U.S. patent application number 10/739042 was filed with the patent office on 2004-09-09 for neutrokine-alpha and neutrokine-alpha splice variant.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Ebner, Reinhard, Ni, Jian, Yu, Guo-Liang.
Application Number | 20040175802 10/739042 |
Document ID | / |
Family ID | 30772336 |
Filed Date | 2004-09-09 |
United States Patent
Application |
20040175802 |
Kind Code |
A1 |
Yu, Guo-Liang ; et
al. |
September 9, 2004 |
Neutrokine-alpha and Neutrokine-alpha splice variant
Abstract
The present invention relates to a novel Neutrokine-a, and a
splice variant thereof designated Neutrokine-aSV, polynucleotides
and polypeptides which are members of the TNF family. In
particular, isolated nucleic acid molecules are provided encoding
the human Neutrokine-a and/or Neutrokine-aSV polypeptides,
including soluble forms of the extracellular domain. Neutrokine-a
and/or Neutrokine-aSV polypeptides are also provided as are
vectors, host cells and recombinant methods for producing the same.
The invention further relates to screening methods for identifying
agonists and antagonists of Neutrokine-a and/or Neutrokine-aSV
activity. Also provided are diagnostic methods for detecting immune
system-related disorders and therapeutic methods for treating
immune system-related disorders.
Inventors: |
Yu, Guo-Liang; (Berkeley,
CA) ; Ebner, Reinhard; (Gaithersburg, MD) ;
Ni, Jian; (Germantown, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC
INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
30772336 |
Appl. No.: |
10/739042 |
Filed: |
December 19, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10739042 |
Dec 19, 2003 |
|
|
|
09255794 |
Feb 23, 1999 |
|
|
|
6716576 |
|
|
|
|
09255794 |
Feb 23, 1999 |
|
|
|
09005874 |
Jan 12, 1998 |
|
|
|
6689579 |
|
|
|
|
09255794 |
Feb 23, 1999 |
|
|
|
PCT/US96/17957 |
Oct 25, 1996 |
|
|
|
60036100 |
Jan 14, 1997 |
|
|
|
Current U.S.
Class: |
435/69.5 ;
435/320.1; 435/325; 530/351; 536/23.5 |
Current CPC
Class: |
C07K 14/52 20130101;
A61K 38/00 20130101; C07H 21/04 20130101 |
Class at
Publication: |
435/069.5 ;
435/320.1; 435/325; 536/023.5; 530/351 |
International
Class: |
C07K 014/525; C07H
021/04; C12P 021/02 |
Claims
What is claimed is:
1. An isolated nucleic acid molecule comprising a polynucleotide
having a nucleotide sequence at least 95% identical to a sequence
selected from the group consisting of: (a) a nucleotide sequence
encoding the Neutrokine-a polypeptide having the complete amino
acid sequence in FIGS. 1A and 1B (SEQ ID NO:2); (b) a nucleotide
sequence encoding the Neutrokine-a polypeptide having the complete
amino acid sequence encoded by the cDNA clone contained in the
deposit having ATCC accession number 97768; (c) a nucleotide
sequence encoding the Neutrokine-a polypeptide extracellular
domain; (d) a nucleotide sequence encoding the Neutrokine-a
polypeptide transmembrane domain; (e) a nucleotide sequence
encoding the Neutrokine-a polypeptide intracellular domain; (f) a
nucleotide sequence encoding a soluble Neutrokine-a polypeptide
comprising the extracellular and intracellular domains but lacking
the transmembrane domain; and (g) a nucleotide sequence
complementary to any of the nucleotide sequences in (a), (b), (c),
(d), (e) or (f) above.
2. The nucleic acid molecule of claim 1 wherein said polynucleotide
has the complete nucleotide sequence in FIGS. 1A and 1B (SEQ ID
NO:1).
3. The nucleic acid molecule of claim 1 wherein said polynucleotide
has the nucleotide sequence in FIGS. 1A and 1B (SEQ ID NO:1)
encoding the Neutrokine-a polypeptide having the complete amino
acid sequence in FIGS. 1A and 1B (SEQ ID NO:2).
4. The nucleic acid molecule of claim 1 wherein said polynucleotide
has the nucleotide sequence encoding a soluble Neutrokine-a
polypeptide comprising the extracellular domain shown in FIGS. 1A
and 1B (SEQ ID NO:2).
5. An isolated nucleic acid molecule comprising a polynucleotide
having a nucleotide sequence at least 95% identical to a sequence
selected from the group consisting of: (a) a nucleotide sequence
encoding a polypeptide having the amino acid sequence consisting of
residues n-285 of SEQ ID NO:2, where n is an integer in the range
of 2-190 (b) a nucleotide sequence encoding a polypeptide having
the amino acid sequence consisting of residues 1-m of SEQ ID NO:2,
where m is an integer in the range of 274-284; (c) a nucleotide
sequence encoding a polypeptide having the amino acid sequence
consisting of residues n-m of SEQ ID NO:2, where n and m are
integers as defined respectively in (a) and (b) above; and (d) a
nucleotide sequence encoding a polypeptide consisting of a portion
of the complete Neutrokine-a amino acid sequence encoded by the
cDNA clone contained in the deposit having ATCC accession number
97768, wherein said portion excludes from 1 to 190 amino acids from
the amino terminus and from 1 to 11 amino acids from the C-terminus
of said complete amino acid sequence.
6. The nucleic acid molecule of claim 1 wherein said polynucleotide
has the complete nucleotide sequence of the cDNA clone contained in
the deposit having ATCC accession number 97768.
7. The nucleic acid molecule of claim 1 wherein said polynucleotide
has the nucleotide sequence encoding the Neutrokine-a polypeptide
having the complete amino acid sequence encoded by the cDNA clone
contained in the deposit having ATCC accession number 97768.
8. The nucleic acid molecule of claim 1 wherein said polynucleotide
has the nucleotide sequence encoding a soluble Neutrokine-a
polypeptide comprising the extracellular domain encoded by the cDNA
clone contained in the deposit having ATCC accession number
97768.
9. An isolated nucleic acid molecule comprising a polynucleotide
which hybridizes under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence identical to a
nucleotide sequence in (a), (b), (c), (d), (e) or (f) of claim 1
wherein said polynucleotide which hybridizes does not hybridize
under stringent hybridization conditions to a polynucleotide having
a nucleotide sequence consisting of only A residues or of only T
residues.
10. An isolated nucleic acid molecule comprising a polynucleotide
which encodes the amino acid sequence of an epitope-bearing portion
of a Neutrokine-a polypeptide having an amino acid sequence in (a),
(b), (c), (d), (e) or (f) of claim 1.
11. The isolated nucleic acid molecule of claim 10, which encodes
an epitope-bearing portion of a Neutrokine-a polypeptide selected
from the group consisting of: a polypeptide comprising amino acid
residues from about Phe-115 to about Leu-147 (SEQ ID NO:2); a
polypeptide comprising amino acid residues from about Ile-150 to
about Tyr-163 (SEQ ID NO:2); a polypeptide comprising amino acid
residues from about Ser-171 to about Phe-194 (SEQ ID NO:2); a
polypeptide comprising amino acid residues from about Glu-223 to
about Tyr-247 (SEQ ID NO:2); and a polypeptide comprising amino
acid residues from about Ser-271 to about Phe-278 (SEQ ID
NO:2).
12. A method for making a recombinant vector comprising inserting
an isolated nucleic acid molecule of claim 1 into a vector.
13. A recombinant vector produced by the method of claim 12.
14. A method of making a recombinant host cell comprising
introducing the recombinant vector of claim 13 into a host
cell.
15. A recombinant host cell produced by the method of claim 14.
16. A recombinant method for producing a Neutrokine-a polypeptide,
comprising culturing the recombinant host cell of claim 15 under
conditions such that said polypeptide is expressed and recovering
said polypeptide.
17. An isolated Neutrokine-a polypeptide comprising an amino acid
sequence at least 95% identical to a sequence selected from the
group consisting of: (a) the amino acid sequence of the
Neutrokine-a polypeptide having the complete amino acid sequence in
FIGS. 1A and 1B (SEQ ID NO:2); (b) the amino acid sequence of the
Neutrokine-a polypeptide having the complete amino acid sequence
encoded by the cDNA clone contained in the deposit having ATCC
accession number 97768; (c) the amino acid sequence of the
Neutrokine-a polypeptide extracellular domain; (d) the amino acid
sequence of the Neutrokine-a polypeptide transmembrane domain; (e)
the amino acid sequence of the Neutrokine-a polypeptide
intracellular domain; (f) the amino acid sequence of a soluble
Neutrokine-a polypeptide comprising the domain; and (g) the amino
acid sequence of an epitope-bearing portion of any one of the
polypeptides of (a), (b), (c), (d), (e) or (f).
18. An isolated polypeptide of claim 17 comprising an
epitope-bearing portion of the Neutrokine-a protein, wherein said
portion is selected from the group consisting of: a polypeptide
comprising amino acid residues from about Phe-115 to about Leu-147
(SEQ ID NO:2); a polypeptide comprising amino acid residues from
about Ile-150 to about Tyr-163 (SEQ ID NO:2); a polypeptide
comprising amino acid residues from about Ser-171 to about Phe-194
(SEQ ID NO:2); a polypeptide comprising amino acid residues from
about Glu-223 to about Tyr-247 (SEQ ID NO:2); a polypeptide
comprising amino acid residues from about Ser-271 to about Phe-278
(SEQ ID NO:2).
19. An isolated antibody that binds specifically to a Neutrokine-a
polypeptide of claim 17.
20. A pharmaceutical composition comprising a polypeptide of claim
17 and a pharmaceutically acceptable carrier.
21. An isolated polynucleotide encoding a modified Neutrokine-a
protein, wherein, except for at least one conservative amino acid
substitution, said modified peptide has an amino acid sequence that
is identical to a member selected from the group consisting of: (a)
amino acids 1 to 285 of SEQ ID NO:2; (b) amino acids 2 to 285 of
SEQ ID NO:2; (c) amino acids 1 to 46 of SEQ ID NO:2; (c) amino
acids 47 to 72 of SEQ ID NO:2; and (c) amino acids 73 to 286 of SEQ
ID NO:2.
22. A modified Neutrokine-a polypeptide molecule, wherein, except
for at least one conservative amino acid substitution, said
modified peptide has an amino acid sequence that is identical to a
member selected from the group consisting of: (a) amino acids 1 to
285 of SEQ ID NO:2; (b) amino acids 2 to 285 of SEQ ID NO:2; (c)
amino acids 1 to 46 of SEQ ID NO:2; (c) amino acids 47 to 72 of SEQ
ID NO:2; and (c) amino acids 73 to 286 of SEQ ID NO:2.
23. An isolated nucleic acid molecule comprising a polynucleotide
having a sequence at least 95% identical to a sequence selected
selected from the group consisting of: (a) the nucleotide sequence
of SEQ ID NO:7; (b) the nucleotide sequence of SEQ ID NO:8; (c) the
nucleotide sequence of SEQ ID NO:9; (d) the nucleotide sequence of
a portion of the sequence shown in FIGS. 1A and 1B (SEQ ID NO:1)
wherein said portion comprises at least 30 contiguous nucleotides
from nucleotide 1 to nucleotide 2442, excluding the sequence from
nucleotide 1387 to 1421, the sequence from nucleotide 9 to 382, the
sequence from nucleotide 1674 to 1996, the sequence from nucleotide
1401 to 1784, the sequence from nucleotide 900 to 1237, and any
fragments located within these sequences; and (e) a nucleotide
sequence complementary to any of the nucleotide sequences in (a),
(b), (c) or (d) above.
24. An isolated nucleic acid molecule comprising a polynucleotide
having a nucleotide sequence at least 95% identical to a sequence
selected from the group consisting of: (a) a nucleotide sequence
encoding the Neutrokine-aSV polypeptide having the complete amino
acid sequence in FIGS. 5A and 5B (SEQ ID NO:19); (b) a nucleotide
sequence encoding the Neutrokine-aSV polypeptide having the
complete amino acid sequence encoded by the cDNA clone contained in
the deposit having ATCC accession number 203518; (c) a nucleotide
sequence encoding the Neutrokine-aSV polypeptide extracellular
domain; (d) a nucleotide sequence encoding the Neutrokine-aSV
polypeptide transmembrane domain; (e) a nucleotide sequence
encoding the Neutrokine-aSV polypeptide intracellular domain; (f) a
nucleotide sequence encoding a soluble Neutrokine-aSV polypeptide
comprising the extracellular and intracellular domains but lacking
the transmembrane domain; and (g) a nucleotide sequence
complementary to any of the nucleotide sequences in (a), (b), (c),
(d), (e) or (f) above.
Description
[0001] This application is a divisional of U.S. application Ser.
No. 09/255,794, filed Feb. 23, 1999, which is a
continuation-in-part of U.S. application Ser. No. 09/005,874, filed
Jan. 12, 1998, which claims the benefit under 35 U.S.C. .sctn.
119(e) of U.S. Provisional Application No. 60/036,100 filed Jan.
14, 1997 and U.S. application Ser. No. 09/005,874 is also a
continuation-in-part of International Application No.
PCT/US96/17957 filed Oct. 25, 1996. Each of U.S. application Ser.
No. 09/255,794, U.S. Provisional Application No. 60/036,100, and
International Application No. PCT/US96/17957 is herein incorporated
by reference in its entirety.
[0002] The present invention relates to a novel cytokine which has
been designated Neutrokine-a ("Neutrokine-.alpha."). In addition,
an apparant splicing variant of Neutrokine-.alpha. has been
identified and designated Neutrokine-.alpha.SV. In specific
embodiments, the present invention provides nucleic acid molecules
encoding Neutrokine-a and Neutrokine-.alpha.SV polypeptides. In
additional embodiments, Neutrokine-a and Neutrokine-.alpha.SV
polypeptides are also provided, as are vectors, host cells and
recombinant methods for producing the same.
RELATED ART
[0003] Human tumor necrosis factors (TNF-.alpha.) and (TNF-.beta.,
or lymphotoxin) are related members of a broad class of polypeptide
mediators, which includes the interferons, interleukins and growth
factors, collectively called cytokines (Beutler, B. and Cerami, A.,
Annu. Ret. Immunol., 7:625-655 (1989)). Sequence analysis of
cytokine receptors has defined several subfamilies of membrane
proteins (1) the Ig superfamily, (2) the hematopoietin (cytokine
receptor superfamily and (3) the tumor necrosis factor (TNF)/nerve
growth factor (NGF) receptor superfamily (for review of TNF
superfamily see, Gruss and Dower, Blood 85(12):3378-3404 (1995) and
Aggarwal and Natarajan, Eur. Cytokine Netw., 7(2):93-124 (1996)).
The TNF/NGF receptor superfamily contains at least 10 difference
proteins. Gruss and Dower, supra. Ligands for these receptors have
been identified and belong to at least two cytokine superfamilies.
Gruss and Dower, supra.
[0004] Tumor necrosis factor (a mixture of TNF-.alpha. and
TNF-.beta.) was originally discovered as a result of its anti-tumor
activity, however, now it is recognized as a pleiotropic cytokine
capable of numerous biological activities including apoptosis of
some transformed cell lines, mediation of cell activation and
proliferation and also as playing important roles in immune
regulation and inflammation.
[0005] To date, known members of the TNF-ligand superfamily include
TNF-.alpha., TNF-.beta. (lymphotoxin-.alpha.), LT-.beta., OX40L,
Fas ligand, CD30L, CD27L, CD40L and 4-IBBL. The ligands of the TNF
ligand superfamily are acidic, TNF-like molecules with
approximately 20% sequence homology in the extracellular domains
(range, 12%-36%) and exist mainly as membrane-bound forms with the
biologically active form being a trimeric/multimeric complex.
Soluble forms of the TNF ligand superfamily have only been
identified so far for TNF, LT-.beta., and Fas ligand (for a general
review, see Gruss, H. and Dower, S. K., Blood, 85(12):3378-3404
(1995)), which is hereby incorporated by reference in its entirety.
These proteins are involved in regulation of cell proliferation,
activation, and differentiation, including control of cell survival
or death by apoptosis or cytotoxicity (Armitage, R. J., Curr. Opin.
Immunol. 6:407 (1994) and Smith, C. A., Cell 75:959 (1994)).
[0006] Tumor necrosis factor-alpha (TNF-a; also termed cachectin;
hereinafter "TNF") is secreted primarily by monocytes and
macrophages in response to endotoxin or other stimuli as a soluble
homotrimer of 17 kD protein subunits (Smith, R. A. et al., J. Biol.
Chem. 262:6951-6954 (1987)). A membrane-bound 26 kD precursor form
of TNF has also been described (Kriegler, M. et al., Cell 53:45-53
(1988)).
[0007] Accumulating evidence indicates that TNF is a regulatory
cytokine with pleiotropic biological activities. These activities
include: inhibition of lipoprotein lipase synthesis ("cachectin"
activity) (Beutler, B. et al., Nature 316:552 (1985)), activation
of polymorphonuclear leukocytes (Klebanoff, S. J. et al., J.
Immunol. 136:4220 (1986); Perussia, B., et al., J. Immunol. 138:765
(1987)), inhibition of cell growth or stimulation of cell growth
(Vilcek, J. et al., J. Exp. Med. 163:632 (1986); Sugarman, B. J. et
al., Science 230:943 (1985); Lachman, L. B. et al., J. Immunol.
138:2913 (1987)), cytotoxic action on certain transformed cell
types (Lachman, L. B. et al., supra; Darzynkiewicz, Z. et al.,
Canc. Res. 44:83 (1984)), antiviral activity (Kohase, M. et al.,
Cell 45:659 (1986); Wong, G. H. W. et al., Nature 323:819 (1986)),
stimulation of bone resorption (Bertolini, D. R. et al., Nature
319:516 (1986); Saklatvala, J., Nature 322:547 (1986)), stimulation
of collagenase and prostaglandin E2 production (Dayer, J.-M. et
al., J. Exp. Med. 162:2163 (1985)); and immunoregulatory actions,
including activation of T cells (Yokota, S. et al., J. Immunol.
140:531 (1988)), B cells (Kehrl, J. H. et al., J. Exp. Med. 166:786
(1987)), monocytes (Philip, R. et al., Nature 323:86 (1986)),
thymocytes (Ranges, G. E. et al., J. Exp. Med. 167:1472 (1988)),
and stimulation of the cell-surface expression of major
histocompatibility complex (MHC) class I and class II molecules
(Collins, T. et al., Proc. Natl. Acad. Sci. USA 83:446 (1986);
Pujol-Borrel, R. et al., Nature 326:304 (1987)).
[0008] TNF is noted for its pro-inflammatory actions which result
in tissue injury, such as induction of procoagulant activity on
vascular endothelial cells (Pober, J. S. et al., J. Immunol.
136:1680 (1986)), increased adherence of neutrophils and
lymphocytes (Pober, J. S. et al., J. Immunol. 138:3319 (1987)), and
stimulation of the release of platelet activating factor from
macrophages, neutrophils and vascular endothelial cells (Camussi,
G. et al., J. Exp. Med. 166:1390 (1987)).
[0009] Recent evidence implicates TNF in the pathogenesis of many
infections (Cerami, A. et al., Immunol. Today 9:28 (1988)), immune
disorders, neoplastic pathology, e.g., in cachexia accompanying
some malignancies (Oliff, A. et al., Cell 50:555 (1987)), and in
autoimmune pathologies and graft-versus host pathology (Piguet,
P.-F. et al., J. Exp. Med. 166:1280 (1987)). The association of TNF
with cancer and infectious pathologies is often related to the
host's catabolic state. A major problem in cancer patients is
weight loss, usually associated with anorexia., The extensive
wasting which results is known as "cachexia" (Kern, K. A. et al. J.
Parent. Enter. Nutr. 12:286-298 (1988)). Cachexia includes
progressive weight loss, anorexia, and persistent erosion of body
mass in response to a malignant growth. The cachectic state is thus
associated with significant morbidity and is responsible for the
majority of cancer mortality. A number of studies have suggested
that TNF is an important mediator of the cachexia in cancer,
infectious pathology, and in other catabolic states.
[0010] TNF is thought to play a central role in the
pathophysiological consequences of Gram-negative sepsis and
endotoxic shock (Michie, H. R. et al., Br. J. Surg. 76:670-671
(1989); Debets, J. M. H. et al., Second Vienna Shock Forum,
p.463-466 (1989); Simpson, S. Q. et al., Crit. Care Clin. 5:27-47
(1989)), including fever, malaise, anorexia, and cachexia.
Endotoxin is a potent monocyte/macrophage activator which
stimulates production and secretion of TNF (Kombluth, S. K. et al.,
J. Immunol. 137:2585-2591 (1986)) and other cytokines. Because TNF
could mimic many biological effects of endotoxin, it was concluded
to be a central mediator responsible for the clinical
manifestations of endotoxin-related illness. TNF and other
monocyte-derived cytokines mediate the metabolic and neurohormonal
responses to endotoxin (Michie, H. R. et al., N. Eng. J. Med.
318:1481-1486 (1988)). Endotoxin administration to human volunteers
produces acute illness with flu-like symptoms including fever,
tachycardia, increased metabolic rate and stress hormone release
(Revhaug, A. et al., Arch. Surg. 123:162-170 (1988)). Elevated
levels of circulating TNF have also been found in patients
suffering from Gram-negative sepsis (Waage, A. et al., Lancet
1:355-357 (1987); Hammerle, A. F. et al., Second Vienna Shock Forum
p. 715-718 (1989); Debets, J. M. H. et al., Crit. Care Med.
17:489-497 (1989); Calandra, T. et al., J. Infec. Dis. 161:982-987
(1990)).
[0011] Passive immunotherapy directed at neutralizing TNF may have
a beneficial effect in Gram-negative sepsis and endotoxemia, based
on the increased TNF production and elevated TNF levels in these
pathology states, as discussed above. Antibodies to a "modulator"
material which was characterized as cachectin (later found to be
identical to TNF) were disclosed by Cerami et al. (EPO Patent
Publication 0,212,489, Mar. 4, 1987). Such antibodies were said to
be useful in diagnostic immunoassays and in therapy of shock in
bacterial infections. Rubin et al. (EPO Patent Publication
0,218,868, Apr. 22, 1987) disclosed monoclonal antibodies to human
TNF, the hybridomas secreting such antibodies, methods of producing
such antibodies, and the use of such antibodies in immunoassay of
TNF. Yone et al. (EPO Patent Publication 0,288,088, Oct. 26, 1988)
disclosed anti-TNF antibodies, including mAbs, and their utility in
immunoassay diagnosis of pathologies, in particular Kawasaki's
pathology and bacterial infection. The body fluids of patients with
Kawasaki's pathology (infantile acute febrile mucocutaneous lymph
node syndrome; Kawasaki, T., Allergy 16:178 (1967); Kawasaki, T.,
Shonica (Pediatrics) 26:935 (1985)) were said to contain elevated
TNF levels which were related to progress of the pathology (Yone et
al., supra).
[0012] Other investigators have described mAbs specific for
recombinant human TNF which had neutralizing activity in vitro
(Liang, C-M. et al. Biochem. Biophys. Res. Comm. 137:847-854
(1986); Meager, A. et al., Hybridoma 6:305-311 (1987); Fendly et
al., Hybridoma 6:359-369 (1987); Bringman, T S et al., Hybridoma
6:489-507 (1987); Hirai, M. et al., J. Immunol. Meth. 96:57-62
(1987); Moller, A. et al. (Cytokine 2:162-169 (1990)). Some of
these mAbs were used to map epitopes of human TNF and develop
enzyme immunoassays (Fendly et al., supra; Hirai et al., supra;
Moller et al., supra) and to assist in the purification of
recombinant TNF (Bringman et al., supra). However, these studies do
not provide a basis for producing TNF neutralizing antibodies that
can be used for in vivo diagnostic or therapeutic uses in humans,
due to immunogenicity, lack of specificity and/or pharmaceutical
suitability.
[0013] Neutralizing antisera or mAbs to TNF have been shown in
mammals other than man to abrogate adverse physiological changes
and prevent death after lethal challenge in experimental
endotoxemia and bacteremia. This effect has been demonstrated,
e.g., in rodent lethality assays and in primate pathology model
systems (Mathison, J. C. et al., J. Clin. Invest. 81:1925-1937
(1988); Beutler, B. et al., Science 229:869-871 (1985); Tracey, K.
J. et al., Nature 330:662-664 (1987); Shimamoto, Y. et al.,
Immunol. Lett. 17:311-318 (1988); Silva, A. T. et al., J. Infect.
Dis. 162:421-427 (1990); Opal, S. M. et al., J. Infect. Dis.
161:1148-1152 (1990); Hinshaw, L. B. et al., Circ. Shock 30:279-292
(1990)).
[0014] To date, experience with anti-TNF mAb therapy in humans has
been limited but shows beneficial therapeutic results, e.g., in
arthritis and sepsis. See, e.g., Elliott, M. J. et al., Baillieres
Clin. Rheumatol. 9:633-52 (1995); Feldmann M, et al., Ann. N.Y.
Acad. Sci. USA 766:272-8 (1995); van der Poll, T. et al., Shock
3:1-12 (1995); Wherry et al., Crit. Care. Med. 21:S436-40 (1993);
Tracey K. J., et al., Crit. Care Med. 21:S415-22 (1993).
[0015] Mammalian development is dependent on both the proliferation
and differentiation of cells as well as programmed cell death which
occurs through apoptosis (Walker, et al., Methods Achiev. Exp.
Pathol. 13:18 (1988). Apoptosis plays a critical role in the
destruction of immune thymocytes that recognize self antigens.
Failure of this normal elimination process may play a role in
autoimmune diseases (Gammon et al., Immunology Today 12:193
(1991)).
[0016] Itoh et al. (Cell 66:233 (1991)) described a cell surface
antigen, Fas/CD95 that mediates apoptosis and is involved in clonal
deletion of T-cells. Fas is expressed in activated T-cells,
B-cells, neutrophils and in thymus, liver, heart and lung and ovary
in adult mice (Watanabe-Fukunaga et al., J. Immunol. 148:1274
(1992)) in addition to activated T-cells, B-cells, neutorophils. In
experiments where a monoclonal Ab is cross-linked to Fas, apoptosis
is induced (Yonehara et al., J. Exp. Med. 169:1747 (1989); Trauth
et al., Science 245:301 (1989)). In addition, there is an example
where binding of a monoclonal Ab to Fas is stimulatory to T-cells
under certain conditions (Alderson et al., J. Exp. Med. 178:2231
(1993)).
[0017] Fas antigen is a cell surface protein of relative MW of 45
Kd. Both human and murine genes for Fas have been cloned by
Watanabe-Fukunaga et al., (J. Immunol. 148:1274 (1992)) and Itoh et
al. (Cell 66:233 (1991)). The proteins encoded by these genes are
both transmembrane proteins with structural homology to the Nerve
Growth Factor/Tumor Necrosis Factor receptor superfamily, which
includes two TNF receptors, the low affinity Nerve Growth Factor
receptor and CD40, CD27, CD30, and OX40.
[0018] Recently the Fas ligand has been described (Suda et al.,
Cell 75:1169 (1993)). The amino acid sequence indicates that Fas
ligand is a type II transmembrane protein belonging to the TNF
family. Thus, the Fas ligand polypeptide comprises three main
domains: a short intracellular domain at the amino terminal end and
a longer extracellular domain at the carboxy terminal end,
connected by a hydrophobic transmembrane domain. Fas ligand is
expressed in splenocytes and thymocytes, consistent with T-cell
mediated cytotoxicity. The purified Fas ligand has a MW of 40
kD.
[0019] Recently, it has been demonstrated that Fas/Fas ligand
interactions are required for apoptosis following the activation of
T-cells (Ju et al., Nature 373:444 (1995); Brunner et al., Nature
373:441 (1995)). Activation of T-cells induces both proteins on the
cell surface. Subsequent interaction between the ligand and
receptor results in apoptosis of the cells. This supports the
possible regulatory role for apoptosis induced by Fas/Fas ligand
interaction during normal immune responses.
[0020] Accordingly, there is a need to provide cytokines similar to
TNF that are involved in pathological conditions. Such novel
cytokines may be used to make novel antibodies or other antagonists
that bind these TNF-like cytokines for diagnosis and therapy of
disorders related to TNF-like cytokines.
SUMMARY OF THE INVENTION
[0021] In accordance with one embodiment of the present invention,
there is provided a novel extracellular domain of a Neutrokine-a
polypeptide, and a novel extracellular domain of a Neutrokine-aSV
polypeptide, as well as biologically active and diagnostically or
therapeutically useful fragments, analogs and derivatives
thereof.
[0022] In accordance with another embodiment of the present
invention, there are provided isolated nucleic acid molecules
encoding human Neutrokine-a or Neutrokine-aSV, including mRNAs,
DNAs, cDNAs, genomic DNAs as well as analogs and biologically
active and diagnostically or therapeutically useful fragments and
derivatives thereof.
[0023] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding a cytokine and an
apparent splice variant thereof that are structurally similar to
TNF and related cytokines and have similar biological effects and
activities. This cytokine is named Neutrokine-a and the invention
includes Neutrokine-a polypeptides having at least a portion of the
amino acid sequence in FIGS. 1A and 1B (SEQ ID NO:2) or amino acid
sequence encoded by the cDNA clone (HNEDU15) deposited in a
bacterial host on Oct. 22, 1996 assigned ATCC number 97768. The
nucleotide sequence determined by sequencing the deposited
Neutrokine-a clone, which is shown in FIGS. 1A and 1B (SEQ ID
NO:1), contains an open reading frame encoding a complete
polypeptide of 285 amino acid residues including an N-terminal
methionine, a predicted intracellular domain of about 46 amino acid
residues, a predicted transmembrane domain of about 26 amino acids,
a predicted extracellular domain of about 213 amino acids, and a
deduced molecular weight for the complete protein of about 31 kDa.
As for other type II transmembrane proteins, soluble forms of
Neutrokine-.alpha. include all or a portion of the extracellular
domain cleaved from the transmembrane domain and a polypeptide
comprising the complete Neutrokine-.alpha. polypeptide lacking the
transmembrane domain, i.e., the extracellular domain linked to the
intracellular domain.
[0024] The apparent splice variant of Neutrokine-a is named
Neutrokine-aSV and the invention includes Neutrokine-aSV
polypeptides having at least a portion of the amino acid sequence
in FIGS. 5A and 5B (SEQ ID NO:19) or amino acid sequence encoded by
the cDNA clone HDPMC52 deposited on Dec. 10, 1998 and assigned ATCC
number 203518. The nucleotide sequence determined by sequencing the
deposited Neutrokine-aSV clone, which is shown in FIGS. 5A and 5B
(SEQ ID NO:18), contains an open reading frame encoding a complete
polypeptide of 266 amino acid residues including an N-terminal
methionine, a predicted intracellular domain of about 46 amino acid
residues, a predicted transmembrane domain of about 26 amino acids,
a predicted extracellular domain of about 194 amino acids, and a
deduced molecular weight for the complete protein of about 29 kDa.
As for other type II transmembrane proteins, soluble forms of
Neutrokine-aSV include all or a portion of the extracellular domain
cleaved from the transmembrane domain and a polypeptide comprising
the complete Neutrokine-aSV polypeptide lacking the transmembrane
domain, i.e., the extracellular domain linked to the intracellular
domain.
[0025] Thus, one embodiment of the invention provides an isolated
nucleic acid molecule comprising a polynucleotide having a
nucleotide sequence selected from the group consisting of: (a) a
nucleotide sequence encoding a full-length Neutrokine-a polypeptide
having the complete amino acid sequence in FIGS. 1A and 1B (SEQ ID
NO:2) or as encoded by the cDNA clone contained in the deposit
having ATCC accession number 97768; (b) a nucleotide sequence
encoding the predicted extracellular domain of the Neutrokine-a
polypeptide having the amino acid sequence at positions 73 to 285
in FIGS. 1A and 1B (SEQ ID NO:2) or as encoded by the clone
contained in the deposit having ATCC accession number 97768; (c) a
nucleotide sequence encoding a fragment of the polypeptide of (b)
having Neutrokine-a functional activity (e.g., biological
acitivity); (d) a nucleotide sequence encoding a polypeptide
comprising the Neutrokine-a intracellular domain (predicted to
constitute amino acid residues from about 1 to about 46 in FIGS. 1A
and 1B (SEQ ID NO:2)) or as encoded by the clone contained in the
deposit having ATCC accession number 97768; (e) a nucleotide
sequence encoding a polypeptide comprising the Neutrokine-a
transmembrane domain (predicted to constitute amino acid residues
from about 47 to about 72 in FIGS. 1A and 1B (SEQ ID NO:2) or as
encoded by the cDNA clone contained in the deposit having ATCC
accession number 97768; (f) a nucleotide sequence encoding a
soluble Neutrokine-a polypeptide having the extracellular and
intracellular domains but lacking the transmembrane domain; and (g)
a nucleotide sequence complementary to any of the nucleotide
sequences in (a), (b), (c), (d), (e) or (f) above.
[0026] Another embodiment of the invention provides an isolated
nucleic acid molecule comprising a polynucleotide having a
nucleotide sequence selected from the group consisting of: (a) a
nucleotide sequence encoding a full-length Neutrokine-aSV
polypeptide having the complete amino acid sequence in FIGS. 5A and
5B (SEQ ID NO:19) or as encoded by the cDNA clone contained in the
ATCC Deposit deposited on Dec. 10, 1998 as ATCC Number 203518; (b)
a nucleotide sequence encoding the predicted extracellular domain
of the Neutrokine-aSV polypeptide having the amino acid sequence at
positions 73 to 266 in FIGS. 1A and 1B (SEQ ID NO:2) or as encoded
by the cDNA clone contained in ATCC 203518 deposited on Dec. 10,
1998; (c) a nucleotide sequence encoding a polypeptide comprising
the Neutrokine-aSV intracellular domain (predicted to constitute
amino acid residues from about 1 to about 46 in FIGS. 5A and 5B
(SEQ ID NO:19)) or as encoded by the cDNA clone contained in ATCC
No. 203518 deposited on Dec. 10, 1998; (d) a nucleotide sequence
encoding a polypeptide comprising the Neutrokine-aSV transmembrane
domain (predicted to constitute amino acid residues from about 47
to about 72 in FIGS. 5A and 5B (SEQ ID NO:19) or as encoded by the
cDNA clone contained in ATCC No. 203518 deposited on Dec. 10, 1998;
(e) a nucleotide sequence encoding a soluble Neutrokine-aSV
polypeptide having the extracellular and intracellular domains but
lacking the transmembrane domain; and (f) a nucleotide sequence
complementary to any of the nucleotide sequences in (a), (b), (c),
(d), or (e) above.
[0027] Further embodiments of the invention include isolated
nucleic acid molecules that comprise a polynucleotide having a
nucleotide sequence at least 90% identical, and more preferably at
least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide
sequences in (a), (b), (c), (d), (e), (f) or (g) above, or a
polynucleotide which hybridizes under stringent hybridization
conditions to a polynucleotide in (a), (b), (c), (d), (e), (f) or
(g) above. This polynucleotide which hybridizes does not hybridize
under stringent hybridization conditions to a polynucleotide having
a nucleotide sequence consisting of only A residues or of only T
residues. An additional nucleic acid embodiment of the invention
relates to an isolated nucleic acid molecule comprising a
polynucleotide which encodes the amino acid sequence of an
epitope-bearing portion of a Neutrokine-a or Neutrokine-aSV
polypeptide having an amino acid sequence in (a), (b), (c), (d),
(e) or (f) above. A further nucleic acid embodiment of the
invention relates to an isolated nucleic acid molecule comprising a
polynucleotide which encodes the amino acid sequence of a
Neutrokine-a or Neutrokine-aSV polypeptide having an amino acid
sequence which contains at least one amino acid addition,
substitution, and/or deletion but not more than 50 amino acid
additions, substitutions and/or deletions, even more preferably,
not more than 40 amino acid additions, substitutions, and/or
deletions, still more preferably, not more than 30 amino acid
additions, substitutions, and/or deletions, and still even more
preferably, not more than 20 amino acid additions, substitutions,
and/or deletions. Of course, in order of ever-increasing
preference, it is highly preferable for a polynucleotide which
encodes the amino acid sequence of a Neutrokine-a or Neutrokine-aSV
polypeptide to have an amino acid sequence which contains not more
than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 or 1-100, 1-50, 1-25, 1-20,
1-15, 1-10, or 1-5 amino acid additions, substitutions and/or
deletions. Conservative substitutions are preferable.
[0028] The present invention also relates to recombinant vectors,
which include the isolated nucleic acid molecules of the present
invention, and to host cells containing the recombinant vectors, as
well as to methods of making such vectors and host cells and for
using them for production of Neutrokine-a polypeptides or peptides
by recombinant techniques.
[0029] In accordance with a further embodiment of the present
invention, there is provided a process for producing such
polypeptide by recombinant techniques comprising culturing
recombinant prokaryotic and/or eukaryotic host cells, containing a
human Neutrokine-a or Neutrokine-aSV nucleic acid sequence, under
conditions promoting expression of said polypeptide and subsequent
recovery of said polypeptide.
[0030] The invention further provides an isolated Neutrokine-a
polypeptide comprising an amino acid sequence selected from the
group consisting of: (a) the amino acid sequence of the full-length
Neutrokine-a polypeptide having the complete amino acid sequence
shown in FIGS. 1A and 1B (i.e., positions 1-285 of SEQ ID NO:2) or
as encoded by the cDNA clone contained in the deposit having ATCC
accession number 97768; (b) the amino acid sequence of the
full-length Neutrokine-a polypeptide having the complete amino acid
sequence shown in SEQ ID NO:2 excepting the N-terminal methionine
(i.e., positions 2 to 285 of SEQ ID NO:2); (c) a fragment of the
polypeptide of (b) having Neutrokine-a functional activity (e.g.,
biological activity); (d) the amino acid sequence of the predicted
extracellular domain of the Neutrokine-a polypeptide having the
amino acid sequence at positions 73 to 285 in FIGS. 1A and 1B (SEQ
ID NO:2) or as encoded by the cDNA clone contained in the deposit
having ATCC accession number 97768; (e) the amino acid sequence of
the Neutrokine-a intracellular domain (predicted to constitute
amino acid residues from about 1 to about 46 in FIGS. 1A and 1B
(SEQ ID NO:2)) or as encoded by the cDNA clone contained in the
deposit having ATCC accession number 97768; (f) the amino acid
sequence of the Neutrokine-a transmembrane domain (predicted to
constitute amino acid residues from about 47 to about 72 in FIGS.
1A and 1B (SEQ ID NO:2)) or as encoded by the cDNA clone contained
in the deposit having ATCC accession number 97768; (g) the amino
acid sequence of the soluble Neutrokine-a polypeptide having the
extracellular and intracellular domains but lacking the
transmembrane domain, wherein each of these domains is defined
above; and (g) fragments of the polypeptide of (a), (b), (c), (d),
(e), or (f). The polypeptides of the present invention also include
polypeptides having an amino acid sequence at least 80% identical,
more preferably at least 90% identical, and still more preferably
95%, 96%, 97%, 98% or 99% identical to those described in (a), (b),
(c), (d), (e) (f), or (g) above, as well as polypeptides having an
amino acid sequence with at least 90% similarity, and more
preferably at least 95% similarity, to those above. Additional
embodiments of the invention relates to a polypeptide which
comprises the amino acid sequence of an epitope-bearing portion of
a Neutrokine-a polypeptide having an amino acid sequence described
in (a), (b), (c), (d), (e), (f), or (g) above. Peptides or
polypeptides having the amino acid sequence of an epitope-bearing
portion of a Neutrokine-a polypeptide of the invention include
portions of such polypeptides with at least six or seven,
preferably at least nine, and more preferably at least about 30
amino acids to about 50 amino acids, although epitope-bearing
polypeptides of any length up to and including the entire amino
acid sequence of a polypeptide of the invention described above
also are included in the invention.
[0031] The invention further provides an isolated Neutrokine-aSV
polypeptide comprising an amino acid sequence selected from the
group consisting of: (a) the amino acid sequence of the full-length
Neutrokine-aSV polypeptide having the complete amino acid sequence
shown in FIGS. 5A and 5B (i.e., positions 1-266 of SEQ ID NO:19) or
as encoded by the cDNA clone contained in ATCC No. 203518 deposited
on Dec. 10, 1998; (b) the amino acid sequence of the full-length
Neutrokine-aSV polypeptide having the complete amino acid sequence
shown in SEQ ID NO:19 excepting the N-terminal methionine (i.e.,
positions 2 to 266 of SEQ ID NO:19); (c) the amino acid sequence of
the predicted extracellular domain of the Neutrokine-aSV
polypeptide having the amino acid sequence at positions 73 to 266
in FIGS. 5A and 5B (SEQ ID NO:19) or as encoded by the cDNA clone
contained in ATCC No. 203518 deposited on Dec. 10, 1998; (d) the
amino acid sequence of the Neutrokine-aSV intracellular domain
(predicted to constitute amino acid residues from about 1 to about
46 in FIGS. 5A and 5B (SEQ ID NO:19)) or as encoded by the cDNA
clone contained in ATCC No. 203518 deposited on Dec. 10, 1998; (e)
the amino acid sequence of the Neutrokine-aSV transmembrane domain
(predicted to constitute amino acid residues from about 47 to about
72 in FIGS. 5A and 5B (SEQ ID NO:19)) or as encoded by the cDNA
clone contained in ATCC No. 203518 deposited on Dec. 10, 1998; (f)
the amino acid sequence of the soluble Neutrokine-aSV polypeptide
having the extracellular and intracellular domains but lacking the
transmembrane domain, wherein each of these domains is defined
above; and (g) fragments of the polypeptide of (a), (b), (c), (d),
(e), or (f). The polypeptides of the present invention also include
polypeptides having an amino acid sequence at least 80% identical,
more preferably at least 90% identical, and still more preferably
95%, 96%, 97%, 98% or 99% identical to those described in (a), (b),
(c), (d), (e) (f), or (g) above, as well as polypeptides having an
amino acid sequence with at least 90% similarity, and more
preferably at least 95% similarity, to those above. Additional
embodiments of the invention relates to a polypeptide which
comprises the amino acid sequence of an epitope-bearing portion of
a Neutrokine-aSV polypeptide having an amino acid sequence
described in (a), (b), (c), (d), (e), (f), or (g) above. Peptides
or polypeptides having the amino acid sequence of an
epitope-bearing portion of a Neutrokine-aSV polypeptide of the
invention include portions of such polypeptides with at least six
or seven, preferably at least nine, and more preferably at least
about 30 amino acids to about 50 amino acids, although
epitope-bearing polypeptides of any length up to and including the
entire amino acid sequence of a polypeptide of the invention
described above also are included in the invention.
[0032] An additional embodiment of the invention relates to a
polypeptide which has the amino acid sequence of an epitope-bearing
portion of a Neutrokine-a or Neutrokine-aSV polypeptide having an
amino acid sequence described in (a), (b), (c), (d), (e), (f) or
(g) above. Peptides or polypeptides having the amino acid sequence
of an epitope-bearing portion of a Neutrokine-a or Neutrokine-aSV
polypeptide of the invention include portions of such polypeptides
with at least six or seven, preferably at least nine, and more
preferably at least about 30 amino acids to about 50 amino acids,
although epitope-bearing polypeptides of any length up to and
including the entire amino acid sequence of a polypeptide of the
invention described above also are included in the invention. In
another embodiment, the invention provides an isolated antibody
that binds specifically (i.e., uniquely) to a polypeptide having an
amino acid sequence described in (a), (b), (c), (d), (e), (f) or
(g), above.
[0033] The invention further provides methods for isolating
antibodies that bind specifically (i.e., uniquely) to a
Neutrokine-a or Neutrokine-aSV polypeptide having an amino acid
sequence as described herein. Such antibodies are useful
diagnostically or therapeutically as described below.
[0034] The invention also provides for pharmaceutical compositions
comprising soluble Neutrokine-a and/or Neutrokine-aSV polypeptides,
particularly human Neutrokine-a and/or Neutrokine-aSV polypeptides
which may be employed, for instance, to treat tumor and tumor
metastasis, infections by bacteria, viruses and other parasites,
immunodeficiencies, inflammatory diseases, lymphadenopathy,
autoimmune diseases, graft versus host disease, stimulate
peripheral tolerance, destroy some transformed cell lines, mediate
cell activation and proliferation, and to mediate immune regulation
and inflammatory responses.
[0035] The invention further provides compositions comprising a
Neutrokine-a or Neutrokine-aSV polynucleotide or a Neutrokine-a or
Neutrokine-aSV polypeptide for administration to cells in vitro, to
cells ex vivo and to cells in vivo, or to a multicellular organism.
In preferred embodiments, the compositions of the invention
comprise a Neutrokine-a and/or Neutrokine-aSV polynucleotide for
expression of a Neutrokine-a and/or Neutrokine-aSV polypeptide in a
host organism for treatment of disease. Particularly preferred in
this regard is expression in a human patient for treatment of a
dysfunction associated with aberrant endogenous activity of a
Neutrokine-a or Neutrokine-aSV gene (e.g., enhancement of a normal
B-cell function by expanding B-cell numbers).
[0036] The present invention also provides a screening method for
identifying compounds capable of enhancing or inhibiting a cellular
response induced by Neutrokine-a and/or Neutrokine-aSV which
involves contacting cells which express Neutrokine-a and/or
Neutrokine-aSV with the candidate compound, assaying a cellular
response, and comparing the cellular response to a standard
cellular response, the standard being assayed when contact is made
in absence of the candidate compound; whereby, an increased
cellular response over the standard indicates that the compound is
an agonist and a decreased cellular response over the standard
indicates that the compound is an antagonist.
[0037] In another embodiment, a method for identifying Neutrokine-a
and/or Neutrokine-aSV receptors is provided, as well as a screening
assay for agonists and antagonists using such receptors. This assay
involves determining the effect a candidate compound has on
Neutrokine-a and/or Neutrokine-aSV binding to the Neutrokine-a
and/or Neutrokine-aSV receptor. In particular, the method involves
contacting a Neutrokine-a and/or Neutrokine-aSV receptor with a
Neutrokine-a and/or Neutrokine-aSV polypeptide of the invention and
a candidate compound and determining whether Neutrokine-a and/or
Neutrokine-aSV polypeptide binding to the Neutrokine-a and/or
Neutrokine-aSV receptor is increased or decreased due to the
presence of the candidate compound. The antagonists may be employed
to prevent septic shock, inflammation, cerebral malaria, activation
of the HIV virus, graft-host rejection, bone resorption, rheumatoid
arthritis, cachexia (wasting or malnutrition), and immune system
function.
[0038] The present inventors have discovered that Neutrokine-a is
expressed not only in cells of monocytic lineage, but also in
kidney, lung, peripheral leukocyte, bone marrow, T cell lymphoma, B
cell lymphoma, activated T cells, stomach cancer, smooth muscle,
macrophages, and cord blood tissue. The present inventors have
further discovered that Neutrokine-aSV appears to be expressed
highly only in primary dendritic cells. For a number of disorders
of these tissues and cells, such as tumor and tumor metastasis,
infection of bacteria, viruses and other parasites,
immunodeficiencies, septic shock, inflammation, cerebral malaria,
activation of the HIV virus, graft-host rejection, bone resorption,
rheumatoid arthritis and cachexia (wasting or malnutrition, it is
believed that significantly higher or lower levels of Neutrokine-a
and/or Neutrokine-aSV gene expression can be detected in certain
tissues (e.g., bone marrow) or bodily fluids (e.g., serum, plasma,
urine, synovial fluid or spinal fluid) taken from an individual
having such a disorder, relative to a "standard" Neutrokine-a
and/or Neutrokine-aSV gene expression level, i.e., the Neutrokine-a
and/or Neutrokine-aSV expression level in tissue or bodily fluids
from an individual not having the disorder. Thus, the invention
provides a diagnostic method useful during diagnosis of a disorder,
which involves: (a) assaying Neutrokine-a and/or Neutrokine-aSV
gene expression level in cells or body fluid of an individual; (b)
comparing the Neutrokine-a and/or Neutrokine-aSV gene expression
level with a standard Neutrokine-a and/or Neutrokine-aSV gene
expression level, whereby an increase or decrease in the assayed
Neutrokine-a and/or Neutrokine-aSV gene expression level compared
to the standard expression level is indicative of a disorder.
[0039] An additional embodiment of the invention is related to a
method for treating an individual in need of an increased or
constitutive level of Neutrokine-a and/or Neutrokine-aSV activity
in the body comprising administering to such an individual a
composition comprising a therapeutically effective amount of an
isolated Neutrokine-a and/or Neutrokine-aSV polypeptide of the
invention or an agonist thereof.
[0040] A still further embodiment of the invention is related to a
method for treating an individual in need of a decreased level of
Neutrokine-a and/or Neutrokine-aSV activity in the body comprising,
administering to such an individual a composition comprising a
therapeutically effective amount of an Neutrokine-a and/or
Neutrokine-aSV antagonist. Preferred antagonists for use in the
present invention are Neutrokine-a-specific and/or
Neutrokine-aSV-specific antibodies.
BRIEF DESCRIPTION OF THE FIGURES
[0041] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0042] FIGS. 1A and 1B shows the nucleotide (SEQ ID NO:1) and
deduced amino acid (SEQ ID NO:2) sequences of Neutrokine-a. Amino
acids 1 to 46 represent the predicted intracellular domain, amino
acids 47 to 72 the predicted transmembrane domain (the
double-underlined sequence), and amino acids 73 to 285, the
predicted extracellular domain (the remaining sequence). Potential
asparagine-linked glycosylation sites are marked in FIGS. 1A and 1B
with a bolded asparagine symbol (N) in the Neutrokine-a amino acid
sequence and a bolded pound sign (#) above the first nucleotide
encoding that asparagine residue in the Neutrokine-a nucleotide
sequence. Potential N-linked glycosylation sequences are found at
the following locations in the Neutrokine-a amino acid sequence:
N-124 through Q-127 (N-124, S-125, S-126, Q-127) and N-242 through
C-245 (N-242, N-243, S-244, C-245).
[0043] Regions of high identity between Neutrokine-a,
Neutrokine-aSV, TNF-a, TNF-b, LT-b, and the closely related Fas
Ligand (an aligment of these sequences is presented in FIG. 2) are
underlined in FIGS. 1A and 1B. These regions are not limiting and
are labeled as Conserved Domain (CD)-I, CD-II, CD-III, CD-IV, CD-V,
CD-VI, CD-VII, CD-VIII, CD-IX, CD-X, and CD-XI in FIGS. 1A and
1B.
[0044] FIGS. 2A and 2B show the regions of identity between the
amino acid sequences of Neutrokine-a (SEQ ID NO:2) and
Neutrokine-aSV (SEQ ID NO:19), and TNF-a ("TNFalpha" in FIGS. 2A
and 2B; GenBank No. Z15026; SEQ ID NO:3), TNF-.beta. ("TNFbeta" in
FIGS. 2A and 2B; GenBank No. Z15026; SEQ ID NO:4), Lymphotoxin-b
("LTbeta" in FIGS. 2A and 2B; GenBank No. L11016; SEQ ID NO:5), and
FAS ligand ("FASL" in FIGS. 2A and 2B; GenBank No. U11821; SEQ ID
NO:6), determined by the "MegAlign" routine which is part of the
computer program called "DNA*STAR." Residues that match the
consensus are shaded.
[0045] FIG. 3 shows an analysis of the Neutrokine-a amino acid
sequence. Alpha, beta, turn and coil regions; hydrophilicity and
hydrophobicity; amphipathic regions; flexible regions; antigenic
index and surface probability are shown, as predicted for the amino
acid sequence of SEQ ID NO:2 using the default parameters of the
recited computer programs. In the "Antigenic Index--Jameson-Wolf"
graph, the indicate location of the highly antigenic regions of
Neutrokine-a i.e., regions from which epitope-bearing peptides of
the invention may be obtained. Antigenic polypeptides include from
about Phe-115 to about Leu-147, from about Ile-110 to about
Tyr-163, from about Ser-171 to about Phe-194, from about Glu-223 to
about Tyr-247, and from about Ser-271 to about Phe-278, of the
amino acid sequence of SEQ ID NO:2.
[0046] The data presented in FIG. 3 are also represented in tabular
form in Table I. The columns are labeled with the headings "Res",
"Position", and Roman Numerals I-XIV. The column headings refer to
the following features of the amino acid sequence presented in FIG.
3, and Table I: "Res": amino acid residue of SEQ ID NO:2 and FIGS.
1A and 1B; "Position": position of the corresponding residue within
SEQ ID NO:2 and FIGS. 1A and 1B; I: Alpha, Regions--Garnier-Robson;
II: Alpha, Regions--Chou-Fasman; III: Beta,
Regions--Garnier-Robson; IV: Beta, Regions--Chou-Fasman; V: Turn,
Regions Garnier-Robson; VI: Turn, Regions--Chou-Fasman; VI: Coil,
Regions--Garnier-Robson; Vm: Hydrophilicity Plot--Kyte-Doolittle;
IX: Hydrophobicity Plot--Hopp-Woods; X: Alpha, Amphipathic
Regions--Eisenberg; XI: Beta, Amphipathic Regions--Eisenberg; XII:
Flexible Regions--Karplus-Schulz; XIII: Antigenic
Index--Jameson-Wolf; and XIV: Surface Probability Plot--Emini.
[0047] FIGS. 4A, 4B, and 4C show the alignment of the Neutrokine-a
nucleotide sequence (SEQ ID NO:1) determined from the human cDNA
clone (HNEDU15) deposited in ATCC No. 97768 with related human cDNA
clones of the invention which have been designated HSOAD55 (SEQ ID
NO:7), HSLAH84 (SEQ ID NO:8) and HLTBM08 (SEQ ID NO:9).
[0048] FIGS. 5A and 5B shows the nucleotide (SEQ ID NO:18) and
deduced amino acid (SEQ ID NO:19) sequences of the Neutrokine-aSV
protein. Amino acids 1 to 46 represent the predicted intracellular
domain, amino acids 47 to 72 the predicted transmembrane domain
(the double-underlined sequence), and amino acids 73 to 266, the
predicted extracellular domain (the remaining sequence). Potential
asparagine-linked glycosylation sites are marked in FIGS. 5A and 5B
with a bolded asparagine symbol (N) in the Neutrokine-aSV amino
acid sequence and a bolded pound sign (#) above the first
nucleotide encoding that asparagine residue in the Neutrokine-aSV
nucleotide sequence. Potential N-linked glycosylation sequences are
found at the following locations in the Neutrokine-aSV amino acid
sequence: N-124 through Q-127 (N-124, S-125, S-126, Q-127) and
N-223 through C-226 (N-223, N-224, S-225, C-226). Antigenic
polypeptides include from about Pro-32 to about Leu-47, from about
Glu-116 to about Ser-143, from about Phe-153 to about Tyr-173, from
about Pro-218 to about Tyr-227, from about Ala-232 to about
Gln-241; from about Ile-244 to about Ala-249; and from about
Ser-252 to about Val-257 of the amino acid sequence of SEQ ID
NO:19.
[0049] Regions of high identity between Neutrokine-a,
Neutrokine-aSV, TNF-a, TNF-b, LT-b, and the closely related Fas
Ligand (an aligment of these sequences is presented in FIG. 2) are
underlined in FIGS. 1A and 1B. Polypeptides comprising, or
alternatively, consisting of the amino acid sequence of any
combination of one, two, three, four, five, six, seven, eight,
nine, ten, or or all of these regions are encompassed by the
invention. These conserved regions (of Neutrokine-a and
Neutrokine-aSV) are labeled as Conserved Domain (CD)-I, CD-II,
CD-III, CD-V, CD-VI, CD-VII, CD-VIII, CD-IX, CD-X, and CD-XI in
FIGS. 5A and 5B. Neutrokine-aSV does not contain the sequence of
CD-IV described in the legend of FIGS. 1A and 1B.
[0050] An additional alignment of the Neutrokine-a polypeptide
sequence (SEQ ID NO:2) with APRIL, TNF alpha, and LT alpha is
presented in FIG. 7A. In FIG. 7A, beta sheet regions are indicated
as described below in the FIG. 7A legend.
[0051] FIG. 6 shows an analysis of the Neutrokine-a amino acid
sequence. Alpha, beta, turn and coil regions; hydrophilicity and
hydrophobicity; amphipathic regions; flexible regions; antigenic
index and surface probability are shown, as predicted for the amino
acid sequence of SEQ ID NO:2 using the default parameters of the
recited computer programs. In the "Antigenic Index--Jameson-Wolf"
graph, the indicate location of the highly antigenic regions of the
Neutrokine-a protein, i.e., regions from which epitope-bearing
peptides of the invention may be obtained. The data shown in FIG. 6
can be easily represented in tabular format similar to the data
shown in Table I. Such a tablular representation of the exact data
disclosed in FIG. 6 can be generated using the MegAlign component
of the DNA*STAR computer sequence analysis package set on default
parameters. This is the identical program that was used to generate
FIGS. 3 and 6 of the present application.
[0052] FIG. 7A. Sequence and expression of Neutrokine-a. Amino-acid
sequence of Neutrokine-a and alignment with APRIL, TNF alpha, and
LT alpha. The full length amino acid sequence of Neutrokine-a (SEQ
ID NO:2) is shown together with an alignment of its predicted
receptor-ligand binding domain with those of APRIL (SEQ ID NO:22),
TNF alpha (amino acid residues 88-233 of SEQ ID NO:3), and LT alpha
(amino acid residues 62-205 of SEQ ID NO:4). The predicted membrane
spanning region is indicated and the site of cleavage depicted with
an arrow. Identical amino acids are shaded in yellow. Sequences
overlaid with lines (A thru H) represent predicted beta-pleated
sheet regions.
[0053] FIG. 7B. Expression of Neutrokine-a mRNA. Northern
hybridization analysis was performed using the Neutrokine-a orf as
a probe on blots of poly(A)+ RNA (Clonetech) from a spectrum of
human tissue types and a selection of cancer cell lines.
[0054] FIGS. 5A and 81B. Cell surface expression of Neutrokine-a on
tumor cell lines and normal monocytes as detected by monoclonal
antibody 12D6A. A. Single cell suspensions were prepared and cells
resuspended at 10.sup.7/mL. One million cells were stained with the
anti-Neutrokine-a antibody or an isotype matched control mAb.
Binding was detected by addition of PE-labeled goat anti mouse IgG.
Cells were washed and analyzed on a Becton Dickinson FACScan using
the CellQuest software provided by the manufacturer. B. Flow
cytometric analysis of Neutrokine-a protein expression on in vitro
cultured monocytes. Comparable results were obtained with monocytes
from three different donors in three independent experiments.
[0055] FIGS. 9A and 9B. Neutrokine-a induced proliferation of human
tonsillar B cells. A. The biological activity of Neutrokine-a was
assessed in a standard B-lymphocyte co-stimulation assay utilizing
either SAC or anti-IgM antibody as the priming agent. Second
signals such as IL-2 and IL-15 synergize with SAC and IgM
crosslinking to elicit B cell proliferation as measured by
tritiated-thymidine incorporation. Novel synergizing agents can be
readily identified using this assay. The assay involves isolation
of human tonsillar B cells by magnetic bead (MACS) depletion of
CD3-positive cells. The resulting cell population is greater than
95% B cells as assessed by expression of CD45R(B220). Various
dilutions of each sample are placed into individual wells of a
96-well plate to which are added 10.sup.5 B cells suspended in
culture medium (RPMI 1640 containing 10% FBS, 5.times.10.sup.-5M
2ME, 100 U/ml penicillin, 10 ug/ml streptomycin, and 10.sup.-5
dilution of SAC) in a total volume of 150 ul. Proliferation is
quantitated by a 20 h pulse (1 uCi/well) with .sup.3H-thymidine
(6.7 Ci/mM) beginning 72 h post factor addition. The positive and
negative controls are IL2 and medium respectively. B. Neutrokine
induced proliferation of anti-IgM primed B cells.
[0056] FIG. 10. Biological assessment of amino-terminal truncations
of Neutrokine-a. Using the standard B cell proliferation assay
various truncations of Neutrokine-a were tested for biological
activity.
[0057] FIG. 11. Neutrokine-a binding to tonsillar B cells and the
myeloma cell line IM9. Purified Neutrokine-a was labeled with
biotin using the EZ-link.TM. NHS-Biotin reagent (Pierce, Rockford,
Ill.). The resultant protein was added to either normal or
neoplastic cells. Following a shrot incubation, the labeled protein
was wahsed out and PE-labeled strepavidin added to visualize
Neutrokine-alpha binding. Cells were washed and analyzed on a
Becton Dickinson FACScan using the CellQuest software provided by
the manufacturer. Similar results were observed with a FLAG-tagged
Neutrokine-a protein.
[0058] FIGS. 12A and 12B. In vivo administration of Neutrokine-a
results in disruption of splenic architecture and appearance of a
mature B cell population. A. Analyses of formalin-fixed spleens
taken from normal (left) and Neutrokine-a treated (2 mg/Kg, BID,
4d) mice (right). Upper panels are sections stained with H&E
while lower figures have been staiend with a B cell marker,
anti-CD45R(B220), and developed with peroxidase/DAB to visualize B
cells. B. FACS analysis of B-cell population in spleen. CD45R
(B220) and ThB (Ly 6D) expression on splenocytes from BALB/c mice
injected with control buffer or (2 mg/Kg, BID, 4d) Neutrokine-a
protein.
DETAILED DESCRIPTION
[0059] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding a Neutrokine-a
polypeptides having the amino acid sequences shown in FIGS. 1A and
1B (SEQ ID NO:2), which was determined by sequencing a cDNA clone.
The nucleotide sequence shown in FIGS. 1A and 1B (SEQ ID NO:1) was
obtained by sequencing the HNEDU15 clone, which was deposited on
Oct. 22, 1996 at the American Type Culture Collection, 10801
University Boulevard, Manassas, Va. 20110-2209, and assigned ATCC
Accession No. 97768. The deposited clone is contained in the
pBluescript SK(-) plasmid (Stratagene, La Jolla, Calif.).
[0060] The present invention also provides isolated nucleic acid
molecules comprising a polynucleotide encoding Neutrokine-aSV
polypeptides having the amino acid sequences shown in FIGS. 5A and
5B (SEQ ID NO:19), which was determined by sequencing a cDNA clone.
The nucleotide sequence shown in FIGS. 5A and 5B (SEQ ID NO:18) was
obtained by sequencing the HDPMC52 clone, which was deposited on
Dec. 10, 1998 at the American Type Culture Collection, and assigned
ATCC Accession No. 203518. The deposited clone is contained in the
pBluescript SK(-) plasmid (Stratagene, La Jolla, Calif.).
[0061] The Neutrokine-a and Neutrokine-a polypeptides of the
present invention share sequence homology with the translation
products of the human mRNAs for TNF-a, TNF-.beta., LTbeta, Fas
ligand, APRIL, and LTalpha. (See, FIGS. 2A, 2B, and 7A). As noted
above, TNF-a is thought to be an important cytokine that plays a
role in cytotoxicity, necrosis, apoptosis, costimulation,
proliferation, lymph node formation, immunoglobulin class switch,
differentiation, antiviral activity, and regulation of adhesion
molecules and other cytokines and growth factors.
Nucleic Acid Molecules
[0062] Unless otherwise indicated, all nucleotide sequences
determined by sequencing a DNA molecule herein were determined
using an automated DNA sequencer (such as the Model 373 from
Applied Biosystems, Inc., Foster City, Calif.), and all amino acid
sequences of polypeptides encoded by DNA molecules determined
herein were predicted by translation of a DNA sequence determined
as above. Therefore, as is known in the art for any DNA sequence
determined by this automated approach, any nucleotide sequence
determined herein may contain some errors. Nucleotide sequences
determined by automation are typically at least about 90%
identical, more typically at least about 95% to at least about
99.9% identical to the actual nucleotide sequence of the sequenced
DNA molecule. The actual sequence can be more precisely determined
by other approaches including manual DNA sequencing methods well
known in the art. As is also known in the art, a single insertion
or deletion in a determined nucleotide sequence compared to the
actual sequence will cause a frame shift in translation of the
nucleotide sequence such that the predicted amino acid sequence
encoded by a determined nucleotide sequence will be completely
different from the amino acid sequence actually encoded by the
sequenced DNA molecule, beginning at the point of such an insertion
or deletion.
[0063] By "nucleotide sequence" of a nucleic acid molecule or
polynucleotide is intended, for a DNA molecule or polynucleotide, a
sequence of deoxyribonucleotides, and for an RNA molecule or
polynucleotide, the corresponding sequence of ribonucleotides (A,
G, C and U), where each thymidine deoxyribonucleotide (T) in the
specified deoxyribonucleotide sequence is replaced by the
ribonucleotide uridine (U).
[0064] Using the information provided herein, such as the
nucleotide sequence in FIGS. 1A and 1B, a nucleic acid molecule of
the present invention encoding a Neutrokine-a polypeptide may be
obtained using standard cloning and screening procedures, such as
those for cloning cDNAs using mRNA as starting material.
Illustrative of the invention, the nucleic acid molecule described
in FIGS. 1A and 1B (SEQ ID NO:1) was discovered in a cDNA library
derived from neutrophils. Expressed sequence tags corresponding to
a portion of the Neutrokine-a cDNA were also found in kidney, lung,
peripheral leukocyte, bone marrow, T cell lymphoma, B cell
lymphoma, activated T cells, stomach cancer, smooth muscle,
macrophages, and cord blood tissue. In addition, using the
nucleotide information provided in FIGS. 5A and 5B, a nucleic acid
molecule of the present invention encoding a Neutrokine-aSV
polypeptide may be obtained using standard cloning and screening
procedures, such as those for cloning cDNAs using mRNA as starting
material. Illustrative of the invention, the nucleic acid molecule
described in FIGS. 5A and 5B (SEQ ID NO:18) was discovered in a
cDNA library derived from primary dendritic cells.
[0065] The deposited clone contains an open reading frame encoding
a protein of about 285 amino acid residues, a predicted
intracellular domain of about 46 amino acids (amino acid residues
from about 1 to about 46 in FIGS. 1A and 1B (SEQ ID NO:2)), a
predicted transmembrane domain of about 26 amino acids (underlined
amino acid residues from about 47 to about 72 in FIGS. 1A and 1B
(SEQ ID NO:2)), a predicted extracellular domain of about 213 amino
acids (amino acid residues from about 73 to about 285 in FIGS. 1A
and 1B (SEQ ID NO:2)); and a deduced molecular weight of about 31
kDa. The Neutrokine-a polypeptide shown in FIGS. 1A and 1B (SEQ ID
NO:2) is about 20% similar and about 10% identical to human
TNF-.alpha. which can be accessed on GenBank as Accession No.
339764.
[0066] The Neutrokine-aSV gene contains an open reading frame
encoding a protein of about 266 amino acid residues, a predicted
intracellular domain of about 46 amino acids (amino acid residues
from about 1 to about 46 in FIGS. 5A and 5B (SEQ ID NO:19)), a
predicted transmembrane domain of about 26 amino acids (underlined
amino acid residues from about 47 to about 72 in FIGS. 5A and 5B
(SEQ ID NO:19)), a predicted extracellular domain of about 194
amino acids (amino acid residues from about 73 to about 266 in
FIGS. 5A and 5B (SEQ ID NO:19)); and a deduced molecular weight of
about 29 kDa. The Neutrokine-aSV polypeptide shown in FIGS. 5A and
5B (SEQ ID NO:19) is about 33.9% similar and about 22.0% identical
to human TNF-.alpha. which can be accessed on GenBank as Accession
No. 339764.
[0067] As one of ordinary skill would appreciate, due to the
possibilities of sequencing errors discussed above, the actual
complete Neutrokine-a and/or Neutrokine-aSV polypeptides encoded by
the deposited cDNAs, which comprise about 285 and 266 amino acids,
respectively, may be somewhat shorter. In particular, the
determined Neutrokine-a and Neutrokine-aSV coding sequences contain
a common second methionine codon which may serve as an alternative
start codon for translation of the open reading frame, at
nucleotide positions 210-212 in FIGS. 1A and 1B (SEQ ID NO:1) and
at nucleotide positions 64-66 in FIGS. 5A and 5B (SEQ ID NO:18).
More generally, the actual open reading frame may be anywhere in
the range of .+-.20 amino acids, more likely in the range of .+-.10
amino acids, of that predicted from either the first or second
methionine codon from the N-terminus shown in FIGS. 1A and 1B (SEQ
ID NO:1) and in FIGS. 5A and 5B (SEQ ID NO:18). It will further be
appreciated that, the polypeptide domains described herein have
been predicted by computer analysis, and accordingly, that
depending on the analytical criteria used for identifying various
functional domains, the exact "address" of the extracelluar,
intracelluar and transmembrane domains of the Neutrokine-a and
Neutrokine-aSV polypeptides may differ slightly. For example, the
exact location of the Neutrokine-a and Neutrokine-aSV extracellular
domains in FIGS. 1A and 1B (SEQ ID NO:2) and FIGS. 5A and 5B (SEQ
ID NO:19) may vary slightly (e.g., the address may "shift" by about
1 to about 20 residues, more likely about 1 to about 5 residues)
depending on the criteria used to define the domain. In this case,
the ends of the transmembrane domains and the beginning of the
extracellular domains were predicted on the basis of the
identification of the hydrophobic amino acid sequence in the above
indicated positions, as shown in FIGS. 3 and 6 and in Table I. In
any event, as discussed further below, the invention further
provides polypeptides having various residues deleted from the
N-terminus and/or C-terminus of the complete polypeptides,
including polypeptides lacking one or more amino acids from the
N-termini of the extracellular domains described herein, which
constitute soluble forms of the extracellular domains of the
Neutrokine-.alpha. and Neutrokine-aSV polypeptides.
[0068] As indicated, nucleic acid molecules and polynucleotides of
the present invention may be in the form of RNA, such as mRNA, or
in the form of DNA, including, for instance, cDNA and genomic DNA
obtained by cloning or produced synthetically. The DNA may be
double-stranded or single-stranded. Single-stranded DNA or RNA may
be the coding strand, also known as the sense strand, or it may be
the non-coding strand, also referred to as the anti-sense
strand.
[0069] By "isolated" nucleic acid molecule(s) is intended a nucleic
acid molecule (DNA or RNA), which has been removed from its native
environment. For example, recombinant DNA molecules contained in a
vector are considered isolated for the purposes of the present
invention. Further examples of isolated DNA molecules include
recombinant DNA molecules maintained in heterologous host cells or
purified (partially or substantially) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts
of the DNA molecules of the present invention. However, a nucleic
acid contained in a clone that is a member of a library (e.g., a
genomic or cDNA library) that has not been isolated from other
members of the library (e.g., in the form of a homogeneous solution
containing the clone and other members of the library) or a
chromosome isolated or removed from a cell or a cell lysate (e.g.,
a "chromosome spread", as in a karyotype), is not "isolated" for
the purposes of this invention. As discussed further herein,
isolated nucleic acid molecules according to the present invention
may be produced naturally, recombinantly, or synthetically.
[0070] Isolated nucleic acid molecules of the present invention
include DNA molecules comprising an open reading frame (ORF) with
an initiation codon at positions 147-149 of the nucleotide sequence
shown in FIGS. 1A and 1B (SEQ ID NO:1). In addition, isolated
nucleic acid molecules of the invention include DNA molecules which
comprise a sequence substantially different from those described
above, but which due to the degeneracy of the genetic code, still
encode the Neutrokine-a protein. Of course, the genetic code is
well known in the art. Thus, it would be routine for one skilled in
the art to generate the degenerate variants described above. In
another embodiment, the invention provides isolated nucleic acid
molecules encoding the Neutrokine-a polypeptide having an amino
acid sequence encoded by the cDNA contained in the plasmid having
ATCC accession number 97768. Preferably, this nucleic acid molecule
comprises a sequence encoding the extracellular domain of the
polypeptide encoded by the cDNA contained in the plasmid having
ATCC accession number 97768.
[0071] Isolated nucleic acid molecules of the present invention
also include DNA molecules comprising an open reading frame (ORF)
with an initiation codon at positions 1-3 of the nucleotide
sequence shown in FIGS. 5A and 5B (SEQ ID NO:18). In addition,
isolated nucleic acid molecules of the invention include DNA
molecules which comprise a sequence substantially different from
those described above, but which due to the degeneracy of the
genetic code, still encode the Neutrokine-aSV polypeptide. Of
course, the genetic code is well known in the art. Thus, it would
be routine for one skilled in the art to generate the degenerate
variants described above. In another embodiment, the invention
provides isolated nucleic acid molecules encoding the
Neutrokine-aSV polypeptide having an amino acid encoded by the cDNA
contained in the plasmid having ATCC accession number 203518.
Preferably, this nucleic acid molecule comprises a sequence
encoding the extracellular domain of the polypeptide encoded by the
cDNA contained in the plasmid having ATCC accession number
203518.
[0072] The invention further provides an isolated nucleic acid
molecule having the nucleotide sequence shown in FIGS. 1A and 1B
(SEQ ID NO:1) or the nucleotide sequence of the Neutrokine-a cDNA
contained in the plasmid having ATCC accession number 97768, or a
nucleic acid molecule having a sequence complementary to one of the
above sequences. In addition, the invention provides an isolated
nucleic acid molecule having the nucleotide sequence shown in FIGS.
5A and 5B (SEQ ID NO:18) or the nucleotide sequence of the
Neutrokine-a SV cDNA contained in the plasmid having ATCC accession
number 203518, or a nucleic acid molecule having a sequence
complementary to one of the above sequences. Such isolated
molecules, particularly DNA molecules, have uses which include, but
are not limited to, as probes for gene mapping by in situ
hybridization with chromosomes, and for detecting expression of the
Neutrokine-a and Neutrokine-aSV in human tissue, for instance, by
Northern or Western blot analysis.
[0073] The invention also provides nucleic acid molecules having
nucleotide sequences related to extensive portions of SEQ ID NO:1
and SEQ ID NO:18 which have been determined from the following
related cDNA clones: HSOAD55 (SEQ ID NO:7), HSLAH84 (SEQ ID NO:8),
and HLTBM08 (SEQ ID NO:9).
[0074] The present invention is further directed to nucleic acid
molecules encoding portions of the nucleotide sequences described
herein, as well as to fragments of the isolated nucleic acid
molecules described herein. In one embodiment, the invention
provides a polynucleotide having a nucleotide sequence representing
the portion of SEQ ID NO:1 which consists of the nucleotides at
positions 1-1001 of SEQ ID NO:1. In antoher embodiment, the
invention provides a polynucleotide having a nucleotide sequence
representing the portion of SEQ ID NO:18 which consists of
positions 1-798 of SEQ ID NO:18.
[0075] The present invention is further directed to fragments of
the nucleic acid molecules (i.e. polynucleotides) described herein.
By a fragment of a nucleic acid molecule having, for example, the
nucleotide sequence of the cDNA contained in the plasmid having
ATCC accession number 97768, a nucleotide sequence encoding the
polypeptide sequence encoded by the cDNA contained in the plasmid
having ATCC accession number 97768, the nucleotide sequence of SEQ
ID NO:1, a nucleotide sequence encoding the polypeptide sequence of
SEQ ID NO:2, the nucleotide sequence of the cDNA contained in the
plasmid having ATCC accession number 203518, a nucleotide sequence
encoding the polypeptide sequence encoded by the cDNA contained in
the plasmid having ATCC accession number 203518, the nucleotide
sequence of SEQ ID NO:18, a nucleotide sequence encoding the
polypeptide sequence of SEQ ID NO:20, or the complementary strand
thereto, is intended fragments at least 15 nt, and more preferably
at least 20 nt or at least 25 nt, still more preferably at least 30
nt, and even more preferably, at least 40, 50, 100, 150, 200, 250,
300, 325, 350, 375, 400, 450, or 500 nt in length. These fragments
have numerous uses which include, but are not limited to,
diagnostic probes and primers as discussed herein. Of course,
larger fragments, such as those of 501-1500 nt in length are also
useful according to the present invention as are fragments
corresponding to most, if not all, of the nucleotide sequences of
the cDNA contained in the plasmid having ATCC accession number
97768, the nucleotide sequence of SEQ ID NO:1, the nucleotide
sequences of the cDNA contained in the plasmid having ATCC
accession number 203518, and the nucleotide sequence of SEQ ID
NO:18. By a fragment at least 20 nt in length, for example, is
intended fragments which include the particularly recited ranges of
nucleotides from the nucleotide sequence of the deposited cDNAs or
the nucleotide sequence as shown in FIGS. 1A and 1B (SEQ ID NO:1)
or in FIGS. 5A and 5B (SEQ ID NO:18), wherein the fragments may be
larger or smaller than the particularly recited range by several
(i.e. 5, 4, 3, 2 or 1) amino acids, at either extreme or at both
extremes. Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding epitope-bearing portions of
the Neutrokine-a and/or Neutrokine-aSV polypeptide as identified in
FIGS. 1A and 1B (SEQ ID NO:2) and in FIGS. 5A and 5B (SEQ ID
NO:19), respectively, and described in more detail below.
[0076] Representative examples of Neutrokine-.alpha. polynucleotide
fragments of the invention include, for example, fragments that
comprise, or alternatively, consist of, a sequence from about
nucleotide 1 to 50, 51 to 100, 101 to 146, 147 to 200, 201 to 250,
251 to 300, 301 to 350, 351 to 400, 401 to 450, 451 to 500, 501 to
550, 551 to 600, 600 to 650, 651 to 700, 701 to 750, 751 to 800,
800 to 850, 851 to 900, 901 to 950, 951 to 1000, 1001 to 1050,
and/or 1051 to 1082, of SEQ ID NO:1, or the complementary strand
thereto, or the cDNA contained in the plasmid having ATCC accession
number 97768. In this context "about" includes the particularly
recited ranges, and ranges that are larger or smaller by several
(5, 4, 3, 2, or 1) nucleotides, at either terminus or at both
termini.
[0077] Additional representative examples of Neutrokine-.alpha.SV
polynucleotide fragments of the invention include, for example,
fragments that comprise, or alternatively, consist of, a sequence
from about nucleotide 1 to 50, 51 to 100, 101 to 150, 151 to 200,
201 to 250, 251 to 300, 301 to 350, 351 to 400, 401 to 450, 451 to
500, 501 to 550, 551 to 600, 600 to 650, 651 to 700, 701 to 750,
751 to 800, 800 to 850, and/or 851 to 900 of SEQ ID NO:18, or the
complementary strand thereto, or the cDNA contained in the plasmid
having ATCC accession number 203518. In this context "about"
includes the particularly recited ranges, and ranges that are
larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at
either terminus or at both termini.
[0078] In certain preferred embodiments, polynucleotide of the
invention comprise, or alternatively, consist of nucleotide
residues 571-627, 580-627, 590-627, 600-627, 610-627, 571-620,
580-620, 590-620, 600-620, 571-610, 580-610, 590-610, 571-600,
580-600, and/or 571-590 of SEQ ID NO:1.
[0079] In certain other preferred embodiments, polynucleotide of
the invention comprise, or alternatively, consist of nucleotide
residues 1-879, 25-879, 50-879, 75-879, 100-879, 125-879, 150-879,
175-879, 200-879, 225-879, 250-879, 275-879, 300-879, 325-879,
350-879, 375-879, 400-879, 425-879, 450-879, 475-879, 500-879,
525-879, 550-879, 575-879, 600-879, 625-879, 650-879, 675-879,
700-879, 725-879, 750-879, 775-879, 800-879, 825-879, 850-879,
1-850, 25-850, 50-850, 75-850, 100-850, 125-850, 150-850, 175-850,
200-850, 225-850, 250-850, 275-850, 300-850, 325-850, 350-850,
375-850, 400-850, 425-850, 450-850, 475-850, 500-850, 525-850,
550-850, 575-850, 600-850, 625-850, 650-850, 675-850, 700-850,
725-850, 750-850, 775-850, 800-850, 825-850, 1-825, 25-825, 50-825,
75-825, 100-825, 125-825, 150-825, 175-825, 200-825, 225-825,
250-825, 275-825, 300-825, 325-825, 350-825, 375-825, 400-825,
425-825, 450-825, 475-825, 500-825, 525-825, 550-825, 575-825,
600-825, 625-825, 650-825, 675-825, 700-825, 725-825, 750-825,
775-825, 800-825, 1-800, 25-800, 50-800, 75-800, 100-800, 125-800,
150-800, 175-800, 200-800, 225-800, 250-800, 275-800, 300-800,
325-800, 350-800, 375-800, 400-800, 425-800, 450-800, 475-800,
500-800, 525-800, 550-800, 575-800, 600-800, 625-800, 650-800,
675-800, 700-800, 725-800, 750-800, 775-800, 1-775, 25-775, 50-775,
75-775, 100-775, 125-775, 150-775, 175-775, 200-775, 225-775,
250-775, 275-775, 300-775, 325-775, 350-775, 375-775, 400-775,
425-775, 450-775, 475-775, 500-775, 525-775, 550-775, 575-775,
600-775, 625-775, 650-775, 675-775, 700-775, 725-775, 750-775,
1-750, 25-750, 50-750, 75-750, 100-750, 125-750, 150-750, 175-750,
200-750, 225-750, 250-750, 275-750, 300-750, 325-750, 350-750,
375-750, 400-750, 425-750, 450-750, 475-750, 500-750, 525-750,
550-750, 575-750, 600-750, 625-750, 650-750, 675-750, 700-750,
725-750, 1-725, 25-725, 50-725, 75-725, 100-725, 125-725, 150-725,
175-725, 200-725, 225-725, 250-725, 275-725, 300-725, 325-725,
350-725, 375-725, 400-725, 425-725, 450-725, 475-725, 500-725,
525-725, 550-725, 575-725, 600-725, 625-725, 650-725, 675-725,
700-725, 1-700, 25-700, 50-700, 75-700, 100-700, 125-700, 150-700,
175-700, 200-700, 225-700, 250-700, 275-700, 300-700, 325-700,
350-700, 375-700, 400-700, 425-700, 450-700, 475-700, 500-700,
525-700, 550-700, 575-700, 600-700, 625-700, 650-700, 675-700,
1-675, 25-675, 50-675, 75-675, 100-675, 125-675, 150-675, 175-675,
200-675, 225-675, 250-675, 275-675, 300-675, 325-675, 350-675,
375-675, 400-675, 425-675, 450-675, 475-675, 500-675, 525-675,
550-675, 575-675, 600-675, 625-675, 650-675, 1-650, 25-650, 50-650,
75-650, 100-650, 125-650, 150-650, 175-650, 200-650, 225-650,
250-650, 275-650, 300-650, 325-650, 350-650, 375-650, 400-650,
425-650, 450-650, 475-650, 500-650, 525-650, 550-650, 575-650,
600-650, 625-650, 1-625, 25-625, 50-625, 75-625, 100-625, 125-625,
150-625, 175-625, 200-625, 225-625, 250-625, 275-625, 300-625,
325-625, 350-625, 375-625, 400-625, 425-625, 450-625, 475-625,
500-625, 525-625, 550-625, 575-625, 600-625, 1-600, 25-600, 50-600,
75-600, 100-600, 125-600, 150-600, 175-600, 200-600, 225-600,
250-600, 275-600, 300-600, 325-600, 350-600, 375-600, 400-600,
425-600, 450-600, 475-600, 500-600, 525-600, 550-600, 575-600,
1-575, 25-575, 50-575, 75-575, 100-575, 125-575, 150-575, 175-575,
200-575, 225-575, 250-575, 275-575, 300-575, 325-575, 350-575,
375-575, 400-575, 425-575, 450-575, 475-575, 500-575, 525-575,
550-575, 1-550, 25-550, 50-550, 75-550, 100-550, 125-550, 150-550,
175-550, 200-550, 225-550, 250-550, 275-550, 300-550, 325-550,
350-550, 375-550, 400-550, 425-550, 450-550, 475-550, 500-550,
525-550, 1-525, 25-525, 50-525, 75-525, 100-525, 125-525, 150-525,
175-525, 200-525, 225-525, 250-525, 275-525, 300-525, 325-525,
350-525, 375-525, 400-525, 425-525, 450-525, 475-525, 500-525,
1-500, 25-500, 50-500, 75-500, 100-500, 125-500, 150-500, 175-500,
200-500, 225-500, 250-500, 275-500, 300-500, 325-500, 350-500,
375-500, 400-500, 425-500, 450-500, 475-500, 1-475, 25-475, 50-475,
75-475, 100-475, 125-475, 150-475, 175-475, 200-475, 225-475,
250-475, 275-475, 300475, 325-475, 350-475, 375-475, 400-475,
425-475, 450-475, 1-450, 25-450, 50-450, 75-450, 100-450, 125-450,
150-450, 175-450, 200-450, 225-450, 250-450, 275-450, 300-450,
325-450, 350-450, 375-450, 400-450, 425-450, 1-425, 25-425, 50-425,
75-425, 100-425, 125-425, 150-425, 175-425, 200-425, 225-425,
250-425, 275-425, 300-425, 325-425, 350-425, 375-425, 400-425,
1-400, 25-400, 50-400, 75-400, 100-400, 125-400, 150-400, 175-400,
200-400, 225-400, 250-400, 275-400, 300-400, 325-400, 350-400,
375-400, 1-375, 25-375, 50-375, 75-375, 100-375, 125-375, 150-375,
175-375, 200-375, 225-375, 250-375, 275-375, 300-375, 325-375,
350-375, 1-350, 25-350, 50-350, 75-350, 100-350, 125-350, 150-350,
175-350, 200-350, 225-350, 250-350, 275-350, 300-350, 325-350,
1-325, 25-325, 50-325, 75-325, 100-325, 125-325, 150-325, 175-325,
200-325, 225-325, 250-325, 275-325, 300-325, 1-300, 25-300, 50-300,
75-300, 100-300, 125-300, 150-300, 175-300, 200-300, 225-300,
250-300, 275-300, 1-275, 25-275, 50-275, 75-275, 100-275, 125-275,
150-275, 175-275, 200-275, 225-275, 250-275, 1-250, 25-250, 50-250,
75-250, 100-250, 125-250, 150-250, 175-250, 200-250, 225-250,
1-225, 25-225, 50-225, 75-225, 100-225, 125-225, 150-225, 175-225,
200-225, 1-200, 25-200, 50-200, 75-200, 100-200, 125-200, 150-200,
175-200, 1-175, 25-175, 50-175, 75-175, 100-175, 125-175, 150-175,
1-150, 25-150, 50-150, 75-150, 100-150, 125-150, 1-125, 25-125,
50-125, 75-125, 100-125, 1-100, 25-100, 50-100, 75-100, 1-75,
25-75, 50-75, 1-50, 25-50, and 1-25 of SEQ ID NO:18.
[0080] In certain additional preferred embodiments, polynucleotide
of the invention comprise, or alternatively, consist of nucleotide
residues 400-627, 425-627, 450-627, 475-627, 500-627, 525-627,
550-627, 575-627, 600-627, 400-600, 425-600, 450-600, 475-600,
500-600, 525-600, 550-600, 575-600, 400-575, 425-575, 450-575,
475-575, 500-575, 525-575, 550-575, 400-550, 425-550, 450-550,
475-550, 500-550, 525-550, 400-500, 425-500, 450-500, 475-500,
400-475, 425-475, 450-475, 400-450, 425-450, 571-800, 600-800,
625-800, 650-800, 675-800, 700-800, 725-800, 750-800, 775-800,
571-775, 600-775, 625-775, 650-775, 675-775, 700-775, 725-775,
750-775, 571-750, 600-750, 625-750, 650-750, 675-750, 700-750,
725-750, 571-725, 600-725, 625-725, 650-725, 675-725, 700-725,
571-700, 600-700, 625-700, 650-700, 675-700, 571-675, 600-675,
625-675, 650-675, 571-650, 600-650, 625-650, 571-625, 600-625,
and/or 571-600 of SEQ ID NO:1.
[0081] In additional preferred embodiments, polynucleotide of the
invention comprise, or alternatively, consist of nucleotide
residues 147-500, 147-450, 147-400, 147-350, 200-500, 200-450,
200-400, 200-350, 250-500, 250-450, 250-400, 250-350, 300-500,
300-450, 300-400, 300-350, 350-750, 350-700, 350-650, 350-600,
350-550, 400-750, 400-700, 400-650, 400-600, 400-550, 425-750,
425-700, 425-650, 425-600, 425-550, 450-1020, 450-1001, 450-950,
450-900, 450-850, 450-800, 450-775, 500-1001, 500-950, 500-900,
500-850, 500-800, 500-775, 550-1001, 550-950, 550-900, 550-850,
550-800, 550-775, 600-1001, 600-950, 600-900, 600-850, 600-800,
600-775, 650-1001, 650-950, 650-900, 650-850, 650-800, 650-775,
700-1001, 700-950, 700-900, 700-850, 700-800, 700-775, 825-1082,
850-1082, 875-1082, 900-1082, 925-1082, 950-1082, 975-1082,
1000-1082, 1025-1082, and/or 1050-1082 of SEQ ID NO:1.
[0082] In additional specific embodiments, the polynucleotide
fragments of the invention encode a polypeptide comprising, or
alternatively, consisting of the predicted intracellular domain
(amino acids 1 to 46 of SEQ ID NO:2), the predicted transmembrane
domain (amino acids 47 to 72 of SEQ ID NO:2), the predicted
extracellular domain (amino acids 73 to 285 of SEQ ID NO:2), or the
predicted TNF conserved domain (amino acids 191 to 284 of SEQ ID
NO:2) of Neutrokine-.alpha.. In additional embodiments, the
polynucleotide fragments of the invention encode a polypeptide
comprising, or alternatively, consisting of any combination of 1,
2, 3, or all 4 of the above recited domains.
[0083] In additional specific embodiments, the polynucleotide
fragments of the invention encode a polypeptide comprising, or
alternatively, consisting of the predicted intracellular domain
(amino acids 1 to 46 of SEQ ID NO:19), the predicted transmembrane
domain (amino acids 47 to 72 of SEQ ID NO:19), the predicted
extracellular domain (amino acids 73 to 266 of SEQ ID NO:19), or
the predicted TNF conserved domain (amino acids 172 to 265 of SEQ
ID NO:19) of Neutrokine-.alpha.. In additional embodiments, the
polynucleotide fragments of the invention encode a polypeptide
comprising, or alternatively, consisting of any combination of 1,
2, 3, or all 4 of the above recited domains.
[0084] Preferably, the polynucleotide fragments of the invention
encode a polypeptide which demonstrates a Neutrokine-.alpha. and/or
Neutrokine-aSV functional activity. By a polypeptide demonstrating
"functional activity" is meant, a polypeptide capable of displaying
one or more known functional activities associated with a
full-length and/or secreted Neutrokine-.alpha. polypeptide and/or
Neutrokine-.alpha.SV polypeptide. Such functional activities
include, but are not limited to, biological activity (e.g., ability
to stimulate B cell proliferation, differentiation, and/or
activation), antigenicity [ability to bind (or compete with a
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide for
binding) to an anti-Neutrokine-.alpha. and/or
anti-Neutrokine-.alpha.- SV antibody], immunogenicity (ability to
generate antibody which binds to a Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide), ability to form multimers with
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptides of the
invention, and ability to bind to a receptor or ligand for a
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide (e.g.,
DR5 (See, International Publication No. WO 98/41629), TR10 (See,
International Publication No. WO 98/54202), 312C2 (See,
International Publication No. WO 98/06842), and TR11, TR11SV1, and
TR11SV2 (See, U.S. application Ser. No. 09/176,200, now U.S. Pat.
No. 6,509,173)).
[0085] The functional activity of Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptides, and fragments, variants
derivatives, and analogs thereof, can be assayed by various
methods.
[0086] For example, in one embodiment where one is assaying for the
ability to bind or compete with full-length Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV polypeptide for binding to
anti-Neutrokine-.alpha. and/or anti-Neutrokine-.alpha.SV antibody,
various immunoassays known in the art can be used, including but
not limited to, competitive and non-competitive assay systems using
techniques such as radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoradiometric
assays, gel diffusion precipitation reactions, immunodiffusion
assays, in situ immunoassays (using colloidal gold, enzyme or
radioisotope labels, for example), western blots, precipitation
reactions, agglutination assays (e.g., gel agglutination assays,
hemagglutination assays), complement fixation assays,
immunofluorescence assays, protein A assays, and
immunoelectrophoresis assays, etc. In one embodiment, antibody
binding is detected by detecting a label on the primary antibody.
In another embodiment, the primary antibody is detected by
detecting binding of a secondary antibody or reagent to the primary
antibody. In a further embodiment, the secondary antibody is
labelled. Many means are known in the art for detecting binding in
an immunoassay and are within the scope of the present
invention.
[0087] In another embodiment, where a Neutrokine-.alpha. and/or
Neutrokine-.alpha. ligand is identified (e.g., DR5 (See,
International Publication No. WO 98/41629), TR10 (See,
International Publication No. WO 98/54202), 312C2 (See,
International Publication No. WO 98/06842), and TR11, TR11SV1, and
TR11SV2 (See, U.S. application Ser. No. 09/176,200, now U.S. Pat.
No. 6,509,173)), or the ability of a polypeptide fragment, variant
or derivative of the invention to multimerize is being evaluated,
binding can be assayed, e.g., by means well-known in the art, such
as, for example, reducing and non-reducing gelchromatography,
protein affinity chromatography, and affinity blotting. See
generally, Phizicky, E., et al., 1995, Microbiol. Rev. 59:94-123.
In another embodiment, physiological correlates of
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV binding to its
substrates (signal transduction) can be assayed.
[0088] In addition, assays described herein (see, at least, Example
6) and otherwise known in the art may routinely be applied to
measure the ability of Neutrokine-.alpha. and/or Neutrokine-.alpha.
polypeptides and fragments, variants derivatives and analogs
thereof to elicit Neutrokine-.alpha. and/or Neutrokine-.alpha.
related biological activity (e.g., to stimulate, or alternatively
to inhibit (in the case of Neutrokine-a and/or Neutrokine-aSV
antagonists) B cell proliferation, differentiation and/or
activation in vitro or in vivo).
[0089] Other methods will be known to the skilled artisan and are
within the scope of the invention.
[0090] In additional embodiments, the polynucleotides of the
invention encode functional attributes of Neutrokine-a and
Neutrokine-aSV. Preferred embodiments of the invention in this
regard include fragments that comprise alpha-helix and alpha-helix
forming regions ("alpha-regions"), beta-sheet and beta-sheet
forming regions ("beta-regions"), turn and turn-forming regions
("turn-regions"), coil and coil-forming regions ("coil-regions"),
hydrophilic regions, hydrophobic regions, alpha amphipathic
regions, beta amphipathic regions, flexible regions,
surface-forming regions and high antigenic index regions of
Neutrokine-a and Neutrokine-aSV polypeptides.
[0091] It is believed one or more of the beta pleated sheet regions
of Neutrokine-.alpha. disclosed in FIG. 7A is important for
dimerization and also for interactions between Neutrokine-.alpha.
and its ligands (e.g., Neutrokine-.alpha. polypeptides, and DR5
(See, International Publication No. WO 98/41629), TR10 (See,
International Publication No. WO 98/54202), 312C2 (See,
International Publication No. WO 98/06842), and TR11, TR11SV1, and
TR11SV2 (See, U.S. application Ser. No. 09/176,200, now U.S. Pat.
No. 6,509,173)). Accordingly, specific embodiments of the invention
are directed to polynucleotides encoding polypeptides which
comprise, or alternatively consist of, the amino acid sequence of
beta pleated sheet region A, A', B, B', C, D, E, F, G, or H
disclosed in FIG. 7A and described in Example 6. Additional
embodiments of the invention are directed to polynucleotides
encoding Neutrokine-a polypeptides which comprise, or alternatively
consist of, any combination of 1, 2, 3, 4, 5, 6, 7, 8, 9 or all 10
of beta pleated sheet regions A-H disclosed in FIG. 7A and
described in Example 6. Additional preferred embodiments of the
invention are directed to polypeptides which comprise, or
alternatively consist of, the Neutrokine-.alpha. amino acid
sequence of beta pleated sheet region A, A', B, B', C, D, E, F, G,
or H disclosed in FIG. 7A and described in Example 6. Additional
embodiments of the invention are directed Neutrokine-.alpha.
polypeptides which comprise, or alternatively consist of, any
combination of 1, 2, 3, 4, 5, 6, 7, 8, 9 or all 10 of beta pleated
sheet regions A-H disclosed in FIG. 7A and described in Example
6.
[0092] Certain preferred regions in this regard are set out in FIG.
3 (Table 1). The data presented in FIG. 3 and that presented in
Table I, merely present a different format of the same results
obtained when the amino acid sequence of SEQ ID NO:2 is analyzed
using the default parameters of the DNA*STAR computer
algorithm.
[0093] The above-mentioned preferred regions set out in FIG. 3 and
in Table I include, but are not limited to, regions of the
aforementioned types identified by analysis of the amino acid
sequence set out in FIGS. 1A and 1B. As set out in FIG. 3 and in
Table I, such preferred regions include Garnier-Robson
alpha-regions, beta-regions, turn-regions, and coil-regions,
Chou-Fasman alpha-regions, beta-regions, and coil-regions,
Kyte-Doolittle hydrophilic regions and hydrophobic regions,
Eisenberg alpha- and beta-amphipathic regions, Karplus-Schulz
flexible regions, Emini surface-forming regions and Jameson-Wolf
regions of high antigenic index. Among highly preferred
polynucleotides in this regard are those that encode polypeptides
comprising regions of Neutrokine-a and/or Neutrokine-aSV that
combine several structural features, such as several (e.g., 1, 2,
3, or 4) of the features set out above.
[0094] Additionally, the data presented in columns VIII IX, XIII,
and XIV of Table I can routinely be used to determine regions of
Neutrokine-a which exhibit a high degree of potential for
antigenicity. Regions of high antigenicity are determined from the
data presented in columns VIII, IX, XIII, and/or IV by choosing
values which represent regions of the polypeptide which are likely
to be exposed on the surface of the polypeptide in an environment
in which antigen recognition may occur in the process of initiation
of an immune response. The data presented in FIG. 6 can also
routinely be presented in a similar tabular format by simply
examining the amino acid sequence disclosed in FIG. 6 (SEQ ID
NO:19) using the modules and algorithms of the DNA*STAR set on
default parameters. As above, the amino acid sequence presented in
FIG. 6 can also be used to determine regions of Neutrokine-a which
exhibit a high degree of potential for antigenicity whether
presented as a Figure (as in FIG. 6) or a table (as in Table
1).
1TABLE I Res Position I II III IV V VI VII VIII IX X XI XII XIII
XIV Met 1 A . . . . . . 0.73 -0.71 . . . 0.95 1.39 Asp 2 A . . . .
T . 1.12 -0.66 * . . 1.15 1.56 Asp 3 A . . . . T . 1.62 -1.09 * . .
1.15 2.12 Ser 4 A . . . . T . 2.01 -1.51 . . . 1.15 4.19 Thr 5 A .
. . . T . 2.40 -2.13 . . F 1.30 4.35 Glu 6 A A . . . . . 2.70 -1.73
* * F 0.90 4.51 Arg 7 A A . . . . . 2.81 -1.34 * * F 0.90 4.51 Glu
8 A A . . . . . 2.00 -1.73 * * F 0.90 6.12 Gln 9 A A . . . . . 1.99
-1.53 * * F 0.90 2.91 Ser 10 A . . B . . . 2.00 -1.04 * * F 0.90
2.15 Arg 11 A . . B . . . 1.33 -0.66 * * F 0.90 1.66 Leu 12 A . . B
. . . 0.41 -0.09 * * F 0.45 0.51 Thr 13 A . . B . . . 0.46 0.20 * *
F -0.15 0.32 Ser 14 A A . . . . . 0.50 -0.19 * * . 0.30 0.32 Cys 15
A A . . . . . 0.91 -0.19 * * . 0.30 0.78 Leu 16 A A . . . . . 0.80
-0.87 * * F 0.90 1.06 Lys 17 A A . . . . . 1.61 -1.36 . * F 0.90
1.37 Lys 18 A A . . . . . 1.32 -1.74 . * F 0.90 4.44 Arg 19 A A . .
. . . 1.67 -1.70 . * F 0.90 5.33 Glu 20 A A . . . . . 1.52 -2.39 .
* F 0.90 5.33 Glu 21 A A . . . . . 2.38 -1.70 . * F 0.90 2.20 Met
22 A A . . . . . 2.33 -1.70 . * F 0.90 2.24 Lys 23 A A . . . . .
1.62 -1.70 * * F 0.90 2.24 Leu 24 A A . . . . . 0.66 -1.13 * * F
0.75 0.69 Lys 25 A A . . . . . 0.36 -0.49 . * F 0.45 0.52 Glu 26 A
A . B . . . -0.53 -0.71 * * . 0.60 0.35 Cys 27 A A . B . . . -0.74
-0.03 * * . 0.30 0.30 Val 28 A A . B . . . -1.00 -0.03 * * . 0.30
0.12 Ser 29 A A . B . . . -0.08 0.40 * * . -0.30 0.11 Ile 30 A . .
B . . . -0.08 0.40 * * . -0.30 0.40 Leu 31 A . . B . . . -0.08
-0.17 * . . 0.45 1.08 Pro 32 . . . B . . C 0.29 -0.81 * . F 1.10
1.39 Arg 33 . . . . T . . 0.93 -0.81 . * F 1.50 2.66 Lys 34 . . . .
T . . 0.93 -1.07 . . F 1.84 4.98 Glu 35 . . . . . . C 0.97 -1.37 *
* F 1.98 4.32 Ser 36 . . . . . T C 1.89 -1.16 * * F 2.52 1.64 Pro
37 . . . . . T C 1.80 -1.16 * * F 2.86 1.60 Ser 38 . . . . T T .
1.39 -0.77 * . F 3.40 1.24 Val 39 A . . . . T . 1.39 -0.39 . * F
2.36 1.24 Arg 40 A . . . . . . 1.39 -0.77 * * F 2.46 1.60 Ser 41 A
. . . . . . 1.34 -1.20 * * F 2.46 2.00 Ser 42 . . . . T T . 1.60
-1.16 . * F 3.06 2.67 Lys 43 . . . . T T . 1.09 -1.80 . * F 3.06
2.72 Asp 44 . . . . T T . 1.13 -1.11 * * F 3.40 1.67 Gly 45 A . . .
. T . 0.43 -0.81 * * F 2.66 1.03 Lys 46 A A . . . . . 0.14 -0.70 .
. F 1.77 0.52 Leu 47 A A . . . . . 0.13 -0.20 * . . 0.98 0.31 Leu
48 A A . . . . . -0.72 0.29 * . . 0.04 0.46 Ala 49 A A . . . . .
-1.53 0.54 . * . -0.60 0.19 Ala 50 A A . . . . . -2.00 1.23 . . .
-0.60 0.19 Thr 51 A A . . . . . -2.63 1.23 . . . -0.60 0.19 Leu 52
A A . . . . . -2.63 1.04 . . . -0.60 0.19 Leu 53 A A . . . . .
-2.63 1.23 . . . -0.60 0.15 Leu 54 A A . . . . . -2.34 1.41 . . .
-0.60 0.09 Ala 55 A A . . . . . -2.42 1.31 . . . -0.60 0.14 Leu 56
A A . . . . . -2.78 1.20 . . . -0.60 0.09 Leu 57 A . . . . T .
-2.78 1.09 . . . -0.20 0.06 Ser 58 A . . . . T . -2.28 1.09 . . .
-0.20 0.05 Cys 59 A . . . . T . -2.32 1.07 . . . -0.20 0.09 Cys 60
A . . . . T . -2.59 1.03 . . . -0.20 0.08 Leu 61 . . B B . . .
-2.08 0.99 . . . -0.60 0.04 Thr 62 . . B B . . . -1.97 0.99 . . .
-0.60 0.11 Val 63 . . B B . . . -1.91 1.20 . . . -0.60 0.17 Val 64
. . B B . . . -1.24 1.39 . . . -0.60 0.33 Ser 65 . . B B . . .
-1.43 1.10 . . . -0.60 0.40 Phe 66 A . . B . . . -1.21 1.26 . . .
-0.60 0.40 Tyr 67 A . . B . . . -1.49 1.11 . . . -0.60 0.54 Gln 68
A . . B . . . -1.44 0.97 . . . -0.60 0.41 Val 69 A . . B . . .
-0.59 1.27 . . . -0.60 0.39 Ala 70 A . . B . . . -0.63 0.89 . . .
-0.60 0.43 Ala 71 A . . B . . . 0.07 0.56 . * . -0.60 0.25 Leu 72 A
. . . . T . -0.50 0.16 . * . 0.10 0.55 Gln 73 A . . . . T . -1.09
0.20 . . F 0.25 0.45 Gly 74 A . . . . T . -0.53 0.20 . . F 0.25
0.45 Asp 75 A . . . . T . -0.76 0.09 . * F 0.25 0.73 Leu 76 A A . .
. . . -0.06 0.09 . * F -0.15 0.35 Ala 77 A A . . . . . 0.17 -0.31 .
* . 0.30 0.69 Ser 78 A A . . . . . 0.17 -0.24 . * . 0.30 0.42 Leu
79 A A . . . . . -0.30 -0.24 . * . 0.30 0.88 Arg 80 A A . . . . .
-0.30 -0.24 . * . 0.30 0.72 Ala 81 A A . . . . . 0.17 -0.34 . * .
0.30 0.93 Glu 82 A A . . . . . 0.72 -0.30 . * . 0.45 1.11 Leu 83 A
A . . . . . 0.99 -0.49 . * . 0.30 0.77 Gln 84 A A . . . . . 1.21
0.01 . * . -0.15 1.04 Gly 85 A A . . . . . 1.10 0.01 * * . -0.30
0.61 His 86 A A . . . . . 1.73 0.01 * * . -0.15 1.27 His 87 A A . .
. . . 0.92 -0.67 . * . 0.75 1.47 Ala 88 A A . . . . . 1.52 -0.39 .
* . 0.45 1.22 Glu 89 A A . . . . . 0.93 -0.39 . . . 0.45 1.39 Lys
90 A A . . . . . 0.93 -0.39 * . F 0.60 1.03 Leu 91 A . . . . T .
0.38 -0.46 * . . 0.85 1.01 Pro 92 A . . . . T . 0.07 -0.46 . . .
0.70 0.59 Ala 93 A . . . . T . 0.07 -0.03 . . . 0.70 0.29 Gly 94 A
. . . . T . -0.14 0.47 . . . -0.20 0.36 Ala 95 A . . . . . . -0.14
0.21 . * . -0.10 0.36 Gly 96 A . . . . . . 0.08 -0.21 . . F 0.65
0.71 Ala 97 A . . . . . . -0.06 -0.21 . . F 0.65 0.72 Pro 98 A . .
. . . . -0.28 -0.21 . * F 0.65 0.71 Lys 99 A A . . . . . 0.07 -0.03
. . F 0.45 0.59 Ala 100 A A . . . . . 0.66 -0.46 . . F 0.60 1.01
Gly 101 A A . . . . . 0.41 -0.96 . . F 0.90 1.13 Leu 102 A A . . .
. . 0.79 -0.89 . . F 0.75 0.57 Glu 103 A A . . . . . 0.41 -0.46 * .
F 0.45 0.88 Glu 104 A A . . . . . -0.49 -0.46 * . F 0.45 0.89 Ala
105 A A . . . . . -0.21 -0.24 . . . 0.30 0.81 Pro 106 A A . . . . .
-0.46 -0.44 . . . 0.30 0.67 Ala 107 A A . . . . . 0.01 0.06 . . .
-0.30 0.39 Val 108 A A . . . . . -0.80 0.49 . * . -0.60 0.38 Thr
109 A A . . . . . -0.76 0.67 . * . -0.60 0.20 Ala 110 A A . . . . .
-1.06 0.24 * * . -0.30 0.40 Gly 111 A A . . . . . -1.54 0.43 * * .
-0.60 0.38 Leu 112 A A . . . . . -0.96 0.57 * * . -0.60 0.23 Lys
113 . A B . . . . -0.31 0.09 * * . -0.30 0.39 Ile 114 . A B . . . .
-0.21 0.01 * . . -0.30 0.61 Phe 115 . A B . . . . -0.21 0.01 * . .
0.15 1.15 Glu 116 . A . . . . C -0.08 -0.17 * . F 1.25 0.58 Pro 117
. A . . . . C 0.39 0.26 * * F 1.10 1.28 Pro 118 . . . . . . C 0.34
-0.00 . . F 2.20 1.47 Ala 119 . . . . . T C 0.89 -0.79 . * F 3.00
1.47 Pro 120 . . . . . T C 1.59 -0.36 . * F 2.25 0.94 Gly 121 . . .
. T T . 1.29 -0.39 . * F 2.15 0.98 Glu 122 . . . . T T . 1.20 -0.43
. . F 2.00 1.30 Gly 123 . . . . . . C 1.41 -0.54 . . F 1.60 1.12
Asn 124 . . . . . T C 2.00 -0.57 . . F 1.50 1.97 Ser 125 . . . . .
T C 1.91 -0.60 . * F 1.50 1.82 Ser 126 . . . . . T C 2.37 -0.21 . *
F 1.54 2.47 Gln 127 . . . . . T C 2.37 -0.64 . * F 2.18 3.01 Asn
128 . . . . . . C 2.76 -0.64 . . F 2.32 3.61 Ser 129 . . . . . T C
2.87 -1.03 . . F 2.86 5.39 Arg 130 . . . . T T . 2.58 -1.41 * . F
3.40 6.09 Asn 131 . . . . T T . 2.02 -1.31 * . F 3.06 3.83 Lys 132
. . . . T T . 2.02 -1.07 * . F 2.72 2.12 Arg 133 . . . . T . . 1.68
-1.06 * . F 2.18 1.88 Ala 134 . . . . . . C 1.77 -0.63 * . F 1.64
1.15 Val 135 . . . . . . C 1.66 -0.60 * . F 1.49 0.89 Gln 136 . . .
. . . C 1.66 -0.60 * . F 1.83 0.79 Gly 137 . . . . . T C 1.30 -0.60
* . F 2.52 1.35 Pro 138 . . . . . T C 0.33 -0.61 * . F 2.86 2.63
Glu 139 . . . . T T . 0.61 -0.61 * . F 3.40 1.13 Glu 140 A . . . .
T . 1.47 -0.53 * . F 2.66 1.64 Thr 141 A . . . . . . 1.47 -0.56 . .
F 2.12 1.84 Val 142 A . . . . . . 1.14 -0.99 . . F 1.78 1.77 Thr
143 A . . . . T . 0.54 -0.41 . . F 1.19 0.55 Gln 144 A . . . . T .
0.54 0.27 * . F 0.25 0.31 Asp 145 A . . . . T . -0.27 0.19 * . F
0.25 0.73 Cys 146 A . . . . T . -0.84 0.23 * . . 0.10 0.42 Leu 147
A A . . . . . -0.58 0.43 * . . -0.60 0.17 Gln 148 A A . . . . .
-0.27 0.53 * . . -0.60 0.10 Leu 149 A A . . . . . -0.57 0.53 * * .
-0.30 0.32 Ile 150 A A . . . . . -0.57 0.34 * . . 0.30 0.52 Ala 151
. A . . . . C -0.21 -0.34 . * . 1.40 0.52 Asp 152 . . . . T T .
0.39 -0.26 . * F 2.45 0.91 Ser 153 . . . . . T C 0.08 -0.51 . . F
3.00 2.00 Glu 154 . . . . . T C -0.00 -0.71 . . F 2.70 2.86 Thr 155
. . . . . T C 0.89 -0.53 * . F 2.40 1.20 Pro 156 . . . B . . C 1.52
-0.13 * . F 1.56 1.55 Thr 157 . . . B T . . 1.18 -0.51 * . F 1.92
1.79 Ile 158 A . . B . . . 1.18 -0.09 . . F 1.08 1.23 Gln 159 . . .
. T T . 0.93 -0.19 . . F 2.04 1.07 Lys 160 . . . . T T . 0.93 0.14
* . F 1.60 1.16 Gly 161 . . . . T T . 0.44 0.14 * . F 1.44 2.38 Ser
162 . . . . T T . -0.10 0.24 * . F 1.28 1.19 Tyr 163 . . . B T . .
0.58 0.49 * . . 0.12 0.44 Thr 164 . . B B . . . 0.29 0.91 * . .
-0.44 0.69 Phe 165 . . B B . . . -0.57 1.40 * . . -0.60 0.54 Val
166 . . B B . . . -1.03 1.70 . . . -0.60 0.29 Pro 167 . . B B . . .
-1.03 1.63 . . . -0.60 0.16 Trp 168 A . . B . . . -1.49 1.53 . * .
-0.60 0.25 Leu 169 A . . B . . . -1.13 1.53 * . . -0.60 0.29 Leu
170 A . . B . . . -0.32 0.89 * . . -0.30 0.38 Ser 171 A . . . . . .
0.19 0.46 * . . 0.20 0.71 Phe 172 . . . . T . . 0.10 -0.03 * . .
1.80 0.85 Lys 173 . . . . T T . -0.20 -0.33 * . F 2.60 1.38 Arg 174
. . . . . T C -0.20 -0.51 . . F 3.00 1.04 Gly 175 . . . . . T C
0.61 -0.21 . . F 2.25 0.99 Ser 176 A . . . . T . 0.91 -1.00 * . F
2.05 0.86 Ala 177 A A . . . . . 1.66 -1.00 * . F 1.35 0.76 Leu 178
A A . . . . . 1.61 -1.00 . . F 1.20 1.54 Glu 179 A A . . . . . 1.50
-1.43 . . F 0.90 1.98 Glu 180 A A . . . . . 1.89 -1.41 * . F 0.90
3.16 Lys 181 A A . . . . . 1.30 -1.91 * . F 0.90 7.66 Glu 182 A A .
. . . . 1.08 -1.91 . . F 0.90 3.10 Asn 183 A A . . . . . 1.03 -1.23
* * F 0.90 1.48 Lys 184 A A . . . . . 1.08 -0.59 * . F 0.75 0.55
Ile 185 A A . . . . . 1.08 -0.59 * * . 0.60 0.63 Leu 186 A A . . .
. . 0.72 -0.59 * * . 0.60 0.68 Val 187 A A . . . . . 0.38 -0.50 . *
. 0.30 0.49 Lys 188 A A . . . . . 0.13 -0.07 * * F 0.45 0.69 Glu
189 A . . . . T . -0.61 0.00 * * F 0.40 1.32 Thr 190 . . . . T T .
-0.42 0.10 . * F 0.80 1.54 Gly 191 . . . . T T . -0.50 0.24 * . F
0.65 0.67 Tyr 192 . . . . T T . 0.11 0.93 * * . 0.20 0.27 Phe 193 .
. B B . . . -0.28 1.69 . . . -0.60 0.29 Phe 194 . . B B . . . -0.28
1.63 . * . -0.60 0.29 Ile 195 . . B B . . . -0.82 1.60 . . . -0.60
0.32 Tyr 196 . . B B . . . -1.29 1.49 . . . -0.60 0.28 Gly 197 . .
. B T . . -1.29 1.39 . . . -0.20 0.26 Gln 198 . . . B T . . -0.90
1.36 . . . -0.20 0.59 Val 199 . . . B . . C -0.20 1.16 . . . -0.40
0.54 Leu 200 . . . B . . C 0.73 0.40 . . . -0.10 0.92 Tyr 201 . . .
. T T . 0.67 -0.03 . . . 1.25 1.06 Thr 202 . . . . T T . 0.77 0.06
. . F 0.80 2.06 Asp 203 . . . . T T . 0.18 0.17 . . F 0.80 3.91 Lys
204 A . . . . T . 0.43 -0.01 . . F 1.00 2.52 Thr 205 A A . . . . .
0.90 -0.16 . . F 0.60 1.73 Tyr 206 A A . . . . . 1.11 -0.21 . . .
0.45 1.03 Ala 207 A A . . . . . 0.61 0.29 . . . -0.30 0.70 Met 208
A A . . . . . -0.28 0.97 . . . -0.60 0.40 Gly 209 A A . B . . .
-0.32 1.17 * . . -0.60 0.18 His 210 A A . B . . . 0.10 0.81 * . .
-0.60 0.31 Leu 211 A A . B . . . 0.39 0.31 . . . -0.30 0.61 Ile 212
A A . B . . . 1.02 -0.30 . . . 0.45 1.22 Gln 213 A A . B . . . 0.77
-0.73 . * . 0.75 1.80 Arg 214 A A . B . . . 1.08 -0.59 . * F 0.90
1.62 Lys 215 A A . B . . . 0.26 -0.77 * * F 0.90 3.14 Lys 216 A A .
B . . . 0.37 -0.81 . * F 0.90 1.35 Val 217 . A B B . . . 0.91 -0.43
* * . 0.30 0.60 His 218 . A B B . . . 0.91 -0.00 . * . 0.30 0.29
Val 219 . A B B . . . 0.80 -0.00 * * . 0.30 0.25 Phe 220 . . B B .
. . -0.06 -0.00 * . . 0.30 0.57 Gly 221 A . . B . . . -0.40 0.04 .
* . -0.30 0.35 Asp 222 A . . . . . . -0.36 -0.07 * . . 0.50 0.63
Glu 223 A . . . . . . -1.18 -0.03 * . . 0.50 0.60 Leu 224 A . . B .
. . -0.63 -0.17 . . . 0.30 0.45 Ser 225 A . . B . . . -0.74 -0.11 .
. . 0.30 0.39 Leu 226 A . . B . . . -1.10 0.57 . * . -0.60 0.18 Val
227 A . . B . . . -0.99 1.36 . * . -0.60 0.19 Thr 228 A . . B . . .
-1.66 0.67 * * . -0.60 0.28 Leu 229 A . . B . . . -1.73 0.86 * . .
-0.60 0.18 Phe 230 A . . B . . . -1.43 0.86 * . . -0.60 0.17 Arg
231 A . . B . . . -0.62 0.61 * . . -0.60 0.21 Cys 232 . . . B T . .
-0.37 0.53 * . . -0.20 0.41 Ile 233 . . . B T . . -0.27 0.46 * . .
-0.20 0.46 Gln 234 . . . B T . . 0.54 0.10 * . . 0.10 0.37 Asn 235
. . . B . . C 0.93 0.10 * . . 0.05 1.19 Met 236 . . . B . . C 0.01
0.01 * . F 0.20 2.44 Pro 237 . . . B . . C 0.47 0.01 * . F 0.44
1.16 Glu 238 . . . . T . . 1.36 0.04 * . F 1.08 1.12 Thr 239 . . .
. . . C 1.36 0.04 * . F 1.12 1.82 Leu 240 . . . . . . C 1.06 -0.17
* . F 1.96 1.89 Pro 241 . . . . T . . 0.99 -0.21 . . F 2.40 1.46
Asn 242 . . . . T . . 0.96 0.36 . . F 1.41 0.54 Asn 243 . . . . T T
. 0.66 0.63 . . F 1.22 1.03 Ser 244 . . . . T T . 0.38 0.33 . . F
1.13 0.89 Cys 245 . . . . T T . 0.84 0.40 . . . 0.74 0.56 Tyr 246 .
. . . T T . 0.17 0.43 . . . 0.20 0.35 Ser 247 A . . . . . . -0.42
0.71 . . . -0.40 0.18 Ala 248 A A . . . . . -0.38 0.83 . . . -0.60
0.34 Gly 249 A A . . . . . -0.89 0.26 . . . -0.30 0.43 Ile 250 A A
. . . . . -0.22 0.19 * . . -0.30 0.27 Ala 251 A A . . . . . 0.02
-0.20 * . . 0.30 0.46 Lys 252 A A . . . . . -0.02 -0.70 . . . 0.60
0.80 Leu 253 A A . . . . . 0.57 -0.70 . . F 0.90 1.13 Glu 254 A A .
. . . . 0.91 -1.39 . . F 0.90 1.87 Glu 255 A A . . . . . 0.99 -1.89
. . F 0.90 1.62 Gly 256 A A . . . . . 1.58 -1.20 . * F 0.90 1.62
Asp 257 A A . . . . . 0.72 -1.49 . * F 0.90 1.62 Glu 258 A A . . .
. . 0.94 -0.80 * * F 0.75 0.77 Leu 259 A A . . . . . 0.06 -0.30 * *
. 0.30 0.79 Gln 260 A A . . . . . -0.16 -0.04 * . . 0.30 0.33 Leu
261 A A . . . . . 0.30 0.39 * . . -0.30 0.30 Ala 262 A A . . . . .
0.30 0.39 * . . -0.30 0.70 Ile 263 A A . . . . . 0.30 -0.30 . * .
0.30 0.70 Pro 264 A . . . . T . 0.52 -0.30 . * F 1.00 1.37 Arg 265
A . . . . T . 0.52 -0.49 . * F 1.00 1.37 Glu 266 A . . . . T . 0.44
-0.59 * * F 1.30 3.38 Asn 267 A . . . . T . 0.73 -0.59 * * F 1.30
1.53 Ala 268 A . . . . . . 0.81 -0.63 * * . 0.95 1.05 Gln 269 A . .
. . . . 1.02 0.06 * * . -0.10 0.50 Ile 270 A . . . . . . 0.57 0.06
. * . 0.15 0.52 Ser 271 . . . . . . C 0.57 0.09 . * . 0.60 0.51 Leu
272 . . . . . . C -0.29 -0.41 . * F 1.60 0.49 Asp 273 . . . . T T .
-0.01 -0.17 . * F 2.25 0.52 Gly 274 . . . . T T . -0.71 -0.37 . * F
2.50 0.56 Asp 275 . . . . T T . -0.52 0.03 . * F 1.65 0.59 Val 276
A . . . . T . -0.57 0.13 . * F 1.00 0.30 Thr 277 A . . B . . .
-0.34 0.56 . * . -0.10 0.30 Phe 278 A . . B . . . -1.16 0.63 . * .
-0.35 0.18 Phe 279 A . . B . . . -0.77 1.31 . * . -0.60 0.20 Gly
280 A A . . . . . -1.58 0.67 . * . -0.60 0.28 Ala 281 A A . . . . .
-1.53 0.87 . * . -0.60 0.27 Leu 282 A A . . . . . -1.61 0.77 * . .
-0.60 0.26 Lys 283 A A . . . . . -1.30 0.41 * . . -0.60 0.33 Leu
284 A A . . . . . -0.99 0.41 . . . -0.60 0.42 Leu 285 A A . . . . .
-1.03 0.34 * . . -0.30 0.65
[0095] Additional preferred nucleic acid fragments of the present
invention include nucleic acid molecules encoding one or more
epitope-bearing portions of Neutrokine-.alpha.. In particular, such
nucleic acid fragments of the present invention included nucleic
acid molecules encoding: a polypeptide comprising amino acid
residues from about Phe-115 to about Leu-147, from about Ile-150 to
about Tyr-163, from about Ser-171 to about Phe-194, from about
Glu-223 to about Tyr-247, and from about Ser-271 to about Phe-278,
of the amino acid sequence of SEQ ID NO:2. Polypeptide fragments
which bear antigenic epitopes of the Neutrokine-.alpha. may be
easily determined by one of skill in the art using the
above-described analysis of the Jameson-Wolf antigenic index, as
shown in FIG. 3. Methods for determining other such epitope-bearing
portions of Neutrokine .alpha. are described in detail below.
[0096] Additional preferred nucleic acid fragments of the present
invention include nucleic acid molecules encoding one or more
epitope-bearing portions of Neutrokine .alpha.SV. In particular,
such nucleic acid fragments of the present invention include
nucleic acid molecules encoding: a polypeptide comprising amino
acid residues from about Pro-32 to about Leu-47, from about Glu-116
to about Ser-143, from about Phe-153 to about Tyr-173, from about
Pro-218 to about Tyr-227, from about Ser-252 to about Thr-258, from
about Ala-232 to about Gln-241; from about Ile-244 to about
Ala-249; and from about Ser-252 to about Val-257, of the amino acid
sequence of SEQ ID NO:19. Polypeptide fragments which bear
antigenic epitopes of the Neutrokine-.alpha. may be easily
determined by one of skill in the art using the above-described
analysis of the Jameson-Wolf antigenic index. Methods for
determining other such epitope-bearing portions of
Neutrokine-.alpha. are described in detail below.
[0097] In specific embodiments, the polynucleotides of the
invention are less than 100000 kb, 50000 kb, 10000 kb, 1000 kb, 500
kb, 400 kb, 350 kb, 300 kb, 250 kb, 200 kb, 175 kb, 150 kb, 125 kb,
100 kb, 75 kb, 50 kb, 40 kb, 30 kb, 25 kb, 20 kb, 15 kb, 10 kb, 7.5
kb, or 5 kb in length.
[0098] In further embodiments, polynucleotides of the invention
comprise at least 15, at least 30, at least 50, at least 100, or at
least 250, at least 500, or at least 1000 contiguous nucleotides of
Neutrokine-.alpha. coding sequence, but consist of less than or
equal to 1000 kb, 500 kb, 250 kb, 200 kb, 150 kb, 100 kb, 75 kb, 50
kb, 30 kb, 25 kb, 20 kb, 15 kb, 10 kb, or 5 kb of genomic DNA that
flanks the 5' or 3' coding nucleotide set forth in FIGS. 1A and 1B
(SEQ ID NO:1) or FIGS. 5A and 5B (SEQ ID NO:18). In further
embodiments, polynucleotides of the invention comprise at least 15,
at least 30, at least 50, at least 100, or at least 250, at least
500, or at least 1000 contiguous nucleotides of Neutrokine-.alpha.
coding sequence, but do not comprise all or a portion of any
Neutrokine-.alpha. intron. In another embodiment, the nucleic acid
comprising Neutrokine-.alpha. coding sequence does not contain
coding sequences of a genomic flanking gene (i.e., 5' or 3' to the
Neutrokine-.alpha. gene in the genome). In other embodiments, the
polynucleotides of the invention do not contain the coding sequence
of more than 1000, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4, 3, 2,
or 1 genomic flanking gene(s).
[0099] In another embodiment, the invention provides an isolated
nucleic acid molecule comprising a polynucleotide which hybridizes
under stringent hybridization conditions to a portion of the
polynucleotide in a nucleic acid molecule of the invention
described above, for instance, the sequence complementary to the
coding and/or noncoding sequence depicted in FIGS. 1A and 1B (SEQ
ID NO:1), the sequence of the cDNA clone contained in the deposit
having ATCC accession no. 97768, the sequence complementary to the
coding sequence and/or noncoding sequence depicted in FIGS. 5A and
5B (SEQ ID NO:18), the sequence of the cDNA clone contained in the
deposit having ATCC accession no. 203518, or fragments of these
sequences, as described herein. By "stringent hybridization
conditions" is intended overnight incubation at 42.degree. C. in a
solution comprising: 50% formamide, 5.times.SSC (750 mM NaCl, 75 mM
trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5.times.
Denhardt's solution, 10% dextran sulfate, and 20 .mu.g/ml
denatured, sheared salmon sperm DNA, followed by washing the
filters in 0.1.times.SSC at about 65.degree. C.
[0100] By a polynucleotide which hybridizes to a "portion" of a
polynucleotide is intended a polynucleotide (either DNA or RNA)
hybridizing to at least about 15 nucleotides (nt), and more
preferably at least about 20 nt, still more preferably at least
about 30 nt, and even more preferably about 30-70 (e.g., 40, 50, or
60) nucleotides, and even more preferably about any integer in the
range of 30-70 or 80-150 nucleotides, or the entire length of the
reference polynucleotide. These have uses, which include, but are
not limited to, diagnostic probes and primers as discussed above
and in more detail below. By a portion of a polynucleotide of "at
least about 20 nt in length," for example, is intended to include
the particularly recited ranges, larger or smaller by several (i.e.
5, 4, 3, 2, 1, or 0) amino acids, at either extreme or at both
extremes of the nucleotide sequence of the reference polynucleotide
(e.g., the sequence of one or both of the deposited cDNAs, the
complementary strand of the nucleotide sequence shown in FIGS. 1A
and 1B (SEQ ID NO:1), or the complementary strand of the nucleotide
sequence shown in FIGS. 5A and 5B (SEQ ID NO:18)). Of course, a
polynucleotide which hybridizes only to a poly A sequence (such as
the 3' terminal poly(A) tract of the Neutrokine-a cDNA shown in
FIGS. 1A and 1B (SEQ ID NO:1) or the 3' terminal poly(A) tract of
the Neutrokine-aSV cDNA shown in FIGS. 5A and 5B (SEQ ID NO:18)),
or to a complementary stretch of T (or U) residues, would not be
included in a polynucleotide of the invention used to hybridize to
a portion of a nucleic acid of the invention, since such a
polynucleotide would hybridize to any nucleic acid molecule
containing a poly (A) stretch or the complement thereof (e.g.,
practically any double-stranded cDNA clone generated using oligo dT
as a primer).
[0101] As indicated, nucleic acid molecules of the present
invention which encode a Neutrokine-a polypeptide or a
Neutrokine-aSV polypeptide may include, but are not limited to,
polynucleotides encoding the amino acid sequence of the respective
extracellular domains of the polypeptides, by themselves; and the
coding sequence for the extracellular domains of the respective
polypeptides and additional sequences, such as those encoding the
intracellular and transmembrane domain sequences, or a pre-, or
pro- or prepro-protein sequence; the coding sequence of the
respective extracellular domains of the polypeptides, with or
without the aforementioned additional coding sequences.
[0102] Also encoded by nucleic acids of the invention are the above
protein sequences together with additional, non-coding sequences,
including for example, but not limited to, introns and non-coding
5' and 3' sequences, such as the transcribed, non-translated
sequences that play a role in transcription, mRNA processing,
including splicing and polyadenylation signals, for example,
ribosome binding and stability of mRNA; an additional coding
sequence which codes for additional amino acids, such as those
which provide additional functionalities.
[0103] Thus, the sequence encoding the polypeptide may be fused to
a marker sequence, such as a sequence encoding a peptide which
facilitates purification of the fused polypeptide. In certain
preferred embodiments of this embodiment of the invention, the
marker amino acid sequence is a hexa-histidine peptide, such as the
tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, Calif., 91311), among others, many of which are
commercially available. As described in Gentz et al., Proc. Natl.
Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine
provides for convenient purification of the fusion protein. The
"HA" tag is another peptide useful for purification which
corresponds to an epitope derived from the influenza hemagglutinin
protein, which has been described by Wilson et al., Cell 37: 767
(1984). As discussed below, other such fusion proteins include the
Neutrokine-a or the Neutrokine-aSV polypeptides fused to Fc at the
N- or C-terminus.
[0104] The present invention further relates to variants of the
nucleic acid molecules of the present invention, which encode
portions, analogs or derivatives of the Neutrokine-a or
Neutrokine-aSV polypeptides of SEQ ID NO:2. Variants may occur
naturally, such as a natural allelic variant. By an "allelic
variant" is intended one of several alternate forms of a gene
occupying a given locus on a chromosome of an organism. Genes II,
Lewin, B., ed., John Wiley & Sons, New York (1985).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques.
[0105] Such variants include those produced by nucleotide
substitutions, deletions or additions. The substitutions, deletions
or additions may involve one or more nucleotides. The variants may
be altered in coding regions, non-coding regions, or both.
Alterations in the coding regions may produce conservative or
non-conservative amino acid substitutions, deletions or additions.
Especially preferred among these are silent substitutions,
additions and deletions, which do not alter the properties and
activities of the Neutrokine-a and/or Neutrokine-aSV polypeptides
or portions thereof. Also especially preferred in this regard are
conservative substitutions.
[0106] Additional embodiments of the invention are directed to
isolated nucleic acid molecules comprising a polynucleotide which
encodes the amino acid sequence of a Neutrokine-a and/or
Neutrokine-aSV polypeptide (e.g., a Neutrokine-a and/or
Neutrokine-aSV polypeptide fragment described herein) having an
amino acid sequence which contains at least one conservative amino
acid substitution, but not more than 50 conservative amino acid
substitutions, even more preferably, not more than 40 conservative
amino acid substitutions, still more preferably, not more than 30
conservative amino acid substitutions, and still even more
preferably, not more than 20 conservative amino acid substitutions,
10-20 conservative amino acid substitutions, 5-10 conservative
amino acid substitutions, 1-5 conservative amino acid
substitutions, 3-5 conservative amino acid substitutions, or 1-3
conservative amino acid substitutions. Of course, in order of
ever-increasing preference, it is highly preferable for a
polynucleotide which encodes the amino acid sequence of a
Neutrokine-a and/or Neutrokine-aSV polypeptide to have an amino
acid sequence which contains not more than 10, 9, 8, 7, 6, 5, 4, 3,
2 or 1 conservative amino acid substitutions.
[0107] Most highly preferred are nucleic acid molecules encoding
the extracellular domain of the protein having the amino acid
sequence shown in FIGS. 1A and 1B (SEQ ID NO:2) or the
extracellular domain of the Neutrokine-a amino acid sequence
encoded by the cDNA clone contained in the deposit having ATCC
accession number 97768. Further embodiments include an isolated
nucleic acid molecule comprising a polynucleotide having a
nucleotide sequence at least 90% identical, and more preferably at
least 95%, 96%, 97%, 98% or 99% identical to a polynucleotide
selected from the group consisting of: (a) a nucleotide sequence
encoding the Neutrokine-a polypeptide having the complete amino
acid sequence in FIGS. 1A and 1B (i.e., positions 1 to 285 of SEQ
ID NO:2); (b) a nucleotide sequence encoding the Neutrokine-a
polypeptide having the complete amino acid sequence in SEQ ID NO:2
excepting the N-terminal methionine (i.e., positions 2 to 285 of
SEQ ID NO:2); (c) a fragment of the polypeptide of (b) having
Neutrokine-a functional activity (e.g., antigenic or biological
activity); (d) a nucleotide sequence encoding the predicted
extracellular domain of the Neutrokine-a polypeptide having the
amino acid sequence at positions 73-285 in FIGS. 1A and 1B (SEQ ID
NO:2); (e) a nucleotide sequence encoding the Neutrokine-a
polypeptide having the complete amino acid sequence encoded by the
cDNA clone contained in the deposit having ATCC accession number
97768; (f) a nucleotide sequence encoding the extracellular domain
of the Neutrokine-a polypeptide having the amino acid sequence
encoded by the cDNA contained in the deposit having ATCC accession
number 97768; and (g) a nucleotide sequence complementary to any of
the nucleotide sequences in (a), (b), (c), (d), (e), (f), or (g)
above.
[0108] A further embodiment of the invention relates to an isolated
nucleic acid molecule comprising a polynucleotide which encodes the
amino acid sequence of a Neutrokine-a polypeptide having an amino
acid sequence which contains at least one conservative amino acid
substitution, but not more than 50 conservative amino acid
substitutions, even more preferably, not more than 40 conservative
amino acid substitutions, still more preferably not more than 30
conservative amino acid substitutions, and still even more
preferably not more than 20 conservative amino acid substitutions.
Of course, in order of ever-increasing preference, it is highly
preferable for a polynucleotide which encodes the amino acid
sequence of a Neutrokine-a polypeptide to have an amino acid
sequence which contains not more than 7-10, 5-10, 3-7,3-5, 2-5,1-5,
1-3, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 conservative amino acid
substitutions.
[0109] Also most highly preferred are nucleic acid molecules
encoding the extracellular domain of the protein having the amino
acid sequence shown in FIGS. 5A and 5B (SEQ ID NO:19) or the
extracellular domain of the Neutrokine-aSV amino acid sequence
encoded by the cDNA clone contained in the deposit having ATCC
accession number 203518. Further embodiments include an isolated
nucleic acid molecule comprising a polynucleotide having a
nucleotide sequence at least 90% identical, and more preferably at
least 95%, 96%, 97%, 98% or 99% identical to a polynucleotide
selected from the group consisting of: (a) a nucleotide sequence
encoding the Neutrokine-aSV polypeptide having the complete amino
acid sequence in FIGS. 5A and 5B (i.e., positions 1 to 266 of SEQ
ID NO:19); (b) a nucleotide sequence encoding the Neutrokine-aSV
polypeptide having the complete amino acid sequence in SEQ ID NO:19
excepting the N-terminal methionine (i.e., positions 2 to 266 of
SEQ ID NO:2); (c) a nucleotide sequence encoding the predicted
extracellular domain of the Neutrokine-aSV polypeptide having the
amino acid sequence at positions 73-285 in FIGS. 5A and 5B (SEQ ID
NO:19); (d) a nucleotide sequence encoding the Neutrokine-aSV
polypeptide having the complete amino acid sequence encoded by the
cDNA clone contained in the deposit having ATCC accession number
203518; (e) a nucleotide sequence encoding the extracellular domain
of the Neutrokine-aSV polypeptide having the amino acid sequence
encoded by the cDNA clone contained in the deposit having ATCC
accession number 203518; and (f) a nucleotide sequence
complementary to any of the nucleotide sequences in (a), (b), (c),
(d) or (e), above.
[0110] Further, the invention includes a polynucleotide comprising
a sequence at least 95% identical to any portion of at least about
10 contiguous nucleotides, about 20 contiguous nucleotides, about
25 contiguous nucleotides, or about 30 contiguous nucleotides,
preferably at least about 40 nucleotides, or at least about 50
nucleotides, of the sequence from nucleotide 1 to nucleotide 1082
in FIGS. 1A and 1B (SEQ ID NO:1), preferably excluding the
nucleotide sequences determined from the abovelisted cDNA clones
and the nucleotide sequences from nucleotide 797 to 1082, 810 to
1082, and 346 to 542. In this context "about" includes the
particularly recited ranges, larger or smaller by several (i.e. 5,
4, 3, 2 or 1) amino acids, at either extreme or at both
extremes.
[0111] By a polynucleotide having a nucleotide sequence at least,
for example, 95% "identical" to a reference nucleotide sequence
encoding a Neutrokine-a and/or Neutrokine-aSV polypeptide is
intended that the nucleotide sequence of the polynucleotide is
identical to the reference sequence except that the polynucleotide
sequence may include up to five mismatches per each 100 nucleotides
of the reference nucleotide sequence encoding the Neutrokine-a
and/or Neutrokine-aSV polypeptide. In other words, to obtain a
polynucleotide having a nucleotide sequence at least 95% identical
to a reference nucleotide sequence, up to 5% of the nucleotides in
the reference sequence may be deleted or substituted with another
nucleotide, or a number of nucleotides up to 5% of the total
nucleotides in the reference sequence may be inserted into the
reference sequence. These mutations of the reference sequence may
occur at the 5' or 3' terminal positions of the reference
nucleotide sequence or anywhere between those terminal positions,
interspersed either individually among nucleotides in the reference
sequence or in one or more contiguous groups within the reference
sequence. The reference (query) sequence may be the entire
nucleotide sequence encoding Neutrokine-.alpha. or
Neutrokine-.alpha.SV, as shown in FIGS. 1A and 1B (SEQ ID NO:1) and
FIGS. 5A and 5B (SEQ ID NO:18), respectively, or any
Neutrokine-.alpha. or Neutrokine-.alpha.SV polynucleotide fragment
as described herein.
[0112] As a practical matter, whether any particular nucleic acid
molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to,
for instance, the nucleotide sequences shown in FIGS. 1A and 1B, or
the nucleotide sequences shown in FIGS. 5A and 5B, or to the
nucleotides sequence of the deposited cDNA clones, or fragments
thereof, can be determined conventionally using known computer
programs such as the Bestfit program (Wisconsin Sequence Analysis
Package, Version 8 for Unix, Genetics Computer Group, University
Research Park, 575 Science Drive, Madison, Wis. 53711). Bestfit
uses the local homology algorithm of Smith and Waterman to find the
best segment of homology between two sequences (Advances in Applied
Mathematics 2:482-489 (1981)). When using Bestfit or any other
sequence alignment program to determine whether a particular
sequence is, for instance, 95% identical to a reference sequence
according to the present invention, the parameters are set, of
course, such that the percentage of identity is calculated over the
full length of the reference nucleotide sequence and that gaps in
homology of up to 5% of the total number of nucleotides in the
reference sequence are allowed.
[0113] In a specific embodiment, the identity between a reference
(query) sequence (a sequence of the present invention) and a
subject sequence, also referred to as a global sequence alignment,
is determined using the FASTDB computer program based on the
algorithm of Brutlag and colleagues (Comp. App. Biosci. 6:237-245
(1990)). In a sequence alignment the query and subject sequences
are both DNA sequences. An RNA sequence can be compared by
converting U's to T's. The result of said global sequence alignment
is in percent identity. Preferred parameters used in a FASTDB
alignment of DNA sequences to calculate percent identity are:
Matrix=Unitary, k-tuple=4, Mismatch Penalty=1, Joining Penalty=30,
Randomization Group Length=O, Cutoff Score=1, Gap Penalty=5, Gap
Size Penalty 0.05, Window Size=500 or the length of the subject
nucleotide sequence, whichever is shorter. According to this
embodiment, if the subject sequence is shorter than the query
sequence because of 5' or 3' deletions, not because of internal
deletions, a manual correction is made to the results to take into
consideration the fact that the FASTDB program does not account for
5' and 3' truncations of the subject sequence when calculating
percent identity. For subject sequences truncated at the 5' or 3'
ends, relative to the query sequence, the percent identity is
corrected by calculating the number of bases of the query sequence
that are 5' and 3' of the subject sequence, which are not
matched/aligned, as a percent of the total bases of the query
sequence. A determination of whether a nucleotide is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This corrected score is what is used for the purposes of this
embodiment. Only bases outside the 5' and 3' bases of the subject
sequence, as displayed by the FASTDB alignment, which are not
matched/aligned with the query sequence, are calculated for the
purposes of manually adjusting the percent identity score. For
example, a 90 base subject sequence is aligned to a 100 base query
sequence to determine percent identity. The deletions occur at the
5' end of the subject sequence and therefore, the FASTDB alignment
does not show a matched/alignment of the first 10 bases at 5' end.
The 10 unpaired bases represent 10% of the sequence (number of
bases at the 5' and 3' ends not matched/total number of bases in
the query sequence) so 10% is subtracted from the percent identity
score calculated by the FASTDB program. If the remaining 90 bases
were perfectly matched the final percent identity would be 90%. In
another example, a 90 base subject sequence is compared with a 100
base query sequence. This time the deletions are internal deletions
so that there are no bases on the 5' or 3' of the subject sequence
which are not matched/aligned with the query. In this case the
percent identity calculated by FASTDB is not manually corrected.
Once again, only bases 5' and 3' of the subject sequence which are
not matched/aligned with the query sequence are manually corrected
for. No other manual corrections are made for the purposes of this
embodiment.
[0114] The present application is directed to nucleic acid
molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the
nucleic acid sequences (i.e., polynucleotides) disclosed herein
(e.g., those disclosed in FIGS. 1A and 1B (SEQ ID NO:1) or to the
nucleic acid sequence of the deposited cDNAs), irrespective of
whether they encode a polypeptide having Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV functional activity (e.g., biological
activity). In addition, the present application is also directed to
nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99%
identical to the nucleic acid sequence shown in FIGS. 5A and 5B
(SEQ ID NO:18) or to the nucleic acid sequence of the deposited
cDNA, irrespective of whether they encode a polypeptide having
Neutrokine-aSV activity. This is because even where a particular
nucleic acid molecule does not encode a polypeptide having
Neutrokine-a and/or Neutrokine-aSV activity, one of skill in the
art would still know how to use the nucleic acid molecule, for
instance, as a hybridization probe or a polymerase chain reaction
(PCR) primer. Uses of the nucleic acid molecules of the present
invention that do not encode a polypeptide having Neutrokine-a
and/or Neutrokine-aSV activity include, inter alia, (1) isolating
the Neutrokine-a and/or Neutrokine-aSV gene or allelic variants
thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH")
to metaphase chromosomal spreads to provide precise chromosomal
location of the Neutrokine-a and/or Neutrokine-aSV gene, as
described in Verma et al., Human Chromosomes: A Manual of Basic
Techniques, Pergamon Press, New York (1988); and Northern Blot
analysis for detecting Neutrokine-a and/or Neutrokine-aSV mRNA
expression in specific tissues.
[0115] Preferred, however, are nucleic acid molecules having
sequences at least 90%, 95%, 96%, 97%, 98% or 99% identical to the
nucleic acid sequences disclosed herein (e.g., the nucleotide
sequence shown in FIGS. 1A and 1B (SEQ ID NO:1) and the nucleic
acid sequence of the deposited cDNAs, or fragments thereof), which
do, in fact, encode a polypeptide having Neutrokine-a and/or
Neutrokine-aSV polypeptide functional activity (e.g., biological
activity). Also preferred are nucleic acid molecules having
sequences at least 90%, 95%, 96%, 97%, 98% or 99% identical to the
nucleic acid sequence shown in FIGS. 5A and 5B (SEQ ID NO:18) or to
the nucleic acid sequence of the deposited cDNA which do, in fact,
encode a polypeptide having Neutrokine-a and/or Neutrokine-aSV
polypeptide functional activity (e.g., biological activity).
[0116] By "a polypeptide having Neutrokine-a polypeptide functional
activity" (e.g., biological activity) and "a polypeptide having
Neutrokine-aSV polypeptide functional activity" (e.g., biological
activity) are intended polypeptides exhibiting activity similar,
but not necessarily identical, to an activity of the extracellular
domain or the full-length Neutrokine-a or Neutrokine-aSV
polypeptides of the invention, as measured in a particular
functional assay (e.g., immunological or biological assay). For
example, Neutrokine-a and/or Neutrokine-aSV polypeptide functional
activity can be measured by the ability of a polypeptide sequence
described herein to form multimers (e.g., homodimers and
homotrimers) with the complete Neutrokine-a and/or Neutrokine-aSV
or extracellular domain of Neutrokine-a and/or Neutrokine-aSV, and
to bind a Neutrokine-a and/or Neutrokine-aSV ligand (e.g., DR5
(See, International Publication No. WO 98/41629), TR10 (See,
International Publication No. WO 98/54202), 312C2 (See,
International Publication No. WO 98/06842), and TR11, TR11SV1, and
TR11SV2 (See, U.S. application Ser. No. 09/176,200, now U.S. Pat.
No. 6,509,173)). Neutrokine-a and/or Neutrokine-aSV polypeptide
functional activity can be also be measured by determining the
ability of a polypeptide of the invention to induce lymphocyte
(e.g., B cell) proliferation, differentiation or activation. These
functional assays can be routinely performed using techniques
described herein (e.g., see Example 6) and otherwise known in the
art. Additionally, Neutrokine-a or Neutrokine-aSV polypeptides of
the present invention modulate cell proliferation, cytotoxicity and
cell death. An in vitro cell proliferation, cytotoxicity and cell
death assay for measuring the effect of a protein on certain cells
can be performed by using reagents well known and commonly
available in the art for detecting cell replication and/or death.
For instance, numerous such assays for TNF-related protein
activities are described in the various references in this
disclosure. Briefly, an example of such an assay involves
collecting human or animal (e.g., mouse) cells and mixing with (1)
transfected host cell-supernatant containing Neutrokine-a protein
(or a candidate polypeptide) or (2) nontransfected host
cell-supernatant control, and measuring the effect on cell numbers
or viability after incubation of certain period of time. Such cell
proliferation modulation activities as can be measure in this type
of assay are useful for treating tumor, tumor metastasis,
infections, autoimmune diseases inflammation and other
immune-related diseases.
[0117] Neutrokine-a and Neutrokine-aSV modulate cell proliferation
and differentiation in a dose-dependent manner in the
above-described assay. Accordingly, it is preferred that "a
polypeptide having Neutrokine-a polypeptide functional activity"
(e.g., biological activity) and "a polypeptide having
Neutrokine-aSV polypeptide functional activity" (e.g., biological
activity) includes polypeptides that also exhibit any of the same
cell modulatory (particularly immunomodulatory) activities in the
above-described assays in a dose-dependent manner. Although the
degree of dose-dependent activity need not be identical to that of
the Neutrokine-a and/or Neutrokine-aSV polypeptides, preferably, "a
polypeptide having Neutrokine-a polypeptide functional activity"
and "a polypeptide having Neutrokine-aSV polypeptide functional
activity" will exhibit substantially similar dose-dependence in a
given activity as compared to the Neutrokine-a and/or
Neutrokine-aSV polypeptides (i.e., the candidate polypeptide will
exhibit greater activity or not more than about 25-fold less and,
preferably, not more than about tenfold less activity relative to
the reference Neutrokine-a and/or Neutrokine-aSV polypeptides).
[0118] In certain preferred embodiments, "a polypeptide having
Neutrokine-a polypeptide functional activity" (e.g., biological
activity) and "a polypeptide having Neutrokine-aSV polypeptide
functional activity" (e.g., biological activity) includes
polypeptides that also exhibit any of the same B cell (or other
cell type) modulatory (particularly immunomodulatory) activities
described in FIGS. 8A, 8B, 9A, 9B, 10, 11, 12A, and 12B, and in
Example 6.
[0119] Like other members of TNF family, Neutrokine-a exhibits
activity on leukocytes including, for example, monocytes,
lymphocytes (e.g., B cells) and neutrophils. For this reason
Neutrokine-a is active in directing the proliferation,
differentiation and migration of these cell types. Such activity is
useful for immune enhancement or suppression, myeloprotection, stem
cell mobilization, acute and chronic inflammatory control and
treatment of leukemia. Assays for measuring such activity are known
in the art. For example, see Peters et al., Immun. Today 17:273
(1996); Young et al., J. Exp. Med. 182:1111 (1995); Caux et al.,
Nature 390:258 (1992); and Santiago-Schwarz et al., Adv. Exp. Med.
Biol. 378:7 (1995)."
[0120] Moreover, Neutrokine-aSV also exhibits activity on
leukocytes including for example monocytes, lymphocytes and
neutrophils. For this reason Neutrokine-aSV is active in directing
the proliferation, differentiation and migration of these cell
types. Such activity is useful for immune enhancement or
suppression, myeloprotection, stem cell mobilization, acute and
chronic inflammatory control and treatment of leukemia. Assays for
measuring such activity are known in the art. For example, see
Peters et al., Immun. Today 17:273 (1996); Young et al., J. Exp.
Med. 182:1111 (1995); Caux et al., Nature 390:258 (1992); and
Santiago-Schwarz et al., Adv. Exp. Med. Biol. 378:7 (1995)."
[0121] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid
sequence contained in cDNA clone deposited in ATCC accession no.
97768, or the nucleic acid sequence shown in FIGS. 1A and 1B (SEQ
ID NO:1), or fragments thereof, will encode a polypeptide "having
Neutrokine-a polypeptide functional activity" (e.g., biological
activity). One of ordinary skill in the art will also immediately
recognize that a large number of the nucleic acid molecules having
a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to
the nucleic acid sequence contained in cDNA clone deposited in ATCC
accession no. 203518 or the nucleic acid sequence shown in FIGS. 5A
and 5B (SEQ ID NO:18) will encode a polypeptide "having
Neutrokine-aSV polypeptide functional activity" (e.g., biological
activity). In fact, since degenerate variants of these nucleotide
sequences all encode the same polypeptide, this will be clear to
the skilled artisan even without performing the above described
comparison assay. It will be further recognized in the art that,
for such nucleic acid molecules that are not degenerate variants, a
reasonable number will also encode a polypeptide having
Neutrokine-a and/or Neutrokine-aSV activity. This is because the
skilled artisan is fully aware of amino acid substitutions that are
either less likely or not likely to significantly effect protein
function (e.g., replacing one aliphatic amino acid with a second
aliphatic amino acid), as further described below.
[0122] A further embodiment of the invention relates to an isolated
nucleic acid molecule comprising a polynucleotide which encodes the
amino acid sequence of a Neutrokine-aSV polypeptide having an amino
acid sequence which contains at least one conservative amino acid
substitution, but not more than 50 conservative amino acid
substitutions, even more preferably, not more than 40 conservative
amino acid substitutions, still more preferably not more than 30
conservative amino acid substitutions, and still even more
preferably not more than 20 conservative amino acid substitutions.
Of course, in order of ever-increasing preference, it is highly
preferable for a polynucleotide which encodes the amino acid
sequence of a Neutrokine-aSV polypeptide to have an amino acid
sequence which contains not more than 7-10, 5-10, 3-7,3-5, 2-5,1-5,
1-3, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 conservative amino acid
substitutions.
[0123] Polypeptide fragments of the present invention include
polypeptides comprising or alternatively, consisting of, an amino
acid sequence contained in SEQ ID NO:2, encoded by the cDNA
contained in the deposited clone, or encoded by nucleic acids which
hybridize (e.g., under stringent hybridization conditions) to the
nucleotide sequence contained in the deposited clone, or shown in
FIGS. 1A and 1B (SEQ ID NO:1) or the complementary strand thereto.
Protein fragments may be "free-standing," or comprised within a
larger polypeptide of which the fragment forms a part or region,
most preferably as a single continuous region. Representative
examples of polypeptide fragments of the invention, include, for
example, fragments that comprise or alternatively, consist of from
about amino acid residues: 1 to 50, 51 to 100, 101 to 150, 151 to
200, 201 to 250, and/or 251 to 285 of SEQ ID NO:2. Moreover,
polypeptide fragments can be at least 10, 20, 30, 40, 50, 60, 70,
80, 90, 100, 110, 120, 130, 140, 150, 175 or 200 amino acids in
length.
[0124] In specific embodiments, polypeptide fragments of the
invention comprise, or alternatively consist of, amino acid
residues: 1-46, 31-44, 47-72, 73-285, 73-83, 94-102, 148-152,
166-181, 185-209, 210-221, 226-237, 244-249, 253-265, and/or
277-284, as depicted in FIGS. 1A and 1B (SEQ ID NO:2).
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0125] It will be recognized by one of ordinary skill in the art
that mutations targeted to regions of a Neutrokine-.alpha.
polypeptide of the invention which encompass the nineteen amino
acid residue insertion which is not found in the Neutrokine-aSV
polypeptide sequence (i.e., amino acid residues Val-142 through
Lys-160 of the sequence presented in FIGS. 1A and 1B and in SEQ ID
NO:2) may affect the observed biological activities of the
Neutrokine-.alpha. polypeptide. More specifically, a partial,
non-limiting and non-exclusive list of such residues of the
Neutrokine-.alpha. polypeptide sequence which may be targeted for
mutation includes the following amino acid residues of the
Neutrokine-.alpha. polypeptide sequence as shown in SEQ ID NO:2:
V-142; T-143; Q-144; D-145; C-146; L-147; Q-148; L-149; I-150;
A-151; D-152; S-153; E-154; T-155; P-156; T-157; 1-158; Q-159; and
K-160. Polynucleotides encoding Neutrokine-a polypeptides which
have one or more mutations in the region from V-142 through K-160
of SEQ ID NO:2 are contemplated.
[0126] Similarly, polynucleotides encoding polypeptides which
contain all or some portion of the region V-142 through K-160 of
SEQ ID NO:2 are likely to be valuable diagnostic and therapeutic
polynucleotides with regard to detecting and/or altering expression
of either Neutrokine-.alpha. or Neutrokine-.alpha.SV
polynucleotides. In addition, polynucleotides which span the
junction of amino acid residues T-141 and G-142 of the
Neutrokine-aSV polypeptide shown in SEQ ID NO:19 (in between which
the V-142 through K-160 amino acid sequence of Neutrokine-a is
apparently inserted), are also likely to be useful both
diagnostically and therapeutically. Such T-141/G-142 spanning
polynucleotides will exhibit a much higher likelihood of
hybridization with Neutrokine-aSV polynucleotides than with
Neutrokine-a polynucleotides. A partial, non-limiting,
non-exclusive list of such Neutrokine-aSV polypeptides which are
encoded by polynucleotides of the invention includes the following:
G-121 through E-163; E-122 through E-163; G-123 through E-163;
N-124 through E-163; S-125 through E-163; S-126 through E-163;
Q-127 through E-163; N-128 through E-163; S-129 through E-163;
R-130 through E-163; N-131 through E-163; K-132 through E-163;
R-133 through E-163; A-134 through E-163; V-135 through E-163;
Q-136 through E-163; G-137 through E-163; P-138 through E-163;
E-139 through E-163; E-140 through E-163; T-141 through E-163;
G-142 through E-163; S-143 through E-163; Y-144 through E-163;
T-145 through E-163; F-146 through E-163; V-147 through E-163;
P-148 through E-163; W-149 through E-163; L-150 through E-163;
L-151 through E-163; S-152 through E-163; F-153 through E-163;
K-154 through E-163; R-155 through E-163; G-156 through E-163;
S-157 through E-163; A-158 through E-163; L-159 through E-163;
E-160 through E-163; E-161 through E-163; K-162 through E-163;
G-121 through K-162; G-121 through E-161; G-121 through E-160;
G-121 through L-159; G-121 through A-158; G-121 through S-157;
G-121 through G-156; G-121 through R-155; G-121 through K-154;
G-121 through F-153; G-121 through S-152; G-121 through L-151;
G-121 through L-150; G-121 through W-149; G-121 through P-148;
G-121 through V-147; G-121 through F-146; G-121 through T-145;
G-121 through Y-144; G-121 through S-143; G-121 through G-142;
G-121 through T-141; G-121 through E-140; G-121 through E-139;
G-121 through P-138; G-121 through G-137; G-121 through Q-136;
G-121 through V-135; G-121 through A-134; G-121 through R-133;
G-121 through K-132; G-121 through N-131; G-121 through R-130;
G-121 through S-129; G-121 through N-128; G-121 through Q-127;
G-121 through S-126; G-121 through S-125; G-121 through N-124;
G-121 through G-123; and G-121 through E-122 of SEQ ID NO:19.
[0127] Vectors and Host Cells
[0128] The present invention also relates to vectors which include
the isolated DNA molecules of the present invention, host cells
which are genetically engineered with the recombinant vectors, or
which are otherwise engineered to produce the polypeptides of the
invention, and the production of Neutrokine-a and/or Neutrokine-aSV
polypeptides, or fragments thereof, by recombinant techniques.
[0129] In one embodiment, the polynucleotides of the invention are
joined to a vector (e.g., a cloning or expression vector). The
vector may be, for example, a phage, plasmid, viral or retroviral
vector. Retroviral vectors may be replication competent or
replication defective. In the latter case, viral propagation
generally will occur only in complementing host cells. The
polynucleotides may be joined to a vector containing a selectable
marker for propagation in a host. Introduction of the vector
construct into the host cell can be effected by techniques known in
the art which include, but are not limited to, calcium phosphate
transfection, DEAE-dextran mediated transfection, cationic
lipid-mediated transfection, electroporation, transduction,
infection or other methods. Such methods are described in many
standard laboratory manuals, such as Davis et al., Basic Methods In
Molecular Biology (1986).
[0130] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), a-factor, acid phosphatase, or heat shock proteins,
among others. The heterologous structural sequence is assembled in
appropriate phase with translation initiation and termination
sequences, and preferably, a leader sequence capable of directing
secretion of translated protein into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence can
encode a fusion protein including an N-terminal identification
peptide imparting desired characteristics, for example,
stabilization or simplified purification of expressed recombinant
product.
[0131] In one embodiment, the DNA of the invention is operatively
associated with an appropriate heterologous regulatory element
(e.g., promoter or enhancer), such as, the phage lambda PL
promoter, the E. coli lac, trp, phoA, and tac promoters, the SV40
early and late promoters and promoters of retroviral LTRs, to name
a few. Other suitable promoters will be known to the skilled
artisan.
[0132] As indicated, the expression vectors will preferably include
at least one selectable marker. Such markers include dihydrofolate
reductase, G418 or neomycin resistance for eukaryotic cell culture
and tetracycline, kanamycin or ampicillin resistance genes for
culturing in E. coli and other bacteria. Representative examples of
appropriate hosts include, but are not limited to, bacterial cells,
such as E. coli, Streptomyces and Salmonella typhimurium cells;
fungal cells, such as yeast cells; insect cells such as Drosophila
S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293 and
Bowes melanoma cells; and plant cells. Appropriate culture mediums
and conditions for the above-described host cells are known in the
art.
[0133] The host cell can be a higher eukaryotic cell, such as a
mammalian cell (e.g., a human derived cell), or a lower eukaryotic
cell, such as a yeast cell, or the host cell can be a prokaryotic
cell, such as a bacterial cell. The host strain may be chosen which
modulates the expression of the inserted gene sequences, or
modifies and processes the gene product in the specific fashion
desired. Expression from certain promoters can be elevated in the
presence of certain inducers; thus expression of the genetically
engineered polypeptide may be controlled. Furthermore, different
host cells have characteristics and specific mechanisms for the
translational and post-translational processing and modification
(e.g., phosphorylation, cleavage) of proteins. Appropriate cell
lines can be chosen to ensure the desired modifications and
processing of the foreign protein expressed. Selection of
appropriate vectors and promoters for expression in a host cell is
a well known procedure and the requisite techniques for expression
vector construction, introduction of the vector into the host and
expression in the host are routine skills in the art.
[0134] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium, and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice. As a
representative, but nonlimiting example, useful expression vectors
for bacterial use can comprise a selectable marker and bacterial
origin of replication derived from commercially available plasmids
comprising genetic elements of the well known cloning vector pBR322
(ATCC 37017). Such commercial vectors include, for example,
pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEMI
(Promega Biotec, Madison, Wis., USA). These pBR322 "backbone"
sections are combined with an appropriate promoter and the
structural sequence to be expressed. Among vectors preferred for
use in bacteria include pHE4-5 (ATCC Accession No. 209311; and
variations thereof), pQE70, pQE60 and pQE-9, available from QIAGEN,
Inc., supra; pBS vectors, Phagescript vectors, Bluescript vectors,
pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene; and
ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from
Pharmacia. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT,
pOG44, pXT1 and pSG available from Stratagene; and pSVK3, pBPV,
pMSG and pSVL available from Pharmacia. Other suitable vectors will
be readily apparent to the skilled artisan.
[0135] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period. Cells are typically harvested by
centrifugation, disrupted by physical or chemical means, and the
resulting crude extract retained for further purification.
[0136] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well know to those skilled in the art.
[0137] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0138] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman (Cell 23:175 (1981)), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites may be used to provide the
required nontranscribed genetic elements.
[0139] In addition to encompassing host cells containing the vector
constructs discussed herein, the invention also encompasses
primary, secondary, and immortalized host cells of vertebrate
origin, particularly mammalian origin, that have been engineered to
delete or replace endogenous genetic material (e.g.,
Neutrokine-.alpha. coding sequence), and/or to include genetic
material (e.g., heterologous polynucleotide sequences) that is
operably associated with Neutrokine-.alpha. polynucleotides of the
invention, and which activates, alters, and/or amplifies endogenous
Neutrokine-.alpha. polynucleotides. For example, techniques known
in the art may be used to operably associate heterologous control
regions (e.g., promoter and/or enhancer) and endogenous
Neutrokine-.alpha. polynucleotide sequences via homologous
recombination (see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24,
1997; International Publication No. WO 96/29411, published Sep. 26,
1996; International Publication No. WO 94/12650, published Aug. 4,
1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935
(1989); and Zijlstra et al., Nature 342:435-438 (1989), the
disclosures of each of which are incorporated by reference in their
entireties).
[0140] The host cells described infra can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, cell-free translation systems can also be
employed to produce the polypeptides of the invention using RNAs
derived from the DNA constructs of the present invention.
[0141] The polypeptide of the invention may be expressed or
synthesized in a modified form, such as a fusion protein
(comprising the polypeptide joined via a peptide bond to a
heterologous protein sequence (of a different protein)), and may
include not only secretion signals, but also additional
heterologous functional regions. Such a fusion protein can be made
by ligating polynucleotides of the invention and the desired
nucleic acid sequence encoding the desired amino acid sequence to
each other, by methods known in the art, in the proper reading
frame, and expressing the fusion protein product by methods known
in the art. Alternatively, such a fusion protein can be made by
protein synthetic techniques, e.g., by use of a peptide
synthesizer. Thus, for instance, a region of additional amino
acids, particularly charged amino acids, may be added to the
N-terminus of the polypeptide to improve stability and persistence
in the host cell, during purification, or during subsequent
handling and storage. Also, peptide moieties may be added to the
polypeptide to facilitate purification. Such regions may be removed
prior to final preparation of the polypeptide. The addition of
peptide moieties to polypeptides to engender secretion or
excretion, to improve stability and to facilitate purification,
among others, are familiar and routine techniques in the art.
[0142] A preferred fusion protein comprises a heterologous region
from immunoglobulin that is useful to stabilize and purify
proteins. For example, EP-A-O 464 533 (Canadian counterpart
2045869) discloses fusion proteins comprising various portions of
constant region of immunoglobulin molecules together with another
human protein or part thereof. In many cases, the Fc part in a
fusion protein is thoroughly advantageous for use in therapy and
diagnosis and thus results, for example, in improved
pharmacokinetic properties (EP-A 0232 262). On the other hand, for
some uses it would be desirable to be able to delete the Fc part
after the fusion protein has been expressed, detected and purified
in the advantageous manner described. This is the case when Fc
portion proves to be a hindrance to use in therapy and diagnosis,
for example when the fusion protein is to be used as antigen for
immunizations. In drug discovery, for example, human proteins, such
as hIL-5 has been fused with Fc portions for the purpose of
high-throughput screening assays to identify antagonists of hIL-5.
See, D. Bennett et al., J. Molecular Recognition 8:52-58 (1995) and
K. Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).
[0143] Polypeptides of the present invention include naturally
purified products, products of chemical synthetic procedures, and
products produced by recombinant techniques from a prokaryotic or
eukaryotic host, including, for example, bacterial, yeast, higher
plant, insect and mammalian cells. Depending upon the host employed
in a recombinant production procedure, the polypeptides of the
present invention may be glycosylated or may be non-glycosylated.
In addition, polypeptides of the invention may also include an
initial modified methionine residue, in some cases as a result of
host-mediated processes.
[0144] Polypeptides of the invention can be chemically synthesized
using techniques known in the art (e.g., see Creighton, 1983,
Proteins: Structures and Molecular Principles, W.H. Freeman &
Co., N.Y., and Hunkapiller, M., et al., 1984, Nature 310:105-111).
For example, a peptide corresponding to a fragment of the complete
Neutrokine-.alpha. or Neutrokine-.alpha.SV polypeptides of the
invention can be synthesized by use of a peptide synthesizer.
Furthermore, if desired, nonclassical amino acids or chemical amino
acid analogs can be introduced as a substitution or addition into
the Neutrokine-.alpha. or Neutrokine-.alpha.SV polynucleotide
sequence. Non-classical amino acids include, but are not limited
to, to the D-isomers of the common amino acids, 2,4-diaminobutyric
acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino
butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino
isobutyric acid, 3-amino propionic acid, ornithine, norleucine,
norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline,
cysteic acid, tbutylglycine, t-butylalanine, phenylglycine,
cyclohexylalanine, b-alanine, fluoro-amino acids, designer amino
acids such as b-methyl amino acids, Ca-methyl amino acids,
Na-methyl amino acids, and amino acid analogs in general.
Furthermore, the amino acid can be D (dextrorotary) or L
(levorotary).
[0145] The invention encompasses Neutrokine-.alpha. or
Neutrokine-.alpha.SV polypeptides which are differentially modified
during or after translation, e.g., by glycosylation, acetylation,
phosphorylation, amidation, derivatization by known
protecting/blocking groups, proteolytic cleavage, linkage to an
antibody molecule or other cellular ligand, etc. Any of numerous
chemical modifications may be carried out by known techniques,
including but not limited, to specific chemical cleavage by
cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease,
NaBH.sub.4; acetylation, formylation, oxidation, reduction;
metabolic synthesis in the presence of tunicamycin; etc.
[0146] Additional post-translational modifications encompassed by
the invention include, for example, e.g., N-linked or O-linked
carbohydrate chains, processing of N-terminal or C-terminal ends),
attachment of chemical moieties to the amino acid backbone,
chemical modifications of N-linked or O-linked carbohydrate chains,
and addition or deletion of an N-terminal methionine residue as a
result of procaryotic host cell expression. The polypeptides may
also be modified with a detectable label, such as an enzymatic,
fluorescent, isotopic or affinity label to allow for detection and
isolation of the protein.
[0147] Also provided by the invention are chemically modified
derivatives of Neutrokine-.alpha. or Neutrokine-.alpha.SV which may
provide additional advantages such as increased solubility,
stability and circulating time of the polypeptide, or decreased
immunogenicity (see U.S. Pat. No. 4,179,337). The chemical moieties
for derivitization may be selected from water soluble polymers such
as polyethylene glycol, ethylene glycol/propylene glycol
copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and
the like. The polypeptides may be modified at random positions
within the molecule, or at predetermined positions within the
molecule and may include one, two, three or more attached chemical
moieties.
[0148] The polymer may be of any molecular weight, and may be
branched or unbranched. For polyethylene glycol, the preferred
molecular weight is between about 1 kDa and about 100 kDa (the term
"about" indicating that in preparations of polyethylene glycol,
some molecules will weigh more, some less, than the stated
molecular weight) for ease in handling and manufacturing. Other
sizes may be used, depending on the desired therapeutic profile
(e.g., the duration of sustained release desired, the effects, if
any on biological activity, the ease in handling, the degree or
lack of antigenicity and other known effects of the polyethylene
glycol to a therapeutic protein or analog).
[0149] The polyethylene glycol molecules (or other chemical
moieties) should be attached to the protein with consideration of
effects on functional or antigenic domains of the protein. There
are a number of attachment methods available to those skilled in
the art, e.g., EP 0 401 384, herein incorporated by reference
(coupling PEG to G-CSF), see also Malik et al., Exp. Hematol.
20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl
chloride). For example, polyethylene glycol may be covalently bound
through amino acid residues via a reactive group, such as, a free
amino or carboxyl group. Reactive groups are those to which an
activated polyethylene glycol molecule may be bound. The amino acid
residues having a free amino group may include lysine residues and
the N-terminal amino acid residues; those having a free carboxyl
group may include aspartic acid residues glutamic acid residues and
the C-terminal amino acid residue. Sulfhydryl groups may also be
used as a reactive group for attaching the polyethylene glycol
molecules. Preferred for therapeutic purposes is attachment at an
amino group, such as attachment at the N-terminus or lysine
group.
[0150] One may specifically desire proteins chemically modified at
the N-terminus. Using polyethylene glycol as an illustration, one
may select from a variety of polyethylene glycol molecules (by
molecular weight, branching, etc.), the proportion of polyethylene
glycol molecules to protein (or peptide) molecules in the reaction
mix, the type of pegylation reaction to be performed, and the
method of obtaining the selected N-terminally pegylated protein.
The method of obtaining the N-terminally pegylated preparation
(i.e., separating this moiety from other monopegylated moieties if
necessary) may be by purification of the N-terminally pegylated
material from a population of pegylated protein molecules.
Selective proteins chemically modified at the N-terminus
modification may be accomplished by reductive alkylation which
exploits differential reactivity of different types of primary
amino groups (lysine versus the N-terminal) available for
derivatization in a particular protein. Under the appropriate
reaction conditions, substantially selective derivatization of the
protein at the N-terminus with a carbonyl group containing polymer
is achieved.
[0151] The Neutrokine-a and/or Neutrokine-aSV polypeptides can be
recovered and purified by known methods which include, but are not
limited to, ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Most preferably, high
performance liquid chromatography ("HPLC") is employed for
purification.
Neutrokine-a Polypeptides
[0152] The Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptides of the invention may be in monomers or multimers
(i.e., dimers, trimers, tetramers and higher multimers).
Accordingly, the present invention relates to monomers and
multimers of the Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptides of the invention, their preparation, and compositions
(preferably, pharmaceutical compositions) containing them. In
specific embodiments, the polypeptides of the invention are
monomers, dimers, trimers or tetramers. In additional embodiments,
the multimers of the invention are at least dimers, at least
trimers, or at least tetramers.
[0153] Multimers encompassed by the invention may be homomers or
heteromers. As used herein, the term homomer, refers to a multimer
containing only Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptides of the invention (including Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV fragments, variants, and fusion proteins, as
described herein). These homomers may contain Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV polypeptides having identical or
different amino acid sequences. In a specific embodiment, a homomer
of the invention is a multimer containing only Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV polypeptides having an identical amino
acid sequence. In another specific embodiment, a homomer of the
invention is a multimer containing Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptides having different amino acid
sequences. In specific embodiments, the multimer of the invention
is a homodimer (e.g., containing Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptides having identical or different
amino acid sequences) or a homotrimer (e.g., containing
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptides having
identical or different amino acid sequences). In additional
embodiments, the homomeric multimer of the invention is at least a
homodimer, at least a homotrimer, or at least a homotetramer.
[0154] As used herein, the term heteromer refers to a multimer
containing heterologous polypeptides (i.e., polypeptides of a
different protein) in addition to the Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptides of the invention. In a specific
embodiment, the multimer of the invention is a heterodimer, a
heterotrimer, or a heterotetramer. In additional embodiments, the
homomeric multimer of the invention is at least a homodimer, at
least a homotrimer, or at least a homotetramer.
[0155] Multimers of the invention may be the result of hydrophobic,
hydrophilic, ionic and/or covalent associations and/or may be
indirectly linked, by for example, liposome formation. Thus, in one
embodiment, multimers of the invention, such as, for example,
homodimers or homotrimers, are formed when polypeptides of the
invention contact one another in solution. In another embodiment,
heteromultimers of the invention, such as, for example,
heterotrimers or heterotetramers, are formed when polypeptides of
the invention contact antibodies to the polypeptides of the
invention (including antibodies to the heterologous polypeptide
sequence in a fusion protein of the invention) in solution. In
other embodiments, multimers of the invention are formed by
covalent associations with and/or between the Neutrokine-.alpha.
and/or Neutrokine-.alpha. polypeptides of the invention. Such
covalent associations may involve one or more amino acid residues
contained in the polypeptide sequence (e.g., that recited in SEQ ID
NO:2 or SEQ ID NO:19, or contained in the polypeptide encoded by
the clones deposited in connection with this application). In one
instance, the covalent associations are cross-linking between
cysteine residues located within the polypeptide sequences which
interact in the native (i.e., naturally occurring) polypeptide. In
another instance, the covalent associations are the consequence of
chemical or recombinant manipulation. Alternatively, such covalent
associations may involve one or more amino acid residues contained
in the heterologous polypeptide sequence in a Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV fusion protein. In one example,
covalent associations are between the heterologous sequence
contained in a fusion protein of the invention (see, e.g., U.S.
Pat. No. 5,478,925). In a specific example, the covalent
associations are between the heterologous sequence contained in a
Neutrokine-.alpha.-Fc and/or Neutrokine-.alpha.SV-Fc fusion protein
of the invention (as described herein). In another specific
example, covalent associations of fusion proteins of the invention
are between heterologous polypeptide sequence from another TNF
family ligand/receptor member that is capable of forming covalently
associated multimers, such as for example, oseteoprotegerin (see,
e.g., International Publication No. WO 98/49305, the contents of
which are herein incorporated by reference in its entirety).
[0156] The multimers of the invention may be generated using
chemical techniques known in the art. For example, polypeptides
desired to be contained in the multimers of the invention may be
chemically cross-linked using linker molecules and linker molecule
length optimization techniques known in the art (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). Additionally, multimers of the invention may be
generated using techniques known in the art to form one or more
inter-molecule cross-links between the cysteine residues located
within the sequence of the polypeptides desired to be contained in
the multimer (see, e.g., U.S. Pat. No. 5,478,925, which is herein
incorporated by reference in its entirety). Further, polypeptides
of the invention may be routinely modified by the addition of
cysteine or biotin to the C terminus or N-terminus of the
polypeptide and techniques known in the art may be applied to
generate multimers containing one or more of these modified
polypeptides (see, e.g., U.S. Pat. No. 5,478,925, which is herein
incorporated by reference in its entirety). Additionally,
techniques known in the art may be applied to generate liposomes
containing the polypeptide components desired to be contained in
the multimer of the invention (see, e.g., U.S. Pat. No. 5,478,925,
which is herein incorporated by reference in its entirety).
[0157] Alternatively, multimers of the invention may be generated
using genetic engineering techniques known in the art. In one
embodiment, polypeptides contained in multimers of the invention
are produced recombinantly using fusion protein technology
described herein or otherwise known in the art (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). In a specific embodiment, polynucleotides coding for
a homodimer of the invention are generated by ligating a
polynucleotide sequence encoding a polypeptide of the invention to
a sequence encoding a linker polypeptide and then further to a
synthetic polynucleotide encoding the translated product of the
polypeptide in the reverse orientation from the original C-terminus
to the N-terminus (lacking the leader sequence) (see, e.g., U.S.
Pat. No. 5,478,925, which is herein incorporated by reference in
its entirety). In another embodiment, recombinant techniques
described herein or otherwise known in the art are applied to
generate recombinant polypeptides of the invention which contain a
transmembrane domain and which can be incorporated by membrane
reconstitution techniques into liposomes (see, e.g., U.S. Pat. No.
5,478,925, which is herein incorporated by reference in its
entirety).
[0158] In one embodiment, the invention provides an isolated
Neutrokine-a polypeptide having the amino acid sequence encoded by
the cDNA clone contained in ATCC No. 97768, or the amino acid
sequence in FIGS. 1A and 1B (SEQ ID NO:2), or a peptide or
polypeptide comprising a portion (i.e., a fragment) of the above
polypeptides. In another embodiment, the invention provides an
isolated Neutrokine-aSV polypeptide having the amino acid encoded
by the cDNA clone contained in ATCC No. 203518, or the amino acid
sequence in FIGS. 5A and 5B (SEQ ID NO:19), or a peptide or
polypeptide comprising a portion (i.e., fragment) of the above
polypeptides.
[0159] Polypeptide fragments of the present invention include
polypeptides comprising or alternatively, consisting of, an amino
acid sequence contained in SEQ ID NO:2, encoded by the cDNA
contained in the plasmid having ATCC accession number 97768, or
encoded by nucleic acids which hybridize (e.g., under stringent
hybridization conditions) to the nucleotide sequence contained in
the deposited clone, or the complementary strand of the nucleotide
sequence shown in FIGS. 1A-B (SEQ ID NO:1.
[0160] Additionally, polypeptide fragments of the present invention
include polypeptides comprising or alternatively, consisting of, an
amino acid sequence contained in SEQ ID NO:19, encoded by the cDNA
contained in the plasmid having ATCC accession number 203518, or
encoded by nucleic acids which hybridize (e.g., under stringent
hybridization conditions) to the nucleotide sequence contained in
the deposited clone, or the complementary strand of the nucleotide
sequence shown in FIGS. 5A-B (SEQ ID NO:18).
[0161] Protein fragments may be "free-standing," or comprised
within a larger polypeptide of which the fragment forms a part or
region, most preferably as a single continuous region.
Representative examples of polypeptide fragments of the invention,
include, for example, fragments that comprise or alternatively,
consist of from about amino acid residues: 1 to 15, 16-30, 31-46,
47-55, 56-72, 73-104, 105-163, 163-188, 186-210 and 210-284 of the
amino acid sequence disclosed in SEQ ID NO:2. Additional
representative examples of polypeptide fragments of the invention,
include, for example, fragments that comprise or alternatively,
consist of from about amino acid residues: 1 to 143, 1-150, 47-143,
47-150, 73-143, 73-150, 100-150, 140-145, 142-148, 140-150, 140200,
140-225, and 140-266 of the amino acid sequence disclosed in SEQ ID
NO:19. Moreover, polypeptide fragments can be at least 10, 20, 30,
40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 175 or 200
amino acids in length. In this context, "about" means several, a
few, 5, 4, 3, 2 or 1. Polynucleotides encoding these polypeptide
fragments are also encompassed by the invention.
[0162] Additional preferred embodiments encompass polypeptide
fragments comprising, or alternatively consisting of, the predicted
intracellular domain of Neutrokine-a (amino acid residues 1-46 of
SEQ ID NO:2), the predicted transmembrane domain of Neutrokine-a
(amino acid residues 47-72 of SEQ ID NO:2), the predicted
extracellular domain of Neutrokine-a (amino acid residues 73-285 of
SEQ ID NO:2), the predicted TNF conserved domain of
Neutrokine-.alpha. (amino acids 191 to 284 of SEQ ID NO:2), and a
polypeptide comprising, or alternatively, consisting of the
predicted intracellular domain fused to the predicted extracellular
domain of Neutrokine-a (amino acid residues 1-46 fused to amino
acid residues 73-285 of SEQ ID NO:2).
[0163] Further additional preferred embodiments encompass
polypeptide fragments comprising, or alternatively consisting of,
the predicted intracellular domain of Neutrokine-.alpha.SV (amino
acid residues 1-46 of SEQ ID NO:19), the predicted transmembrane
domain of Neutrokine-aSV (amino acid residues 47-72 of SEQ ID
NO:19), the predicted extracellular domain of Neutrokine-aSV (amino
acid residues 73-266 of SEQ ID NO:19), the predicted TNF conserved
domain of Neutrokine-aSV (amino acids 172 to 265 of SEQ ID NO:19),
and a polypeptide comprising, or alternatively, consisting of the
predicted intracellular domain fused to the predicted extracellular
domain of Neutrokine-.alpha.SV (amino acid residues 1-46 fused to
amino acid residues 73-266 of SEQ ID NO:19).
[0164] Additional embodiments encompass Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide fragments comprising functional
regions of polypeptides of the invention, such as the
Garnier-Robson alpha-regions, beta-regions, turn-regions, and
coil-regions, Chou-Fasman alpha-regions, beta-regions, and
coil-regions, Kyte-Doolittle hydrophilic regions and hydrophobic
regions, Eisenberg alpha- and beta-amphipathic regions,
Karplus-Schulz flexible regions, Emini surface-forming regions and
Jameson-Wolf regions of high antigenic index set out in FIGS. 3 and
6 and in Table I and as described herein. In a preferred
embodiment, the polypeptide fragments of the invention are
antigenic. The data presented in columns VIII, IX, XIII, and XIV of
Table I can be used to routinely determine regions of Neutrokine-a
which exhibit a high degree of potential for antigenicity. Regions
of high antigenicity are determined from the data presented in
columns VIII, IX, XIII, and/or IV by choosing values which
represent regions of the polypeptide which are likely to be exposed
on the surface of the polypeptide in an environment in which
antigen recognition may occur in the process of initiation of an
immune response. Among highly preferred fragments of the invention
are those that comprise regions of Neutrokine-a and/or
Neutrokine-aSV that combine several structural features, such as
several (e.g., 1, 2, 3 or 4) of the features set out above.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0165] In another embodiment, the invention provides a peptide or
polypeptide comprising an epitope-bearing portion of a polypeptide
of the invention. Polynucleotides encoding these peptides or
polypeptides are also encompassed by the invention. The epitope of
this polypeptide portion is an immunogenic or antigenic epitope of
a polypeptide of the invention. An "immunogenic epitope" is defined
as a part of a protein that elicits an antibody response when the
whole protein is the immunogen. On the other hand, a region of a
protein molecule to which an antibody can bind is defined as an
"antigenic epitope." The number of immunogenic epitopes of a
protein generally is less than the number of antigenic epitopes.
See, for instance, Geysen et al., Proc. Natl. Acad. Sci. USA
81:3998-4002 (1983).
[0166] As to the selection of peptides or polypeptides bearing an
antigenic epitope (i.e., that contain a region of a protein
molecule to which an antibody can bind), it is well known in that
art that relatively short synthetic peptides that mimic part of a
protein sequence are routinely capable of eliciting an antiserum
that reacts with the partially mimicked protein. See, for instance,
Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner, R. A.
(1983) "Antibodies that react with predetermined sites on
proteins", Science, 219:660-666. Peptides capable of eliciting
protein-reactive sera are frequently represented in the primary
sequence of a protein, can be characterized by a set of simple
chemical rules, and are confined neither to immunodominant regions
of intact proteins (i.e., immunogenic epitopes) nor to the amino or
carboxyl terminals. Antigenic epitope-bearing peptides and
polypeptides of the invention are therefore useful to raise
antibodies, including monoclonal antibodies, that bind specifically
to a polypeptide of the invention. See, for instance, Wilson et
al., Cell 37:767-778 (1984) at 777.
[0167] Antigenic epitope-bearing peptides and polypeptides of the
invention preferably contain a sequence of at least seven, more
preferably at least nine and most preferably between about 15 to
about 30 amino acids contained within the amino acid sequence of a
polypeptide of the invention. Non-limiting examples of antigenic
polypeptides or peptides that can be used to generate
Neutrokine-.alpha.- and/or Neutrokine-aSV-specific antibodies
include: a polypeptide comprising amino acid residues from about
Phe-115 to about Leu-147 in FIGS. 1A and 1B (SEQ ID NO:2); a
polypeptide comprising amino acid residues from about Ile-150 to
about Tyr-163 in FIGS. 1A and 1B (SEQ ID NO:2); a polypeptide
comprising amino acid residues from about Ser-171 to about Phe-194
in FIGS. 1A and 1B (SEQ ID NO:2); a polypeptide comprising amino
acid residues from about Glu-223 to about Tyr-247 in FIGS. 1A and
1B (SEQ ID NO:2); and a polypeptide comprising amino acid residues
from about Ser-271 to about Phe-278 in FIGS. 1A and 1B (SEQ ID
NO:2). These polypeptide fragments have been determined to bear
antigenic epitopes of the Neutrokine-.alpha. polypeptide by the
analysis of the Jameson-Wolf antigenic index, as shown in FIG. 3
and Table I, above.
[0168] Non-limiting examples of antigenic polypeptides or peptides
that can be used to generate Neutrokine-.alpha.- and/or
Neutrokine-aSV-specific antibodies include: a polypeptide
comprising amino acid residues from about Pro-32 to about Leu-47 in
FIGS. 5A and 5B (SEQ ID NO:19); a polypeptide comprising amino acid
residues from about Glu-116 to about Ser-143 in FIGS. 5A and 5B
(SEQ ID NO:19); a polypeptide comprising amino acid residues from
about Phe-153 to about Tyr-173 in FIGS. 5A and 5B (SEQ ID NO:19); a
polypeptide comprising amino acid residues from about Pro-218 to
about Tyr-227 in FIGS. 5A and 5B (SEQ ID NO:19); a polypeptide
comprising amino acid residues from about Ala-232 to about Gln-241
in FIGS. 5A and 5B (SEQ ID NO:19); a polypeptide comprising amino
acid residues from about Ile-244 to about Ala-249 in FIGS. 5A and
5B (SEQ ID NO:19); and a polypeptide comprising amino acid residues
from about Ser-252 to about Val-257 in FIGS. 5A and 5B (SEQ ID
NO:19). Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0169] These polypeptide fragments have been determined to bear
antigenic epitopes of the Neutrokine-.alpha.SV polypeptide by the
analysis of the Jameson-Wolf antigenic index, as shown in FIG. 6
and a tabular representation of the data presented in FIG. 6
generated by the Protean component of the DNA*STAR computer program
(as set forth above).
[0170] The epitope-bearing peptides and polypeptides of the
invention may be produced by any conventional means. See, e.g.,
Houghten, R. A. (1985) General method for the rapid solid-phase
synthesis of large numbers of peptides: specificity of
antigen-antibody interaction at the level of individual amino
acids. Proc. Natl. Acad. Sci. USA 82:5131-5135; this "Simultaneous
Multiple Peptide Synthesis (SMPS)" process is further described in
U.S. Pat. No. 4,631,211 to Houghten et al. (1986).
[0171] Epitope-bearing peptides and polypeptides of the invention
are used to induce antibodies according to methods well known in
the art. See, for instance, Sutcliffe et al., supra; Wilson et al.,
supra; Chow, M. et al., Proc. Natl. Acad. Sci. USA 82:910-914; and
Bittle, F. J. et al., J. Gen. Virol. 66:2347-2354 (1985).
Immunogenic epitope-bearing peptides of the invention, i.e., those
parts of a protein that elicit an antibody response when the whole
protein is the immunogen, are identified according to methods known
in the art. See, for instance, Geysen et al., supra. Further still,
U.S. Pat. No. 5,194,392 to Geysen (1990) describes a general method
of detecting or determining the sequence of monomers (amino acids
or other compounds) which is a topological equivalent of the
epitope (i.e., a "mimotope") which is complementary to a particular
paratope (antigen binding site) of an antibody of interest. More
generally, U.S. Pat. No. 4,433,092 to Geysen (1989) describes a
method of detecting or determining a sequence of monomers which is
a topographical equivalent of a ligand which is complementary to
the ligand binding site of a particular receptor of interest.
Similarly, U.S. Pat. No. 5,480,971 to Houghten, R. A. et al. (1996)
on Peralkylated Oligopeptide Mixtures discloses linear
C.sub.1-C.sub.7-alkyl peralkylated oligopeptides and sets and
libraries of such peptides, as well as methods for using such
oligopeptide sets and libraries for determining the sequence of a
peralkylated oligopeptide that preferentially binds to an acceptor
molecule of interest. Thus, non-peptide analogs of the
epitope-bearing peptides of the invention also can be made
routinely by these methods.
[0172] As one of skill in the art will appreciate,
Neutrokine-.alpha. and/or Neutrokine-aSV polypeptides of the
present invention and the epitope-bearing fragments thereof
described above can be combined with parts of the constant domain
of immunoglobulins (IgG), resulting in chimeric polypeptides. These
fusion proteins facilitate purification and show an increased
half-life in vivo. This has been shown, e.g., for chimeric proteins
consisting of the first two domains of the human CD4-polypeptide
and various domains of the constant regions of the heavy or light
chains of mammalian immunoglobulins (EP A 394,827; Traunecker et
al., Nature 331:84-86 (1988)). Fusion proteins that have a
disulfide-linked dimeric structure due to the IgG part can also be
more efficient in binding and neutralizing other molecules than the
monomeric Neutrokine-.alpha. and/or Neutrokine-aSV polypeptides or
polypeptide fragments alone (Fountoulakis et al., J. Biochem.
270:3958-3964 (1995)).
[0173] To improve or alter the characteristics of Neutrokine-a
and/or Neutrokine-aSV polypeptides, protein engineering may be
employed. Recombinant DNA technology known to those skilled in the
art can be used to create novel mutant proteins or "muteins
including single or multiple amino acid substitutions, deletions,
additions or fusion proteins. Such modified polypeptides can show,
e.g., enhanced activity or increased stability. In addition, they
may be purified in higher yields and show better solubility than
the corresponding natural polypeptide, at least under certain
purification and storage conditions. For instance, for many
proteins, including the extracellular domain or the mature form(s)
of a secreted protein, it is known in the art that one or more
amino acids may be deleted from the N-terminus or C-terminus
without substantial loss of biological function. For instance, Ron
et al., J. Biol. Chem., 268:2984-2988 (1993) reported modified KGF
proteins that had heparin binding activity even if 3, 8, or 27
amino-terminal amino acid residues were missing.
[0174] In the present case, since the protein of the invention is a
member of the TNF polypeptide family, deletions of N-terminal amino
acids up to the Gly (G) residue at position 191 in FIGS. 1A and 1B
(SEQ ID NO:2) may retain some biological activity such as, for
example, the ability to stimulate lymphocyte (e.g., B cell)
proliferation, differentiation, and/or activation, and cytotoxicity
to appropriate target cells. Polypeptides having further N-terminal
deletions including the Gly (G) residue would not be expected to
retain biological activities because it is known that this residue
in TNF-related polypeptides is in the beginning of the conserved
domain required for biological activities. However, even if
deletion of one or more amino acids from the N-terminus of a
protein results in modification of loss of one or more biological
functions of the protein, other functional activities may still be
retained. Thus, the ability of the shortened protein to induce
and/or bind to antibodies which recognize the complete or
extracellular domain of the protein generally will be retained when
less than the majority of the residues of the complete or
extracellular domain of the protein are removed from the
N-terminus. Whether a particular polypeptide lacking N-terminal
residues of a complete protein retains such immunologic activities
can readily be determined by routine methods described herein and
otherwise known in the art.
[0175] Accordingly, the present invention further provides
polypeptides having one or more residues from the amino terminus of
the amino acid sequence of the Neutrokine-a shown in FIGS. 1A and
1B (SEQ ID NO:2), up to the glycine residue at position 191
(Gly-191 residue from the amino terminus), and polynucleotides
encoding such polypeptides. In particular, the present invention
provides polypeptides having the amino acid sequence of residues
n.sup.1-285 of SEQ ID NO:2, where n.sup.1 is an integer in the
range of the amino acid position of amino acid residues 2-190 of
the amino acid sequence in SEQ ID NO:2. More in particular, the
invention provides polynucleotides encoding polypeptides
comprising, or alternatively consisting of, the amino acid sequence
of residues 2-285, 3-285, 4-285, 5-285, 6-285, 7-285, 8-285, 9-285,
10-285, 11-285, 12-285, 13-285, 14-285, 15-285, 16-285, 17-285,
18-285, 19-285, 20-285, 21-285, 22-285, 23-285, 24-285, 25-285,
26-285, 27-285, 28-285, 29-285, 30-285, 31-285, 32-285, 33-285,
34-285, 35-285, 36-285, 37-285, 38-285, 39-285, 40-285, 41-285,
42-285, 43-285, 44-285, 45-285, 46-285, 47-285, 48-285, 49-285,
50-285, 51-285, 52-285, 53-285, 54-285, 55-285, 56-285, 57-285,
58-285, 59-285, 60-285, 61-285, 62-285, 63-285, 64-285, 65-285,
66-285, 67-285, 68-285, 69-285, 70-285, 71-285, 72-285, 73-285,
74-285, 75-285, 76-285, 77-285, 78-285, 79-285, 80-285, 81-285,
82-285, 83-285, 84-285, 85-285, 86-285, 87-285, 88-285, 89-285,
90-285, 91-285, 92-285, 93-285, 94-285, 95-285, 96-285, 97-285,
98-285, 99-285, 100-285, 101-285, 102-285, 103-285, 104-285,
105-285, 106-285, 107-285, 108-285, 109-285, 110-285, 111-285,
112-285, 113-285, 114-285, 115-285, 116-285, 117-285, 118-285,
119-285, 120-285, 121-285, 122-285, 123-285, 124-285, 125-285,
126-285, 127-285, 128-285, 129-285, 130-285, 131-285, 132-285,
133-285, 134-285, 135-285, 136-285, 137-285, 138-285, 139-285,
140-285, 141-285, 142-285, 143-285, 144-285, 145-285, 146-285,
147-285, 148-285, 149-285, 150-285, 151-285, 152-285, 153-285,
154-285, 155-285, 156-285, 157-285, 158-285, 159-285, 160-285,
161-285, 162-285, 163-285, 164-285, 165-285, 166-285, 167-285,
168-285, 169-285, 170-285, 171-285, 172-285, 173-285, 174-285,
175-285, 176-285, 177-285, 178-285, 179-285, 180-285, 181-285,
182-285, 183-285, 184-285, 185-285, 186-285, 187-285, 188-285,
189-285, and 190-285 of SEQ ID NO:2. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0176] Similarly, many examples of biologically functional
C-terminal deletion muteins are known. For instance, Interferon
gamma shows up to ten times higher activities by deleting 8-10
amino acid residues from the carboxy terminus of the protein
(Dobeli et al., J. Biotechnology 7:199-216 (1988). Since the
present protein is a member of the TNF polypeptide family,
deletions of C-terminal amino acids up to the leucine residue at
position 284 are expected to retain most if not all biological
activity such as, for example, ligand binding, the ability to
stimulate lymphocyte (e.g., B cell) proliferation, differentiation,
and/or activation, and modulation of cell replication. Polypeptides
having deletions of up to about 10 additional C-terminal residues
(i.e., up to the glycine residue at position 274) also may retain
some activity such as receptor binding, although such polypeptides
would lack a portion of the conserved TNF domain which extends to
about Leu-284 of SEQ ID NO:2. However, even if deletion of one or
more amino acids from the C-terminus of a protein results in
modification of loss of one or more biological functions of the
protein, other functional activities may still be retained. Thus,
the ability of the shortened protein to induce and/or bind to
antibodies which recognize the complete or mature protein generally
will be retained when less than the majority of the residues of the
complete or mature protein are removed from the C-terminus. Whether
a particular polypeptide lacking C-terminal residues of a complete
protein retains such immunologic activities can readily be
determined by routine methods described herein and otherwise known
in the art.
[0177] Accordingly, the present invention further provides
polypeptides having one or more residues from the carboxy terminus
of the amino acid sequence of the Neutrokine-.alpha. shown in FIGS.
1A and 1B (SEQ ID NO:2), up to the glycine residue at position 274
(Gly-274) and polynucleotides encoding such polypeptides. In
particular, the present invention provides polypeptides having the
amino acid sequence of residues 1-m.sup.1 of the amino acid
sequence in SEQ ID NO:2, where m.sup.1 is any integer in the range
of the amino acid position of amino acid residues 274-284 in SEQ ID
NO:2. More in particular, the invention provides polynucleotides
encoding polypeptides comprising, or alternatively consisting of,
the amino acid sequence of residues 1-274, 1-275, 1-276, 1-277,
1-278, 1-279, 1-280, 1-281, 1-282, 1-283 and 1-284 of SEQ ID NO:2.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0178] Also provided are polypeptides having one or more amino
acids deleted from both the amino and the carboxyl termini, which
may be described generally as having residues n.sup.1-m.sup.1 of
SEQ ID NO:2, where n.sup.1 and m.sup.1 are integers as defined
above. Also included are a nucleotide sequence encoding a
polypeptide consisting of a portion of the complete
Neutrokine-.alpha. amino acid sequence encoded by the deposited
cDNA clone contained in ATCC Accession No. 97768 where this portion
excludes from 1 to 190 amino acids from the amino terminus or from
1 to 11 amino acids from the C-terminus of the complete amino acid
sequence (or any combination of these N-terminal and C-terminal
deletions) encoded by the cDNA clone in the deposited clone.
Polynucleotides encoding all of the above deletion polypeptides are
encompassed by the invention.
[0179] In specific embodiments, the following N- and/or
C-terminally deleted polypeptide fragments of Neutrokine-a and/or
Neutrokine-aSV are preferred: amino acid residues Ala-71 through
Leu-285, amino acid residues Ala-81 through Leu-285, amino acid
residues Leu-112 through Leu-285, amino acid residues Ala-134
through Leu-285, amino acid residues Leu-147 through Leu-285, and
amino acid residues Gly-161 through Leu-285 of SEQ ID NO:2.
[0180] Furthermore, since the predicted extracellular domain of the
Neutrokine-a polypeptides of the invention may itself elicit
biological activity, deletions of N- and C-terminal amino acid
residues from the predicted extracellular region of the polypeptide
(spanning positions Gln-73 to Leu-285 of SEQ ID NO:2) may retain
some biological activity such as, for example, ligand binding,
stimulation of lymphocyte (e.g., B cell) proliferation,
differentiation, and/or activation, and modulation of cell
replication or modulation of target cell activities. However, even
if deletion of one or more amino acids from the N-terminus of the
predicted extracellular domain of a Neutrokine-a polypeptide
results in modification of loss of one or more biological functions
of the polypeptide, other functional activities may still be
retained. Thus, the ability of the shortened polypeptides to induce
and/or bind to antibodies which recognize the complete or mature or
extracellular domains of the polypeptides generally will be
retained when less than the majority of the residues of the
complete or mature or extracellular domains of the polypeptides are
removed from the N-terminus. Whether a particular polypeptide
lacking N-terminal residues of a complete polypeptide retains such
immunologic activities can readily be determined by routine methods
described herein and otherwise known in the art.
[0181] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the amino
terminus of the amino acid sequence of Neutrokine-a shown in SEQ ID
NO:2, up to the glycine residue at position number 280, and
polynucleotides encoding such polypeptides. In particular, the
present invention provides polypeptides comprising the amino acid
sequence of residues n.sup.2-285 of SEQ ID NO:2, where n.sup.2 is
an integer in the range of the amino acid position of amino acid
residues 73-280 in SEQ ID NO:2, and 73 is the position of the first
residue from the N-terminus of the predicted extracellular domain
of the Neutrokine-a polypeptide (disclosed in SEQ ID NO:2).
[0182] More in particular, in certain embodiments, the invention
provides polynucleotides encoding polypeptides comprising, or
alternatively consisting of, the amino acid sequence of residues of
Q-73 to L-285; G-74 to L-285; D-75 to L-285; L-76 to L-285; A-77 to
L-285; S-78 to L-285; L-79 to L-285; R-80 to L-285; A-81 to L-285;
E-82 to L-285; L-83 to L-285; Q-84 to L-285; G-85 to L-285; H-86 to
L-285; H-87 to L-285; A-88 to L-285; E-89 to L-285; K-90 to L-285;
L-91 to L-285; P-92 to L-285; A-93 to L-285; G-94 to L-285; A-95 to
L-285; G-96 to L-285; A-97 to L-285; P-98 to L-285; K-99 to L-285;
A-100 to L-285; G-101 to L-285; L-102 to L-285; E-103 to L-285;
E-104 to L-285; A-105 to L-285; P-106 to L-285; A-107 to L-285;
V-108 to L-285; T-109 to L-285; A-110 to L-285; G-111 to L-285;
L-112 to L-285; K-113 to L-285; I-114 to L-285; F-115 to L-285;
E-116 to L-285; P-117 to L-285; P-118 to L-285; A-119 to L-285;
P-120 to L-285; G-121 to L-285; E-122 to L-285; G-123 to L-285;
N-124 to L-285; S-125 to L-285; S-126 to L-285; Q-127 to L-285;
N-128 to L-285; S-129 to L-285; R-130 to L-285; N-131 to L-285;
K-132 to L-285; R-133 to L-285; A-134 to L-285; V-135 to L-285;
Q-136 to L-285; G-137 to L-285; P-138 to L-285; E-139 to L-285;
E-140 to L-285; T-141 to L-285; V-142 to L-285; T-143 to L-285;
Q-144 to L-285; D-145 to L-285; C-146 to L-285; L-147 to L-285;
Q-148 to L-285; L-149 to L-285; 1-150 to L-285; A-151 to L-285;
D-152 to L-285; S-153 to L-285; E-154 to L-285; T-155 to L-285;
P-156 to L-285; T-157 to L-285; 1-158 to L-285; Q-159 to L-285;
K-160 to L-285; G-161 to L-285; S-162 to L-285; Y-163 to L-285;
T-164 to L-285; F-165 to L-285; V-166 to L-285; P-167 to L-285;
W-168 to L-285; L-169 to L-285; L-170 to L-285; S-171 to L-285;
F-172 to L-285; K-173 to L-285; R-174 to L-285; G-175 to L-285;
S-176 to L-285; A-177 to L-285; L-178 to L-285; E-179 to L-285;
E-180 to L-285; K-181 to L-285; E-182 to L-285; N-183 to L-285;
K-184 to L-285; 1-185 to L-285; L-186 to L-285; V-187 to L-285;
K-188 to L-285; E-189 to L-285; T-190 to L-285; G-191 to L-285;
Y-192 to L-285; F-193 to L-285; F-194 to L-285; 1-195 to L-285;
Y-196 to L-285; G-197 to L-285; Q-198 to L-285; V-199 to L-285;
L-200 to L-285; Y-201 to L-285; T-202 to L-285; D-203 to L-285;
K-204 to L-285; T-205 to L-285; Y-206 to L-285; A-207 to L-285;
M-208 to L-285; G-209 to L-285; H-210 to L-285; L-211 to L-285;
1-212 to L-285; Q-213 to L-285; R-214 to L-285; K-215 to L-285;
K-216 to L-285; V-217 to L-285; H-218 to L-285; V-219 to L-285;
F-220 to L-285; G-221 to L-285; D-222 to L-285; E-223 to L-285;
L-224 to L-285; S-225 to L-285; L-226 to L-285; V-227 to L-285;
T-228 to L-285; L-229 to L-285; F-230 to L-285; R-231 to L-285;
C-232 to L-285; 1-233 to L-285; Q-234 to L-285; N-235 to L-285;
M-236 to L-285; P-237 to L-285; E-238 to L-285; T-239 to L-285;
L-240 to L-285; P-241 to L-285; N-242 to L-285; N-243 to L-285;
S-244 to L-285; C-245 to L-285; Y-246 to L-285; S-247 to L-285;
A-248 to L-285; G-249 to L-285; 1-250 to L-285; A-251 to L-285;
K-252 to L-285; L-253 to L-285; E-254 to L-285; E-255 to L-285;
G-256 to L-285; D-257 to L-285; E-258 to L-285; L-259 to L-285;
Q-260 to L-285; L-261 to L-285; A-262 to L-285; I-263 to L-285;
P-264 to L-285; R-265 to L-285; E-266 to L-285; N-267 to L-285;
A-268 to L-285; Q-269 to L-285; 1-270 to L-285; S-271 to L-285;
L-272 to L-285; D-273 to L-285; G-274 to L-285; D-275 to L-285;
V-276 to L-285; T-277 to L-285; F-278 to L-285; F-279 to L-285; and
G-280 to L-285 of SEQ ID NO:2. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
[0183] Similarly, deletions of C-terminal amino acid residues of
the predicted extracellular domain of Neutrokine-a up to the
leucine residue at position 79 of SEQ ID NO:2 may retain some
biological activity, such as, for example, ligand binding,
stimulation of lymphocyte (e.g., B cell) proliferation,
differentiation, and/or activation, and modulation of cell
replication or modulation of target cell activities. Polypeptides
having further C-terminal deletions including Leu-79 of SEQ ID NO:2
would not be expected to retain biological activities.
[0184] However, even if deletion of one or more amino acids from
the C-terminus of a polypeptide results in modification of loss of
one or more biological functions of the polypeptide, other
functional activities may still be retained. Thus, the ability of
the shortened polypeptide to induce and/or bind to antibodies which
recognize the complete, mature or extracellular forms of the
polypeptide generally will be retained when less than the majority
of the residues of the complete, mature or extracellular forms of
the polypeptide are removed from the C-terminus. Whether a
particular polypeptide lacking C-terminal residues of the predicted
extracellular domain retains such immunologic activities can
readily be determined by routine methods described herein and
otherwise known in the art.
[0185] Accordingly, the present invention further provides
polypeptides having one or more residues from the carboxy terminus
of the amino acid sequence of the predicted extracellular domain of
Neutrokine-a shown in SEQ ID NO:2, up to the leucine residue at
position 79 of SEQ ID NO:2, and polynucleotides encoding such
polypeptides. In particular, the present invention provides
polypeptides having the amino acid sequence of residues 73-m.sup.2
of the amino acid sequence in SEQ ID NO:2, where m.sup.2 is any
integer in the range of the amino acid position of amino acid
residues 79 to 285 in the amino acid sequence in SEQ ID NO:2, and
residue 78 is the position of the first residue at the C-terminus
of the predicted extracellular domain of the Neutrokine-a
polypeptide (disclosed in SEQ ID NO:2).
[0186] More in particular, in certain embodiments, the invention
provides polynucleotides encoding polypeptides comprising, or
alternatively consisting of, the amino acid sequence of residues
Q-73 to Leu-285; Q-73 to L-284; Q-73 to K-283; Q-73 to L-282; Q-73
to A-281; Q-73 to G-280; Q-73 to F-279; Q-73 to F-278; Q-73 to
T-277; Q-73 to V-276; Q-73 to D-275; Q-73 to G-274; Q-73 to D-273;
Q-73 to L-272; Q-73 to S-271; Q-73 to 1-270; Q-73 to Q-269; Q-73 to
A-268; Q-73 to N-267; Q-73 to E-266; Q-73 to R-265; Q-73 to P-264;
Q-73 to 1-263; Q-73 to A-262; Q-73 to L-261; Q-73 to Q-260; Q-73 to
L-259; Q-73 to E-258; Q-73 to D-257; Q-73 to G-256; Q-73 to E-255;
Q-73 to E-254; Q-73 to L-253; Q-73 to K-252; Q-73 to A-251; Q-73 to
1-250; Q-73 to G-249; Q-73 to A-248; Q-73 to S-247; Q-73 to Y-246;
Q-73 to C-245; Q-73 to S-244; Q-73 to N-243; Q-73 to N-242; Q-73 to
P-241; Q-73 to L-240; Q-73 to T-239; Q-73 to E-238; Q-73 to P-237;
Q-73 to M-236; Q-73 to N-235; Q-73 to Q-234; Q-73 to 1-233; Q-73 to
C-232; Q-73 to R-231; Q-73 to F-230; Q-73 to L-229; Q-73 to T-228;
Q-73 to V-227; Q-73 to L-226; Q-73 to S-225; Q-73 to L-224; Q-73 to
E-223; Q-73 to D-222; Q-73 to G-221; Q-73 to F-220; Q-73 to V-219;
Q-73 to H-218; Q-73 to V-217; Q-73 to K-216; Q-73 to K-215; Q-73 to
R-214; Q-73 to Q-213; Q-73 to 1-212; Q-73 to L-211; Q-73 to H-210;
Q-73 to G-209; Q-73 to M-208; Q-73 to A-207; Q-73 to Y-206; Q-73 to
T-205; Q-73 to K-204; Q-73 to D-203; Q-73 to T-202; Q-73 to Y-201;
Q-73 to L-200; Q-73 to V-199; Q-73 to Q-198; Q-73 to G-197; Q-73 to
Y-196; Q-73 to 1-195; Q-73 to F-194; Q-73 to F-193; Q-73 to Y-192;
Q-73 to G-191; Q-73 to T-190; Q-73 to E-189; Q-73 to K-188; Q-73 to
V-187; Q-73 to L-186; Q-73 to 1-185; Q-73 to K-184; Q-73 to N-183;
Q-73 to E-182; Q-73 to K-181; Q-73 to E-180; Q-73 to E-179; Q-73 to
L-178; Q-73 to A-177; Q-73 to S-176; Q-73 to G-175; Q-73 to R-174;
Q-73 to K-173; Q-73 to F-172; Q-73 to S-171; Q-73 to L-170; Q-73 to
L-169; Q-73 to W-168; Q-73 to P-167; Q-73 to V-166; Q-73 to F-165;
Q-73 to T-164; Q-73 to Y-163; Q-73 to S-162; Q-73 to G-161; Q-73 to
K-160; Q-73 to Q-159; Q-73 to I-158; Q-73 to T-157; Q-73 to P-156;
Q-73 to T-155; Q-73 to E-154; Q-73 to S-153; Q-73 to D-152; Q-73 to
A-151; Q-73 to 1-150; Q-73 to L-149; Q-73 to Q-148; Q-73 to L-147;
Q-73 to C-146; Q-73 to D-145; Q-73 to Q-144; Q-73 to T-143; Q-73 to
V-142; Q-73 to T-141; Q-73 to E-140; Q-73 to E-139; Q-73 to P-138;
Q-73 to G-137; Q-73 to Q-136; Q-73 to V-135; Q-73 to A-134; Q-73 to
R-133; Q-73 to K-132; Q-73 to N-131; Q-73 to R-130; Q-73 to S-129;
Q-73 to N-128; Q-73 to Q-127; Q-73 to S-126; Q-73 to S-125; Q-73 to
N-124; Q-73 to G-123; Q-73 to E-122; Q-73 to G-121; Q-73 to P-120;
Q-73 to A-119; Q-73 to P-118; Q-73 to P-117; Q-73 to E-116; Q-73 to
F-115; Q-73 to I-114; Q-73 to K-113; Q-73 to L-112; Q-73 to G-111;
Q-73 to A-110; Q-73 to T-109; Q-73 to V-108; Q-73 to A-107; Q-73 to
P-106; Q-73 to A-105; Q-73 to E-104; Q-73 to E-103; Q-73 to L-102;
Q-73 to G-101; Q-73 to A-100; Q-73 to K-99; Q-73 to P-98; Q-73 to
A-97; Q-73 to G-96; Q-73 to A-95; Q-73 to G-94; Q-73 to A-93; Q-73
to P-92; Q-73 to L-91; Q-73 to K-90; Q-73 to E-89; Q-73 to A-88;
Q-73 to H-87; Q-73 to H-86; Q-73 to G-85; Q-73 to Q-84; Q-73 to
L-83; Q-73 to E-82; Q-73 to A-81; Q-73 to R-80; and Q-73 to L-79 of
SEQ ID NO:2. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0187] The invention also provides polypeptides having one or more
amino acids deleted from both the amino and the carboxyl termini of
the predicted extracellular domain of Neutrokine-a, which may be
described generally as having residues n.sup.2-m.sup.2 of SEQ ID
NO:2 where n.sup.2 and m.sup.2 are integers as defined above.
[0188] In another embodiment, a nucleotide sequence encoding a
polypeptide consisting of a portion of the extracellular domain of
the Neutrokine-a amino acid sequence encoded by the cDNA clone
contained in the deposit having ATCC accession no. 97768, where
this portion excludes from 1 to about 206 amino acids from the
amino terminus of the extracellular domain of the amino acid
sequence encoded by the cDNA clone contained in the deposit having
ATCC accession no. 97768, or from 1 to about 206 amino acids from
the carboxy terminus of the extracellular domain of the amino acid
sequence encoded by the cDNA clone contained in the deposit having
ATCC accession no. 97768, or any combination of the above amino
terminal and carboxy terminal deletions, of the entire
extracellular domain of the amino acid sequence encoded by the cDNA
clone contained in the deposit having ATCC accession no. 97768.
[0189] As mentioned above, even if deletion of one or more amino
acids from the N-terminus of a polypeptide results in modification
of loss of one or more functional activities (e.g., biological
activity) of the polypeptide, other functions or biological
activities may still be retained. Thus, the ability of a shortened
Neutrokine-a mutein to induce and/or bind to antibodies which
recognize the full-length or mature forms or the extracellular
domain of the polypeptide generally will be retained when less than
the majority of the residues of the full-length or mature or
extracellular domain of the polypeptide are removed from the
N-terminus. Whether a particular polypeptide lacking N-terminal
residues of a complete polypeptide retains such immunologic
activities can readily be determined by routine methods described
herein and otherwise known in the art. It is not unlikely that a
Neutrokine-a mutein with a large number of deleted N-terminal amino
acid residues may retain some functional (e.g., biological or
immunogenic) activities. In fact, peptides composed of as few as
six Neutrokine-a amino acid residues may often evoke an immune
response.
[0190] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the amino
terminus of the predicted full-length amino acid sequence of the
Neutrokine-a shown in SEQ ID NO:2, up to the glycine residue at
position number 280 of the sequence shown SEQ ID NO:2 and
polynucleotides encoding such polypeptides. In particular, the
present invention provides polypeptides comprising the amino acid
sequence of residues n.sup.3-285 of the sequence shown in SEQ ID
NO:2, where n.sup.3 is an integer in the range of the amino acid
position of amino acid residues 1 to 280 of the amino acid sequence
in SEQ ID NO:2.
[0191] More in particular, the invention provides polynucleotides
encoding polypeptides comprising, or alternatively consisting of,
the amino acid sequence of residues of D-2 to L-285; D-3 to L-285;
S-4 to L-285; T-5 to L-285; E-6 to L-285; R-7 to L-285; E-8 to
L-285; Q-9 to L-285; S-10 to L-285; R-11 to L-285; L-12 to L-285;
T-13 to L-285; S-14 to L-285; C-15 to L-285; L-16 to L-285; K-17 to
L-285; K-18 to L-285; R-19 to L-285; E-20 to L-285; E-21 to L-285;
M-22 to L-285; K-23 to L-285; L-24 to L-285; K-25 to L-285; E-26 to
L-285; C-27 to L-285; V-28 to L-285; S-29 to L-285; 1-30 to L-285;
L-31 to L-285; P-32 to L-285; R-33 to L-285; K-34 to L-285; E-35 to
L-285; S-36 to L-285; P-37 to L-285; S-38 to L-285; V-39 to L-285;
R-40 to L-285; S-41 to L-285; S-42 to L-285; K-43 to L-285; D-44 to
L-285; G-45 to L-285; K-46 to L-285; L-47 to L-285; L-48 to L-285;
A-49 to L-285; A-50 to L-285; T-51 to L-285; L-52 to L-285; L-53 to
L-285; L-54 to L-285; A-55 to L-285; L-56 to L-285; L-57 to L-285;
S-58 to L-285; C-59 to L-285; C-60 to L-285; L-61 to L-285; T-62 to
L-285; V-63 to L-285; V-64 to L-285; S-65 to L-285; F-66 to L-285;
Y-67 to L-285; Q-68 to L-285; V-69 to L-285; A-70 to L-285; A-71 to
L-285; L-72 to L-285; Q-73 to L-285; G-74 to L-285; D-75 to L-285;
L-76 to L-285; A-77 to L-285; S-78 to L-285; L-79 to L-285; R-80 to
L-285; A-81 to L-285; E-82 to L-285; L-83 to L-285; Q-84 to L-285;
G-85 to L-285; H-86 to L-285; H-87 to L-285; A-88 to L-285; E-89 to
L-285; K-90 to L-285; L-91 to L-285; P-92 to L-285; A-93 to L-285;
G-94 to L-285; A-95 to L-285; G-96 to L-285; A-97 to L-285; P-98 to
L-285; K-99 to L-285; A-100 to L-285; G-101 to L-285; L-102 to
L-285; E-103 to L-285; E-104 to L-285; A-105 to L-285; P-106 to
L-285; A-107 to L-285; V-108 to L-285; T-109 to L-285; A-110 to
L-285; G-111 to L-285; L-112 to L-285; K-113 to L-285; 1-114 to
L-285; F-115 to L-285; E-116 to L-285; P-117 to L-285; P-118 to
L-285; A-119 to L-285; P-120 to L-285; G-121 to L-285; E-122 to
L-285; G-123 to L-285; N-124 to L-285; S-125 to L-285; S-126 to
L-285; Q-127 to L-285; N-128 to L-285; S-129 to L-285; R-130 to
L-285; N-131 to L-285; K-132 to L-285; R-133 to L-285; A-134 to
L-285; V-135 to L-285; Q-136 to L-285; G-137 to L-285; P-138 to
L-285; E-139 to L-285; E-140 to L-285; T-141 to L-285; V-142 to
L-285; T-143 to L-285; Q-144 to L-285; D-145 to L-285; C-146 to
L-285; L-147 to L-285; Q-148 to L-285; L-149 to L-285; 1-150 to
L-285; A-151 to L-285; D-152 to L-285; S-153 to L-285; E-154 to
L-285; T-155 to L-285; P-156 to L-285; T-157 to L-285; 1-158 to
L-285; Q-159 to L-285; K-160 to L-285; G-161 to L-285; S-162 to
L-285; Y-163 to L-285; T-164 to L-285; F-165 to L-285; V-166 to
L-285; P-167 to L-285; W-168 to L-285; L-169 to L-285; L-170 to
L-285; S-171 to L-285; F-172 to L-285; K-173 to L-285; R-174 to
L-285; G-175 to L-285; S-176 to L-285; A-177 to L-285; L-178 to
L-285; E-179 to L-285; E-180 to L-285; K-181 to L-285; E-182 to
L-285; N-183 to L-285; K-184 to L-285; 1-185 to L-285; L-186 to
L-285; V-187 to L-285; K-188 to L-285; E-189 to L-285; T-190 to
L-285; G-191 to L-285; Y-192 to L-285; F-193 to L-285; F-194 to
L-285; 1-195 to L-285; Y-196 to L-285; G-197 to L-285; Q-198 to
L-285; V-199 to L-285; L-200 to L-285; Y-201 to L-285; T-202 to
L-285; D-203 to L-285; K-204 to L-285; T-205 to L-285; Y-206 to
L-285; A-207 to L-285; M-208 to L-285; G-209 to L-285; H-210 to
L-285; L-211 to L-285; 1-212 to L-285; Q-213 to L-285; R-214 to
L-285; K-215 to L-285; K-216 to L-285; V-217 to L-285; H-218 to
L-285; V-219 to L-285; F-220 to L-285; G-221 to L-285; D-222 to
L-285; E-223 to L-285; L-224 to L-285; S-225 to L-285; L-226 to
L-285; V-227 to L-285; T-228 to L-285; L-229 to L-285; F-230 to
L-285; R-231 to L-285; C-232 to L-285; 1-233 to L-285; Q-234 to
L-285; N-235 to L-285; M-236 to L-285; P-237 to L-285; E-238 to
L-285; T-239 to L-285; L-240 to L-285; P-241 to L-285; N-242 to
L-285; N-243 to L-285; S-244 to L-285; C-245 to L-285; Y-246 to
L-285; S-247 to L-285; A-248 to L-285; G-249 to L-285; I-250 to
L-285; A-251 to L-285; K-252 to L-285; L-253 to L-285; E-254 to
L-285; E-255 to L-285; G-256 to L-285; D-257 to L-285; E-258 to
L-285; L-259 to L-285; Q-260 to L-285; L-261 to L-285; A-262 to
L-285; 1-263 to L-285; P-264 to L-285; R-265 to L-285; E-266 to
L-285; N-267 to L-285; A-268 to L-285; Q-269 to L-285; 1-270 to
L-285; S-271 to L-285; L-272 to L-285; D-273 to L-285; G-274 to
L-285; D-275 to L-285; V-276 to L-285; T-277 to L-285; F-278 to
L-285; F-279 to L-285; and G-280 to L-285 of SEQ ID NO:2.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0192] Also as mentioned above, even if deletion of one or more
amino acids from the C-terminus of a protein results in
modification of loss of one or more functional activities (e.g.,
biological activity) of the protein, other functional activities
may still be retained. Thus, the ability of a shortened
Neutrokine-a mutein to induce and/or bind to antibodies which
recognize the complete or mature form or the extracellular domain
of the polypeptide generally will be retained when less than the
majority of the residues of the complete or mature form or the
extracellular domain of the polypeptide are removed from the
C-terminus. Whether a particular polypeptide lacking C-terminal
residues of a complete polypeptide retains such immunologic
activities can readily be determined by routine methods described
herein and otherwise known in the art. It is not unlikely that a
Neutrokine-a mutein with a large number of deleted C-terminal amino
acid residues may retain some functional (e.g., biological or
immunogenic) activities. In fact, peptides composed of as few as
six Neutrokine-a amino acid residues may often evoke an immune
response.
[0193] Accordingly, the present invention further provides in
another embodiment, polypeptides having one or more residues
deleted from the carboxy terminus of the amino acid sequence of the
Neutrokine-a shown in SEQ ID NO:2, up to the glutamic acid residue
at position number 6, and polynucleotides encoding such
polypeptides. In particular, the present invention provides
polypeptides comprising the amino acid sequence of residues
1-m.sup.3 of SEQ ID NO:2, where m.sup.3 is an integer in the range
of the amino acid position of amino acid residues 6-284 of the
amino acid sequence in SEQ ID NO:2.
[0194] More in particular, the invention provides polynucleotides
encoding polypeptides comprising, or alternatively consisting of,
the amino acid sequence of residues M-1 to L-284; M-1 to K-283; M-1
to L-282; M-1 to A-281; M-1 to G-280; M-1 to F-279; M-1 to F-278;
M-1 to T-277; M-1 to V-276; M-1 to D-275; M-1 to G-274; M-1 to
D-273; M-1 to L-272; M-1 to S-271; M-1 to 1-270; M-1 to Q-269; M-1
to A-268; M-1 to N-267; M-1 to E-266; M-1 to R-265; M-1 to P-264;
M-1 to 1-263; M-1 to A-262; M-1 to L-261; M-1 to Q-260; M-1 to
L-259; M-1 to E-258; M-1 to D-257; M-1 to G-256; M-1 to E-255; M-1
to E-254; M-1 to L-253; M-1 to K-252; M-1 to A-251; M-1 to 1-250;
M-1 to G-249; M-1 to A-248; M-1 to S-247; M-1 to Y-246; M-1 to
C-245; M-1 to S-244; M-1 to N-243; M-1 to N-242; M-1 to P-241; M-1
to L-240; M-1 to T-239; M-1 to E-238; M-1 to P-237; M-1 to M-236;
M-1 to N-235; M-1 to Q-234; M-1 to I-233; M-1 to C-232; M-1 to
R-231; M-1 to F-230; M-1 to L-229; M-1 to T-228; M-1 to V-227; M-1
to L-226; M-1 to S-225; M-1 to L-224; M-1 to E-223; M-1 to D-222;
M-1 to G-221; M-1 to F-220; M-1 to V-219; M-1 to H-218; M-1 to
V-217; M-1 to K-216; M-1 to K-215; M-1 to R-214; M-1 to Q-213; M-1
to I-212; M-1 to L-211; M-1 to H-210; M-1 to G-209; M-1 to M-208;
M-1 to A-207; M-1 to Y-206; M-1 to T-205; M-1 to K-204; M-1 to
D-203; M-1 to T-202; M-1 to Y-201; M-1 to L-200; M-1 to V-199; M-1
to Q-198; M-1 to G-197; M-1 to Y-196; M-1 to I-195; M-1 to F-194;
M-1 to F-193; M-1 to Y-192; M-1 to G-191; M-1 to T-190; M-1 to
E-189; M-1 to K-188; M-1 to V-187; M-1 to L-186; M-1 to I-185; M-1
to K-184; M-1 to N-183; M-1 to E-182; M-1 to K-181; M-1 to E-180;
M-1 to E-179; M-1 to L-178; M-1 to A-177; M-1 to S-176; M-1 to
G-175; M-1 to R-174; M-1 to K-173; M-1 to F-172; M-1 to S-171; M-1
to L-170; M-1 to L-169; M-1 to W-168; M-1 to P-167; M-1 to V-166;
M-1 to F-165; M-1 to T-164; M-1 to Y-163; M-1 to S-162; M-1 to
G-161; M-1 to K-160; M-1 to Q-159; M-1 to I-158; M-1 to T-157; M-1
to P-156; M-1 to T-155; M-1 to E-154; M-1 to S-153; M-1 to D-152;
M-1 to A-151; M-1 to I-150; M-1 to L-149; M-1 to Q-148; M-1 to
L-147; M-1 to C-146; M-1 to D-145; M-1 to Q-144; M-1 to T-143; M-1
to V-142; M-1 to T-141; M-1 to E-140; M-1 to E-139; M-1 to P-138;
M-1 to G-137; M-1 to Q-136; M-1 to V-135; M-1 to A-134; M-1 to
R-133; M-1 to K-132; M-1 to N-131; M-1 to R-130; M-1 to S-129; M-1
to N-128; M-1 to Q-127; M-1 to S-126; M-1 to S-125; M-1 to N-124;
M-1 to G-123; M-1 to E-122; M-1 to G-121; M-1 to P-120; M-1 to
A-119; M-1 to P-118; M-1 to P-117; M-1 to E-116; M-1 to F-115; M-1
to I-114; M-1 to K-113; M-1 to L-112; M-1 to G-111; M-1 to A-110;
M-1 to T-109; M-1 to V-108; M-1 to A-107; M-1 to P-106; M-1 to
A-105; M-1 to E-104; M-1 to E-103; M-1 to L-102; M-1 to G-101; M-1
to A-100; M-1 to K-99; M-1 to P-98; M-1 to A-97; M-1 to G-96; M-1
to A-95; M-1 to G-94; M-1 to A-93; M-1 to P-92; M-1 to L-91; M-1 to
K-90; M-1 to E-89; M-1 to A-88; M-1 to H-87; M-1 to H-86; M-1 to
G-85; M-1 to Q-84; M-1 to L-83; M-1 to E-82; M-1 to A-81; M-1 to
R-80; M-1 to L-79; M-1 to S-78; M-1 to A-77; M-1 to L-76; M-1 to
D-75; M-1 to G-74; M-1 to Q-73; M-1 to L-72; M-1 to A-71; M-1 to
A-70; M-1 to V-69; M-1 to Q-68; M-1 to Y-67; M-1 to F-66; M-1 to
S-65; M-1 to V-64; M-1 to V-63; M-1 to T-62; M-1 to L-61; M-1 to
C-60; M-1 to C-59; M-1 to S-58; M-1 to L-57; M-1 to L-56; M-1 to
A-55; M-1 to L-54; M-1 to L-53; M-1 to L-52; M-1 to T-51; M-1 to
A-50; M-1 to A-49; M-1 to L-48; M-1 to L-47; M-1 to K-46; M-1 to
G-45; M-1 to D-44; M-1 to K-43; M-1 to S-42; M-1 to S-41; M-1 to
R-40; M-1 to V-39; M-1 to S-38; M-1 to P-37; M-1 to S-36; M-1 to
E-35; M-1 to K-34; M-1 to R-33; M-1 to P-32; M-1 to L-31; M-1 to
1-30; M-1 to S-29; M-1 to V-28; M-1 to C-27; M-1 to E-26; M-1 to
K-25; M-1 to L-24; M-1 to K-23; M-1 to M-22; M-1 to E-21; M-1 to
E-20; M-1 to R-19; M-1 to K-18; M-1 to K-17; M-1 to L-16; M-1 to
C-15; M-1 to S-14; M-1 to T-13; M-1 to L-12; M-1 to R-11; M-1 to
S-10; M-1 to Q-9; M-1 to E-8; M-1 to R-7; and M-1 to E-6 of SEQ ID
NO:2. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0195] The invention also provides polypeptides having one or more
amino acids deleted from both the amino and the carboxyl termini of
a Neutrokine-a polypeptide, which may be described generally as
having residues n.sup.3-m.sup.3 of SEQ ID NO:2, where n.sup.3 and
m.sup.3 are integers as defined above.
[0196] Furthermore, since the predicted extracellular domain of the
Neutrokine-aSV polypeptides of the invention may itself elicit
functional activity (e.g., biological activity), deletions of N-
and C-terminal amino acid residues from the predicted extracellular
region of the polypeptide at positions Gln-73 to Leu-266 of SEQ ID
NO:19 may retain some functional activity, such as, for example,
ligand binding, to stimulation of lymphocyte (e.g., B cell)
proliferation, differentiation, and/or activation, modulation of
cell replication, modulation of target cell activities and/or
immunogenicity. However, even if deletion of one or more amino
acids from the N-terminus of the predicted extracellular domain of
a Neutrokine-aSV polypeptide results in modification of loss of one
or more functional activities of the polypeptide, other functional
activities may still be retained. Thus, the ability of the
shortened polypeptides to induce and/or bind to antibodies which
recognize the complete or mature or extracellular domains of the
polypeptides generally will be retained when less than the majority
of the residues of the complete or mature or extracellular domains
of the polypeptides are removed from the N-terminus. Whether a
particular polypeptide lacking N-terminal residues of a complete
polypeptide retains such immunologic activities can readily be
determined by routine methods described herein and otherwise known
in the art.
[0197] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the amino
terminus of the amino acid sequence of Neutrokine-aSV shown in SEQ
ID NO:19, up to the glycine residue at position number 261, and
polynucleotides encoding such polypeptides. In particular, the
present invention provides polypeptides comprising the amino acid
sequence of residues n.sup.4-266 of SEQ ID NO:19, where n.sup.4 is
an integer in the range of the amino acid position of amino acid
residues 73-261 of the amino acid sequence in SEQ ID NO:19, and 261
is the position of the first residue from the N-terminus of the
predicted extracellular domain Neutrokine-aSV polypeptide (shown in
SEQ ID NO:19).
[0198] More in particular, in certain embodiments, the invention
provides polynucleotides encoding polypeptides comprising, or
alternatively consisting of, the amino acid sequence of residues of
Q-73 to L-266; G-74 to L-266; D-75 to L-266; L-76 to L-266; A-77 to
L-266; S-78 to L-266; L-79 to L-266; R-80 to L-266; A-81 to L-266;
E-82 to L-266; L-83 to L-266; Q-84 to L-266; G-85 to L-266; H-86 to
L-266; H-87 to L-266; A-88 to L-266; E-89 to L-266; K-90 to L-266;
L-91 to L-266; P-92 to L-266; A-93 to L-266; G-94 to L-266; A-95 to
L-266; G-96 to L-266; A-97 to L-266; P-98 to L-266; K-99 to L-266;
A-100 to L-266; G-101 to L-266; L-102 to L-266; E-103 to L-266;
E-104 to L-266; A-105 to L-266; P-106 to L-266; A-107 to L-266;
V-108 to L-266; T-109 to L-266; A-110 to L-266; G-111 to L-266;
L-112 to L-266; K-113 to L-266; I-114 to L-266; F-115 to L-266;
E-116 to L-266; P-117 to L-266; P-118 to L-266; A-119 to L-266;
P-120 to L-266; G-121 to L-266; E-122 to L-266; G-123 to L-266;
N-124 to L-266; S-125 to L-266; S-126 to L-266; Q-127 to L-266;
N-128 to L-266; S-129 to L-266; R-130 to L-266; N-131 to L-266;
K-132 to L-266; R-133 to L-266; A-134 to L-266; V-135 to L-266;
Q-136 to L-266; G-137 to L-266; P-138 to L-266; E-139 to L-266;
E-140 to L-266; T-141 to L-266; G-142 to L-266; S-143 to L-266;
Y-144 to L-266; T-145 to L-266; F-146 to L-266; V-147 to L-266;
P-148 to L-266; W-149 to L-266; L-150 to L-266; L-151 to L-266;
S-152 to L-266; F-153 to L-266; K-154 to L-266; R-155 to L-266;
G-156 to L-266; S-157 to L-266; A-158 to L-266; L-159 to L-266;
E-160 to L-266; E-161 to L-266; K-162 to L-266; E-163 to L-266;
N-164 to L-266; K-165 to L-266; I-166 to L-266; L-167 to L-266;
V-168 to L-266; K-169 to L-266; E-170 to L-266; T-171 to L-266;
G-172 to L-266; Y-173 to L-266; F-174 to L-266; F-175 to L-266;
1-176 to L-266; Y-177 to L-266; G-178 to L-266; Q-179 to L-266;
V-180 to L-266; L-181 to L-266; Y-182 to L-266; T-183 to L-266;
D-184 to L-266; K-185 to L-266; T-186 to L-266; Y-187 to L-266;
A-188 to L-266; M-189 to L-266; G-190 to L-266; H-191 to L-266;
L-192 to L-266; I-193 to L-266; Q-194 to L-266; R-195 to L-266;
K-196 to L-266; K-197 to L-266; V-198 to L-266; H-199 to L-266;
V-200 to L-266; F-201 to L-266; G-202 to L-266; D-203 to L-266;
E-204 to L-266; L-205 to L-266; S-206 to L-266; L-207 to L-266;
V-208 to L-266; T-209 to L-266; L-210 to L-266; F-211 to L-266;
R-212 to L-266; C-213 to L-266; 1-214 to L-266; Q-215 to L-266;
N-216 to L-266; M-217 to L-266; P-218 to L-266; E-219 to L-266;
T-220 to L-266; L-221 to L-266; P-222 to L-266; N-223 to L-266;
N-224 to L-266; S-225 to L-266; C-226 to L-266; Y-227 to L-266;
S-228 to L-266; A-229 to L-266; G-230 to L-266; 1-231 to L-266;
A-232 to L-266; K-233 to L-266; L-234 to L-266; E-235 to L-266;
E-236 to L-266; G-237 to L-266; D-238 to L-266; E-239 to L-266;
L-240 to L-266; Q-241 to L-266; L-242 to L-266; A-243 to L-266;
1-244 to L-266; P-245 to L-266; R-246 to L-266; E-247 to L-266;
N-248 to L-266; A-249 to L-266; Q-250 to L-266; 1-251 to L-266;
S-252 to L-266; L-253 to L-266; D-254 to L-266; G-255 to L-266;
D-256 to L-266; V-257 to L-266; T-258 to L-266; F-259 to L-266;
F-260 to L-266; and G-261 to L-266 of SEQ ID NO:19. Polynucleotides
encoding these polypeptides are also encompassed by the
invention.
[0199] Similarly, deletions of C-terminal amino acid residues of
the predicted extracellular domain of Neutrokine-aSV up to the
leucine residue at position 79 of SEQ ID NO:19 may retain some
functional activity, such as, for example, ligand binding, the
ability to stimulate lymphocyte (e.g., B cell) proliferation,
differentiation, and/or activation, modulation of cell replication,
modulation of target cell activities and/or immunogenicity.
Polypeptides having further C-terminal deletions including Leu-79
of SEQ ID NO:19 would not be expected to retain biological
activities.
[0200] However, even if deletion of one or more amino acids from
the C-terminus of a polypeptide results in modification of loss of
one or more functional activities (e.g., biological activity) of
the polypeptide, other functional activities may still be retained.
Thus, the ability of the shortened polypeptide to induce and/or
bind to antibodies which recognize the complete, mature or
extracellular forms of the polypeptide generally will be retained
when less than the majority of the residues of the complete, mature
or extracellular forms of the polypeptide are removed from the
C-terminus. Whether a particular polypeptide lacking C-terminal
residues of the predicted extracellular domain retains such
immunologic activities can readily be determined by routine methods
described herein and otherwise known in the art.
[0201] Accordingly, the present invention further provides
polypeptides having one or more residues from the carboxy terminus
of the amino acid sequence of the predicted extracellular domain of
Neutrokine-aSV shown in SEQ ID NO:19, up to the leucine residue at
position 79 of SEQ ID NO:19, and polynucleotides encoding such
polypeptides. In particular, the present invention provides
polypeptides having the amino acid sequence of residues 73-m.sup.4
of the amino acid sequence in SEQ ID NO:19, where m.sup.4 is any
integer in the range of the amino acid position of amino acid
residues 79-266 of the amino acid sequence in SEQ ID NO:19.
[0202] More in particular, in certain embodiments, the invention
provides polynucleotides encoding polypeptides comprising, or
alternatively consisting of, the amino acid sequence of residues
Q-73 to L-265; Q-73 to K-264; Q-73 to L-263; Q-73 to A-262; Q-73 to
G-261; Q-73 to F-260; Q-73 to F-259; Q-73 to T-258; Q-73 to V-257;
Q-73 to D-256; Q-73 to G-255; Q-73 to D-254; Q-73 to L-253; Q-73 to
S-252; Q-73 to 1-251; Q-73 to Q-250; Q-73 to A-249; Q-73 to N-248;
Q-73 to E-247; Q-73 to R-246; Q-73 to P-245; Q-73 to 1-244; Q-73 to
A-243; Q-73 to L-242; Q-73 to Q-241; Q-73 to L-240; Q-73 to E-239;
Q-73 to D-238; Q-73 to G-237; Q-73 to E-236; Q-73 to E-235; Q-73 to
L-234; Q-73 to K-233; Q-73 to A-232; Q-73 to 1-231; Q-73 to G-230;
Q-73 to A-229; Q-73 to S-228; Q-73 to Y-227; Q-73 to C-226; Q-73 to
S-225; Q-73 to N-224; Q-73 to N-223; Q-73 to P-222; Q-73 to L-221;
Q-73 to T-220; Q-73 to E-219; Q-73 to P-218; Q-73 to M-217; Q-73 to
N-216; Q-73 to Q-215; Q-73 to 1-214; Q-73 to C-213; Q-73 to R-212;
Q-73 to F-211; Q-73 to L-210; Q-73 to T-209; Q-73 to V-208; Q-73 to
L-207; Q-73 to S-206; Q-73 to L-205; Q-73 to E-204; Q-73 to D-203;
Q-73 to G-202; Q-73 to F-201; Q-73 to V-200; Q-73 to H-199; Q-73 to
V-198; Q-73 to K-197; Q-73 to K-196; Q-73 to R-195; Q-73 to Q-194;
Q-73 to 1-193; Q-73 to L-192; Q-73 to H-191; Q-73 to G-190; Q-73 to
Q-7389; Q-73 to A-188; Q-73 to Y-187; Q-73 to T-186; Q-73 to K-185;
Q-73 to D-184; Q-73 to T-183; Q-73 to Y-182; Q-73 to L-181; Q-73 to
V-180; Q-73 to Q-179; Q-73 to G-178; Q-73 to Y-177; Q-73 to I-176;
Q-73 to F-175; Q-73 to F-174; Q-73 to Y-173; Q-73 to G-172; Q-73 to
T-171; Q-73 to E-170; Q-73 to K-169; Q-73 to V-168; Q-73 to L-167;
Q-73 to 1-166; Q-73 to K-165; Q-73 to N-164; Q-73 to E-163; Q-73 to
K-162; Q-73 to E-161; Q-73 to E-160; Q-73 to L-159; Q-73 to A-158;
Q-73 to S-157; Q-73 to G-156; Q-73 to R-155; Q-73 to K-154; Q-73 to
F-153; Q-73 to S-152; Q-73 to L-151; Q-73 to L-150; Q-73 to W-149;
Q-73 to P-148; Q-73 to V-147; Q-73 to F-146; Q-73 to T-145; Q-73 to
Y-144; Q-73 to S-143; Q-73 to G-142; Q-73 to T-141; Q-73 to E-140;
Q-73 to E-139; Q-73 to P-138; Q-73 to G-137; Q-73 to Q-136; Q-73 to
V-135; Q-73 to A-134; Q-73 to R-133; Q-73 to K-132; Q-73 to N-131;
Q-73 to R-130; Q-73 to S-129; Q-73 to N-128; Q-73 to Q-127; Q-73 to
S-126; Q-73 to S-125; Q-73 to N-124; Q-73 to G-123; Q-73 to E-122;
Q-73 to G-121; Q-73 to P-120; Q-73 to A-19; Q-73 to P-118; Q-73 to
P-117; Q-73 to E-116; Q-73 to F-115; Q-73 to I-114; Q-73 to K-113;
Q-73 to L-112; Q-73 to G-111; Q-73 to A-110; Q-73 to T-109; Q-73 to
V-108; Q-73 to A-107; Q-73 to P-106; Q-73 to A-105; Q-73 to E-104;
Q-73 to E-103; Q-73 to L-102; Q-73 to G-101; Q-73 to A-100; Q-73 to
K-99; Q-73 to P-98; Q-73 to A-97; Q-73 to G-96; Q-73 to A-95; Q-73
to G-94; Q-73 to A-93; Q-73 to P-92; Q-73 to L-91; Q-73 to K-90;
Q-73 to E-89; Q-73 to A-88; Q-73 to H-87; Q-73 to H-86; Q-73 to
G-85; Q-73 to Q-84; Q-73 to L-83; Q-73 to E-82; Q-73 to A-81; Q-73
to R-80; Q-73 to L-79; and Q-73 to S-78 of SEQ ID NO:19.
Polynucleotides encoding these polypeptides are also encompassed by
the invention.
[0203] The invention also provides polypeptides having one or more
amino acids deleted from both the amino and the carboxyl termini of
the predicted extracellular domain of Neutrokine-aSV, which may be
described generally as having residues n.sup.4-m.sup.4 of SEQ ID
NO:19 where n.sup.4 and m.sup.4 are integers as defined above.
[0204] In another embodiment, a nucleotide sequence encoding a
polypeptide consisting of a portion of the extracellular domain of
the Neutrokine-aSV amino acid sequence encoded by the cDNA clone
contained in the deposit having ATCC Accession No. 203518, where
this portion excludes from 1 to about 260 amino acids from the
amino terminus of the extracellular domain of the amino acid
sequence encoded by cDNA clone contained in the deposit having ATCC
Accession No. 203518, or from 1 to about 187 amino acids from the
carboxy terminus of the extracellular domain of the amino acid
sequence encoded by cDNA clone contained in the deposit having ATCC
Accession No. 203518, or any combination of the above amino
terminal and carboxy terminal deletions, of the entire
extracellular domain of the amino acid sequence encoded by the cDNA
clone contained in the deposit having ATCC Accession No.
203518.
[0205] As mentioned above, even if deletion of one or more amino
acids from the N-terminus of a polypeptide results in modification
of loss of one or more functional activities (e.g., biological
activity) of the polypeptide, other functional activities may still
be retained. Thus, the ability of a shortened Neutrokine-aSV mutein
to induce and/or bind to antibodies which recognize the full-length
or mature forms or the extracellular domain of the polypeptide
generally will be retained when less than the majority of the
residues of the full-length or mature or extracellular domain of
the polypeptide are removed from the N-terminus. Whether a
particular polypeptide lacking N-terminal residues of a complete
polypeptide retains such immunologic activities can readily be
determined by routine methods described herein and otherwise known
in the art. It is not unlikely that a Neutrokine-aSV mutein with a
large number of deleted N-terminal amino acid residues may retain
functional (e.g., immunogenic) activities. In fact, peptides
composed of as few as six Neutrokine-aSV amino acid residues may
often evoke an immune response.
[0206] Accordingly, the present invention further provides
polypeptides having one or more residues deleted from the amino
terminus of the predicted full-length amino acid sequence of the
Neutrokine-aSV shown in SEQ ID NO:19, up to the glycine residue at
position number 261 of the sequence shown SEQ ID NO:19 and
polynucleotides encoding such polypeptides. In particular, the
present invention provides polypeptides comprising the amino acid
sequence of residues n.sup.5-266 of the sequence shown in SEQ ID
NO:19, where n.sup.5 is an integer in the range of the amino acid
position of amino acid residues 1 to 261 of the amino acid sequence
in SEQ ID NO:19.
[0207] More in particular, the invention provides polynucleotides
encoding polypeptides comprising, or alternatively consisting of,
the amino acid sequence of residues of D-2 to L-266; D-3 to L-266;
S-4 to L-266; T-5 to L-266; E-6 to L-266; R-7 to L-266; E-8 to
L-266; Q-9 to L-266; S-10 to L-266; R-11 to L-266; L-12 to L-266;
T-13 to L-266; S-14 to L-266; C-15 to L-266; L-16 to L-266; K-17 to
L-266; K-18 to L-266; R-19 to L-266; E-20 to L-266; E-21 to L-266;
M-22 to L-266; K-23 to L-266; L-24 to L-266; K-25 to L-266; E-26 to
L-266; C-27 to L-266; V-28 to L-266; S-29 to L-266; 1-30 to L-266;
L-31 to L-266; P-32 to L-266; R-33 to L-266; K-34 to L-266; E-35 to
L-266; S-36 to L-266; P-37 to L-266; S-38 to L-266; V-39 to L-266;
R-40 to L-266; S-41 to L-266; S-42 to L-266; K-43 to L-266; D-44 to
L-266; G-45 to L-266; K-46 to L-266; L-47 to L-266; L-48 to L-266;
A-49 to L-266; A-50 to L-266; T-51 to L-266; L-52 to L-266; L-53 to
L-266; L-54 to L-266; A-55 to L-266; L-56 to L-266; L-57 to L-266;
S-58 to L-266; C-59 to L-266; C-60 to L-266; L-61 to L-266; T-62 to
L-266; V-63 to L-266; V-64 to L-266; S-65 to L-266; F-66 to L-266;
Y-67 to L-266; Q-68 to L-266; V-69 to L-266; A-70 to L-266; A-71 to
L-266; L-72 to L-266; Q-73 to L-266; G-74 to L-266; D-75 to L-266;
L-76 to L-266; A-77 to L-266; S-78 to L-266; L-79 to L-266; R-80 to
L-266; A-81 to L-266; E-82 to L-266; L-83 to L-266; Q-84 to L-266;
G-85 to L-266; H-86 to L-266; H-87 to L-266; A-88 to L-266; E-89 to
L-266; K-90 to L-266; L-91 to L-266; P-92 to L-266; A-93 to L-266;
G-94 to L-266; A-95 to L-266; G-96 to L-266; A-97 to L-266; P-98 to
L-266; K-99 to L-266; A-100 to L-266; G-101 to L-266; L-102 to
L-266; E-103 to L-266; E-104 to L-266; A-105 to L-266; P-106 to
L-266; A-107 to L-266; V-108 to L-266; T-109 to L-266; A-110 to
L-266; G-111 to L-266; L-112 to L-266; K-113 to L-266; 1-114 to
L-266; F-115 to L-266; E-116 to L-266; P-117 to L-266; P-118 to
L-266; A-119 to L-266; P-120 to L-266; G-121 to L-266; E-122 to
L-266; G-123 to L-266; N-124 to L-266; S-125 to L-266; S-126 to
L-266; Q-127 to L-266; N-128 to L-266; S-129 to L-266; R-130 to
L-266; N-131 to L-266; K-132 to L-266; R-133 to L-266; A-134 to
L-266; V-135 to L-266; Q-136 to L-266; G-137 to L-266; P-138 to
L-266; E-139 to L-266; E-140 to L-266; T-141 to L-266; G-142 to
L-266; S-143 to L-266; Y-144 to L-266; T-145 to L-266; F-146 to
L-266; V-147 to L-266; P-148 to L-266; W-149 to L-266; L-150 to
L-266; L-151 to L-266; S-152 to L-266; F-153 to L-266; K-154 to
L-266; R-155 to L-266; G-156 to L-266; S-157 to L-266; A-158 to
L-266; L-159 to L-266; E-160 to L-266; E-161 to L-266; K-162 to
L-266; E-163 to L-266; N-164 to L-266; K-165 to L-266; 1-166 to
L-266; L-167 to L-266; V-168 to L-266; K-169 to L-266; E-170 to
L-266; T-171 to L-266; G-172 to L-266; Y-173 to L-266; F-174 to
L-266; F-175 to L-266; 1-176 to L-266; Y-177 to L-266; G-178 to
L-266; Q-179 to L-266; V-180 to L-266; L-181 to L-266; Y-182 to
L-266; T-183 to L-266; D-184 to L-266; K-185 to L-266; T-186 to
L-266; Y-187 to L-266; A-188 to L-266; M-189 to L-266; G-190 to
L-266; H-191 to L-266; L-192 to L-266; I-193 to L-266; Q-194 to
L-266; R-195 to L-266; K-196 to L-266; K-197 to L-266; V-198 to
L-266; H-199 to L-266; V-200 to L-266; F-201 to L-266; G-202 to
L-266; D-203 to L-266; E-204 to L-266; L-205 to L-266; S-206 to
L-266; L-207 to L-266; V-208 to L-266; T-209 to L-266; L-210 to
L-266; F-211 to L-266; R-212 to L-266; C-213 to L-266; 1-214 to
L-266; Q-215 to L-266; N-216 to L-266; M-217 to L-266; P-218 to
L-266; E-219 to L-266; T-220 to L-266; L-221 to L-266; P-222 to
L-266; N-223 to L-266; N-224 to L-266; S-225 to L-266; C-226 to
L-266; Y-227 to L-266; S-228 to L-266; A-229 to L-266; G-230 to
L-266; 1-231 to L-266; A-232 to L-266; K-233 to L-266; L-234 to
L-266; E-235 to L-266; E-236 to L-266; G-237 to L-266; D-238 to
L-266; E-239 to L-266; L-240 to L-266; Q-241 to L-266; L-242 to
L-266; A-243 to L-266; 1-244 to L-266; P-245 to L-266; R-246 to
L-266; E-247 to L-266; N-248 to L-266; A-249 to L-266; Q-250 to
L-266; 1-251 to L-266; S-252 to L-266; L-253 to L-266; D-254 to
L-266; G-255 to L-266; D-256 to L-266; V-257 to L-266; T-258 to
L-266; F-259 to L-266; F-260 to L-266; and G-261 to L-266 of SEQ ID
NO:19. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0208] Also as mentioned above, even if deletion of one or more
amino acids from the C-terminus of a protein results in
modification of loss of one or more functional activities (e.g.,
biological activities) of the protein, other functional activities
may still be retained. Thus, the ability of a shortened
Neutrokine-aSV mutein to induce and/or bind to antibodies which
recognize the complete or mature form or the extracellular domain
of the polypeptide generally will be retained when less than the
majority of the residues of the complete or mature form or the
extracellular domain of the polypeptide are removed from the
C-terminus. Whether a particular polypeptide lacking C-terminal
residues of a complete polypeptide retains such immunologic
activities can readily be determined by routine methods described
herein and otherwise known in the art. It is not unlikely that a
Neutrokine-aSV mutein with a large number of deleted C-terminal
amino acid residues may retain some functional (e.g., immunogenic)
activities. In fact, peptides composed of as few as six
Neutrokine-aSV amino acid residues may often evoke an immune
response.
[0209] Accordingly, the present invention further provides in
another embodiment, polypeptides having one or more residues
deleted from the carboxy terminus of the amino acid sequence of the
Neutrokine-aSV shown in SEQ ID NO:19, up to the glutamic acid
residue at position number 6, and polynucleotides encoding such
polypeptides. In particular, the present invention provides
polypeptides comprising the amino acid sequence of residues
1-m.sup.5 of SEQ ID NO:19, where m.sup.5 is an integer in the range
of the amino acid position of amino acid residues 6 to 265 in the
amino acid sequence of SEQ ID NO:19.
[0210] More in particular, the invention provides polynucleotides
encoding polypeptides comprising, or alternatively consisting of,
the amino acid sequence of residues M-1 to L-265; M-1 to K-264; M-1
to L-263; M-1 to A-262; M-1 to G-261; M-1 to F-260; M-1 to F-259;
M-1 to T-258; M-1 to V-257; M-1 to D-256; M-1 to G-255; M-1 to
D-254; M-1 to L-253; M-1 to S-252; M-1 to 1-251; M-1 to Q-250; M-1
to A-249; M-1 to N-248; M-1 to E-247; M-1 to R-246; M-1 to P-245;
M-1 to 1-244; M-1 to A-243; M-1 to L-242; M-1 to Q-241; M-1 to
L-240; M-1 to E-239; M-1 to D-238; M-1 to G-237; M-1 to E-236; M-1
to E-235; M-1 to L-234; M-1 to K-233; M-1 to A-232; M-1 to 1-231;
M-1 to G-230; M-1 to A-229; M-1 to S-228; M-1 to Y-227; M-1 to
C-226; M-1 to S-225; M-1 to N-224; M-1 to N-223; M-1 to P-222; M-1
to L-221; M-1 to T-220; M-1 to E-219; M-1 to P-218; M-1 to M-217;
M-1 to N-216; M-1 to Q-215; M-1 to 1-214; M-1 to C-213; M-1 to
R-212; M-1 to F-211; M-1 to L-210; M-1 to T-209; M-1 to V-208; M-1
to L-207; M-1 to S-206; M-1 to L-205; M-1 to E-204; M-1 to D-203;
M-1 to G-202; M-1 to F-201; M-1 to V-200; M-1 to H-199; M-1 to
V-198; M-1 to K-197; M-1 to K-196; M-1 to R-195; M-1 to Q-194; M-1
to I-193; M-1 to L-192; M-1 to H-191; M-1 to G-190; M-1 to M-189;
M-1 to A-188; M-1 to Y-187; M-1 to T-186; M-1 to K-185; M-1 to
D-184; M-1 to T-183; M-1 to Y-182; M-1 to L-181; M-1 to V-180; M-1
to Q-179; M-1 to G-178; M-1 to Y-177; M-1 to 1-176; M-1 to F-175;
M-1 to F-174; M-1 to Y-173; M-1 to G-172; M-1 to T-171; M-1 to
E-170; M-1 to K-169; M-1 to V-168; M-1 to L-167; M-1 to 1-166; M-1
to K-165; M-1 to N-164; M-1 to E-163; M-1 to K-162; M-1 to E-161;
M-1 to E-160; M-1 to L-159; M-1 to A-158; M-1 to S-157; M-1 to
G-156; M-1 to R-155; M-1 to K-154; M-1 to F-153; M-1 to S-152; M-1
to L-151; M-1 to L-150; M-1 to W-149; M-1 to P-148; M-1 to V-147;
M-1 to F-146; M-1 to T-145; M-1 to Y-144; M-1 to S-143; M-1 to
G-142; M-1 to T-141; M-1 to E-140; M-1 to E-139; M-1 to P-138; M-1
to G-137; M-1 to Q-136; M-1 to V-135; M-1 to A-134; M-1 to R-133;
M-1 to K-132; M-1 to N-131; M-1 to R-130; M-1 to S-129; M-1 to
N-128; M-1 to Q-127; M-1 to S-126; M-1 to S-125; M-1 to N-124; M-1
to G-123; M-1 to E-122; M-1 to G-121; M-1 to P-120; M-1 to A-119;
M-1 to P-118; M-1 to P-117; M-1 to E-116; M-1 to F-115; M-1 to
I-114; M-1 to K-113; M-1 to L-112; M-1 to G-111; M-1 to A-110; M-1
to T-109; M-1 to V-108; M-1 to A-107; M-1 to P-106; M-1 to A-105;
M-1 to E-104; M-1 to E-103; M-1 to L-102; M-1 to G-101; M-1 to
A-100; M-1 to K-99; M-1 to P-98; M-1 to A-97; M-1 to G-96; M-1 to
A-95; M-1 to G-94; M-1 to A-93; M-1 to P-92; M-1 to L-91; M-1 to
K-90; M-1 to E-89; M-1 to A-88; M-1 to H-87; M-1 to H-86; M-1 to
G-85; M-1 to Q-84; M-1 to L-83; M-1 to E-82; M-1 to A-81; M-1 to
R-80; M-1 to L-79; M-1 to S-78; M-1 to A-77; M-1 to L-76; M-1 to
D-75; M-1 to G-74; M-1 to Q-73; M-1 to L-72; M-1 to A-71; M-1 to
A-70; M-1 to V-69; M-1 to Q-68; M-1 to Y-67; M-1 to F-66; M-1 to
S-65; M-1 to V-64; M-1 to V-63; M-1 to T-62; M-1 to L-61; M-1 to
C-60; M-1 to C-59; M-1 to S-58; M-1 to L-57; M-1 to L-56; M-1 to
A-55; M-1 to L-54; M-1 to L-53; M-1 to L-52; M-1 to T-51; M-1 to
A-50; M-1 to A-49; M-1 to L-48; M-1 to L-47; M-1 to K-46; M-1 to
G-45; M-1 to D-44; M-1 to K-43; M-1 to S-42; M-1 to S-41; M-1 to
R-40; M-1 to V-39; M-1 to S-38; M-1 to P-37; M-1 to S-36; M-1 to
E-35; M-1 to K-34; M-1 to R-33; M-1 to P-32; M-1 to L-31; M-1 to
1-30; M-1 to S-29; M-1 to V-28; M-1 to C-27; M-1 to E-26; M-1 to
K-25; M-1 to L-24; M-1 to K-23; M-1 to M-22; M-1 to E-21; M-1 to
E-20; M-1 to R-19; M-1 to K-18; M-1 to K-17; M-1 to L-16; M-1 to
C-15; M-1 to S-14; M-1 to T-13; M-1 to L-12; M-1 to R-11; M-1 to
S-10; M-1 to Q-9; M-1 to E-8; M-1 to R-7; and M-1 to E-6 of SEQ ID
NO:19. Polynucleotides encoding these polypeptides are also
encompassed by the invention.
[0211] The invention also provides polypeptides having one or more
amino acids deleted from both the amino and the carboxyl termini of
a Neutrokine-aSV polypeptide, which may be described generally as
having residues n.sup.5-m.sup.5 of SEQ ID NO:19, where n.sup.5 and
m.sup.5 are integers as defined above.
[0212] Other Mutants
[0213] It will be recognized by one of ordinary skill in the art
that some amino acid sequences of the Neutrokine-.alpha. and
Neutrokine-.alpha.SV polypeptides can be varied without significant
effect of the structure or function of the polypeptide. If such
differences in sequence are contemplated, it should be remembered
that there will be critical areas on the polypeptide which
determine activity.
[0214] Thus, the invention further includes variations of the
Neutrokine-.alpha. polypeptide which show substantial
Neutrokine-.alpha. polypeptide functional activity (e.g.,
biological activity) or which include regions of Neutrokine-.alpha.
polypeptide such as the protein portions discussed below. The
invention also includes variations of the Neutrokine-.alpha.SV
polypeptide which show substantial Neutrokine-.alpha.SV polypeptide
functional activity (e.g., biological activity) or which include
regions of Neutrokine-.alpha.SV polypeptide such as the polypeptide
portions discussed below. Such mutants include deletions,
insertions, inversions, repeats, and type substitutions selected
according to general rules known in the art so as have little
effect on activity. For example, guidance concerning how to make
phenotypically silent amino acid substitutions is provided in
Bowie, J. U. et al., "Deciphering the Message in Protein Sequences:
Tolerance to Amino Acid Substitutions," Science 247:1306-1310
(1990), wherein the authors indicate that there are two main
approaches for studying the tolerance of an amino acid sequence to
change. The first method relies on the process of evolution, in
which mutations are either accepted or rejected by natural
selection. The second approach uses genetic engineering to
introduce amino acid changes at specific positions of a cloned gene
and selections or screens to identify sequences that maintain
functionality.
[0215] As the authors state, these studies have revealed that
proteins are surprisingly tolerant of amino acid substitutions. The
authors further indicate which amino acid changes are likely to be
permissive at a certain position of the protein. For example, most
buried amino acid residues require nonpolar side chains, whereas
few features of surface side chains are generally conserved. Other
such phenotypically silent substitutions are described in Bowie, J.
U. et al., supra, and the references cited therein. Typically seen
as conservative substitutions are the replacements, one for
another, among the aliphatic amino acids Ala, Val, Leu and Ile;
interchange of the hydroxyl residues Ser and Thr, exchange of the
acidic residues Asp and Glu, substitution between the amide
residues Asn and Gln, exchange of the basic residues Lys and Arg
and replacements among the aromatic residues Phe, Tyr.
[0216] Thus, the fragment, derivative or analog of the polypeptide
of FIGS. 1A and 1B (SEQ ID NO:2), or that encoded by the deposited
cDNA, may be (i) one in which one or more of the amino acid
residues are substituted with a conserved or non-conserved amino
acid residue (preferably a conserved amino acid residue) and such
substituted amino acid residue may or may not be one encoded by the
genetic code, or (ii) one in which one or more of the amino acid
residues includes a substituent group, or (iii) one in which the
extracellular domain of the polypeptide is fused with another
compound, such as a compound to increase the half-life of the
polypeptide (for example, polyethylene glycol), or (iv) one in
which the additional amino acids are fused to the extracellular
domain of the polypeptide, such as an IgG Fc fusion region peptide
or leader or secretory sequence or a sequence which is employed for
purification of the extracellular domain of the polypeptide or a
proprotein sequence. Such fragments, derivatives and analogs are
deemed to be within the scope of those skilled in the art from the
teachings herein
[0217] Furthermore, the fragment, derivative or analog of the
polypeptide of FIGS. 5A and 5B (SEQ ID NO:19), or that encoded by
the deposited cDNA, may be (i) one in which one or more of the
amino acid residues are substituted with a conserved or
non-conserved amino acid residue (preferably a conserved amino acid
residue) and such substituted amino acid residue may or may not be
one encoded by the genetic code, or (ii) one in which one or more
of the amino acid residues includes a substituent group, or (iii)
one in which the extracellular domain of the polypeptide is fused
with another compound, such as a compound to increase the half-life
of the polypeptide (for example, polyethylene glycol), or (iv) one
in which the additional amino acids are fused to the extracellular
domain of the polypeptide, such as an IgG Fc fusion region peptide
or leader or secretory sequence or a sequence which is employed for
purification of the extracellular domain of the polypeptide or a
proprotein sequence. Such fragments, derivatives and analogs are
deemed to be within the scope of those skilled in the art from the
teachings herein
[0218] Thus, the Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptides of the present invention may include one or more amino
acid substitutions, deletions or additions, either from natural
mutations or human manipulation. As indicated, changes are
preferably of a minor nature, such as conservative amino acid
substitutions that do not significantly affect the folding or
activity of the protein (see Table II).
2TABLE II Conservative Amino Acid Substitutions. Aromatic
Phenylalanine Tryptophan Tyrosine Hydrophobic Leucine Isoleucine
Valine Polar Glutamine Asparagine Basic Arginine Lysine Histidine
Acidic Aspartic Acid Glutamic Acid Small Alanine Serine Threonine
Methionine Glycine
[0219] Amino acids in the Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptides of the present invention that are
essential for function can be identified by methods known in the
art, such as site-directed mutagenesis or alanine-scanning
mutagenesis (Cunningham and Wells, Science 244:1081-1085 (1989)).
The latter procedure introduces single alanine mutations at every
residue in the molecule. The resulting mutant molecules are then
tested for functional activity, such ligand binding and the ability
to stimulate lymphocyte (e.g., B cell) as, for example,
proliferation, differentiation, and/or activation.
[0220] Of special interest are substitutions of charged amino acids
with other charged or neutral amino acids which may produce
proteins with highly desirable improved characteristics, such as
less aggregation. Aggregation may not only reduce activity but also
be problematic when preparing pharmaceutical formulations, because
aggregates can be immunogenic (Pinckard et al., Clin. Exp. Immunol.
2:331-340 (1967); Robbins et al., Diabetes 36: 838-845 (1987);
Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems
10:307-377 (1993).
[0221] Replacement of amino acids can also change the selectivity
of the binding of a ligand to cell surface receptors. For example,
Ostade et al., Nature 361:266-268 (1993) describes certain
mutations resulting in selective binding of TNF-a to only one of
the two known types of TNF receptors. Since Neutrokine-.alpha. and
Neutrokine-.alpha.SV is members of the TNF polypeptide family,
mutations similar to those in TNF-.alpha. are likely to have
similar effects in Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV.
[0222] Sites that are critical for ligand-receptor binding can also
be determined by structural analysis such as crystallization,
nuclear magnetic resonance or photoaffinity labeling (Smith et al.,
J. Mol. Biol. 224:899-904 (1992) and de Vos et al. Science
255:306-312 (1992)). Since Neutrokine-.alpha. is a member of the
TNF-related protein family, to modulate rather than completely
eliminate functional activities (e.g., biological activities) of
Neutrokine-.alpha., preferably mutations are made in sequences
encoding amino acids in the TNF conserved domain, i.e., in
positions Gly-191 through Leu-284 of FIGS. 1A and 1B (SEQ ID NO:2),
more preferably in residues within this region which are not
conserved in all members of the TGF family. By making a specific
mutation in Neutrokine-.alpha. in the position where such a
conserved amino acid is typically found in related TNFs,
Neutrokine-.alpha. will act as an antagonist, thus possessing
activity for example, which inhibits lymphocyte (e.g., B cell)
proliferation, differentiation, and/or activation. Accordingly,
polypeptides of the present invention include Neutrokine-.alpha.
mutants. Such Neutrokine-.alpha. mutants are comprised of the
full-length or preferably the extracellular domain of the
Neutrokine-.alpha. amino acid sequence shown in FIGS. 1A and 1B
(SEQ ID NO:2). Polynucleotides encode the above Neutrokine-.alpha.
mutants are also encompassed by the invention.
[0223] Since Neutrokine-.alpha.SV is a member of the TNF-related
protein family, to modulate rather than completely eliminate
functional activities (e.g., biological activities) of
Neutrokine-.alpha.SV, preferably mutations are made in sequences
encoding amino acids in the TNF conserved domain, i.e., in
positions Gly-172 through Leu-265 of FIGS. 5A and 5B (SEQ ID
NO:19), more preferably in residues within this region which are
not conserved in all members of the TGF family. By making a
specific mutation in Neutrokine-.alpha.SV in the position where
such a conserved amino acid is typically found in related TNFs,
Neutrokine-.alpha.SV will act as an antagonist, thus possessing
activity for example, which inhibits lymphocyte (e.g., B cell)
proliferation, differentiation, and/or activation. Accordingly,
polypeptides of the present invention include Neutrokine-.alpha.SV
mutants. Such Neutrokine-.alpha.SV mutants are comprised of the
full-length or preferably the extracellular domain of the
Neutrokine-.alpha.SV amino acid sequence shown in FIGS. 5A and 5B
(SEQ ID NO:19 Polynucleotides encode the above Neutrokine-.alpha.SV
mutants are also encompassed by the invention.
[0224] In addition, it will be recognized by one of ordinary skill
in the art that mutations targeted to regions of a
Neutrokine-.alpha. polypeptide of the invention which encompass the
nineteen amino acid residue insertion which is not found in the
Neutrokine-aSV polypeptide sequence (i.e., amino acid residues
Val-142 through Lys-160 of the sequence presented in FIGS. 1A and
1B and in SEQ ID NO:2) may affect the observed functional
activities (e.g., biological activity) of the Neutrokine-.alpha.
polypeptide. More specifically, a partial, non-limiting and
non-exclusive list of such residues of the Neutrokine-.alpha.
polypeptide sequence which may be targeted for mutation includes
the following amino acid residues of the Neutrokine-.alpha.
polypeptide sequence as shown in SEQ ID NO:2: V-142; T-143; Q-144;
D-145; C-146; L-147; Q-148; L-149; 1-150; A-151; D-152; S-153;
E-154; T-155; P-156; T-157; 1-158; Q-159; and K-160.
[0225] Recombinant DNA technology known to those skilled in the art
can be used to create novel mutant proteins or muteins including
single or multiple amino acid substitutions, deletions, additions
or fusion proteins. Such modified polypeptides can show, e.g.,
enhanced activity or increased stability. In addition, they may be
purified in higher yields and show better solubility than the
corresponding natural polypeptide, at least under certain
purification and storage conditions.
[0226] Thus, the invention also encompasses Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV derivatives and analogs that have one
or more amino acid residues deleted, added, or substituted to
generate Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptides that are better suited for expression, scale up, etc.,
in the host cells chosen. For example, cysteine residues can be
deleted or substituted with another amino acid residue in order to
eliminate disulfide bridges; N-linked glycosylation sites can be
altered or eliminated to achieve, for example, expression of a
homogeneous product that is more easily recovered and purified from
yeast hosts which are known to hyperglycosylate N-linked sites. To
this end, a variety of amino acid substitutions at one or both of
the first or third amino acid positions on any one or more of the
glycosylation recognitions sequences in the Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV polypeptides of the invention, and/or
an amino acid deletion at the second position of any one or more
such recognition sequences will prevent glycosylation of the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV at the modified
tripeptide sequence (see, e.g., Miyajimo et al., EMBO J.
5(6):1193-1197).
[0227] The polypeptides of the present invention are preferably
provided in an isolated form, and preferably are substantially
purified. A recombinantly produced version of the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptides can be
substantially purified by the one-step method described in Smith
and Johnson, Gene 67:31-40 (1988).
[0228] Percent Identity
[0229] The polypeptides of the present invention include the
complete polypeptide encoded by the deposited cDNA (ATCC Deposit
No. 97768) including the intracellular, transmembrane and
extracellular domains of the polypeptide encoded by the deposited
cDNA, the extracellular domain minus the intracellular and
transmembrane domains of the protein, the complete polypeptide of
FIGS. 1A and 1B (amino acid residues 1-285 of SEQ ID NO:2), the
extracellular domain of FIGS. 1A and 1B (amino acid residues 73-285
of SEQ ID NO:2) minus the intracellular and transmembrane domains,
as well as polypeptides which have at least 90% similarity, more
preferably at least 95% similarity, and still more preferably at
least 96%, 97%, 98% or 99% similarity to those described above.
[0230] The polypeptides of the present invention also include the
complete polypeptide encoded by the deposited cDNA including the
intracellular, transmembrane and extracellular domains of the
polypeptide encoded by the deposited cDNA (ATCC Deposit No.
203518), the extracellular domain minus the intracellular and
transmembrane domains of the protein, the complete polypeptide of
FIGS. 5A and 5B (amino acid residues 1-266 of SEQ ID NO:19), the
extracellular domain of FIGS. 5A and 5B (amino acid residues 73-266
of SEQ ID NO:19) minus the intracellular and transmembrane domains,
as well as polypeptides which have at least 90% similarity, more
preferably at least 95% similarity, and still more preferably at
least 96%, 97%, 98% or 99% similarity to those described above.
[0231] Further polypeptides of the present invention include
polypeptides at least 80% identical, more preferably at least 90%
or 95% identical, still more preferably at least 96%, 97%, 98% or
99% identical to the polypeptide encoded by the deposited cDNA
(ATCC Deposit No. 97768) or to the polypeptide of FIGS. 1A and 1B
(SEQ ID NO:2), and also include portions of such polypeptides with
at least 30 amino acids and more preferably at least 50 amino
acids.
[0232] Further polypeptides of the present invention include
polypeptides at least 80% identical, more preferably at least 90%
or 95% identical, still more preferably at least 96%, 97%, 98% or
99% identical to the polypeptide encoded by the deposited cDNA
(ATCC Deposit No. 203518) or to the polypeptide of FIGS. 5A and 5B
(SEQ ID NO:19), and also include portions of such polypeptides with
at least 30 amino acids and more preferably at least 50 amino
acids.
[0233] By "% similarity" for two polypeptides is intended a
similarity score produced by comparing the amino acid sequences of
the two polypeptides using the Bestfit program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, 575 Science Drive, Madison, Wis. 53711)
and the default settings for determining similarity. Bestfit uses
the local homology algorithm of Smith and Waterman (Advances in
Applied Mathematics 2:482-489, 1981) to find the best segment of
similarity between two sequences.
[0234] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a reference amino acid sequence of a
Neutrokine-a and/or Neutrokine-aSV polypeptide is intended that the
amino acid sequence of the polypeptide is identical to the
reference sequence except that the polypeptide sequence may include
up to five amino acid alterations per each 100 amino acids of the
reference amino acid of the Neutrokine-a and/or Neutrokine-aSV
polypeptide. In other words, to obtain a polypeptide having an
amino acid sequence at least 95% identical to a reference amino
acid sequence, up to 5% of the amino acid residues in the reference
sequence may be deleted or substituted with another amino acid, or
a number of amino acids up to 5% of the total amino acid residues
in the reference sequence may be inserted into the reference
sequence. These alterations of the reference sequence may occur at
the amino or carboxy terminal positions of the reference amino acid
sequence or anywhere between those terminal positions, interspersed
either individually among residues in the reference sequence or in
one or more contiguous groups within the reference sequence.
[0235] As a practical matter, whether any particular polypeptide is
at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance,
the amino acid sequence shown in FIGS. 1A and 1B (SEQ ID NO:2), the
amino acid sequence encoded by the deposited cDNA clone HNEDU15
(ATCC Accession No. 97768), or fragments thereof, or, for instance,
to the amino acid sequence shown in FIGS. 5A and 5B (SEQ ID NO:19),
the amino acid sequence encoded by the deposited cDNA clone HDPMC52
(ATCC Accession No. 203518), or fragments thereof, can be
determined conventionally using known computer programs such the
Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for
Unix, Genetics Computer Group, University Research Park, 575
Science Drive, Madison, Wis. 53711). When using Bestfit or any
other sequence alignment program to determine whether a particular
sequence is, for instance, 95% identical to a reference sequence
according to the present invention, the parameters are set, of
course, such that the percentage of identity is calculated over the
full length of the reference amino acid sequence and that gaps in
homology of up to 5% of the total number of amino acid residues in
the reference sequence are allowed.
[0236] In a specific embodiment, the identity between a reference
(query) sequence (a sequence of the present invention) and a
subject sequence, also referred to as a global sequence alignment,
is determined using the FASTDB computer program based on the
algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
Preferred parameters used in a FASTDB amino acid alignment are:
Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1, Joining Penalty=20,
Randomization Group Length=0, Cutoff Score=1, Window Size=sequence
length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or
the length of the subject amino acid sequence, whichever is
shorter. According to this embodiment, if the subject sequence is
shorter than the query sequence due to N- or C-terminal deletions,
not because of internal deletions, a manual correction is made to
the results to take into consideration the fact that the FASTDB
program does not account for N- and C-terminal truncations of the
subject sequence when calculating global percent identity. For
subject sequences truncated at the N- and C-termini, relative to
the query sequence, the percent identity is corrected by
calculating the number of residues of the query sequence that are
N- and C-terminal of the subject sequence, which are not
matched/aligned with a corresponding subject residue, as a percent
of the total bases of the query sequence. A determination of
whether a residue is matched/aligned is determined by results of
the FASTDB sequence alignment. This percentage is then subtracted
from the percent identity, calculated by the above FASTDB program
using the specified parameters, to arrive at a final percent
identity score. This final percent identity score is what is used
for the purposes of this embodiment. Only residues to the N- and
C-termini of the subject sequence, which are not matched/aligned
with the query sequence, are considered for the purposes of
manually adjusting the percent identity score. That is, only query
residue positions outside the farthest N- and C-terminal residues
of the subject sequence. For example, a 90 amino acid residue
subject sequence is aligned with a 100 residue query sequence to
determine percent identity. The deletion occurs at the N-terminus
of the subject sequence and therefore, the FASTDB alignment does
not show a matching/alignment of the first 10 residues at the
N-terminus. The 10 unpaired residues represent 10% of the sequence
(number of residues at the N- and C-termini not matched/total
number of residues in the query sequence) so 10% is subtracted from
the percent identity score calculated by the FASTDB program. If the
remaining 90 residues were perfectly matched the final percent
identity would be 90%. In another example, a 90 residue subject
sequence is compared with a 100 residue query sequence. This time
the deletions are internal deletions so there are no residues at
the N- or C-termini of the subject sequence which are not
matched/aligned with the query. In this case the percent identity
calculated by FASTDB is not manually corrected. Once again, only
residue positions outside the N- and C-terminal ends of the subject
sequence, as displayed in the FASTDB alignment, which are not
matched/aligned with the query sequence are manually corrected for.
No other manual corrections are made for the purposes of this
embodiment.
[0237] A further embodiment of the invention relates to a peptide
or polypeptide which comprises the amino acid sequence of a
Neutrokine-a or Neutrokine-aSV polypeptide having an amino acid
sequence which contains at least one conservative amino acid
substitution, but not more than 50 conservative amino acid
substitutions, even more preferably, not more than 40 conservative
amino acid substitutions, still more preferably, not more than 30
conservative amino acid substitutions, and still even more
preferably, not more than 20 conservative amino acid substitutions.
Of course, in order of ever-increasing preference, it is highly
preferable for a peptide or polypeptide to have an amino acid
sequence which comprises the amino acid sequence of a Neutrokine-a
polypeptide, which contains at least one, but not more than 10, 9,
8, 7, 6, 5, 4, 3, 2 or 1 conservative amino acid substitutions.
[0238] The polypeptide of the present invention could be used as a
molecular weight marker on SDS-PAGE gels or on molecular sieve gel
filtration columns using methods well known to those skilled in the
art. Additionally, as described in detail below, the polypeptides
of the present invention can also be used to raise polyclonal and
monoclonal antibodies, which are useful in assays for detecting
Neutrokine-.alpha. and/or Neutrokine-aSV polypeptide expression as
described below or as agonists and antagonists capable of enhancing
or inhibiting Neutrokine-.alpha. and/or Neutrokine-aSV function.
Further, such polypeptides can be used in the yeast two-hybrid
system to "capture" Neutrokine-(x and/or Neutrokine-aSV binding
proteins which are also candidate agonists and antagonists
according to the present invention. The yeast two hybrid system is
described in Fields and Song, Nature 340:245-246 (1989).
[0239] Transgenics and "Knock-Outs"
[0240] The polypeptides of the invention can also be expressed in
transgenic animals. Animals of any species, including, but not
limited to, mice, rats, rabbits, hamsters, guinea pigs, pigs,
micro-pigs, goats, sheep, cows and non-human primates, e.g.,
baboons, monkeys, and chimpanzees may be used to generate
transgenic animals. In a specific embodiment, techniques described
herein or otherwise known in the art, are used to express
polypeptides of the invention in humans, as part of a gene therapy
protocol.
[0241] Any technique known in the art may be used to introduce the
transgene (i.e., polynucleotides of the invention) into animals to
produce the founder lines of transgenic animals. Such techniques
include, but are not limited to, pronuclear microinjection
(Paterson et al., Appl. Microbiol. Biotechnol. 40:691-698 (1994);
Carver et al., Biotechnology (NY) 11:1263-1270 (1993); Wright et
al., Biotechnology (NY) 9:830-834 (1991); and Hoppe et al., U.S.
Pat. No. 4,873,191 (1989)); retrovirus mediated gene transfer into
germ lines (Van der Putten et al., Proc. Natl. Acad. Sci., USA
82:6148-6152 (1985)), blastocysts or embryos; gene targeting in
embryonic stem cells (Thompson et al., Cell 56:313-321 (1989));
electroporation of cells or embryos (Lo, 1983, Mol Cell. Biol.
3:1803-1814 (1983)); introduction of the polynucleotides of the
invention using a gene gun (see, e.g., Ulmer et al., Science
259:1745 (1993); introducing nucleic acid constructs into embryonic
pleuripotent stem cells and transferring the stem cells back into
the blastocyst; and sperm-mediated gene transfer (Lavitrano et al.,
Cell 57:717-723 (1989); etc. For a review of such techniques, see
Gordon, "Transgenic Animals," Intl. Rev. Cytol. 115:171-229 (1989),
which is incorporated by reference herein in its entirety.
[0242] Any technique known in the art may be used to produce
transgenic clones containing polynucleotides of the invention, for
example, nuclear transfer into enucleated oocytes of nuclei from
cultured embryonic, fetal, or adult cells induced to quiescence
(Campell et al., Nature 380:64-66 (1996); Wilmut et al., Nature
385:810-813 (1997)).
[0243] The present invention provides for transgenic animals that
carry the transgene in all their cells, as well as animals which
carry the transgene in some, but not all their cells, i.e., mosaic
animals or chimeric. The transgene may be integrated as a single
transgene or as multiple copies such as in concatamers, e.g.,
head-to-head tandems or head-to-tail tandems. The transgene may
also be selectively introduced into and activated in a particular
cell type by following, for example, the teaching of Lasko et al.
(Lasko et al., Proc. Natl. Acad. Sci. USA 89:6232-6236 (1992)). The
regulatory sequences required for such a cell-type specific
activation will depend upon the particular cell type of interest,
and will be apparent to those of skill in the art. When it is
desired that the polynucleotide transgene be integrated into the
chromosomal site of the endogenous gene, gene targeting is
preferred. Briefly, when such a technique is to be utilized,
vectors containing some nucleotide sequences homologous to the
endogenous gene are designed for the purpose of integrating, via
homologous recombination with chromosomal sequences, into and
disrupting the function of the nucleotide sequence of the
endogenous gene. The transgene may also be selectively introduced
into a particular cell type, thus inactivating the endogenous gene
in only that cell type, by following, for example, the teaching of
Gu et al. (Gu et al., Science 265:103-106 (1994)). The regulatory
sequences required for such a cell-type specific inactivation will
depend upon the particular cell type of interest, and will be
apparent to those of skill in the art.
[0244] Once transgenic animals have been generated, the expression
of the recombinant gene may be assayed utilizing standard
techniques. Initial screening may be accomplished by Southern blot
analysis or PCR techniques to analyze animal tissues to verify that
integration of the transgene has taken place. The level of mRNA
expression of the transgene in the tissues of the transgenic
animals may also be assessed using techniques which include, but
are not limited to, Northern blot analysis of tissue samples
obtained from the animal, in situ hybridization analysis, and
reverse transcriptase-PCR (rt-PCR). Samples of transgenic
gene-expressing tissue may also be evaluated immunocytochemically
or immunohistochemically using antibodies specific for the
transgene product.
[0245] Once the founder animals are produced, they may be bred,
inbred, outbred, or crossbred to produce colonies of the particular
animal. Examples of such breeding strategies include, but are not
limited to: outbreeding of founder animals with more than one
integration site in order to establish separate lines; inbreeding
of separate lines in order to produce compound transgenics that
express the transgene at higher levels because of the effects of
additive expression of each transgene; crossing of heterozygous
transgenic animals to produce animals homozygous for a given
integration site in order to both augment expression and eliminate
the need for screening of animals by DNA analysis; crossing of
separate homozygous lines to produce compound heterozygous or
homozygous lines; and breeding to place the transgene on a distinct
background that is appropriate for an experimental model of
interest.
[0246] Transgenic and "knock-out" animals of the invention have
uses which include, but are not limited to, animal model systems
useful in elaborating the biological function of Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV polypeptides, studying conditions
and/or disorders associated with aberrant Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV expression, and in screening for compounds
effective in ameliorating such conditions and/or disorders.
[0247] In further embodiments of the invention, cells that are
genetically engineered to express the polypeptides of the
invention, or alternatively, that are genetically engineered not to
express the polypeptides of the invention (e.g., knockouts) are
administered to a patient in vivo. Such cells may be obtained from
the patient (i.e., animal, including human) or an MHC compatible
donor and can include, but are not limited to fibroblasts, bone
marrow cells, blood cells (e.g., lymphocytes), adipocytes, muscle
cells, endothelial cells etc. The cells are genetically engineered
in vitro using recombinant DNA techniques to introduce the coding
sequence of polypeptides of the invention into the cells, or
alternatively, to disrupt the coding sequence and/or endogenous
regulatory sequence associated with the polypeptides of the
invention, e.g., by transduction (using viral vectors, and
preferably vectors that integrate the transgene into the cell
genome) or transfection procedures, including, but not limited to,
the use of plasmids, cosmids, YACs, naked DNA, electroporation,
liposomes, etc. The coding sequence of the polypeptides of the
invention can be placed under the control of a strong constitutive
or inducible promoter or promoter/enhancer to achieve expression,
and preferably secretion, of the polypeptides of the invention. The
engineered cells which express and preferably secrete the
polypeptides of the invention can be introduced into the patient
systemically, e.g., in the circulation, or intraperitoneally.
[0248] Alternatively, the cells can be incorporated into a matrix
and implanted in the body, eg., genetically engineered fibroblasts
can be implanted as part of a skin graft; genetically engineered
endothelial cells can be implanted as part of a lymphatic or
vascular graft. (See, for example, Anderson et al. U.S. Pat. No.
5,399,349; and Mulligan & Wilson, U.S. Pat. No. 5,460,959 each
of which is incorporated by reference herein in its entirety).
[0249] When the cells to be administered are non-autologous or
non-MHC compatible cells, they can be administered using well known
techniques which prevent the development of a host immune response
against the introduced cells. For example, the cells may be
introduced in an encapsulated form which, while allowing for an
exchange of components with the immediate extracellular
environment, does not allow the introduced cells to be recognized
by the host immune system.
[0250] Antibodies
[0251] The present invention further relates to antibodies and
T-cell antigen receptors (TCR) which specifically bind the
polypeptides of the present invention. The antibodies of the
present invention include IgG (including IgG1, IgG2, IgG3, and
IgG4), IgA (including IgA1 and IgA2), IgD, IgE, or IgM, and IgY. As
used herein, the term "antibody" (Ab) is meant to include whole
antibodies, including single-chain whole antibodies, and
antigen-binding fragments thereof. Most preferably the antibodies
are human antigen binding antibody fragments of the present
invention include, but are not limited to, Fab, Fab' and F(ab')2,
Fd, single-chain Fvs (scFv), single-chain antibodies,
disulfide-linked Fvs (sdFv) and fragments comprising either a
V.sub.L or V.sub.H domain. The antibodies may be from any animal
origin including birds and mammals. Preferably, the antibodies are
human, murine, rabbit, goat, guinea pig, camel, horse, or
chicken.
[0252] Antigen-binding antibody fragments, including single-chain
antibodies, may comprise the variable region(s) alone or in
combination with the entire or partial of the following: hinge
region, CH1, CH2, and CH3 domains. Also included in the invention
are any combinations of variable region(s) and hinge region, CH1,
CH2, and CH3 domains. The present invention further includes
chimeric, humanized, and human monoclonal and polyclonal antibodies
which specifically bind the polypeptides of the present invention.
The present invention further includes antibodies which are
anti-idiotypic to the antibodies of the present invention.
[0253] The antibodies of the present invention may be monospecific,
bispecific, trispecific or of greater multispecificity.
Multispecific antibodies may be specific for different epitopes of
a polypeptide of the present invention or may be specific for both
a polypeptide of the present invention as well as for heterologous
compositions, such as a heterologous polypeptide or solid support
material. See, e.g., WO 93/17715; WO 92/08802; WO 91/00360; WO
92/05793; Tutt, A. et al. (1991) J. Immunol. 147:60-69; U.S. Pat.
Nos. 5,573,920, 4,474,893, 5,601,819, 4,714,681, 4,925,648;
Kostelny, S. A. et al. (1992) J. Immunol. 148:1547-1553.
[0254] Antibodies of the present invention may be described or
specified in terms of the epitope(s) or portion(s) of a polypeptide
of the present invention which are recognized or specifically bound
by the antibody. The epitope(s) or polypeptide portion(s) may be
specified as described herein, e.g., by N-terminal and C-terminal
positions, by size in contiguous amino acid residues, or listed in
the Tables and Figures. Antibodies which specifically bind any
epitope or polypeptide of the present invention may also be
excluded. Therefore, the present invention includes antibodies that
specifically bind polypeptides of the present invention, and allows
for the exclusion of the same.
[0255] Antibodies of the present invention may also be described or
specified in terms of their cross-reactivity. Antibodies that do
not bind any other analog, ortholog, or homolog of the polypeptides
of the present invention are included. Antibodies that do not bind
polypeptides with less than 95%, less than 90%, less than 85%, less
than 80%, less than 75%, less than 70%, less than 65%, less than
60%, less than 55%, and less than 50% identity (as calculated using
methods known in the art and described herein) to a polypeptide of
the present invention are also included in the present invention.
Further included in the present invention are antibodies which only
bind polypeptides encoded by polynucleotides which hybridize to a
polynucleotide of the present invention under stringent
hybridization conditions (as described herein). Antibodies of the
present invention may also be described or specified in terms of
their binding affinity. Preferred binding affinities include those
with a dissociation constant or Kd less than 5.times.10.sup.-6M,
10.sup.-6M, 5.times.10.sup.-7M, 10.sup.-7M, 5.times.10.sup.-8M,
10.sup.-8M, 5.times.10.sup.-9M, 10.sup.-9M, 5.times.10.sup.-10M,
10.sup.-10M, 5.times.10.sup.-11M, 10.sup.-11M, 5.times.10.sup.-12M,
10.sup.-12M, 5.times.10.sup.-13M, 10.sup.-13M, 5.times.10.sup.-14M,
10.sup.-14M, 5.times.10.sup.-15M, and 10.sup.-15M.
[0256] Antibodies of the present invention have uses that include,
but are not limited to, methods known in the art to purify, detect,
and target the polypeptides of the present invention including both
in vitro and in vivo diagnostic and therapeutic methods. For
example, the antibodies have use in immunoassays for qualitatively
and quantitatively measuring levels of the polypeptides of the
present invention in biological samples. See, e.g., Harlow et al.,
ANTIBODIES: A LABORATORY MANUAL, (Cold Spring Harbor Laboratory
Press, 2nd ed. 1988) (incorporated by reference in the
entirety).
[0257] The antibodies of the present invention may be used either
alone or in combination with other compositions. The antibodies may
further be recombinantly fused to a heterologous polypeptide at the
N- or C-terminus or chemically conjugated (including covalently and
non-covalently conjugations) to polypeptides or other compositions.
For example, antibodies of the present invention may be
recombinantly fused or conjugated to molecules useful as labels in
detection assays and effector molecules such as heterologous
polypeptides, drugs, or toxins. See, e.g., WO 92/08495; WO
91/14438; WO 89/12624; U.S. Pat. No. 5,314,995; and EP 0 396
387.
[0258] The antibodies of the present invention may be prepared by
any suitable method known in the art. For example, a polypeptide of
the present invention or an antigenic fragment thereof can be
administered to an animal in order to induce the production of sera
containing polyclonal antibodies. Monoclonal antibodies can be
prepared using a wide of techniques known in the art including the
use of hybridoma and recombinant technology. See, e.g., Harlow et
al., ANTIBODIES: A LABORATORY MANUAL, (Cold Spring Harbor
Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: MONOCLONAL
ANTIBODIES AND T-CELL HYBRIDOMAS 563-681 (Elsevier, N.Y., 1981)
(said references incorporated by reference in their
entireties).
[0259] The antibodies of the present invention may be prepared by
any of a variety of standard methods. For example, cells expressing
the Neutrokine-a and/or Neutrokine-aSV polypeptide or an antigenic
fragment thereof can be administered to an animal in order to
induce the production of sera containing polyclonal antibodies. In
a preferred method, a preparation of Neutrokine-.alpha. and/or
Neutrokine-aSV polypeptide is prepared and purified to render it
substantially free of natural contaminants. Such a preparation is
then introduced into an animal in order to produce polyclonal
antisera of greater specific activity.
[0260] In the most preferred method, the antibodies of the present
invention are monoclonal antibodies (or Neutrokine-.alpha. and/or
Neutrokine-aSV polypeptide binding fragments thereof). Such
monoclonal antibodies can be prepared using hybridoma technology
(Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J.
Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292
(1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell
Hybridomas, Elsevier, N.Y., (1981) pp. 563-681). In general, such
procedures involve immunizing an animal (preferably a mouse) with a
Neutrokine-.alpha. and/or Neutrokine-aSV polypeptide antigen or,
more preferably, with a Neutrokine-.alpha. and/or Neutrokine-aSV
polypeptide-expressing cell. Suitable cells can be recognized by
their capacity to bind anti-Neutrokine-.alpha. and/or
anti-Neutrokine-aSV polypeptide antibody. Such cells may be
cultured in any suitable tissue culture medium; however, it is
preferable to culture cells in Earle's modified Eagle's medium
supplemented with 10% fetal bovine serum (inactivated at about
56.degree. C.), and supplemented with about 10 g/l of nonessential
amino acids, about 1,000 U/ml of penicillin, and about 100 .mu.g/ml
of streptomycin. The splenocytes of such mice are extracted and
fused with a suitable myeloma cell line. Any suitable myeloma cell
line may be employed in accordance with the present invention;
however, it is preferable to employ the parent myeloma cell line
(SP2O), available from the ATCC, Manassas, Va. After fusion, the
resulting hybridoma cells are selectively maintained in HAT medium,
and then cloned by limiting dilution as described by Wands et al.
(Gastroenterology 80:225-232 (1981)). The hybridoma cells obtained
through such a selection are then assayed to identify clones which
secrete antibodies capable of binding the Neutrokine-.alpha. and/or
Neutrokine-aSV antigen.
[0261] Alternatively, additional antibodies capable of binding to
the Neutrokine-.alpha. and/or Neutrokine-aSV polypeptide antigen
may be produced in a two-step procedure through the use of
anti-idiotypic antibodies. Such a method makes use of the fact that
antibodies are themselves antigens, and that, therefore, it is
possible to obtain an antibody which binds to a second antibody. In
accordance with this method, Neutrokine-.alpha. and/or
Neutrokine-aSV polypeptide-specific antibodies are used to immunize
an animal, preferably a mouse. The splenocytes of such an animal
are then used to produce hybridoma cells, and the hybridoma cells
are screened to identify clones which produce an antibody whose
ability to bind to the Neutrokine-.alpha. and/or Neutrokine-aSV
polypeptide-specific antibody can be blocked by the
Neutrokine-.alpha. and/or Neutrokine-aSV antigen. Such antibodies
comprise anti-idiotypic antibodies to the Neutrokine-.alpha. and/or
Neutrokine-aSV polypeptide-specific antibody and can be used to
immunize an animal to induce formation of further
Neutrokine-.alpha. and/or Neutrokine-aSV polypeptide-specific
antibodies.
[0262] Fab and F(ab')2 fragments may be produced by proteolytic
cleavage, using enzymes such as papain (to produce Fab fragments)
or pepsin (to produce F(ab')2 fragments).
[0263] Alternatively, antibodies of the present invention can be
produced through the application of recombinant DNA technology or
through synthetic chemistry using methods known in the art. For
example, the antibodies of the present invention can be prepared
using various phage display methods known in the art. In phage
display methods, functional antibody domains are displayed on the
surface of a phage particle which carries polynucleotide sequences
encoding them. Phage with a desired binding property are selected
from a repertoire or combinatorial antibody library (e.g. human or
murine) by selecting directly with antigen, typically antigen bound
or captured to a solid surface or bead. Phage used in these methods
are typically filamentous phage including fd and M13 with Fab, Fv
or disulfide stabilized Fv antibody domains recombinantly fused to
either the phage gene III or gene VIII protein. Examples of phage
display methods that can be used to make the antibodies of the
present invention include those disclosed in Brinkman U. et al.
(1995) J. Immunol. Methods 182:41-50; Ames, R. S. et al. (1995) J.
Immunol. Methods 184:177-186; Kettleborough, C. A. et al. (1994)
Eur. J. Immunol. 24:952-958; Persic, L. et al. (1997) Gene 187
9-18; Burton, D. R. et al. (1994) Advances in Immunology
57:191-280; PCT/GB91/01134; WO 90/02809; WO 91/10737; WO 92/01047;
WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Pat.
Nos. 5,698,426, 5,223,409, 5,403,484, 5,580,717, 5,427,908,
5,750,753, 5,821,047, 5,571,698, 5,427,908, 5,516,637, 5,780,225,
5,658,727 and 5,733,743 (said references incorporated by reference
in their entireties).
[0264] As described in the above references, after phage selection,
the antibody coding regions from the phage can be isolated and used
to generate whole antibodies, including human antibodies, or any
other desired antigen binding fragment, and expressed in any
desired host including mammalian cells, insect cells, plant cells,
yeast, and bacteria. For example, techniques to recombinantly
produce Fab, Fab' and F(ab')2 fragments can also be employed using
methods known in the art such as those disclosed in WO 92/22324;
Mullinax, R. L. et al. (1992) BioTechniques 12(6):864-869; and
Sawai, H. et al. (1995) AJRI 34:26-34; and Better, M. et al. (1988)
Science 240:1041-1043 (said references incorporated by reference in
their entireties).
[0265] Examples of techniques which can be used to produce
single-chain Fvs and antibodies include those described in U.S.
Pat. Nos. 4,946,778 and 5,258,498; Huston et al. (1991) Methods in
Enzymology 203:46-88; Shu, L. et al. (1993) PNAS 90:7995-7999; and
Skerra, A. et al. (1988) Science 240:1038-1040. For some uses,
including in vivo use of antibodies in humans and in vitro
detection assays, it may be preferable to use chimeric, humanized,
or human antibodies. Methods for producing chimeric antibodies are
known in the art. See e.g., Morrison, Science 229:1202 (1985); Oi
et al., BioTechniques 4:214 (1986); Gillies, S. D. et al. (1989) J.
Immunol. Methods 125:191-202; and U.S. Pat. No. 5,807,715.
Antibodies can be humanized using a variety of techniques including
CDR-grafting (EP 0 239 400; WO 91/09967; U.S. Pat. No. 5,530,101;
and 5,585,089), veneering or resurfacing (EP 0 592 106; EP 0 519
596; Padlan E. A., (1991) Molecular Immunology 28(4/5):489-498;
Studnicka G. M. et al. (1994) Protein Engineering 7(6):805-814;
Roguska M. A. et al. (1994) PNAS 91:969-973), and chain shuffling
(U.S. Pat. No. 5,565,332). Human antibodies can be made by a
variety of methods known in the art including phage display methods
described above. See also, U.S. Pat. Nos. 4,444,887, 4,716,111,
5,545,806, and 5,814,318; and WO 98/46645 (said references
incorporated by reference in their entireties).
[0266] Further included in the present invention are antibodies
recombinantly fused or chemically conjugated (including both
covalently and non-covalently conjugations) to a polypeptide of the
present invention. The antibodies may be specific for antigens
other than polypeptides of the present invention. For example,
antibodies may be used to target the polypeptides of the present
invention to particular cell types, either in vitro or in vivo, by
fusing or conjugating the polypeptides of the present invention to
antibodies specific for particular cell surface receptors.
Antibodies fused or conjugated to the polypeptides of the present
invention may also be used in in vitro immunoassays and
purification methods using methods known in the art. See e.g.,
Harbor et al. supra and WO 93/21232; EP 0 439 095; Naramura, M. et
al. (1994) Immunol. Lett. 39:91-99; U.S. Pat. No. 5,474,981;
Gillies, S. O. et al. (1992) PNAS 89:1428-1432; Fell, H. P. et al.
(1991) J. Immunol. 146:2446-2452 (said references incorporated by
reference in their entireties).
[0267] The present invention further includes compositions
comprising the polypeptides of the present invention fused or
conjugated to antibody domains other than the variable regions. For
example, the polypeptides of the present invention may be fused or
conjugated to an antibody Fc region, or portion thereof. The
antibody portion fused to a polypeptide of the present invention
may comprise the hinge region, CH1 domain, CH2 domain, and CH3
domain or any combination of whole domains or portions thereof. The
polypeptides of the present invention may be fused or conjugated to
the above antibody portions to increase the in vivo half life of
the polypeptides or for use in immunoassays using methods known in
the art. The polypeptides may also be fused or conjugated to the
above antibody portions to form multimers. For example, Fc portions
fused to the polypeptides of the present invention can form dimers
through disulfide bonding between the Fc portions. Higher
multimeric forms can be made by fusing the polypeptides to portions
of IgA and IgM. Methods for fusing or conjugating the polypeptides
of the present invention to antibody portions are known in the art.
See e.g., U.S. Pat. Nos. 5,336,603, 5,622,929, 5,359,046,
5,349,053, 5,447,851, 5,112,946; EP 0 307 434, EP 0 367 166; WO
96/04388, WO 91/06570; Ashkenazi, A. et al. (1991) PNAS
88:10535-10539; Zheng, X. X. et al. (1995) J. Immunol.
154:5590-5600; and Vil, H. et al. (1992) PNAS 89:11337-11341 (said
references incorporated by reference in their entireties).
[0268] The invention further relates to antibodies which act as
agonists or antagonists of the polypeptides of the present
invention. For example, the present invention includes antibodies
which disrupt the receptor/ligand interactions with the
polypeptides of the invention either partially or fully. Included
are both receptor-specific antibodies and ligand-specific
antibodies. Included are receptor-specific antibodies which do not
prevent ligand binding but prevent receptor activation. Receptor
activation (i.e., signaling) may be determined by techniques
described herein or otherwise known in the art. Also included are
receptor-specific antibodies which both prevent ligand binding and
receptor activation. Likewise, included are neutralizing antibodies
which bind the ligand and prevent binding of the ligand to the
receptor, as well as antibodies which bind the ligand, thereby
preventing receptor activation, but do not prevent the ligand from
binding the receptor. Further included are antibodies which
activate the receptor. These antibodies may act as agonists for
either all or less than all of the biological activities affected
by ligand-mediated receptor activation. The antibodies may be
specified as agonists or antagonists for biological activities
comprising specific activities disclosed herein. The above antibody
agonists can be made using methods known in the art. See e.g., WO
96/40281; U.S. Pat. No. 5,811,097; Deng, B. et al. (1998) Blood
92(6):1981-1988; Chen, Z. et al. (1998) Cancer Res.
58(16):3668-3678; Harrop, J. A. et al. (1998) J. Immunol.
161(4):1786-1794; Zhu, Z. et al. (1998) Cancer Res.
58(15):3209-3214; Yoon, D. Y. et al. (1998) J. Immunol.
160(7):3170-3179; Prat, M. et al. (1998) J. Cell. Sci.
111(Pt2):237-247; Pitard, V. et al. (1997) J. Immunol. Methods
205(2):177-190; Liautard, J. et al. (1997) Cytokinde 9(4):233-241;
Carlson, N. G. et al. (1997) J. Biol. Chem. 272(17):11295-11301;
Taryman, R. E. et al. (1995) Neuron 14(4):755-762; Muller, Y. A. et
al. (1998) Structure 6(9):1153-1167; Bartunek, P. et al. (1996)
Cytokine 8(1):14-20 (said references incorporated by reference in
their entireties).
[0269] As discussed above, antibodies to the Neutrokine-.alpha.
and/or Neutrokine-.alpha. SV polypeptides of the invention can, in
turn, be utilized to generate anti-idiotype antibodies that "mimic"
the Neutrokine-.alpha., using techniques well known to those
skilled in the art. (See, e.g., Greenspan & Bona, FASEB J.
7(5):437-444; (1989) and Nissinoff, J. Immunol. 147(8):2429-2438
(1991)). For example, antibodies which bind to Neutrokine-.alpha.
and/or Neutrokine-.alpha. SV and competitively inhibit the
Neutrokine-.alpha. and/or Neutrokine-.alpha. SV multimerization
and/or binding to ligand can be used to generate anti-idiotypes
that "mimic" the Neutrokine-.alpha. TNF mutimerization and/or
binding domain and, as a consequence, bind to and neutralize
Neutrokine-.alpha. or Neutrokine-.alpha. SV and/or its ligand. Such
neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes
can be used in therapeutic regimens to neutralize
Neutrokine-.alpha. ligand. For example, such anti-idiotypic
antibodies can be used to bind Neutrokine-.alpha. and/or
Neutrokine-.alpha. SV, or to bind Neutrokine-.alpha. and/or
Neutrokine-.alpha. SV receptors on the surface of cells of B cell
lineage, and thereby block Neutrokine-.alpha. and/or
Neutrokine-.alpha. SV mediated B cell activation, proliferation,
and/or differentiation.
Immune System-Related Disorder Diagnosis
[0270] Neutrokine-.alpha. is expressed in kidney, lung, peripheral
leukocyte, bone marrow, T cell lymphoma, B cell lymphoma, activated
T cells, stomach cancer, smooth muscle, macrophages, and cord blood
tissue, and particularly cells of monocytic lineage. Moreover,
Neutrokine-.alpha.SV is expressed in primary dendritic cells. For a
number of immune system-related disorders, substantially altered
(increased or decreased) levels of Neutrokine-.alpha. and/or
Neutrokine-aSV gene expression can be detected in immune system
tissue or other cells or bodily fluids (e.g., sera, plasma, urine,
synovial fluid or spinal fluid) taken from an individual having
such a disorder, relative to a "standard" Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV gene expression level, that is, the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV expression level in
immune system tissues or bodily fluids from an individual not
having the immune system disorder. Thus, the invention provides a
diagnostic method useful during diagnosis of an system disorder,
which involves measuring the expression level of the gene encoding
the Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide in
immune system tissue or other cells or body fluid from an
individual and comparing the measured gene expression level with a
standard Neutrokine-.alpha. and/or Neutrokine-.alpha.SV gene
expression level, whereby an increase or decrease in the gene
expression level compared to the standard is indicative of an
immune system disorder.
[0271] In particular, it is believed that certain tissues in
mammals with cancer of cells or tissue of the immune system express
significantly enhanced or reduced levels of the Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV polypeptide and mRNA encoding the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide when
compared to a corresponding "standard" level. Further, it is
believed that enhanced or depressed levels of the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide can be
detected in certain body fluids (e.g., sera, plasma, urine, and
spinal fluid) from mammals with such a cancer when compared to sera
from mammals of the same species not having the cancer.
[0272] Thus, the invention provides a diagnostic method useful
during diagnosis of a immune system disorder, including cancers of
this system, which involves measuring the expression level of the
gene encoding the Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptide in immune system tissue or other cells or body fluid
from an individual and comparing the measured gene expression level
with a standard Neutrokine-.alpha. and/or Neutrokine-.alpha.SV gene
expression level, whereby an increase or decrease in the gene
expression level compared to the standard is indicative of an
immune system disorder.
[0273] Where a diagnosis of a disorder in the immune system,
including diagnosis of a tumor, has already been made according to
conventional methods, the present invention is useful as a
prognostic indicator, whereby patients exhibiting enhanced or
depressed Neutrokine-.alpha. and/or Neutrokine-.alpha.SV gene
expression will experience a worse clinical outcome relative to
patients expressing the gene at a level nearer the standard
level.
[0274] By "assaying the expression level of the gene encoding the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide" is
intended qualitatively or quantitatively measuring or estimating
the level of the Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptide or the level of the mRNA encoding the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide in a
first biological sample either directly (e.g., by determining or
estimating absolute protein level or mRNA level) or relatively
(e.g., by comparing to the Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide level or mRNA level in a second
biological sample). Preferably, the Neutrokine-.alpha. and/or
Neutrokine-aSV polypeptide level or mRNA level in the first
biological sample is measured or estimated and compared to a
standard Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide
level or mRNA level, the standard being taken from a second
biological sample obtained from an individual not having the
disorder or being determined by averaging levels from a population
of individuals not having a disorder of the immune system. As will
be appreciated in the art, once a standard Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV polypeptide level or mRNA level is
known, it can be used repeatedly as a standard for comparison.
[0275] By "biological sample" is intended any biological sample
obtained from an individual, body fluid, cell line, tissue culture,
or other source which contains Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide or mRNA. As indicated, biological
samples include body fluids (such as sera, plasma, urine, synovial
fluid and spinal fluid) which contain free extracellular domains of
the Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide,
immune system tissue, and other tissue sources found to express
complete or free extracellular domain of the Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV or a Neutrokine-a and/or
Neutrokine-.alpha.SV receptor. Methods for obtaining tissue
biopsies and body fluids from mammals are well known in the art.
Where the biological sample is to include mRNA, a tissue biopsy is
the preferred source.
[0276] The present invention is useful for diagnosis or treatment
of various immune system-related disorders in mammals, preferably
humans. Such disorders include but are not limited to tumors and
tumor metastasis, infections by bacteria, viruses and other
parasites, immunodeficiencies, inflammatory diseases,
lymphadenopathy, autoimmune diseases, and graft versus host
disease.
[0277] Total cellular RNA can be isolated from a biological sample
using any suitable technique such as the single-step
guanidinium-thiocyanate-ph- enol-chloroform method described in
Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987). Levels
of mRNA encoding the Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptide are then assayed using any appropriate method. These
include Northern blot analysis, S1 nuclease mapping, the polymerase
chain reaction (PCR), reverse transcription in combination with the
polymerase chain reaction (RT-PCR), and reverse transcription in
combination with the ligase chain reaction (RT-LCR).
[0278] Assaying Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptide levels in a biological sample can occur using
antibody-based techniques. For example, Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide expression in tissues can be
studied with classical immunohistological methods (Jalkanen, M., et
al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, M., et al., J.
Cell. Biol. 105:3087-3096 (1987)). Other antibody-based methods
useful for detecting Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptide gene expression include immunoassays, such as the
enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay
(RIA). Suitable antibody assay labels are known in the art and
include enzyme labels, such as, glucose oxidase, and radioisotopes,
such as iodine (.sup.125I, .sup.121I, carbon (.sup.14C), sulfur
(.sup.35S), tritium (.sup.3H), indium (.sup.112In), and technetium
(.sup.99mTc), and fluorescent labels, such as fluorescein and
rhodamine, and biotin.
[0279] In addition to assaying Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide levels in a biological sample
obtained from an individual, Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide can also be detected in vivo by
imaging. Antibody labels or markers for in vivo imaging of
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide include
those detectable by X-radiography, NMR or ESR. For X-radiography,
suitable labels include radioisotopes such as barium or cesium,
which emit detectable radiation but are not overtly harmful to the
subject. Suitable markers for NMR and ESR include those with a
detectable characteristic spin, such as deuterium, which may be
incorporated into the antibody by labeling of nutrients for the
relevant hybridoma. Where in vivo imaging is used to detect
enhanced levels of Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptide for diagnosis in humans, it may be preferable to use
"humanized" chimeric monoclonal antibodies. Such antibodies can be
produced using genetic constructs derived from hybridoma cells
producing the monoclonal antibodies described above. Methods for
producing chimeric antibodies are known in the art. See, for
review, Morrison, Science 229:1202 (1985); Oi et al., BioTechniques
4:214 (1986); Cabilly et al., U.S. Pat. No. 4,816,567; Taniguchi et
al., EP 171496; Morrison et al., EP 173494; Neuberger et al., WO
8601533; Robinson et al., WO 8702671; Boulianne et al., Nature
312:643 (1984); Neuberger et al., Nature 314:268 (1985).
[0280] A Neutrokine-.alpha. and/or Neutrokine-aSV
polypeptide-specific antibody or antibody fragment which has been
labeled with an appropriate detectable imaging moiety, such as a
radioisotope (for example, .sup.131I, .sup.112In, .sup.99mTc), a
radio-opaque substance, or a material detectable by nuclear
magnetic resonance, is introduced (for example, parenterally,
subcutaneously or intraperitoneally) into the mammal to be examined
for immune system disorder. It will be understood in the art that
the size of the subject and the imaging system used will determine
the quantity of imaging moiety needed to produce diagnostic images.
In the case of a radioisotope moiety, for a human subject, the
quantity of radioactivity injected will normally range from about 5
to 20 millicuries of .sup.99mTc. The labeled antibody or antibody
fragment will then preferentially accumulate at the location of
cells which contain Neutrokine-.alpha. protein. In vivo tumor
imaging is described in S. W. Burchiel et al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their
Fragments" (Chapter 13 in Tumor Imaging: The Radiochemical
Detection of Cancer, S. W. Burchiel and B. A. Rhodes, eds., Masson
Publishing Inc. (1982)).
Treatment of Immune System-Related Disorders
[0281] As noted above, Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polynucleotides and polypeptides are useful
for diagnosis of conditions involving abnormally high or low
expression of Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
activities. Given the cells and tissues where Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV is expressed as well as the activities
modulated by Neutrokine-.alpha. and/or Neutrokine-.alpha.SV, it is
readily apparent that a substantially altered (increased or
decreased) level of expression of Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV in an individual compared to the standard or
"normal" level produces pathological conditions related to the
bodily system(s) in which Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV is expressed and/or is active.
[0282] It will also be appreciated by one of ordinary skill that,
since the Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptides of the invention are members of the TNF family, the
extracellular domains of the respective proteins may be released in
soluble form from the cells which express Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV by proteolytic cleavage and therefore, when
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide
(particularly a soluble form of the respective extracellular
domains) is added from an exogenous source to cells, tissues or the
body of an individual, the polypeptide will exert its modulating
activities on any of its target cells of that individual. Also,
cells expressing this type II transmembrane protein may be added to
cells, tissues or the body of an individual whereby the added cells
will bind to cells expressing receptor for Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV whereby the cells expressing
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV can cause actions
(e.g., cytotoxicity) on the receptor-bearing target cells.
[0283] Therefore, it will be appreciated that conditions caused by
a decrease in the standard or normal level of Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV activity in an individual, particularly
disorders of the immune system, can be treated by administration of
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide (in the
form of soluble extracellular domain or cells expressing the
complete protein). Thus, the invention also provides a method of
treatment of an individual in need of an increased level of
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV activity comprising
administering to such an individual a pharmaceutical composition
comprising an amount of an isolated Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide of the invention, effective to
increase the Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
activity level in such an individual.
[0284] Since Neutrokine-.alpha. and/or Neutrokine-.alpha.SV belong
to the TNF superfamily, the polypeptides should also modulate
angiogenesis. In addition, since Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV inhibit immune cell functions, the
polypeptides will have a wide range of anti-inflammatory
activities. Neutrokine-.alpha. and/or Neutrokine-.alpha.SV may be
employed as an anti-neovascularizing agent to treat solid tumors by
stimulating the invasion and activation of host defense cells,
e.g., cytotoxic T cells and macrophages and by inhibiting the
angiogenesis of tumors. Those of skill in the art will recognize
other non-cancer indications where blood vessel proliferation is
not wanted. They may also be employed to enhance host defenses
against resistant chronic and acute infections, for example,
myobacterial infections via the attraction and activation of
microbicidal leukocytes. Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV may also be employed to inhibit T-cell
proliferation by the inhibition of IL-2 biosynthesis for the
treatment of T-cell mediated auto-immune diseases and lymphocytic
leukemias. Neutrokine-.alpha. and/or Neutrokine-.alpha.SV may also
be employed to stimulate wound healing, both via the recruitment of
debris clearing and connective tissue promoting inflammatory cells.
In this same manner, Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
may also be employed to treat other fibrotic disorders, including
liver cirrhosis, osteoarthritis and pulmonary fibrosis.
Neutrokine-.alpha. and/or Neutrokine-aSV also increases the
presence of eosinophils which have the distinctive function of
killing the larvae of parasites that invade tissues, as in
schistosomiasis, trichinosis and ascariasis. It may also be
employed to regulate hematopoiesis, by regulating the activation
and differentiation of various hematopoietic progenitor cells, for
example, to release mature leukocytes from the bone marrow
following chemotherapy, i.e., in stem cell mobilization.
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV may also be employed
to treat sepsis.
[0285] Additional preferred embodiments of the invention include,
but are not limited to, the use of Neutrokine-.alpha. polypeptides
and functional agonists in the following applications:
[0286] A vaccine adjuvant that enhances immune responsiveness to
specific antigen.
[0287] An adjuvant to enhance tumor-specific immune responses.
[0288] An adjuvant to enhance anti-viral immune responses.
[0289] As a stimulator of B cell responsiveness to pathogens.
[0290] As an agent that elevates the immune status of a individual
prior to their receipt of immunosuppressive therapies.
[0291] As an agent to accelerate recovery of immunocompromised
individuals;
[0292] As an agent to boost immunoresponsiveness among aged
populations; As an immune system enhancer following bone marrow
transplant.
[0293] As a mediator of mucosal immune responses. The expression of
Neutrokine-a by monocytes and the responsiveness of B cell to this
factor suggests that it may be involved in exchange of signals
between B cells and monocytes or their differentiated progeny. This
activity is in many ways analogous to the CD40-CD154 signalling
between B cells and T cells. Neutrokine-a may therefore be an
important regulator of T cell independent immune responses to
environmental pathogens. In particular, the unconventional B cell
populations (CD5+) that are associated with mucosal sites and
responsible for much of the innate immunity in humans may respond
to Neutrokine-a thereby enhancing an individual's protective immune
status.
[0294] As an agent to direct an individuals immune system towards
development of a humoral response (i.e. TH2) as opposed to a TH1
cellular response.
[0295] As a means to induce tumor proliferation and thus make it
more susceptible to anti-neoplastic agents. For example multiple
myeloma is a slowly dividing disease and is thus refractory to
virtually all anti-neoplastic regimens. If these cells were forced
to proliferate more rapidly their susceptibility profile would
likely change.
[0296] As B cell specific binding protein to which specific
activators or inhibitors of cell growth may be attached. The result
would be to focus the activity of such activators or inhibitors
onto normal, diseased, or neoplastic B cell populations.
[0297] As a means of detecting B-lineage cells by virtue of its
specificity. This application may require labeling the protein with
biotin or other agents to afford a means of detection.
[0298] As a stimulator of B cell production in pathologies such as
AIDS, chronic lymphocyte disorder and/or Common Variable
Immunodificiency;
[0299] As part of a B cell selection device the function of which
is to isolate B cells from a heterogenous mixture of cell types.
Neutrokine-a could be coupled to a solid support to which B cells
would then specifically bind. Unbound cells would be washed out and
the bound cells subsequently eluted. This technique would allow
purging of tumor cells from, for example, bone marrow or peripheral
blood prior to transplant.
[0300] As a therapy for generation and/or regeneration of lymphoid
tissues following surgery, trauma or genetic defect.
[0301] As a gene-based therapy for genetically inherited disorders
resulting in immuno-incompetence such as observed among SCID
patients.
[0302] As an antigen for the generation of antibodies to inhibit or
enhance Neutrokine-a mediated responses.
[0303] As a means of activating monocytes/macrophages to defend
against parasitic diseases that effect monocytes such as
Leshmania.
[0304] As pretreatment of bone marrow samples prior to transplant.
Such treatment would increase B cell representation and thus
accelerate recover.
[0305] As a means of regulating secreted cytokines that are
elicited by Neutrokine-a.
[0306] All of the above described applications as they may apply to
veterinary medicine.
[0307] Antagonists of Neutrokine-a include binding and/or
inhibitory antibodies, antisense nucleic acids, ribozymes or
soluble forms of the Neutrokine-a receptor(s). These would be
expected to reverse many of the activities of the ligand described
above as well as find clinical or practical application as:
[0308] A means of blocking various aspects of immune responses to
foreign agents or self. Examples include autoimmune disorders such
as lupus, and arthritis, as well as immunoresponsiveness to skin
allergies, inflammation, bowel disease, injury and pathogens.
Although our current data speaks directly to the potential role of
Neutrokine-a in B cell and monocyte related pathologies, it remains
possible that other cell types may gain expression or
responsiveness to Neutrokine-.alpha.. Thus, Neutrokine-.alpha. may,
like CD40 and its ligand, be regulated by the status of the immune
system and the microenvironment in which the cell is located.
[0309] A therapy for preventing the B cell proliferation and Ig
secretion associated with autoimmune diseases such as idiopathic
thrombocytopenic purpura, systemic lupus erythramatosus and MS.
[0310] An inhibitor of graft versus host disease or transplant
rejection.
[0311] A therapy for B cell malignancies such as ALL, Hodgkins
disease, non-Hodgkins lymphoma, Chronic lymphocyte leukemia,
plasmacytomas, multiple myeloma, Burkitt's lymphoma, and
EBV-transformed diseases.
[0312] A therapy for chronic hypergammaglobulinemeia evident in
such diseases as monoclonalgammopathy of undetermined significance
(MGUS), Waldenstrom's disease, and related idiopathic
monoclonalgammopathies.
[0313] A means of decreasing the involvement of B cells and Ig
associated with Chronic Myelogenous Leukemia.
[0314] An immunosuppressive agent(s).
[0315] An inhibitor of signalling pathways involving ERK1, COX2 and
Cyclin D2 which have been associated with Neutrokine-a induced B
cell activation.
[0316] The agonists and antagonists may be employed in a
composition with a pharmaceutically acceptable carrier, e.g., as
described above.
[0317] The antagonists may be employed for instance to inhibit
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV the chemotaxis and
activation of macrophages and their precursors, and of neutrophils,
basophils, B lymphocytes and some T-cell subsets, e.g., activated
and CD8 cytotoxic T cells and natural killer cells, in certain
auto-immune and chronic inflammatory and infective diseases.
Examples of auto-immune diseases include multiple sclerosis, and
insulin-dependent diabetes. The antagonists may also be employed to
treat infectious diseases including silicosis, sarcoidosis,
idiopathic pulmonary fibrosis by preventing the recruitment and
activation of mononuclear phagocytes. They may also be employed to
treat idiopathic hyper-eosinophilic syndrome by preventing
eosinophil production and migration. Endotoxic shock may also be
treated by the antagonists by preventing the migration of
macrophages and their production of the Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptides of the present invention. The
antagonists may also be employed for treating atherosclerosis, by
preventing monocyte infiltration in the artery wall. The
antagonists may also be employed to treat histamine-mediated
allergic reactions and immunological disorders including late phase
allergic reactions, chronic urticaria, and atopic dermatitis by
inhibiting chemokine-induced mast cell and basophil degranulation
and release of histamine. IgE-mediated allergic reactions such as
allergic asthma, rhinitis, and eczema may also be treated. The
antagonists may also be employed to treat chronic and acute
inflammation by preventing the attraction of monocytes to a wound
area. They may also be employed to regulate normal pulmonary
macrophage populations, since chronic and acute inflammatory
pulmonary diseases are associated with sequestration of mononuclear
phagocytes in the lung. Antagonists may also be employed to treat
rheumatoid arthritis by preventing the attraction of monocytes into
synovial fluid in the joints of patients. Monocyte influx and
activation plays a significant role in the pathogenesis of both
degenerative and inflammatory arthropathies. The antagonists may be
employed to interfere with the deleterious cascades attributed
primarily to IL-1 and TNF, which prevents the biosynthesis of other
inflammatory cytokines. In this way, the antagonists may be
employed to prevent inflammation. The antagonists may also be
employed to inhibit prostaglandin-independent fever induced by
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV. The antagonists may
also be employed to treat cases of bone marrow failure, for
example, aplastic anemia and myelodysplastic syndrome. The
antagonists may also be employed to treat asthma and allergy by
preventing eosinophil accumulation in the lung. The antagonists may
also be employed to treat subepithelial basement membrane fibrosis
which is a prominent feature of the asthmatic lung.
[0318] Antibodies against Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV may be employed to bind to and inhibit
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV activity to treat
ARDS, by preventing infiltration of neutrophils into the lung after
injury. The antagonists and antagonists of the instant may be
employed in a composition with a pharmaceutically acceptable
carrier, e.g., as described hereinafter.
[0319] Formulations
[0320] The Neutrokine- and/or Neutrokine-.alpha.SV polypeptide
composition (preferably containing a polypeptide which is a soluble
form of the Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
extracellular domains) will be formulated and dosed in a fashion
consistent with good medical practice, taking into account the
clinical condition of the individual patient (especially the side
effects of treatment with Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide alone), the site of delivery of
the Neutrokine-.alpha. Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide composition, the method of
administration, the scheduling of administration, and other factors
known to practitioners. The "effective amount" of
Neutrokine-.alpha. and/or Neutrokine-aSV polypeptide for purposes
herein is thus determined by such considerations.
[0321] As a general proposition, the total pharmaceutically
effective amount of Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptide administered parenterally per dose will be in the range
of about 1 .mu.g/kg/day to 10 mg/kg/day of patient body weight,
although, as noted above, this will be subject to therapeutic
discretion. More preferably, this dose is at least 0.01 mg/kg/day,
and most preferably for humans between about 0.01 and 1 mg/kg/day
for the hormone. If given continuously, the Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV polypeptide is typically administered
at a dose rate of about 1 .mu.g/kg/hour to about 50 .mu.g/kg/hour,
either by 1-4 injections per day or by continuous subcutaneous
infusions, for example, using a mini-pump. An intravenous bag
solution may also be employed. The length of treatment needed to
observe changes and the interval following treatment for responses
to occur appears to vary depending on the desired effect.
[0322] Pharmaceutical compositions containing Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV polypeptides of the invention may be
administered orally, rectally, parenterally, intracistemally,
intravaginally, intraperitoneally, topically (as by powders,
ointments, drops or transdermal patch), bucally, or as an oral or
nasal spray. In one embodiment, "pharmaceutically acceptable
carrier" means a non-toxic solid, semisolid or liquid filler,
diluent, encapsulating material or formulation auxiliary of any
type. In a specific embodiment, "pharmaceutically acceptable" means
approved by a regulatory agency of the federal or a state
government or listed in the U.S. Pharmacopeia or other generally
recognized pharmacopeia for use in animals, and more particularly
humans. Nonlimiting examples of suitable pharmaceutical carriers
according to this embodiment are provided in "Remington's
Pharmaceutical Sciences" by E. W. Martin, and include sterile
liquids, such as water and oils, including those of petroleum,
animal, vegetable or synthetic origin, such as peanut oil, soybean
oil, mineral oil, sesame oil and the like. Water is a preferred
carrier when the pharmaceutical composition is administered
intravenously. Saline solutions and aqueous dextrose and glycerol
solutions can be employed as liquid carriers, particularly for
injectable solutions.
[0323] The term "parenteral" as used herein refers to modes of
administration which include intravenous, intramuscular,
intraperitoneal, intrasternal, subcutaneous and intraarticular
injection and infusion.
[0324] The Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptide is also suitably administered by sustained-release
systems. Suitable examples of sustained-release compositions
include semi-permeable polymer matrices in the form of shaped
articles, e.g., films, or mirocapsules. Sustained-release matrices
include polylactides (U.S. Pat. No. 3,773,919, EP 58,481),
copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman,
U. et al., Biopolymers 22:547-556 (1983)), poly (2-hydroxyethyl
methacrylate) (R. Langer et al., J. Biomed. Mater. Res. 15:167-277
(1981), and R. Langer, Chem. Tech. 12:98-105 (1982)), ethylene
vinyl acetate (R. Langer et al., Id.) or poly-D(-)-3-hydroxybutyric
acid (EP 133,988). Sustained-release Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide compositions also include
liposomally entrapped Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide. Liposomes containing
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide are
prepared by methods known per se: DE 3,218,121; Epstein et al.,
Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al.,
Proc. Natl. Acad. Sci. (USA) 77:4030-4034 (1980); EP 52,322; EP
36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat. Appl.
83-118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324.
Ordinarily, the liposomes are of the small (about 200-800
Angstroms) unilamellar type in which the lipid content is greater
than about 30 mol. percent cholesterol, the selected proportion
being adjusted for the optimal Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide therapy.
[0325] For parenteral administration, in one embodiment, the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide is
formulated generally by mixing it at the desired degree of purity,
in a unit dosage injectable form (solution, suspension, or
emulsion), with a pharmaceutically acceptable carrier, i.e., one
that is non-toxic to recipients at the dosages and concentrations
employed and is compatible with other ingredients of the
formulation. For example, the formulation preferably does not
include oxidizing agents and other compounds that are known to be
deleterious to polypeptides.
[0326] Generally, the formulations are prepared by contacting the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide
uniformly and intimately with liquid carriers or finely divided
solid carriers or both. Then, if necessary, the product is shaped
into the desired formulation. Preferably the carrier is a
parenteral carrier, more preferably a solution that is isotonic
with the blood of the recipient. Examples of such carrier vehicles
include water, saline, Ringer's solution, and dextrose solution.
Non-aqueous vehicles such as fixed oils and ethyl oleate are also
useful herein, as well as liposomes.
[0327] The carrier suitably contains minor amounts of additives
such as substances that enhance isotonicity and chemical stability.
Such materials are non-toxic to recipients at the dosages and
concentrations employed, and include buffers such as phosphate,
citrate, succinate, acetic acid, and other organic acids or their
salts; antioxidants such as ascorbic acid; low molecular weight
(less than about ten residues) polypeptides, e.g., polyarginine or
tripeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids, such as glycine, glutamic acid, aspartic acid, or
arginine; monosaccharides, disaccharides, and other carbohydrates
including cellulose or its derivatives, glucose, manose, or
dextrins; chelating agents such as EDTA; sugar alcohols such as
mannitol or sorbitol; counterions such as sodium; and/or nonionic
surfactants such as polysorbates, poloxamers, or PEG.
[0328] The Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptide is typically formulated in such vehicles at a
concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10
mg/ml, at a pH of about 3 to 8. It will be understood that the use
of certain of the foregoing excipients, carriers, or stabilizers
will result in the formation of Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide salts.
[0329] Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide
to be used for therapeutic administration must be sterile.
Sterility is readily accomplished by filtration through sterile
filtration membranes (e.g., 0.2 micron membranes). Therapeutic
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide
compositions generally are placed into a container having a sterile
access port, for example, an intravenous solution bag or vial
having a stopper pierceable by a hypodermic injection needle.
[0330] Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide
ordinarily will be stored in unit or multi-dose containers, for
example, sealed ampoules or vials, as an aqueous solution or as a
lyophilized formulation for reconstitution. As an example of a
lyophilized formulation, 10-ml vials are filled with 5 ml of
sterile-filtered 1% (w/v) aqueous Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide solution, and the resulting
mixture is lyophilized. The infusion solution is prepared by
reconstituting the lyophilized Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide using bacteriostatic
Water-for-Injection.
[0331] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the polypeptides of the present
invention may be employed in conjunction with other therapeutic
compounds.
[0332] Agonists and Antagonists--Assays and Molecules
[0333] The invention also provides a method of screening compounds
to identify those which enhance or block the action of
Neutrokine-.alpha. and/or Neutrokine-aSV polypeptide on cells, such
as its interaction with Neutrokine-.alpha. and/or Neutrokine-aSV
binding molecules such as receptor molecules. An agonist is a
compound which increases the natural biological functions of
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV or which functions
in a manner similar to Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV while antagonists decrease or eliminate such
functions.
[0334] In another embodiment, the invention provides a method for
identifying a receptor protein or other ligand-binding protein
which binds specifically to a Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide. For example, a cellular
compartment, such as a membrane or a preparation thereof, may be
prepared from a cell that expresses a molecule that binds
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV. The preparation is
incubated with labeled Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV and complexes of Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV bound to the receptor or other binding protein
are isolated and characterized according to routine methods known
in the art. Alternatively, the Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide may be bound to a solid support so
that binding molecules solubilized from cells are bound to the
column and then eluted and characterized according to routine
methods.
[0335] In the assay of the invention for agonists or antagonists, a
cellular compartment, such as a membrane or a preparation thereof,
may be prepared from a cell that expresses a molecule that binds
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV such as a molecule
of a signaling or regulatory pathway modulated by
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV. The preparation is
incubated with labeled Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV in the absence or the presence of a candidate
molecule which may be a Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV agonist or antagonist. The ability of the
candidate molecule to bind the binding molecule is reflected in
decreased binding of the labeled ligand. Molecules which bind
gratuitously, i.e., without inducing the effects of
Neutrokine-.alpha. on binding the Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV binding molecule, are most likely to be good
antagonists. Molecules that bind well and elicit effects that are
the same as or closely related to Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV are agonists.
[0336] Neutrokine-.alpha. and/or Neutrokine-.alpha.SV-like effects
of potential agonists and antagonists may by measured, for
instance, by determining activity of a second messenger system
following interaction of the candidate molecule with a cell or
appropriate cell preparation, and comparing the effect with that of
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV or molecules that
elicit the same effects as Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV. Second messenger systems that may be useful
in this regard include but are not limited to AMP guanylate
cyclase, ion channel or phosphoinositide hydrolysis second
messenger systems.
[0337] Another example of an assay for Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV antagonists is a competitive assay that
combines Neutrokine-a and/or Neutrokine-aSV and a potential
antagonist with membrane-bound receptor molecules or recombinant
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV receptor molecules
under appropriate conditions for a competitive inhibition assay.
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV can be labeled, such
as by radioactivity, such that the number of Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV molecules bound to a receptor molecule
can be determined accurately to assess the effectiveness of the
potential antagonist.
[0338] Potential antagonists include small organic molecules,
peptides, polypeptides and antibodies that bind to a polypeptide of
the invention and thereby inhibit or extinguish its activity.
Potential antagonists also may be small organic molecules, a
peptide, a polypeptide such as a closely related protein or
antibody that binds the same sites on a binding molecule, such as a
receptor molecule, without inducing Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV induced activities, thereby preventing the
action of Neutrokine-.alpha. and/or Neutrokine-.alpha.SV by
excluding Neutrokine-.alpha. and/or Neutrokine-.alpha.SV from
binding.
[0339] Other potential antagonists include antisense molecules.
Antisense technology can be used to control gene expression through
antisense DNA or RNA or through triple-helix formation. Antisense
techniques are discussed, for example, in Okano, J. Neurochem. 56:
560 (1991); "Oligodeoxynucleotides as Antisense Inhibitors of Gene
Expression, CRC Press, Boca Raton, Fla. (1988). Antisense
technology can be used to control gene expression through antisense
DNA or RNA, or through triple-helix formation. Antisense techniques
are discussed for example, in Okano, J., Neurochem. 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988). Triple helix formation is
discussed in, for instance Lee et al., Nucleic Acids Research 6:
3073 (1979); Cooney et al., Science 241: 456 (1988); and Dervan et
al., Science 251: 1360 (1991). The methods are based on binding of
a polynucleotide to a complementary DNA or RNA. For example, the 5'
coding portion of a polynucleotide that encodes the extracellular
domain of the polypeptide of the present invention may be used to
design an antisense RNA oligonucleotide of from about 10 to 40 base
pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
thereby preventing transcription and the production of
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks
translation of the mRNA molecule into Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptide. The oligonucleotides described
above can also be delivered to cells such that the antisense RNA or
DNA may be expressed in vivo to inhibit production of
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV.
[0340] In one embodiment, the Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV antisense nucleic acid of the invention is
produced intracellularly by transcription from an exogenous
sequence. For example, a vector or a portion thereof, is
transcribed, producing an antisense nucleic acid (RNA) of the
invention. Such a vector would contain a sequence encoding the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV antisense nucleic
acid. Such a vector can remain episomal or become chromosomally
integrated, as long as it can be transcribed to produce the desired
antisense RNA. Such vectors can be constructed by recombinant DNA
technology methods standard in the art. Vectors can be plasmid,
viral, or others know in the art, used for replication and
expression in vertebrate cells. Expression of the sequence encoding
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV, or fragments
thereof, can be by any promoter known in the art to act in
vertebrate, preferably human cells. Such promoters can be inducible
or constitutive. Such promoters include, but are not limited to,
the SV40 early promoter region (Bernoist and Chambon, Nature
29:304-310 (1981), the promoter contained in the 3' long terminal
repeat of Rous sarcoma virus (Yamamoto et al., Cell 22:787-797
(1980), the herpes thymidine promoter (Wagner et al., Proc. Natl.
Acad. Sci. U.S.A. 78:1441-1445 (1981), the regulatory sequences of
the metallothionein gene (Brinster, et al., Nature 296:39-42
(1982)), etc.
[0341] The antisense nucleic acids of the invention comprise a
sequence complementary to at least a portion of an RNA transcript
of a Neutrokine-.alpha. and/or Neutrokine-.alpha.SV gene. However,
absolute complementarity, although preferred, is not required. A
sequence "complementary to at least a portion of an RNA," referred
to herein, means a sequence having sufficient complementarity to be
able to hybridize with the RNA, forming a stable duplex; in the
case of double stranded Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV antisense nucleic acids, a single strand of
the duplex DNA may thus be tested, or triplex formation may be
assayed. The ability to hybridize will depend on both the degree of
complementarity and the length of the antisense nucleic acid
Generally, the larger the hybridizing nucleic acid, the more base
mismatches with a Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
RNA it may contain and still form a stable duplex (or triplex as
the case may be). One skilled in the art can ascertain a tolerable
degree of mismatch by use of standard procedures to determine the
melting point of the hybridized complex.
[0342] Oligonucleotides that are complementary to the 5' end of the
message, e.g., the 5' untranslated sequence up to and including the
AUG initiation codon, should work most efficiently at inhibiting
translation. However, sequences complementary to the 3'
untranslated sequences of mRNAs have been shown to be effective at
inhibiting translation of mRNAs as well. See generally, Wagner, R.,
1994, Nature 372:333-335. Thus, oligonucleotides complementary to
either the 5'- or 3'-non-translated, non-coding regions of
Neutrokine-.alpha. and Neutrokine-.alpha.SV shown in FIGS. 1A-B and
5A-B, respectively, could be used in an antisense approach to
inhibit translation of endogenous Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV mRNA. Oligonucleotides complementary to the 5'
untranslated region of the mRNA should include the complement of
the AUG start codon. Antisense oligonucleotides complementary to
mRNA coding regions are less efficient inhibitors of translation
but could be used in accordance with the invention. Whether
designed to hybridize to the 5'-, 3'- or coding region of
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV mRNA, antisense
nucleic acids should be at least six nucleotides in length, and are
preferably oligonucleotides ranging from 6 to about 50 nucleotides
in length. In specific aspects the oligonucleotide is at least 10
nucleotides, at least 17 nucleotides, at least 25 nucleotides or at
least 50 nucleotides.
[0343] The polynucleotides of the invention can be DNA or RNA or
chimeric mixtures or derivatives or modified versions thereof,
single-stranded or double-stranded. The oligonucleotide can be
modified at the base moiety, sugar moiety, or phosphate backbone,
for example, to improve stability of the molecule, hybridization,
etc. The oligonucleotide may include other appended groups such as
peptides (e.g., for targeting host cell receptors in vivo), or
agents facilitating transport across the cell membrane (see, e.g.,
Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556;
Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT
Publication No. WO88/09810, published Dec. 15, 1988) or the
blood-brain barrier (see, e.g., PCT Publication No. WO89/10134,
published Apr. 25, 1988), hybridization-triggered cleavage agents.
(See, e.g., Krol et al., 1988, BioTechniques 6:958-976) or
intercalating agents. (See, e.g., Zon, 1988, Pharm. Res.
5:539-549). To this end, the oligonucleotide may be conjugated to
another molecule, e.g., a peptide, hybridization triggered
cross-linking agent, transport agent, hybridization-triggered
cleavage agent, etc.
[0344] The antisense oligonucleotide may comprise at least one
modified base moiety which is selected from the group including,
but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomet-
hyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine,
3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopenteny- ladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and
2,6-diaminopurine.
[0345] The antisense oligonucleotide may also comprise at least one
modified sugar moiety selected from the group including, but not
limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
[0346] In yet another embodiment, the antisense oligonucleotide
comprises at least one modified phosphate backbone selected from
the group including, but not limited to, a phosphorothioate, a
phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a
phosphordiamidate, a methylphosphonate, an alkyl phosphotriester,
and a formacetal or analog thereof.
[0347] In yet another embodiment, the antisense oligonucleotide is
an a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms
specific double-stranded hybrids with complementary RNA in which,
contrary to the usual b-units, the strands run parallel to each
other (Gautier et al., Nucl. Acids Res. 15:6625-6641 (1987)). The
oligonucleotide is a 2.cent.-O-methylribonucleotide (Inoue et al.,
Nucl. Acids Res. 15:6131-6148 (1987)), or a chimeric RNA-DNA
analogue (Inoue et al., FEBS Lett. 215:327-330 (1997)).
[0348] Polynucleotides of the invention may be synthesized by
standard methods known in the art, e.g. by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides may be synthesized by the method of Stein et al.
(Nucl. Acids Res. 16:3209 (1988)), methylphosphonate
oligonucleotides can be prepared by use of controlled pore glass
polymer supports (Sarin et al., Proc. Natl. Acad. Sci. U.S.A.
85:7448-7451 (1988)), etc.
[0349] While antisense nucleotides complementary to the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV coding region
sequence could be used, those complementary to the transcribed
untranslated region are most preferred.
[0350] Potential antagonists according to the invention also
include catalytic RNA, or a ribozyme (See, e.g., PCT International
Publication WO 90/11364, published Oct. 4, 1990; Sarver et al,
Science 247:1222-1225 (1990). While ribozymes that cleave mRNA at
site specific recognition sequences can be used to destroy
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV mRNAs, the use of
hammerhead ribozymes is preferred. Hammerhead ribozymes cleave
mRNAs at locations dictated by flanking regions that form
complementary base pairs with the target mRNA. The sole requirement
is that the target mRNA have the following sequence of two bases:
5'-UG-3'. The construction and production of hammerhead ribozymes
is well known in the art and is described more fully in Haseloff
and Gerlach, Nature 334:585-591 (1988). There are numerous
potential hammerhead ribozyme cleavage sites within the nucleotide
sequence of Neutrokine-.alpha. and Neutrokine-aSV (FIGS. 1A-B and
5A-B, respectively). Preferably, the ribozyme is engineered so that
the cleavage recognition site is located near the 5' end of the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV mRNA; i.e., to
increase efficiency and minimize the intracellular accumulation of
non-functional mRNA transcripts.
[0351] As in the antisense approach, the ribozymes of the invention
can be composed of modified oligonucleotides (e.g. for improved
stability, targeting, etc.) and should be delivered to cells which
express Neutrokine-.alpha. and/or Neutrokine-.alpha.SV in vivo. DNA
constructs encoding the ribozyme may be introduced into the cell in
the same manner as described above for the introduction of
antisense encoding DNA. A preferred method of delivery involves
using a DNA construct "encoding" the ribozyme under the control of
a strong constitutive promoter, such as, for example, pol III or
pol II promoter, so that transfected cells will produce sufficient
quantities of the ribozyme to destroy endogenous Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV messages and inhibit translation. Since
ribozymes unlike antisense molecules, are catalytic, a lower
intracellular concentration is required for efficiency.
[0352] Endogenous gene expression can also be reduced by
inactivating or "knocking out" the Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV gene and/or its promoter using targeted
homologous recombination. (E.g., see Smithies et al., Nature
317:230-234 (1985); Thomas & Capecchi, Cell 51:503-512 (1987);
Thompson et al., Cell 5:313-321 (1989); each of which is
incorporated by reference herein in its entirety). For example, a
mutant, non-functional polynucleotide of the invention (or a
completely unrelated DNA sequence) flanked by DNA homologous to the
endogenous polynucleotide sequence (either the coding regions or
regulatory regions of the gene) can be used, with or without a
selectable marker and/or a negative selectable marker, to transfect
cells that express polypeptides of the invention in vivo. In
another embodiment, techniques known in the art are used to
generate knockouts in cells that contain, but do not express the
gene of interest. Insertion of the DNA construct, via targeted
homologous recombination, results in inactivation of the targeted
gene. Such approaches are particularly suited in research and
agricultural fields where modifications to embryonic stem cells can
be used to generate animal offspring with an inactive targeted gene
(e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra).
However this approach can be routinely adapted for use in humans
provided the recombinant DNA constructs are directly administered
or targeted to the required site in vivo using appropriate viral
vectors that will be apparent to those of skill in the art. The
contents of each of the documents recited in this paragraph is
herein incorporated by reference in its entirety.
[0353] In other embodiments, antagonists according to the present
invention include soluble forms of Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV (e.g., fragments of Neutrokine-.alpha. shown
in FIGS. 1A-B that include the ligand binding domain, TNF conserved
domain, and/or extracellular domain of Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV and fragments of Neutrokine-.alpha.SV shown in
FIGS. 5A-B that include the ligand binding domain, TNF conserved
domain, and/or extracellular domain of Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV). Such soluble forms of the Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV, which may be naturally occurring or
synthetic, antagonize Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV mediated signaling by competing with native
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV for binding to
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV receptors (e.g., DR5
(See, International Publication No. WO 98/41629), TR10 (See,
International Publication No. WO 98/54202), 312C2 (See,
International Publication No. WO 98/06842), and TR11, TR11SV1, and
TR11SV2 (See, U.S. application Ser. No. 09/176,200, now U.S. Pat.
No. 6,509,173)), and/or by forming a multimer that may or may not
be capable of binding the receptor, but which is incapable of
inducing signal transduction. Preferably, these antagonists inhibit
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV mediated stimulation
of lymphocyte (e.g., B-cell) proliferation, differentiation, and/or
activation. Antagonists of the present invention also include
antibodies specific for TNF-family ligands and
Neutrokine-.alpha.-Fc and/or Neutrokine-.alpha.SV-Fc fusion
proteins.
[0354] By a "TNF-family ligand" is intended naturally occurring,
recombinant, and synthetic ligands that are capable of binding to a
member of the TNF receptor family and inducing and/or blocking the
ligand/receptor signaling pathway. Members of the TNF ligand family
include, but are not limited to, TNF-.alpha., lymphotoxin-.alpha.
(LT-.alpha., also known as TNF-b), LT-b (found in complex
heterotrimer LT-a2-b), FasL, CD40L, CD27L, CD30L, 4-1BBL, OX40L and
nerve growth factor (NGF). In preferred embodiments, the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV TNF-family ligands
of the invention are DR5 (See, International Publication No. WO
98/41629), TR10 (See, International Publication No. WO 98/54202),
312C2 (See, International Publication No. WO 98/06842), and TR11,
TR11SV1, and TR11SV2 (See, U.S. application Ser. No. 09/176,200,
now U.S. Pat. No. 6,509,173).
[0355] Antagonists of the present invention also include antibodies
specific for TNF-family receptors or the Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV polypeptides of the invention. Antibodies
according to the present invention may be prepared by any of a
variety of standard methods using Neutrokine-a and/or
Neutrokine-aSV immunogens of the present invention. As indicated,
such Neutrokine-.alpha. and/or Neutrokine-.alpha.SV immunogens
include the complete Neutrokine-.alpha. and Neutrokine-.alpha.SV
polypeptides depicted in FIGS. 1A-B (SEQ ID NO:2) and FIGS. 5A-B
(SEQ ID NO:19), respectively, (which may or may not include the
leader sequence) and Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptide fragments comprising, for example, the ligand binding
domain, TNF-conserved domain, extracellular domain, transmembrane
domain, and/or intracellular domain, or any combination
thereof.
[0356] Polyclonal and monoclonal antibody agonists or antagonists
according to the present invention can be raised according to the
methods disclosed in Tartaglia and Goeddel, J. Biol. Chem.
267(7):4304-4307(1992)); Tartaglia et al., Cell 73:213-216 (1993)),
and PCT Application WO 94/09137 and are preferably specific to
(i.e., bind uniquely to polypeptides of the invention having the
amino acid sequence of SEQ ID NO:2. The term "antibody" (Ab) or
"monoclonal antibody" (mAb) as used herein is meant to include
intact molecules as well as fragments thereof (such as, for
example, Fab and F(ab') fragments) which are capable of binding an
antigen. Fab, Fab' and F(ab') fragments lack the Fc fragment intact
antibody, clear more rapidly from the circulation, and may have
less non-specific tissue binding of an intact antibody (Wahl et
al., J. Nucl. Med., 24:316-325 (1983)).
[0357] In a preferred method, antibodies according to the present
invention are mAbs. Such mAbs can be prepared using hybridoma
technology (Kohler and Millstein, Nature 256:495-497 (1975) and
U.S. Pat. No. 4,376,110; Harlow et al., Antibodies: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y., 1988; Monoclonal Antibodies and Hybridomas: A New Dimension
in Biological Analyses, Plenum Press, New York, N.Y., 1980;
Campbell, "Monoclonal Antibody Technology," In: Laboratory
Techniques in Biochemistry and Molecular Biology, Volume 13 (Burdon
et al., eds.), Elsevier, Amsterdam (1984)).
[0358] Proteins and other compounds which bind the
Neutrokine-.alpha. and/or Neutrokine-aSV domains are also candidate
agonists and antagonists according to the present invention. Such
binding compounds can be "captured" using the yeast two-hybrid
system (Fields and Song, Nature 340:245-246 (1989)). A modified
version of the yeast two-hybrid system has been described by Roger
Brent and his colleagues (Gyuris, Cell 75:791-803 (1993); Zervos et
al., Cell 72:223-232 (1993)). Preferably, the yeast two-hybrid
system is used according to the present invention to capture
compounds which bind to the ligand binding domain, extracellular,
intracellular, transmembrane, and death domain of the
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV. Such compounds are
good candidate agonists and antagonists of the present
invention.
[0359] For example, using the two-hybrid assay described above, the
extracellular or intracellular domain of the Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV receptor, or a portion thereof, may be
used to identify cellular proteins which interact with
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV the receptor in
vivo. Such an assay may also be used to identify ligands with
potential agonistic or antagonistic activity of Neutrokine-a and/or
Neutrokine-aSV receptor function. This screening assay has
previously been used to identify protein which interact with the
cytoplasmic domain of the murine TNF-RII and led to the
identification of two receptor associated proteins. Rothe et al.,
Cell 78:681 (1994). Such proteins and amino acid sequences which
bind to the cytoplasmic domain of the Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV receptors are good candidate agonist and
antagonist of the present invention.
[0360] Other screening techniques include the use of cells which
express the polypeptide of the present invention (for example,
transfected CHO cells) in a system which measures extracellular pH
changes caused by receptor activation, for example, as described in
Science, 246:181-296 (1989). In another example, potential agonists
or antagonists may be contacted with a cell which expresses the
polypeptide of the present invention and a second messenger
response, e.g., signal transduction may be measured to determine
whether the potential antagonist or agonist is effective.
[0361] Agonist according to the present invention include naturally
occurring and synthetic compounds such as, for example, TNF family
ligand peptide fragments, transforming growth factor,
neurotransmitters (such as glutamate, dopamine,
N-methyl-D-aspartate), tumor suppressors (p53), cytolytic T cells
and antimetabolites. Preferred agonists include chemotherapeutic
drugs such as, for example, cisplatin, doxorubicin, bleomycin,
cytosine arabinoside, nitrogen mustard, methotrexate and
vincristine. Others include ethanol and -amyloid peptide. (Science
267:1457-1458 (1995)).
[0362] Preferred agonists are fragments of Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV polypeptides of the invention which
stimulate lymphocyte (e.g, B cell) proliferation, differentiation
and/or activation. Further preferred agonists include polyclonal
and monoclonal antibodies raised against the Neutrokine-.alpha.
and/or Neutrokine-.alpha.SV polypeptides of the invention, or a
fragment thereof. Such agonist antibodies raised against a
TNF-family receptor are disclosed in Tartaglia et al., Proc. Natl.
Acad. Sci. USA 88:9292-9296 (1991); and Tartaglia et al., J. Biol.
Chem. 267:4304-4307(1992). See, also, PCT Application WO
94/09137.
[0363] In further embodiments of the invention, cells that are
genetically engineered to express the polypeptides of the
invention, or alternatively, that are genetically engineered not to
express the polypeptides of the invention (e.g., knockouts) are
administered to a patient in vivo. Such cells may be obtained from
the patient (i.e., animal, including human) or an MHC compatible
donor and can include, but are not limited to fibroblasts, bone
marrow cells, blood cells (e.g., lymphocytes), adipocytes, muscle
cells, endothelial cells etc. The cells are genetically engineered
in vitro using recombinant DNA techniques to introduce the coding
sequence of polypeptides of the invention into the cells, or
alternatively, to disrupt the coding sequence and/or endogenous
regulatory sequence associated with the polypeptides of the
invention, e.g., by transduction (using viral vectors, and
preferably vectors that integrate the transgene into the cell
genome) or transfection procedures, including, but not limited to,
the use of plasmids, cosmids, YACs, naked DNA, electroporation,
liposomes, etc. The coding sequence of the polypeptides of the
invention can be placed under the control of a strong constitutive
or inducible promoter or promoter/enhancer to achieve expression,
and preferably secretion, of the polypeptides of the invention. The
engineered cells which express and preferably secrete the
polypeptides of the invention can be introduced into the patient
systemically, e.g., in the circulation, or intraperitoneally.
[0364] Alternatively, the cells can be incorporated into a matrix
and implanted in the body, e.g., genetically engineered fibroblasts
can be implanted as part of a skin graft; genetically engineered
endothelial cells can be implanted as part of a lymphatic or
vascular graft. (See, for example, Anderson et al. U.S. Pat. No.
5,399,349; and Mulligan & Wilson, U.S. Pat. No. 5,460,959 each
of which is incorporated by reference herein in its entirety).
[0365] When the cells to be administered are non-autologous or
non-MHC compatible cells, they can be administered using well known
techniques which prevent the development of a host immune response
against the introduced cells. For example, the cells may be
introduced in an encapsulated form which, while allowing for an
exchange of components with the immediate extracellular
environment, does not allow the introduced cells to be recognized
by the host immune system.
[0366] In yet another embodiment of the invention, the activity of
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide can be
reduced using a "dominant negative." To this end, constructs which
encode defective Neutrokine-.alpha. and/or Neutrokine-.alpha.SV
polypeptide, such as, for example, mutants lacking all or a portion
of the TNF-conserved domain, can be used in gene therapy approaches
to diminish the activity of Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV on appropriate target cells. For example,
nucleotide sequences that direct host cell expression of
Neutrokine-.alpha. and/or Neutrokine-.alpha.SV polypeptide in which
all or a portion of the TNF-conserved domain is altered or missing
can be introduced into monocytic cells or other cells or tissues
(either by in vivo or ex vivo gene therapy methods described herein
or otherwise known in the art). Alternatively, targeted homologous
recombination can be utilized to introduce such deletions or
mutations into the subject's endogenous Neutrokine-.alpha. and/or
Neutrokine-.alpha.SV gene in monocytes. The engineered cells will
express non-functional Neutrokine-.alpha. and/or Neutrokine-aSV
polypeptides (i.e., a ligand (e.g., multimer) that may be capable
of binding, but which is incapable of inducing signal
transduction).
[0367] Chromosome Assays
[0368] The nucleic acid molecules of the present invention are also
valuable for chromosome identification. The sequence is
specifically targeted to and can hybridize with a particular
location on an individual human chromosome. Moreover, there is a
current need for identifying particular sites on the chromosome.
Few chromosome marking reagents based on actual sequence data
(repeat polymorphisms) are presently available for marking
chromosomal location. The mapping of DNAs to chromosomes according
to the present invention is an important first step in correlating
those sequences with genes associated with disease.
[0369] In certain preferred embodiments in this regard, the cDNA
and/or polynucleotides herein disclosed is used to clone genomic
DNA of a Neutrokine-.alpha. and/or Neutrokine-aSV gene. This can be
accomplished using a variety of well known techniques and
libraries, which generally are available commercially. The genomic
DNA then is used for in situ chromosome mapping using well known
techniques for this purpose.
[0370] In addition, in some cases, sequences can be mapped to
chromosomes by preparing PCR primers (preferably 15-25 bp) from the
cDNA. Computer analysis of the 3' untranslated region of the gene
is used to rapidly select primers that do not span more than one
exon in the genomic DNA, thus complicating the amplification
process. These primers are then used for PCR screening of somatic
cell hybrids containing individual human chromosomes. Fluorescence
in situ hybridization ("FISH") of a cDNA clone to a metaphase
chromosomal spread can be used to provide a precise chromosomal
location in one step. This technique can be used with probes from
the cDNA as short as 50 or 60 bp. For a review of this technique,
see Verma et al., Human Chromosomes: A Manual Of Basic Techniques,
Pergamon Press, New York (1988).
[0371] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance In Man, available
on-line through Johns Hopkins University, Welch Medical Library.
The relationship between genes and diseases that have been mapped
to the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0372] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0373] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0374] Utilizing the techniques described above, the chromosomal
location of Neutrokine-a and Neutrokine-aSV was determined with
high confidence using a combination of somatic cell hybrids and
radiation hybrids to chromosome position 13q34.
EXAMPLES
[0375] Having generally described the invention, the same will be
more readily understood by reference to the following examples,
which are provided by way of illustration and are not intended as
limiting. Many of the following examples are set forth referring
specifically to Neutrokine-a polynucleotides and polypeptides of
the invention. Each example may also be practised to generate
and/or examine Neutrokine-aSV polynucleotides and/or polypeptides
of the invention. One of ordinary skill in the art would easily be
able to direct the following examples to Neutrokine-aSV.
Example 1a
Expression and Purification of "His-Tagged" Neutrokine-a in E.
coli
[0376] The bacterial expression vector pQE9 (pD10) is used for
bacterial expression in this example. (QIAGEN, Inc., supra). pQE9
encodes ampicillin antibiotic resistance ("Ampr") and contains a
bacterial origin of replication ("ori"), an IPTG inducible
promoter, a ribosome binding site ("RBS"), six codons encoding
histidine residues that allow affinity purification using
nickel-nitrilo-tri-acetic acid ("Ni-NTA") affinity resin sold by
QIAGEN, Inc., supra, and suitable single restriction enzyme
cleavage sites. These elements are arranged such that an inserted
DNA fragment encoding a polypeptide expresses that polypeptide with
the six His residues (i.e., a "6.times.His tag") covalently linked
to the amino terminus of that polypeptide.
[0377] The DNA sequence encoding the desired portion of the
Neurokine-a protein comprising the extracellular domain sequence is
amplified from the deposited cDNA clone using PCR oligonucleotide
primers which anneal to the amino terminal sequences of the desired
portion of the Neurokine-a protein and to sequences in the
deposited construct 3' to the cDNA coding sequence. Additional
nucleotides containing restriction sites to facilitate cloning in
the pQE9 vector are added to the 5' and 3' primer sequences,
respectively.
[0378] For cloning the extracellular domain of the protein, the 5'
primer has the sequence 5' GTG GGA TCC AGC CTC CGG GCA GAG CTG-3'
(SEQ ID NO:10) containing the underlined Bam HI restriction site
followed by 18 nucleotides of the amino terminal coding sequence of
the extracellular domain of the Neurokine-a sequence in FIGS. 1A
and 1B. One of ordinary skill in the art would appreciate, of
course, that the point in the protein coding sequence where the 5'
primer begins may be varied to amplify a DNA segment encoding any
desired portion of the complete Neutrokine a protein shorter or
longer than the extracellular domain of the form. The 3' primer has
the sequence 5'-GTG AAG CTT TTA TTA CAG CAG TTT CAA TGC ACC-3' (SEQ
ID NO:11) containing the underlined Hind III restriction site
followed by two stop codons and 18 nucleotides complementary to the
3' end of the coding sequence of the Neurokine-a DNA sequence in
FIGS. 1A and 1B.
[0379] The amplified Neurokine-a DNA fragment and the vector pQE9
are digested with Bam HI and Hind III and the digested DNAs are
then ligated together. Insertion of the Neurokine-a DNA into the
restricted pQE9 vector places the Neurokine-a protein coding region
downstream from the IPTG-inducible promoter and in-frame with an
initiating AUG and the six histidine codons.
[0380] The ligation mixture is transformed into competent E. coli
cells using standard procedures such as those described in Sambrook
et al., Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). E.
coli strain M15/rep4, containing multiple copies of the plasmid
pREP4, which expresses the lac repressor and confers kanamycin
resistance ("Kan.sup.r"), is used in carrying out the illustrative
example described herein. This strain, which is only one of many
that are suitable for expressing Neurokine-a protein, is available
commercially from QIAGEN, Inc., supra. Transformants are identified
by their ability to grow on LB plates in the presence of ampicillin
and kanamycin. Plasmid DNA is isolated from resistant colonies and
the identity of the cloned DNA confirmed by restriction analysis,
PCR and DNA sequencing. Clones containing the desired constructs
are grown overnight ("O/N") in liquid culture in LB media
supplemented with both ampicillin (100 .mu.g/ml) and kanamycin (25
.mu.g/ml). The O/N culture is used to inoculate a large culture, at
a dilution of approximately 1:25 to 1:250. The cells are grown to
an optical density at 600 nm ("OD600") of between 0.4 and 0.6.
Isopropyl-.beta.-D-thiogalactopyranoside ("IPTG") is then added to
a final concentration of 1 mM to induce transcription from the lac
repressor sensitive promoter, by inactivating the lacI repressor.
Cells subsequently are incubated further for 3 to 4 hours. Cells
then are harvested by centrifugation.
[0381] The cells are then stirred for 3-4 hours at 4.degree. C. in
6M guanidine-HCl, pH 8. The cell debris is removed by
centrifugation, and the supernatant containing the Neurokine-a is
loaded onto a nickel-nitrilo-tri-acetic acid ("Ni-NTA") affinity
resin column (available from QIAGEN, Inc., supra). Proteins with a
6.times.His tag bind to the Ni-NTA resin with high affinity and can
be purified in a simple one-step procedure (for details see: The
QIAexpressionist, 1995, QIAGEN, Inc., supra). Briefly the
supernatant is loaded onto the column in 6 M guanidine-HCl, pH 8,
the column is first washed with 10 volumes of 6 M guanidine-HCl, pH
8, then washed with 10 volumes of 6 M guanidine-HCl pH 6, and
finally the Neurokine-a is eluted with 6 M guanidine-HCl, pH 5.
[0382] The purified protein is then renatured by dialyzing it
against phosphate-buffered saline (PBS) or 50 mM Na-acetate, pH 6
buffer plus 200 mM NaCl. Alternatively, the protein can be
successfully refolded while immobilized on the Ni-NTA column. The
recommended conditions are as follows: renature using a linear
6M-1M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl pH
7.4, containing protease inhibitors. The renaturation should be
performed over a period of 1.5 hours or more. After renaturation
the proteins can be eluted by the addition of 250 mM immidazole.
Immidazole is removed by a final dialyzing step against PBS or 50
mM sodium acetate pH 6 buffer plus 200 mM NaCl. The purified
protein is stored at 4.degree. C. or frozen at -80.degree. C.
Example 1b
Expression and Purification of Neutrokine-a in E. coli
[0383] The bacterial expression vector pQE60 is used for bacterial
expression in this example. (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, Calif., 91311). pQE60 encodes ampicillin antibiotic
resistance ("Ampr") and contains a bacterial origin of replication
("ori"), an IPTG inducible promoter, a ribosome binding site
("RBS"), six codons encoding histidine residues that allow affinity
purification using nickel-nitrilo-tri-acetic acid ("Ni-NTA")
affinity resin sold by QIAGEN, Inc., supra, and suitable single
restriction enzyme cleavage sites. These elements are arranged such
that a DNA fragment encoding a polypeptide may be inserted in such
as way as to produce that polypeptide with the six His residues
(i.e., a "6.times.His tag") covalently linked to the carboxyl
terminus of that polypeptide. However, in this example, the
polypeptide coding sequence is inserted such that translation of
the six His codons is prevented and, therefore, the polypeptide is
produced with no 6.times.His tag.
[0384] The DNA sequence encoding the desired portion of the
Neurokine-a protein comprising the extracellular domain sequence is
amplified from the deposited cDNA clone using PCR oligonucleotide
primers which anneal to the amino terminal sequences of the desired
portion of the Neurokine-a protein and to sequences in the
deposited construct 3' to the cDNA coding sequence. Additional
nucleotides containing restriction sites to facilitate cloning in
the pQE60 vector are added to the 5' and 3' sequences,
respectively.
[0385] For cloning the extracellular domain of the protein, the 5'
primer has the sequence 5' GTG TCA TGA GCC TCC GGG CAG AGC TG 3'
(SEQ ID NO:12) containing the underlined Bsp HI restriction site
followed by 17 nucleotides of the amino terminal coding sequence of
the extracellular domain of the Neurokine-a sequence in FIGS. 1A
and 1B. One of ordinary skill in the art would appreciate, of
course, that the point in the protein coding sequence where the 5'
primer begins may be varied to amplify a desired portion of the
complete protein shorter or longer than the extracellular domain of
the form. The 3' primer has the sequence 5'-GTG AAG CTT TTA TTA CAG
CAG TTT CAA TGC ACC 3' (SEQ ID NO:13) containing the underlined
Hind III restriction site followed by two stop codons and 18
nucleotides complementary to the 3' end of the coding sequence in
the Neurokine-a DNA sequence in FIGS. 1A and 1B.
[0386] The amplified Neurokine-a DNA fragments and the vector pQE60
are digested with Bsp HI and Hind III and the digested DNAs are
then ligated together. Insertion of the Neurokine-a DNA into the
restricted pQE60 vector places the Neurokine-a protein coding
region including its associated stop codon downstream from the
IPTG-inducible promoter and in-frame with an initiating AUG. The
associated stop codon prevents translation of the six histidine
codons downstream of the insertion point.
[0387] The ligation mixture is transformed into competent E. coli
cells using standard procedures such as those described in Sambrook
et al., Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). E.
coli strain M15/rep4, containing multiple copies of the plasmid
pREP4, which expresses the lac repressor and confers kanamycin
resistance ("Kanr"), is used in carrying out the illustrative
example described herein. This strain, which is only one of many
that are suitable for expressing Neurokine-a protein, is available
commercially from QIAGEN, Inc., supra. Transformants are identified
by their ability to grow on LB plates in the presence of ampicillin
and kanamycin. Plasmid DNA is isolated from resistant colonies and
the identity of the cloned DNA confirmed by restriction analysis,
PCR and DNA sequencing.
[0388] One of ordinary skill in the art recognizes that any of a
number of bacterial expression vectors may be useful in place of
pQE9 and pQE60 in the expression protocols presented in this
example. For example, the novel pHE4 series of bacterial expression
vectors, in particular, the pHE4-5 vector may be used for bacterial
expression in this example (ATCC Accession No. 209311; and
variations thereof). The plasmid DNA designated pHE4-5/MPIFD23 in
ATCC Deposit No. 209311 is vector plasmid DNA which contains an
insert which encodes another ORF. The construct was deposited with
the American Type Culture Collection, 10801 University Boulevard,
Manassas, Va. 20110-2209, on Sep. 30, 1997. Using the Nde I and Asp
718 restriction sites flanking the irrelevant MPIF ORF insert, one
of ordinary skill in the art could easily use current molecular
biological techniques to replace the irrelevant ORF in the pHE4-5
vector with the Neutrokine-a ORF of the present invention.
[0389] The pHE4-5 bacterial expression vector includes a neomycin
phosphotransferase gene for selection, an E. coli origin of
replication, a T5 phage promoter sequence, two lac operator
sequences, a Shine-Delgarno sequence, and the lactose operon
repressor gene (lacIq). These elements are arranged such that an
inserted DNA fragment encoding a polypeptide expresses that
polypeptide with the six His residues (i.e., a "6.times.His tag")
covalently linked to the amino terminus of that polypeptide. The
promoter and operator sequences of the pHE4-5 vector were made
synthetically. Synthetic production of nucleic acid sequences is
well known in the art (CLONETECH 95/96 Catalog, pages 215-216,
CLONETECH, 1020 East Meadow Circle, Palo Alto, Calif. 94303).
[0390] Clones containing the desired Neutrokine-a constructs are
grown overnight ("O/N") in liquid culture in LB media supplemented
with both ampicillin (100 .mu.g/ml) and kanamycin (25 .mu.g/ml).
The O/N culture is used to inoculate a large culture, at a dilution
of approximately 1:25 to 1:250. The cells are grown to an optical
density at 600 nm ("OD600") of between 0.4 and 0.6.
isopropyl-b-D-thiogalactopyranoside ("IPTG") is then added to a
final concentration of 1 mM to induce transcription from the lac
repressor sensitive promoter, by inactivating the lacI repressor.
Cells subsequently are incubated further for 3 to 4 hours. Cells
then are harvested by centrifugation.
[0391] The cells are then stirred for 3-4 hours at 4.degree. C. in
6M guanidine-HCl, pH 8. The cell debris is removed by
centrifugation, and the supernatant containing the Neutrokine a is
dialyzed against 50 mM Na-acetate buffer pH 6, supplemented with
200 mM NaCl. Alternatively, the protein can be successfully
refolded by dialyzing it against 500 mM NaCl, 20% glycerol, 25 mM
Tris/HCl pH 7.4, containing protease inhibitors. After renaturation
the protein can be purified by ion exchange, hydrophobic
interaction and size exclusion chromatography. Alternatively, an
affinity chromatography step such as an antibody column can be used
to obtain pure Neurokine-a protein. The purified protein is stored
at 4.degree. C. or frozen at -80.degree. C.
[0392] In certain embodiments, it is preferred to generate
expression constructs as detailed in this Example to mutate one or
more of the three cysteine residues in the Neutrokine-a polypeptide
sequence. The cysteine residues in the Neutrokine-a polypeptide
sequence are located at positions 147, 232, and 245 as shown in SEQ
ID NO:2 and at positions 213 and 226 of the Neutrokine-a
polypeptide sequence as shown in SEQ ID NO:19 (there is no cysteine
in the Neutrokine-aSV polypeptide sequence which corresponds to
Cys-147 in the Neutrokine-a polypeptide sequence because amino acid
residues 143-160 of the Neutrokine-a polypeptide sequence are not
present in the Neutrokine-aSV polypeptide sequence).
Example 2
Cloning and Expression of Neutrokine-a Protein in a Baculovirus
Expression System
[0393] In this illustrative example, the plasmid shuttle vector
pA2GP is used to insert the cloned DNA encoding the extracellular
domain of the protein, lacking its naturally associated
intracellular and transmembrane sequences, into a baculovirus to
express the extracellular domain of the Neurokine-a protein, using
a baculovirus leader and standard methods as described in Summers
et al., A Manual of Methods for Baculovirus Vectors and Insect Cell
Culture Procedures, Texas Agricultural Experimental Station
Bulletin No. 1555 (1987). This expression vector contains the
strong polyhedrin promoter of the Autographa californica nuclear
polyhedrosis virus (AcMNPV) followed by the secretory signal
peptide (leader) of the baculovirus gp67 protein and convenient
restriction sites such as Bam HI, Xba I and Asp 718. The
polyadenylation site of the simian virus 40 ("SV40") is used for
efficient polyadenylation. For easy selection of recombinant virus,
the plasmid contains the beta-galactosidase gene from E. coli under
control of a weak Drosophila promoter in the same orientation,
followed by the polyadenylation signal of the polyhedrin gene. The
inserted genes are flanked on both sides by viral sequences for
cell-mediated homologous recombination with wild-type viral DNA to
generate viable virus that expresses the cloned polynucleotide.
[0394] Many other baculovirus vectors could be used in place of the
vector above, such as pAc373, pVL941 and pAcIM1, as one skilled in
the art would readily appreciate, as long as the construct provides
appropriately located signals for transcription, translation,
secretion and the like, including a signal peptide and an in-frame
AUG as required. Such vectors are described, for instance, in
Luckow et al., Virology 170:31-39 (1989).
[0395] The cDNA sequence encoding an N-terminally deleted form of
the extracellular domain of the Neurokine-a protein in the
deposited clone, lacking the AUG initiation codon, the naturally
associated intracellular and transmembrane domain sequences, and
amino acids Gln-73 through Leu-79 shown in FIGS. 1A and 1B (SEQ ID
NO:2), is amplified using PCR oligonucleotide primers corresponding
to the 5' and 3' sequences of the gene. The 5' primer has the
sequence 5'-GTG GGA TCC CCG GGC AGA GCT GCA GGG C-3' (SEQ ID NO:14)
containing the underlined Bam HI restriction enzyme site followed
by 18 nucleotides of the sequence of the extracellular domain of
the Neurokine-a protein shown in FIGS. 1A and 1B, beginning with
the indicated N-terminus of the extracellular domain of the
protein. The 3' primer has the sequence 5'-GTG GGA TCC TTA TTA CAG
CAG TTT CAA TGC ACC-3' (SEQ ID NO:15) containing the underlined Bam
HI restriction site followed by two stop codons and 18 nucleotides
complementary to the 3' coding sequence in FIGS. 1A and 1B.
[0396] In certain other embodiments, constructs designed to express
the entire predicted extracellular domain of the Neutrokine-a
(i.e., amino acid residues Gln-73 through Leu-285) are preferred.
One of skill in the art would be able to use the polynucleotide and
polypeptide sequences provided as SEQ ID NO:1 and SEQ ID NO:2,
respectively, to design polynucleotide primers to generate such a
clone.
[0397] In a further preferred embodiment, a pA2GP expression
construct encodes amino acid residues Leu-112 through Leu-285 of
the Neutrokine-a polypeptide sequence shown as SEQ ID NO:2.
[0398] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("Geneclean," BIO 101 Inc., La
Jolla, Calif.). The fragment then is digested with Bam HI and again
is purified on a 1% agarose gel. This fragment is designated herein
Fl.
[0399] The plasmid is digested with the restriction enzymes Bam HI
and optionally, can be dephosphorylated using calf intestinal
phosphatase, using routine procedures known in the art. The DNA is
then isolated from a 1% agarose gel using a commercially available
kit ("Geneclean" BIO 101 Inc., La Jolla, Calif.). This vector DNA
is designated herein "VI".
[0400] Fragment F1 and the dephosphorylated plasmid V1 are ligated
together with T4 DNA ligase. E. coli HB101 or other suitable E.
coli hosts such as XL-1 Blue (Statagene Cloning Systems, La Jolla,
Calif.) cells are transformed with the ligation mixture and spread
on culture plates. Bacteria are identified that contain the plasmid
with the human Neurokine-a gene by digesting DNA from individual
colonies using Bam HI and then analyzing the digestion product by
gel electrophoresis. The sequence of the cloned fragment is
confirmed by DNA sequencing. This plasmid is designated herein
pA2GP-Neutrokine-a.
[0401] Five .mu.g of the plasmid pA2GP-Neutrokine-a is
co-transfected with 1.0 .mu.g of a commercially available
linearized baculovirus DNA ("BaculoGold.TM. baculovirus DNA",
Pharmingen, San Diego, Calif.), using the lipofection method
described by Felgner et al., Proc. Natl. Acad. Sci. USA 84:
7413-7417 (1987). One .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g
of the plasmid pA2GP Neurokine-a are mixed in a sterile well of a
microtiter plate containing 50 .mu.l of serum-free Grace's medium
(Life Technologies Inc., Gaithersburg, Md.). Afterwards, 10 .mu.l
Lipofectin plus 90 .mu.l Grace's medium are added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture is added drop-wise to Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate is then incubated for 5 hours at
27.degree. C. The transfection solution is then removed from the
plate and 1 ml of Grace's insect medium supplemented with 10% fetal
calf serum is added. Cultivation is then continued at 27.degree. C.
for four days.
[0402] After four days the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, supra. An
agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg)
is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. (A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10). After appropriate incubation, blue stained plaques are
picked with the tip of a micropipettor (e.g., Eppendorf). The agar
containing the recombinant viruses is then resuspended in a
microcentrifuge tube containing 200 .mu.l of Grace's medium and the
suspension containing the recombinant baculovirus is used to infect
Sf9 cells seeded in 35 mm dishes. Four days later the supernatants
of these culture dishes are harvested and then they are stored at
4.degree. C. The recombinant virus is called V-Neurokine-a.
[0403] To verify the expression of the Neurokine-a gene Sf9 cells
are grown in Grace's medium supplemented with 10% heat-inactivated
FBS. The cells are infected with the recombinant baculovirus
V-Neurokine-a at a multiplicity of infection ("MOI") of about 2. If
radiolabeled proteins are desired, 6 hours later the medium is
removed and is replaced with SF900 II medium minus methionine and
cysteine (available from Life Technologies Inc., Rockville, Md.).
After 42 hours, 5 .mu.Ci of .sup.35S-methionine and 5 .mu.Ci
.sup.35S-cysteine (available from Amersham) are added. The cells
are further incubated for 16 hours and then are harvested by
centrifugation. The proteins in the supernatant as well as the
intracellular proteins are analyzed by SDS-PAGE followed by
autoradiography (if radiolabeled).
[0404] Microsequencing of the amino acid sequence of the amino
terminus of purified protein may be used to determine the amino
terminal sequence of the extracellular domain of the protein and
thus the cleavage point and length of the secretory signal
peptide.
[0405] In a specific experimental example, recombinant Neutrokine-a
was purified from baculovirus infected Sf9 cell supernatants as
follows. The insect cells were grown in EXCEL401 medium (JRH
Scientific) with 1% (v/v) fetal bovine serum. At 92 hours
post-infection, the harvested supernatant was clarified by
centrifugation at 18,000.times.g followed by 0.45 m depth
filtration. A de-lipid filtration step might be also used to remove
the lipid contaminants and in turn to improve initial capturing of
the Neutrokine-a protein.
[0406] The supernatant was loaded onto a set of poros HS-50/HQ-50
in tandem mode. As alternatives, Toyopearl QAE, Toyopearl Super Q
(Tosohass), Q-Sepharose (Pharmacia) and equivalent resins might be
used. This step is used as a negative purification step to remove
strong anion binding contaminants. The HS/HQ flow through material
was adjusted to pH 7.5 with 1 M Tris-HCl pH 8, diluted with equal
volume of 50 mM Tris-HCl pH 8, and loaded onto a poros PI-20 or
PI-50 column. The PI column was washed first with 4 column volumes
of 75 mM sodium chloride in 50 mM Tris-HCl at pH 7.5, then eluted
using 3 to 5 column volumes of a stepwise gradient of 300 mM, 750
mM, 1500 mM sodium chloride in 50 mM Tris-HCl pH 7.5. Neutrokine-a
protein appears as a 17 KD band on reduced SDS-PAGE and is present
in the 0.75 M to 1.5M Sodium chloride fractions.
[0407] The PI fraction was further purified through a Sephacryl
S100 HR (Pharmacia) size exclusion column equilibrated with 0.15 M
sodium chloride, 50 mM sodium acetate at pH 6. The S200 fractions
were mixed with sodium chloride to a final concentration of 3 M and
loaded onto a Toyopearl Hexyl 650C (Tosohass) column. The Hexyl
column was eluted with a linear gradient from 3 M to 0.05 M sodium
chloride in 50 mM Sodium acetate pH 6 in 5 to 15 column volumes.
The sodium chloride gradient can also be replaced by ammonium
sulfate gradient of 1M to 0 M in 50 mM sodium acetate pH 6 in the
Hexyl chromatographic step. Fractions containing purified
Neutrokine-a as analyzed through SDS-PAGE were combined and
dialyzed against a buffer containing 150 mM Sodium chloride, 50 mM
Sodium acetate, pH 6.
[0408] The final purified Neutrokine-a protein expressed in a
baculovirus system as explained herein has an N-terminus sequence
which begins with amino acid residue Ala-134 of SEQ ID NO:2.
RP-HPLC analysis shows a single peak of greater than 95% purity.
Endotoxin level was below the detection limit in LAL assay.
Example 3
Cloning and Expression of Neutrokine-a in Mammalian Cells
[0409] A typical mammalian expression vector contains the promoter
element, which mediates the initiation of transcription of mRNA,
the protein coding sequence, and signals required for the
termination of transcription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription can be achieved with the
early and late promoters from SV40, the long terminal repeats
(LTRs) from Retroviruses, e.g., RSV, HTLVI, HIVI and the early
promoter of the cytomegalovirus (CMV). However, cellular elements
can also be used (e.g., the human actin promoter). Suitable
expression vectors for use in practicing the present invention
include, for example, vectors such as pSVL and pMSG (Pharmacia,
Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and
pBC12MI (ATCC 67109). Mammalian host cells that could be used
include, human HeLa, 293, H9 and Jurkat cells, mouse NIH3T3 and
C127 cells, Cos 1, Cos 7 and CVI, quail QC1-3 cells, mouse L cells,
Chinese hamster ovary (CHO) cells, and HEK 293 cells.
[0410] Alternatively, the gene can be expressed in stable cell
lines that contain the gene integrated into a chromosome. The
co-transfection with a selectable marker such as dhfr, gpt,
neomycin, hygromycin allows the identification and isolation of the
transfected cells.
[0411] The transfected gene can also be amplified to express large
amounts of the encoded protein. The DHFR (dihydrofolate reductase)
marker is useful to develop cell lines that carry several hundred
or even several thousand copies of the gene of interest. Another
useful selection marker is the enzyme glutamine synthase (GS)
(Murphy et al., Biochem J. 227:277-279 (1991); Bebbington et al.,
Bio/Technology 10:169-175 (1992)). Using these markers, the
mammalian cells are grown in selective medium and the cells with
the highest resistance are selected. These cell lines contain the
amplified gene(s) integrated into a chromosome. Chinese hamster
ovary (CHO) and NSO cells are often used for the production of
proteins.
[0412] The expression vectors pC1 and pC4 contain the strong
promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular
and Cellular Biology, 438-447 (March, 1985)) plus a fragment of the
CMV-enhancer (Boshart et al., Cell 41:521-530 (1985)). Multiple
cloning sites, e.g., with the restriction enzyme cleavage sites Bam
FHI, Xba I and Asp 718, facilitate the cloning of the gene of
interest. The vectors contain in addition the 3' intron, the
polyadenylation and termination signal of the rat preproinsulin
gene.
Example 3(a)
Cloning and Expression in COS Cells
[0413] The expression plasmid, pNeurokine-a-HA, is made by cloning
a portion of the deposited cDNA encoding the extracellular domain
of the Neurokine-a protein into the expression vector pcDNAI/Amp or
pcDNAIII (which can be obtained from Invitrogen, Inc.). To produce
a soluble, secreted form of the polypeptide, the extracellular
domain is fused to the secretory leader sequence of the human IL-6
gene.
[0414] The expression vector pcDNAI/amp contains: (1) an E. coli
origin of replication effective for propagation in E. coli and
other prokaryotic cells; (2) an ampicillin resistance gene for
selection of plasmid-containing prokaryotic cells; (3) an SV40
origin of replication for propagation in eukaryotic cells; (4) a
CMV promoter, a polylinker, an SV40 intron; (5) several codons
encoding a hemagglutinin fragment (i.e., an "HA" tag to facilitate
purification) followed by a termination codon and polyadenylation
signal arranged so that a cDNA can be conveniently placed under
expression control of the CMV promoter and operably linked to the
SV40 intron and the polyadenylation signal by means of restriction
sites in the polylinker. The HA tag corresponds to an epitope
derived from the influenza hemagglutinin protein described by
Wilson et al., Cell 37: 767 (1984). The fusion of the HA tag to the
target protein allows easy detection and recovery of the
recombinant protein with an antibody that recognizes the HA
epitope. pcDNAIII contains, in addition, the selectable neomycin
marker.
[0415] A DNA fragment encoding the extracellular domain of the
Neurokine-a polypeptide is cloned into the polylinker region of the
vector so that recombinant protein expression is directed by the
CMV promoter. The plasmid construction strategy is as follows. The
Neurokine-a cDNA of the deposited clone is amplified using primers
that contain convenient restriction sites, much as described above
for construction of vectors for expression of Neurokine-a in E.
coli. Suitable primers include the following, which are used in
this example. The 5' primer, containing the underlined Bam HI site,
a Kozak sequence, an AUG start codon, a sequence encoding the
secretory leader peptide from the human IL-6 gene, and 18
nucleotides of the 5' coding region of the extracellular domain of
Neurokine-a protein, has the following sequence: 5'-GCG GGA TCC GCC
ACC ATG AAC TCC TTC TCC ACA AGC GCC TTC GGT CCA GTT GCC TTC TCC CTG
GGG CTG CTC CTG GTG TTG CCT GCT GCC TTC CCT GCC CCA GTT GTG AGA CAA
GGG GAC CTG GCC AGC-3' (SEQ ID NO:16). The 3' primer, containing
the underlined Bam HI restriction site and 18 of nucleotides
complementary to the 3' coding sequence immediately before the stop
codon, has the following sequence: 5'-GTG GGA TCC TTA CAG CAG TTT
CAA TGC ACC-3' (SEQ ID NO:17).
[0416] The PCR amplified DNA fragment and the vector, pcDNAI/Amp,
are digested with Bam HI and then ligated. The ligation mixture is
transformed into E. coli strain SURE (available from Stratagene
Cloning Systems, 11099 North Torrey Pines Road, La Jolla, Calif.
92037), and the transformed culture is plated on ampicillin media
plates which then are incubated to allow growth of ampicillin
resistant colonies. Plasmid DNA is isolated from resistant colonies
and examined by restriction analysis or other means for the
presence of the fragment encoding the Neutrokine-a extracellular
domain.
[0417] For expression of recombinant Neurokine-a, COS cells are
transfected with an expression vector, as described above, using
DEAE-DEXTRAN, as described, for instance, in Sambrook et al.,
Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory
Press, Cold Spring Harbor, N.Y. (1989). Cells are incubated under
conditions for expression of Neurokine-a by the vector.
[0418] Expression of the Neurokine-a-HA fusion protein is detected
by radiolabeling and immunoprecipitation, using methods described
in, for example Harlow et al., Antibodies: A Laboratory Manual, 2nd
Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1988). To this end, two days after transfection, the cells are
labeled by incubation in media containing .sup.35S-cysteine for 8
hours. The cells and the media are collected, and the cells are
washed and the lysed with detergent-containing RIPA buffer: 150 mM
NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5,
as described by Wilson et al. cited above. Proteins are
precipitated from the cell lysate and from the culture media using
an HA-specific monoclonal antibody. The precipitated proteins then
are analyzed by SDS-PAGE and autoradiography. An expression product
of the expected size is seen in the cell lysate, which is not seen
in negative controls.
Example 3(b)
Cloning and Expression in CHO Cells
[0419] The vector pC4 is used for the expression of Neurokine-a
protein. Plasmid pC4 is a derivative of the plasmid pSV2-dhfr (ATCC
Accession No. 37146). To produce a soluble, secreted form of the
Neurokine-a polypeptide, the portion of the deposited cDNA encoding
the extracellular domain is fused to the secretory leader sequence
of the human IL-6 gene. The vector plasmid contains the mouse DHFR
gene under control of the SV40 early promoter. Chinese hamster
ovary- or other cells lacking dihydrofolate activity that are
transfected with these plasmids can be selected by growing the
cells in a selective medium (alpha minus MEM, Life Technologies)
supplemented with the chemotherapeutic agent methotrexate. The
amplification of the DHFR genes in cells resistant to methotrexate
(MTX) has been well documented (see, e.g., Alt, F. W., Kellems, R.
M., Bertino, J. R., and Schimke, R. T., 1978, J. Biol. Chem.
253:1357-1370, Hamlin, J. L. and Ma, C. 1990, Biochem. et Biophys.
Acta, 1097:107-143, Page, M. J. and Sydenham, M. A. 1991,
Biotechnology 9:64-68). Cells grown in increasing concentrations of
MTX develop resistance to the drug by overproducing the target
enzyme, DHFR, as a result of amplification of the DHFR gene. If a
second gene is linked to the DHFR gene, it is usually co-amplified
and over-expressed. It is known in the art that this approach may
be used to develop cell lines carrying more than 1,000 copies of
the amplified gene(s). Subsequently, when the methotrexate is
withdrawn, cell lines are obtained which contain the amplified gene
integrated into one or more chromosome(s) of the host cell.
[0420] Plasmid pC4 contains for expressing the gene of interest the
strong promoter of the long terminal repeat (LTR) of the Rouse
Sarcoma Virus (Cullen, et al., Molecular and Cellular Biology,
March 1985:438-447) plus a fragment isolated from the enhancer of
the immediate early gene of human cytomegalovirus (CMV) (Boshart et
al., Cell 41:521-530 (1985)). Downstream of the promoter are the
following single restriction enzyme cleavage sites that allow the
integration of the genes: BamHI, Xba I, and Asp718. Behind these
cloning sites the plasmid contains the 3' intron and
polyadenylation site of the rat preproinsulin gene. Other high
efficiency promoters can also be used for the expression, e.g., the
human B-actin promoter, the SV40 early or late promoters or the
long terminal repeats from other retroviruses, e.g., HIV and HTLVI.
Clontech's Tet-Off and Tet-On gene expression systems and similar
systems can be used to express the Neurokine-a in a regulated way
in mammalian cells (Gossen, M., & Bujard, H. 1992, Proc. Natl.
Acad. Sci. USA 89: 5547-5551). For the polyadenylation of the mRNA
other signals, e.g., from the human growth hormone or globin genes
can be used as well. Stable cell lines carrying a gene of interest
integrated into the chromosomes can also be selected upon
co-transfection with a selectable marker such as gpt, G418 or
hygromycin. It is advantageous to use more than one selectable
marker in the beginning, e.g., G418 plus methotrexate.
[0421] The plasmid pC4 is digested with the restriction enzymes Bam
HI and then dephosphorylated using calf intestinal phosphates by
procedures known in the art. The vector is then isolated from a 1%
agarose gel.
[0422] The DNA sequence encoding the extracellular domain of the
Neutrokine-a protein is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene. The 5'
primer, containing the underlined Bam HI site, a Kozak sequence, an
AUG start codon, a sequence encoding the secretory leader peptide
from the human IL-6 gene, and 18 nucleotides of the 5' coding
region of the extracellular domain of Neurokine-a protein, has the
following sequence: 5'-GCG GGA TCC GCC ACC ATG AAC TCC TTC TCC ACA
AGC GCC TTC GGT CCA GTT GCC TTC TCC CTG GGG CTG CTC CTG GTG TTG CCT
GCT GCC TTC CCT GCC CCA GTT GTG AGA CAA GGG GAC CTG GCC AGC-3' (SEQ
ID NO:16). The 3' primer, containing the underlined Bam HI and 18
of nucleotides complementary to the 3' coding sequence immediately
before the stop codon, has the following sequence: 5'-GTG GGA TCC
TTA CAG CAG TTT CAA TGC ACC-3' (SEQ ID NO:17).
[0423] The amplified fragment is digested with the endonuclease Bam
HI and then purified again on a 1% agarose gel. The isolated
fragment and the dephosphorylated vector are then ligated with T4
DNA ligase. E. coli HB101 or XL-1 Blue cells are then transformed
and bacteria are identified that contain the fragment inserted into
plasmid pC4 using, for instance, restriction enzyme analysis.
[0424] Chinese hamster ovary cells lacking an active DHFR gene are
used for transfection. Five .mu.g of the expression plasmid pC4 is
cotransfected with 0.5 .mu.g of the plasmid pSVneo using lipofectin
(Felgner et al., supra). The plasmid pSV2-neo contains a dominant
selectable marker, the neo gene from Tn5 encoding an enzyme that
confers resistance to a group of antibiotics including G418. The
cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418.
After 2 days, the cells are trypsinized and seeded in hybridoma
cloning plates (Greiner, Germany) in alpha minus MEM supplemented
with 10, 25, or 50 ng/ml of metothrexate plus 1 mg/ml G418. After
about 10-14 days single clones are trypsinized and then seeded in
6-well petri dishes or 10 ml flasks using different concentrations
of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM). Clones
growing at the highest concentrations of methotrexate are then
transferred to new 6-well plates containing even higher
concentrations of methotrexate (1 .mu.M, 2 .mu.M, 5 .mu.M, 10
.mu.M, 20 .mu.M). The same procedure is repeated until clones are
obtained which grow at a concentration of 100-200 .mu.M. Expression
of the desired gene product is analyzed, for instance, by SDS-PAGE
and Western blot or by reversed phase HPLC analysis.
[0425] At least six Neutrokine-a expression constructs have been
generated by the inventors herein to facilitate the production of
Neutrokine-a and/or Neutrokine-aSV polypeptides of several sizes
and in several systems. The expression constructs are as follows:
(1) pNa.A71-L285 (expresses amino acid residues Ala-71 through
Leu-285), (2) pNa.A81-L285 (expresses amino acid residues Ala-81
through Leu-285), (3) pNa.L112L285 (expresses amino acid residues
Leu-112 through Leu-285), (4) pNa.A134-L285 (expresses amino acid
residues Ala-134 through Leu-285), (5) pNa.L147-L285 (expresses
amino acid residues Leu-147 through Leu-285), and (6) pNa.G161-L285
(expresses amino acid residues Gly-161 through Leu-285).
[0426] In preferred embodiments, the expression constructs are used
to express various Neutrokine-a muteins from bacterial,
baculoviral, and mammalian systems.
[0427] In certain additional preferred embodiments, the constructs
express a Neutrokine-a polypeptide fragment fused at the N- and/or
C-terminus to a heterologous polypeptide, e.g., the signal peptide
from human IL-6, the signal peptide from CK-b8 (amino acids -21 to
-1 of the CK-b8 sequence disclosed in published PCT application
PCT/US95/09058), or the human IgG Fc region. Other sequences could
be used which are known to those of skill in the art.
Example 4
Tissue Distribution of Neutrokine-a mRNA Expression
[0428] Northern blot analysis is carried out to examine
Neutrokine-a gene expression in human tissues, using methods
described by, among others, Sambrook et al., cited above. A cDNA
probe containing the entire nucleotide sequence of the Neutrokine-a
protein (SEQ ID NO:1) is labeled with .sup.32P using the
rediprime.TM. DNA labeling system (Amersham Life Science),
according to manufacturer's instructions. After labeling, the probe
is purified using a CHROMA SPIN-100.TM. column (Clontech
Laboratories, Inc.), according to manufacturer's protocol number
PT1200-1. The purified labeled probe is then used to examine
various human tissues for Neutrokine-a and/or Neutrokine-a
mRNA.
[0429] Multiple Tissue Northern (MTN) blots containing various
human tissues (H) or human immune system tissues (IM) are obtained
from Clontech and are examined with the labeled probe using
ExpressHyb.TM. hybridization solution (Clontech) according to
manufacturer's protocol number PT1190-1. Following hybridization
and washing, the blots are mounted and exposed to film at
-70.degree. C. overnight, and films developed according to standard
procedures.
[0430] To determine the pattern of Neutrokine-a and/or Neutrokine-a
expression a panel of multiple tissue Northern blots were probed.
This revealed predominant expression of single 2.6 kb mRNA in
peripheral blood leukocytes, spleen, lymph node and bone marrow,
and detectable expression in placenta, heart, lung, fetal liver,
thymus and pancreas. Analysis of a panel of cell lines demonstrated
high expression of Neutrokine-a and/or Neutrokine-a in HL60 cells,
detectable expression in K562, but no expression in Raji, HeLa, or
MOLT-4 cells. Overall it appears that Neutrokine-a and/or
Neutrokine-a mRNA expression is enriched in the immune system.
Example 5
Gene Therapy Using Endogenous Neutrokine-a Gene
[0431] Another method of gene therapy according to the present
invention involves operably associating the endogenous Neutrokine-a
sequence with a promoter via homologous recombination as described,
for example, in U.S. Pat. No. 5,641,670, issued Jun. 24, 1997;
International Publication No. WO 96/29411, published Sep. 26, 1996;
International Publication No. WO 94/12650, published Aug. 4, 1994;
Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and
Zijlstra et al., Nature 342:435-438 (1989). This method involves
the activation of a gene which is present in the target cells, but
which is not expressed in the cells, or is expressed at a lower
level than desired. Polynucleotide constructs are made which
contain a promoter and targeting sequences, which are homologous to
the 5' non-coding sequence of endogenous Neutrokine-a, flanking the
promoter. The targeting sequence will be sufficiently near the 5'
end of Neutrokine-a so the promoter will be operably linked to the
endogenous sequence upon homologous recombination. The promoter and
the targeting sequences can be amplified using PCR. Preferably, the
amplified promoter contains distinct restriction enzyme sites on
the 5' and 3' ends. Preferably, the 3' end of the first targeting
sequence contains the same restriction enzyme site as the 5' end of
the amplified promoter and the 5' end of the second targeting
sequence contains the same restriction site as the 3' end of the
amplified promoter.
[0432] The amplified promoter and the amplified targeting sequences
are digested with the appropriate restriction enzymes and
subsequently treated with calf intestinal phosphatase. The digested
promoter and digested targeting sequences are added together in the
presence of T4 DNA ligase. The resulting mixture is maintained
under conditions appropriate for ligation of the two fragments. The
construct is size fractionated on an agarose gel then purified by
phenol extraction and ethanol precipitation.
[0433] In this Example, the polynucleotide constructs are
administered as naked polynucleotides via electroporation. However,
the polynucleotide constructs may also be administered with
transfection-facilitating agents, such as liposomes, viral
sequences, viral particles, precipitating agents, etc. Such methods
of delivery are known in the art.
[0434] Once the cells are transfected, homologous recombination
will take place which results in the promoter being operably linked
to the endogenous Neutrokine-a sequence. This results in the
expression of Neutrokine-a in the cell. Expression may be detected
by immunological staining, or any other method known in the
art.
[0435] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in DMEM+10% fetal calf serum.
Exponentially growing or early stationary phase fibroblasts are
trypsinized and rinsed from the plastic surface with nutrient
medium. An aliquot of the cell suspension is removed for counting,
and the remaining cells are subjected to centrifugation. The
supernatant is aspirated and the pellet is resuspended in 5 ml of
electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl,
0.7 mM Na2 HPO4, 6 mM dextrose). The cells are recentrifuged, the
supernatant aspirated, and the cells resuspended in electroporation
buffer containing 1 mg/ml acetylated bovine serum albumin. The
final cell suspension contains approximately 3.times.106 cells/ml.
Electroporation should be performed immediately following
resuspension.
[0436] Plasmid DNA is prepared according to standard techniques.
For example, to construct a plasmid for targeting to the
Neutrokine-a locus, plasmid pUC18 (MBI Fermentas, Amherst, N.Y.) is
digested with HindIII. The CMV promoter is amplified by PCR with an
XbaI site on the 5' end and a BamHI site on the 3'end. Two
Neutrokine-a non-coding sequences are amplified via PCR: one
Neutrokine-a non-coding sequence (Neutrokine-a fragment 1) is
amplified with a HindIII site at the 5' end and an Xba site at the
3'end; the other Neutrokine-a non-coding sequence (Neutrokine-a
fragment 2) is amplified with a BamHI site at the 5'end and a
HindIII site at the 3'end. The CMV promoter and Neutrokine-a
fragments are digested with the appropriate enzymes (CMV
promoter--XbaI and BamHI; Neutrokine-a fragment 1--XbaI;
Neutrokine-a fragment 2--BamHI) and ligated together. The resulting
ligation product is digested with HindIII, and ligated with the
HindIII-digested pUC18 plasmid.
[0437] Plasmid DNA is added to a sterile cuvette with a 0.4 cm
electrode gap (Bio-Rad). The final DNA concentration is generally
at least 120 .mu.g/ml. 0.5 ml of the cell suspension (containing
approximately 1.5..times.106 cells) is then added to the cuvette,
and the cell suspension and DNA solutions are gently mixed.
Electroporation is performed with a Gene-Pulser apparatus
(Bio-Rad). Capacitance and voltage are set at 960 .mu.F and 250-300
V, respectively. As voltage increases, cell survival decreases, but
the percentage of surviving cells that stably incorporate the
introduced DNA into their genome increases dramatically. Given
these parameters, a pulse time of approximately 14-20 mSec should
be observed.
[0438] Electroporated cells are maintained at room temperature for
approximately 5 min, and the contents of the cuvette are then
gently removed with a sterile transfer pipette. The cells are added
directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf
serum) in a 10 cm dish and incubated at 37.degree. C. The following
day, the media is aspirated and replaced with 10 ml of fresh media
and incubated for a further 16-24 hours.
[0439] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product. The fibroblasts can then be introduced into a patient as
described above.
Example 6
Neutrokine-a, a Novel Human Tumor Necrosis Factor Homologue that
Induces B Cell Proliferation and Differentiation
[0440] Background
[0441] Generation of a functional humoral immune resposes requires
both soluble and cognate signaling between B-lineage cells and
their microenvironment. Signals may impart a positive stimulus that
allows a B-lineage cell to continue its programmed development, or
a negative stimulus that instructs the cell to arrest its current
developmental pathway. To date, numerous stimulatory and inhibitory
signals have been found to influence B cell responsiveness
including IL-2, IL-4, IL5, IL6, IL-7, IL-10, IL-13, IL14 and IL15.
Interestingly, these signals are by themselves weak effectors but
can, in combination with various co-stimulatory proteins, induce
activation, proliferation, differentiation, homing, tolerance and
death among B cell populations. One of the best studied classes of
B cell co-stimulatory proteins is the TNF-superfamily. Within this
family CD40, CD27, and CD30 along with their repective ligands
CD154, CD70, and CD153 have been found to regulate a variety of
immune responses. Recently, Human Genome Sciences Inc. has
identified a novel member of the TNF-lignad family, Neutrokine-a,
which is a potent and specific inducer of B lymphocyte activation,
proliferation and differentiation. Neutrokine-a is produced by
monocytic cell types, and has its effects on B cells through a
putative receptor expressed on B cells. Engagement of the receptor
in the presence of a co-stimulatory signal delivered through
membrane bound Ig receptors results in the proliferation and
differntiation of normal human tonsillar B cells.
[0442] Results
[0443] As part of an ongoing genomics-based gene discovery program,
the Human Genome Sciences, Inc. EST database was searched for
sequences encoding characteristic TNF-like domains. Recently, a 285
amino acid protein was identified in a human neutrophil-derived
cDNA library that shared significant homology to APRIL (28%),
LT.alpha. (20%), and TNF.alpha. (10%), (FIG. 7A). Like other
members of the TNF-ligand family, it is a type II transmembrane
protein containing a predicted N-terminal cytosolic domain of 46
residues, a transmembrane region of 22 residues, and a 212 residue
extracellular domain. Expression of this cDNA in mammalian cells
(both HEK 293 and Chinese Hamster Ovary) identified a 152 amino
acid soluble form with an N-terminal sequence beginning with the
alanine residue at amino acid 134 (arrow in FIGS. 7A and 7B).
Reconstruction of the mass to charge ratio defined a mass for
Neutrokine-a of 17,038 Daltons, a value in compete agreement with
that predicted for this 152 amino acid protein with a single
disulfide bond (17037.5 Daltons).
[0444] The expression profiles of Neutrokine-a mRNA were assessed
by Northern blot (FIG. 7B) and flow cytometric analyses (Table III
and FIGS. 8A and 8B). Neutrokine-a is encoded by a single 2.6 kb
mRNA found at high levels in peripheral blood leukocytes, spleen,
lymph node and bone marrow. Lower expression levels were detectable
in placenta, heart, lung, fetal liver, thymus and pancreas. Among a
panel of cell lines, Neutrokine-a mRNA was detected in HL60 and
K562, but not in Raji, HeLa, or MOLT-4 cells. These results were
confirmed by flow cytometric analyses using the
Neutrokine-a-specific mAb 12D6A. As shown in Table III,
Neutrokine-a expression is not detected on T or B lineage cells but
rather restricted to cells within the myeloid lineage.
Representative staining profiles of the tumor lines K562, HL-60,
U937 and THP-1 cells with 12E6 are shown in FIG. 8A. Further
analyses of normal blood cell types demonstrated significant
expression on resting monocytes that was upregulated approximately
4-fold following exposure of cells to IFN.gamma. (100 U/mL) for
three days (FIG. 8B). Neutrokine-a was not expressed on freshly
isolated neutrophils, T cells, B cells, and NK.
[0445] To generate Neutrokine-a recombinant protein, Neutrokine-a
encoding amino acids 112-285 were fused to a heterologous signal
peptide and subcloned into a baculovirus expression vector.
Recombinant Neutrokine-a was purified from 10 liters of recombinant
baculovirus infected Sf9 cell supernatants at 92 h post-infection.
The insect cells were grown in EXCEL401 medium (JRH Scientific)
with 1% (v/v) fetal bovine serum. The harvested supernatant was
clarified by centrifugation at 18,000.times.g followed by 0.45
.mu.m depth filtration.
[0446] The supernatant was loaded onto a set of porose HS-50/HQ-50
in tandem mode. The HS/HQ flow through material was adjusted to pH
7.5 with 1 M Tris-HCl pH 8, diluted with equal volume of 50 mM
Tris-HCl pH 8, and loaded onto a poros PI-20 column. The PI column
was washed first with 4 column volumes of 75 mM NaCl in 50 mM
Tris-HCl at pH 7.5, then eluted using 3 to 5 column volumes of a
stepwise gradient of 300 mM, 750 mM, 1500 mM sodium chloride in 50
mM Tris-HCl pH 7.5. Neutrokine-a protein appears as a 17 KD band on
reduced SDS-PAGE and is present in the 0.3 M to 1.5M NaCl
fractions.
[0447] The PI fraction was further purified through a Sephacryl
S100 HR size exclusion column equilibrated with 0.15 M NaCl, 50 mM
NaOAc at pH 6. The S200 fractions were mixed with NaCl to a final
concentration of 3 M and loaded onto a Toyopearl Hexyl 650C column.
The Hexyl column was eluted with a linear gradient from 3 M to 0.05
M NaCl in 50 mM NaOAc pH6 in 15 column volumes. Fractions
containing purified Neutrokine-a as analyzed through SDS-PAGE were
combined and dialyzed against a buffer containing 150 mM NaCl, 50
mM NaOAc.
[0448] The final purified Neutrokine-a protein has an N-terminus
sequence of AVQGP (beginning with amino acid residue Ala-134 of SEQ
ID NO:2). This corresponds identically to the sequence of soluble
Neutrokine-a derived from CHO cells lines stably transfected with
the full length Neutrokine-a gene. RP-HPLC analysis shows a single
peak of greater than 95% purity. Endotoxin level was below the
detection limit in LAL assay.
[0449] Purified rNeutrokine-a was assessed for its ability to
induce activation, proliferation, differentiation or death in
numerous cell based assays involving B cells, T cells, monocytes,
NK cells, hematopoietic progenitors, and a variety of cell types of
endothelial and epithelial origin. Among these assays, Neutrokine-a
was uniquely found to increase B cell proliferation in a standard
co-stimulatory assay in which purified tonsillar B cells are
cultured in the presence of either formalin-fixed Staphylococcus
aureus Cowan I (SAC) or immobilized anti-human IgM as priming
agents. As shown in FIG. 9A, recombinant Neutrokine-a purified from
baculovirus cultures induces a dose-dependent proliferation of
tonsillar B cells. This response is qualitatively like that of
rhuIL2 over the dose range from 0.1 to 10,000 ng/mL. Neutrokine-a
also induces B cell proliferation when cultured with cells
co-stimulated with immobilized anti-IgM (FIG. 9B). A dose-dependent
response is readily observed as the amount of crosslinking agent
increases in the presence of a fixed concentration of either IL2 or
rNeutrokine-a. As with SAC, the magnitude of the rNeutrokine-a
response is approximately half that of IL2 at any given
concentration.
[0450] To further define the structural and functional
characteristics of Neutrokine-a, amino-truncated forms of the
protein were generated. A total of 6 truncated proteins encoding
various portions of the extracellular domain were transiently
expressed in CHO cells with the resulting supernatants screened for
biological activity in the standard B cell co-stimulatory SAC
assay. As shown in FIG. 10, the soluble forms of Neutrokine-a
beginning at residue Ala-71, Ala-81, Leu-112, and Ala-134 (of SEQ
ID NO:2) were equally active. In contrast, the activity associated
with mutants beginning at Leu-147 and Gly-161 (of SEQ ID NO:2) were
no different than that of supernatants obtained from cells
transfected with the vector control (pC4). Taken together, it
appears that the predicted beta-pleated sheet formed by amino acid
residues 144-151 of SEQ ID NO:2 (see FIGS. 7A and 7B) is critical
for effective B cell signaling.
[0451] The ability of Neutrokine-a to uniquely activate normal B
cell populations predicts the existence of a specific cell surface
receptor(s). In an attempt to assess Neutrokine-a receptor
distribution and potentially define novel cellular targets,
purified rNeutrokine-a was biotinylated using a
N-hydroxysuccinimidobiotin reagent and associated protocols
provided by the manufacturer (Pierce, Rockford, Ill.). The
resultant biotin-Neutrokine-a protein retained function as it was
equally effective at stimulating B cell proliferation when compared
to unlabelled rNeutrokine-a. Direct binding of biotin-Neutrokine-a
was assessed by Flow cytometric means using a
strepavidin-phycoerythrin conjugate. Analyses indicate that the
cellular receptor(s) for Neutrokine-a are expressed on normal and
neoplastic cells of the B lineage (FIG. 11). Biotinylated
Neutrokine-a bound freshly isolated tonsillar B cells in a dose
dependent manner with saturating levels attained at approximately
10 ng of labelled protein per 10.sup.6 cells. Receptor expression
was also detected on the myeloma cell line IM9 but the level of
binding was significantly less at all concentrations tested raising
the possibility of fewer receptors per cell, the presence of lower
affinity receptor(s) or novel receptor(s). Lineage-specific
analyses of whole human peripheral blood cells indicates that
binding of biotinylated Neutrokine-a was undetectable on T cells,
NK cells, monocytes and granulocytes as assessed by CD3, CD56,
CD14, and CD66b respectively. In contrast, biotinylated
Neutrokine-a bound B cells as defined by CD20 surface expression.
Taken together, these assay technique suggest that Neutrokine-a
dispays a clear B cell tropism in both its receptor distribution
and biological activity. It remains possible however, that
activation of these or other cell populations may induce expression
of Neutrokine-a receptors that are not present on freshly isolated
whole blood cells or established neoplastic cell lines.
[0452] In parallel experiments it was determined that rNeutrokine-a
efficiently stimulated proliferation of mouse splenic B cells but
not immature, Ig.sup.- B cell precursors isolated from mouse bone
marrow. These observations afforded the opportunity to test the in
vivo activity of rNeutrokine-a in a responsive species.
Accordingly, BALB/c mice (3/group) were injected (i.p.) twice per
day with buffer only, or 2 mg/Kg of rNeutrokine-a. Mice received
this treatment for 4 consecutive days at which time they were
sacrificed and various tissues and serum collected for analyses.
The effects of Neutrokine-a administration was evident
histoligically in both H&E stained and CD45R(B220) stained
sections (FIG. 12A). Comparison of H&E sections from normal and
Neutrokine-a-treated spleens identified diffuse peri-arterial
lymphatic sheaths and a significant increase in the nucleated
cellularity of the red pulp regions (FIG. 12A). Immunohistochemical
studies using a B cell marker, anti-CD45R(B220) suggest that the
splenic disorganization observed in Neutrokine-a treated mice was
due to increased B cell representation within loosely defined B
cell zones that infiltrated established T cell regions. Further
experiments will be required to define the mechanism by which
Neutrokine-a alter spenic architecture.
[0453] Flow cytometric analyses of the spleens from Neutrokine-a
treated mice indicate that Neutrokine-a specifically increased the
proportion of ThB+, CD45R(B220)dull B cells over that observed in
control mice (FIG. 11). The increase was greater than 10-fold in
mice.
[0454] A predicted consequence of increased mature B cell
representation in vivo is a relative increase in serum Ig titers.
Accordingly, serum IgM and IgA levels were compared between buffer
and Neutrokine-a-treated mice. Neutrokine-a administration resulted
in a 2 to 5-fold increase in both IgM and IgA serum levels.
[0455] Discussion
[0456] The data presented herein describes Neutrokine-a, a novel
member of the TNF-ligand superfamily that specifically induces both
in vivo and in vitro B cell proliferation and differentiation. The
biological profile of Neutrokine-a is unique based on its
restricted gene/protein expression and its apparent B cell tropism.
The potential uses of such a factor, its receptor(s) or
functionally related agonists and antagonists of either are
diverse. These agents may find application as diagnostic and/or
therapeutic agent in virtually any aspect of the normal and
diseased immune system.
[0457] Finally, the chromosomal location of Neutrokine-a was
determined using a combination of somatic cell hybrids and
radiation hybrids to chromosome position 13q34. This is the first
member of the TNF cytokine superfamily to map to this region.
Knowing the genomic location of Neutrokine-a and its biological
profile allows one to correlate specific inherited disorders with
potential alterations in Neutrokine-a, its associated receptor(s)
and/or related signalling pathways.
[0458] The assays and experiments described above clearly provide
the scientific rational for the use of Neutrokine-a as a regulator
of B cell proliferation and differentiation. The possible uses of
the either soluble of membrane bound Neutrokine-a, its native
receptor and various receptor antagonists are diverse and include
treatement of autoimmune disorders and immunodeficiencies resulting
from infection, anti-neoplastic therapy and/or inherited disorders.
Moreover, many of the pre-neoplastic monoclonal gammopathies and
neoplastic B cell diseases such as multiple myeloma may utilize
Neutrokine-a or its receptor as either inducing or progressing
factors.
[0459] Accordingly, Neutrokine-a or derived, functional agonists
may find application as the following:
[0460] A vaccine adjuvant that enhances immune responsiveness to
specific antigen.
[0461] An adjuvant to enhance tumor-specific immune responses.
[0462] An adjuvant to enhance anti-viral immune responses.
[0463] As a stimulator of B cell responsiveness to pathogens.
[0464] As an agent that elevates the immune status of a individual
prior to their receipt of immunosuppressive therapies.
[0465] As an agent to accelerate recovery of immunocompromised
individuals;
[0466] As an agent to boost immunoresponsiveness among aged
populations; As an immune system enhancer following bone marrow
transplant.
[0467] As a mediator of mucosal immune responses. The expression of
Neutrokine-a by monocytes and the responsiveness of B cell to this
factor suggests that it may be involved in exchange of signals
between B cells and monocytes or their differentiated progeny. This
activity is in many ways analogous to the CD40-CD154 signalling
between B cells and T cells. Neutrokine-a may therefore be an
important regulator of T cell independent immune responses to
environmental pathogens. In particular, the unconventional B cell
populations (CD5+) that are associated with mucosal sites and
responsible for much of the innate immunity in humans may respond
to Neutrokine-a thereby enhancing an individual's protective immune
status.
[0468] As an agent to direct an individuals immune system towards
development of a humoral response (i.e. TH2) as opposed to a TH1
cellular response.
[0469] As a means to induce tumor proliferation and thus make it
more susceptible to anti-neoplastic agents. For example multiple
myeloma is a slowly dividing disease and is thus refractory to
virtually all anti-neoplastic regimens. If these cells were forced
to proliferate more rapidly their susceptibility profile would
likely change.
[0470] As B cell specific binding protein to which specific
activators or inhibitors of cell growth may be attached. The result
would be to focus the activity of such activators or inhibitors
onto normal, diseased, or neoplastic B cell populations.
[0471] As a means of detecting B-lineage cells by virtue of its
specificity. This application may require labeling the protein with
biotin or other agents to afford a means of detection.
[0472] As a stimulator of B cell production in pathologies such as
AIDS, chronic lymphocyte disorder and/or Common Variable
Immunodificiency;
[0473] As part of a B cell selection device the function of which
is to isolate B cells from a heterogenous mixture of cell types.
Neutrokine-a could be coupled to a solid support to which B cells
would then specifically bind. Unbound cells would be washed out and
the bound cells subsequently eluted. This technique would allow
purging of tumor cells from, for example, bone marrow or peripheral
blood prior to transplant.
[0474] As a therapy for generation and/or regeneration of lymphoid
tissues following surgery, trauma or genetic defect.
[0475] As a gene-based therapy for genetically inherited disorders
resulting in immuno-incompetence such as observed among SCID
patients.
[0476] As an antigen for the generation of antibodies to inhibit or
enhance Neutrokine-a mediated responses.
[0477] As a means of activating monocytes/macrophages to defend
against parasitic diseases that effect monocytes such as
Leshmania.
[0478] As pretreatment of bone marrow samples prior to transplant.
Such treatment would increase B cell representation and thus
accelerate recover.
[0479] As a means of regulating secreted cytokines that are
elicited by Neutrokine-a.
[0480] All of the above described applications as they may apply to
veterinary medicine.
[0481] Antagonists of Neutrokine-a include binding and/or
inhibitory antibodies, antisense nucleic acids, ribozymes or
soluble forms of the Neutrokine-a receptor(s). These would be
expected to reverse many of the activities of the ligand described
above as well as find clinical or practical application as:
[0482] A means of blocking various aspects of immune responses to
foreign agents or self. Examples include autoimmune disorders such
as lupus, and arthritis, as well as immunoresponsiveness to skin
allergies, inflammation, bowel disease, injury and pathogens.
Although our current data speaks directly to the potential role of
Neutrokine-a in B cell and monocyte related pathologies, it remains
possible that other cell types may gain expression or
responsiveness to Neutrokine-a. Thus, Neutrokine-a may, like CD40
and its ligand, be regulated by the status of the immune system and
the microenvironment in which the cell is located.
[0483] A therapy for preventing the B cell proliferation and Ig
secretion associated with autoimmune diseases such as idiopathic
thrombocytopenic purpura, systemic lupus erythramatosus and MS.
[0484] An inhibitor of graft versus host disease or transplant
rejection.
[0485] A therapy for B cell malignancies such as ALL, Hodgkins
disease, non-Hodgkins lymphoma, Chronic lymphocyte leukemia,
plasmacytomas, multiple myeloma, Burkitt's lymphoma, and
EBV-transformed diseases.
[0486] A therapy for chronic hypergammaglobulinemeia evident in
such diseases as monoclonalgammopathy of undetermined significance
(MGUS), Waldenstrom's disease, and related idiopathic
monoclonalgammopathies.
[0487] A means of decreasing the involvement of B cells and Ig
associated with Chronic Myelogenous Leukemia.
[0488] An immunosuppressive agent(s).
[0489] An inhibitor of signalling pathways involving ERK1, COX2 and
Cyclin D2 which have been associated with Neutrokine-a induced B
cell activation.
[0490] Isolation of a cDNA Showing Homology to the TNF Ligand
Superfamily
[0491] An expressed sequence tag (EST) database of human cDNAs was
screened for homologs of TNF alpha utilizing the Neutrokine-a
algorithiom. Several overlapping ESTs showing homology to TNF and
other family members were identified, and the longest clone
(isolated from a neutrophil library) was picked and the full length
sequence determined. The designated methionine is likely to be the
start codon as there is an upstream in frame stop codon and no
upstream in frame methionines.
[0492] Mammalian Cell Transfections
[0493] Cell culture reagents obtained from Life Technologies. Human
embryonic kidney cells 293 were maintained in DMEM containing 10%
serum
[0494] Purification of Recombinant Human Neutrokine-a (Polypeptide
Fragment from Ala-134 to Leu-285 of SEQ ID NO:2).
[0495] To generate Neutrokine-a recombinant protein, Neutrokine-a
encoding amino acid residues 112 through 285 of SEQ ID NO:2 was
fused to a heterologous signal peptide and subcloned into a
baculovirus expression vector. Recombinant Neutrokine-a was
purified from 10 liters of recombinant baculovirus infected Sf9
cell supernatants at 92 h post-infection. The insect cells were
grown in EXCEL401 medium (JRH Scientific) with 1% (v/v) fetal
bovine serum. The harvested supernatant was clarified by
centrifugation at 18,000.times.g followed by 0.45 .mu.m depth
filtration.
[0496] The supernatant was loaded onto a set of porose HS-50/HQ-50
in tandem mode. The HS/HQ flow through material was adjusted to pH
7.5 with 1 M Tris-HCl pH 8, diluted with equal volume of 50 mM
Tris-HCl pH 8, and loaded onto a poros PI-20 column. The PI column
was washed first with 4 column volumes of 75 mM NaCl in 50 mM
Tris-HCl at pH 7.5, then eluted using 3 to 5 column volumes of a
stepwise gradient of 300 mM, 750 mM, 1500 mM sodium chloride in 50
mM Tris-HCl pH 7.5. Neutrokine-a protein appears as a 17 KD band on
reduced SDS-PAGE and is present in the 0.3 M to 1.5M NaCl
fractions.
[0497] The PI fraction was further purified through a Sephacryl
S100 HR size exclusion column equilibrated with 0.15 M NaCl, 50 mM
NaOAc at pH 6. The S200 fractions were mixed with NaCl to a final
concentration of 3 M and loaded onto a Toyopearl Hexyl 650C column.
The Hexyl column was eluted with a linear gradient from 3 M to 0.05
M NaCl in 50 mM NaOAc pH6 in 15 column volumes. Fractions
containing purified TL7 as analyzed through SDS-PAGE were combined
and dialyzed against a buffer containing 150 mM NaCl, 50 mM
NaOAc.
[0498] The final purified Neutrokine-a protein has an N-terminus
sequence beginning with Ala-134 of SEQ ID NO:2 (AVQGP). This
corresponds identically to the sequence of soluble Neutrokine-a
derived from CHO cells lines stably transfected with the full
length Neutrokine-a gene. RP-HPLC analysis shows a single peak of
greater than 95% purity. Endotoxin level was below the detection
limit in LAL assay.
[0499] Northern Blot Analysis
[0500] Northern blot analysis was performed utilizing the following
membranes: human multiple tissue Northern blots I and II, a human
cancer cell line blot, and an Immune blot of poly(A) RNA (2 ug,
Clonetech). Blots were hybridized with random-primed
.sup.32P-labeled probes according to manafacturer's
recommendations. As a probe the complete Neutrokine-a (SEQ ID NO:1)
cDNA was used.
[0501] Chromosomal Mapping
[0502] To determine the chromosomal location of the Neutrokine-a
gene, a panel of monochromosomal somatic cell hybrids (obtained
from Quantum Biotechnology) retaining individual chromosomes was
screened by PCR using Neutrokine-a specific primers. The following
oligonucleotides which span a 233 base pair region of the
Neutrokine-a coding region were used for PCR analysis on 100 ng of
template DNA: TGGTGTCTTTCTACCAGGTGG (5' primer, SEQ ID NO:20);
TTTCTTCTGGACCCTGAACGG (3' primer, SEQ ID NO:21). 35 cycles of PCR
amplification (94.degree. C.-30 secs; 58.degree. C.-45 secs;
72.degree. C.-1 min) were performed on 100 ng of each hybrid in a
50 ul reaction. The anticipated 233 bp PCR product was detected in
human chromosome 13, while no amplification was observed in any
other sample. To sublocalize Neutrokine-a on chromosome 13, a panel
of 83 radiation hybrids (obtained from Research Genetics) was used.
In addition to the human genomic DNA, amplicons were observed in
hybrids 4, 8, 21, 36, 51, 58, 64, 66 and 75. Analysis of this data
using the Stanford Human Genome Center RHserver revealed linkage to
the SHGC-36171 marker on chromosome 13. Superposition of this map
with the cytogenetic map of human chromosome 13 allowed the
assignment of Neutrokine-a to chromosomal band 13q34. Analysis of
the radiation hybrid data was performed using the server at the
Stanford Human Genome Center.
[0503] It will be clear that the invention may be practiced
otherwise than as particularly described in the foregoing
description and examples. Numerous modifications and variations of
the present invention are possible in light of the above teachings
and, therefore, are within the scope of the appended claims.
[0504] The entire disclosure of all publications (including
patents, patent applications, journal articles, laboratory manuals,
books, or other documents) cited herein are hereby incorporated by
reference.
[0505] Further, the Sequence Listing submitted herewith, and the
Sequence Listings submitted in copending application Ser. No.
09/005,874, filed Jan. 12, 1998, U.S. 60/036,100, filed Jan. 14,
1997, and PCT/US96/17957, filed Oct. 25, 1996, in both computer and
paper forms in each case, are hereby incorporated by reference in
their entireties.
3TABLE III Cell surface expression of Neutrokine- alpha as detected
by mAb 12E6 Neutrokine-alpha cell Cell line Cellular Morphology
surface expression Monocytic lineage U937 Lymphoma,
histiocytic/macrophage + HL-60 Leukemia, acute promyelocytic + K562
Leukemia, chronic myelogenous + THP-1 Leukemia, acute monocytic +
T-lineage Jurkat Leukemia, T lymphocytic - MOLT-4 Leukemia, T
lymphoblastic - B-lineage Daudi Burkitt's, lymphoblastic - Namalwa
Burkitt's, lymphocyte - Raji Burkitt's, lymphocyte - Reh Leukemia,
lymphocytic - ARH-77 Leukemia, plasma cell - IM-9 Myeloma - RPMI
8226 Myeloma -
[0506]
Sequence CWU 1
1
22 1 1100 DNA Homo sapiens CDS (147)..(1001) 1 aaattcagga
taactctcct gaggggtgag ccaagccctg ccatgtagtg cacgcaggac 60
atcaacaaac acagataaca ggaaatgatc cattccctgt ggtcacttat tctaaaggcc
120 ccaaccttca aagttcaagt agtgat atg gat gac tcc aca gaa agg gag
cag 173 Met Asp Asp Ser Thr Glu Arg Glu Gln 1 5 tca cgc ctt act tct
tgc ctt aag aaa aga gaa gaa atg aaa ctg aag 221 Ser Arg Leu Thr Ser
Cys Leu Lys Lys Arg Glu Glu Met Lys Leu Lys 10 15 20 25 gag tgt gtt
tcc atc ctc cca cgg aag gaa agc ccc tct gtc cga tcc 269 Glu Cys Val
Ser Ile Leu Pro Arg Lys Glu Ser Pro Ser Val Arg Ser 30 35 40 tcc
aaa gac gga aag ctg ctg gct gca acc ttg ctg ctg gca ctg ctg 317 Ser
Lys Asp Gly Lys Leu Leu Ala Ala Thr Leu Leu Leu Ala Leu Leu 45 50
55 tct tgc tgc ctc acg gtg gtg tct ttc tac cag gtg gcc gcc ctg caa
365 Ser Cys Cys Leu Thr Val Val Ser Phe Tyr Gln Val Ala Ala Leu Gln
60 65 70 ggg gac ctg gcc agc ctc cgg gca gag ctg cag ggc cac cac
gcg gag 413 Gly Asp Leu Ala Ser Leu Arg Ala Glu Leu Gln Gly His His
Ala Glu 75 80 85 aag ctg cca gca gga gca gga gcc ccc aag gcc ggc
ctg gag gaa gct 461 Lys Leu Pro Ala Gly Ala Gly Ala Pro Lys Ala Gly
Leu Glu Glu Ala 90 95 100 105 cca gct gtc acc gcg gga ctg aaa atc
ttt gaa cca cca gct cca gga 509 Pro Ala Val Thr Ala Gly Leu Lys Ile
Phe Glu Pro Pro Ala Pro Gly 110 115 120 gaa ggc aac tcc agt cag aac
agc aga aat aag cgt gcc gtt cag ggt 557 Glu Gly Asn Ser Ser Gln Asn
Ser Arg Asn Lys Arg Ala Val Gln Gly 125 130 135 cca gaa gaa aca gtc
act caa gac tgc ttg caa ctg att gca gac agt 605 Pro Glu Glu Thr Val
Thr Gln Asp Cys Leu Gln Leu Ile Ala Asp Ser 140 145 150 gaa aca cca
act ata caa aaa gga tct tac aca ttt gtt cca tgg ctt 653 Glu Thr Pro
Thr Ile Gln Lys Gly Ser Tyr Thr Phe Val Pro Trp Leu 155 160 165 ctc
agc ttt aaa agg gga agt gcc cta gaa gaa aaa gag aat aaa ata 701 Leu
Ser Phe Lys Arg Gly Ser Ala Leu Glu Glu Lys Glu Asn Lys Ile 170 175
180 185 ttg gtc aaa gaa act ggt tac ttt ttt ata tat ggt cag gtt tta
tat 749 Leu Val Lys Glu Thr Gly Tyr Phe Phe Ile Tyr Gly Gln Val Leu
Tyr 190 195 200 act gat aag acc tac gcc atg gga cat cta att cag agg
aag aag gtc 797 Thr Asp Lys Thr Tyr Ala Met Gly His Leu Ile Gln Arg
Lys Lys Val 205 210 215 cat gtc ttt ggg gat gaa ttg agt ctg gtg act
ttg ttt cga tgt att 845 His Val Phe Gly Asp Glu Leu Ser Leu Val Thr
Leu Phe Arg Cys Ile 220 225 230 caa aat atg cct gaa aca cta ccc aat
aat tcc tgc tat tca gct ggc 893 Gln Asn Met Pro Glu Thr Leu Pro Asn
Asn Ser Cys Tyr Ser Ala Gly 235 240 245 att gca aaa ctg gaa gaa gga
gat gaa ctc caa ctt gca ata cca aga 941 Ile Ala Lys Leu Glu Glu Gly
Asp Glu Leu Gln Leu Ala Ile Pro Arg 250 255 260 265 gaa aat gca caa
ata tca ctg gat gga gat gtc aca ttt ttt ggt gca 989 Glu Asn Ala Gln
Ile Ser Leu Asp Gly Asp Val Thr Phe Phe Gly Ala 270 275 280 ttg aaa
ctg ctg tgacctactt acaccatgtc tgtagctatt ttcctccctt 1041 Leu Lys
Leu Leu 285 tctctgtacc tctaagaaga aagaatctaa ctgaaaatac caaaaaaaaa
aaaaaaaaa 1100 2 285 PRT Homo sapiens 2 Met Asp Asp Ser Thr Glu Arg
Glu Gln Ser Arg Leu Thr Ser Cys Leu 1 5 10 15 Lys Lys Arg Glu Glu
Met Lys Leu Lys Glu Cys Val Ser Ile Leu Pro 20 25 30 Arg Lys Glu
Ser Pro Ser Val Arg Ser Ser Lys Asp Gly Lys Leu Leu 35 40 45 Ala
Ala Thr Leu Leu Leu Ala Leu Leu Ser Cys Cys Leu Thr Val Val 50 55
60 Ser Phe Tyr Gln Val Ala Ala Leu Gln Gly Asp Leu Ala Ser Leu Arg
65 70 75 80 Ala Glu Leu Gln Gly His His Ala Glu Lys Leu Pro Ala Gly
Ala Gly 85 90 95 Ala Pro Lys Ala Gly Leu Glu Glu Ala Pro Ala Val
Thr Ala Gly Leu 100 105 110 Lys Ile Phe Glu Pro Pro Ala Pro Gly Glu
Gly Asn Ser Ser Gln Asn 115 120 125 Ser Arg Asn Lys Arg Ala Val Gln
Gly Pro Glu Glu Thr Val Thr Gln 130 135 140 Asp Cys Leu Gln Leu Ile
Ala Asp Ser Glu Thr Pro Thr Ile Gln Lys 145 150 155 160 Gly Ser Tyr
Thr Phe Val Pro Trp Leu Leu Ser Phe Lys Arg Gly Ser 165 170 175 Ala
Leu Glu Glu Lys Glu Asn Lys Ile Leu Val Lys Glu Thr Gly Tyr 180 185
190 Phe Phe Ile Tyr Gly Gln Val Leu Tyr Thr Asp Lys Thr Tyr Ala Met
195 200 205 Gly His Leu Ile Gln Arg Lys Lys Val His Val Phe Gly Asp
Glu Leu 210 215 220 Ser Leu Val Thr Leu Phe Arg Cys Ile Gln Asn Met
Pro Glu Thr Leu 225 230 235 240 Pro Asn Asn Ser Cys Tyr Ser Ala Gly
Ile Ala Lys Leu Glu Glu Gly 245 250 255 Asp Glu Leu Gln Leu Ala Ile
Pro Arg Glu Asn Ala Gln Ile Ser Leu 260 265 270 Asp Gly Asp Val Thr
Phe Phe Gly Ala Leu Lys Leu Leu 275 280 285 3 233 PRT Homo sapiens
3 Met Ser Thr Glu Ser Met Ile Arg Asp Val Glu Leu Ala Glu Glu Ala 1
5 10 15 Leu Pro Lys Lys Thr Gly Gly Pro Gln Gly Ser Arg Arg Cys Leu
Phe 20 25 30 Leu Ser Leu Phe Ser Phe Leu Ile Val Ala Gly Ala Thr
Thr Leu Phe 35 40 45 Cys Leu Leu His Phe Gly Val Ile Gly Pro Gln
Arg Glu Glu Phe Pro 50 55 60 Arg Asp Leu Ser Leu Ile Ser Pro Leu
Ala Gln Ala Val Arg Ser Ser 65 70 75 80 Ser Arg Thr Pro Ser Asp Lys
Pro Val Ala His Val Val Ala Asn Pro 85 90 95 Gln Ala Glu Gly Gln
Leu Gln Trp Leu Asn Arg Arg Ala Asn Ala Leu 100 105 110 Leu Ala Asn
Gly Val Glu Leu Arg Asp Asn Gln Leu Val Val Pro Ser 115 120 125 Glu
Gly Leu Tyr Leu Ile Tyr Ser Gln Val Leu Phe Lys Gly Gln Gly 130 135
140 Cys Pro Ser Thr His Val Leu Leu Thr His Thr Ile Ser Arg Ile Ala
145 150 155 160 Val Ser Tyr Gln Thr Lys Val Asn Leu Leu Ser Ala Ile
Lys Ser Pro 165 170 175 Cys Gln Arg Glu Thr Pro Glu Gly Ala Glu Ala
Lys Pro Trp Tyr Glu 180 185 190 Pro Ile Tyr Leu Gly Gly Val Phe Gln
Leu Glu Lys Gly Asp Arg Leu 195 200 205 Ser Ala Glu Ile Asn Arg Pro
Asp Tyr Leu Asp Phe Ala Glu Ser Gly 210 215 220 Gln Val Tyr Phe Gly
Ile Ile Ala Leu 225 230 4 205 PRT Homo sapiens 4 Met Thr Pro Pro
Glu Arg Leu Phe Leu Pro Arg Val Arg Gly Thr Thr 1 5 10 15 Leu His
Leu Leu Leu Leu Gly Leu Leu Leu Val Leu Leu Pro Gly Ala 20 25 30
Gln Gly Leu Pro Gly Val Gly Leu Thr Pro Ser Ala Ala Gln Thr Ala 35
40 45 Arg Gln His Pro Lys Met His Leu Ala His Ser Thr Leu Lys Pro
Ala 50 55 60 Ala His Leu Ile Gly Asp Pro Ser Lys Gln Asn Ser Leu
Leu Trp Arg 65 70 75 80 Ala Asn Thr Asp Arg Ala Phe Leu Gln Asp Gly
Phe Ser Leu Ser Asn 85 90 95 Asn Ser Leu Leu Val Pro Thr Ser Gly
Ile Tyr Phe Val Tyr Ser Gln 100 105 110 Val Val Phe Ser Gly Lys Ala
Tyr Ser Pro Lys Ala Thr Ser Ser Pro 115 120 125 Leu Tyr Leu Ala His
Glu Val Gln Leu Phe Ser Ser Gln Tyr Pro Phe 130 135 140 His Val Pro
Leu Leu Ser Ser Gln Lys Met Val Tyr Pro Gly Leu Gln 145 150 155 160
Glu Pro Trp Leu His Ser Met Tyr His Gly Ala Ala Phe Gln Leu Thr 165
170 175 Gln Gly Asp Gln Leu Ser Thr His Thr Asp Gly Ile Pro His Leu
Val 180 185 190 Leu Ser Pro Ser Thr Val Phe Phe Gly Ala Phe Ala Leu
195 200 205 5 244 PRT Homo sapiens 5 Met Gly Ala Leu Gly Leu Glu
Gly Arg Gly Gly Arg Leu Gln Gly Arg 1 5 10 15 Gly Ser Leu Leu Leu
Ala Val Ala Gly Ala Thr Ser Leu Val Thr Leu 20 25 30 Leu Leu Ala
Val Pro Ile Thr Val Leu Ala Val Leu Ala Leu Val Pro 35 40 45 Gln
Asp Gln Gly Gly Leu Val Thr Glu Thr Ala Asp Pro Gly Ala Gln 50 55
60 Ala Gln Gln Gly Leu Gly Phe Gln Lys Leu Pro Glu Glu Glu Pro Glu
65 70 75 80 Thr Asp Leu Ser Pro Gly Leu Pro Ala Ala His Leu Ile Gly
Ala Pro 85 90 95 Leu Lys Gly Gln Gly Leu Gly Trp Glu Thr Thr Lys
Glu Gln Ala Phe 100 105 110 Leu Thr Ser Gly Thr Gln Phe Ser Asp Ala
Glu Gly Leu Ala Leu Pro 115 120 125 Gln Asp Gly Leu Tyr Tyr Leu Tyr
Cys Leu Val Gly Tyr Arg Gly Arg 130 135 140 Ala Pro Pro Gly Gly Gly
Asp Pro Gln Gly Arg Ser Val Thr Leu Arg 145 150 155 160 Ser Ser Leu
Tyr Arg Ala Gly Gly Ala Tyr Gly Pro Gly Thr Pro Glu 165 170 175 Leu
Leu Leu Glu Gly Ala Glu Thr Val Thr Pro Val Leu Asp Pro Ala 180 185
190 Arg Arg Gln Gly Tyr Gly Pro Leu Trp Tyr Thr Ser Val Gly Phe Gly
195 200 205 Gly Leu Val Gln Leu Arg Arg Gly Glu Arg Val Tyr Val Asn
Ile Ser 210 215 220 His Pro Asp Met Val Asp Phe Ala Arg Gly Lys Thr
Phe Phe Gly Ala 225 230 235 240 Val Met Val Gly 6 281 PRT Homo
sapiens 6 Met Gln Gln Pro Phe Asn Tyr Pro Tyr Pro Gln Ile Tyr Trp
Val Asp 1 5 10 15 Ser Ser Ala Ser Ser Pro Trp Ala Pro Pro Gly Thr
Val Leu Pro Cys 20 25 30 Pro Thr Ser Val Pro Arg Arg Pro Gly Gln
Arg Arg Pro Pro Pro Pro 35 40 45 Pro Pro Pro Pro Pro Leu Pro Pro
Pro Pro Pro Pro Pro Pro Leu Pro 50 55 60 Pro Leu Pro Leu Pro Pro
Leu Lys Lys Arg Gly Asn His Ser Thr Gly 65 70 75 80 Leu Cys Leu Leu
Val Met Phe Phe Met Val Leu Val Ala Leu Val Gly 85 90 95 Leu Gly
Leu Gly Met Phe Gln Leu Phe His Leu Gln Lys Glu Leu Ala 100 105 110
Glu Leu Arg Glu Ser Thr Ser Gln Met His Thr Ala Ser Ser Leu Glu 115
120 125 Lys Gln Ile Gly His Pro Ser Pro Pro Pro Glu Lys Lys Glu Leu
Arg 130 135 140 Lys Val Ala His Leu Thr Gly Lys Ser Asn Ser Arg Ser
Met Pro Leu 145 150 155 160 Glu Trp Glu Asp Thr Tyr Gly Ile Val Leu
Leu Ser Gly Val Lys Tyr 165 170 175 Lys Lys Gly Gly Leu Val Ile Asn
Glu Thr Gly Leu Tyr Phe Val Tyr 180 185 190 Ser Lys Val Tyr Phe Arg
Gly Gln Ser Cys Asn Asn Leu Pro Leu Ser 195 200 205 His Lys Val Tyr
Met Arg Asn Ser Lys Tyr Pro Gln Asp Leu Val Met 210 215 220 Met Glu
Gly Lys Met Met Ser Tyr Cys Thr Thr Gly Gln Met Trp Ala 225 230 235
240 Arg Ser Ser Tyr Leu Gly Ala Val Phe Asn Leu Thr Ser Ala Asp His
245 250 255 Leu Tyr Val Asn Val Ser Glu Leu Ser Leu Val Asn Phe Glu
Glu Ser 260 265 270 Gln Thr Phe Phe Gly Leu Tyr Lys Leu 275 280 7
338 DNA Homo sapiens misc_feature (4) n equals a, t, g, or c 7
aggntaactc tcctgagggg tgagccaagc cctgccatgt agtgcacgca ggacatcanc
60 aaacacannn nncaggaaat aatccattcc ctgtggtcac ttattctaaa
ggccccaacc 120 ttcaaagttc aagtagtgat atggatgact ccacagaaag
ggagcagtca cgccttactt 180 cttgccttaa gaaaagagaa gaaatgaaac
tgnaaggagt gtgtttccat cctcccacgg 240 aaggaaagcc cctctntccg
atcctccaaa gacggaaagc tgctggctgc aaccttgntg 300 ntggcattgt
gttcttgctg nctcaaggtg gtgttntt 338 8 509 DNA Homo sapiens
misc_feature (10) n equals a, t, g, or c 8 aattcggcan agnaaactgg
ttactttttt atatatggtc aggttttata tactgataag 60 acctacgcca
tgggacatct agttcagagg aagaaggtcc atgtctttgg ggatgaattg 120
agtctggtga ctttgtttcg atgtattcaa aatatgcctg aaacactacc caataattcc
180 tgctattcag ctggcattgc aaaactggna ggaaggagat gaactccaac
ttgcaatacc 240 aggggaaaat gcacaattat cactgggatg gagatgttca
cattttttgg gtgccattga 300 aactgctgtg acctncttac ancangtgct
gttngctatt ttncctncct nttctntggt 360 aacctcttag gaaggaagga
ttcttaactg ggaaataacc caaaaaaann ttaaangggt 420 angngnnana
ngnggggnng ttnncnngnn gnnttttngg nntatnttnt nntngggnnn 480
ngtaaaaatg gggccnangg gggnttttt 509 9 497 DNA Homo sapiens
misc_feature (168) n equals a, t, g, or c 9 aattcggcac gagcaaggcc
ggcctggagg aagctccagc tgtcaccgcg ggactgaaaa 60 tctttgaacc
accagctcca ggagaaggca actccagtca gaacagcaga aataagcgtg 120
ccgttcaggg tccagaagaa acagtcactc aagactgctt gcaactgntt gcagacagtg
180 aaacaccaac tatacaaaaa ggctcccttc tgntgccaca tttgggccaa
ggaatggaga 240 gatttcttcg tctggaaaca ttttgccaaa ctcttcagat
actctttnct ctctgggaat 300 caaaggaaaa tctctactta gattnacaca
tttgttccca tgggtntctt aagttttaaa 360 aggggagtgc ccttaggagg
aaaaggggat aaatattggc caaggnactg gttantttnt 420 aaatatggtc
aggtttntat anctggtagg cctcgccatg ggcattnatt canggngagg 480
ncnntctttt gggntga 497 10 27 DNA Artificial sequence PCR primer 10
gtgggatcca gcctccgggc agagctg 27 11 33 DNA Artificial sequence PCR
primer 11 gtgaagcttt tattacagca gtttcaatgc acc 33 12 26 DNA
Artificial sequence PCR primer 12 gtgtcatgag cctccgggca gagctg 26
13 33 DNA Artificial sequence PCR primer 13 gtgaagcttt tattacagca
gtttcaatgc acc 33 14 28 DNA Artificial sequence PCR primer 14
gtgggatccc cgggcagagc tgcagggc 28 15 33 DNA Artificial sequence PCR
primer 15 gtgggatcct tattacagca gtttcaatgc acc 33 16 129 DNA
Artificial sequence PCR primer 16 gcgggatccg ccaccatgaa ctccttctcc
acaagcgcct tcggtccagt tgccttctcc 60 ctggggctgc tcctggtgtt
gcctgctgcc ttccctgccc cagttgtgag acaaggggac 120 ctggccagc 129 17 30
DNA Artificial sequence PCR primer 17 gtgggatcct tacagcagtt
tcaatgcacc 30 18 903 DNA Homo sapiens CDS (1)..(798) 18 atg gat gac
tcc aca gaa agg gag cag tca cgc ctt act tct tgc ctt 48 Met Asp Asp
Ser Thr Glu Arg Glu Gln Ser Arg Leu Thr Ser Cys Leu 1 5 10 15 aag
aaa aga gaa gaa atg aaa ctg aag gag tgt gtt tcc atc ctc cca 96 Lys
Lys Arg Glu Glu Met Lys Leu Lys Glu Cys Val Ser Ile Leu Pro 20 25
30 cgg aag gaa agc ccc tct gtc cga tcc tcc aaa gac gga aag ctg ctg
144 Arg Lys Glu Ser Pro Ser Val Arg Ser Ser Lys Asp Gly Lys Leu Leu
35 40 45 gct gca acc ttg ctg ctg gca ctg ctg tct tgc tgc ctc acg
gtg gtg 192 Ala Ala Thr Leu Leu Leu Ala Leu Leu Ser Cys Cys Leu Thr
Val Val 50 55 60 tct ttc tac cag gtg gcc gcc ctg caa ggg gac ctg
gcc agc ctc cgg 240 Ser Phe Tyr Gln Val Ala Ala Leu Gln Gly Asp Leu
Ala Ser Leu Arg 65 70 75 80 gca gag ctg cag ggc cac cac gcg gag aag
ctg cca gca gga gca gga 288 Ala Glu Leu Gln Gly His His Ala Glu Lys
Leu Pro Ala Gly Ala Gly 85 90 95 gcc ccc aag gcc ggc ctg gag gaa
gct cca gct gtc acc gcg gga ctg 336 Ala Pro Lys Ala Gly Leu Glu Glu
Ala Pro Ala Val Thr Ala Gly Leu 100 105 110 aaa atc ttt gaa cca cca
gct cca gga gaa ggc aac tcc agt cag aac 384 Lys Ile Phe Glu Pro Pro
Ala Pro Gly Glu Gly Asn Ser Ser Gln Asn 115 120 125 agc aga aat aag
cgt gcc gtt cag ggt cca gaa gaa aca gga tct tac 432 Ser Arg Asn Lys
Arg Ala Val Gln Gly Pro Glu Glu Thr Gly Ser Tyr 130 135 140 aca ttt
gtt cca tgg ctt ctc agc ttt aaa agg gga agt gcc cta gaa 480 Thr Phe
Val Pro Trp Leu Leu Ser Phe Lys Arg Gly Ser Ala Leu Glu 145 150
155 160 gaa aaa gag aat aaa ata ttg gtc aaa gaa act ggt tac ttt ttt
ata 528 Glu Lys Glu Asn Lys Ile Leu Val Lys Glu Thr Gly Tyr Phe Phe
Ile 165 170 175 tat ggt cag gtt tta tat act gat aag acc tac gcc atg
gga cat cta 576 Tyr Gly Gln Val Leu Tyr Thr Asp Lys Thr Tyr Ala Met
Gly His Leu 180 185 190 att cag agg aag aag gtc cat gtc ttt ggg gat
gaa ttg agt ctg gtg 624 Ile Gln Arg Lys Lys Val His Val Phe Gly Asp
Glu Leu Ser Leu Val 195 200 205 act ttg ttt cga tgt att caa aat atg
cct gaa aca cta ccc aat aat 672 Thr Leu Phe Arg Cys Ile Gln Asn Met
Pro Glu Thr Leu Pro Asn Asn 210 215 220 tcc tgc tat tca gct ggc att
gca aaa ctg gaa gaa gga gat gaa ctc 720 Ser Cys Tyr Ser Ala Gly Ile
Ala Lys Leu Glu Glu Gly Asp Glu Leu 225 230 235 240 caa ctt gca ata
cca aga gaa aat gca caa ata tca ctg gat gga gat 768 Gln Leu Ala Ile
Pro Arg Glu Asn Ala Gln Ile Ser Leu Asp Gly Asp 245 250 255 gtc aca
ttt ttt ggt gca ttg aaa ctg ctg tgacctactt acaccatgtc 818 Val Thr
Phe Phe Gly Ala Leu Lys Leu Leu 260 265 tgtagctatt ttcctccctt
tctctgtacc tctaagaaga aagaatctaa ctgaaaatac 878 caaaaaaaaa
aaaaaaaaaa aaaaa 903 19 266 PRT Homo sapiens 19 Met Asp Asp Ser Thr
Glu Arg Glu Gln Ser Arg Leu Thr Ser Cys Leu 1 5 10 15 Lys Lys Arg
Glu Glu Met Lys Leu Lys Glu Cys Val Ser Ile Leu Pro 20 25 30 Arg
Lys Glu Ser Pro Ser Val Arg Ser Ser Lys Asp Gly Lys Leu Leu 35 40
45 Ala Ala Thr Leu Leu Leu Ala Leu Leu Ser Cys Cys Leu Thr Val Val
50 55 60 Ser Phe Tyr Gln Val Ala Ala Leu Gln Gly Asp Leu Ala Ser
Leu Arg 65 70 75 80 Ala Glu Leu Gln Gly His His Ala Glu Lys Leu Pro
Ala Gly Ala Gly 85 90 95 Ala Pro Lys Ala Gly Leu Glu Glu Ala Pro
Ala Val Thr Ala Gly Leu 100 105 110 Lys Ile Phe Glu Pro Pro Ala Pro
Gly Glu Gly Asn Ser Ser Gln Asn 115 120 125 Ser Arg Asn Lys Arg Ala
Val Gln Gly Pro Glu Glu Thr Gly Ser Tyr 130 135 140 Thr Phe Val Pro
Trp Leu Leu Ser Phe Lys Arg Gly Ser Ala Leu Glu 145 150 155 160 Glu
Lys Glu Asn Lys Ile Leu Val Lys Glu Thr Gly Tyr Phe Phe Ile 165 170
175 Tyr Gly Gln Val Leu Tyr Thr Asp Lys Thr Tyr Ala Met Gly His Leu
180 185 190 Ile Gln Arg Lys Lys Val His Val Phe Gly Asp Glu Leu Ser
Leu Val 195 200 205 Thr Leu Phe Arg Cys Ile Gln Asn Met Pro Glu Thr
Leu Pro Asn Asn 210 215 220 Ser Cys Tyr Ser Ala Gly Ile Ala Lys Leu
Glu Glu Gly Asp Glu Leu 225 230 235 240 Gln Leu Ala Ile Pro Arg Glu
Asn Ala Gln Ile Ser Leu Asp Gly Asp 245 250 255 Val Thr Phe Phe Gly
Ala Leu Lys Leu Leu 260 265 20 21 DNA Artificial sequence PCR
primer 20 tggtgtcttt ctaccaggtg g 21 21 21 DNA Artificial sequence
PCR primer 21 tttcttctgg accctgaacg g 21 22 136 PRT Homo sapiens 22
His Ser Val Leu His Leu Val Pro Ile Asn Ala Thr Ser Lys Asp Asp 1 5
10 15 Ser Asp Val Thr Glu Val Met Trp Gln Pro Ala Leu Arg Arg Gly
Arg 20 25 30 Gly Leu Gln Ala Gln Gly Tyr Gly Val Arg Ile Gln Asp
Ala Gly Val 35 40 45 Tyr Leu Leu Tyr Ser Gln Val Leu Phe Gln Asp
Val Thr Phe Thr Met 50 55 60 Gly Gln Val Val Ser Arg Glu Gly Gln
Gly Arg Gln Glu Thr Leu Phe 65 70 75 80 Arg Cys Ile Arg Ser Met Pro
Ser His Pro Asp Arg Ala Tyr Asn Ser 85 90 95 Cys Tyr Ser Ala Gly
Val Phe His Leu His Gln Gly Asp Ile Leu Ser 100 105 110 Val Ile Ile
Pro Arg Ala Arg Ala Lys Leu Asn Leu Ser Pro His Gly 115 120 125 Thr
Phe Leu Gly Phe Val Lys Leu 130 135
* * * * *