U.S. patent application number 10/386575 was filed with the patent office on 2004-09-16 for multimers of s. solfataricus single-stranded dna-binding protein and methods of use thereof.
This patent application is currently assigned to REGENTS OF THE UNIVERSITY OF CALIFORNIA. Invention is credited to Haseltine, Cynthia A., Kowalczykowski, Stephen C..
Application Number | 20040180342 10/386575 |
Document ID | / |
Family ID | 32961707 |
Filed Date | 2004-09-16 |
United States Patent
Application |
20040180342 |
Kind Code |
A1 |
Haseltine, Cynthia A. ; et
al. |
September 16, 2004 |
Multimers of S. solfataricus single-stranded DNA-binding protein
and methods of use thereof
Abstract
The invention provides multimers of S. solfataricus ssDNA
binding protein that bind single stranded DNA. The multimers are
robust and stable reagents for use in PCR and other techniques for
engineering DNA. The invention further provides methods for
performing nucleic acid amplification and engineering using the
multimers.
Inventors: |
Haseltine, Cynthia A.;
(Davis, CA) ; Kowalczykowski, Stephen C.; (Davis,
CA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER
EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
REGENTS OF THE UNIVERSITY OF
CALIFORNIA
Oakland
CA
|
Family ID: |
32961707 |
Appl. No.: |
10/386575 |
Filed: |
March 11, 2003 |
Current U.S.
Class: |
435/6.18 ;
435/199; 435/6.1; 435/91.2 |
Current CPC
Class: |
C12Q 1/686 20130101;
C07K 14/195 20130101; C12P 19/34 20130101; C12Q 1/686 20130101;
C12Q 2522/101 20130101 |
Class at
Publication: |
435/006 ;
435/091.2; 435/199 |
International
Class: |
C12Q 001/68; C12P
019/34; C12N 009/22 |
Goverment Interests
[0001] This invention was made with government support under Grant
(or Contract) No. GM62653 awarded by the National Institutes of
Health and Grant (or Contract) No. 0074380 awarded by the National
Science Foundation. The government has certain rights in this
invention.
Claims
What is claimed is:
1. An isolated multimer, wherein each unit of said multimer has at
least 70% sequence identity to SEQ ID NO:1, and wherein said
multimer binds single stranded DNA.
2. An isolated multimer of claim 1, wherein each unit of said
multimer has at least 80% sequence identity to SEQ ID NO:1.
3. An isolated multimer of claim 1, wherein each unit of said
multimer has at least 90% sequence identity to SEQ ID NO:1.
4. An isolated multimer of claim 1, wherein each unit has the
sequence of SEQ ID NO:1.
5. An isolated multimer of claim 1, wherein said multimer is a
tetramer.
6. A method of performing nucleic acid amplification, said method
comprising contacting a single stranded DNA with a multimeric
protein, wherein each unit of said multimeric protein has at least
70% sequence identity to SEQ ID NO:1, and wherein said multimeric
protein binds single stranded DNA.
7. A method of claim 6, wherein each unit of said multimeric
protein has at least 80% sequence identity to SEQ ID NO:1.
8. A method of claim 6, wherein each unit of said multimeric
protein has at least 90% sequence identity to SEQ ID NO:1.
9. A method of claim 6, wherein each unit of said multimeric
protein has the sequence of SEQ ID NO:1.
10. A method of claim 6, wherein said nucleic acid amplification is
selected from the group consisting of polymerase chain reaction,
ligase chain reaction, transcription-based amplification system,
and self-sustained sequence replication system.
11. A method of claim 10, wherein the method of nucleic acid
amplification is polymerase chain reaction.
12. A method for performing nucleic acid engineering, comprising
contacting single stranded DNA with a multimeric protein, wherein
each unit of said multimeric protein has at least 70% sequence
identity to SEQ ID NO:1, and wherein said multimeric protein binds
single stranded DNA.
13. A method of claim 12, wherein each unit of said multimeric
protein has at least 80% sequence identity to SEQ ID NO:1, and
wherein said multimeric protein binds single stranded DNA.
14. A method of claim 12, wherein each unit of said multimeric
protein has at least 90% sequence identity to SEQ ID NO:1, and
wherein said multimeric protein binds single stranded DNA.
15. A method of claim 12, wherein each unit of said multimeric
protein has the sequence of SEQ ID NO:1, and wherein said
multimeric protein binds single stranded DNA.
16. A method of claim 12, wherein said nucleic acid engineering is
selected from the group consisting of PCR-based DNA sequencing,
recombination mediated cloning, PCR-mediated gene replacement,
PCR-mediated recombination, RT-PCR cDNA synthesis, and in vitro
sequence mutagenesis.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0002] NOT APPLICABLE
REFERENCE TO A "SEQUENCE LISTING," A TABLE, OR A COMPUTER PROGRAM
LISTING APPENDIX SUBMITTED ON A COMPACT DISK
[0003] NOT APPLICABLE
FIELD OF THE INVENTION
[0004] This invention relates to single stranded DNA binding
proteins that are robust reagents for use in nucleic acid
amplification reactions.
BACKGROUND OF THE INVENTION
[0005] Single-stranded DNA (ssDNA) binding proteins (SSBs) are
essential in most intracellular interactions that involve DNA,
including replication, repair, and recombination (Kowalczykowski,
S. C. et al., Microbiol Rev 58:401-465 (1994); Lohman, T. M. et
al., Annu Rev Biochem 63:527-570 (1994) ("Lohman 1994")).
Homologues of this class of proteins were identified in all three
domains of life, as well as in viral genomes (Chedin, F. et al.,
Trends Biochem Sci 23:273-277 (1998) ("Chedin 1998"); Iftode, C. et
al., Crit Rev Biochem Mol Biol 34:141-180 (1999); Kelly, T. J. et
al., Proc Natl Acad Sci USA 95:14634-14639 (1998); Kowalczykowski,
S. C. et al., Single-stranded DNA binding proteins. in The Enzymes.
Boyer, P. D. (ed.) New York: Academic Press, pp. 373-442 (1981);
Lohman 1994; Wold, M. S. Annu Rev Biochem 66:61-92 (1997)). Despite
the lack of strong homology at the amino acid level, preservation
of both structural and domain organization suggests that SSBs are
derived from a common evolutionary ancestor (Chedin 1998;
Pfuetzner, R. A. et al., J Biol Chem 272:430-434 (1997);
Raghunathan, S. et al., Nat Struct Biol 7:648-652 (2000)). While
functionally equivalent, eubacterial SSB and the eukaryotic
version, RPA, have distinctly different quaternary structures. In
eubacteria, SSB is encoded by a single gene and the active form of
the protein is a homotetramer in which each monomer provides one
ssDNA-binding domain (Lohman 1994). In eukaryotes, the RPA complex
from both humans and yeast is composed of three distinct subunits
which together provide a total of four ssDNA-binding domains
(Brill, S. J. et al., Mol Cell Biol 18:7225-7234 (1998)).
[0006] Archaea are a separate group of organisms distinguished from
the eubacteria through 16S rDNA sequence analysis. These
prokaryotes are further subdivided into three diverse groups named
the crenarchaeota, the euryarchaeota, and the korarchaeota (Barns,
S. M. et al., Proc Natl Acad Sci USA, 93:9188-9193 (1996); Woese,
C. R. et al., Proc Natl Acad Sci USA 87:4576-4579 (1990); Woese, C.
R. et al., Proc Natl Acad Sci USA 74:5088-5090 (1977)). Only
members of the crenarchaeal and euryarchaeal groups, however, have
been cultivated. Genomic studies suggest a significant evolutionary
division between metabolic and informational processes in archaea.
While most intermediary metabolic processes strongly resemble those
observed in eubacteria, genomic informational processes are
generally thought to be more closely related to those found in
eukaryotes (reviewed in (Doolittle, W. F. et al., Curr Biol
8:R209-211 (1998))).
[0007] Archaea utilize eukaryotic B-type DNA polymerases for
replication, and their ribosomal proteins, as well as translation
initiation factors, are remarkably eukaryotic. The recent
identification of archaeal snoRNA genes reveals an unexpected
eukaryotic connection (Omer, A. D. et al., Science 288:517-522
(2000)). Transcription also involves eukaryotic protein homologues,
but the discovery of multiple TBP and TFB proteins in halophiles
hints at a unique archaeal transcription mechanism (Baliga, N. S.
et al., Mol Microbiol, 36:1184-1185 (2000)). Examination of
archaeal recombination proteins suggests a definite similarity with
eukaryotes. The archaeal DNA strand exchange protein RadA is more
similar to its eukaryotic counterpart, Rad51 protein, than to the
eubacterial RecA protein, both at the amino acid level (Sandler, S.
J. et al., J Bacteriol 181:907-915 (1999)) and at the biochemical
level (Seitz, E. M. et al., Genes Dev 12:1248-1253 (1998)). The
associated RadB protein is proposed to serve as a simpler archaeal
version of eukaryotic Rad55/57 protein (DiRuggiero, J. et al., J
Mol Evol 49:474-484 (1999); Komori, K. et al., J Biol Chem
275:33782-33790 (2000); Rashid, N. et al., Mol Gen Genet
253:397-400 (1996)), and archaeal Holliday junction resolvase
protein characterization suggests they may also be eukaryotic in
nature (Komori, K. et al., Proc Natl Acad Sci USA 96:8873-8878
(1999); Kvaratskhelia, M. et al., J Mol Biol 297:923-932
(2000)).
[0008] Recent descriptions of archaeal SSB homologues from the
euryarchaeal branch of the archaeal domain demonstrate their amino
acid sequences are more similar to eukaryotic RPA than to
eubacterial SSB (Chedin 1998; Kelly, T. J. et al., Proc Natl Acad
Sci USA 95:14634-14639 (1998)). However, these archaeal proteins
maintain multiple ssDNA-binding domains within one or just a pair
of polypeptides and therefore, are expected to function as monomers
or heterodimers rather than as a homotetramer (as does E. coli
SSB). It was proposed that these archaeal RPA homologues are
evolutionarily related to eukaryotic RPA through gene duplication
and recombination events (Chedin 1998).
[0009] Genome sequencing of several archaeons simplified molecular
analysis in these organisms. While a number of euryarchaeal genome
sequences have been determined, to date the only publicly available
crenarchaeal genome sequences are that of Aeropyrum pernix
(Kawarabayasi, Y. et al., DNA Res 6:83-101:145-152 (1999)) and
Sulfolobus solfataricus (She, Q. et al., Proc Natl Acad Sci USA
98:7835-7840(2001)). In 2001, Wadsworth and White described the
identification of an ssDNA binding protein from S. solfataricus.
Wadsworth and White, Nuc Acids Res 29(4):914-920 (2001).
BRIEF SUMMARY OF THE INVENTION
[0010] This invention provides isolated multimers, wherein each
unit of said multimer has at least 70% sequence identity to SEQ ID
NO:1, and wherein the multimer binds single stranded DNA. In some
embodiments, each unit of the multimer has at least 80% sequence
identity to SEQ ID NO:1. In other embodiments, each unit of the
multimer has at least 90% sequence identity to SEQ ID NO:1. The
invention further provides embodiments wherein each unit has the
sequence of SEQ ID NO:1. In some preferred embodiments, the
multimer is a tetramer.
[0011] In another important group of embodiments, the invention
provides methods of performing nucleic acid amplification, said
method comprising contacting a single stranded DNA with a
multimeric protein, wherein each unit of the multimeric protein has
at least 70% sequence identity to SEQ ID NO:1, and wherein said
multimer binds single stranded DNA. In some of these embodiments,
each unit of the multimeric protein has at least 80% sequence
identity to SEQ ID NO:1, while in others, each unit of the
multimeric protein has at least 90% sequence identity to SEQ ID
NO:1. In some embodiments, each unit of the multimeric protein has
the sequence of SEQ ID NO:1. The nucleic acid amplification can be,
for example, polymerase chain reaction, ligase chain reaction,
transcription-based amplification system, and self-sustained
sequence replication system. In some embodiments, the method of
nucleic acid amplification is polymerase chain reaction.
[0012] The invention further provides methods for performing
nucleic acid engineering, comprising contacting single stranded DNA
with a multimeric protein, wherein each unit of the multimeric
protein has at least 70% sequence identity to SEQ ID NO:1, and
wherein said multimer binds single stranded DNA. In some of these
embodiments, each unit of the multimeric protein has at least 80%
sequence identity to SEQ ID NO:1, while in others, each unit of the
multimeric protein has at least 90% sequence identity to SEQ ID
NO:1. In some embodiments, each unit of the multimeric protein has
the sequence of SEQ ID NO:1. The nucleic acid engineering can be,
for example, PCR-based DNA sequencing, recombination mediated
cloning, PCR-mediated gene replacement, PCR-mediated recombination,
RT-PCR cDNA synthesis, and in vitro sequence mutagenesis.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1. Alignment of ssDNA-binding domain protein sequences.
Crenarchaeal sequences are aligned with the first ssDNA-binding
domains of M. jannachii RPA (SEQ ID NO:5), S. cerevisiae RPA70 (SEQ
ID NO:6), and H. sapiens RPA70 (SEQ ID NO:7). Identical residues
are shaded black and conserved residues are shaded gray. The *
symbol indicates residues identified in the H. sapiens RPA70 that
interact with DNA (Bochkarev, A. et al., Nature, 385:176-181
(1997)), while an x indicates residues that are identical between
the two crenarchaeal sequences. The consensus is shown beneath the
alignment. Sequence accession numbers are as follows: S.
solfataricus SSB (portion shown in Figure is SEQ ID NO:3), SSO2364;
A. pernix SSB (portion shown in Figure is SEQ ID NO:4), giS510001;
M. jannachii RPA, MJ1159; S. cerevisiae RPA70, gi6319321; H.
sapiens RPA70, gi1350579.
[0014] FIG. 2. Schematic representation of the domainal
architecture of ssDNA-binding proteins in all three domains of
life. Homologous DNA-binding domains are represented by shaded
boxes and the location of the zinc-finger motif is indicated. A
summary of the attributes of each type of ssDNA-binding protein is
represented in the boxes. A range of percentage similarities for
proteins from each domain to the first single-stranded DNA-binding
domain of S. cerevisiae RPA70 were determined using the BestFit
program and are indicated.
[0015] FIG. 3. SDS-PAGE of the purified SsoSSB protein. Samples
were subjected to SDS-PAGE and gels were stained with Coomassie
brilliant blue R250. The samples loaded were: uninduced crude cell
sonicate (lane 1, 100 .mu.g protein); induced crude cell sonicate
(lane 2, 100 .mu.g protein); heat-treated clarified sonicate (lane
3, 80 .mu.g protein); pooled ssDNA-cellulose fractions (lane 4, 15
.mu.g protein); and concentrated Resource Q fractions (lane 5, 15
.mu.g protein). The arrow indicates the position of the SsoSSB
protein.
[0016] FIG. 4 consists of FIGS. 4A and 4B, showing gel filtration
chromatography of SsoSSB protein. FIG. 4A. Elution of purified
SsoSSB protein relative to molecular weight standards: BSA (66
kDa), carbonic anhydrase (29 kDa), and cytochrome C (12.4 kDa),
which are represented by closed squares. Ve/Vo, elution volume
divided by void volume. FIG. 4B. A representative elution profile
for purified SsoSSB protein. Closed squares represent optical
density at 280 nm (OD.sub.280) for the elution volume
indicated.
[0017] FIG. 5. Gel mobility-shift analysis of SsoSSB protein
binding to ssDNA. Increasing concentrations of protein (0.04 .mu.M
to 20 .mu.M) were added to a constant concentration of 63-mer
oligonucleotide (10 .mu.M nucleotides).
[0018] FIG. 6 consists of FIGS. 6A and 6B, and shows that
overexpression of SsoSSB protein rescues the lethal phenotype of an
E. coli ssb-1 mutation. Both Figures: KLC789 cells containing the
pTara arabinose-inducible T7 expression plasmid, and either pET21a
(circles) or the SsoSSB expression vector (squares) were grown at
30.degree. C. in either arabinose (closed symbols) or glucose (open
symbols). Cultures were shifted to 43.degree. C. at the point
indicated by the arrow. FIG. 6A. Optical densities were monitored
spectrophotometrically at 600 nm. FIG. 6B. Colony forming units
(cfu) were determined by plating in triplicate and the points shown
are averages of the replicates.
[0019] FIG. 7 consists of FIGS. 7A and 7B and shows that SsoSSB
protein stimulates DNA strand exchange by E. coli RecA protein.
FIG. 7A. A schematic representation of the formation of nicked
circular dsDNA and joint molecules from starting substrates. FIG.
7B. Photo of gel. Lane 1, no protein; lane 2, RecA protein; lane 3,
RecA protein and SsoSSB protein; lane 4, RecA protein and E. coli
SSB protein. The abbreviations are: JM, joint molecules; NC, nicked
circular dsDNA; DS, dsDNA; and SS, ssDNA.
[0020] FIG. 8 consists of FIGS. 8A and 8B. FIG. 8A sets forth the
amino acid sequence of SsoSSB protein. FIG. 8B sets forth the
nucleotide sequence encoding SsoSSB protein.
DETAILED DESCRIPTION
[0021] I. Introduction
[0022] The crenarchaeon S. solfataricus is a hyperthermophic aerobe
that grows in sulfur hot springs. Its optimal growth conditions are
temperatures of 70-90.degree. C. and pH levels from 2-4. The entire
genome of the organism was sequenced and published in 2001. She et
al., "The complete genome of the crenarchaeon Sulfolobus
solfataricus P2," Proc. Natl Acad Sci (USA) 98:7835-7840 (2001). In
2001, Wadsworth and White reported the identification of a
single-stranded DNA (ssDNA) binding protein (SSB) from S.
solfataricus. Wadsworth and White, Nuc Acids Res 29(4):914-920
(2001). The work from this laboratory indicates that the SSB is
present as a monomer.
[0023] The S. solfataricus ssDNA binding protein ("SsoSSB protein")
consists of 148 amino acids with 47% identity and 69% similarity
(that is, that the residues are either identical or conservative
substitutions for one another) to the SSB of another crenarchaeon,
A. pernix. The amino acid sequence of SsoSSB (SEQ ID NO:1) is shown
in FIG. 8A, and is available in the National Center for
Biotechnology Information Entrez database under accession numbers
NP.sub.--343725 and AAK42515.
[0024] Surprisingly, it has been discovered that the monomers of S.
solfataricus ssDNA binding protein ("SsoSSB protein") associate
with one another to form a complex, referred to herein as
"multimeric protein" or a "multimer") in solution and it is the
complex, or multimeric protein, that is functional in binding
ssDNA. The multimeric proteins are, however, composed of monomers
of the SsoSSB protein. The multimers are comprised of multiples of
2. It is believed that the multimers are not composed of more than
24 monomers of SsoSSB, and are more commonly composed of 12 or
fewer. Data from the studies reported in the Examples indicates
that SsoSSB is present in solution primarily as dimers and
tetramers, with tetramers being the prevalent multimeric form
present. The most active form of the protein is therefore a
homotetramer in which each monomer provides one ssDNA-binding
domain. While S. solfataricus SSB has no sequence homology to the
E. coli SSB protein, it therefore physically acts more like the SSB
found in eubacteria, which multimerize, than like those found in
eukaryotes and the SSB of other archaeons identified to date.
[0025] Accordingly, the present invention provides multimers
comprising monomers of single stranded DNA binding protein of S.
solfataricus or of defined variations of the SsoSSB protein that
retain the ability to bind ssDNA. In preferred forms, the multimer
is a dimer (that is, an assembly of two monomers) or a tetramer
(that is, an assembly of four monomers), with the tetramer form
being the most preferred. The multimers function to bind ssDNA.
[0026] II. Uses of the ssDNA-Binding Proteins of the Invention
[0027] Members of the Archaea typically live in conditions of
extreme heat, pH, or salt concentrations. Thus, they offer a source
of enzymes and other proteins which can be useful reagents in
assays and other commercial reactions. As noted above, the
crenarchaeon S. solfataricus grows optimally at temperatures
between 70-90.degree. C. Thus, its proteins are particularly
adapted for use at temperatures which are high for reagents
originating from biological sources. More specifically, the DNA
replication of S. solfataricus takes place at high temperature.
But, the multimers are active over a wide range of temperatures,
and can be used at temperatures as low as 37.degree. C. to as high
as 65.degree. C. and even as high as 90.degree. C.
[0028] During polymerase chain reaction (PCR), this activity
permits DNA polymerase to replicate more of the DNA template strand
in each PCR cycle than would be replicated in the absence of the
protein, thereby increasing yield. Moreover, temperature-resistant
proteins such as SsoSSB protein multimers are not inactivated by
the temperature cycling which is part of the PCR process, and thus
do not have to be replaced before the next reaction can proceed.
This enhances the ability to automate the procedures. Thus, use of
heat-resistant ssDNA-binding proteins, like the multimers provided
here, not only increases the yield of each PCR cycle, but also
permits automation of the overall process and the speed with which
cycles can be conducted.
[0029] Additionally, archaeal proteins are much more stable than
most eukaryotic and bacterial proteins. For example, SSB protein
from E. coli must be stored at -80.degree. C. If refrigerated, it
loses some or all of its activity within a month and at room
temperature, it loses some or all of its activity within 72 hours.
By contrast, SsoSSB retains its activity at room temperature for at
least three weeks, and can be refrigerated for over a year without
loss of activity. The stability of the protein therefore makes it
convenient for use even in protocols in which high temperatures are
not required.
[0030] SsoSSB protein multimers are therefore robust reagents
useful for a variety of biotechnical applications involving
amplification or engineering of nucleic acids, or both. The
multimers are expected to be useful in a number of such techniques
well known in the art, such as PCR, ligase chain reaction,
transcription-based amplification system, self-sustained sequence
replication system, PCR-based DNA sequencing, recombination
mediated cloning, PCR-mediated gene replacement, PCR-mediated
recombination, reverse transcriptase (RT)-PCR cDNA synthesis, and
in vitro sequence mutagenesis. For convenience, techniques which
employ the binding of ssDNA in the course of manipulating nucleic
acids, such as PCR-based DNA sequencing, recombination mediated
cloning, PCR-mediated gene replacement, PCR-mediated recombination,
reverse transcriptase (RT)-PCR cDNA synthesis, and in vitro
sequence mutagenesis, are sometimes referred to herein as "nucleic
acid engineering."
[0031] III. Modifications of S. solfataricus ssDNA Binding Protein
Multimers.
[0032] It is understood that the S. solfataricus ssDNA binding
protein can be modified and still retain the desired robustness and
ssDNA binding function. In some embodiments, the amino acid
sequence has at least 70% identity to that of SEQ ID NO:1. In other
embodiments, the amino acid sequence has 75%, 80%, 85%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98% or even 99% identity to SEQ ID
NO:1 (with each increasing percentage of identity being more
preferred), and retains the ability to bind ssDNA.
[0033] It should be noted that the monomers composing a particular
multimer need not be exact duplicates of one another. Thus, while a
dimer or a tetramer of the invention is for convenience considered
a homodimer or a homotetramer, the monomers of the dimer or
tetramer may not be precisely identical. In a given tetramer, for
example, one monomer might have the native sequence of SEQ ID NO:1,
the second monomer might have a conservative substitution compared
to the native sequence (SEQ ID NO:1) and the third and fourth
monomers might have only 80% and 90% sequence identity,
respectively, to the native sequence. Or, all four monomers of the
tetramer might be close to the sequence of SEQ ID NO:1, but each
might have several conservative substitutions of residues of SEQ ID
NO:1. Or, all four monomers might have the same two conservative
substitutions and otherwise have the sequence of SEQ ID NO:1, or
all four might have the sequence of native SEQ ID NO:1, in which
case all the monomers are identical to one another. Whatever the
exact composition of the individual monomers, however, it is
important is that the multimer they form retains the desired
ability to bind ssDNA.
[0034] Persons of skill are also aware that ssDNA binding proteins
typically contain a motif known as an
oligonucleotide/oligosaccharide binding ("OB")-fold". OB-fold
proteins are a superfamily of proteins having common structural
features; both the superfamily and the common structural features
are well known in the art. See, e.g., Callebaut and Mornon, Biochem
J 321:125-32 (1997). Williamson et al., Biochemistry 33:11745-59
(1994) summarize some of these features: "[t]he common structural
features include the number of beta-strands and their arrangement,
the beta-barrel shear number, an interstrand hydrogen bond network,
the packing of the hydrophobic core, and a conserved beta-bulge."
One feature of ssDNA binding, OB-fold proteins is the presence of a
channel in the protein so sized as to permit binding of ssDNA along
the channel. As noted by Bochkarev et al., Nature 385:176-81
(1997): "[t]he ssDNA lies in a channel that extends from one
subdomain to the other." For ease in visualization, the protein
channel is sometimes described in the art as similar in
conformation to a hand curled around a glass.
[0035] SsoSSB protein is a monomer, which contains an OB-fold
between residues 32-71. The monomers assemble into a multimer with
structural features typical of OB-fold proteins which bind ssDNA.
Multimers of SsoSSB proteins form a channel so sized as to permit
binding of the ssDNA along the channel. The carboxyl terminus of
the protein monomers also contains a number of acidic residues.
[0036] FIG. 1 shows an alignment of SsoSSB protein with other
OB-fold ssDNA binding proteins. As noted in the Description of FIG.
1, the SsoSSB residues shown on a black background are identical
among these proteins. These residues can be assumed to be important
for protein function and their substitution in an SsoSSB monomer is
therefore generally less favored. As also noted in the Description
of FIG. 1, residues shown on a gray background are conservative
substitutions among the proteins. Thus, it is expected that other
conservative substitutions of these residues in an SsoSSB monomer
will likely result in a functional ssDNA binding proteins multimer.
The residues shown in FIG. 1 on a normal, white background are not
conserved among the various ssDNA binding proteins aligned in the
Figure; these residues can generally undergo substitution. In
preferred embodiments, the substitutions are conservative
substitutions. Substitutions can also generally be made outside of
the OB-fold region defined by residues 32-71. Any particular
substitution can be readily tested, for example by the assays set
forth in the Examples, to confirm that the substitution does not
decrease the ability to bind ssDNA below any particular degree
chosen by the practitioner.
[0037] Preferably, a multimer containing the modified protein
retains at least 50% of the ability of a multimer of native S.
solfataricus SSB to bind DNA. More preferably, a multimer
containing the modified protein has at least 60%, 65%, 70% 75%,
80%, 85%, 90%, 95% or even more of the ability of a multimer of
native S. solfataricus SSB to bind ssDNA, as measured in such
assays. Gel-shift assays provide especially convenient methods of
determining the degree to which any particular modified SsoSSB
protein multimer retains the ability of a native SsoSSB protein
multimer to bind single stranded DNA. Many other such assays are,
however, known in the art and can be used at the practitioner's
choice. For example, the multimers can be permitted to bind ssDNA
and the fluorescence of the proteins examined by spectrophotometry.
Higher degrees of binding are detected by decreased fluorescence as
more amino acids of the proteins are blocked by the DNA.
[0038] Although the discussion above refers to substitutions of the
native SsoSSB sequence, SEQ ID NO:1, persons of skill will be aware
that it is not necessary to first synthesize or express the protein
and then to modify it. Typically, the practitioner decides on the
substitution or substitutions desired, and assembles a nucleic acid
vector that when expressed in a suitable host cell, such as E.
coli, results in a protein with the desired sequence. Kits for
engineering plasmids containing desired nucleic acid inserts and
expressing such vectors in host cells are commercially available
from a number of venders, and are well known in the art.
[0039] The terms "identical" or percent "identity," in the context
of two or more polypeptide sequences, refer to two or more
sequences or subsequences that are the same or have a specified
percentage of amino acid residues that are the same, when compared
and aligned for maximum correspondence over a comparison window, as
measured using one of the following sequence comparison algorithms
or by manual alignment and visual inspection. When percentage of
sequence identity is used in reference to proteins or peptides, it
is recognized that residue positions that are not identical often
differ by conservative amino acid substitutions, where amino acids
residues are substituted for other amino acid residues with similar
chemical properties (e.g., charge or hydrophobicity) and therefore
do not change the functional properties of the molecule. Where
sequences differ in conservative substitutions, the percent
sequence identity may be adjusted upwards to correct for the
conservative nature of the substitution. Means for making this
adjustment are well known to those of skill in the art. Typically
this involves scoring a conservative substitution as a partial
rather than a full mismatch, thereby increasing the percentage
sequence identity. Thus, for example, where an identical amino acid
is given a score of 1 and a non-conservative substitution is given
a score of zero, a conservative substitution is given a score
between zero and 1. The scoring of conservative substitutions is
calculated according to, e.g., the algorithm of Meyers &
Miller, Computer Applic. Biol. Sci. 4:11-17 (1988), e.g., as
implemented in the program PC/GENE (Intelligenetics, Mountain View,
Calif., USA).
[0040] As noted, one type of substitution is termed a "conservative
substitution." One of skill will recognize that individual
substitutions, in a peptide, polypeptide, or protein sequence which
alters a single amino acid or a small percentage of amino acids in
the encoded sequence are "conservatively modified variants" where
the alteration results in the substitution of an amino acid with a
chemically similar amino acid. Conservative substitution tables
providing functionally similar amino acids are well known in the
art. The following six groups each contain amino acids that are
generally considered to be conservative substitutions for one
another:
[0041] 1) Alanine (A), Serine (S), Threonine (T);
[0042] 2) Aspartic acid (D), Glutamic acid (E);
[0043] 3) Asparagine (N), Glutamine (Q);
[0044] 4) Arginine (R), Lysine (K);
[0045] 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V);
and
[0046] 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
[0047] (see, e.g., Creighton, Proteins (1984)).
[0048] The phrase "substantially identical," in the context of two
polypeptides, refers to sequences or subsequences that have at
least 60%, preferably 70%, more preferably 80%, most preferably
90-95% amino acid residue identity when aligned for maximum
correspondence over a comparison window as measured using one of
the following sequence comparison algorithms or by manual alignment
and visual inspection. This definition also refers to the
complement of a test sequence, which has substantial sequence or
subsequence complementarity when the test sequence has substantial
identity to a reference sequence.
[0049] One of skill in the art will recognize that two polypeptides
can also be "substantially identical" if the two polypeptides are
immunologically similar. Thus, overall protein structure may be
similar while the primary structure of the two polypeptides display
significant variation. Therefore, a method to measure whether two
polypeptides are substantially identical involves measuring the
binding of monoclonal or polyclonal antibodies to each polypeptide.
Two polypeptides are substantially identical if the antibodies
specific for a first polypeptide bind to a second polypeptide with
an affinity of at least one third of the affinity for the first
polypeptide.
[0050] For sequence comparison, typically one sequence acts as a
reference sequence, to which test sequences are compared. When
using a sequence comparison algorithm, test and reference sequences
are input into a computer, subsequence coordinates are designated,
if necessary, and sequence algorithm program parameters are
designated. The sequence comparison algorithm then calculates the
percent sequence identity for the test sequence(s) relative to the
reference sequence, based on the designated program parameters.
[0051] Optimal alignment of sequences for comparison can be
conducted, e.g., by the local homology algorithm of Smith &
Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment
algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970),
by the search for similarity method of Pearson & Lipman, Proc.
Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, 575 Science Dr., Madison, Wis.), or by visual
inspection (see generally, Current Protocols in Molecular Biology,
F. M. Ausubel et al., eds., Current Protocols, a joint venture
between Greene Publishing Associates, Inc. and John Wiley &
Sons, Inc., (1995 Supplement) (Ausubel)).
[0052] Examples of algorithms that are suitable for determining
percent sequence identity and sequence similarity are the BLAST and
BLAST 2.0 algorithms, which are described in Altschul et al. (1990)
J. Mol. Biol. 215: 403-410 and Altschul et al. (1997) Nucleic Acids
Res. 25: 3389-3402, respectively. Software for performing BLAST
analyses is publicly available through the National Center for
Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This
algorithm involves first identifying high scoring sequence pairs
(HSPs) by identifying short words of length W in the query
sequence, which either match or satisfy some positive-valued
threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score
threshold (Altschul et al, supra). These initial neighborhood word
hits act as seeds for initiating searches to find longer HSPs
containing them. The word hits are then extended in both directions
along each sequence for as far as the cumulative alignment score
can be increased. Cumulative scores are calculated using, for
nucleotide sequences, the parameters M (reward score for a pair of
matching residues; always>0) and N (penalty score for
mismatching residues; always<0). For amino acid sequences, a
scoring matrix is used to calculate the cumulative score. Extension
of the word hits in each direction are halted when: the cumulative
alignment score falls off by the quantity X from its maximum
achieved value; the cumulative score goes to zero or below, due to
the accumulation of one or more negative-scoring residue
alignments; or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and
speed of the alignment. The BLASTN program (for nucleotide
sequences) uses as defaults a wordlength (W) of 11, an expectation
(E) of 10, M=5, N=-4, and a comparison of both strands. For amino
acid sequences, the BLASTP program uses as defaults a wordlength
(W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix
(see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915
(1989)).
[0053] In addition to calculating percent sequence identity, the
BLAST algorithm also performs a statistical analysis of the
similarity between two sequences (see, e.g., Karlin & Altschul,
Proc. Nat'l. Acad. Sci. USA 90:5873-5787(1993)). One measure of
similarity provided by the BLAST algorithm is the smallest sum
probability (P(N)), which provides an indication of the probability
by which a match between two amino acid sequences would occur by
chance.
[0054] "Conservatively modified variants" applies to both amino
acid and nucleic acid sequences. With respect to particular nucleic
acid sequences, conservatively modified variants refers to those
nucleic acids which encode identical or essentially identical amino
acid sequences, or where the nucleic acid does not encode an amino
acid sequence, to essentially identical sequences. Because of the
degeneracy of the genetic code, a large number of functionally
identical nucleic acids encode any given protein. For instance, the
codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
Thus, at every position where an alanine is specified by a codon,
the codon can be altered to any of the corresponding codons
described without altering the encoded polypeptide. Such nucleic
acid variations are "silent variations," which are one species of
conservatively modified variations. One of skill will recognize
that each codon in a nucleic acid (except AUG, which is ordinarily
the only codon for methionine) can be modified to yield a
functionally identical molecule. Accordingly, each silent variation
of a nucleic acid which encodes a polypeptide is implicit in any
particular described sequence.
EXAMPLES
[0055] The following examples are offered to illustrate, but not to
limit the claimed invention.
Example 1
[0056] This Example sets forth materials and methods used in the
studies reported herein.
[0057] Alignment of protein sequences. The S. solfataricus ssb
sequence (SSO2364) encoding the SSB protein (SsoSSB) was identified
using BLASTP at the S. solfataricus genome website:
http://www-archbac.u-psud.fr/proje- cts/sulfolobus. The A. pernix
ssb sequence (gi51105001) encoding the SSB protein (ApeSSB) was
identified using BLAST at the PEDANT website:
http://pedant.gsf.de/. Both open reading frames were recognized
through their homology to MJ1159, encoding the Methanococcus
jannaschii RPA protein (Chedin, F. et al., Trends Biochem Sci
23:273-277 (1998)). Subsequent alignments were performed using the
ALIGN program at http://www.toulouse.inra.fr/multalin.html and
additional features were highlighted by manual adjustment. BestFit
comparisons were performed using the Wisconsin Package Version
10.1, Genetics Computer Group (GCG), Madison, Wis. and were between
S. cerevisiae RPA70 single-stranded DNA-binding region 1
(gi6319321, amino acids 301-399) and the following single-stranded
DNA-binding protein sequences; Archaeoglobus fulgidus (gi11497994),
A. pernix (gi5105001), Bacillus subtilis (gi2127217), Escherichia
coli (gi134913) Homo sapiens (gi1350579), M. jannaschii (MJ1159),
Methanobacterium thermoautotrophicum (gi2622495), Pyrococcus
abyssii (gi5457718), Pyrococcus horikoshii (gi3258332), S.
solfataricus (SSO2364), as well as between E. coli SSB protein
(gi134913) and S. solfataricus (SSO2364). The A. fulgidus sequence
used was one of two identified as homologous to MJ1159 and is the
most homologous to the N-terminus of the M. jannaschii protein
(Chedin 1998). The M. thermoautotrophicum sequence was adjusted to
account for the frameshift identified by Chedin 1998.
[0058] Strains and cultivation. S. solfataricus strain P2 (DSM
1616, (Zillig, W. et al., Arch Microbiol 125:259-269 (1980)) was
the generous gift of Dennis Grogan (University of Cincinnati) and
was grown at 80.degree. C. as described (Rolfsmeier, M. et al., J
Bacteriol 180:1287-1295 (1998)) at a pH of 3.0 in screw cap flasks
as described (Rolfsmeier, M. et al., J Bacteriol 177:482-485
(1995)). Basal salts medium was Allen's medium (Allen M. B., Arch.
Mikrobiol., 32:270-277 (1959)) as modified by Brock (Brock, T. D.
et al., Arch Mikrobiol 84:54-68 (1972)) and was supplemented with
tryptone to a final concentration of 0.2% (w/v). Growth was
monitored spectrophotometrically at a wavelength of 540 nm.
Escherichia coli strains were DH5.alpha. (.phi.80dlacZ.DELTA.15,
endA1, recA1, hsdR17 (r.sub.k.sup.-,m.sub.k.sup.+- ), supE44,
thi-1, gyrA96, relA1, .DELTA.(lacZYA-argF)U169); BL21(DE3) (ompT
[lon] hsdSB (r.sub.B.sup.-m.sub.B.sup.-; an E. coli B strain) with
DE3, a X prophage carrying the T7 RNA polymerase gene); and KLC789
(F.sup.-, metA 7, rha8, thyA36, amp50, deoC2, ssb-1) (Chase, J. W.
et al., J Mol Biol 164:193-211 (1983)) from laboratory collections
or BL21(DE3) CodonPlus ultracompetent cells from Stratagene. E.
coli was propagated in LB medium (Sambrook, J. et al., Molecular
cloning: a laboratory manual. Cold Spring Harbor, N.Y.: Cold Spring
Harbor Laboratory Press (1989)) at 30.degree. C. in Ehrlenmeyer
flasks shaken at 250 rpm.
[0059] PCR amplification and cloning of the SsoSSB gene. Genomic
DNA was prepared from S. solfataricus cells as previously described
(Rolfsmeier, M. et al., J Bacteriol 180:1287-1295 (1998)). PCR was
performed using 10 mM potassium chloride, 10 mM ammonium sulfate, 2
mM magnesium chloride, 20 mM Tris-Cl (pH 8.75), 0.1% Triton X-100,
100 .mu.M dNTP's, 100 pmol primers, 2 ng template DNA, and 2.5 U of
recombinant Pfu DNA polymerase (Stratagene). The primers for
amplification of SsoSSB were: 5'-CGGGATCCCCTTTCA
TTAACACATAGATTTATAAATGG-3' (SEQ ID NO:8) (SSB-F) and
5'-CGGGATCCGGAGCAA GCTCGTATACTTTGTCTCTAGCC-3' (SEQ ID NO:9)
(SSB-R). All primer sequences were chosen based on sequence
information presented at the S. solfataricus genome website:
http://www-archbac.u-psud.fr/projects- /sulfolobus. PCR was
performed using a 55.degree. C. annealing temperature and the
resulting PCR products were digested with BamHI and ligated into
the BamHI site of pUC19. Ligated molecules were transformed into
DH5.alpha. as previously described (Rolfsmeier, M. et al., J
Bacteriol 180:1287-1295 (1998)). Plasmids from transformants were
isolated using the Qiagen midiprep system and DNA sequences were
determined using BigDye dRhodamine Terminator chemistry
(Perkin-Elmer Corp.) at the Division of Biological Sciences
Automated DNA sequencing facility at UC Davis.
[0060] Overexpression of SsoSSB protein. Sequence information
obtained from the pUC19 clones was used to design a forward PCR
primer with an NdeI site at the starting ATG codon for SsoSSB. The
gene sequence was re-amplified from the cloned template using the
new forward primer (5'-GTGAGTCGAGTCATATGGAAG-3') (SEQ ID NO:10) and
the original reverse primer. The resulting product was digested
using NdeI and BamHI prior to ligation into pET21a (Novagen) that
had been digested with the same enzymes to place the gene under the
control of the T7 promoter. Ligation products were transformed into
the CodonPlus strain (Stratagene) and transformants were cultivated
at 30.degree. C. in LB containing 100 .mu.g/ml ampicillin until
mid-log phase.
[0061] Purification of SsoSSB protein. BL21(DE3) CodonPlus cells
(Stratagene) harboring the pET21a SsoSSB expression construct were
grown at 30.degree. C. in a 500 ml volume to an OD.sub.600 of 1.0.
IPTG was added to a final concentration of 1 mM and expression was
allowed to continue for 2 hours. Cells were harvested by
centrifugation and stored at -20.degree. C. until processing. The
frozen cell pellet was resuspended in 4 ml of 10 mM Tris-Cl (pH
7.5), 1 mM EDTA (TE) with 50 mM NaCl and sonicated to disrupt the
cells. The sonicate was heat treated at 80.degree. C. for 1 hour,
and insoluble material was removed by centrifugation. Clarified
sonicate was applied to a ssDNA cellulose column equilibrated in 30
mM Tris-Cl (pH 7.5), 1 mM EDTA, 1 mM DTT, and 10% glycerol; the
column was washed with the same buffer containing 0.5 M NaCl and
0.75 M NaCl at room temperature. Fractions eluting at 0.75 M NaCl
were pooled and dialyzed into buffer containing 20 mM Tris-Cl (pH
7.5), 1 mM DTT, 1 mM EDTA, and 10% glycerol. This material was then
applied to a Resource Q column (Pharmacia) equilibrated with the
same buffer at room temperature. Protein was eluted using a
gradient of 50 mM NaCl to 1 M NaCl in the same buffer; the SsoSSB
protein eluted from the column at approximately 60 mM NaCl. The
protein was pooled and concentrated by using dry polyethylene
glycol and then dialyzed against 25 mM Tris HCl (pH 7.5), 20 mM
NaCl, 1 mM EDTA, 1 mM DTT, 10% spectral grade glycerol, and stored
at 4.degree. C. Protein concentrations were obtained by
spectrophotometric absorbance at a wavelength of 280 nm, using an
extinction coefficient of 12660 M-1 cm.sup.-1 as determined with
the ProtParam tool at the ExPASy website
(http://expasy.cbr.nrc.ca/tools/- protparam.html).
[0062] Gel filtration of SsoSSB protein. Fast protein liquid
chromatography (FPLC) was performed at 4.degree. C. using a
Superose 12 column (Pharmacia) and 25 mM Tris HCl pH 7.5, 1 mM DTT,
100 mM NaCl, 1 mM EDTA as the running buffer. Molecular size
standards were BSA (66 kDa), carbonic anhydrase (29 kDa), and
cytochrome C (12.4 kDa) and were prepared in running buffer. A
total of 10 .mu.g of SsoSSB protein was loaded on the column in a
volume of 100 .mu.l. Elution profiles were determined by monitoring
OD.sub.280 readings and a standard curve was prepared by plotting
Ve/Vo against the molecular mass of the size standards. The value
of Vo was determined by elution of dextran blue from the Superose
12 column.
[0063] Gel mobility-shift analysis. The 63-mer oligonucleotide
5'-ACAGCACCAAT
GAAATCTATTAAGCTCCTCATCGTCCGCAAAAATATCGTCACCTCAAAAGGA-3' (SEQ ID
NO:11) was end-labeled with .sup.32P using T4 polynucleotide kinase
(NEB). SsoSSB protein was incubated at the indicated concentrations
with 10 .mu.M (nucleotides) of the .sup.32P labeled oligonucleotide
for 30 minutes at 75.degree. C. in buffer containing 30 mM Tris OAc
(pH 7.5), 10 mM MgOAc.sub.2, 5 mM NaCl, 0.1 mM DTT and 50 .mu.g/ml
BSA. Increasing concentrations of linearized pUC19 were used as the
dsDNA competitor as indicated in the text. Loading dye was then
added and the samples were applied to a vertical 10% acrylamide gel
prepared with 1.times.TBE buffer (0.089 M Tris-borate, 0.089 M
boric acid, 0.002 M EDTA).
[0064] In vivo complementation. The SsoSSB expression vector or
pET21a (empty vector) was transformed into E. coli strain KLC789
(Chase, J. W. et al., J Mol Biol 164:193-211 (1983)) containing
pTara, a T7 polymerase expression vector that is inducible by
arabinose addition. The pTara plasmid was the generous gift of
Kathleen Mathews (Rice University) (Wycuff, D. R. et al., Anal
Biochem 277:67-73 (2000)). Transformants were propagated in LB
medium lacking yeast extract with 0.2% (w/v) arabinose, 100
.mu.g/ml ampicillin, and 30 .mu.g/ml chloramphenicol for 16 hours
at 30.degree. C. to allow phenotypic overexpression of SsoSSB
protein. Control cultures were propagated identically, except 0.2%
(w/v) glucose was substituted for arabinose. Cells were subcultured
into fresh medium without chloramphenicol and grown at 30.degree.
C. until they were shifted to the non-permissive temperature of
43.degree. C. Optical densities were monitored
spectrophotometrically at a wavelength of 600 nm. Colony forming
units (cfu) per milliliter were determined by plating serial
dilutions of each timepoint in triplicate on LB medium. Plates were
incubated overnight at 30.degree. C. prior to scoring for viable
counts.
[0065] DNA strand exchange reactions. E. coli RecA protein (11
.mu.M) was incubated with .phi.X174 ssDNA (New England Biolabs) at
a concentration of 33 .mu.M (nucleotides) in 30 mM Tris OAc (pH
7.5), 10 mM DTT, 20 mM MgOAc, 2.5 mM ATP, and 5 .mu.g/ml BSA at
37.degree. C. for 10 minutes. After the addition of either 2.2
.mu.M SsoSSB protein or E. coli SSB protein, reaction mixtures were
incubated at 37.degree. C. for another 5 min before the
introduction of PstI-linearized .phi.X174 dsDNA (New England
Biolabs) at a concentration of 33 .mu.M (nucleotides). The reaction
mixtures were then incubated at 37.degree. C. for 90 minutes and
were stopped by the addition of SDS to a final concentration of
0.6% and proteinase K to a final concentration of 1 .mu.g/ml.
Deproteinization of the reaction mixtures was carried out at
37.degree. C. for 10 minutes.
[0066] Gel electrophoresis. Agarose gels for evaluation of cloning
procedures were prepared at 0.8% and run at approximately 150 V in
TBE buffer prior to staining with ethidium bromide. Tricine
SDS/PAGE, used to monitor protein purification, was prepared with a
4% stacking gel and a 20% separating gel as described (Price, L. B.
et al., J Bacteriol 182:4951-4958 (2000)) and run at 100 V.
Acrylamide gels for gel mobility-shift analysis were prepared at
10% in TBE buffer and run at 100 V for 3 hours at 65.degree. C.
prior to exposure to phosphorimaging screens and analysis with a
Storm 840 PhosphorImager (Molecular Dynamics). Agarose gels for
evaluation of DNA strand exchange products were prepared at 1% and
run at approximately 30 V in TAE buffer (0.04 M Tris OAc, 0.002 M
EDTA) for 15 hours prior to staining with ethidium bromide.
Example 2
[0067] This Example sets forth the results of studies conducted
using the methods and materials set forth in the previous
Example.
[0068] Crenarchaeal Homologues of ssDNA Binding Proteins.
[0069] Previous searches of genome sequences identified open
reading frames with homology to human RPA70 from the euryarchaeons
M. jannachii, M. thermoautrophicum, and A. fulgidus (Chedin, F. et
al., Trends Biochem Sci 23:273-277 (1998); Kelly, T. J. et al.,
Proc Natl Acad Sci USA 95:14634-14639 (1998)). Each of these
sequences consists of multiple ssDNA-binding domains contained in
one or a pair of open reading frames, which share a significant
degree of sequence homology among themselves. In one case, the
protein encoded by this homologous sequence was shown to be an RPA
homologue both structurally and functionally (Kelly, T. J. et al.,
Proc Natl Acad Sci USA 95:14634-14639 (1998)). However, there has
been no corresponding homologue of RPA identified in members of the
other branch of the archaeal domain, the crenarchaea. The
availability of sequence information from both A. pernix
(Kawarabayasi, Y. et al., DNA Res 6:83-101:145-152 (1999)) and S.
solfataricus (She, Q. et al., Proc Natl Acad Sci USA 98:7835-7840
(2001)) permitted a search for ssDNA-binding protein sequences in
the crenarchaea.
[0070] A survey of genome sequences from A. pernix and S.
solfataricus with the program BLAST (Altschul, S. F. et al., J Mol
Biol, 215:403-410, (1990)) revealed a single small open reading
frame in each genome with sequence similarity to MJ1159, the RPA
homologue from M. jannaschii. Both open reading frames code for
proteins that are strikingly similar to the first ssDNA-binding
domain of the M. jannaschii RPA (FIG. 1a), but are much shorter
than the M. jannaschii protein. The S. solfataricus sequence
(SSO2364) is 477 base pairs in length and encodes a protein of 148
amino acids while the A. pernix sequence (gi51105001) is 429 base
pairs in length and encodes a protein of 143 amino acids; in
contrast, the M. jannaschii protein is 645 amino acids in length.
The S. solfataricus protein has a predicted pI of 9.0, and the A.
pernix protein also has a predicted pI of 9.0. For comparison, the
pI's of the T4 phage SSB homologue gp32, E. coli SSB, and M.
jannaschii RPA are 4.8, 5.4, and 4.7 respectively. The S.
solfataricus protein has 52% similarity and 26% identity with
MJ1159 from amino acids 68 to 170 and the A. pernix protein has 52%
similarity and 25% identity with MJ1159 from amino acid 70 to 173.
The two residues conserved in all archacal sequences correspond to
amino acids involved in DNA binding in human RPA70 protein domain B
(Thr 359 and Trp 361 in the hsRPA70 sequence) (Bochkarev, A. et
al., Nature, 385:176-181 (1997)) (FIG. 1a). Additionally, the S.
solfataricus sequence shares two other amino acids with human RPA70
that are implicated in DNA binding, Phe 386 and Ser 396 (Bochkarev,
A. et al., Nature, 385:176-181 (1997)).
[0071] The two crenarchaeal protein sequences show a remarkable
level of homology between each other, exhibiting 69% similarity and
47% identity (FIG. 1). Both of the newly identified open reading
frames are significantly shorter than their euryarchaeal and
eukaryotic counterparts, each comprising only a single
ssDNA-binding region as opposed to closely related tandem repeats
(four, in the case of the M. jannaschii protein) of multiple
binding regions in a larger polypeptide. Examination of nearby
regions in each genome revealed no further sequences that might
encode for portions of a ssDNA-binding protein, suggesting either
that S. solfataricus SSO2364 and A. pernix gi5105001 are the only
genes responsible for producing SSB for these crenarchaeons or that
there were other genes elsewhere in the genome that encoded the
remainder of the subunits for an RPA-like protein. No other
sequence with significant similarity to MJ1159 is apparent
elsewhere in the complete genomes of either A. pernix or S.
solfataricus, suggesting that these proteins may serve as the sole
SSBs in these organisms.
[0072] The Crenarchacal Proteins Structurally Resemble E. coli SSB
Protein.
[0073] In contrast to other archaeal SSB homologues which resemble
eukaryotic RPAs, it appears that the overall architecture of the
crenarchaeal versions is distinctly different. Euryarchaeal RPA
homologues are comprised of multiple DNA-binding domains within one
or a pair of proteins and presumably function in monomeric or
heterodimeric forms, respectively (FIG. 2). The open reading frames
from both A. pernix and S. solfataricus, however, are distinguished
by a single core ssDNA-binding domain of about 100 amino acids in
length, identical to that observed in eubacterial ssDNA-binding
proteins. This suggests that the quaternary structure of the
crenarchaeal SSB protein might be analogous to the eubacterial
version and could be tetrameric. Additionally, the crenarchaeal
proteins lack the C-terminal zinc finger of the euryarchaeal RPAs
and instead, contain a number of acidic residues in this region.
This is analogous to the C-terminal structure of E. coli SSB, which
is required for protein-protein interactions (Chase, J. W. et al.,
J Biol Chem 260:7214-7218 (1985); Kelman, Z. et al., EMBO J
17:2436-2449 (1998); Williams, K. R. et al., J Biol Chem
258:3346-3355 (1983)). Also absent in the crenarchaeal sequences is
an approximately 100 residue N-terminal region found in
euryarchaeal RPAs that is believed to be involved in protein
binding (Wold, M. S. Annu Rev Biochem 66:61-92 (1997)).
[0074] The SSB protein homologue of phage T4, gp32, has little
sequence homology to bacterial SSBs but displays both structural
similarity with these proteins and an acidic C-terminus (Shamoo, Y.
et al., Nature 376:362-366 (1995)). Much like gp32, however, the
crenarchaeal SSBs share minimal sequence homology with E. coli SSB.
BestFit alignment of the crenarchaeal sequences with E. coli SSB
shows 35% similarity and 31% identity over only 48 amino acids for
SsoSSB and 43% similarity and 38% identity over only 60 amino acids
for ApeSSB. However, the crenarchaeal proteins do appear to share
structural similarity with the eubacterial protein. Despite reduced
sequence homology with E. coli SSB, homology-dependent modeling of
the expected structure for S. solfataricus SSB reveals striking
similarity between the two proteins in the core DNA binding region;
a similar analysis was used to confirm the previous identification
of the euryarchaeal RPA homologues. The modeling shows strong
evolutionary structural conservation of the OB-fold (residues
32-71) which is implicated in DNA binding, as well as the
.alpha.-helix, which is involved in subunit interactions (Webster
et al, FEBS Lett, 411:313-316 (1997)). Equivalent modeling using
hsRPA70 also demonstrated strong structural conservation,
especially with the RPA-B subdomain. These results confirm that the
open reading frame from S. solfataricus encodes a ssDNA-binding
protein.
[0075] Expression and Purification of the SSB Homologue from S.
solfataricus.
[0076] To determine if SSO2364 from S. solfataricus did indeed
encode a functional SSB protein homologue, we purified and
characterized the candidate protein. The SSO2364 open reading frame
was cloned into the pET21a bacterial expression vector and
subsequently heterologously expressed in E. coli. The bacterial
strain carried a plasmid encoding three rare tRNA genes in an
effort to reduce translational pausing as the predicted protein
sequence contains 11 codons that are rare in E. coli, four of which
are present in the final 50 bases of the open reading frame. The
expressed protein is soluble and was purified to near homogeneity
by first heat-treating the cell sonicate at 80.degree. C. to
denature all mesophilic proteins. This step was followed by
affinity chromatography on ssDNA-cellulose, and by anion exchange
chromatography on Resource Q. The recombinant protein eluted from
ssDNA-cellulose at 0.75 M NaCl, which is identical to the salt
concentration necessary for elution of E. coli SSB (Lohman, T. M.
et al., Biochemistry 25:21-25 (1986)). In contrast, elution of
either yeast or M. jannachii RPA from the same matrix requires 1.5
M NaCl with the addition of 40% ethylene glycol, 1.3 M potassium
thiocyanate, or 1.5 M sodium thiocyanate (Henricksen, L. A. et al.,
J Biol Chem 269:24203-24208 (1994); Heyer, W. D. et al., Embo J
9:2321-2329 (1990); Kelly, T. J. et al., Proc Natl Acad Sci USA
95;14634-14639 (1998)), suggesting that the S. solfataricus SSB
(SsoSSB) protein is chemically more similar to the bacterial
protein than it is to RPA. The SsoSSB protein eluted at
approximately 60 mM NaCl from Resource Q and pooled fractions
yielded essentially pure protein (greater than 98% purity based on
Coomassie stained gels). Examination of the purified protein by
SDS/PAGE revealed a single band with a molecular weight of
approximately 16 kDa, in close agreement with the predicted
molecular weight of 16,138 D as determined from the amino acid
sequence (FIG. 3).
[0077] The SsoSSB Protein Forms Tetramers in Solution.
[0078] It was of interest to determine if the purified S.
solfataricus protein would multimerise in solution. Analytical gel
filtration was used to determine the native form of the recombinant
protein. Examination of the SsoSSB protein in solution revealed
that it was present in three distinct species: monomeric, dimeric,
and tetrameric forms, at 18 kDa, 36 kDa, and 62 kDa, respectively
(FIG. 4a). As demonstrated by a representative elution profile
(FIG. 4b), the composition of the purified material was primarily
tetrameric, while somewhat less dimeric protein was present. A
significantly smaller quantity of the monomeric form of SsoSSB
protein was observed. This result indicates that the SsoSSB protein
indeed forms tetramers in solution. The M. jannachii RPA protein
does not multimerize in solution (Kelly, T. J. et al., Proc Natl
Acad Sci USA 95:14634-14639 (1998))).
[0079] SsoSSB Protein Binds ssDNA.
[0080] To determine the occluded binding site size of the protein
and to evaluate the activity of the SsoSSB protein, we performed
acrylamide gel mobility-shift assays with a radioactively labeled
single-stranded oligonucleotide that was 63 nucleotides in length
(FIG. 5). When a fixed quantity of radiolabeled oligonucleotide was
incubated with increasing quantities of protein, a band of reduced
mobility was observed. The apparent mobility further decreased upon
addition of more protein, finally achieving a constant mobility
after the addition of 2 .mu.M protein. The absence of discrete
species implied rapid equilibration between bound and free forms of
the complexes, and consistent with this possibility, more discrete
species were visualized when electrophoresis was performed more
rapidly (at high voltage). The addition of linear pUC19 DNA to a
100-fold molar (nucleotide) did not alter the mobility-shift
pattern, demonstrating that the SsoSSB has an, at least, 100-fold
greater affinity for ssDNA than for dsDNA. Saturation was achieved
at a ratio of approximately one SSB protein molecule to 5
nucleotides. The M. jannaschii RPA protein has a site size of 15 to
20 nucleotides (Kelly, T. J. et al., Proc Natl Acad Sci USA
95:14634-14639 (1998)) whereas the site size of E. coli SSB
protein, depending on solution conditions, varies from 8 to 16
nucleotides per monomer. The apparent site size of SsoSSB protein
is similar to the 7 nucleotide site size observed for phage T4 SSB
protein, gp32. Binding of SsoSSB protein to ssDNA does not appear
to be a cooperative process under these conditions, as
intermediately shifted species are evident instead of the
approximately 2-state transitions that typify cooperative binding.
Rather, a steady reduction in the mobility of protein-DNA complexes
occurs as protein concentration is increased, suggesting that
binding of SsoSSB protein to ssDNA is distributive in nature. The
observed band-retardation pattern is likely the result of a
combination of this non-cooperative binding and rapid equilibration
of protein-DNA complexes during electrophoresis.
[0081] SsoSSB Protein is a Functional SSB Homologue.
[0082] In E. coli, SSB is an essential protein. A number of
mutations were used to elucidate the function of E. coli SSB
protein; one mutation is the temperature sensitive mutation called
ssb-1. The ssb-1 mutation is an alteration of amino acid 55 from a
histidine to a tyrosine that is believed to destabilize the
tetrameric SSB protein complex upon shifting temperature from
30.degree. C. to the non-permissive temperature of 43.degree. C.,
resulting in a lethal phenotype (Chase, J. W. et al., J Mol Biol
164:193-211 (1983)). Overexpression of wild-type E. coli SSB
protein encoded on a plasmid can overcome the lethality of the
mutation (Chase, J. W. et al., J Mol Biol 164:193-211 (1983)) as
can the SSB protein of bacteriophage P1 (Lehnherr, H. et al., J
Bacteriol 181:6463-6468 (1999)). To test the in vivo functionality
of SsoSSB, the protein was overexpressed in the E. coli strain
KLC789, which carries the ssb-1 allele. The SsoSSB plasmid was
transformed into KLC789 along with a plasmid carrying an
arabinose-inducible T7 polymerase gene. Cells were grown in the
presence of arabinose for 16 hours at the permissive temperature to
allow over-expression of the SsoSSB protein, while control cultures
were cultivated in the presence of glucose. Cells were then shifted
to the non-permissive temperature and monitored for further growth
(FIG. 6a). The presence of the open reading frame encoding SsoSSB
protein in pET21a permitted continued growth of the ssb-1 mutant
strain while the pET21a vector alone was unable to rescue the
lethal phenotype. Rescued growth required the presence of
arabinose, as control experiments with glucose showed no increase
in optical density that would be consistent with continued growth.
To verify that the cells containing the SsoSSB plasmid were indeed
still growing, viable counts for each timepoint were determined by
plating (FIG. 6b). Following the temperature shift, the control
cultures continued to grow for a brief period and then dramatically
lost viability. In contrast, the cells contaning the SsoSSB plasmid
displayed a continuous increase in viable counts. These results
indicate that SsoSSB protein is capable of replacing E. coli SSB
protein in vivo and that it functions at 43.degree. C.
[0083] SsoSSB Protein Stimulated DNA Strand Exchange by E. coli
RecA Protein.
[0084] It was previously shown that heterologously expressed SSB
proteins can stimulate DNA strand exchange mediated by E. coli RecA
protein (Egner, C. et al., J Bacteriol 169:3422-3428 (1987)). To
demonstrate the functionality of the SsoSSB protein in at least one
nucleic acid metabolic function in vitro, DNA strand exchange
reactions were performed (FIG. 7). Purified SsoSSB protein was
capable of substituting for E. coli SSB protein in DNA strand
exchange reactions mediated by E. coli RecA protein at 37.degree.
C. using homologous .phi.X174 ss- and dsDNA. Clear enhancement of
DNA strand exchange, as determined by production of nicked circular
product, was observed with SsoSSB protein (FIG. 7, lane 3).
Interestingly, the M. jannaschii RPA protein can also promote
RecA-mediated DNA-strand exchange. The reduced amount of nicked
circular product in reactions containing SsoSSB protein relative to
levels with E. coli SSB protein may be the result of performing the
experiment at temperatures where SsoSSB protein is not as
effective. The optimal temperature for the SsoSSB protein is
expected to be near the growth temperature of S. solfataricus,
which is 80.degree. C. As yet, no enhancement of strand exchange
activity through addition of SsoSSB protein to S. solfataricus RadA
protein-containing reactions at high temperature has been observed,
though this may be a consequence of inappropriate assay conditions
or may signify a post-synaptic role for SsoSSB protein at
physiological temperatures.
Example 3
[0085] This Example discusses the results of the studies set forth
above.
[0086] Divergence between the archaeal and eukaryotic lineages is
more recent than the divergence of the bacterial and
eukaryotic/archaeal groups (Olsen, G. J. et al., Cell 89:991-994
(1997)). Accordingly, a number of features shared by eukaryotes and
archaea, but not bacteria, including replication and transcription
proteins were likely obtained after evolutionary divergence of
these three groups. In contrast, features found in archaea and
bacteria but not in eukaryotes including morphological attributes
(a lack of organelles and nucleus), coupling of transcription and
translation, conjugative mechanisms, and a single circular genome
may be reminiscent of a more ancient, shared ancestor.
[0087] However, despite the logic of this viewpoint, the
evolutionary behavior of the archaea is not so simplistic. Our
results indicate that, in contrast to the canonical expectation
that all archaeal ssDNA binding proteins would be RPA-like, the
crenarchaeal SSBs share sequence homology with eukaryal RPAs but
structural homology with bacterial SSBs. Homology-dependent
modeling of SsoSSB demonstrates conservation of the OB-fold,
indicative of ssDNA binding proteins. Both E. coli SSB and SsoSSB
proteins elute from ssDNA-cellulose at the same salt concentration,
and both form tetramers in solution. The apparent binding site size
is approximately 5 nucleotides, which is consistent with the site
size observed for T4 g32 protein and the low site size binding mode
of E. coli SSB protein, but is one-fourth that of M. jannachii RPA
protein, which has four DNA-binding domains. Another feature that
makes the crenarchacal SSB protein more eubacterial is that SsoSSB
protein and ApeSSB protein are missing the zinc finger motif near
the C-terminus which is present in both euryarchaeal and eukaryal
RPAs, suggesting that this motif was acquired after the separation
of the two archaeal branches. Furthermore, the acidic residues in
the SsoSSB protein C-terminal region are similar to those found in
bacterial proteins and may have been maintained from the last
shared bacterial and archaeal ancestor. SsoSSB protein resembles E.
coli SSB chemically in that they both elute from ssDNA-cellulose at
0.75 M NaCl while the euryarchacal and eukaryal RPAs require higher
salt concentrations and the addition of ethylene glycol, potassium
thiocyanate, or sodium thiocyanate for elution from this matrix.
Finally, SsoSSB protein can functionally substitute for E. coli SSB
protein both in vivo and in vitro. In vivo, overexpression of the
SsoSSB protein can overcome the lethal ssb-1 temperature-sensitive
mutation in E. coli; in vitro, the SsoSSB protein can replace the
E. coli SSB protein in DNA strand exchange reactions mediated by
RecA protein.
[0088] Concurrent with our efforts, the same crenarchaeal protein
was identified by another laboratory using biochemical criteria
(Wadsworth, R. I. et al., Nucleic Acids Res 29:914-920 (2001)). No
multimerisation of the protein was demonstrated, contrary to our
observation. In our experience, however, heating of the SsoSSB
protein is necessary for formation of the tetrameric structure as
observed by gel filtration and for activity in DNA strand-exchange.
The absence of this heating step by Wadsworth and White could
account for their failure to observe tetramers.
[0089] Overall, the archaeal ssDNA binding proteins show more
sequence similarity to eukaryotic RPA proteins than to E. coli SSB
protein. However, the common sequences and DNA-binding domain
utilization hint at a conserved evolutionary relationship between
RPA and SSB (FIG. 2). Strong homology among the archaeal proteins
suggests a common evolutionary origin, and the crenarchaeal SSB
proteins may represent a link to ancient ssDNA-binding proteins.
The crenarchaeal SSB protein, being one of the simplest in
structure, may represent the earliest form of single-stranded
DNA-binding proteins involved in recombination and, it may serve as
a model for understanding structure, function, and evolution of the
conserved core ssDNA-binding domain.
[0090] Crenarchaea and euryarchaea are distinguished from each
other not only by single-stranded DNA-binding proteins as described
here, but also by double-stranded DNA-binding proteins. While
eukaryotic-like histone proteins have been identified and
extensively studied in members of the euryarchaea (Sandman, K. et
al., Arch Microbiol 173:165-169 (2000)), no such homologues are
apparent in members of the crenarchaea. Instead, crenarchaea
maintain sequences that code for small, basic dsDNA-binding
proteins (Agback, P. et al., Nat Struct Biol, 5:579-584 (1998));
Faguy, D. M. et al., Curr Biol 9:R883-886 (1999)). These proteins
are proposed to be comparable to histone-like proteins in
eubacteria, especially Sso7d which was shown to be analogous to HU
(Lopez-Garcia, P. et al., Nucleic Acids Res 26:2322-2328 (1998). It
appears that the crenarchaea have maintained both single-stranded
and double-stranded DNA-binding proteins that are more similar to
those found in bacteria than they are to eukaryotic homologues.
Crenarchaeal dsDNA-binding proteins and SSB may have evolved
separately from mechanisms employed by eukaryotes or,
alternatively, crenarchaea diverged earlier, prior to the
co-evolution of eukaryotic-like histones and RPA. The use of a
eubacterial-like SSB may necessitate a eubacterial DNA-binding
protein for the compaction of DNA. The discovery of an SSB
homologue in the crenarchaea that is significantly more similar to
eubacterial SSB both structurally and biochemically than it is to
either euryarchaeal or eukaryotic RPA further establishes the
evolutionary distance between the two archacal phyla.
[0091] It is understood that the examples and embodiments described
herein are for illustrative purposes only and that various
modifications or changes in light thereof will be suggested to
persons skilled in the art and are to be included within the spirit
and purview of this application and scope of the appended claims.
All publications, patents, and patent applications cited herein are
hereby incorporated by reference in their entirety for all
purposes.
Sequence CWU 1
1
12 1 148 PRT Sulfolobus solfataricus single-stranded (ssDNA)
binding protein (SSB) SSO2364 (SsoSSB) 1 Met Glu Glu Lys Val Gly
Asn Leu Lys Pro Asn Met Glu Ser Val Asn 1 5 10 15 Val Thr Val Arg
Val Leu Glu Ala Ser Glu Ala Arg Gln Ile Gln Thr 20 25 30 Lys Asn
Gly Val Arg Thr Ile Ser Glu Ala Ile Val Gly Asp Glu Thr 35 40 45
Gly Arg Val Lys Leu Thr Leu Trp Gly Lys His Ala Gly Ser Ile Lys 50
55 60 Glu Gly Gln Val Val Lys Ile Glu Asn Ala Trp Thr Thr Ala Phe
Lys 65 70 75 80 Gly Gln Val Gln Leu Asn Ala Gly Ser Lys Thr Lys Ile
Ala Glu Ala 85 90 95 Ser Glu Asp Gly Phe Pro Glu Ser Ser Gln Ile
Pro Glu Asn Thr Pro 100 105 110 Thr Ala Pro Gln Gln Met Arg Gly Gly
Gly Arg Gly Phe Arg Gly Gly 115 120 125 Gly Arg Arg Tyr Gly Arg Arg
Gly Gly Arg Arg Gln Glu Asn Glu Glu 130 135 140 Gly Glu Glu Glu 145
2 447 DNA Sulfolobus solfataricus single-stranded (ssDNA) binding
protein (SSB) SSO2364 (SsoSSB) 2 atggaagaaa aagtaggtaa tctaaaacca
aatatggaaa gcgtaaatgt aaccgtaaga 60 gttttggaag caagcgaagc
aagacaaata cagacaaaga acggtgttag aacaatcagt 120 gaggctattg
ttggagatga aacgggaaga gtaaagttaa cattatgggg aaaacatgca 180
ggtagtataa aagaaggtca agtggtaaag atagaaaacg cgtggaccac cgcttttaag
240 ggtcaagtac agttaaatgc tggaagcaaa actaagatag ctgaagcttc
agaagatgga 300 tttccagaat catctcaaat accagaaaat acaccaacag
ctcctcagca aatgcgtgga 360 ggaggaagag gattccgcgg tgggggaaga
aggtatggaa gaagaggtgg tagaagacaa 420 gaaaacgaag aaggtgaaga ggagtga
447 3 93 PRT Sulfolobus solfataricus single-stranded (ssDNA)
binding protein (SSB) SSO2364 (SsoSSB) ssDNA-binding domain 3 Met
Glu Glu Lys Val Gly Asn Leu Lys Pro Asn Met Glu Ser Val Asn 1 5 10
15 Val Thr Val Arg Val Leu Glu Ala Ser Glu Ala Arg Gln Ile Gln Thr
20 25 30 Lys Asn Gly Val Arg Thr Ile Ser Glu Ala Ile Val Gly Asp
Glu Thr 35 40 45 Gly Arg Val Lys Leu Thr Leu Trp Gly Lys His Ala
Gly Ser Ile Lys 50 55 60 Glu Gly Gln Val Val Lys Ile Glu Asn Ala
Trp Thr Thr Ala Phe Lys 65 70 75 80 Gly Gln Val Gln Leu Asn Ala Gly
Ser Lys Thr Lys Ile 85 90 4 88 PRT Aeropyrum pernix single-stranded
(ssDNA) binding protein (SSB) (ApeSSB) ssDNA-binding domain 4 Met
Asp Leu Arg Glu Gly Leu Arg Asn Val Ser Ile Ser Gly Arg Val 1 5 10
15 Leu Glu Thr Gly Glu Pro Lys Met Val Glu Thr Lys Arg Gly Pro Ala
20 25 30 Thr Leu Ser Glu Ala Val Val Gly Asp Glu Ser Gly Arg Val
Lys Val 35 40 45 Thr Leu Trp Gly Ser His Ala Gly Thr Leu Lys Glu
Gly Glu Ala Val 50 55 60 Arg Ile Glu Gly Ala Trp Thr Thr Ser Tyr
Arg Gly Lys Val Gln Val 65 70 75 80 Asn Val Gly Arg Glu Ser Thr Ile
85 5 91 PRT Methanococcus jannaschii MJ1159, replication protein A
(RPA) ssDNA-binding domain 5 Ile Ser Asp Ile Glu Glu Gly Gln Ile
Gly Val Glu Ile Thr Gly Val 1 5 10 15 Ile Thr Asp Ile Ser Glu Ile
Lys Thr Phe Lys Arg Arg Asp Gly Ser 20 25 30 Leu Gly Lys Tyr Lys
Arg Ile Thr Ile Ala Asp Lys Ser Gly Thr Ile 35 40 45 Arg Met Thr
Leu Trp Asp Asp Leu Ala Glu Leu Asp Val Lys Val Gly 50 55 60 Asp
Val Ile Lys Ile Glu Arg Ala Arg Ala Arg Lys Trp Arg Asn Asn 65 70
75 80 Leu Glu Leu Ser Ser Thr Ser Glu Thr Lys Ile 85 90 6 99 PRT
Saccharomyces cerevisiae replication protein A (RPA70)
ssDNA-binding domain 6 Asn Phe Ile Lys Leu Asp Ala Ile Gln Asn Gln
Glu Val Asn Ser Asn 1 5 10 15 Val Asp Val Leu Gly Ile Ile Gln Thr
Ile Asn Pro His Phe Glu Leu 20 25 30 Thr Ser Arg Ala Gly Lys Lys
Phe Asp Arg Arg Asp Ile Thr Ile Val 35 40 45 Asp Asp Ser Gly Phe
Ser Ile Ser Val Gly Leu Trp Asn Gln Gln Ala 50 55 60 Leu Asp Phe
Asn Leu Pro Glu Gly Ser Val Ala Ala Ile Lys Gly Val 65 70 75 80 Arg
Val Thr Asp Phe Gly Gly Lys Ser Leu Ser Met Gly Phe Ser Ser 85 90
95 Thr Leu Ile 7 100 PRT Homo sapiens replication protein A 70 kDa
DNA-binding subunit (RPA70) ssDNA-binding domain 7 Asp Phe Thr Gly
Ile Asp Asp Leu Glu Asn Lys Ser Lys Asp Ser Leu 1 5 10 15 Val Asp
Ile Ile Gly Ile Cys Lys Ser Tyr Glu Asp Ala Thr Lys Ile 20 25 30
Thr Val Arg Ser Asn Asn Arg Glu Val Ala Lys Arg Asn Ile Tyr Leu 35
40 45 Met Asp Thr Ser Gly Lys Val Val Thr Ala Thr Leu Trp Gly Glu
Asp 50 55 60 Ala Asp Lys Phe Asp Gly Ser Arg Gln Pro Val Leu Ala
Ile Lys Gly 65 70 75 80 Ala Arg Val Ser Asp Phe Gly Gly Arg Ser Leu
Ser Val Leu Ser Ser 85 90 95 Ser Thr Ile Ile 100 8 38 DNA
Artificial Sequence Description of Artificial SequencePCR
amplification forward primer SSB-F 8 cgggatcccc tttcattaac
acatagattt ataaatgg 38 9 38 DNA Artificial Sequence Description of
Artificial SequencePCR amplification reverse primer SSB-R 9
cgggatccgg agcaagctcg tatactttgt ctctagcc 38 10 21 DNA Artificial
Sequence Description of Artificial Sequencenew PCR forward primer
for reamplification from cloned template 10 gtgagtcgag tcatatggaa g
21 11 63 DNA Artificial Sequence Description of Artificial
Sequence63-mer oligonucleotide end-labeled with 32-P 11 acagcaccaa
tgaaatctat taagctcctc atcgtccgca aaaatatcgt cacctcaaaa 60 gga 63 12
4 PRT Artificial Sequence Description of Artificial
Sequenceconsensus peptide 12 Thr Leu Trp Gly 1
* * * * *
References