apr. 16, 1991) or U.S. Pat. No.
5,459,127 (Felgner et al., filed Sep. 16, 1993). In other
embodiments, the dsRNA or dsRNA expression vector is complexed with
a liposomes/liposomic composition that includes a cationic lipid
and optionally includes another component such as a 10 neutral
lipid (see, for example, U.S. Pat. No. 5,279,833 (Rose), U.S. Pat.
No. 5,283,185 (Epand), and U.S. Pat. No. 5,932,241). In yet other
embodiments, the dsRNA or dsRNA expression vector is complexed with
any other composition that is devised by one of ordinary skill in
the fields of pharmaceutics and molecular biology.
[0057] Transformation/transfection of the cell may occur through a
variety of means including, but not limited to, lipofection,
DEAE-dextran-mediated transfection, microinjection, protoplast
fusion, calcium phosphate precipitation, viral or retroviral
delivery, electroporation, or biolistic transformation. The RNA or
RNA expression vector (DNA) may be naked RNA or DNA or local
anesthetic complexed RNA or DNA (Pachuk et al., supra). In yet
another embodiment, the cell is not a C. elegans cell. Desirably
the vertebrate (e.g., mammalian) cell has been cultured for only a
small number of passages (e.g., less than 30 passages of a cell
line that has been directly obtained from American Type Culture
Collection), or are primary cells. In addition, desirably the
vertebrate (e.g., mammalian) cell is transformed with dsRNA that is
not complexed with cationic lipids.
[0058] The present methods provide numerous advantages for the
silencing of genes in cells and animals. For example, in other
dsRNA delivery systems some dsRNA molecules induce an interferon
response (Jaramillo et al., Cancer Invest. 13:327-338, 1995).
During the induction of post-transcriptional gene silencing events,
induction of an interferon response is not desired, as this could
lead to cell death and possibly to the prevention of gene
silencing. Thus, a significant advantage of the present invention
is that the dsRNA delivery methods described herein are performed
such that an interferon response is inhibited or prevented. These
methods allow dsRNA to be used in clinical applications for the
prevention 10 or treatment of disease or infection without the
generation of adverse side-effects due to dsRNA-induced toxicity.
The use of both short and long dsRNA molecules in some embodiments
of the present methods may also have improved efficiency for
silencing genes than previous methods that use only short dsRNA
molecules.
[0059] The methods of the present invention also provide a means
for high throughput identification of nucleic acid sequences
involved in modulating the function of a cell, the expression of a
target nucleic acid in a cell, or the biological activity of a
target polypeptide in a cell. By transforming a population of cells
with a dsRNA expression library or a dsRNA library, the effects of
many PTGS events on cell function, expression of a target nucleic
acid in a cell, or the biological activity of a target polypeptide
in a cell can be evaluated simultaneously, thereby allowing for
rapid identification of the nucleic acid sequence involved in a
cell function, target nucleic acid expression, or biological
activity of a target polypeptide of interest. Again, the
administration of a short dsRNA or a nucleic acid encoding a short
dsRNA prevents toxic side-effects that might otherwise complicate
the analysis of gene silencing in the cells or even kill the
cells.
[0060] The transcription systems described herein also provide
advantages to other double stranded expression systems. Following
transformation of the dsRNA library, cells contain hundreds to
thousands of dsRNA expression cassettes, with concomitant
expression of that many expression cassettes. In the dsRNA
expression system of the present invention, dsRNA expression
cassettes contained within the expression vector integrate into the
chromosome of the transfected cell. Desirably, every transformed
cell integrates one of the double stranded expression cassettes.
Through expansion of the transformed cell, episomal
(non-integrated) expression vectors are desirably diluted out of
the cell over time. Desirably no transcription occurs until the
episomal expression vectors are diluted out of the cell, such that
not more than 5 episomal vectors remain in the cell. Most
desirably, no transcription occurs until all of the episomal
vectors have been diluted out of the cell, and only the integrated
expression cassette remains. The time it takes for all episomal
vectors to be removed from the cell is proportional to the
replication rate of the transformed cell, and is generally on the
order of two to several weeks of cell culture and growth. The
numbers of copies of a dsRNA molecule in a transformed cell can be
determined using, for example, standard PCR techniques, and
thereby, the number of episomal vectors in a given cell can be
monitored.
[0061] In some embodiments, once a stable integrant containing five
or fewer, and desirably no episomal expression vectors,
transcription is induced, allowing dsRNA to be expressed in the
cells. This method ensures that, if desired, only one species or
not more than about five species of dsRNA is expressed per cell, as
opposed to other methods that express hundreds to thousands of
double stranded species.
[0062] By "isolated nucleic acid, nucleic acid sequence, dsRNA
nucleic acid sequence, or dsRNA nucleic acid" is meant a nucleic
acid or a portion thereof that is free of the genes that, in the
naturally-occurring genome of the organism from which the nucleic
acid sequence of the invention is derived, flank the gene. The term
therefore includes, for example, a recombinant DNA, with or without
5' or 3' flanking sequences that is incorporated into a vector, for
example, a dsRNA expression vector; into an autonomously
replicating plasmid or virus; or into the genomic DNA of a
prokaryote or eukaryote; or which exists as a separate molecule
(e.g., a cDNA or a genomic or cDNA fragment produced by PCR or
restriction endonuclease digestion) independent of other
sequences.
[0063] By "double stranded RNA" is meant a nucleic acid containing
a region of two or more nucleotides that are in a double stranded
conformation. In various embodiments, the dsRNA consists entirely
of ribonucleotides or consists of a mixture of ribonucleotides and
deoxynucleotides, such as the RNA/DNA hybrids disclosed, for
example, by WO 00/63364, filed Apr. 19, 2000 or U.S. S. No.
60/130,377, filed Apr. 21, 1999. The dsRNA may be a single molecule
with a region of self-complimentarity such that nucleotides in one
segment of the molecule base pair with nucleotides in another
segment of the molecule. In various embodiments, a dsRNA that
consists of a single molecule consists entirely of ribonucleotides
or includes a region of ribonucleotides that is complimentary to a
region of deoxyribonucleotides. Alternatively, the dsRNA may
include two different strands that have a region of complimentarily
to each other. In various embodiments, both strands consist
entirely of ribonucleotides, one strand consists entirely of
ribonucleotides and one strand consists entirely of
deoxyribonucleotides, or one or both strands contain a mixture of
ribonucleotides and deoxyribonucleotides. Desirably, the regions of
complimentarily are at least 70, 80, 90, 95, 98, or 100%
complimentary. Desirably, the region of the dsRNA that is present
in a double stranded conformation includes at least 5, 10, 20, 30,
50, 75, 100, 200, 500, 1000, 2000 or 5000 nucleotides or includes
all of the nucleotides in a cDNA being represented in the dsRNA. In
some embodiments, the dsRNA does not contain any single stranded
regions, such as single stranded ends, or the dsRNA is a hairpin.
In other embodiments, the dsRNA has one or more single stranded
regions or overhangs. Desirable RNA/DNA hybrids include a DNA
strand or region that is an antisense strand or region (e.g, has at
least 70, 80, 90, 95, 98, or 100% complimentary to a target nucleic
acid) and an RNA strand or region that is an sense strand or region
(e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target
nucleic acid). In various embodiments, the RNA/DNA hybrid is made
in vitro using enzymatic or chemical synthetic methods such as
those described herein or those described in WO 00/63364, filed
Apr. 19, 2000 or U.S. S. No. 60/130,377, filed Apr. 21, 1999. In
other embodiments, a DNA strand synthesized in vitro is complexed
with an RNA strand made in vivo or in vitro before, after, or
concurrent with the transformation of the DNA strand into the cell.
In yet other embodiments, the dsRNA is a single circular nucleic
acid containing a sense and an antisense region, or the dsRNA
includes a circular nucleic acid and either a second circular
nucleic acid or a linear nucleic acid (see, for example, WO
00/63364, filed Apr. 19, 2000 or U.S. S. No. 60/130,377, filed Apr.
21, 1999.) Exemplary circular nucleic acids include lariat
structures in which the free 5' phosphoryl group of a nucleotide
becomes linked to the 2' hydroxyl group of another nucleotide in a
loop back fashion.
[0064] In other embodiments, the dsRNA includes one or more
modified nucleotides in which the 2' position in the sugar contains
a halogen (such as flourine group) or contains an alkoxy group
(such as a methoxy group) which increases the half-life of the
dsRNA in vitro or in vivo compared to the corresponding dsRNA in
which the corresponding 2' position contains a hydrogen or an
hydroxyl group. In yet other embodiments, the dsRNA includes one or
more linkages between adjacent nucleotides other than a
naturally-occurring phosphodiester linkage. Examples of such
linkages include phosphoramide, phosphorothioate, and
phosphorodithioate linkages. In other embodiments, the dsRNA
contains one or two capped strands or no capped strands, as
disclosed, for example, by WO 00/63364, filed Apr. 19, 2000 or U.S.
S. No. 60/130,377, filed Apr. 21, 1999. In other embodiments, the
dsRNA contains coding sequence or non-coding sequence, for example,
a regulatory sequence (e.g., a transcription factor binding site, a
promoter, or a 5' or 3' untranslated region (UTR) of an mRNA).
Additionally, the dsRNA can be any of the at least partially
double-stranded RNA molecules disclosed in WO 00/63364, filed Apr.
19, 2000 (see, for example, pages 8-22). Any of the dsRNA molecules
may be expressed in vitro or in vivo using the methods described
herein or standard methods, such as those described in WO 00/63364,
filed Apr. 19, 2000 (see, for example, pages 16-22).
[0065] By "short dsRNA" is meant a dsRNA that has 45, 40, 35, 30,
27, 25, 23, 21, 18, 15, 13, or fewer contiguous nucleotides in
length that are in a double stranded conformation. Desirably, the
short dsRNA is at least 11 nucleotides in length. In desirable
embodiments, the double stranded region is between 11 to 45, 11 to
40, 11 to 30, 11 to 20, 15 to 20, 15 to 18, 20 to 25, 21 to 23, 25
to 30, or 30 to 40 contiguous nucleotides in length, inclusive. In
some embodiments, the short dsRNA is between 30 to 50, 50 to 100,
100 to 200, 200 to 300, 400 to 500, 500 to 700, 700 to 1000, 1000
to 2000, or 2000 to 5000 nucleotides in length, inclusive and has a
double stranded region that is between 11 and 40 contiguous
nucleotides in length, inclusive. In one embodiment, the short
dsRNA is completely double stranded. In some embodiments, the short
dsRNA is between 11 and 30 nucleotides in length, and the entire
dsRNA is double stranded. In other embodiments, the short dsRNA has
one or two single stranded regions. In particular embodiments, the
short dsRNA binds PKR or another protein in a dsRNA-mediated stress
response pathway. Desirably, the short dsRNA inhibits the
dimerization and activation of PKR by at least 20, 40, 60, 80, 90,
or 100%. In some desirable embodiments, the short dsRNA inhibits
the binding of a long dsRNA to PKR or another component of a
dsRNA-mediated stress response pathway by at least 20, 40, 60, 80,
90, or 100%.
[0066] By "long dsRNA" is meant a dsRNA that is at least 40, 50,
100, 200, 500, 1000, 2000, 50000, 10000, or more nucleotides in
length. In some embodiments, the long dsRNA has a double stranded
region of between 100 to 10000, 100 to 1000, 200 to 1000, or 200 to
500 contiguous nucleotides, inclusive. In some embodiments, the
long dsRNA is a single strand which achieves a double-stranded
structure by virtue of regions of self-complementarity (e.g.,
inverted repeats or tandem sense and antisense sequences) that
result in the formation of a hairpin structure. In one embodiment,
the long dsRNA molecule does not produce a functional protein or is
not translated. For example, the long dsRNA may be designed not to
interact with cellular factors involved in translation. Exemplary
long dsRNA molecules lack a poly-adenylation sequence, a Kozak
region necessary for protein translation, an initiating methionine
codon, and/or a cap structure. In other embodiments, the dsRNA
molecule has a cap structure, one or more introns, and/or a
polyadenylation sequence. Other such long dsRNA molecules include
RNA/DNA hybrids. Other dsRNA molecules that may be used in the
methods of the invention and various means for their preparation
and delivery are described in WO 00/63364, filed Apr. 19, 2000, the
teaching of which is incorporated herein by reference.
[0067] By "dsRNA expression library" or "dsRNA expression library"
is meant a collection of nucleic acid expression vectors containing
nucleic acid sequences, for example, cDNA sequences or randomized
nucleic acid sequences that are capable of forming a dsRNA (dsRNA)
upon expression of the nucleic acid sequence. Desirably the dsRNA
expression library contains at least 10,000 unique nucleic acid
sequences, more desirably at least 50,000; 100,000; or 500,000
unique nucleic acid sequences, and most desirably, at least
1,000,000 unique nucleic acid sequences. By a "unique nucleic acid
sequence" is meant that a nucleic acid sequence of a dsRNA
expression library has desirably less than 50%, more desirably less
than 25% or 20%, and most desirably less than 10% nucleic acid
identity to another nucleic acid sequence of a dsRNA expression
library when the full length sequence are compared. Sequence
identity is typically measured using sequence analysis software
with the default parameters specified therein (e.g., Sequence
Analysis Software Package of the Genetics Computer Group,
University of Wisconsin Biotechnology Center, 1710 University
Avenue, Madison, Wis. 53705). This software program matches similar
sequences by assigning degrees of homology to various
substitutions, deletions, and other modifications.
[0068] The preparation of cDNAs for the generation of dsRNA
expression libraries is described herein. A randomized nucleic acid
library may also be generated as described in detail below. The
dsRNA expression library may contain nucleic acid sequences that
are transcribed in the nucleus or that are transcribed in the
cytoplasm of the cell. A dsRNA expression library may be generated
using techniques described herein.
[0069] By "agent that provides an at least partially doubled
stranded RNA" is meant a composition that generates an at least
partially double stranded dsRNA in a cell or animal. For example,
the agent can be a dsRNA, a single stranded RNA molecule that
assumes a double stranded conformation inside the cell or animal
(e.g., a hairpin), or a combination of two single stranded RNA
molecules that are administered simultaneously or sequentially and
that assume a double stranded conformation inside the cell or
animal. Other exemplary agents include a DNA molecule, plasmid,
viral vector, or recombinant virus encoding an at least partially
double stranded RNA. Other agents are disclosed in WO 00/63364,
filed Apr. 19, 2000. In some embodiments, the agent includes
between 1 ng and 20 mg, 1 ng to 1 ug, 1 ug to 1 mg, or 1 mg to 20
mg of DNA and/or RNA.
[0070] By "target nucleic acid" is meant a nucleic acid sequence
whose expression is modulated as a result of post-transcriptional
gene silencing. As used herein, the target nucleic acid may be in
the cell in which the PTGS, transcriptional gene silencing (TGS),
or other gene silencing event occurs or it may be in a neighboring
cell, or in a cell contacted with media or other extracellular
fluid in which the cell that has undergone the PTGS, TGS, or other
gene silencing event is contained. Exemplary target nucleic acids
include nucleic acids associated with cancer or abnormal cell
growth, such as oncogenes, and nucleic acids associated with an
autosomal dominant or recessive disorder (see, for example, WO
00/63364, WO 00/44914, and WO 99/32619).
[0071] Desirably, the dsRNA inhibits the expression of an allele of
a nucleic acid that has a mutation associated with a dominant
disorder and does not substantially inhibit the other allele of the
nucleic acid (e.g, an allele without a mutation associated with the
disorder). Other exemplary target nucleic acids include host
cellular nucleic acids or pathogen nucleic acids required for the
infection or propagation of a pathogen, such as a virus, bacteria,
yeast, protozoa, or parasite.
[0072] By "target polypeptide" is meant a polypeptide whose
biological activity is modulated as a result of gene silencing. As
used herein, the target polypeptide may be in the cell in which the
PTGS, TGS, or other gene silencing event occurs or it may be in a
neighboring cell, or in a cell contacted with media or other
extracellular fluid in which the cell that has undergone the PTGS,
TGS, or other gene silencing event is contained.
[0073] By "treating, stabilizing, or preventing a disease or
disorder" is meant preventing or delaying an initial or subsequent
occurrence of a disease or disorder; increasing the disease-free
survival time between the disappearance of a condition and its
reoccurrence; stabilizing or reducing an adverse symptom associated
with a condition; or inhibiting or stabilizing the progression of a
condition. Preferably, at least 20, 40, 60, 80, 90, or 95% of the
treated subjects have a complete remission in which all evidence of
the disease disappears. In another embodiment, the length of time a
patient survives after being diagnosed with a condition and treated
using a method of the invention is at least 20, 40, 60, 80, 100,
200, or even 500% greater than (i) the average amount of time an
untreated patient survives or (ii) the average amount of time a
patient treated with another therapy survives.
[0074] By "treating, stabilizing, or preventing cancer" is meant
causing a reduction in the size of a tumor, slowing or preventing
an increase in the size of a tumor, increasing the disease-free
survival time between the disappearance of a tumor and its
reappearance, preventing an initial or subsequent occurrence of a
tumor, or reducing or stabilizing an adverse symptom associated
with a tumor. In one embodiment, the percent of cancerous cells
surviving the treatment is at least 20, 40, 60, 80, or 100% lower
than the initial number of cancerous cells, as measured using any
standard assay. Preferably, the decrease in the number of cancerous
cells induced by administration of a composition of the invention
is at least 2, 5, 10, 20, or 50-fold greater than the decrease in
the number of non-cancerous cells. In yet another embodiment, the
number of cancerous cells present after administration of a
composition of the invention is at least 2, 5, 10, 20, or 50-fold
lower than the number of cancerous cells present after
administration of a vehicle control. Preferably, the methods of the
present invention result in a decrease of 20, 40, 60, 80, or 100%
in the size of a tumor as determined using standard methods.
Preferably, at least 20, 40, 60, 80, 90, or 95% of the treated
subjects have a complete remission in which all evidence of the
cancer disappears. Preferably, the cancer does not reappear or
reappears after at least 5, 10, 15, or 20 years. In another
desirable embodiment, the length of time a patient survives after
being diagnosed with cancer and treated with a composition of the
invention is at least 20, 40, 60, 80, 100, 200, or even 500%
greater than (i) the average amount of time an untreated patient
survives or (ii) the average amount of time a patient treated with
another therapy survives.
[0075] By "bacterial infection" is meant the invasion of a host
animal by pathogenic bacteria. For example, the infection may
include the excessive growth of bacteria that are normally present
in or on the body of a animal or growth of bacteria that are not
normally present in or on the animal. More generally, a bacterial
infection can be any situation in which the presence of a bacterial
population(s) is damaging to a host animal. Thus, a animal is
"suffering" from a bacterial infection when an excessive amount of
a bacterial population is present in or on the animal's body, or
when the presence of a bacterial population(s) is damaging the
cells or other tissue of the animal. In one embodiment, the number
of a particular genus or species of bacteria is at least 2, 4, 6,
or 8 times the number normally found in the animal. The bacterial
infection may be due to gram positive and/or gram negative
bacteria.
[0076] By "viral infection" is meant the invasion of a host animal
by a virus. For example, the infection may include the excessive
growth of viruses that are normally present in or on the body of a
animal or growth of viruses that are not normally present in or on
the animal. More generally, a viral infection can be any situation
in which the presence of a viral population(s) is damaging to a
host animal. Thus, a animal is "suffering" from a viral infection
when an excessive amount of a viral population is present in or on
the animal's body, or when the presence of a viral population(s) is
damaging the cells or other tissue of the animal.
[0077] As used herein, by "randomized nucleic acids" is meant
nucleic acids, for example, those that are at least 100, 500, 600,
or 1000 nucleotides in length, constructed from RNA isolated from a
particular cell type. In other embodiments, the nucleic acids are
at least 10, 20, 30, 40, 50, 60, 70, 80, or 90 nucleotides in
length. In yet other embodiments, the number of nucleotides in the
nucleic acids is between 5-100 nucleotides, 15-100 nucleotides,
20-95 nucleotides, 25-90 nucleotides, 35-85 nucleotides, 45-80
nucleotides, 50-75 nucleotides, or 55-70 nucleotides, inclusive. In
still other embodiments, the number of nucleotides in the nucleic
acids is contained in one of the following ranges: 5-15
nucleotides, 15-20 nucleotides, 20-25 nucleotides, 25-35
nucleotides, 35-45 nucleotides, 45-60 nucleotides, 60-70
nucleotides, 70-80 nucleotides, 80-90 nucleotides, or 90-100
nucleotides, inclusive. In other embodiments, the nucleic acids
contain less than 50,000; 10,000; 5,000; or 2,000 nucleotides. A
randomized nucleic acid library may be constructed in a number of
ways. For example, it may be constructed from existing cDNA
libraries. In one example, the cDNA libraries are shuffled using
the "Gene Shuffling" technology of Maxygen Corp. The cDNA sequences
are amplified using inefficient PCR either by restricting
elongation time or through the use of manganese. A library of
recombinants is created, and the library is finally amplified by
PCR and cloned into vectors. In a second method, existing cDNA
libraries are digested with an endonuclease to generate fragments
of 10 to 300 base pairs. Alternatively, the cDNA libraries are
digested to generate shorter fragments of, for example, 5 to 50
base pairs, 5 to 40 base pairs, 5 to 20 base pairs, 5 to 10 base
pairs, or 10 to 20 base pairs, inclusive. If the fragments are to
contain 5' OH and 3' PO.sub.4 groups, they are dephosphorylated
using alkaline phosphatase and phosphorylated using polynucleotide
kinase. These dsDNA fragments are then ligated to form larger
molecules, and are size selected. In a third example, randomized
nucleic acid libraries are created by using random priming of cDNA
libraries (using random hexamers and Klenow) to generate short
fragments of 20 to 100 nucleotides. Alternatively, shorter
fragments are generated that contain, for example, 5 to 50
nucleotides, 5 to 40 nucleotides, 5 to 20 nucleotides, 5 to 10
nucleotides, or 10 to 20 nucleotides, inclusive. These fragments
are then ligated randomly to give a desired sized larger
fragment.
[0078] Alternatively, a randomized nucleic acid library can be
generated from random sequences of oligonucleotides. For example,
DNA or RNA oligonucleotides may be prepared chemically. Random DNA
sequences may also be prepared enzymatically using terminal
transferase in the presence of all dNTPs. Random RNA molecules may
be prepared using NDPs and NDP phosphorylase. The random sequences
may be 10 to 300 bases in length. Alternatively, shorter random
sequences are used that contain, for example, 5 to 50 bases, 5 to
40 bases, 5 to 20 bases, 5 to 10 bases, or 10 to 20 bases,
inclusive. The sequences are ligated to form the desired larger
sequence using RNA ligase. Alternatively these sequences may be
ligated chemically. The oligonucleotides are phosphorylated at the
5' position using polynucleotide kinase or by chemical methods,
prior to ligation enzymatically. Chemical ligations can utilize a
5' PO.sub.4 and a 3' OH group or a 5' OH and a 3' PO.sub.4
group.
[0079] Alternatively, a randomized nucleic acid library can be
generated by converting the random DNA sequences into dsDNA
sequences using DNA polymerase (Klenow), dNTP and random
heteromeric primers, and the RNA sequences are converted into dsDNA
sequences by reverse transcriptase and Klenow. After converting
into ssDNA or dsDNA the sequences are then amplified by PCR. The
dsDNA fragments can also be ligated to give larger fragments of a
desired size.
[0080] The randomized nucleic acids may be cloned into a vector,
for example, an expression vector, as a dsRNA transcription
cassette. The sequence of the nucleic acid may not be known at the
time the vector is generated. The randomized nucleic acid may
contain coding sequence or non-coding sequence, for example, a
regulatory sequence (e.g., a transcription factor binding site, a
promoter, or a 5' or 3' untranslated region (UTR) of an mRNA).
[0081] By "Cre-mediated double recombination" is meant two nucleic
acid recombination events involving loxP sites that are mediated by
Cre recombinase. A Cre-mediated double recombination event can
occur, for example, as illustrated in FIG. 1.
[0082] By "function of a cell" is meant any cell activity that can
be measured or assessed. Examples of cell function include, but are
not limited to, cell motility, apoptosis, cell growth, cell
invasion, vascularization, cell cycle events, cell differentiation,
cell dedifferentiation, neuronal cell regeneration, and the ability
of a cell to support viral replication. The function of a cell may
also be to affect the function, gene expression, or the polypeptide
biological activity of another cell, for example, a neighboring
cell, a cell that is contacted with the cell, or a cell that is
contacted with media or other extracellular fluid that the cell is
contained in.
[0083] By "apoptosis" is meant a cell death pathway wherein a dying
cell displays a set of well-characterized biochemical hallmarks
that include cytolemmal membrane blebbing, cell soma shrinkage,
chromatin condensation, nuclear disintegration, and DNA laddering.
There are many well-known assays for determining the apoptotic
state of a cell, including, and not limited to: reduction of MTT
tetrazolium dye, TUNEL staining, Annexin V staining, propidium
iodide staining, DNA laddering, PARP cleavage, caspase activation,
and assessment of cellular and nuclear morphology. Any of these or
other known assays may be used in the methods of the invention to
determine whether a cell is undergoing apoptosis.
[0084] By "polypeptide biological activity" is meant the ability of
a target polypeptide to modulate cell function. The level of
polypeptide biological activity may be directly measured using
standard assays known in the art. For example, the relative level
of polypeptide biological activity may be assessed by measuring the
level of the mRNA that encodes the target polypeptide (e.g., by
reverse transcription-polymerase chain reaction (RT-PCR)
amplification or Northern blot analysis); the level of target
polypeptide (e.g., by ELISA or Western blot analysis); the activity
of a reporter gene under the transcriptional regulation of a target
polypeptide transcriptional regulatory region (e.g., by reporter
gene assay, as described below); the specific interaction of a
target polypeptide with another molecule, for example, a
polypeptide that is activated by the target polypeptide or that
inhibits the target polypeptide activity (e.g., by the two-hybrid
assay); or the phosphorylation or glycosylation state of the target
polypeptide. A compound, such as a dsRNA, that increases the level
of the target polypeptide, mRNA encoding the target polypeptide, or
reporter gene activity within a cell, a cell extract, or other
experimental sample is a compound that stimulates or increases the
biological activity of a target polypeptide. A compound, such as a
dsRNA, that decreases the level of the target polypeptide, mRNA
encoding the target polypeptide, or reporter gene activity within a
cell, a cell extract, or other experimental sample is a compound
that decreases the biological activity of a target polypeptide.
[0085] By "assaying" is meant analyzing the effect of a treatment,
be it chemical or physical, administered to whole animals, cells,
tissues, or molecules derived therefrom. The material being
analyzed may be an animal, a cell, a tissue, a lysate or extract
derived from a cell, or a molecule derived from a cell. The
analysis may be, for example, for the purpose of detecting altered
cell function, altered gene expression, altered endogenous RNA
stability, altered polypeptide stability, altered polypeptide
levels, or altered polypeptide biological activity. The means for
analyzing may include, for example, antibody labeling,
immunoprecipitation, phosphorylation assays, glycosylation assays,
and methods known to those skilled in the art for detecting nucleic
acids. In some embodiments, assaying is conducted under selective
conditions.
[0086] By "modulates" is meant changing, either by a decrease or an
increase. As used herein, desirably a nucleic acid decreases the
function of a cell, the expression of a target nucleic acid in a
cell, or the biological activity of a target polypeptide in a cell
by least 20%, more desirably by at least 30%, 40%, 50%, 60% or 75%,
and most desirably by at least 90%. Also as used herein, desirably
a nucleic acid increases the function of a cell, the expression of
a target nucleic acid in a cell, or the biological activity of a
target polypeptide in a cell by at least 1.5-fold to 2-fold, more
desirably by at least 3-fold, and most desirably by at least
5-fold.
[0087] By "a decrease" is meant a lowering in the level of (a)
protein (e.g., as measured by ELISA or Western blot analysis); (b)
reporter gene activity (e.g., as measured by reporter gene assay,
for example, .beta.-galactosidase, green fluorescent protein, or
luciferase activity); (c) mRNA (e.g., as measured by RT-PCR or
Northern blot analysis relative to an internal control, such as a
"housekeeping" gene product, for example, .beta.-actin or
glyceraldehyde 3-phosphate dehydrogenase (GAPDH)); or (d) cell
function, for example, as assayed by the number of apoptotic,
mobile, growing, cell cycle arrested, invasive, differentiated, or
dedifferentiated cells in a test sample. In all cases, the lowering
is desirably by at least 20%, more desirably by at least 30%, 40%,
50%, 60%, 75%, and most desirably by at least 90%. As used herein,
a decrease may be the direct or indirect result of PTGS, TGS, or
another gene silencing event.
[0088] By "an increase" is meant a rise in the level of (a) protein
(e.g., as measured by ELISA or Western blot analysis); (b) reporter
gene activity (e.g., as measured by reporter gene assay, for
example, .beta.-galactosidase, green fluorescent protein, or
luciferase activity); (c) mRNA (e.g., as measured by RT-PCR or
Northern blot analysis relative to an internal control, such as a
"housekeeping" gene product, for example, .beta.-actin or
glyceraldehyde 3-phosphate dehydrogenase (GAPDH)); or (d) cell
function, for example, as assayed by the number of apoptotic,
mobile, growing, cell cycle arrested, invasive, differentiated, or
dedifferentiated cells in a test sample. Desirably, the increase is
by at least 1.5-fold to 2-fold, more desirably by at least 3-fold,
and most desirably by at least 5-fold. As used herein, an increase
may be the indirect result of PTGS, TGS, or another gene silencing
event. For example, the dsRNA may inhibit the expression of a
protein, such as a suppressor protein, that would otherwise inhibit
the expression of another nucleic acid.
[0089] By "alteration in the level of gene expression" is meant a
change in transcription, translation, or mRNA or protein stability
such that the overall amount of a product of the gene, i.e., mRNA
or polypeptide, is increased or decreased.
[0090] By "reporter gene" is meant any gene that encodes a product
whose expression is detectable and/or able to be quantitated by
immunological, chemical, biochemical, or biological assays. A
reporter gene product may, for example, have one of the following
attributes, without restriction: fluorescence (e.g., green
fluorescent protein), enzymatic activity (e.g.,
.beta.-galactosidase, luciferase, chloramphenicol
acetyltransferase), toxicity (e.g., ricin A), or an ability to be
specifically bound by an additional molecule (e.g., an unlabeled
antibody, followed by a labelled secondary antibody, or biotin, or
a detectably labelled antibody). It is understood that any
engineered variants of reporter genes that are readily available to
one skilled in the art, are also included, without restriction, in
the foregoing definition.
[0091] By "protein" or "polypeptide" or "polypeptide fragment" is
meant any chain of more than two amino acids, regardless of
post-translational modification (e.g., glycosylation or
phosphorylation), constituting all or part of a naturally-occurring
polypeptide or peptide, or constituting a non-naturally occurring
polypeptide or peptide.
[0092] By "promoter" is meant a minimal sequence sufficient to
direct transcription of a gene. Also included in this definition
are those transcription control elements (e.g., enhancers) that are
sufficient to render promoter-dependent gene expression
controllable in a cell type-specific, tissue-specific, or
temporal-specific manner, or that are inducible by external signals
or agents; such elements, which are well-known to skilled artisans,
may be found in a 5' or 3' region of a gene or within an intron.
Desirably a promoter is operably linked to a nucleic acid sequence,
for example, a cDNA or a gene in such a way as to permit expression
of the nucleic acid sequence.
[0093] By "operably linked" is meant that a gene and one or more
transcriptional regulatory sequences, e.g., a promoter or enhancer,
are connected in such a way as to permit gene expression when the
appropriate molecules (e.g., transcriptional activator proteins)
are bound to the regulatory sequences.
[0094] By "expression vector" is meant a DNA construct that
contains at least one promoter operably linked to a downstream gene
or coding region (e.g., a cDNA or genomic DNA fragment that encodes
a protein, optionally, operatively linked to sequence lying outside
a coding region, an antisense RNA coding region, or RNA sequences
lying outside a coding region). Transfection or transformation of
the expression vector into a recipient cell allows the cell to
express RNA encoded by the expression vector. An expression vector
may be a genetically engineered plasmid, virus, or artificial
chromosome derived from, for example, a bacteriophage, adenovirus,
retrovirus, poxvirus, or herpesvirus.
[0095] By "transformation" or "transfection" is meant any method
for introducing foreign molecules into a cell (e.g., a bacterial,
yeast, fungal, algal, plant, insect, or animal cell, particularly a
vertebrate or mammalian cell). The cell may be in an animal.
Lipofection, DEAE-dextran-mediated transfection, microinjection,
protoplast fusion, calcium phosphate precipitation, viral or
retroviral delivery, electroporation, and biolistic transformation
are just a few of the transformation/transfection methods known to
those skilled in the art. The RNA or RNA expression vector (DNA)
may be naked RNA or DNA or local anesthetic complexed RNA or DNA
(Pachuk et al., supra). Other standard transformation/transfection
methods and other RNA and/or DNA delivery agents (e.g., a cationic
lipid, liposome, or bupivacaine) are described in WO 00/63364,
filed Apr. 19, 2000 (see, for example, pages 18-26). Commercially
available kits can also be used to deliver RNA or DNA to a cell.
For example, the Transmessenger Kit from Qiagen, an RNA kit from
Xeragon Inc., and an RNA kit from DNA Engine Inc. (Seattle, Wash.)
can be used to introduce single or dsRNA into a cell.
[0096] By "transformed cell" or "transfected cell" is meant a cell
(or a descendent of a cell) into which a nucleic acid molecule, for
example, a dsRNA or double stranded expression vector has been
introduced, by means of recombinant nucleic acid techniques. Such
cells may be either stably or transiently transfected.
[0097] By "selective conditions" is meant conditions under which a
specific cell or group of cells can be selected for. For example,
the parameters of a fluorescence-activated cell sorter (FACS) can
be modulated to identify a specific cell or group of cells. Cell
panning, a technique known to those skilled in the art, is another
method that employs selective conditions.
[0098] As use herein, by "optimized" is meant that a nucleic acid
fragment is generated through inefficient first strand synthesis
(e.g., reverse transcription (RT) and/or RT/second strand synthesis
(RT-SSS) using Klenow or other enzymes and/or RT-PCR or PCR, to be
of a particular length. Desirably the length of the nucleic acid
fragment is less than a full length cDNA or is 100, 500, 600, or
1000 nucleotides in length. In other embodiments, the nucleic acid
fragment is at least 10, 20, 30, 40, 50, 60, 70, 80, or 90
nucleotides in length. In yet other embodiments, the number of
nucleotides in the nucleic acid fragment is between 5-100
nucleotides, 15-100 nucleotides, 20-95 nucleotides, 25-90
nucleotides, 35-85 nucleotides, 45-80 nucleotides, 50-75
nucleotides, or 55-70 nucleotides, inclusive. In still other
embodiments, the number of nucleotides in the nucleic acid fragment
is contained in one of the following ranges: 5-15 nucleotides,
15-20 nucleotides, 20-25 nucleotides, 25-35 nucleotides, 35-45
nucleotides, 45-60 nucleotides, 60-70 nucleotides, 70-80
nucleotides, 80-90 nucleotides, or 90-100 nucleotides, inclusive.
In other embodiments, the nucleic acid fragment contains less than
50,000; 10,000; 5,000; or 2,000 nucleotides. Optimization of the
length of a nucleic acid can be achieved during first strand or
second strand synthesis of a desired nucleic acid by lowering Mg
concentrations to no less than the nucleotide concentrations; by
adding Mn.sup.++ to the reaction to achieve the desired size
selection (e.g., by replacing Mg.sup.++completely, or by adding
Mn.sup.++at varying concentrations along with Mg.sup.++); by
decreasing and/or limiting concentrations of dNTP(s) to effect the
desired fragment size; by using various concentrations of ddNTP(s)
along with standard or optimal concentrations of dNTP(s), to
achieve varying ratios, to obtain the desired fragment size; by
using limited and controlled exonuclease digestion of the fragment
following RT, RT-SSS, RT-PCR, or PCR; or by a combination of any of
these methods.
[0099] As used herein, by "sized selected" is meant that a nucleic
acid of a particular size is selected for use in the construction
of dsRNA expression libraries as described herein. Desirably the
size selected nucleic acid is less than a full length cDNA sequence
or at least 100, 500, 600, or 1000 nucleotides in length. In other
embodiments, the nucleic acid is at least 10, 20, 30, 40, 50, 60,
70, 80, or 90 nucleotides in length. In yet other embodiments, the
number of nucleotides in the nucleic acid is between 5-100
nucleotides, 15-100 nucleotides, 20-95 nucleotides, 25-90
nucleotides, 35-85 nucleotides, 45-80 nucleotides, 50-75
nucleotides, or 55-70 nucleotides, inclusive. In still other
embodiments, the number of nucleotides in the nucleic acid is
contained in one of the following ranges: 5-15 nucleotides, 15-20
nucleotides, 20-25 nucleotides, 25-35 nucleotides, 35-45
nucleotides, 45-60 nucleotides, 60-70 nucleotides, 70-80
nucleotides, 80-90 nucleotides, or 90-100 nucleotides, inclusive.
In other embodiments, the nucleic acid contains less than 50,000;
10,000; 5,000; or 2,000 nucleotides. For example, a nucleic acid
may be size selected using size exclusion chromatography (e.g., as
size exclusion Sepharose matrices) according to standard procedures
(see, for example, Sambrook, Fritsch, and Maniatis, Molecular
Cloning: A Laboratory Manual (3rd ed.), Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 2001).
[0100] By "under conditions that inhibit or prevent an interferon
response or a dsRNA stress response" is meant conditions that
prevent or inhibit one or more interferon responses or cellular RNA
stress responses involving cell toxicity, cell death, an
anti-proliferative response, or a decreased ability of a dsRNA to
carry out a PTGS event. These responses include, but are not
limited to, interferon induction (both Type 1 and Type II),
induction of one or more interferon stimulated genes, PKR
activation, 2'5'-OAS activation, and any downstream cellular and/or
organismal sequelae that result from the activation/induction of
one or more of these responses. By "organismal sequelac" is meant
any effect(s) in a whole animal, organ, or more locally (e.g., at a
site of injection) caused by the stress response. Exemplary
manifestations include elevated cytokine production, local
inflammation, and necrosis. Desirably the conditions that inhibit
these responses are such that not more than 95%, 90%, 80%, 75%,
60%, 40%, or 25%, and most desirably not more than 10% of the cells
undergo cell toxicity, cell death, or a decreased ability to carry
out a PTGS, TGS, or other gene silencing event, compared to a cell
not exposed to such interferon response inhibiting conditions, all
other conditions being equal (e.g., same cell type, same
transformation with the same dsRNA expression library.
[0101] Apoptosis, interferon induction, 2'5' OAS
activation/induction, PKR induction/activation, anti-proliferative
responses, and cytopathic effects are all indicators for the RNA
stress response pathway. Exemplary assays that can be used to
measure the induction of an RNA stress response as described herein
include a TUNEL assay to detect apoptotic cells, ELISA assays to
detect the induction of alpha, beta and gamma interferon, ribosomal
RNA fragmentation analysis to detect activation of 2'5'OAS,
measurement of phosphorylated eIF2a as an indicator of PKR (protein
kinase RNA inducible) activation, proliferation assays to detect
changes in cellular proliferation, and microscopic analysis of
cells to identify cellular cytopathic effects (see, e.g., Example
11). Desirably, the level of an interferon response or a dsRNA
stress response in a cell transformed with a dsRNA or a dsRNA
expression vector is less than 20, 10, 5, or 2-fold greater than
the corresponding level in a mock-transfected control cell under
the same conditions, as measured using one of the assays described
herein. In other embodiments, the level of an interferon response
or a dsRNA stress response in a cell transformed with a dsRNA or a
dsRNA expression vector using the methods of the present invention
is less than 500%, 200%, 100%, 50%, 25%, or 10% greater than the
corresponding level in a corresponding transformed cell that is not
exposed to such interferon response inhibiting conditions, all
other conditions being equal. Desirably, the dsRNA does not induce
a global inhibition of cellular transcription or translation.
[0102] By "specifically hybridizes" is meant a dsRNA that
hybridizes to a target nucleic acid but does not substantially
hybridize to other nucleic acids in a sample (e.g., a sample from a
cell) that naturally includes the target nucleic acid, when assayed
under denaturing conditions. In one embodiment, the amount of a
target nucleic acid hybridized to, or associated with, the dsRNA,
as measured using standard assays, is 2-fold, desirably 5-fold,
more desirably 10-fold, and most desirably 50-fold greater than the
amount of a control nucleic acid hybridized to, or associated with,
the dsRNA.
[0103] By "substantial sequence identity" is meant sufficient
sequence identity between a dsRNA and a target nucleic acid for the
dsRNA to inhibit the expression of the nucleic acid. Preferably,
the sequence of the dsRNA is at least 40, 50, 60, 70, 80, 90, 95,
or 100% identical to the sequence of a region of the target nucleic
acid.
[0104] By "specifically inhibits the expression of a target nucleic
acid" is meant inhibits the expression of a target nucleic acid
more than the expression of other, non-target nucleic acids which
include other nucleic acids in the cell or biological sample having
a sequence that is less than 99, 95, 90, 80, or 70% identical or
complementary to that of the target nucleic acid. Desirably, the
inhibition of the expression of these non-target molecules is
2-fold, desirably 5-fold, more desirably 10-fold, and most
desirably 50-fold less than the inhibition of the expression the
target nucleic acid.
[0105] By "high stringency conditions" is meant hybridization in
2.times.SSC at 40 C with a DNA probe length of at least 40
nucleotides. For other definitions of high stringency conditions,
see F. Ausubel et al., Current Protocols in Molecular Biology, pp.
6.3.1-6.3.6, John Wiley & Sons, New York, N.Y., 1994, hereby
incorporated by reference.
[0106] Conditions and techniques that can be used to prevent an
interferon response or dsRNA stress response during the screening
methods of the present invention are described herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0107] FIG. 1 is a schematic representation of a strategy to
isolate clonally pure stable integrants that contain a single
expression unit isolated from cells transfected with a
double-stranded RNA encoding a cDNA library.
[0108] FIG. 2 is a schematic illustration of the RNA stress
response pathway, also known as the Type 1 interferon response. The
pathway is branched and RNA mediated induction/activation can occur
at multiple points in the pathway. RNA (dsRNA and other structures)
can act to elicit the production of alpha and or beta interferon in
most cell types. Early and key events in the interferon response
pathway include interferon-mediated activation of the Jak-Stat
pathway, which involves tyrosin-phosphorylation of STAT proteins
(STATs). Activated STATs translocate to the nucleus and bind to
specific sites in the promoters of IFN-inducible genes thereby
effecting transcription of these genes: the expression of which act
in concert to push the cell towards apoptosis or to an
anti-proliferative state. There are hundreds of
interferon-stimulated genes but only two of the better
characterized ones, PKR and 2'5'-OAS, have been shown. RNA can also
activate the pathway in an interferon and STAT independent manner.
In addition, dsRNA/structured RNA can also activate inactive PKR
and 2'5'-OAS which are constitutively expressed in many cell
types.
[0109] FIG. 3 is a schematic illustration of a vector containing
nucleotides 400-1200 of accession number #U89938 (SEAP) for the
generation of a dsRNA molecule specific for SEAP. The EcoRI
fragment encoding SEA flanked by converging T7 promoters is used as
a template for dsRNA synthesis.
[0110] FIGS. 4A and 4B are lists of sequences for dsRNA molecules
used to inhibit expression of SEAP or IL-12. FIG. 4A contains SEQ
ID NOs: 1-9, and FIG. 4B contains SEQ ID NOs: 10-18.
DETAILED DESCRIPTION OF THE INVENTION
[0111] The present invention is based on the surprising discovery
that short dsRNA molecules (e.g., dsRNA molecules containing a
region of between 11 and 40 nucleotides in length that is in a
double stranded conformation) can be used to inhibit the
PKR/interferon/stress/cytotoxici- ty response induced by other
dsRNA molecules (e.g., short or long dsRNA molecules homologous to
one or more target genes) in vertebrate cells, tissues, and
organisms. For example, short dsRNA can be used to inhibit toxicity
that may otherwise be induced by long dsRNA (e.g., long dsRNA that
is homologous to a target nucleic acid). In particular, two short
dsRNA molecules prevented the toxic effects that are normally
induced by the dsRNA poly (I)(C) (Example 2). Additionally, a first
short dsRNA can be used to inhibit toxicity that may otherwise be
induced by a second short dsRNA that is homologous to a target
nucleic acid, such as a second short dsRNA that induces toxicity
because it has a sequence with affinity for PKR or another
component in the dsRNA-mediated stress response pathway. The first
short dsRNA that is administered to inhibit toxicity may, for
example, inhibit the binding of the second dsRNA to PKR or inhibit
the dimerization or activation of PKR. Thus, the present methods
inhibit the induction of non-specific cytotoxicity and cell death
by dsRNA molecules (e.g., long dsRNA molecules) that would
otherwise preclude their use for gene silencing in vertebrate cells
and vertebrates.
[0112] Important Role of PKR in DsRNA-Mediated Toxicity
[0113] The cytotoxicity triggered by dsRNA molecules is a complex,
multi-pathway process. Protein kinase PKR is an important component
of the Type 1 interferon response. PKR is constitutively present in
most cell types in its inactive monomer form. PKR must dimerize in
order to become activated. Activation is mediated through a process
involving autophosphorylation. Once activated, PKR catalyzes the
intermolecular phosphorylation of a number of molecules including
translation factor eIF-2alpha. This serine phosphorylation of
eIF-2alpha results in global inhibition of translation initiation.
A basal level of phosphorylated eIF-2alpha is present in most cells
and most likely reflects a basal level of activated PKR in these
cells.
[0114] PKR has a dsRNA binding motif that has been shown to be able
to bind dsRNA as small as 11 nucleotides in length. However, PKR
activation has been shown to require dsRNA of at least 30
nucleotides in length, with an optimal length of about 80
nucleotides. The requirement for at least 30 nucleotides for
activation is thought to reflect the length of dsRNA that is
required for two PKR monomers to sit next to each other on the same
dsRNA molecule. Thus, binding of two monomers to the same dsRNA
molecule enables dimerization of PKR. This process is referred to
as RNA-dependent activation.
[0115] While not meant to limit the invention to any specific
mechanism of action, the present methods for preventing the
interferon response may provide short dsRNA molecules that are of a
size sufficient to bind PKR, but small enough to prevent two PKR
molecules from binding. When supplied at a high enough level or
concentration, these short dsRNA molecules may titrate out all of
the PKR monomers and prevent them from dimerizing. Because
dimerized PKR dissociates into two PKR monomers, the released
monomers may also be captured by short dsRNA. If this mechanism is
involved, global translation is expected to increase following
administration of short dsRNA molecules because short dsRNA
molecules may decrease the basal level of activated PKR. Consistent
with this mechanism, short dsRNA was found to increase the
expression of an unrelated gene (Example 2).
[0116] Although the short dsRNA molecules are most likely
preventing dimerization, they could also be acting in a similar
manner with respect to other components of the interferon response
pathway(s) because many of these components also have dsRNA binding
domains.
[0117] Applications of Present Methods
[0118] Short dsRNA molecules can be used in conjunction with
exogenously added or endogenously expressed dsRNA molecules in gene
silencing applications to prevent the activation of PKR that would
otherwise be elicited by the latter dsRNA. Currently, the
administration of such exogenously added dsRNA to cells and animals
for gene-silencing experiments is limited by the cytotoxicty
induced by dsRNA (e.g., long dsRNA), Short dsRNA or a vector stably
or transiently expressing short dsRNA can be delivered before
(e.g., 10, 20, 30, 45, 60, 90, 120, 240, or 300 minutes before),
during, or after (e.g., 2, 5, 10, 20, 30, 45, 60, or 90 minutes
after) the delivery of exogenous dsRNA or a vector encoding dsRNA
to animals or cell cultures. A vector expressing a short dsRNA can
also be administered up to 1, 2, 3, 5, 10, or more days before
administration of dsRNA homologous to a target nucleic acid. A
vector expressing short dsRNA can be administered any number of
days before the administration of dsRNA homologous to a target
nucleic acid (e.g., target-specific dsRNA) or a vector encoding
this dsRNA, as long as the dsRNA-mediated stress response pathway
is still inhibited by the short dsRNA when the target-specific
dsRNA is administered. The timing of the delivery of these nucleic
acids can be readily be selected or optimized by one skilled in the
art of pharmacology using standard methods. The methods of the
invention may also be useful in any circumstances in which PKR
suppression is desired; e.g., in DNA expression systems in which
small amounts of dsRNA may be inadvertently formed when
transcription occurs from cryptic promoters within the non-template
strand. The present invention is also useful for industrial
applications such as the manufacture of dsRNA molecules in
vertebrate cell cultures. The present invention can be used to make
"knockout" or "knockdown" vertebrate cell lines or research
organisms (e.g., mice, rabbits, sheep, or cows) in which one or
more target nucleic acids are silenced. The present invention also
allows the identification of the function of a gene by determining
the effect of inactivating the gene in a vertebrate cell or
organism. These gene silencing methods can also be used to validate
a selected gene as a potential target for drug discovery or
development.
[0119] The methods of the invention can also treat, stabilize, or
prevent diseases associated with the presence of an endogenous or
pathogen protein in vertebrate organisms (e.g., human and non-human
mammals). These methods are expected to be especially useful for
therapeutic treatment for viral diseases, including chronic viral
infections such as HBV, HIV, papilloma viruses, and herpes viruses.
In some embodiments, the methods of the invention are used to
prevent or treat acute or chronic viral diseases by targeting a
viral nucleic acid necessary for replication and/or pathogenesis of
the virus in a mammalian cell. Slow virus infection characterized
by a long incubation or a prolonged disease course are especially
appropriate targets for the methods of the invention, including
such chronic viral infections as HTLV-I, HTLV-II, EBV, HBV, CMV,
HCV, HIV, papilloma viruses, and herpes viruses. For prophylaxis of
viral infection, the selected gene target is desirably introduced
into a cell together with the short dsRNA and long dsRNA molecules
of the invention. Particularly suitable for such treatment are
various species of the Retroviruses, Herpesviruses, Hepadnaviruses,
Poxviruses, Papillomaviruses, and Papovaviruses. Exemplary target
genes necessary for replication and/or pathogenesis of the virus in
an infected vertebrate (e.g., mammalian) cell include nucleic acids
of the pathogen or host necessary for entry of the pathogen into
the host (e.g., host T cell CD4 receptors), nucleic acids encoding
proteins necessary for viral propagation (e.g., HIV gag, env, and
pol), and regulatory genes such as tat and rev. Other exemplary
targets include nucleic acids for HIV reverse transcriptase, HIV
protease, HPV6 L1 and E2 genes, HPV11 L1 and E2 genes, HPV16 E6 and
E7 genes, HPV18 E6 and E7 genes, HBV surface antigens, core
antigen, and reverse transcriptase, HSD gD gene, HSVvp16 gene,
HSVgC, gH, gL, and gB genes, HSV ICP0, ICP4, and ICP6 genes;
Varicella zoster gB, gC and gH genes, and non-coding viral
polynucleotide sequences which provide regulatory functions
necessary for transfer of the infection from cell to cell (e.g.,
HIV LTR and other viral promoter sequences such as HSV vp 16
promoter, HSV-ICP0 promoter, HSV-ICP4, ICP6, and gD promoters, HBV
surface antigen promoter, and HBV pre-genomic promoter). Desirably,
a dsRNA (e.g., long dsRNA) of the invention reduces or inhibits the
function of a viral nucleic acid in the cells of a mammal or
vertebrate, and a short dsRNA of the invention blocks the dsRNA
stress response that may be triggered by dsRNA.
[0120] Other exemplary pathogens include bacteria, rickettsia,
chlamydia, fungi, and protozoa such as extraintestinal pathogenic
protozoa which cause malaria, babesiosis, trypanosomiasis,
leishmaniasis, or toxoplasmosis. The intracellular malaria-causing
pathogen Plasmodium species P. falciparum, P. vivax, P. ovate, and
P. malariae are desirable targets for dsRNA-mediated gene
silencing, especially in the chronic, relapsing forms of malaria.
Other intracellular pathogens include Babesia microti and other
agents of Babesiosis, protozoa of the genus Trypanosoma that cause
African sleeping sickness and American Trypanosomiasis or Chagas'
Disease; Toxoplasma gondii which causes toxoplasmosis,
Mycobacterium tuberculosis, M. bovis, and M avium complex which
cause various tuberculous diseases in humans and other animals.
Desirably, a dsRNA (e.g., long dsRNA) of the invention reduces or
inhibits the function of a pathogen nucleic acid in the cells of a
mammal or vertebrate, and a short dsRNA of the invention blocks the
dsRNA stress response that may be triggered by dsRNA.
[0121] In some methods for the prevention of an infection, a
pathogen target gene or a region from a pathogen target-gene (e.g.,
a region from an intron, exon, untranslated region, promoter, or
coding region) is introduced into the cell or animal. For example,
this target nucleic acid can be inserted into a vector that
desirably integrates in the genome of a cell and administered to
the cell or animal. Alternatively, this target nucleic acid can be
administered without being incorporated into a vector. The presence
of a region or an entire target nucleic acid in the cell or animal
is expected to enhance the amplification of the simultaneously or
sequentially administered dsRNA that is homologous to the target
gene. The amplified dsRNA or amplified cleavage products from the
dsRNA silence the target gene in pathogens that later infect the
cell or animal. Short dsRNA is also administered to the cell or
animal to inhibit dsRNA-mediated toxicity.
[0122] Similarly, to silence an endogenous target gene that is not
currently being expressed in a particular cell or animal, it may be
necessary to introduce a region from the target gene into the cell
or animal to enhance the amplification of the administered dsRNA
that is homologous to the target gene. The amplified dsRNA or
amplified cleavage products from the dsRNA desirably prevent or
inhibit the later expression of the target gene in the cell or
animal. Desirably, short dsRNA is also administered to inhibit
toxic effects.
[0123] Still other exemplary target nucleic acids encode a prion,
such as the protein associated with the transmissible spongiform
encephalopathies, including scrapie in sheep and goats; bovine
spongiform encephalopathy (BSE) or "Mad Cow Disease", and other
prion diseases of animals, such as transmissible mink
encephalopathy, chronic wasting disease of mule deer and elk, and
feline spongiform encephalopathy. Prion diseases in humans include
Creutzfeldt-Jakob disease, kuru, Gerstmann-Straussler-Scheinker
disease (which is manifest as ataxia and other signs of damage to
the cerebellum), and fatal familial insomnia. Desirably, a dsRNA
(e.g., long dsRNA) of the invention reduces or inhibits the
function of a prion nucleic acid in the cells of a mammal or
vertebrate, and a short dsRNA of the invention blocks the dsRNA
stress response that may be triggered by dsRNA.
[0124] The invention also provides compositions and methods for
treatment or prophylaxis of a cancer in a mammal by administering
to the mammal one or more of the compositions of the invention in
which the target nucleic acid is an abnormal or abnormally
expressed cancer-causing gene, tumor antigen or portion thereof, or
a regulatory sequence. Desirably, the target nucleic acid is
required for the maintenance of the tumor in the mammal. Exemplary
oncogene targets include ABL1, BRAF, BCL1, BCL2, BCL6, CBFA2,
CSF1R, EGFR, ERBB2 (HER-2/neu), FOS, HRAS, MYB, MYC, LCK, MYCL1,
MYCN, NRAS, ROS1, RET, SRC, and TCF3. Such an abnormal nucleic acid
can be, for example, a fusion of two normal genes, and the target
sequence can be the sequence which spans that fusion, e.g., the
bcr/abl gene sequence (Philadelphia chromosome) characteristic of
certain chronic myeloid leukemias, rather than the normal sequences
of the non-fused bcr and abl (see, e.g., WO 94/13793, published
Jun. 23, 1994, the teaching of which is hereby incorporated by
reference). Viral-induced cancers are particularly appropriate for
application of the compositions and methods of the invention.
Examples of these cancers include human-papillomavirus (HPV)
associated malignancies which may be related to the effects of
oncoproteins, E6 and E7 from HPV subtypes 16 and 18, p53 and RB
tumor suppressor genes, and Epstein-Barr virus (EBV) which has been
detected in most Burkitt's-like lymphomas and almost all
HIV-associated CNS lymphomas. The composition is administered in an
amount sufficient to reduce or inhibit the function of the
tumor-maintaining nucleic acid in the mammal.
[0125] The gene silencing methods of the present invention may also
employ a multitarget or polyepitope approach. Desirably, the
sequence of the dsRNA includes regions homologous to genes of one
or more pathogens, multiple genes or epitopes from a single
pathogen, multiple endogenous genes to be silenced, or multiple
regions from the same gene to be silenced. Exemplary regions of
homology including regions homologous to exons, introns, or
regulatory elements such as promoter regions and non-translated
regions.
[0126] The following examples are to illustrate the invention. They
are not meant to limit the invention in any way. For example, it is
noted that any of the following examples can be used with dsRNA
molecules of any length that are substantially identical to a
region of a target nucleic acid. The methods of the present
invention can be readily adapted by one skilled in the art to
utilize multiple dsRNA molecules to inhibit multiple target nucleic
acids. Any of the dsRNA molecules, target nucleic acids, or methods
described by Giordano, Pachuk, and Satishchandran (U.S. Ser. No.
10/062,707, filed Jan. 31, 2002, "Use of post-transcriptional gene
silencing for identifying nucleic acid sequences that modulate the
function of a cell") can also be used in the present methods.
[0127] While the use of the present invention is not limited to
vertebrate or mammalian cells, such cells can be used to carry out
the methods described herein. Desirably, the vertebrate (e.g.,
mammalian) cells used to carry out the present invention are cells
that have been cultured for only a small number of passages (e.g.,
less than 30 passages of a cell line that has been obtained
directly from American Type Culture Collection), or are primary
cells. In addition, vertebrate (e.g., mammalian) cells can be used
to carry out the present invention when the dsRNA being transfected
into the cell is not complexed with cationic lipids.
EXAMPLE 1
Exemplary Methods for the Generation and Administration of
DsRNA
[0128] Generation of DsRNA
[0129] Short and long dsRNA can be made using a variety of methods
known to those of skill in the art. For example, ssRNA sense and
antisense strands can be synthesized chemically in vitro [see, for
example, Q. Xu et al, Nucl. Acids Res., 24 (18): 3643-4, 1996 and
other references cited in WO 00/63364, pp. 16-7], transcribed in
vitro using commercially available materials and conventional
enzymatic synthetic methods, (e.g., using the bacteriophage T7, T3,
or SP6 RNA polymerases according to conventional methods such as
those described by Promega Protocols and Applications Guide
3.sup.rd Ed., Eds. Doyle, 1996, ISBN No. 1-882274-57-1], or
expressed in cell culture using recombinant methods. The RNA can
then be purified using non-denaturing methods including various
chromatographic methods and hybridized to form dsRNA. Such methods
are well known to those of skill in the art and are described, for
example, in WO 01/75164, WO 00/63364, and Sambrook et al.,
Molecular Cloning, A Laboratory Manual, 2.sup.nd Ed.; Cold Spring
Harbor Laboratory Press, New York, 1989, the teaching of which is
incorporated herein by reference.
[0130] In vitro transcription reactions are carried out using the
Riboprobe Kit (Promega Corp.), according to the manufacturer's
directions. The template DNA is as described above. Following
synthesis, the RNA is treated with RQ1 DNase (Promega Corp.) to
remove template DNA. The RNA is then treated with Proteinase K and
extracted with phenol-chloroform to remove contaminating RNases.
The RNA is ethanol precipitated, washed with 70% ethanol, and
resuspended in RNase-free water. Aliquots of RNA are removed for
analysis and the RNA solution is flash frozen by incubating in an
ethanol-dry ice bath. The RNA is stored at -80.degree. C.
[0131] As an alternative to phenol-chloroform extraction, RNA can
be purified in the absence of phenol using standard methods such as
those described by Li et al. (WO 00/44914, filed Jan. 28, 2000).
Alternatively, RNA that is extracted with phenol and/or chloroform
can be purified to reduce or eliminate the amount of phenol and/or
chloroform. For example, standard column chromatography can be used
to purify the RNA (WO 00/44914, filed Jan. 28, 2000).
[0132] Double stranded RNA is made by combining equimolar amounts
of PCR fragments encoding antisense RNA and sense RNA, as described
above, in the transcription reaction. Single stranded antisense or
sense RNA is made by using a single species of PCR fragment in the
reaction. The RNA concentration is determined by spectrophotometric
analysis, and RNA quality is assessed by denaturing gel
electrophoresis and by digestion with RNase T1, which degrades
single stranded RNA.
[0133] An mRNA library is produced using Qbeta bacteriophage, by
ligating the mRNA molecules to the flank sequences that are
required for Qbeta replicase function (Qbeta flank or Qbeta flank
plus P1), using RNA ligase. The ligated RNA molecules are then
transformed into bacteria that express Qbeta replicase and the coat
protein. Single plaques are then inoculated into fresh bacteria.
All plaques are expected to carry transgene sequences. Each plaque
is grown in larger quantities in bacteria that produce the Qbeta
polymerase, and RNA is isolated from the bacteriophage particles.
Alternatively, if the Qbeta flank plus P1 is used to generate the
library (e.g., P1=MS2, VEEV, or Sindbis promoter sequences), these
vectors can be used to carry out the in vitro transcription along
with the cognate polymerase. The in vitro made dsRNA is then used
to transfect cells.
[0134] Administration of DsRNA
[0135] The short dsRNA molecules and long dsRNA molecules may be
delivered as "naked" polynucleotides, by injection,
electroporation, or any polynucleotide delivery method known to
those of skill in the field of RNA and DNA. For example, in vitro
synthesized dsRNA may be directly added to a cell culture medium.
Uptake of dsRNA is also facilitated by electroporation using those
conditions required for DNA uptake by the desired cell type. RNA
uptake is also mediated by lipofection using any of a variety of
commercially available and proprietary cationic lipids,
DEAE-dextran-mediated transfection, microinjection, protoplast
fusion, calcium phosphate precipitation, viral or retroviral
delivery, anesthetic RNA complex, or biolistic transformation.
[0136] Alternatively, the RNA molecules may by delivered by an
agent (e.g., a double-stranded DNA molecule) that generates an at
least partially double stranded molecule in cell culture, in a
tissue, or in vivo in a vertebrate or mammal. The DNA molecule
provides the nucleotide sequence which is transcribed within the
cell to become an at least partially double stranded RNA. These
compositions desirably contain one or more optional polynucleotide
delivery agents or co-agents, such as a cationic amphiphile local
anesthetic such as bupivacaine, a peptide, cationic lipid, a
liposome or lipidic particle, a polycation such as polylysine, a
branched, three-dimensional polycation such as a dendrimer, a
carbohydrate, a cationic amphiphile, a detergent, a benzylammonium
surfactant, one or more multifunctional cationic
polyamine-cholesterol agents disclosed in U.S. Pat. No. 5,837,533
and U.S. Pat. No. 6,127,170, or another of the many compounds known
in the art to facilitate delivery of polynucleotides into cells.
Non-exclusive examples of such facilitating agents or co-agents are
described in U.S. Pat. No. 5,593,972; U.S. Pat. No. 5,703,055; U.S.
Pat. No. 5,837,533; U.S. Pat. No. 6,127,170; U.S. Pat. No.
5,962,428, U.S. Pat. No. 6,197,755, WO 96/10038, published Apr. 4,
1996, and WO 94/16737, published Aug. 8, 1994, the teaching of
which are hereby incorporated by reference.
[0137] For administration of dsRNA (e.g., a short dsRNA to inhibit
toxicity or a long dsRNA to silence a gene) to a cell or cell
culture, typically between 50 ng and 5 ug, such as between 50 ng
and 500 ng or between 500 ng and 5 ug dsRNA is used per one million
cells. For administration of a vector encoding dsRNA (e.g., a short
dsRNA to inhibit toxicity or a long dsRNA to silence a gene) to a
cell or cell culture, typically between 10 ng and 2.5 ug, such as
between 10 ng and 500 ng or between 500 ng and 2.5 ug dsRNA is used
per one million cells. Other doses, such as even higher doses may
also be used.
[0138] For administration of dsRNA (e.g., a short dsRNA to inhibit
toxicity or a long dsRNA to silence a gene) to an animal, typically
between 10 mg to 100 mg, 1 mg to 10 mg, 500 ug to 1 mg, or 5 ug to
500 ug dsRNA is administered to a 90-100 pound person animal (in
order of increasing preference). For administration of a vector
encoding dsRNA (e.g., a short dsRNA to inhibit toxicity or a long
dsRNA to silence a gene) to an animal, typically between 100 mg to
300 mg, 10 mg to 100 mg, 1 mg to 10 mg, 500 ug to 1 mg, or 50 ug to
500 ug dsRNA is administered to a 90-100 pound person (in order of
increasing preference). The dose may be adjusted based on the
weight of the animal. In some embodiments, about 1 to 10 mg/kg or
about 2 to 2.5 mg/kg is administered. Other doses may also be
used.
[0139] For administration to an intact animal, typically between 10
ng and 50 ug, between 50 ng and 100 ng, or between 100 ng and 5 ug
of dsRNA or DNA encoding a dsRNA is used. In desirably embodiments,
approximately 10 ug of a DNA or 5 ug of dsRNA is administered to
the animal. With respect to the methods of the invention, it is not
intended that the administration of dsRNA or DNA encoding dsRNA to
cells or animals be limited to a particular mode of administration,
dosage, or frequency of dosing; the present invention contemplates
all modes of administration sufficient to provide a dose adequate
to inhibit gene expression, prevent a disease, or treat a
disease.
[0140] Short dsRNA is delivered before, during, or after the
delivery of the dsRNA (e.g., a longer dsRNA) that might otherwise
be expected to induce cytotoxicity. If desired, modulation of cell
function, gene expression, or polypeptide biological activity is
then assessed in the cells or animals.
EXAMPLE 2
Demonstration that Short DsRNA Induces an Increase in Global
Translation, Most Likely Due to Inhibition of PKR Activation
[0141] To evaluate the use of short dsRNA for post transcriptional
gene silencing (PTGS), short dsRNA homologous to SEAP (human
placental secreted heat-stable alkaline phosphatase) and murine
IL-12 were tested individually for their ability to silence
exogenous SEAP and IL-12 genes (FIGS. 4A and 4B). In particular,
human rhabdomyosarcoma cells were transiently transfected with both
SEAP and murine IL-12 expression vectors and thus expressed both
SEAP and murine IL-12. Since both of these proteins are secreted,
they were detected in the medium of cultured transfected cells.
SEAP was measured using a colorimetric kinetic enzyme assay, and
murine IL-12 was measured using a commercially available ELISA kit
from R&D systems. Short dsRNA molecules designed against SEAP
were transfected into the cells. The SEAP short dsRNA was expected
to reduce the level of SEAP expression, but have no effect on the
level of IL-12. The reciprocal experiment was also carried out in
which short dsRNA molecules designed against murine IL-12 were
transfected into the cells. The IL-12 short dsRNA was expected to
reduce IL-12 levels but not effect SEAP levels. Thus SEAP and IL-12
serve as controls for each other. The amount of each vector per one
million cells was 500 ng. The short dsRNA molecules were tested in
three different amounts: 1.25 ug, 2.5 ug, and 5 ug per one million
cells.
[0142] SEAP short dsRNA down-regulated SEAP production and
surprisingly appeared to dramatically up-regulate IL-12 expression.
Similarly, IL-12 short dsRNA down-regulated IL-12 as expected and
surprisingly increased SEAP expression. Thus, the short dsRNA
molecules down-regulated expression of their respective targets via
PTGS as expected. One explanation of the unexpected increase in
expression of an unrelated gene is that short dsRNA inhibits
dimerization of PKR. In order to test this hypothesis, the
following experiment was performed.
EXAMPLE 3
Co-Transfection of Short DsRNA with Poly (I)(C) Prevents
DsRNA-Induced Cytotoxicity
[0143] Polyriboinosinic acid: polyribocytidylic acid [also called
poly(I)(C)]is a commercially available synthetic RNA composition
known to induce the interferon response (see, for example, Adamson,
Nature, 223, Aug. 16, 1969; U.S. Pats No. 4,283,393). Cytotoxicity
following poly (I)(C) administration is mediated in part by PKR
activation. Short dsRNA molecules with no known homology to RNA
molecules expressed in RD cells were complexed with a commercially
available cationic lipid composition (Lipofectamine). In particular
the short dsRNA was a molecule containing a sequence from Human
Hepatitis B (HBV) (the 25-mer CCUCCAAUCACUCACCAACCUCCUG). Any other
short dsRNA sequence could also be used. Poly (I)(C) from
Pharmacia, which is heterologous in length, was also complexed with
Lipofectamine and used at a dose of 5 ug poly (I)(C) per one
million cells. Other exemplary concentrations of poly(I)(C) or long
dsRNA that may be used include about 50 ng to about 5 ug per one
million cells or about 500 ng to about 5 ug per one million cells.
To eliminate the PRK response, 2.5 ug of short dsRNA was also
delivered to one million cells. Another exemplary concentration of
short dsRNA that may be used to prevent toxicity in cell culture
include 50 ng to 5 ug per one million cells. To prevent toxicity in
animals, exemplary concentrations of short dsRNA include 500 ug to
1 mg, 1 mg to 10 mg, 10 mg to 100 mg, 5 ug to 100 mg, and more
desirably 5 ug to 500 ug.
[0144] In this experiment, one set of RD cells was transfected with
only poly (I)(C) while the second set of cells was transfected with
poly(I)(C) and short dsRNA (at a dose of 2.5 ug each per one
million cells). The cells were incubated and observed for several
days. By 20 hours post-transfection, there was massive loss of the
poly (I)(C) transfected cells to apoptosis.
[0145] Surprisingly, there was no cytotoxicty observed in cells
transfected with both poly (I)(C) and short dsRNA, suggesting that
the short dsRNA was protecting against cytotoxicity, even in the
face of the massive insult provided by the poly(I)(C). This
observation provides the basis for the present methods of using
short dsRNA molecules to inhibit dsRNA-mediated toxicity in a
variety of gene silencing (e.g., PTGS and TGS) applications.
EXAMPLE 4
Exemplary Method for Using Short DsRNA to Inhibit or Prevent dsRNA
Mediated Toxicity
[0146] In one gene silencing method, a long dsRNA (e.g., a dsRNA
greater than 100, 200, 300, 400, 500, or more nucleotides) specific
to a target gene such as SEAP is transfected into cells for the
purpose of inducing sequence specific gene-silencing without
inducing the type I interferon response (also known as the dsRNA
stress response). Short dsRNA (e.g., one or more dsRNA molecules of
approximately 18 or 25 nucleotides in length) are co-transfected
with the long SEAP-specific dsRNA into cells expressing SEAP. Cells
are maintained in culture and monitored for loss of SEAP
expression. Cells are also observed for any indication of an
interferon or other dsRNA-mediated cytotoxic response.
[0147] In Vitro Expression of SEAP Specific DsRNA (e.g., Long
DsRNA)
[0148] A plasmid containing 800 nucleotides of SEAP situated
between two converging T7 promoters is digested with a restriction
enzyme (FIG. 3). The restriction fragment bearing the SEAP sequence
flanked by the T7 promoters is gel purified using standard
techniques. The purified fragment is treated with proteinase K to
remove any contaminating RNA molecules, phenol and chloroform
extracted, EtOH precipitated, and resuspended in RNase-free water
using well known techniques. The purified fragment is then used as
a template for in vitro transcription catalyzed by T7 RNA
polymerase. Transcription is performed using a RiboMAX Large Scale
RNA Production system kit from Promega Corporation according to the
manufacturer's directions. RNA concentration is determined using
260/280 spectrophotometric analysis.
[0149] Generation of Short DsRNA
[0150] Short dsRNA was chemically synthesized by Dharmacon
(Colorado). Short dsRNA can also be prepared enzymatically using a
dsRNA synthesis kit available from Ambion according to the
manufacturer's directions. Short dsRNA molecules are designed to
avoid any extensive homology to known endogenously expressed mRNA
molecules in human rhabdomyosarcoma cells, the cells used for these
experiments (see for example, WO 00/63364 and WO 01/04313). When
other cells are used, short dsRNA molecules are desirably designed
to avoid extensive homology to mRNA molecules (e.g., essential mRNA
molecules) normally expressed in those cells. It is also possible,
however, for the short dsRNA molecules to have extensive homology
to mRNA molecules that are not required for normal metabolism of
the cell. Desirably, any inhibition of these mRNA molecules by the
short dsRNA does not slow down or otherwise affect the growth rate
or health of the cell.
[0151] Creation of Transient Expression Systems
[0152] Human rhabdomyosarcoma cells (RD) were transfected with both
SEAP and murine IL-12 expression vectors. The accession number for
the p40 subunit of murine IL-12 is M86671; the accession number for
SEAP is U89938. Both SEAP and 1'-12 were under the control of the
HCMV promoter and the bovine growth hormone (BGH) polyadenylation
signal. RD cells were cultured in DMEM (10% FBS) in T75 flasks
until a 90-95% confluency was reached, and the cells were
transfected with the SEAP and IL-12 expression vectors.
Transfection was mediated using Lipofectamine (Invitrogen)
according to the manufacturer's directions. Briefly, for each T75
flask of cells, 11 ug each of the SEAP and 11-12 expression vectors
were added to 800 ul Optimem, a serum-free medium available from
Invitrogen. In a separate tube, 80 ul Lipofectamine was added to
800 ul Optimem. The contents of the tube containing Lipofectamine
was added to the tube containing the DNA. The mixture was allowed
to incubate for 20 minutes at room temperature. During this
incubation period, media was removed from the RD cells and replaced
with 10 ml of Optimem. This Optimen wash was allowed to remain on
the cells for 20 minutes after which time the Optimem was removed
and replaced with seven mL of fresh Optimem. The transfection
mixture (DNA vectors plus Lipofectamine) was added to the cells,
and the cells were incubated for 17-20 hours, at which time the
media containing the transfection mixture was removed from the
cells and replaced with 15 mL DMEM (10% FBS). Cells began to
secrete SEAP and IL-12 on that day and continued to secrete
detectable levels of each protein for about one month.
[0153] Transfection of DsRNA
[0154] The day prior to transfection, RD cells transiently
expressing both IL-12 and SEAP are seeded into individual wells of
six-well plates at a density of about 7.5.times.10.sup.6 per well
and cultured overnight at 37.degree. C. in DMEM (10% FBS). Each
transfection is performed in quadruplicate. The following
transfections are performed: short dsRNA (chemically synthesized),
short dsRNA alone (enzymatically synthesized), SEAP-specific long
dsRNA alone, SEAP-specific long dsRNA plus chemically synthesized
short dsRNA, SEAP-specific long dsRNA plus enzymatically
synthesized short dsRNA, and control untransfected cells. All
transfection mixes are performed using Lipofectamine as described
above and using similar charge to charge ratios of nucleic acid to
Lipofectamine as described for creation of the transient expression
systems above. Short dsRNA alone transfections are performed using
500 ng, 1 ug, 2.5 ug, or 5 ug complexed with Lipofectamine. Long
dsRNA alone transfections are performed using 1 ug or 2.5 ug dsRNA
complexed with Lipofectamine. For transfection of both long and
short dsRNA, the long dsRNA (1 ug or 2.5 ug) and the short dsRNA
(500 ng, 1 ug, 2.5 ug, or 5 ug) are complexed separately with
Lipofectamine and then each added to the same cells at the time of
transfection. Alternatively, short dsRNA and long dsRNA can be
complexed together. Transfection mixes are incubated for 20-30
minutes at room temperature.
[0155] While transfection mixtures are incubating, media is removed
from the cells in the six-well plates. Two ml of Optimem is added
to each well, and the cells are incubated at 37.degree. C. for
about 15-20 minutes. The Optimem is removed and 800 ul Optimem is
added per well. The transfection mixes are added such that some
wells receive the short dsRNA molecules alone at each short dsRNA
concentration, the long dsRNA molecules alone at each
concentration, and the long dsRNA and short dsRNA at each
concentration. For example, cells receive 1 ug long dsRNA and
either 500 ng, 1 ug, 2.5 ug or 5 ug short dsRNA. Chemically
synthesized short dsRNA is used in one set, and enzymatically
synthesized short dsRNA is used in a second set. The cells
receiving 2.5 ug long dsRNA also receive short dsRNA molecules as
just described. Control cells receive no transfection mixtures. The
transfected cells are incubated at 37.degree. C. for 17-20 hours.
The media is then removed from the cells and replaced with DMEM
(10% FBS). The cells are kept in culture for two weeks, and the
media is sampled periodically (e.g., once a day) over a two week
period. The media is assayed for SEAP and murine IL-12 expression.
Murine IL-12 is assayed using the Quantikine Kit from R&D
systems according to the manufacturer's directions. Murine 11-12 is
assayed as an indicator of a non-specific, toxic effect such as the
effect known to be mediated by long dsRNA and poly (I)(C). Cells
are also visualized microscopically for the evidence of cytopathic
effect. At eight hours post-transfection, cell lysates are
harvested from two of the quadruplicate for measurement of
eIF-2alpha phosphorylated and non-phosphorylated levels. This time
period following transfection of long dsRNA has been shown to be a
peak in expression of phosphorylated eIF-2alpha.
[0156] Cytotoxicity/Interferon-Beta Assay
[0157] The following parameters of the Type 1 interferon response
are monitored following delivery/expression of RNA in RD cells:
alpha/beta interferon production, 2'5'-OAS mRNA induction, and PKR
and 2'5'-OAS activation. Cytoxicity may also be evaluated through
the use of an apoptotic nuclear staining assay (TdT FragEL, DNA
Fragmentation Detection Kit, In Situ Apoptosis Assay from Oncogene
(Boston, Mass.)), the measurement of antiproliferative responses,
and the visual recording of cytopathic effect. For interferon
analysis, supernatants are removed from RNA stimulated and control
cells at various times points. Interferon-alpha and beta are
measured using the human interferon-alpha ELISA kit from Endogen
(Rockford, Ill.) and the human interferon-beta ELISA kit from RD1
(Flanders, N.J.) according to manufacturer's directions. The
detection of mRNA molecules encoding the p69 human
2',5'-oligoadenylate synthetase is performed by reverse
transcriptase PCR using the Titan One Tube Reverse transcriptase
PCR Kit (Roche Biochemicals, Nutley, N.J.) according to the
manufacturer's directions. Primers and conditions for the p69
encoding mRNA are described in Hovnanian et al. (Genomics
52(3):267-77, 1998).
[0158] Measurement of Phosphorylated eIF-2alpha
[0159] PKR activation is monitored by measuring the ratio of
phosphorylated to non-phosphorylated eIF2alpha using Western blot
analysis and antibodies specific for phosphorylated eIF2a and
non-phosphorylated eIF2a. Measurements are made at various time
points over 24 hours following dsRNA stimulation. Since activation
of PKR has been found to peak at different times depending on the
RNA delivered and since the ratio of phosphorylated to
unphosphorylated eIF2alpha changes in control cells over 24 hours,
each sample is compared to the appropriate time point control and
expressed as a fraction of the control value. 2'5'OAS activation is
monitored using a ribosomal fragmentation assay (Li et al., J Biol
Chem 275(12):8880-8, 2000).
[0160] Expected Results
[0161] SEAP levels are expected to decline with respect to those
levels in the untransfected controls in every set of cells
receiving SEAP specific dsRNA. No significant reduction in SEAP is
expected in cells receiving only the short dsRNA molecules.
However, IL-12 levels are most likely reduced with respect to those
seen in cells receiving SEAP long dsRNA and no short dsRNA, due to
possible toxicity of long dsRNA. This result indicates that a
non-specific effect is responsible for down regulation of
expression. In addition, cells transfected with SEAP long dsRNA and
no short dsRNA cells may have visible cytopathic effects and have
more phosphorylate eIF-2alpha than the untransfected controls.
Conversely, cells receiving SEAP dsRNA with any of the short dsRNA
molecules may down-regulate SEAP expression without no
down-regulating IL-12 expression. In addition, these cells may have
few or no visible cytopathic effects and have normal ratios of
phosphorlated eIF-2alpha to non-phophorylated eIF-2alpha. These
results would further support the ability of a combination of short
dsRNA and long dsRNA to protect cells against the toxic effects
induced by long dsRNA alone.
[0162] Similar methods can be used to inhibit cytotoxicity induced
by short dsRNA that is homologous to a target gene. Short dsRNA can
also be used to prevent toxicity when long or short dsRNA is
expressed intracellularly under conditions where expression of long
or short dsRNA would otherwise be toxic.
EXAMPLE 5
Exemplary Methods for Using DsRNA-Mediated Gene Silencing to
Determine or Validate the Function of a Gene
[0163] Post-transcriptional gene silencing (PTGS) can also be used
as a tool to identify and validate specific unknown genes involved
in cell function, gene expression, and polypeptide biological
activity. Since novel genes are likely to be identified through the
methods of the present invention, PTGS is developed for use in
validation and to identify novel targets for use in therapies for
diseases, for example, cancer, neurological disorders, obesity,
leukemia, lymphomas, and other disorders of the blood or immune
system.
[0164] The present invention features methods to identify unknown
targets that result in the modulation of a particular phenotype, an
alteration of gene expression in a cell, or an alteration in
polypeptide biological activity in a cell, using either a library
based screening approach or a non-library based approach to
identify nucleic acids that induce gene silencing. The present
invention also allows the determination of function of a given
sequence. These methods involve the direct delivery of in vitro
transcribed dsRNA or the delivery of a plasmid that direct the cell
to make its own dsRNA. As described above, short dsRNA or a plasmid
encoding short dsRNA is also administered to inhibit dsRNA-mediated
toxicity. To avoid problems associated with transfection
efficiency, plasmids are designed to contain a selectable marker to
ensure the survival of only those cells that have taken up plasmid
DNA. One group of plasmids directs the synthesis of dsRNA that is
transcribed in the cytoplasm, while another group directs the
synthesis of dsRNA that is transcribed in the nucleus.
[0165] Identification of Genes by Assaying for a Modulation in Cell
Function
[0166] Functional identification of novel genes can be accomplished
through the use of a number of different assays. For example, cells
may be assayed for cell motility, apoptosis, cell growth, cell
invasion, vascularization, cell cycle events, cell differentiation,
cell dedifferentiation, neuronal cell regeneration, or the ability
to support viral replication, as well as other cell functions known
in the art. Methods for carrying out such functional assays are
well known and are described, for example, in Platet and Garcia
(Invasion Metastasis 18:198-208, 1998-1999);
[0167] Harper et al. (Neuroscience 88:257-267, 1999); and Tomaselli
et al. (J. Cell Biol. 105:2347-2358, 1987), and are also described
below.
[0168] Functional identification of nucleic acid sequences involved
in modulating a particular cell function may be carried out by
comparing cells transfected with a dsRNA to control cells that have
not been transformed with a dsRNA or that have been
mock-transfected, in a functional assay. A cell that has taken up
sequences unrelated to a particular function will perform in the
particular assay in a manner similar to the control cell. A cell
experiencing PTGS of a gene involved in the particular function
will exhibit an altered ability to perform in the functional assay
compared to the control.
[0169] The percent modulation of a particular cell function that
identifies a nucleic acid sequence that modulates the function of a
cell will vary depending on the assay, phenotype, and the
particular nucleic acid affected by PTGS. For each assay, the
percent modulation can readily be determined by one skilled in the
art, when used in conjunction with controls, as described herein.
Desirably the modulation is at least 20%, more desirably at least
30%, 40%, 50%, 60%, 75%, and most desirably at least 90% compared
to the control. An increase in the function of a cell can also be
measured in terms of fold increase, where desirably, the increase
is at least 1.5-fold to 5-fold compared to the control.
[0170] Alternatively, the function of a cell may be to affect the
function, gene expression, or polypeptide biological activity of
another cell, for example, a neighboring cell, a cell that is
contacted with the cell in which a PTGS event occurs, or a cell
that is contacted with media or other extracellular fluid that the
cell in which a PTGS event occurs is contained in. For example, a
cell experiencing PTGS of a gene may modulate cell motility,
apoptosis, cell growth, cell invasion, vascularization, cell cycle
events, cell differentiation, cell dedifferentiation, neuronal cell
regeneration, or the ability to support viral replication of a
nearby cell, or a cell that is exposed to media or other
extracellular fluid in which the transfected cell in which a PTGS
event occurs was once contained. This can be tested by removing the
media in which a cell experiencing a PTGS event is occurring and
placing it on a separate cell or population of cells. If the
function of the separate cell or population of cells is modulated,
compared to a cell or population of cells receiving media obtained
from cells that had been mock transfected, then one or more of the
cells experiencing a PTGS event can affect the function of another
cell. The identity of the nucleic acid sequence that causes the
modulation can be identified with repeated rounds of selection.
[0171] In another method, a single cell experiencing a PTGS event
can be placed in proximity of a cell or a population of cells that
was not transfected with dsRNA, and the effect of this placement is
evaluated for a modulation in the function of the cell or
population of cells. If the function of the non-transfected cell or
population of cells is modulated, compared to a cell or population
of cells in proximity of a cell that was mock transfected, then the
cell experiencing a PTGS event contains a nucleic acid sequence
that can affect the function of another cell. This nucleic acid
sequence can be identified using techniques described herein.
[0172] Identification of Genes Using Differential Gene
Expression
[0173] Differential gene expression analysis can be used to
identify a nucleic acid sequence that modulates the expression of a
target nucleic acid in a cell. Alterations in gene expression
induced by gene silencing can be monitored in a cell into which a
dsRNA has been introduced. For example, differential gene
expression can be assayed by comparing nucleic acids expressed in
cells into which dsRNA has been introduced to nucleic acids
expressed in control cells that were not transfected with dsRNA or
that were mock-transfected. Gene array technology can be used in
order to simultaneously examine the expression levels of many
different nucleic acids. Examples of methods for such expression
analysis are described by Marrack et al. (Current Opinions in
Immunology 12:206-209, 2000); Harkin (Oncologist 5:501-507, 2000);
Pelizzari et al. (Nucleic Acids Res. 28:4577-4581, 2000); and Marx
(Science 289:1670-1672, 2000).
[0174] Identification of Genes by Assaying Polypeptide Biological
Activity
[0175] Novel nucleic acid sequences that modulate the biological
activity of a target polypeptide can also be identified by
examining polypeptide biological activity. Various polypeptide
biological activities can be evaluated to identify novel genes
according to the methods of the invention. For example, the
expression of a target polypeptide(s) may be examined.
Alternatively, the interaction between a target polypeptide(s) and
another molecule(s), for example, another polypeptide or a nucleic
acid may be assayed. Phosphorylation or glycosylation of a target
polypeptide(s) may also be assessed, using standard methods known
to those skilled in the art.
[0176] Identification of nucleic acid sequences involved in
modulating the biological activity of a target polypeptide may be
carried out by comparing the polypeptide biological activity of a
cell transfected with a dsRNA to a control cell that has not been
transfected with a dsRNA or that has been mock-transfected. A cell
that has taken up sequences unrelated to a particular polypeptide
biological activity will perform in the particular assay in a
manner similar to the control cell. A cell experiencing PTGS of a
gene involved in the particular polypeptide biological activity
will exhibit an altered ability to perform in the biological assay,
compared to the control.
[0177] Insertion of Single Units into the Chromosome and Generation
of a Cell Line Containing a Single DsRNA Expression Library
Integrant
[0178] If desired, the following methods can be used to generate a
cell line in which only one construct encoding a dsRNA (e.g., a
long dsRNA) is integrated. These methods may be used to integrate a
construct that encodes a candidate dsRNA that may be homologous to
a target gene of interest. The construct may also encode a short
dsRNA for the inhibition of dsRNA-mediated toxicity. Alternatively,
one or more short dsRNA molecules or constructs encoding a short
dsRNA may be administered to the cell before, during, or after the
administration of the construct encoding the candidate dsRNA.
[0179] These methods involve the generation of a target cell line
in which the dsRNA expression library is subsequently introduced.
Through the use of site-specific recombination, single integrants
of dsRNA expression cassettes are generated at the same locus of
all cells in the target cell line, allowing uniform expression of
the dsRNA in all of the integrants. A dsRNA expression library
derived from various cell lines is used to create a representative
library of stably integrated cells, each cell within the target
cell line containing a single integrant. Cre/lox, Lambda-Cro
repressor, and Flp recombinase systems or retroviruses are used to
generate these singular integrants of dsRNA expression cassettes in
the target cell line (Satoh et al., J. Virol. 74:10631-10638, 2000;
Trinh et al., J. Immunol. Methods 244:185-193, 2000; Serov et al.,
An. Acad. Bras. Cienc. 72:389-398, 2000; Grez et al., Stem Cells.
16:235-243, 1998; Habu et al., Nucleic Acids Symp. Ser. 42:295-296,
1999; Haren et al., Annu. Rev. Microbiol. 53:245-281, 1999; Baer et
al., Biochemistry 39:7041-7049, 2000; Follenzi et al., Nat. Genet.
25:217-222, 2000; Hindmarsh et al., Microbiol. Mol. Biol. Rev.
63:836-843, 1999; Darquet et al., Gene Ther. 6:209-218, 1999;
Darquet et al., Gene Ther. 6:209-218, 1999; Yu et al., Gene
223:77-81, 1998; Darquet et al., Gene Ther. 4:1341-1349, 1997; and
Koch et al., Gene 249:135-144, 2000). These systems are used
singularly to generate singular insertion clones, and also in
combination.
[0180] The following exemplary sequence specific integrative
systems use short target sequences that allow targeted
recombination to be achieved using specific proteins: FLP
recombinase, bacteriophage Lambda integrase, HIV integrase, and
pilin recombinase of Salmonella (Seng et al. Construction of a Flp
"exchange cassette" contained vector and gene targeting in mouse ES
cell] A book chapter PUBMED entry 11797223--Sheng Wu Gong Cheng Xue
Bao. 2001 September;17(5):566-9., Liu et al., Nat Genet. 2001 Jan.
1;30(1):66-72., Awatramani et al., Nat Genet. 2001
November;29(3):257-9., Heidmann and Lehner, Dev Genes Evol. 2001
September;211(8-9):458-65, Schaft et al., Genesis. 2001
September;31(1):6-10, Van Duyne, Annu Rev Biophys Biomol Struct.
2001;30:87-104., Lorbach et al., J Mol Biol. 2000 Mar.
10;296(5):1175-81., Darquet et al., Gene Ther. 1999
February;6(2):209-18., Bushman and Miller, J Virol. 1997
January;71(1):458-64., Fulks et al., J Bacteriol. 1990
January;172(1):310-6). A singular integrant is produced by randomly
inserting the specific sequence (e.g., loxP in the cre recombinase
system) and selecting or identifying the cell that contains a
singular integrant that supports maximal expression. For example,
integrants that show maximal expression following random
integration can be identified through the use of reporter gene
sequences associated with the integrated sequence. The cell can be
used to specifically insert the expression cassette into the site
that contains the target sequence using the specific recombinase,
and possibly also remove the expression cassette that was
originally placed to identify the maximally expressing chromosomal
location. A skilled artisan can also produce singular integrants
using retroviral vectors, which integrate randomly and singularly
into the eukaryotic genome. In particular, singular integrants can
be produced by inserting retroviral vectors that have been
engineered to contain the desired expression cassette into a nave
cell and selecting for the chromosomal location that results in
maximal expression (Michael et al., EMBO Journal, vol 20: pages
2224-2235, 2001; Reik and Murrell., Nature, vol. 405, page 408-409,
2000; Berger et al., Molecular Cell, vol. 8, pages 263-268). One
may also produce a singular integrant by cotransfecting the
bacterial RecA protein with or without nuclear localization signal
along with sequences that are homologous to the target sequence
(e.g., a target endogenous sequence or integrated transgene
sequence). Alternatively, a nucleic acid sequence that encodes a
RecA protein with nuclear localization signals can be cotransfected
(Shibata et al., Proc Natl Acad Sci USA. 2001 Jul.
17;98(15):8425-32. Review., Muyrers et al., Trends Biochem Sci.
2001 May;26(5):325-31., Paul et al., Mutat Res. 2001 Jun. 5;486(1):
11-9., Shcherbakova et al., Mutat Res. 2000 Feb. 16;459(1):65-71.,
Lantsov. Mol Biol (Mosk). 1994 May-June;28(3):485-95).
[0181] An example utilizing such methods is detailed below.
[0182] Creation of the Target Cell Line
[0183] Target cell lines are the same cell lines as the ones from
which the dsRNA expression libraries will be derived. Target cells
are created by transfecting the selected cell line with a
bicistronic plasmid expressing a selectable marker, such as G418
and the reporter gene GFP. The plasmid also bears a loxP site.
Plasmids integrate randomly into the chromosome through the process
of illegitimate recombination at a frequency of 10.sup.-4.
Following transfection, cells containing integrants are selected by
culturing the cells in the presence of G418 at a concentration
determined earlier in a kill curve analysis. About a dozen
G418-resistant colonies are expanded and relative GFP expression
levels are determined using flow cytometry. DNA from the cells is
analyzed by Southern blot analysis to determine integrant copy
number. Several single copy integrants exhibiting the highest GFP
expression levels are then selected as the target cell lines. GFP
expression is monitored because dsRNA encoding templates are then
integrated into the loci containing the loxP, GFP, and G418
cassettes in a site-specific fashion, and it is important to ensure
that these loci are transcriptionally active. Since cells are
selected on the basis of G418 resistance and GFP expression,
integration of the plasmid DNA can occur at the loxP site,
destroying its function. Several cell lines are therefore chosen to
reasonably ensure that at least one integrant has an intact loxP
site.
[0184] dsRNA Expression Library Construction and Site-Specific
Recombination into the Target Cell Line
[0185] A cDNA library or a randomized library is constructed from
RNA isolated from selected cell lines. cDNAs or randomized nucleic
acids in the size range of at least 100 to 1000 nucleotides, for
example, 500 to 600 nucleotides are optimized during synthesis or
are size-selected prior to cloning. In other embodiments, the
nucleic acids are at least 10, 20, 30, 40, 50, 60, 70, 80, or 90
nucleotides in length. In yet other embodiments, the number of
nucleotides in the nucleic acids is between 5-100 nucleotides,
15-100 nucleotides, 20-95 nucleotides, 25-90 nucleotides, 35-85
nucleotides, 45-80 nucleotides, 50-75 nucleotides, or 55-70
nucleotides, inclusive. In still other embodiments, the number of
nucleotides in the nucleic acids is contained in one of the
following ranges: 5-15 nucleotides, 15-20 nucleotides, 20-25
nucleotides, 25-35 nucleotides, 35-45 nucleotides, 45-60
nucleotides, 60-70 nucleotides, 70-80 nucleotides, 80-90
nucleotides, or 90-100 nucleotides, inclusive. In other
embodiments, the nucleic acid contains less than 50,000; 10,000;
5,000; or 2,000 nucleotides. Each cDNA or randomized nucleic acid
is then cloned into a plasmid vector as a dsRNA transcription
cassette flanked by two convergent promoters (such as T7 promoters
as described herein). The promoters are transcriptionally regulated
such that they are off until induced, for example, using a tet
ON/OFF system (Forster et al., Nucleic Acids Res. 27:7708-710,
1999; Liu et al., Biotechniques 24:624-628, 6,30-632, 1998; and
Gatz, Methods Cell Biol. 50:411-424, 1995). The plasmid also
contains the hygromycin resistance gene and an inverted loxP site.
The cDNA plasmid library or randomized plasmid library is then
co-transfected into the target cell line with a plasmid expressing
Cre recombinase, which catalyzes site-specific recombination of the
transfected cDNA plasmid or randomized nucleic acid plasmid at the
inverted loxP site into the chromosomal locus containing the GFP
gene and loxP site (see FIG. 1). The use of the Cre/lox system
allows the efficient integration of a plasmid into the chromosome
(every transfected cell is predicted to undergo a plasmid
integration event). Other site-specific recombination strategies
can also be utilized. This results in having every integration to
occur at the same site, thereby obviating potential problems with
loci dependent expression.
[0186] Two days following transfection, cells are incubated in the
presence of hygromycin to kill untransfected cells and to select
for stable integrants. Transcription of dsRNA is induced, and
selected cells are assayed for an alteration in cell function, the
biological activity of a target polypeptide, or differential gene
expression. Cells expressing dsRNA corresponding to a target
nucleic acid exhibit an altered function, for example, increased or
decreased cell invasion, motility, apoptosis, growth,
differentiation, dedifferentiation, or regeneration, or the ability
of the cell to support viral replication. Cells exhibiting altered
function are then expanded and the sequence of the integrant is
determined. Targets are identified and validated using dsRNA
specific for the identified target, or other non-PTGS mediated
methods, for example antisense technology.
[0187] The regulated transcription system of the present invention
provides an advantage to other double stranded expression systems.
Following transfection of the dsRNA library, cells contain hundreds
to thousands of dsRNA expression cassettes, with concomitant
expression of that many expression cassettes. In the dsRNA
expression system of the present invention, dsRNA expression
cassettes contained within the expression vector integrate into the
chromosome of the transfected cell. As described in detail below,
every transfected cell integrates one of the double stranded
expression cassettes. Desirably no transcription occurs until the
episomal (non-integrated) expression vectors are diluted out of the
cell such that not more than 5 episomal vectors remain in the cell.
Most desirably no transcription occurs until all of the episomal
(non-integrated) expression vectors are diluted out of the cell and
only the integrated expression cassette remains (a process usually
taking about two to several weeks of cell culture). At this time
transcription is induced, allowing dsRNA to be expressed in the
cells. This method ensures that only one species of candidate dsRNA
is expressed per cell, as opposed to other methods that express
hundreds to thousands of double stranded species. The use of the
above-described system results in the loss of all but one
expression cassette, which in turn, permits the rapid screening of
libraries without requiring screening multiple pools of libraries
to identify the target gene.
EXAMPLE 6
Design and Delivery of Vectors for Intracellular Synthesis of DsRNA
for Library Based Screening Approaches to Nucleic Acid
Identification Using PTGS
[0188] The library based screening approaches to nucleic acid
identification may induce even less toxicity or adverse
side-effects when dsRNA resides in certain cellular compartments.
Therefore, expression plasmids that transcribe candidate and/or
short dsRNA in the cytoplasm and in the nucleus may be utilized.
There are two classes of nuclear transcription vectors: one that is
designed to express polyadenylated dsRNA (for example, a vector
containing an RNA polymerase II promoter and a poly A site) and one
that expresses non-adenylated dsRNA (for example, a vector
containing an RNA polymerase II promoter and no poly A site, or a
vector containing a T7 promoter). Different cellular distributions
are predicted for the two species of RNA; both vectors are
transcribed in the nucleus, but the ultimate destinations of the
RNA species are different intracellular locations. Intracellular
transcription may also utilize bacteriophage T7 and SP6 RNA
polymerase, which may be designed to transcribe in the cytoplasm or
in the nucleus. Alternatively, Qbeta replicase RNA-dependent RNA
polymerase may be used to amplify dsRNA. Viral RNA polymerases,
either DNA and RNA dependent, may also be used. Alternatively,
dsRNA replicating polymerases can be used. Cellular polymerases
such as RNA Polymerase I, II, or III or mitochondrial RNA
polymerase may also be utilized. Both the cytoplasmic and nuclear
transcription vectors contain an antibiotic resistance gene to
enable selection of cells that have taken up the plasmid. Cloning
strategies employ chain reaction cloning (CRC), a one-step method
for directional ligation of multiple fragments (Pachuk et al., Gene
243:19-25, 2000). Briefly, the ligations utilize bridge
oligonucleotides to align the DNA fragments in a particular order
and ligation is catalyzed by a heat-stable DNA ligase, such as
Ampligase, available from Epicentre.
[0189] Inducible or Repressible Transcription Vectors for the
Generation of a DsRNA Expression Library
[0190] If desired, inducible and repressible transcription systems
can be used to control the timing of the synthesis of dsRNA. For
example, synthesis of candidate dsRNA molecules can be induced
after synthesis or administration of short dsRNA which is intended
to prevent possible toxic effects due to the candidate dsRNA.
Inducible and repressible regulatory systems involve the use of
promoter elements that contain sequences that bind prokaryotic or
eukaryotic transcription factors upstream of the sequence encoding
dsRNA. In addition, these factors also carry protein domains that
transactivate or transrepress the RNA polymerase II. The regulatory
system also has the ability to bind a small molecule (e.g., a
coinducer or a corepressor). The binding of the small molecule to
the regulatory protein molecule (e.g., a transcription factor)
results in either increased or decreased affinity for the sequence
element. Both inducible and repressible systems can be developed
using any of the inducer/transcription factor combinations by
positioning the binding site appropriately with respect to the
promoter sequence. Examples of previously described
inducible/repressible systems include lacI, ara, Steroid-RU486, and
ecdysone--Rheogene, Lac (Cronin et al. Genes & Development 15:
1506-1517, 2001), ara (Khlebnikov et al., J Bacteriol. 2000
December;182(24):7029-34), ecdysone (Rheogene, www.rheogene.com),
RU48 (steroid, Wang X J, Liefer K M, Tsai S, O'Malley B W, Roop D
R., Proc Natl Acad Sci USA. 1999 Jul. 20;96(15):8483-8), tet
promoter (Rendal et al., Hum Gene Ther. 2002 January;13(2):335-42.
and Larnartina et al., Hum Gene Ther. 2002 January;13(2):199-210),
or a promoter disclosed in WO 00/63364, filed Apr. 19, 2000.
[0191] Nuclear Transcription Vectors for the Generation of a
Nuclear DsRNA Expression Library
[0192] Nuclear transcription vectors for use in library based
screening approaches to identify nucleic acids that modulate cell
function, gene expression, or the biological activity of a target
polypeptide are designed such that the target sequence is flanked
on one end by an RNA polymerase II promoter (for example, the
HCMV-IE promoter) and on the other end by a different RNA
polymerase II promoter (for example, the SCMV promoter). Other
promoters that can be used include other RNA polymerase II
promoters, an RNA polymerase I promoter, an RNA polymerase III
promoter, a mitochondrial RNA polymerase promoter, or a T7 or SP6
promoter in the presence of T7 or SP6 RNA polymerase, respectively,
containing a nuclear localization signal. Bacteriophage or viral
promoters may also be used. The promoters are regulated
transcriptionally (for example, using a tet ON/OFF system (Forster
et al., supra; Liu et al., supra; and Gatz, supra) such that they
are only active in either the presence of a transcription-inducing
agent or upon the removal of a repressor. A single chromosomal
integrant is selected for, and transcription is induced in the cell
to produce the nuclear dsRNA.
[0193] Those vectors containing a promoter recognized by RNA Pol I,
RNA Pol II, or a viral promoter in conjunction with co-expressed
proteins that recognize the viral promoter, may also contain
optional sequences located between each promoter and the inserted
cDNA. These sequences are transcribed and are designed to prevent
the possible translation of a transcribed cDNA. For example, the
transcribed RNA is synthesized to contain a stable stem-loop
structure at the 5' end to impede ribosome scanning. Alternatively,
the exact sequence is irrelevant as long as the length of the
sequence is sufficient to be detrimental to translation initiation
(e.g., the sequence is 200 nucleotides or longer). The RNA
sequences can optionally have sequences that allow polyA addition,
intronic sequences, an HIV REV binding sequence, Mason-Pfizer
monkey virus constitutive transport element (CTE) (U.S. Pat. No.
5,880,276, filed Apr. 25, 1996), and/or self splicing intronic
sequences.
[0194] To generate dsRNA, two promoters can be placed on either
side of the target sequence, such that the direction of
transcription from each promoter is opposing each other.
Alternatively, two plasmids can be cotransfected. One of the
plasmids is designed to transcribe one strand of the target
sequence while the other is designed to transcribe the other
strand. Single promoter constructs may be developed such that two
units of the target sequence are transcribed in tandem, such that
the second unit is in the reverse orientation with respect to the
other. Alternate strategies include the use of filler sequences
between the tandem target sequences.
[0195] Cytoplasmic Transcription Vectors for the Generation of a
Cytoplasmic DsRNA Expression Library
[0196] Cytoplasmic transcription vectors for use in library based
screening approaches to identifying nucleic acids that modulate
cell function, gene expression, or the biological activity of a
target polypeptide in a cell using PTGS are made according to the
following method. This approach involves the transcription of a
single stranded RNA template (derived from a library) in the
nucleus, which is then transported into the cytoplasm where it
serves as a template for the transcription of dsRNA molecules. The
DNA encoding the ssRNA is integrated at a single site in the target
cell line as described for the nuclear RNA expression library,
thereby ensuring the synthesis of only one species of candidate
dsRNA in a cell, each cell expressing a different dsRNA
species.
[0197] A desirable approach is to use endogenous polymerases such
as the mitochondrial polymerase in animal cells or mitochondrial
and chloroplast polymerases in plant cells for cytoplasmic and
mitochondrial (e.g., chloroplast) expression to make dsRNA in the
cytoplasm. These vectors are formed by designing expression
constructs that contain mitochondrial or chloroplast promoters
upstream of the target sequence. As described above for nuclear
transcription vectors, dsRNA can be generated using two such
promoters placed on either side of the target sequence, such that
the direction of transcription from each promoter is opposing each
other. Alternatively, two plasmids can be cotransfected. One of the
plasmids is designed to transcribe one strand of the target
sequence while the other is designed to transcribe the other
strand. Single promoter constructs may be developed such that two
units of the target sequence are transcribed in tandem, such that
the second unit is in the reverse orientation with respect to the
other. Alternate strategies include the use of filler sequences
between the tandem target sequences.
[0198] Alternatively, cytoplasmic expression of dsRNA for use in
library based screening approaches is achieved by a single
subgenomic promoter opposite in orientation with respect to the
nuclear promoter. The nuclear promoter generates one RNA strand
that is transported into the cytoplasm, and the singular subgenomic
promoter at the 3' end of the transcript is sufficient to generate
its antisense copy by an RNA dependent RNA polymerase to result in
a cytoplasmic dsRNA species.
[0199] Target Cell Line Development for Use with Cytoplasmic DsRNA
Expression Libraries
[0200] The target cell line, using the vector containing the G418
cassette, GFP, and loxP site is designed as described above.
[0201] Development of a Cytoplasmic DsRNA Expression Library
[0202] DsRNA expression libraries are generated by inserting cDNA
or randomized sequences (as described herein) into an expression
vector containing a single nuclear promoter (RNA polymerase I, RNA
polymerase II, or RNA polymerase III), which allows transcription
of the insert sequence. It is desirable that this nuclear promoter
activity is regulated transcriptionally (for example, using a tet
ON/OFF system described, for example, by Forster et al, supra; Liu
et al., supra; and Gatz, supra), such that the promoters are only
active in either the presence of a transcription-inducing agent or
upon the removal of a repressor. This ensures that transcription is
not induced until episomal copies of the vector(s) are diluted out.
Vectors also contain a selectable marker, such as the hygromycin
resistance gene, and a loxP site. The expression vectors are
integrated into the target cell line by methods previously
described in this application using Cre recombinase (other
site-specific recombinative strategies can be employed, as
described previously).
[0203] At two days post-transfection, cells are subjected to
hygromycin selection using concentrations established in kill curve
assays. Surviving cells are cultured in hygromycin to select for
cells bearing integrated vectors and to dilute out episomal copies
of the vector(s). At this point transcription is induced, and a
single stranded RNA (ssRNA) species derived from the insert
sequence is transcribed in the nucleus from the nuclear promoter in
the inserted vector. The insert is designed such that the insert
sequences in the transcript are flanked by bi-directional promoters
of RNA bacteriophages (for example, Qbeta or MS2, RNA dependent RNA
polymerase promoters) or cytoplasmic viral RNA-dependent RNA
polymerase promoter sequences (for example, those of Sindbis or
VEEV subgenomic promoters). The nuclear transcript is translocated
to the cytoplasm where it acts as a template for dsRNA by an RNA
dependent RNA polymerase, which may be provided through
co-transfection of a vector that encodes an RNA-dependent RNA
polymerase. Alternatively, an integrated copy of the polymerase may
be used.
EXAMPLE 7
Non-Library Approaches for the Identification of a Nucleic Acid
Sequence that Modulates Cell Function, Cellular Gene Expression, or
Biological Activity of a Target Polypeptide
[0204] Nucleic acid sequences that modulate cell function, gene
expression in a cell, or the biological activity of a target
polypeptide in a cell may also be identified using non-library
based approaches involving PTGS. For example, a single known
nucleic acid sequence encoding a polypeptide with unknown function
or a single nucleic acid fragment of unknown sequence and/or
function can be made into a "candidate" dsRNA molecule. This
candidate dsRNA is then transfected into a desired cell type. A
short dsRNA or a nucleic acid encoding a short dsRNA is also
administered to prevent toxicity. The cell is assayed for
modulations in cell function, gene expression of a target nucleic
acid in the cell, or the biological activity of a target
polypeptide in the cell, using methods described herein. A
modulation in cell function, gene expression in the cell, or the
biological activity of a target polypeptide in the cell identifies
the nucleic acid of the candidate dsRNA as a nucleic acid the
modulates the specific cell function, gene expression, or the
biological activity of a target polypeptide. As a single candidate
dsRNA species is transfected into the cells, the nucleic acid
sequence responsible for the modulation is readily identified.
[0205] The discovery of novel genes through the methods of the
present invention may lead to the generation of novel therapeutics.
For example, genes that decrease cell invasion may be used as
targets for drug development, such as for the development of
cytostatic therapeutics for use in the treatment of cancer.
Development of such therapeutics is important because currently
available cytotoxic anticancer agents are also toxic for normal
rapidly dividing cells. In contrast, a cytostatic agent may only
need to check metastatic processes, and by inference, slow cell
growth, in order to stabilize the disease. In another example,
genes that increase neuronal regeneration may be used to develop
therapeutics for the treatment, prevention, or control of a number
of neurological diseases, including Alzheimer's disease and
Parkinson's disease. Genes that are involved in the ability to
support viral replication and be used as targets in anti-viral
therapies. Such therapies may be used to treat, prevent, or control
viral diseases involving human immunodeficiency virus (HIV),
hepatitis C virus (HCV), hepatitis B virus (HBV), and human
papillomavirus (HPV). The efficacies of therapeutics targeting the
genes identified according to the present invention can be further
tested in cell culture assays, as well as in animal models.
[0206] Generation of Templates for In Vitro Transcription of DsRNA
for Non-Library Based Approaches for Identification of Nucleic
Acids Using PTGS
[0207] Nucleic acid fragments generated, for example, by PCR or
restriction endonuclease digestion, encoding the respective target
sequences were used as templates for in vitro transcription
reactions. PCR fragments are superior to plasmid templates for the
synthesis of discrete sized RNA molecules. The PCR fragments
encoded at least 20-50 or 100 to 1000, for example, 500 to 600
nucleotides (nts) of the target sequence and were derived from the
target mRNA. Known target sequences may be obtained from GenBank
and or other DNA sequence databases. Target sequences may also be
obtained from cellular RNA molecules that were generated into cDNAs
to create a number of different dsRNA molecules. Accordingly, it is
possible that the sequence and/or function of the target sequence
is not known at the time the dsRNA is generated.
[0208] Templates for sense target RNA molecules are generated by
placing the bacteriophage T7 promoter at the 5' end of the target
coding strand while antisense RNA templates contained the T7
promoter at the 5' end of the non-coding strand. This was achieved
by encoding the T7 promoter at the 5' ends of the respective PCR
primers. Alternatively SP6 promoters, or a combination of SP6 and
T7 promoters may be used.
[0209] PCR is performed by conventional methods. The use of both
PCR templates in equimolar amounts in an in vitro transcription
reaction resulted in primarily dsRNA. The use of two separate
fragments has been found to be superior to the use of one PCR
fragment containing two T7 promoters, one located at each end of
the target sequence, presumably due to transcription interference
that occurs during transcription of the dual promoter template.
Following PCR amplification, the DNA is subjected to Proteinase K
digestion and phenol-chloroform extraction to remove contaminating
RNases. Following ethanol precipitation, the DNA is resuspended in
RNase-free water at a concentration of 1 to 3 .mu.g/.mu.l.
[0210] As an alternative to phenol-chloroform extraction, DNA can
be purified in the absence of phenol using standard methods such as
those described by Li et al. (WO 00/44914, filed Jan. 28, 2000).
Alternatively, DNA that is extracted with phenol and/or chloroform
can be purified to reduce or eliminate the amount of phenol and/or
chloroform. For example, standard column chromatography can be used
to purify the DNA (WO 00/44914, filed Jan. 28, 2000).
[0211] Cytoplasmic Transcription Vectors for Non-Library Based
Approaches to Nucleic Acid Identification Using PTGS
[0212] DsRNA molecules for use in non-library based methods for the
identification of nucleic acids that modulate cell function, gene
expression of a target nuclec acid, or target polypeptide
biological activity in a cell can also be generated through the use
of cytoplasmic transcription vectors. Such vectors are generated as
now described.
[0213] The PCR fragments generated for in vitro transcription
templates, as described above, are inserted into a cloning vector
containing one T7 promoter located just outside the polylinker
region. Such a vector is pZERO blunt (Promega Corp.). The PCR
fragment is cloned into a restriction site in the polylinker in
such a way that the fragment's T7 promoter is distal to the
vector's promoter. The resulting vector contains the target
sequence flanked by two T7 promoters; transcription from this
vector occurs in converging directions. Convergent transcription is
desired for these intracellular vectors, due to the uncertainty of
getting sense and antisense vectors into the same cell in high
enough and roughly equivalent amounts. In addition, the local
concentration of antisense and sense RNA molecules with respect to
each other is high enough to enable dsRNA formation when the dual
promoter construct is used.
[0214] A hygromycin resistance cassette is cloned into the pZERO
blunt vector as well. The hygromycin resistance cassette contains
the hygromycin resistance gene under the control of the Herpes
Simplex Virus (HSV) thymidine kinase promoter and the SV40
polyadenlyation signal. The cassette is in a plasmid vector and is
flanked at both ends by a polylinker region enabling ease of
removal and subsequent cloning. Hygromycin selection was chosen
because of the rapidity of death induced by hygromycin as well as
extensive in-house experience with hygromycin selection.
Alternatively, other selection methods known to those skilled in
the art may be used.
[0215] The vectors are transfected into the desired cells using
standard transformation or transfection techniques described
herein, and the cells are assayed for the ability of the dsRNA
molecules encoded by the vectors to modulate cell function, gene
expression of a target nuclec acid, or the biological activity of a
target polypeptide, as described herein.
EXAMPLE 8
Analysis of RNA from Transfected Cells
[0216] Regardless of whether a library based screening approach or
a non-library based approach was used to identify nucleic acid
sequences, in order to measure the level of dsRNA effector molecule
within the cell, as well as the amount of target mRNA within the
cell, a two-step reverse transcription PCR reaction is performed
with the ABI PRISM.TM. 7700 Sequence Detection System. Total RNA is
extracted from cells transfected with dsRNA or a plasmid from a
dsRNA expression library using Trizol and DNase. Two to three
different cDNA synthesis reactions are performed per sample; one
for human GAPDH (a housekeeping gene that should be unaffected by
the effector dsRNA), one for the target mRNA, and/or one for the
sense strand of the expected dsRNA molecule (effector molecule).
Prior to cDNA synthesis of dsRNA sense strands, the RNA sample is
treated with T1 RNase. The cDNA reactions are performed in separate
tubes using 200 ng of total RNA and primers specific for the
relevant RNA molecules. The cDNA products of these reactions are
used as templates for subsequent PCR reactions to amplify GAPDH,
the target cDNA, and/or the sense strand copied from the dsRNA. All
RNA are quantified relative to the internal control, GAPDH.
EXAMPLE 9
Target Sequence Identification
[0217] To identify the target sequence affected by a dsRNA, using
any of the above-described methods, DNA is extracted from expanded
cell lines (or from the transfected cells if using a
non-integrating dsRNA system) according to methods well known to
the skilled artisan. The dsRNA encoding sequence of each integrant
(or non-integrated dsRNA molecule if using a non-library based
method) is amplified by PCR using primers containing the sequence
mapping to the top strand of the T7 promoter (or any other promoter
used to express the dsRNA). Amplified DNA is then cloned into a
cloning vector, such as pZERO blunt (Promega Corp.), and then
sequenced. Sequences are compared to sequences in GenBank and/or
other DNA databases to look for sequence identity or homology using
standard computer programs. If the target mRNA remains unknown, the
mRNA is cloned from the target cell line using primers derived from
the cloned dsRNA by established techniques (Sambrook et al.,
supra). Target validation is then carried out as described
herein.
[0218] In the stably integrated dsRNA expression system described
above, despite efforts to reduce negative position effects,
inefficient dsRNA synthesis by PCR methods may occur. This can be
circumvented by rescuing the integrated cDNA or randomized nucleic
sequences into replicating plasmids. Rescued plasmids are amenable
to amplification in bacteria and to sequencing. Rescue is achieved
by re-transfecting the population of cells transfected with the
dsRNA expression library with the rescue plasmid and a plasmid
encoding Cre recombinase. The rescue plasmid carries a bacterial
origin of replication, a bacterial antibiotic selection marker, an
SV40 origin of replication, and an SV40 T antigen expression
cassette, as well as loxP sites positioned as an inverted repeat to
allow Cre-mediated double recombination. The SV40-based origin of
replication in the rescue plasmid allows amplification of rescued
sequences in the integrated cells. Following rescue, higher levels
of transcription are anticipated, thereby favoring dsRNA formation.
The cells are then screened for modulations in cell function,
target nucleic acid expression, or target polypeptide biological
activity changes as described herein.
EXAMPLE 10
Functional Screening for Cell Invasion
[0219] Cell invasion is one cell function that may be evaluated in
the search for novel genes that are modulated using the methods
described herein. Matrigel, a biological extracellular matrix, has
properties similar to that of a reconstituted basement membrane and
has been used to measure the invasive potential of tumor cells
(Platet and Garcia, supra). Cells transfected with randomized or
cDNA libraries that have been cloned into PTGS vectors are
monitored for their capacity to invade matrigel invasion chambers.
Cells that have taken up sequences unrelated to invasion invade the
matrigel as efficiently as vector-transfected control cells. Cells
experiencing PTGS of genes that are involved in cell invasion
invade much less efficiently. If the dsRNA expression cassette is
stably integrated in a chromosome, these cells are retrieved and
second and third rounds of selection are carried out in order to
isolate specific nucleic acid sequences relevant to cell invasion.
The effect of these sequences on invasion is ultimately confirmed
by their ability to block the formation of tumors in animal
models.
[0220] Several human cell lines, for example, MDA-MB-231, used by
Platet and Garcia (supra), SKBr3, and MCF-7ADR, a more metastatic
variant of MCF-7. MDA-MB-231 breast cancer cells (obtained from the
American Type Culture Collection) are also transfected with cDNA
libraries or randomized nucleic acid libraries constructed into the
vectors described above. The cells are also transfected with a
short dsRNA or a vector encoding a short dsRNA to inhibit toxicity.
Desirably all cells in this assay contain express a single copy of
a candidate dsRNA, as described above.
[0221] Cells cultured in commercially available 24- or 96-well
formatted systems are used to carry out the cell invasion assay. As
this screening protocol relies upon repeated rounds of selection,
it may be desirable to keep the cell numbers in each well low
enough that enrichment is seen in each succeeding round, yet high
enough to recover sufficient cells to culture within a reasonable
time period. Therefore, culture conditions that result in invasion
by greater than 50% of the cells and that still permit recovery
from the surface of the matrigel are made optimal. Non-invasive
(NIH3T3 cells) or poorly invasive (MCF7) cell lines are analyzed in
parallel as negative controls for invasion.
[0222] Initially, triplicate cultures of half-log order dilutions
from 10.sup.2 to 10.sup.6 cells per well are plated. Cells are then
recovered by "scrubbing" with a sterile cotton swab in fresh
culture media and are seeded into 96-well plates. The number of
invasive cells in the matrigel is quantified using either an
MTT-based assay (Sasaki and Passaniti, Biotechniques 24:1038-1043,
1998) or a fluorescent indicator (Gohla et al., Clin. Exp.
Metastasis 14:451-458, 1996).
[0223] Once the appropriate cell densities for the assay have been
empirically determined, stable transfected cells are plated in the
matrigel cell invasion chambers. Each experiment includes the
following controls: a sample of untransfected cells as a reference
culture; untransfected cells treated with anti-invasive
chemotherapeutic agents, such as taxol or doxorubicin, as a
positive control for inhibition of invasion; cells transfected with
empty vectors to confirm that the vector alone had no effects on
invasion; and cells transfected cells with genes that are known to
block invasion in this assay, such as estrogen receptor-.alpha. or
TIMP-2 (Kohn et al., Cancer Research 55:1856-1862, 1995; and
Woodhouse et al., Cancer (Supplement) 80:1529-1536, 1997).
[0224] Cells that fail to invade the matrigel are removed from each
well to the corresponding wells of a 96-well plate and cultured
until macroscopic colonies are visible. It is important to collect
cells at more than one time point after plating, since the time it
takes for PTGS to be effective may vary, and it may be that
different genes are active at different times after plating. Once
the cells are transferred to 96-well plates, they are diluted out
and taken through successive rounds of re-screening in the invasion
assay in order to expand and isolate cell lines with altered
invasive ability. As the population becomes more and more enriched
for cells with a non-invasive phenotype, the reduction in invasive
cells in the matrigel can be better quantified via MTT or
fluorescence assays. Ultimately, a large panel of cloned
double-stable cell lines is generated.
[0225] This assay can also be carried out with cells into which a
dsRNA is not stably integrated into a chromosome. The assay is
conducted essentially as described above except that multiple
rounds of selection and re-screening are not necessary since the
cell is transfected with only one candidate dsRNA species. Thus,
the target(s) of the PTGS event is readily identifiable using the
cloning and sequencing techniques described above.
EXAMPLE 11
Assays to Measure Induction of an RNA Stress Response
[0226] If desired any of the standard methods listed below may be
performed to measure the ability of short dsRNA to inhibit
dsRNA-mediated toxicity.
[0227] Assays Performed to Identify RNA Stress Response
Induction
[0228] The following assays may be performed to measure the
induction of an RNA stress response: TUNEL assay to detect
apoptotic cells, ELISA assays to detect the induction of alpha,
beta and gamma interferon, ribosomal RNA fragmentation analysis to
detect activation of 2'5'OAS, measurement of phosphorylated eIF2a
as an indicator of PKR (protein kinase RNA inducible) activation,
proliferation assays to detect changes in cellular proliferation,
and microscopic analysis of cells to identify cellular cytopathic
effects. Apoptosis, interferon induction, 2'5' OAS activation, PKR
activation, anti-proliferative responses, and cytopathic effects
are all indicators for the RNA stress response pathway.
[0229] ELISA Assays
[0230] Alpha and beta interferon induction are associated with
induction of the RNA stress response. Supernatants are removed from
the transfected and untreated cells at time points of 1, 2, 7, 17,
and 48 hours and every several days for up to one month after the
48 hour time point. Collected supernatants are stored at
-80.degree. C. until they are analyzed for the presence of alpha,
beta, and gamma interferon using commercially available ELISA kits.
The Interferon-alpha ELISA kit is obtained from ENDOGEN (Rockford,
Ill.), the Interferon-Beta ELISA kit is obtained from RD1
(Flanders, N.J.), and the Interferon-gamma ELISA kit is obtained
from R&D Systems (Minneapolois, Minn.). ELISAs are all
performed according to the manufacturer's directions. Alpha, beta,
and gamma interferon are desirably not detected at increased levels
in cells expressing intracellular dsRNA compared to the
corresponding levels in untreated cells. In contrast, considerable
levels of beta interferon have been found in cells transfected with
poly (I)(C) or with in vitro transcribed dsRNA and ssRNA.
[0231] TUNEL Assay
[0232] Apoptosis is an end result of the induction of the RNA
stress response pathway. Cells are stained for the presence of
apoptotic nuclei using a commercially available kit, TdT FragEL,
DNA Fragmentation Detection Kit, In Situ Apoptosis Assay from
Oncogene (Boston, Mass.). Cells are stained according the
manufacturer's directions. Cells are stained at for example, 2
hours, 7 hours, 17 hours, 2 days, 3 days, 4 days, and 5 days after
transfection. Desirably, there is little or no evidence of
apoptosis induced dsRNA at any of the time points analyzed.
[0233] 2'5'OAS Activation
[0234] 2'5'OAS activation is associated with induction/activation
of the RNA stress response pathway. The activation of 2'5'OAS is
determined by performing ribosomal RNA fragmentation analysis.
Briefly, following transfection, total RNA is extracted from cells
using standard procedures. RNA is extracted at the following time
points: 2 hours, 7 hours, 17 hours, 48 hours, 3 days, 4 days, and 5
days after transfection. 5-10 .mu.g RNA is analyzed for each
sample. RNA samples is first denatured in formaldehyde/formamide
RNA sample buffer at 65.degree. C. for 10 minutes prior to being
electrophoresed through 0.5.times.TBE agarose gels. Ribosomal RNA
is visualized by staining with ethidium bromide followed by
ultraviolet transillumination. Ribosomal RNA fragmentation has been
observed in cells transfected with poly (1)(C) and with in vitro
transcribed dsRNA.
[0235] PKR Activation
[0236] The activation of PKR is determined by measuring the levels
of eIF2alpha phosphorylation. Briefly, cells are lysed at various
times after transfection (2 hours, 7 hours, 19 hours, 48 hours, 3
days, 4 days, and 5 days after transfection) and analyzed for
levels of phosphorylated and non-phosphorylated eIF2 alpha. The
protocol for lysing cells can be found in the following reference:
Zhang F. et al., J. Biol. Chem. 276(27):24946-58, 2001. This
analysis is performed as described for detecting PKR
phosphorylation except that antibodies specific for phosphorylated
and non-phosphorylated eIF2alpha are used. These antibodies are
available from Cell Signaling Technology (Beverly, Mass.).
[0237] Cytopathic Effect and Antiproliferative Responses
[0238] Cytopathic effect is associated with the RNA stress
response. Cytopathic effect is assayed by analyzing cells
microscopically using a light microscope. Cells are analyzed at
daily intervals throughout the course of the experiment. Cytopathic
effect is defined as any or all of the following: cells detaching
from surface of well/flask, cells rounding up, an increased number
of vacuoles in transfected cells with respect to the control
untreated cells, or differences in morphology of cells with respect
to the untreated control cells. Cytopathic effects have been found
in cells transfected with Poly (I)(C) or with dsRNA made in vitro.
Desirably, mild or no cytopathic effects are observed using the
methods of the present invention.
[0239] Antiproliferative responses are associated with the RNA
stress response. Antiproliferative responses are assayed by
measuring the division rate of cells. The division rate is
determined by counting cell numbers using standard procedures.
Cells are counted every few days for the duration of the
experiment.
EXAMPLE 12
Optimization of the Concentrations and Relative Ratios of In Vitro
or In Vivo Produced DsRNA and Delivery Agent
[0240] If desired, the optimal concentrations and ratios of dsRNA
to a delivery agent such as a cationic lipid, cationic surfactant,
or local anesthetic can be readily determined to achieve low
toxicity and to efficiently induce gene silencing using in vitro or
in vivo produced dsRNA.
[0241] Summary of Factors Effecting Nucleic Acid/Cationic Lipid
Interactions
[0242] Cationic lipid DNA interactions are electrostatic.
Electrostatic interactions are highly influenced by the ionic
components of the medium. The ability to form stable complexes is
also dependent upon the intermolecular interactions between the
lipid molecules. At low concentrations, certain inter-lipid
interactions are preferred; at higher lipid concentrations, rapid
condensates are formed due to higher order interactions. Although
local interactions are similar in both of these instances (e.g.,
phosphoryl groups in the DNA and the charged cationic head group),
the long range and inter-lipid interactions are substantially
different. Similarly, structurally diverse variants can be obtained
simply by changing the charge ratio of the complex by mixing
varying amounts of cationic lipid with fixed concentrations of the
nucleic acid or vice versa. This variation in the structure of the
complexes is evidenced by altered physical properties of the
complexes (e.g., differences in octanol partitioning, mobility on
density gradients, charge density of the particle, particle size,
and transfectability of cells in culture and in vivo) (Pachuk et
al. DNA Vaccines--Challenges in Delivery, Current Opinion in
Molecular Therapeutics, 2(2) 188-198, 2000 and Pachuk et al., BBA,
1468, 20-30, (2000)). Furthermore, different lipids, local
anesthetics, and surfactants differ in their interactions between
themselves, and therefore novel complexes can be formed with
differing biophysical properties by using different lipids
singularly or in combination. For each cell type, the following
titration can be carried out to determine the optimal ratio and
concentrations that result in complexes that do not induce the
stress response or interferon response. At several of these
concentrations PTGS is predicted to be induced; however, PTGS is
most readily observed under conditions that result in highly
diminished cytotoxicity.
[0243] Complex Formation
[0244] dsRNA is either produced by in vitro transcription using the
T7 promoter and polymerase or another RNA polymerase, such as an E.
coli RNA polymerase. dsRNA can also be produced in an organism or
cell using endogenous polymerases.
[0245] Concentrations of dsRNA specific for a target gene, such as
PSA-specific dsRNA, are varied from 50 ng to 5 ug per one million
cells, and concentrations of short dsRNA (e.g., random short dsRNA
molecules used to inhibit toxicity) are varied from 50 ng to 5 ug
per one million cells. The ratio of the number of moles of short
dsRNA to moles of target-specific dsRNA to is varied from 1000:1,
1:1, to 1:25. In some instances, 150 ng of a plasmid that encodes a
reporter of interest (PSA) to be silenced may be comixed at a
concentration between 10 ng and 10 .mu.g. The concentration of
cationic lipid, cationic surfactant, local anesthetic, or any other
transfection facilitating agent that interacts with the nucleic
acid electrostatically are varied at each of the dsRNA
concentrations to yield charge ratios of 0.1 to 1000
(positive/negative) (i.e., the ratio of positive charge from lipids
or other delivery agents to negative charge from DNA or RNA). The
complexes are prepared in water or in buffer (e.g., phosphate,
HEPES, citrate, Tris-HCl, Tris-glycine, malate, etc. at pH values
that range from 4.0 to 8.5), may contain salt (e.g., 1-250 mM), and
may contain glycerol, sucrose, trehalose, xylose, or other sugars
(e.g., mono-, di-, or polysaccharide). The mixture is allowed to
sit at room temperature, desirably for 30 minutes, and may be
stored indefinitely. The complexes are premixed in serum free
media. The nucleic acid and the transfecting reagent may be mixed
either through direct addition or through a slow mixing process,
such as across a dialyzing membrane or through the use of a
microporous particle or a device that brings the two solutions
together at a slow rate and at low concentrations. In some
instances, the two interacting components are mixed at low
concentrations, and the final complex is concentrated using a
diafilteration or any other concentrating device. Alternatively, if
the complexes are formed at high concentrations of either or both
of the interacting components, the complexes may be diluted to form
an ideal transfection mixture.
[0246] Transfection Protocol and Analysis of DsRNA Stress
Response
[0247] Complexes are added to cells that are .about.60-80%
confluent in serum free media. The complexes are incubated for
various times (e.g., 10 minutes to 24 hours) with the cells at
37.degree. C. and diluted with serum containing media or washed and
replated in serum free media. The cells are monitored for toxicity
and analyzed at various times for signs of dsRNA response (e.g.,
TUNNEL assay to detect nicked DNA, phosphorylation of EIF2alpah,
induction and activation of 2'5' OAS, or interferon-alpha and
-beta). Transfection conditions that result in less than 50%, 25%,
10%, or 1% cytotoxicity or that result in a less than 20, 10, 5, 2,
or 1.5-fold induction of a stress response are analyzed to
determine if PTGS was efficiently induced.
[0248] PSA protein levels are determined in cell culture media
using standard methods. The data is normalized to the number of
live cells in culture to determine the concentrations required to
induce PTGS.
EXAMPLE 13
Other Methods to Avoid DsRNA-Mediated Activation of the RNA Stress
Response Pathway
[0249] If desired, to further inhibit the RNA stress response
pathway, one or more components of the RNA stress response pathway
can be mutated or inactivated to avoid induction/activation of the
component(s) by dsRNA that is delivered to the cell or animal for
the purpose of inducing PTGS. These components, such as those
illustrated in FIG. 2, can be knocked out singularly or in
combination.
[0250] Various standard methods can be used to knockout components
of the RNA stress response pathway, such as a promoter, regulatory
region, or coding region of PKR, human beta interferon Accession
No. M25460), and/or 2'5'OAS (Accession No. NM.sub.--003733).
Alternatively or additionally, one or more interferon response
element (IRE) sequences can be mutated or deleted using a knockout
construct designed based on the IRE consensus sequence (Ghislain,
et al., J Interferon Cytokine Res. 2001 Jun 21(6):379-88.), and/or
one or more transcription factors that bind IRE sequences, such as
STAT1 (Accession number XM.sub.--010893), can be mutated or
deleted. These methods include the use of antisense DNA/RNA,
ribozymes, or targeted gene knockout technology mediated by
homologous recombination. One skilled in the art is able to design
the appropriate antisense sequences, ribozymes, and vectors for
targeted knockouts. For example, targeted knockouts may be prepared
by any of the following standard methods: Shibata et al., Proc Natl
Acad Sci USA. 2001 Jul. 17;98(15):8425-32. Review., Muyrers et al.,
Trends Biochem Sci. 2001 May;26(5):325-31., Paul et al., Mutat Res.
2001 Jun. 5;486(1):11-9., Shcherbakova et al., Mutat Res. 2000 Feb.
16;459(1):65-71., Lantsov. Ideal gene therapy: approaches and
prospects Mol Biol (Mosk). 1994 May-June;28(3):485-95., in Gene
Transfer and Expression--A Laboratory Manual editor: Michael
Kriegler, Publisher--WH Freeman & Co, New York, N.Y., pages
56-60, 1990). Knockout cells can also be created by standard gene
knockout technologies using homologous recombination to alter
target sequences, using homologous DNA alone, or as complexes of
RecA protein and single stranded DNA homologous to the target
sequence(s).
[0251] Knockout cells can be readily identified either through the
use of an antibiotic resistance marker which when transferred to
the chromosome confers resistance to the cell or through the use of
dsRNA itself. In particular, dsRNA (e.g., a high concentration of
dsRNA) induces apoptosis in wild-type cells while mutant cells
survive dsRNA treatment because they cannot mount a stress
response. Yet another approach involves performing the
dsRNA-induced PTGS experiment in the presence of large
concentrations of IRE (dsDNA) oligo, which is expected to titrate
activated STAT proteins. These oligos can be delivered
intracerllularly using transfecting agents or electroporation.
[0252] In another method of preventing the interferon response,
cells (e.g., RD cells) are transfected with a T7 RNA polymerase
expression vector and a T7 dsRNA expression vector encoding dsRNA
homologous to the human protein kinase PKR cDNA (accession number
M35663) or homologous to the coding sequence of any other component
in the RNA stress response pathway. In one particular example,
dsRNA corresponding to nucleotides 190-2000 is encoded by the
T7dsRNA expression vector. The expression vectors are similar to
those described above and shown in FIG. 2, except that the dsRNA
encoding sequence is derived from the human protein kinase PKR
cDNA. Transfection in RD cells is performed as described above.
Within 2-5 days post-transfection, the cells are functionally PKR
negative.
[0253] To prevent an interferon response in a system involving
stable integration of the nucleic acid containing the dsRNA
expression cassette, the vectors used to generate either the loxP
integrant or the vector that encodes the dsRNA expression cassette
are designed to contain sequences that encode proteins that block
the PKR response, such as the Vaccinia virus protein E3 (Romano et
al., Molecular and Cellular Biology 18:7304-7316, 1998; Accession
No. M36339), or a cellular protein P58.sup.IPK, which the influenza
virus mobilizes to block PKR (Gale et al., Microbiology and
Molecular Biology Reviews 64:239-280, 2000; Accession No.
XM.sub.--032882). Several other viral proteins have also been
identified (e.g., Hepatitis C E2; Accession No. S72725) and may be
similarly used. These proteins can be expressed in the desired cell
types or in animals through the use of any of a number of
commercially available mammalian expression vectors or vertebrate
expression vectors. Such vectors can be obtained from a number of
different manufacturers including Invitrogen (Carlsbad, Calif.)
Promega ((Madison, Wis.), or Clontech (Palo Alto, Calif.). An
example of such a vector is the pCI-neo Mammalian Expression Vector
from Promega.
[0254] In yet another alternative, chimeric oligonucleotides may be
used to alter target sequences. Methods for inhibiting expression
of polypeptides through chimeric oligonucleotides are well known in
the art (Igoucheva and Yoon, Human Gene Therapy 11:2307-2312,
2000).
[0255] If desired, proteins involved in gene silencing such as
Dicer or Argonaut can be overexpressed or activated to increase the
amount of inhibition of gene expression (Beach et al., WO 01/68836,
filed Mar. 16, 2001).
[0256] Other Embodiments
[0257] From the foregoing description, it will be apparent that
variations and modifications may be made to the invention described
herein to adopt it to various usages and conditions.
[0258] All publication, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference.
1 <160> NUMBER OF SEQ ID NOS: 19 <210> SEQ ID NO 1
<211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: synthetic <400> SEQUENCE: 1 aagaaucugg
ugcaggaaug g # # #21 <210> SEQ ID NO 2 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: synthetic
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)...(19) <223> OTHER INFORMATION: Bases from 1 to
19 #are RNA <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (20)...(21) <223> OTHER INFORMATION:
Bases from 20 to 21 #are DNA <400> SEQUENCE: 2 gaaucuggug
caggaauggt t # # #21 <210> SEQ ID NO 3 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: synthetic
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)...(2) <223> OTHER INFORMATION: bases from 1 to
2 a #re DNA <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (3)...(21) <223> OTHER INFORMATION:
bases from 3-21 are RN #A <400> SEQUENCE: 3 ttcuuagacc
acguccuuac c # # #21 <210> SEQ ID NO 4 <211> LENGTH: 21
<212> TYPE: RNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: synthetic
<400> SEQUENCE: 4 aagaaggaca aacuggggcc u # # #21 <210>
SEQ ID NO 5 <211> LENGTH: 21 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: synthetic <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)...(19)
<223> OTHER INFORMATION: bases from 1 to 19 #are RNA
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (20)...(2) <223> OTHER INFORMATION: bases from 20
to 21 #are DNA <400> SEQUENCE: 5 gaaggacaaa cuggggccut t # #
#21 <210> SEQ ID NO 6 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: synthetic <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(2) <223> OTHER INFORMATION: bases from 1 to 2 a #re
DNA <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (3)...(21) <223> OTHER INFORMATION:
bases from 3 to 21 #are RNA <400> SEQUENCE: 6 ttcuuccugu
uugaccccgg a # # #21 <210> SEQ ID NO 7 <211> LENGTH: 21
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: synthetic
<400> SEQUENCE: 7 aauacgagau ccaccgagac u # # #21 <210>
SEQ ID NO 8 <211> LENGTH: 21 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: synthetic <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)...(19)
<223> OTHER INFORMATION: bases from 1 to 19 #are RNA
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (20)...(21) <223> OTHER INFORMATION: bases from 20
to 21 #are DNA <400> SEQUENCE: 8 uacgagaucc accgagacut t # #
#21 <210> SEQ ID NO 9 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: synthetic <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(2) <223> OTHER INFORMATION: bases from 1 to 2 a #re
DNA <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (3)...(21) <223> OTHER INFORMATION:
bases from 3 to 21 #are RNA <400> SEQUENCE: 9 ttaugcucua
gguggcucug a # # #21 <210> SEQ ID NO 10 <211> LENGTH:
21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: synthetic
<400> SEQUENCE: 10 aaugcaaagg cgggaauguc u # # #21
<210> SEQ ID NO 11 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: synthetic <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)...(19)
<223> OTHER INFORMATION: bases from 1 to 19 #are RNA
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (20)...(21) <223> OTHER INFORMATION: bases from 20
to 21 #are DNA <400> SEQUENCE: 11 ugcaaaggcg ggaaugucut t # #
#21 <210> SEQ ID NO 12 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: synthetic <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(2) <223> OTHER INFORMATION: bases from 1 to 2 a #re
DNA <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (3)...(21) <223> OTHER INFORMATION:
bases from 3 to 21 #are RNA <400> SEQUENCE: 12 ttacguuucc
gcccuuacag a # # #21 <210> SEQ ID NO 13 <211> LENGTH:
21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: synthetic
<400> SEQUENCE: 13 aaucagggcu gcguagguac a # # #21
<210> SEQ ID NO 14 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: synthetic <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)...(19)
<223> OTHER INFORMATION: bases from 1 to 19 #are RNA
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (20)...(21) <223> OTHER INFORMATION: bases from 20
to 21 #are DNA <400> SEQUENCE: 14 ucagggcugc guagguacat t # #
#21 <210> SEQ ID NO 15 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: synthetic <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(2) <223> OTHER INFORMATION: bases from 1 to 2 a #re
DNA <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (3)...(21) <223> OTHER INFORMATION:
bases from 3 to 21 #are RNA <400> SEQUENCE: 15 ttagucccga
cgcauccaug u # # #21 <210> SEQ ID NO 16 <211> LENGTH:
21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: synthetic
<400> SEQUENCE: 16 aaggugcguu ccucguagag a # # #21
<210> SEQ ID NO 17 <211> LENGTH: 21 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: synthetic <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)...(19)
<223> OTHER INFORMATION: bases from 1 to 19 #are RNA
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (20)...(21) <223> OTHER INFORMATION: bases from 20
to 21 #are DNA <400> SEQUENCE: 17 ggugccuucc ucguagagat t # #
#21 <210> SEQ ID NO 18 <211> LENGTH: 21 <212>
TYPE: DNA <213> ORGANISM: Artificial Sequence <220>
FEATURE: <223> OTHER INFORMATION: synthetic <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(1)...(2) <223> OTHER INFORMATION: bases from 1 to 2 a #re
DNA <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (3)...(21) <223> OTHER INFORMATION:
bases from 3 to 21 #are RNA <400> SEQUENCE: 18 ttccacgcaa
ggagcaucuc u # # #21 <210> SEQ ID NO 19 <211> LENGTH:
25 <212> TYPE: RNA <213> ORGANISM: Human Hepatitis B
(HBV) <400> SEQUENCE: 19 ccuccaauca cucaccaacc uccug # #
25
* * * * *
References