U.S. patent application number 10/626033 was filed with the patent office on 2004-09-16 for method for producing ascorbic acid intermediates.
Invention is credited to Boston, Matthew Grant, Swanson, Barbara A..
Application Number | 20040180413 10/626033 |
Document ID | / |
Family ID | 22816130 |
Filed Date | 2004-09-16 |
United States Patent
Application |
20040180413 |
Kind Code |
A1 |
Boston, Matthew Grant ; et
al. |
September 16, 2004 |
Method for producing ascorbic acid intermediates
Abstract
The present invention relates to non-fermentative methods for
the production of ASA intermediates, KDG, DKG and KLG and methods
for the regeneration of co-factor. The invention provides
genetically engineered host cells comprising heterologous nucleic
acid encoding enzymes useful in the process.
Inventors: |
Boston, Matthew Grant; (San
Carlos, CA) ; Swanson, Barbara A.; (San Francisco,
CA) |
Correspondence
Address: |
Genencor International, Inc.
925 Page Mill Road
Palo Alto
CA
94034-1013
US
|
Family ID: |
22816130 |
Appl. No.: |
10/626033 |
Filed: |
July 23, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10626033 |
Jul 23, 2003 |
|
|
|
09218700 |
Dec 22, 1998 |
|
|
|
6599722 |
|
|
|
|
Current U.S.
Class: |
435/126 |
Current CPC
Class: |
C12P 7/60 20130101; C12P
7/58 20130101 |
Class at
Publication: |
435/126 |
International
Class: |
C12P 017/04 |
Claims
We claim:
1. A process for the non-fermentative production of KDG or DKG from
a carbon source comprising, enzymatically oxidizing the carbon
source by at least one oxidative enzymatic activity to yield KDG or
DKG.
2. The process of claim 1 wherein said KDG is further converted to
erythorbate.
3. The process of claim 1 comprising oxidizing the carbon source by
a first oxidative enzymatic activity to yield a first oxidative
product and oxidizing said first oxidative product by a second
oxidative enzymatic activity to yield KDG.
4. The process of claim 3 wherein said first oxidative enzymatic
activity is a GDH activity and said second oxidative enzymatic
activity is an GADH activity.
5. The process of claim 1 that proceeds in an environment
comprising host cells.
6. The process of claim 5 wherein said host cell is non-viable.
7. The process of claim 5 wherein said host cell is viable.
8. The process of claim 5 wherein at least one oxidative enzymes
are bound to said host cell membranes.
9. The process of claim 1 wherein at least one oxidative enzymatic
activity is in solution.
10. The process of claim 8 wherein said host cell comprises a
mutation in the nucleic acid encoding a KDGDH activity.
11. The process of claim 5 wherein said host cell is an member of
the family Enterobacteriacea.
12. The process of claim 11 wherein said member is a Pantoea
species.
13. The process of claim 1 wherein at least one oxidative enzymatic
activity immobilized.
14. The process of claim 3, further comprising the steps of
enzymatically oxidizing the KDG by at least one oxidative enzyme to
an oxidation product; and enzymatically reducing said oxidation
product by at least one reducing enzyme to 2-KLG.
15. A process for the non-fermentative production of 2-KLG from a
carbon source, comprising the following steps in any order,
enzymatically oxidizing the carbon source by at least one oxidative
enzymatic activity to an oxidation product; and enzymatically
reducing said oxidation product by at least one reducing enzymatic
activity to 2-KLG.
16. The process of claim 15 wherein said carbon source is KDG.
17. The process of claim 15 wherein said oxidative enzymatic
activity requires an oxidized form of an enzymatic co-factor and
said reducing enzymatic activity requires a reduced form of said
enzymatic co-factor and wherein said oxidized from of said
co-factor and said reduced form of said co-factor are recycled
between at least one oxidizing step and at least one reducing
step.
18. The process of claim 15 comprising the following steps in any
order: a. enzymatically oxidizing the carbon source by a first
oxidative enzymatic activity to a first oxidation product; b.
enzymatically oxidizing the first oxidation product by a second
oxidative enzymatic activity to a second oxidation product; c.
enzymatically oxidizing the second oxidation product by a third
oxidative enzymatic activity to a third oxidation product; and d.
enzymatically reducing the third oxidation product by a reducing
enzymatic activity to 2-KLG.
19. The process of claim 18 wherein at least one of said first,
second and third oxidative enzymatic activities requires an
oxidized form of an enzymatic co-factor and said reducing enzymatic
activity requires a reduced form of said enzymatic co-factor and
wherein said oxidized form of said co-factor and said reduced form
of said co-factor are recycled between at least one oxidizing step
and the reducing step.
20. The process of claim 19 wherein said first oxidative enzymatic
activity requires an oxidized form of said enzymatic co-factor.
21. The process of claim 18 wherein said carbon source is glucose
and said first enzymatic activity is a glucose dehydrogenase
activity.
22. The process of claim 21 wherein said glucose dehydrogenase
activity is obtainable from a bacterial, yeast or fungal
source.
23. The process of claim 22 wherein said glucose dehydrogenase
activity is obtainable from a source including T. acidophilum,
Crytococcus uniguttalatus and Bacillus species.
24. The process of claim 19 wherein each of said first, said second
enzyme and said third enzyme is a dehydrogenase activity.
25. The process of claim 19 wherein at least one of said first,
said second, said third and said fourth enzymatic activities are
immobilized.
26. The process of claim 19 wherein at least one of said first,
said second, said third and said fourth enzymatic activities are in
solution.
27. The process of claim 25 wherein said second enzyme is a GADH
activity.
28. The process of claim 25 wherein said third enzyme is KDGDH
activity.
29. The process of claim 25 wherein said fourth enzyme is a
reductase activity.
30. The process of claim 29 wherein said reductase activity is
obtainable from a bacterial, yeast or fungal source.
31. The reductase activity of claim 29 wherein said source includes
Corynebacterium and Erwinia.
32. The process of claim 31 wherein said reductase activity is 2,5
DKG reductase.
33. The process of claim 18 wherein said first oxidation product is
gluconate, said second oxidation product is 2-KDG, and said third
oxidation product is 2,5-DKG.
34. The process of claim 18 that proceeds in an environment
comprising recombinant host cells.
35. The process of claim 34 wherein said host cell is viable.
36. The process of claim 34 wherein said host cell is
non-viable.
37. The process of claim 34 wherein said recombinant host cells
comprise members of Enterobacteriacea.
38. The process of claim 34 that proceeds in an environment
comprising recombinant host cell membranes and wherein at least one
of said first, said second and said third enzymes are bound to said
host cell membranes.
39. The process of claim 37 wherein said recombinant host cell is a
Pantoea species.
40. The process of claim 39 wherein said recombinant host cell is
Pantoea citrea.
41. The process of claim 40 wherein said recombinant host cell has
a mutation of at least one naturally occurring dehydrogenase
activity.
42. The process of claim 41 wherein said mutation is in a membrane
bound GDH activity.
43. The process of claim 41 wherein said host cell further
comprises nucleic acid encoding a heterologous GDH activity.
44. The process of claim 43 wherein said heterologous GDH activity
is obtainable from T. acidophilum, Cryptococcus uniguttalatus, or a
Bacillus species.
45. The process of claim 18 wherein said oxidized form of said
enzymatic cofactor is NADP+ and said reduced form of said enzymatic
cofactor is NADPH.
46. The process of claim 18 wherein said oxidized form of said
enzymatic cofactor is NAD and said reduced form is NADH.
47. The process of claims 1, 15 and 18 that is continuous.
48. The process of claims 1, 15 and 18 that is batch.
49. The process of claims 1, 15 and 18 that proceeds in an
environment comprising organic solvents.
50. The process of claims 1, 15 and 18 that proceeds in an
environment comprising long polymers.
51. The process of claim 18 further comprising the step of
obtaining ASA from said 2-KLG.
52. A host cell comprising nucleic acid having a mutation in the
gene encoding GHD activity.
53. A host cell comprising nucleic acid having a mutation in the
gene encoding KDGDH activity.
54. The host cell of claims 52 or 53 that is a Pantoea species.
55. The host cell of claim 52 further comprising nucleic acid
encoding a heterologous GDH activity.
56. The host cell of claim 55 further comprising nucleic acid
encoding a heterologous reductase activity.
57. The method of claim 1 optionally comprising the step of
recovering said KDG or DKG.
58. The method of claim 14 optionally comprising the step of
recovering said KLG.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to pathway engineering and in
particular to biocatalytic methods for the production of ascorbic
acid intermediates. In particular, the invention provides methods
for the production of ascorbic acid intermediates in
non-fermentative systems.
BACKGROUND OF THE INVENTION
[0002] L-Ascorbic acid (vitamin C, ASA) finds use in the
pharmaceutical and food industry as a vitamin and antioxidant. The
synthesis of ASA has received considerable attention over many
years due to its relatively large market volume and high value as a
specialty chemical. The Reichstein-Grussner method, a chemical
route from glucose to ASA, was first disclosed in 1934 (Helv. Chim.
Acta 17:311-328). Lazarus et al. (1989, "Vitamin C: Bioconversion
via a Recombinant DNA Approach", Genetics and Molecular Biology of
Industrial Microorganisms , American Society for Microbiology,
Washington D.C. Edited by C. L. Hershberger) disclosed a
bioconversion method for production of an intermediate of ASA,
2-keto-L-gulonic acid (2-KLG, KLG) which can be chemically
converted to ASA. This bioconversion of carbon source to KLG
involves a variety of intermediates, the enzymatic process being
associated with co-factor dependent reductase activity. Enzymatic
co-factor regeneration involves the use of enzymes to regenerate
co-factors such as NAD+ to NADH or NADP+ to NADPH at the expense of
another substrate that is then oxidized.
[0003] There remains a need for economically feasible methods for
the production of ASA intermediates. In particular, when such
methods involve the use of enzymatic activities which require
co-factor, it would be particularly desirable to have methods which
provide for co-factor regeneration. The present invention addresses
that need.
SUMMARY OF THE INVENTION
[0004] The present invention relates to the non-fermentative
production of ASA intermediates, e.g., KDG, DKG and KLG, and
ultimately their conversion to end products, e.g., erythorbate and
ascorbic acid, from a carbon source in a biocatalytic environment.
See FIG. 2 for a schematic representation of the production of
these intermediates and products.
[0005] The present invention also relates to a non-fermentative
process for the production of ASA intermediates wherein required
co-factor is regenerated. The biocatalytic environment may comprise
viable or non-viable host cells which contain at least one
enzymatic activity capable of processing the carbon source to the
desired intermediate.
[0006] When KDG is the desired ASA intermediate, the bioreactor is
provided with a carbon source which is biocatalytically converted
through at least one oxidative step to KDG. In this embodiment, the
host cell may comprise a mutation(s) in a gene encoding an
oxidative enzymatic activity specific to oxidizing the KDG. When
DKG is the desired ASA intermediate, the bioreactor is provided
with a carbon source which is biocatalytically converted through at
least one oxidative step to DKG. Depending upon the host cell used,
the host cell may comprise a mutation(s) in a gene encoding an
oxidizing or reducing enzymatic activity such that DKG is not
further converted to other intermediates. When KLG is the desired
ASA intermediate, the bioreactor is provided with a carbon source
which is biocatalytically converted through at least one oxidative
step and at least one reducing step to KLG. Depending upon the host
cell used, the host cell may comprise a mutation(s) in a gene
encoding an oxidizing or reducing enzymatic activity such that KLG
is not further converted to other intermediates. When the oxidative
step and reducing step require co-factor, the method provides a
means for co-factor regeneration. Therefore, the present invention
is based, in part, upon the discovery that catalytic amounts of
co-factor can be regenerated in a non-fermentative, or in vitro,
method for the production of KLG from a carbon source.
[0007] The host cells may be recombinant comprising at least one
heterologous enzymatic activity. The process may be performed as a
batch process or a continuous process. The host cells are
preferably members of the-family Enterobacteriacea and in one
embodiment, the member is a Pantoea species and in particular,
Pantoea citrea. Pantoea citrea can be obtained from ATCC having
ATCC accession number 39140, for example.
[0008] The host cells may be lyophilized, permeabilized, or
otherwise treated to reduce viability or mutated to eliminate
glucose utilization for cell growth or metabolism as long as the
enzymatic activity is available to convert the carbon source to the
desired intermediate. The intermediates may be further processed to
the end products of erythorbate or ASA.
[0009] Accordingly, in one aspect, the present invention provides a
method for the production of the intermediate DKG or KDG from a
carbon source comprising enzymatically oxidizing the carbon source
by at least one oxidative enzymatic activity to yield DKG or KDG.
In another embodiment, the process comprises oxidizing the carbon
source by a first oxidative enzymatic activity to yield a first
oxidative product and oxidizing said first oxidative product by a
second oxidative enzymatic activity to yield KDG. In one
embodiment, the first oxidative enzymatic activity is a GDH
activity and the second oxidative enzymatic activity is a GADH
activity. KDG may be further converted to erythorbate. The process
may further comprise oxidizing KDG by a third oxidative enzymatic
activity to yield DKG.
[0010] For production of KLG, if the carbon source is KDG, the
method comprises the steps of enzymatically oxidizing the KDG by at
least one oxidative enzymatic activity to an oxidation product; and
enzymatically reducing said oxidation product by at least one
reducing enzymatic activity to 2-KLG. Alternatively, if DKG is the
carbon source, DKG is converted to KLG by a reducing enzymatic
activity.
[0011] In one embodiment, at least one oxidative enzymatic activity
is bound to host cell membranes and in another embodiment, at least
one oxidative enzymatic activity is in solution and in another
embodiment, at least one enzymatic activity is immobilized. In the
process for producing KDG, it is preferred that the host cell
comprises a mutation in the nucleic acid encoding a KDGDH activity,
such that the KDG is not further oxidized.
[0012] The present invention also provides a process for the
non-fermentative production of 2-KLG from a carbon source, wherein
said process comprises the following steps in any order,
enzymatically oxidizing the carbon source by at least one oxidative
enzymatic activity to an oxidation product; and enzymatically
reducing said oxidation product by at least one reducing enzymatic
activity to 2-KLG. In one embodiment, the carbon source is KDG. In
another embodiment, said oxidative enzymatic activity requires an
oxidized form of an enzymatic co-factor and said reducing enzymatic
activity requires a reduced form of said enzymatic co-factor and
said oxidized form of said co-factor and said reduced form of said
co-factor are recycled between at least one oxidizing step and at
least one reducing step.
[0013] In another embodiment, the process comprises the following
steps in any order: enzymatically oxidizing the carbon source by a
first oxidative enzymatic activity to a first oxidation product;
enzymatically oxidizing the first oxidation product by a second
oxidative enzymatic activity to a second oxidation product;
enzymatically oxidizing the second oxidation product by a third
oxidative enzymatic activity to a third oxidation product; and
enzymatically reducing the third oxidation product by a reducing
enzymatic activity to 2-KLG. In one embodiment, at least one of
said first, second and third oxidative enzymatic activities
requires an oxidized form of an enzymatic co-factor and said
reducing enzymatic activity requires a reduced form of said
enzymatic co-factor and wherein said oxidized form of said
co-factor and said reduced form of said co-factor are recycled
between at least one oxidizing step and the reducing step. In one
embodiment of the process, the first oxidative enzymatic activity
requires an oxidized form of said enzymatic co-factor.
[0014] In one embodiment of the process, the carbon source is
glucose and said first oxidative enzymatic activity is a glucose
dehydrogenase activity. The glucose dehydrogenase activity may be
obtained from a bacterial, yeast or fungal source, including T.
acidophilum, Cryptococcus uniguttalatus and Bacillus species. In
another embodiment, each of said first, said second enzyme and said
third enzymatic activities is a dehydrogenase activity. In one
embodiment, at least one of said first, said second, said third and
said fourth enzyme activities are immobilized, in another at least
one is in solution and in another at least one is bound to the
membrane of a viable or non-viable host cell.
[0015] In a further embodiment, the second oxidative enzymatic
activity is a GADH and the third oxidative enzymatic activity is
KDGDH. In another embodiment, the reductase activity is obtainable
from a bacterial, yeast or fungal source and in a preferred
embodiment is 2,5 DKG reductase.
[0016] In yet another embodiment of the method, the first oxidation
product is gluconate, the second oxidation product is 2-KDG, and
the third oxidation product is 2,5-DKG.
[0017] In a further embodiment of the process, the recombinant host
cell has a mutation of at least one naturally occurring
dehydrogenase activity and is preferably a deletion in the
naturally occurring membrane bound GDH activity. The host cell may
further comprise nucleic acid encoding a heterologous GDH
activity.
[0018] Some embodiments of the process will proceed in a manner
allowing for enzymatic co-factor recycling. In one aspect, the
oxidized form of the enzymatic cofactor is NADP+ and the reduced
form of said enzymatic cofactor is NADPH. In another aspect, the
oxidized form of said enzymatic cofactor is NAD+ and the reduced
form is NADH. Other co-factors useful in the process of the present
invention include ATP, ADP, FAD and FMN.
[0019] In one embodiment, the process proceeds in an environment
comprising organic solvents and in another, the process proceeds in
an environment comprising long polymers.
[0020] The present invention also provides vectors and recombinant
host cells comprising enzymatic activities which are used in the
methods for producing the ASA intermediates. In one embodiment, the
host cell comprises heterologous nucleic acid encoding GDH
obtainable from species including including T. acidophilum,
Cryptococcus uniguttalatus and Bacillus species and/or DKG
reductase obtainable from Corynebacterium or Erwinia.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1 is a schematic representation of an in vitro process
wherein NADP+ and NADPH are recycled between oxidation and
reduction steps.
[0022] FIG. 2 is a schematic representation of a pathway to ASA
intermediates. Steps labeled A are enzymatic; steps labeled B are
either enzymatic or chemical conversions. The enzyme that converts
glucose (Glc) to GA is a GDH activity; the oxidative enzyme that
converts GA to KDG is a GADH activity; the oxidative enzyme that
converts KDG to DKG is a KDGDH activity and the reducing enzyme
that converts DKG to KLG is DKGR activity.
[0023] FIG. 3 illustrates the activity of reductase in the presence
of 0-40% methanol at pH 7 and 30.degree. C.
[0024] FIG. 4 illustrates Reductase activity in the presence of
0-50% ethanol at pH 7, 22.degree. C.
[0025] FIG. 5 illustrates reductase activity at pH 7 in the
presence of NaCl, KCl, CaCl2 or potassium phosphate (KPi). Initial
rates were measured over 1 min.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0026] Definitions
[0027] The following definitions apply as used herein to glucose
(G); D-gluconate (GA); 2-keto-D-gluconate (2KDG);
2,5-diketo-D-gluconate (2,5DKG or DKG), 2-keto-L-gulonic acid
(2KLG, or KLG), L-idonic acid (IA), ascorbic acid (ASA), glucose
dehydrogenase (GDH), gluconic acid dehydrogenase (GADH),
2,5-diketo-D-gluconate reductase (DKGR), and 2-keto-D-gluconate
reductase (KDGDH).
[0028] As used herein, the term "non-fermentative" or "in vitro"
refers to a biocatalytic process which exploits a cell's enzymatic
activity. The cells may be non-viable or viable and not
significantly growing. The cells may be genetically altered to
eliminate their consumption of glucose and/or any intermediates
produced. The in vitro process of the present invention encompasses
the use of cell membranes which comprise enzymatic activity
associated with the biocatalytic process, the use of permeabilized
cells or lyophilized cells comprising the enzymatic activity
associated with the biocatalytic process and the use of a host cell
or host cell membranes or fragments in any form which provides the
necessary enzymatic activity for the biocatalytic conversion of a
carbon source to any of the ASA intermediates including but not
limited to GA, KDG, DKG and KLG. The cell may be a recombinant cell
which comprises heterologous nucleic acid encoding a desired
enzymatic activity or a naturally occurring cell which comprises
the desired enzymatic activity. The term "bioreactor" as used
herein refers to the environment within which the non-fermentative
or in-vitro process proceeds.
[0029] Many enzymes are only active in the presence of a co-factor,
such as for example, NAD+ or NADP+. The term co-factor as used
herein refers to a substrate secondary in nature to the enzymatic
reaction, but vital to the enzymatic reaction. As used herein, the
term "co-factor" includes, but is not limited to NAD+/NADH;
NADP+/NADPH; ATP; ADP, FAD/FADH.sup.2 and FMN/FMNH.sup.2. The
phrase "regeneration of co-factor" or "recycling of co-factor"
within the in vitro system refers to the phenomenon of continual
oxidation and reduction of the required co-factor through
biocatalysis, such that the required co-factor is present in the
appropriate form for enzyme catalysis to take place. In the present
invention, regeneration of co-factor provides an environment
wherein a reduced form of a co-factor is available for a reducing
enzyme and an oxidative form of the co-factor is available for an
oxidation enzyme. The present invention encompasses regeneration of
co-factor between any enzymatic oxidation step and any enzymatic
reducing step in the biocatalytic pathway from carbon source to the
ASA intermediate, e.g. KLG. The required co-factor may be present
in catalytic amounts provided by the host cell environment or may
be provided exogenously at the beginning of the bioreactor process
in stochiometric quantities in either an oxidized or reduced
form.
[0030] The amount of co-factor added exogenously to the bioreactor
is between about 1 .mu.M to about 5 mM and in a preferred
embodiment, between about 5 .mu.M to about 1 mM. It has been
discovered that ionic strength affects reductase activity.
Therefore in a batch process wherein product accumulation produces
increasing ionic strength, thereby reducing the activity of the
reductase, it is preferred to have amounts of co-factor at the
upper end of the range. In a continuous system wherein the product
is removed, amounts of co-factor in the lower range may be added. A
co-factor added exogenously to an in vitro system may be added
alone or in combination with other substances associated with
biocatalytic conversion of a carbon source to an ASA intermediate.
The present process encompasses the use of co-factor immobilized to
a carrier, co-factor chemically altered, such as in attachment to a
long polymer, and to the use of co-factor in an isolated or
purified form.
[0031] As used herein, the term carbon source encompasses suitable
carbon sources ordinarily used by Enterobacteriaceae strains, such
as 6 carbon sugars, including but not limited to glucose, gulose,
sorbose, fructose, idose, galactose and mannose all in either D or
L form, or a combination of 6 carbon sugars, such as sucrose, or 6
carbon sugar acids including but not limited to 2-keto-L-gulonic
acid, idonic acid, gluconic acid, 6-phosphogluconate,
2-keto-D-gluconic acid, 5-keto-D-gluconic acid,
2-ketogluconatephosphate, 2,5-diketo-L-gulonic acid,
2,3-L-diketogulonic acid, dehydroascorbic acid, erythroascorbic
acid and D-mannonic acid or the enzymatic derivatives of such as
long as the carbon source is capable of being converted to an ASA
intermediate such as, KDG, DKG and KLG, for example.
[0032] As used herein, the family "Enterobacteriaceae " refers to
bacterial strains having the general characteristics of being gram
negative and being facultatively anaerobic. Preferred
Enterobacteriaceae strains are those that are able to produce
2,5-diketo-D-gluconic acid from D-glucose solutions. Included in
the family of Enterobacteriaceae which are able to produce
2,5-diketo-D-gluconic acid from D-glucose solutions are the genus
Erwinia, Enterobacter, Gluconobacter and Pantoea, for example.
Intermediates in the microbial carbohydrate pathway from a carbon
source to ASA, include but are not limited to GA, 2KDG, 2,5DKG,
5DKG, 2KLG and IA. In the present invention, a preferred
Enterobacteriaceae fermentation strain is a Pantoea species and in
particular, Pantoea citrea. Four stereoisomers of ascorbic acid are
possible: L-ascorbic acid, D-araboascorbic acid (erythorbic acid),
which shows vitamin C activity, L-araboascorbic acid, and
D-xyloascorbic acid. As used herein, the term, ASA intermediate
encompasses any product in the pathway to ASA including but not
limited to KDG, DKG and KLG.
[0033] As used herein, the term "recombinant" refers to a host cell
that contains nucleic acid not naturally occurring in the organism
and/or to host cells having additional copies or endogenous nucleic
acid recombinantly introduced. The term "heterologous" as used
herein refers to nucleic acid or amino acid sequences not naturally
occurring in the host cell. As used herein, the term "endogenous"
refers to a nucleic acid naturally occurring in the host.
[0034] As used herein, "nucleic acid" refers to a nucleotide or
polynucleotide sequence, and fragments or portions thereof, and to
DNA or RNA of genomic or synthetic origin which may be
double-stranded or single-stranded, whether representing the sense
or antisense strand. As used herein "amino acid" refers to peptide
or protein sequences or portions thereof.
[0035] As used herein the term "mutation" refers to any alteration
in a nucleic acid such that the product of that nucleic acid is
inactivated or eliminated. Examples of mutations include but are
not limited to point mutations, frame shift mutations and deletions
of part or all of a gene encoding an enzymatic activity, such as an
oxidative enzyme activity or a reducing activity. In one embodiment
disclosed herein for producing KLG whereby co-factor is
regenerated, nucleic acid encoding a membrane bound GDH activity is
mutated thereby inactivating the GDH activity. In another
embodiment, the 2-keto-D-gluconate dehydrogenase activity is
inactivated thereby allowing for optimized production of the
intermediate KDG.
[0036] The phrase "oxidative enzyme" as used herein refers to an
enzyme or enzyme system which can catalyze conversion of a
substrate of a given oxidation state to a product of a higher
oxidation state than substrate. The phrase "reducing enzyme" refers
to an enzyme or enzyme system which can catalyze conversion of a
substrate of a given oxidation state to a product of a lower
oxidation state than substrate. Oxidative enzymes associated with
the biocatalysis of D-glucose to KLG include among others D-glucose
dehydrogenase, D-gluconate dehydrogenase and 2-keto-D-gluconate
dehydrogenase. Reducing enzymes associated with the biocatalysis of
pathway intermediates of ASA into KLG include among others
2,5-diketo-D-gluconate reductase (DKGR), 2-keto reductase (2-KR)
and 5-keto reductase (5-KR). Such enzymes include those produced
naturally by the host strain or those introduced via recombinant
means. In one embodiment disclosed herein, the process proceeds in
a Pantoea citrea host cell having the naturally occurring membrane
bound, non-NADP+ dependent GDH activity eliminated and a cytosolic
NADP+ dependent GDH recombinantly introduced. In another
embodiment, a heterologous nucleic acid encoding a reductase
activity is introduced into the host cell. In a preferred
embodiment, the reductase activity is obtainable from a Coryneform
species or an Erwinia species. As used herein, the term "pathway
enzyme" refers to any enzyme involved in the biocatalytic
conversion of a carbon source to an ASA intermediate, e.g., KDG,
DKG and KLG.
[0037] The terms "isolated" or "purified" as used herein refer to a
nucleic acid or protein or peptide or co-factor that is removed
from at least one component with which it is naturally associated.
In the present invention, an isolated nucleic acid can include a
vector comprising the nucleic acid.
[0038] It is well understood in the art that the acidic derivatives
of saccharides, may exist in a variety of ionization states
depending upon their surrounding media, if in solution, or out of
solution from which they are prepared if in solid form. The use of
a term, such as, for example, idonic acid, to designate such
molecules is intended to include all ionization states of the
organic molecule referred to. Thus, for example, "idonic acid", its
cyclized form "idonolactone", and "idonate" refer to the same
organic moiety, and are not intended to specify particular
ionization states or chemical forms.
Detailed Description
[0039] The present invention relates to the biocatalytic production
of ASA intermediates, e.g., KDG, DKG and KLG, from a carbon source
in an in vitro or non-fermentative environment. Depending upon the
intermediate being produced, the process may require the presence
of enzymatic co-factor. In a preferred embodiment disclosed herein,
the enzymatic co-factor is regenerated. Due to the cost of
co-factor, it is highly advantageous to employ an in vitro process
which allows for the regeneration of catalytic amounts of co-factor
provided by the host cell-environment or provided exogenously.
[0040] Non-Fermentative Production of ASA intermediates
[0041] The present invention provides a means for the production of
ASA intermediates. Such intermediates can be further processed to
ASA, ASA stereoisomers or other products such as erythorbate. In
one preferred embodiment, KDG is the desired ASA intermediate
produced, the bioreactor is provided with viable or non-viable
Pantoea citrea host cells having a mutation in a gene encoding
2-keto-D-gluconate dehydrogenase activity as described herein in
Example II. In this embodiment, the carbon source is
biocatalytically converted through at two oxidative steps, see FIG.
2, to KDG. In this embodiment, there is no need for co-factor
regeneration.
[0042] When DKG is the desired ASA intermediate, the bioreactor is
provided with viable or non-viable Pantoea citrea host cells and a
carbon source which is biocatalytically converted through three
oxidative steps, see FIG. 2, to DKG. In this embodiment, there is
not need for co-factor regeneration.
[0043] When KLG is the desired ASA intermediate, the bioreactor is
provided with viable or non-viable Pantoea citrea host cells and a
carbon source, such as glucose, which is biocatalytically converted
through three oxidative steps, as shown in FIG. 2 and one reducing
step to KLG. In this embodiment, the reductase activity may be
encoded by nucleic acid contained within the Pantoea citrea host
cell or provided exogenously. In this embodiment, the first
oxidative enzymatic activity requires an oxidized form of the
co-factor and the reducing enzymatic activity requires a reduced
form of co-factor. In a preferred embodiment disclosed herein, the
Pantoea citrea cell is modified to eliminate the naturally
occurring GDH activity and a heterologous GDH obtainable from T.
acidophilum, Cryptococcus uniguttalatus or Bacillus species and
having a specificity for NADPH+ is introduced into the Pantoea cell
in order to provide a co-factor recycling system which requires and
regenerates one co-factor. This embodiment, provides a means for
co-factor regeneration, thereby eliminating the cost of
continuously adding exogenous co-factor to the bioreactor for the
production of KLG in Pantoea cells. In this embodiment, the host
cell further comprises nucleic acid encoding a 2,5-DKG reductase
activity or the 2,5-DKG reductase is added exogenously to the
bioreactor.
[0044] In another embodiment for making KLG, the bioreactor is
charged with Pantoea citrea cells comprising nucleic acid encoding
membrane-bound GDH, appropriate enzymes and cofactor, and glucohic
acid is added which is converted to DKG. The reaction mixture is
then made anaerobic and glucose is added. The GDH converts the
glucose to GA, and the reductase converts DKG to KLG, while
cofactor is recycled. When these reactions are completed, oxygen is
added to convert GA to DKG, and the cycles continue.
[0045] In vitro Biocatalytic Environment
[0046] A biocatalytic process of converting a carbon source to an
ASA intermediate begins with a suitable carbon source used by
Enterobacteriaceae strains, such as a 6 carbon sugar, including for
example, glucose, or a 6 carbon sugar acid, such as for example,
KDG. Other metabolite sources include, but are not limited to
galactose, lactose, fructose, or the enzymatic derivatives of such.
In addition to an appropriate carbon source, media must contain
suitable minerals, salts, cofactors, buffers and other components
known to those of skill in the art for sustaining cultures and
promoting the enzymatic pathway necessary for production of desired
end-products. The cells are first grown and for the
non-fermentative process the carbon source utilized for growth is
eliminated, the pH is maintained at between about pH 4 and about pH
9 and oxygen is present.
[0047] In the in vitro biocatalytic process, the carbon source and
metabolites thereof proceed through enzymatic oxidation steps or
enzymatic oxidation and enzymatic reducing steps which may take
place outside of the host cell intracellular environment and which
exploit the enzymatic activity associated with the host cell and
proceed through a pathway to produce the desired ASA intermediate.
The enzymatic steps may proceed sequentially or simultaneously
within the bioreactor and some have a co-factor requirement in
order to produce the desired ASA intermediate. The present
invention encompasses an in vitro process wherein the host cells
are treated with an organic substance, as described in Example III,
such that the cells are non-viable, yet enzymes remain available
for oxidation and reduction of the desired carbon source and/or
metabolites thereof in the biocatalysis of carbon source to ASA
intermediate. The present invention also encompasses an in vitro
process wherein the host cells are lyophilized, permeabilized by
any means, spray-dried, fractured or otherwise treated such that
the enzymes are available for the conversion of carbon source to
ASA intermediate.
[0048] The oxidative or reducing enzymatic activities may be bound
to a host cell membrane, immobilized, such as to a resin, for
example AminoLink coupling gel (from Pierce Chemical Co), to a
polymer, or soluble in the bioreactor environment. In a preferred
embodiment, at least one oxidative enzyme is membrane bound. The
environment may proceed in an organic or aqueous system or a
combination of both, and may proceed in one vessel or more. In one
embodiment, the process proceeds in two vessels, one which utilizes
oxygen and one which is anaerobic. For example, the membrane bound
enzymes that require oxygen (GDH, GADH, KDGDH) may be isolated from
those enzymes that do not require oxygen (cofactor dependent GDH,
cofactor dependent DKGR) allowing the use of a smaller volume
containment vessel that requires oxygen, thereby reducing cost. The
bioreactor may be performed in batch or in a continuous process. In
a batch system, regardless of what is added, all of the broth is
harvested at the same time. In a continuous system, the broth is
regularly removed for downstream processing while fresh substrate
is added. The intermediates produced may be recovered from the
fermentation broth by a variety of methods including ion exchange
resins, absorption or ion retardation resins, activated carbon,
concentration-crystallizatio- n, passage through a membrane,
etc.
[0049] The bioreactor process may also involve more than one cell
type, e.g., one cell may comprise the oxidative activities and a
second cell may comprise the reducing activities. In another
embodiment, the host cell is permeabilized or lyophilized (Izumi et
al., J. Ferment. Technol. 61 (1983) 135-142) as long as the
necessary enzymatic activities remain available to convert the
carbon source or derivatives thereof. The bioreactor may proceed
with some enzymatic activities being provided exogenous and in an
environment wherein solvents or long polymers are provided which
stabilize or increase the enzymatic activities. In an embodiment
disclosed herein, methanol or ethanol is used to increase reductase
activity. In another embodiment, Gafquat is used to stabilise the
reductase (see Gibson et al., U.S. Pat. No. 5,240,843).
[0050] In one illustrative bioreactor described herein, the host
cell is a permeabilized Pantoea citrea provided D-glucose as a
carbon source which undergoes a series of oxidative steps through
enzymatic conversions. The oxidizing enzymes include GDH, GADH and
DGDH and a reducing step which involves 2 DKGR (see U.S. Pat. No.
3,790,444) to yield KLG. The KLG produced by a process of the
present invention may be further converted to ascorbic acid and the
KDG to erythorbate by means known to those of skill in the art, see
for example, Reichstein and Grussner, Helv. Chim. Acta., 17,
311-328 (1934).
[0051] Co-factor Regeneration
[0052] One of the advantages of the process of the present
invention lies in the regeneration of co-factor required by pathway
enzymes. Examples of cofactor which can be used in the current
process include but are not limited to NAD+/NADH; NADP+/NADPH; ATP;
ADP, FAD/FADH.sup.2 and FMN/FMNH.sup.2.
[0053] In one embodiment of the invention, a carbon source is
converted to KLG in a process which involves co-factor
regeneration, as shown in FIG. 1. In this enzymatic cofactor
regeneration process, one equivalent of D-glucose is oxidized to
one equivalent of D-gluconate, and one equivalent of NADP+ is
reduced to one equivalent of NADPH by the catalytic action of GDH.
The one equivalent D-gluconate produced by the GDH is then oxidized
to one equivalent of 2-KDG, and then to one equivalent of 2,5-DKG
by the action of membrane bound dehydrogenases GADH and KDGDH,
respectively. The one equivalent 2,5-DKG produced is then reduced
to one equivalent of 2-KLG, and the NADPH is oxidized back to one
equivalent of NADP+ by the action of 2,5-DKG reductase, effectively
recycling the equivalent cofactor to be available for a second
equivalent of D-glucose oxidation. Other methods of cofactor
regeneration can include chemical, photochemical, and
electrochemical means, where the equivalent oxidized NADP+ is
directly reduced to one equivalent of NADPH by either chemical,
photochemical, or electrochemical means.
[0054] Recombinant Methods
[0055] Host Cells
[0056] Any oxidative or reducing enzymes necessary for directing a
host cell carbohydrate pathway into ASA intermediates, such as, for
example, KDG, DKG or KLG, can be introduced via recombinant DNA
techniques known to those of skill in the art if such enzymes are
not naturally occurring in the host cell. Alternatively, enzymes
that would hinder a desired pathway can be mutated by recombinant
DNA methods. The present invention encompasses the recombinant
introduction or mutation of any enzyme or intermediate necessary to
achieve a desired pathway.
[0057] In one embodiment of the present invention a carbon source,
such as glucose, is converted to KLG through multiple oxidation
steps and a reducing step. In this embodiment, the first oxidation
step and the reducing step requires co-factor. The host cell is
Panoea citrea, the naturally occurring nucleic acid encoding
glucose dehydrogenase (GDH) is mutated such that the dehydrogenase
activity is eliminated and a heteologous GDH is introduced into the
cell. The present invention encompasses a host cell having
additional mutation of enzymes in the carbon flow pathway which
affect production. For general techniques, see, for example, the
techniques described in Maniatis et al., 1989, Molecular Cloning A
Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. and Ausubel
et al., 1989, Current Protocols in Molecular Biology, Greene
Publishing "Associates and Wiley Interscience, N.Y.
[0058] In one embodiment of the present invention, nucleic acid
encoding DKG reductase (DKGR) is recombinantly introduced into the
Pantoea fermentation strain. Many species have been found to
contain DKGR, particularly members of the Coryneform group,
including the genera Corynebacterium, Brevibacterium, and
Arthrobacter. In one embodiment of the present invention, 2,5-DKGR
obtainable from Corynebacterium sp. strain SHS752001 (Grindley et
al., 1988, Applied and Environmental Microbiology 54: 1770-1775) is
recombinantly introduced into a Pantdea citrea. In another
embodiment, 2,5 DKG reductase obtainable by Erwinia herbicola is
disclosed in U.S. Pat. No. 5,008,193 to Anderson et al.
[0059] Sources for nucleic acid encoding oxidative or reducing
enzymes include the following:
1 ENZYME CITATION glucose dehydrogenase Smith et al. 1989, Biochem.
J. 261: 973; Neijssel et al. 1989, Antonie Van Leauvenhoek 56(1):
51-61 gluconic acid dehydrogenase Matsushita et al. 1979, J.
Biochem. 85: 1173; Kulbe et al. 1987, Ann. N. Y. Acad Sci 506: 552
2-keto-D-gluconic acid Stroshane 1977 Biotechnol. dehydrogenase
BioEng 19(4) 459 2-keto gluconate reductase J. Gen. Microbiol.
1991, 137: 1479 2,5-diketo-D-gluconic acid reductase United States
Patent Nos: 5,795,761; 5,376,544; 5,583,025; 4,757,012; 4,758,514;
5,008,193; 5,004,690; 5,032,514
[0060] Vector Sequences
[0061] Expression vectors used in expressing the pathway enzymes,
e.g., a dehydrogenase or reductase, of the present process in host
microorganisms comprise at least one promoter associated with the
enzyme, which promoter is functional in the host cell. In one
embodiment of the present invention, the promoter is the wild-type
promoter for the selected enzyme and in another embodiment of the
present invention, the promoter is heterologous to the enzyme, but
still functional in the host cell. In one embodiment of the present
invention, nucleic acid encoding the enzyme is stably integrated
into the microorganism genome.
[0062] In a preferred embodiment, the expression vector contains a
multiple cloning site cassette which preferably comprises at least
one restriction endonuclease site unique to the vector, to
facilitate ease of nucleic acid manipulation. In a preferred
embodiment, the vector also comprises one or more selectable
markers. As used herein, the term selectable marker refers to a
gene capable of expression in the host microorganism which allows
for ease of selection of those hosts containing the vector.
Examples of such selectable markers include but are not limited to
antibiotics, such as, erythromycin, actinomycin, chloramphenicol
and tetracycline.
[0063] A preferred plasmid for the recombinant introduction of
non-naturally occurring enzymes or intermediates into a strain of
Enterobacteriaceae is RSF1010, a mobilizable, but not self
transmissible plasmid which has the capability to replicate in a
broad range of bacterial hosts, including Gram- and Gram+ bacteria.
(Frey et al., 1989, The Molecular biology of IncQ plasmids. In:
Thomas (Ed.), Promiscuous. Plasmids of Gram Negative Bacteria.
Academic Press, London, pp. 79-94). Frey et al. (1992, Gene
113:101-106) report on three regions found to affect the
mobilization properties of RSF1010.
[0064] Transformation
[0065] General transformation procedures are taught in Current
Protocols In Molecular Biology (vol. 1, edited by Ausubel et al.,
John Wiley & Sons, Inc. 1987, Chapter 9) and include calcium
phosphate methods, transformation using DEAE-Dextran and
electroporation. A variety of transformation procedures are known
by those of skill in the art for introducing nucleic acid encoding
a pathway enzyme in a given host cell. The present process
encompasses pathway enzymes produced by and purified from
recombinant host cells and added exogenously into the in vitro
environment as well processes wherein the pathway enzyme, either
heterologous or endogenous to the host cell, is expressed by an
actively growing host cell or present in the membrane of a
non-viable host cell. A variety of host cells can be used for
recombinantly producing the pathway enzymes to be added
exogenously, including bacterial, fungal, mammalian, insect and
plant cells. Plant transformation methods are taught in Rodriquez
(WO 95/14099, published 26 May 1995).
[0066] In a preferred embodiment of the process, the host cell is
an Enterobacteriaceae. Included in the group of Enterobacteriaceae
are Erwinia, Enterobacter, Gluconobacter and Pantoea species. In
the present invention, a preferred Enterobacteriaceae fermentation
strain is a Pantoea species and in particular, Pantoea citrea. In
another preferred embodiment, the host cell is Pantoea citrea
comprising pathway enzymes capable of converting a carbon source to
KLG. The present invention encompasses pathways from carbon source
to KLG through any intermediate in the microbial carbohydrate
pathway capable of using a carbon source to produce KLG, going
through intermediates including but not limited to GA, 2KDG,
2,5DKG, 5DKG, and IA. In one embodiment, nucleic acid encoding the
pathway enzyme is introduced via a plasmid vector and in another
embodiment, nucleic acid encoding a pathway enzyme is stably
integrated, into the host cell genome.
[0067] Identification of Transformants
[0068] Whether a host cell has been transformed can be detected by
the presence/absence of marker gene expression which can suggest
whether the nucleic acid of interest is present However, its
expression should be confirmed. For example, if the nucleic acid
encoding a pathway enzyme is inserted within a marker gene
sequence, recombinant cells containing the insert can be identified
by the absence of marker gene function. Alternatively, a marker
gene can be placed in tandem with nucleic acid encoding the pathway
enzyme under the control of a single promoter. Expression of the
marker gene in response to induction or selection usually indicates
expression of the enzyme as well.
[0069] Alternatively, host cells which contain the coding sequence
for a pathway enzyme and express the enzyme may be identified by a
variety of procedures known to those of skill in the art. These
procedures include, but are not limited to, DNA-DNA or DNA-RNA
hybridization and protein bioassay or immunoassay techniques which
include membrane-based, solution-based, or chip-based technologies
for the detection and/or quantification of the nucleic acid or
protein.
[0070] Additionally, the presence of the enzyme polynucleotide
sequence in a host microorganism can be detected by DNA-DNA or
DNA-RNA hybridization or amplification using probes, portions or
fragments of the enzyme polynucleotide sequences.
[0071] Assay Conditions
[0072] Methods for detection of ASA intermediates, ASA and ASA
sterioisomers include the use of redox-titration with 2,6
dichloroindophenol (Burton et al. 1979, J. Assoc. Pub. Analysts
17:105) or other suitable reagents; high-performance liquid
chromatography (HPLC) using anion exchange (J. Chrom. 1980,
196:163); and electro-redox procedures (Pachia, 1976, Anal. Chem.
48:364). The skilled artisan will be well aware of controls to be
applied in utilizing these detection methods.
[0073] Recovery of Intermediates
[0074] Once produced, the ASA intermediates can be recovered and/or
purified by any means known to those of skill in the art,
including, lyophilization, crystallization, spray-drying, etc. The
intermediates can also be formulated directly from the bioreactor
and granulated or put in a liquid formulation.
[0075] The manner and method of carrying out the present invention
may be more fully understood by those of skill in the art by
reference to the following examples, which examples are not
intended in any manner to limit the scope of the present invention
or of the claims directed thereto. All references and patent
publications referred to herein are hereby incorporated by
reference.
EXAMPLES
Example I
[0076] This example describes the method for producing a Pantoea
citrea host cell having a mutation in the naturally occurring
GDH.
[0077] Cloning of glucose dehydrogenase gene (GDH) from Pantoea
citrea: The glucose dehydrogenase gene was cloned by polymerase
chain reaction (PCR). Two primers were used in the PCR:
5'AGGGAGTGCTTACTACCTTATCTGCGGTAT- A3' and
5'CGCTAGCTGTGCAATCCATTGATTTTGCACA3'. After the PCR, a DNA product
of about 2 kb was cloned in the vector, PGEM-T (Promega), and the
recombinant E. coli with the correct DNA insert was identified and
the clone was desigated as pRL. The DNA insert Was analyzed by DNA
sequencing and its sequence was found to be 60-70% identical to the
published DNA sequences of a GDH of a strain of Pantoea citrae.
[0078] Generation of a deleted GDH gene by the insertion of
chloramphenicol resistance gene:
[0079] To generate the deletion mutant of the GDH gene in Pantoea
citrea, a recombinant copy of the gene to be deleted was first
generated by the introduction of a selectable marker,
chloramphenicol resistance gene (CAT). The in vitro generated copy
was introduced into the Pantoea citrae and allowed to recombine
with the wild-type copy through homologous recombination. The pRL
DNA was then analyzed by digestion with various restriction
enzymes. Two Smal cleavage sites located about 700 bp apart within
the GDH encoding DNA were found. The pRL was digested with Smal to
remove the 700 bp fragment which was then replaced with a Smal
digested 1.05 kb DNA containing the chloramphenicol resistance gene
to generate the recombinant plasmid, designated as pRLcm4. The
method used to generate pRLcm4 were standard techniques used by
those of skill in the art. The GDH-CAT encoding sequence from
pRLcm4 was further transferred to a plasmid, pGP704. The DNA
encoding the GDH-CAT cassette was removed from pRLcm4 by the
combined digestion of restriction enzymes Aatll and Spel. The
cohesive ends of the digested DNA were removed by the treatment of
T4 DNA polymerase in the presense of deoxynucleotide triphosphate
mixtures. The GDH-CAT cassette was then ligated with the EcoRV
digested pGP704. Recombinant plasmid of pGP704 containing the
GDH-CAT cassette was identified and designated as p704RLcm.
[0080] Introduction of the deleted GDH gene into the chromosome of
Pantoea citrae: Plasmid p704RLcm was introduced into wild-type
Pantoea citrae by electroporation. The transformed cell was first
plated in agar plates containing 12.5 ug/ml of chloramphenicol and
resistant colonies were observed. To differentiate the true
deletion mutant (which should display chloramphenicol resistant
phenotype) from cells which simply harbors the plasmid p704RLcm,
the chloramphenicol resistant colonies were screened against
ampicillin, another antibiotic resistance marker carrier by
p704RLcm. Amplicilin sensitve clones were identified. Several
clones which had the right phenotype (chloramphenicol resistant and
amplicilin sensitive) were characterized by biochemical assays and
all exhibited GDH negative phenotype. DNA blot analysis also
confirmed that the wild-type GDH gene was replaced with the deleted
copy.
Example II
[0081] Example II describes the method for producing a host cell
having a mutation in the naturally occurring 2-Keto-D-gluconate
dehydrogenase (E3).
[0082] 2-Keto-D-gluconate dehydrogenase (EC1.1.99.4) from
Gluconobacter melanogenus is purified according to the procedure of
McIntire et al., (McIntire, W., Singer, T. P., Ameyama, M., Adachi,
O., Matsushita, K., and Shinagawa, E. Biochem. J. (1985) 231,
651-654) and references therein. The purified protein is digested
with trypsin and chymotrypsin or other proteases to produce peptide
fragments which are separated by HPLC or other techniques.
Individual peptides are collected and sequenced. From the sequence,
DNA probes are synthesized which will anneal to the corresponding
sequence in the host organism or a related organism's genome. Using
standard PCR techniques, larger fragments of the desired gene are
amplified, purified and sequenced. These fragments are used to
hybridize to the gene and allow for cloning and sequencing of the
entire gene. Once the sequence is known, the gene is deleted as
described for D-gluconate dehydrogenase (GDH) in Example 1
[0083] Other methods to reduce or eliminate 2-keto-D-gluconate
dehydrogenase include inhibitors (organic acids such as citrate and
succinate are reported to inhibit 2-keto-D-gluconate dehydrogenase;
Shinagawa, E. and Ameyama, M. Methods in Enzymology (1982) 89,
194-198), and changes in pH or temperature.
[0084] The enzyme can be assayed for activity or loss of activity
using the assays described in Shinagawa and Ameyama.
Example III
[0085] Example III illustrates a method for producing KLG in
Bioreactor where co-factor is regenerated.
[0086] Materials and Methods
[0087] Cell Permeabilization
[0088] 400 ml of P. citrea cells having a mutation in the naturally
occurring membrane bound GDH was grown to 80 OD (600 nm ) in 10 g/L
gluconate, and mixed with 16 ml of a mixture of 10% toluene and 90%
acetone for 3 minutes at 22 C. The permeabilized cells were then
centrifuged for 10 minutes at 9000 rpm, and the resulting cell
pellet was washed with 400 ml of 50 mM tris, pH 7. The washings
were repeated twice more to ensure removal of residual organic
solvent.
[0089] Charging of the Reactor
[0090] The 400 ml of permeabilized cells in 50 mM tris, pH 7 from
above were placed into a one liter glass vessel equipped with a
stirrer, temperature control, oxygen delivery tube, base delivery
tube, a sample port, and oxygen and pH probes. 200 ul of MAZU
antifoam (BASF) was added to the solution to control excess
foaming, pressurized air was fed to the vessel, the temperature was
brought to 28 C., and the stirrer was turned on to rotate at 1200
rpm until the oxygen probe read over 60% saturation. 16 grams of
crystalline glucose and 4 grams of crystalline Na gluconate were
then added to a final concentration of 10 g/L gluconate and 40 g/L
glucose. The mixture was allowed to react until all the gluconate
had been converted to DKG. The glucose level was maintained above
20 g/L. Due to the cell permeabilization, minimal amounts of
glucose entered into non-productive cellular metabolism. pH was
maintained at 7 by the controlled addition of 50% NaOH
throughout.
[0091] Addition of the Soluble Enzymes and Cofactor
[0092] Once the gluconate was converted to DKG, 2000 units each of
cofactor dependent GDH and DKG reductase (for DKGR, one unit is
equal to one OD absorbance change per minute when measured at 340
nm) were added, along with 400 uM NADP+. The reactor was stirred,
fed air, and maintained at 28 C. as above. Periodic additions of
glucose were made throughout the run to ensure constant substrate
supply for both of the cofactor dependent enzymes.
[0093] Results
[0094] A bioreactor experiment was performed with non-purified
reductase A:F22Y/A272G (U.S. Pat. No. 5,795,761), in the form of a
crude extract from E. coli. T. acidophilum GDH and NADP+ were
purchase in purified form from Sigma. GA to DKG rates were greater
than 10 g/L/hr. Initial 2KLG formation rates were greater than 10
g/L/hr. Integrated rate over the first six hours was over 5 g/L/hr.
Cofactor appeared to be stable over the first 6 hours, and
predominantly in the reduced form. The total turnover number was
537 (215 mM 2KLG /0.4 mM NADP+). During the first six hours, the
intermediates GA and DKG never went above 4 g/L. The run was
stopped 6.5 hours after the initial cell charge, and a wind down
phase of low agitation at 22 C. was run overnight. The final titer
of KLG was about 42 g/L.
[0095] Aliquots were removed during the course of the bioreactor
incubation. These aliquots were first spun in a microfuge to pellet
the cells. To assay for remaining reductase activity, 25
microliters of sample supurnatant were added to a solution composed
of 910 ul buffer (50 mM bis-tris, pH 7), 20 ul DKG (70 mg/ml) and
250 uM NADPH. Reductase activity was measured by monitoring the
loss of absorbance at 340 nm for 1 min. GDH activity was measured
by adding 25 ul of sample to a solution containing 520 ul buffer,
150 ul NaCl (1 M), 200 ul urea (8 M), 50 ul glc (1 M) and 60 ul
NADP+ (5 mM), and monitoring increase in absorbance at 340 nm for 1
min. Both the reductase and the GDH showed full activity throughout
the course of the bioreactor experiment.
Example IV
[0096] This Example illustrates the production of KDG in an
in-vitro bioreactor.
[0097] Cells containing membrane-bound D-glucose dehydrogenase and
D-gluconic acid dehydrogenase activities but not 2-keto-D-gluconate
dehydrogenase activity are grown and harvested. One example of such
a cell is Pantoea citrea which has a mutation in the
2-keto-D-gluconate dehydrogenase enzyme, and is grown and treated
as in Example III. The cells are permeabilized as described in
Example III. Glucose (crystalline or in solution) is added in
aliquots or continuously. The pH is maintained by controlled
addition of a concentrated NaOH solution. The glucose is converted
to D-gluconic acid and then KDG. Product formation is monitored by
analyzing aliquots on a suitable HPLC system. Product is recovered
by removing the cells by centrifugation and concentrating or
removing the remaining liquid.
Example V
[0098] This Example Illustrates that the Addition of Organic
Solvents Increases Reductase Activity
[0099] 1-2 mg of DKG, 250 uM NADPH, F22Y/A272G reductase A and
enough 50 mM bis-tris buffer, pH 7, to bring the final volume to 1
ml is added to a cuvette. Reductase activity is measured by
monitoring the decrease in absorbance at 340 nm. The amount of
reductase added typically produces a change in absorbance of
0.1-0.2 OD/min at room temperature or 30.degree. C. Under the same
conditions, aliquots of methanol or ethanol were added to the
solution and reductase activity measured. Reductase activity in the
presence of various amounts of methanol at 30.degree. C. is shown
in FIG. 3, and activity in the presence of ethanol at 22.degree. C.
is shown in FIG. 4.
[0100] As shown in the Figures, reductase activity is increased in
the presence of certain amounts of methanol or ethanol. Optimal
concentrations range between 10 and 25% of the organic solvent.
[0101] GDH from T. acidophilum has a small decrease in activity
when it is incubated with 10% methanol (assay conditions are 50 mM
Tris, pH 7, 12.5 mM D-glucose, 250 uM NADP+, in 1 ml. Activity is
monitored by the increase in absorbance at 340 nm). Permeabilized
cells were incubated with 15% MeOH and gluconic acid. The
activities of D-gluconic acid dehydrogenase and 2-keto-D-gluconic
acid dehyrogenase were not significantly affected by the addition
of methanol as monitored by product formation (HPLC analysis).
[0102] The addition of methanol or ethanol to a complete bioreactor
reaction would increase reductase activity. Losses in the GDH
activity or other components could be overcome by adding more GDH
or cells.
Example VI
[0103] Example VI illustrates the reductase activity in the
presence of Gafquat and PEG8000.
[0104] Reductase was incubated with 250 uM NADPH, 1-2 mg/ml DKG,
and 0, 0.7% and 2.8% Gafquat (ISP Technologies, Inc.) or 0.5%
PEG8000 in 1 ml (50 mM bis-tris buffer, pH 7) at 30.degree. C.
Reductase activity was measured as in Example VI. As shown in Table
1, the addition of Gafquat increases reductase activity by 80%
compared to activity without Gafquat. PEG8000 increases reductase
activity approximately 15%.
2TABLE 1 Increase of reductase activity in the presence of Gafquat
or PEG8000. Polymer % Added to Final Solution % Activity with No
Additive Gafquat 0.7-2.8 180 PEG8000 0.5 115
Example VII
[0105] Example VII illustrates the reductase activity in the
presence of salt.
[0106] Reductase A F22Y/A272G activity was measured in the presence
of varying amounts of different salts. The assay consisted of
adding reductase to a solution (1 ml final volume) containing 250
uM NADPH, DKG (1-1.5 mg/ml), 50 mM bis-tris buffer, pH 7.0, and
varying amounts of potassium phosphate, NaCl, KCl or CaCl2. All
reactions were done at 30.degree. C. The results are shown in FIG.
5.
[0107] As shown in FIG. 5, reductase activity stays the same or
slightly increases when incubated with up to 100 mM NaCi or KCl.
Activity then drops as salt concentrations are increased to 250 mM.
Reductase activity drops in concentrations of CaCl2 or potassium
phosphate of 20 mM or more. Reductase activity is therefore
sensitive to ionic strength and not to a specific ion.
[0108] The reductase binding constant (Km) for NADPH in the
presence of 200 mM NaCl was determined using standard biochemical
techniques (Fersht, A. "Enzyme Structure and Mechanism" (1977) W.
H. Freeman and Company). The reactions were done in pH 7 bis-tris
buffer containing approximately 1.5 mg/ml DKG at 30.degree. C. and
varying amounts of NADPH. The Km for NADPH in the presence of 200
mM NaCl was found to increase 10-30 fold over the Km determined
without NaCl. The maximal rate (Vmax) in salt was similar or
slightly increased over the no-salt Vmax. One way to reduce the
effect of salt on reductase activity is to increase the
concentration of NADPH until it is at or above the Km under those
conditions. Alternatively, charged species including KLG could be
removed.
Sequence CWU 1
1
2 1 31 DNA Artificial Sequence Synthetic 1 agggagtgct tactacctta
tctgcggtat a 31 2 31 DNA Artificial Sequence Synthetic 2 cgctagctgt
gcaatccatt gattttgcac a 31
* * * * *