U.S. patent application number 10/697535 was filed with the patent office on 2004-09-09 for infectivity-enhanced conditionally-replicative adenovirus and uses thereof.
Invention is credited to Alemany, Ramon, Curiel, David T., Dmitriev, Igor, Krasnykh, Victor.
Application Number | 20040175362 10/697535 |
Document ID | / |
Family ID | 34550384 |
Filed Date | 2004-09-09 |
United States Patent
Application |
20040175362 |
Kind Code |
A1 |
Curiel, David T. ; et
al. |
September 9, 2004 |
Infectivity-enhanced conditionally-replicative adenovirus and uses
thereof
Abstract
A modified adenovirus capable of overcoming the problem of low
level of coxsackie-adenovirus receptor (CAR) expression on tumor
cells and methods of using such adenovirus are provided. The fiber
protein of the adenovirus is modified by insertion or replacement
so as to target the adenovirus to tumor cells, and the replication
of the modified adenovirus is limited to tumor cells due to
specific promoter control or mutations in E1a or E1b genes.
Inventors: |
Curiel, David T.;
(Birmingham, AL) ; Krasnykh, Victor; (Houston,
TX) ; Alemany, Ramon; (Barcelona, ES) ;
Dmitriev, Igor; (Birmingham, AL) |
Correspondence
Address: |
Thomas J. Kowalski, Esq.
c/o FROMMER LAWRENCE & HAUP LLP
745 Fifth Avenue
New York
NY
10151
US
|
Family ID: |
34550384 |
Appl. No.: |
10/697535 |
Filed: |
October 30, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10697535 |
Oct 30, 2003 |
|
|
|
09569789 |
May 12, 2000 |
|
|
|
60133634 |
May 12, 1999 |
|
|
|
Current U.S.
Class: |
424/93.2 ;
435/235.1; 435/456 |
Current CPC
Class: |
C07K 2319/00 20130101;
A61K 45/06 20130101; A61K 35/761 20130101; A61P 35/00 20180101;
A61K 48/0058 20130101; C12N 2810/6018 20130101; C12N 7/00 20130101;
C12N 2830/008 20130101; C12N 2810/40 20130101; C12N 2710/10321
20130101; C12N 2810/405 20130101; C12N 2810/859 20130101; C07K
16/081 20130101; C12N 2810/851 20130101; C12N 2710/10343 20130101;
A61K 2300/00 20130101; C12N 2710/10345 20130101; A61K 48/00
20130101; C07K 2317/55 20130101; C12N 15/86 20130101 |
Class at
Publication: |
424/093.2 ;
435/456; 435/235.1 |
International
Class: |
A61K 048/00; C12N
007/00; C12N 015/861 |
Goverment Interests
[0002] This invention was produced in part using funds obtained
through a grant from the National Institutes of Health.
Consequently, the federal government has certain rights in this
invention.
Claims
What is claimed is:
1. An infectivity-enhanced conditionally-replicative adenovirus,
wherein said adenovirus possesses enhanced infectivity towards a
specific cell type due to a modification or replacement of the
fiber of a wildtype adenovirus, said modification or replacement
results in enhanced infectivity relative to said wildtype
adenovirus, and wherein said infectivity-enhanced
conditionally-replicative adenovirus has at least one conditionally
regulated early gene, said early gene conditionally regulated such
that replication of said infectivity-enhanced
conditionally-replicative adenovirus is limited to said specific
cell type.
2. The infectivity-enhanced conditionally-replicative adenovirus of
claim 1, wherein said cell type is a tumor cell.
3. The infectivity-enhanced conditionally-replicative adenovirus of
claim 1, wherein said modification or replacement to the fiber
results in coxsackie-adenovirus receptor-independent gene transfer
with respect to the type 5 receptor.
4. The infectivity-enhanced conditionally-replicative adenovirus of
claim 1, wherein said modification or replacement to the fiber is
selected from the group consisting of introducing a ligand into the
HI loop of said fiber, replacing said fiber with a substitute
protein which presents a targeting ligand, and introducing a fiber
knob domain from a different subtype of adenovirus.
5. The infectivity-enhanced conditionally-replicative adenovirus of
claim 4, wherein said ligand is selected from the group consisting
of physiological ligands, anti-receptor antibodies and
cell-specific peptides.
6. The infectivity-enhanced conditionally-replicative adenovirus of
claim 4, wherein said ligand comprises a tripeptide of Arg-Gly-Asp
(RGD).
7. The infectivity-enhanced conditionally-replicative adenovirus of
claim 4, wherein said ligand comprises a peptide having the
sequence CDCRGDCFC.
8. The infectivity-enhanced conditionally-replicative adenovirus of
claim 1, wherein said early gene is conditionally regulated by
means selected from the group consisting of a tissue-specific
promoter operably linked to said early gene and a mutation in said
early gene.
9. The infectivity-enhanced conditionally-replicative adenovirus of
claim 8, wherein said tissue-specific promoter is from a gene
encoding a protein selected from the group consisting of prostate
specific antigen, carcinoembryonic antigen, secretory leukoprotease
inhibitor, alpha-fetoprotein, vascular endothelial growth factor,
CXCR4 and survivin.
10. The infectivity-enhanced conditionally-replicative adenovirus
of claim 1, wherein said infectivity-enhanced
conditionally-replicative adenovirus carries a therapeutic gene in
its genome.
11. The infectivity-enhanced conditionally-replicative adenovirus
of claim 10, wherein said therapeutic gene is a herpes simplex
virus thymidine kinase gene.
12. A method of killing tumor cells in an individual, comprising
the steps of: pretreating said individual with an effective amount
of the infectivity-enhanced conditionally-replicative adenovirus of
claim 11; and administering ganciclovir to said individual.
13. A method of providing adenoviral gene therapy in an individual,
comprising the steps of: administering to said individual a
therapeutic dose of an infectivity-enhanced
conditionally-replicative adenovirus, wherein said adenovirus
possesses enhanced infectivity towards a specific cell type due to
modification or replacement of the fiber of a wildtype adenovirus,
wherein said modification or replacement results in enhanced
infectivity relative to said wildtype adenovirus, and wherein said
infectivity-enhanced conditionally-replicative adenovirus has at
least one conditionally regulated early gene, said early gene
conditionally regulated such that replication of said
infectivity-enhanced conditionally-replicative adenovirus is
limited to said specific cell type.
14. The method of claim 13, wherein said administration is by means
selected from the group consisting of intravenously,
intraperitoneally, systemically, orally and intratumorally.
15. The method of claim 13, wherein said individual has cancer.
16. The method of claim 13, wherein said cell is a tumor cell.
17. The method of claim 13, wherein said modification or
replacement to the fiber results in coxsackie-adenovirus
receptor-independent gene transfer with respect to the type 5
receptor.
18. The method of claim 13, wherein said modification or
replacement to the fiber is selected from the group consisting of
introducing a ligand into the HI loop of said fiber, replacing said
fiber with a substitute protein which presents a targeting ligand,
and introducing a fiber knob domain from a different subtype of
adenovirus.
19. The method of claim 18, wherein said ligand is selected from
the group consisting of physiological ligands, anti-receptor
antibodies and cell-specific peptides.
20. The method of claim 18, wherein said ligand comprises a
tripeptide having the sequence Arg-Gly-Asp (RGD).
21. The method of claim 18, wherein said ligand comprises a peptide
having the sequence CDCRGDCFC.
22. The method of claim 13, wherein said early gene is
conditionally regulated by means selected from the group consisting
of a tissue-specific promoter operably linked to said early gene
and a mutation in said early gene.
23. The method of claim 22, wherein said tissue-specific promoter
is from a gene encoding a protein selected from the group
consisting of prostate specific antigen, carcinoembryonic antigen,
secretory leukoprotease inhibitor, alpha-fetoprotein, vascular
endothelial growth factor, CXCR4 and survivin.
24. The method of claim 13, wherein said adenovirus carries in its
genome a therapeutic gene.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This continuation-in-part application claims the benefit of
patent application U.S. Ser. No. 09/569,789, filed May 12, 2000,
which claims benefit of provisional patent application U.S. S No.
60/133,634, filed May 12, 1999, now abandoned.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention relates generally to adenoviral
vectors. More specifically, the present invention relates to
infectivity-enhanced conditionally replicative adenovirus
vectors.
[0005] 2. Description of the Related Art
[0006] Surgery, chemotherapy and radiotherapy constitute the
conventional therapies in clinical use to treat cancer. These
therapies have produced a high rate of cure in early-stage cancer,
but most late-stage cancers remain incurable because they cannot be
resected or the dose of radiation or chemotherapy administered is
limited by toxicity to normal tissues. An alternative promising
approach is the transfer of genetic material to tumor or normal
cells as a new therapy itself or to increase the therapeutic index
of the existing conventional therapies. In this regard, three main
strategies have been developed to accomplish cancer gene therapy:
potentiating immune responses against tumors, eliciting direct
toxicity to tumors, and compensating the molecular lesions of tumor
cells.
[0007] To achieve the high level of gene transfer required in most
cancer gene therapy applications, several viral and non-viral
vectors have been designed. Adenoviral vectors have been used
preferentially over other viral and non-viral vectors for several
reasons, including infectivity of epithelial cells, high titers, in
vivo stability, high levels of expression of the transgene,
gene-carrying capability, expression in non-dividing cells, and
lack of integration of the virus into the genome. In most of the
adenoviral vectors used in cancer gene therapy, the transgene
substitutes for the early 1 region (E1) of the virus. The E1 region
contains the adenoviral genes expressed first in the infectious
stage and controls expression of the other viral genes. The early
region 3 (E3) gene codes for proteins that block a host's immune
response to viral-infected cells and is also usually deleted in
vectors used for cancer gene therapy, particularly in
immunopotentiating strategies.
[0008] E1-substituted, E3-deleted vectors can carry up to 8 kb of
non-viral DNA, which is sufficient for most gene therapy
applications. E1-substituted, E3-deleted vectors are propagated in
packaging cell lines that transcomplement their E1-defectiveness,
with production yields of up to 10,000 virion particles per
infected cell, depending upon the transgene and its level of
expression in the packaging cell. Not all of the viral particles
are able to transduce cells or to replicate in the packaging cell
line, so bioactivity of a particular vector has been defined as the
ratio of functional particles to total particles. This bioactivity
varies from {fraction (1/10)} to {fraction (1/1000)}, depending not
only upon the vector, but also upon the methods of purification and
quantification. The titer used is the concentration of functional
particles, which can be as high as 10.sup.12 per milliliter.
[0009] One problem encountered when propagating these vectors to
high titers is the recombination of vector sequences with the E1
sequences present in the packaging cell line, thereby producing
replication-competent adenoviruses (RCA). This problem has been
solved by using packaging cell lines where the E1 gene does not
overlap with the vector sequences.
[0010] The current generation of adenoviral vectors are limited in
their use for cancer gene therapy, primarily for three reasons: (1)
the vectors are cleared by the reticuloendothelial system; (2) the
vectors are immunogenic; and (3) the vectors infect normal cells.
The problem of filtration by the reticuloendothelial system cells
such as macrophages of the spleen or Kupffer cells of the liver
affects adenoviral vectors as well as other viral and non-viral
vectors and limits their utility in intravascular administration.
The early and late viral genes that remain in E1-E3 deleted vectors
may also be expressed at low, but sufficient enough levels such
that the transduced cells are recognized and lysed by the activated
cytotoxic T lymphocytes. Additionally, a higher viral dose must be
injected to reach the entire tumor before a neutralizing immune
response develops. The major limitation then becomes the amount of
vector that can be safely administered, which will depend upon the
capacity of the vector to affect tumor cells without affecting
normal cells.
[0011] The limitations of adenoviral vectors at the level of
infectivity is two-fold. On the one hand, human clinical trials
with adenoviral vectors have demonstrated relatively inefficient
gene transfer in vivo. This has been related to the paucity of the
primary adenovirus receptor, coxsackie-adenovirus receptor (CAR),
on tumor cells relative to their cell line counterparts. On this
basis, it has been proposed that gene delivery via CAR-independent
pathways may be required to circumvent this key aspect of tumor
biology. On the other hand, adenoviral vectors efficiently infect
normal cells of many epithelia. This results in the expression of
the transgene in normal tissue cells with the consequent adverse
effects. This problem has been addressed by targeting adenoviral
vectors to tumor cells at the level of receptor interaction and
transgene transcription.
[0012] Targeting adenoviral vectors to new receptors has been
achieved by using conjugates of antibodies and ligands, in which
the antibody portion of the conjugate blocks the interaction of the
fiber with the CAR receptor and the ligand portion provides binding
for a novel receptor. Receptor targeting has also been achieved by
genetic modification of the fiber.
[0013] Transcriptional targeting of adenoviral vectors has been
demonstrated using tumor-antigen promoters or tissue-specific
promoters to control the expression of the transgene. However,
these promoters can lose their specificity when inserted in the
viral genome and, depending upon the level of toxicity of the
transgene, even low levels of expression can be detrimental to
normal cells. Thus, for cancer gene therapy, the major issues
limiting the utility of adenoviral vectors are the efficiency and
specificity of the transduction.
[0014] A major limitation found in the use of adenoviral vectors in
the clinical setting is the number of tumor cells that remain
unaffected by the transgene. A vector that propagates specifically
in tumor cells, results in lysis and subsequently allows for
transduction of neighbor cells by newly produced virions will
increase the number of tumor cells affected by the transgene. A
good replicative vector should be weakly pathogenic or
non-pathogenic to humans and should be tumor-selective. Efforts
have been aimed at improving the safety of replication-competent
adenoviruses with the goal of being able to administer much higher
doses. One strategy is to transcomplement the E1 defect with an
E1-expression plasmid conjugated into the vector capsid, which
allows a single round of replication thereby producing a new
E1-substituted vector with the ability of local amplification and
subsequent gene transduction.
[0015] Other strategies are designed to obtain vectors that
replicate continuously and whose progeny are also able to
replicate, but are incapable of propagating in normal cells. In
this regard, two approaches have been described that render
adenovirus propagation selective for tumor cells: (1) deletions,
and (2) promoter regulation. Adenoviral mutants unable to
inactivate p53 propagate poorly in cells expressing p53 but
efficiently in tumor cells where p53 is already inactive. Based
upon this strategy, an adenovirus mutant in which the E1b-55k viral
protein was deleted and was unable to bind to p53 was effective in
eliminating tumors in preclinical models and is in clinical trials.
Controlling viral replication by substituting a viral promoter,
such as the E1a promoter, with a tumor associated-antigen promoter,
such as the alpha-fetoprotein promoter or the prostate antigen
promoter, has been demonstrated, and specific lysis of tumors
transfected with an adenovirus vector expressing either of the
above-mentioned promoters was demonstrated in murine models.
[0016] Both approaches have limitations, however. The fact that
other viral proteins besides E1b 55K also interact with p53, and
because p53 can be necessary for the active release of virus in the
later stages of infection may affect the specificity of the vector.
Another caveat results from using E1a as the only controlled viral
gene since E1a-like activity has been found in many tumor cell
lines. Furthermore, the actual specificity of the above-mentioned
promoters for cancer cells, and the fact that promoters inserted in
the viral genome can lose their expression specificity are factors
that hindered clinical applications of this approach.
[0017] Therefore, new methods are clearly needed to achieve more
selective therapeutic effects of replication-competent
adenoviruses. For these vectors, in parallel to what has been
achieved with non-replicative vectors, modification of viral
tropism could enhance tumor transduction and tumor selectivity at
the level of cell entry, and in this way realize the full potential
of replicative vectors for cancer gene therapy.
[0018] The prior art is deficient in adenoviral vectors that are
specific for a particular cell type (i.e., do not infect other cell
types) and that replicate with high efficiency in only those
particular cell types. The present invention fulfills this
long-standing need in the art.
SUMMARY OF THE INVENTION
[0019] Adenoviral vectors have been widely employed in cancer gene
therapy. Their high titers, structural stability, broad
infectivity, high levels of transgene expression, and lack of
integration have contributed to the utility of this vector. In this
regard, adenoviral vectors have been used to transfer a variety of
genes such as cytokines, tumor suppresser genes, pro-drug
converting genes, antisense RNAs and ribozymes to inhibit the
expression of oncogenes, antiangiogenic genes, etc. Despite the
promise of adenoviral vectors, results from experimental models and
clinical trials have been less than optimal.
[0020] Within this context, several specific limitations have been
identified. One limitation lies in the poor infectability of
primary tumors due to low levels of the primary adenovirus receptor
CAR. A second limitation that particularly affects the efficiency
of replicative vectors is related to the lack of tumor-specific
replication achieved using promoters or mutations. The present
invention describes methods to increase adenovirus infectivity
based upon modification of the virus tropism. The present invention
demonstrates that modification of the adenovirus fiber by genetic
manipulation increases infectivity of primary tumors several orders
of magnitude due to CAR-independent gene transfer. In addition,
selective replication in tumors is described herein, and represents
a safe and effective means to lyse and transduce tumors. The
present invention further describes a strategy based upon control
of the expression of one or more essential early viral genes using
tumor-specific promoters.
[0021] It is a goal of the present invention to improve the
infectivity and specificity of conditional replicative vectors,
thereby improving their therapeutic utility and efficacy.
[0022] One object of the present invention is to provide adenoviral
vectors that possess enhanced infectivity to a specific cell type
(i.e., that are not limited to CAR-dependent cell entry) and that
replicate with high efficiency in only those cell types.
[0023] In one embodiment of the present invention, there is
provided an infectivity-enhanced conditionally-replicative
adenovirus. This adenovirus possesses enhanced infectivity towards
a specific cell type, which is accomplished by a modification or
replacement of the fiber of the adenovirus. The modification is
accomplished by introducing a fiber knob domain from a different
subtype of adenovirus, introducing a ligand into the HI loop of the
fiber knob, or replacing the fiber with a substitute protein which
presents a targeting ligand. Additionally, the adenovirus has at
least one conditionally regulated early gene, such that replication
of the adenovirus is limited to the specific cell type.
[0024] Other and further aspects, features, and advantages of the
present invention will be apparent from the following description
of the presently preferred embodiments of the invention. These
embodiments are given for the purpose of disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 shows that an anti-knob Fab-FGF2 conjugate enhances
cell transduction. FIG. 1A shows that AdCMVluc (5.times.10.sup.7
pfu) was preincubated with 1.44 .mu.g of Fab or 1.94 .mu.g of
Fab-FGF2. SKOV3 cells (24,000 cells per well in 24-well plates)
were infected with control vector or with the vector complexes (MOI
of 50). Inhibition was performed by adding a polyclonal anti-FGF2
to the complex before infection. Luciferase activity in cell
lysates was assayed 24 h after infection. The mean of triplicate
experiments is shown. FIG. 1B shows that AdCMVLacZ was complexed
with Fab-FGF2 conjugate as in FIG. 1A. SKOV3 cell were infected
with control vector (a, c) or complexed vector (b, d) at MOI of 5
(a, b) or 50 (c, d) and stained with X-gal 24 h after
infection.
[0026] FIG. 2 shows that Fab-FGF2 retargeting augments in vivo
therapeutic benefit of the AdCMVHSV-TK vector. Five days after i.p.
inoculation of 2.times.10.sup.7 SKOV3 cell in SCID mice,
2.times.10.sup.8 or 2.times.10.sup.9 pfu of AdCMVTK alone or
complexed with FGF2 were injected i.p. Forty-eight h later, half of
the mice were treated with GCV (50 mg/kg body weight) for 14 days.
Survival was monitored daily.
[0027] FIG. 3 shows the HI loop of the fiber as a domain to insert
ligand for retargeting adenoviruses. FIG. 3A shows the knob trimer
viewed along the three-fold symmetry axis (Reproduced from Xia et
al. [42]). FIG. 3B shows the localization of targeting ligands
within the fiber molecule.
[0028] FIG. 4 shows adenovirus-mediated gene transfer to various
human cell lines. 293 (FIG. 4A), human vascular endothelial cells
(HUVEC) (FIG. 4B) or Rhabdomyosarcoma (RD) (FIG. 4C) cells
preincubated for 10 min at room temperature in medium containing
recombinant Ad5 fiber knob at 100 .mu.g/ml were then exposed for 30
min at room temperature to AdCMVLuc or Ad5lucRGD in DMEM/F12 at 1,
10 or 100 pfu/cell. The unbound virus was aspirated and complete
medium was added. After incubation at 37.degree. C. for 30 hours,
the cells were lysed and the luciferase activity in relative light
units (rlu) was determined.
[0029] Background luciferase activities detected in mock infected
cells were 261, 223, and 163 rlu for 293, HUVEC and RD cells,
respectively. These activities were subtracted from all readings
obtained with the corresponding cell line. Each point represents
the mean of three determinations.+-.SD.
[0030] FIG. 5 shows a comparison of the gene transfer efficiencies
to cultured ovarian cancer cells mediated by AdCMVLuc and
Ad5lucRGD. Human ovarian cancer cells SKOV3.1p1 (FIG. 5A) and OV-4
(FIG. 5B) were transduced with AdCMVLuc or Ad5lucRGD at an MOI of 1
or 10 pfu/cell essentially as described in FIG. 4 for 293, HUVEC
and RD cells. Recombinant Ad5 fiber knob protein was added to cells
prior to infection with the virus. Each data point is the average
of three independent measurements obtained in one experiment.
[0031] FIG. 6 shows transduction of primary cells isolated from
ascites obtained from ovarian cancer patients. Cells isolated from
ascites of two (FIGS. 6A and B) ovarian cancer patients were
transduced with AdCMVLuc or Ad5lucRGD at MOI of 1 or 10 in the
presence or absence of blocking Ad5 fiber knob protein. The data
points represent the mean of three independent determinations.
[0032] FIG. 7 shows a comparison of expression of luciferase
achieved with the RGD-modified vector, AdRGDluc versus the
non-modified vector AdCMVluc. For each cell line, 25,000 cells were
infected at different MOIs and the luciferase expression was
measured 36 h after infection. The mean value of three wells is
shown.
[0033] FIG. 8 shows enhancement of adenovirus infectivity by RGD
modification of the fiber knob. Triplicates of A549 cells (panel A)
and LNCaP cells (panel B) were transduced with increasing doses of
either Ad5luc or Ad5lucRGD. After 36 h, cell transduction was
determined by luciferase assay. The data are presented as relative
light units (RLU) normalized to mg of cellular protein. The results
show an infectivity advantage of the RGD modified vector over the
non-modified one in both cell lines.
[0034] FIG. 9 shows luciferase expression levels achieved with the
RGD-modified vector, AdRGDluc, versus the non-modified vector,
AdCMVluc, depending on the adsorption time. A549 lung
adenocarcinoma cells (10.sup.5/well) were incubated with an MOI of
100 pfu/cell during different times (a larger amount of cells and a
higher MOI were used relative to the previous experiment in order
to achieve detectable expression at short adsorption times). After
the adsorption time, the cells were washed three times with PBS and
complete medium was added. Luciferase was measure 36 h after
infection. The mean value of three wells is shown.
[0035] FIG. 10 shows a conceptual representation of the conditional
replication enablement system for adenovirus. The initial
introduction of recombinant virus into the tumor mass infects the
cells shown as circles. The replication enabling plasmid converts
these cells in vector-producing cells. The produced vector can
infect adjacent cells (arrows).
[0036] FIG. 11 shows functional analysis of pE1FR. LS174T cells
were cotransduced with the plasmid indicated in the abscissa as a
liposomic complex (0.5 .mu.g DNA/1.0 .mu.g DOTAP:DOPE) and AdCMVluc
(MOI=1). Forty eight hours after transduction, the amount of virus
present in the lysate of cells was measured by a plaque assay in
293 cells.
[0037] FIG. 12 shows enhancement of E1-defective adenoviral
transgene expression by pE1FR administration. Nude mice engrafted
with human lung adenocarcinoma tumors (A549 cell line) received an
intratumoral injection of E1-defective virus AdCMVluc (108 pfu per
8-10 mm diameter tumor) mixed with plasmid pE1FR or pUC13 (3
.mu.g). One week later, luciferase expression in tumors was
measured. Each bar represents one mouse with a pair of tumors, one
treated with AdCMVluc and pE1FR and the other one with AdCMVluc and
pUC13. The ratio of luciferase expression in the tumor treated with
pE1FR versus the one treated with pUC13 is shown.
[0038] FIG. 13 shows the E1A-like activity of IL-6 can be exploited
to produce Ad312 virions in HepG2 cells and in a variety of cell
lines responsible to IL-6. Cells (1 to 4.times.10.sup.5) were
infected with wild type adenovirus or Ad5dl312 at an MOI of 10 in
the absence or presence of 100 units/ml of rhIL-6. Six days later,
cells were lysed and the amount of virus in the lysates was
quantitated by plaque assay in 293 cells. For each cell line, bar
from left to right represent wild type, wild type+IL-6, dl312, and
dl312+IL-6.
[0039] FIG. 14 shows replication of Ad5dl312 and oncolytic effect
in tumor cells without IL-6 addition. Ovarian carcinoma cells
(OVCAR-3) were infected with E1-a deleted AD5dl312, wild type or
E4-deleted Ad5dl1014 (MOI=10). FIG. 14A shows that six days
post-infection, cells were lysed and the amount of virus in the
lysates was measured by plaque assay in 293 cells (for WT and
dl312) or W162 cells (for dl1014). FIG. 14B shows that in a
separate experiment, seven days post-infection cells were fixed
with formaldehyde and stained with crystal violet. No viable cells
were found in wells with cells infected with WT and dl312 viruses
in contrast to mock-infected and dl1014-infected cells.
[0040] FIG. 15 shows that E1a-deleted virus dl312 can lyse human
ovarian cancer cells. SW626 cells and two primary cultures of two
ovarian tumors were infected with E1-a deleted Ad5dl312, wild type
or E4-deleted Ad5dl1014 (MOI=10). Seven days post-infection, cells
were fixed with formaldehyde and stained with crystal violet. No
viable cells were found after infection with the wild type and
dl312 viruses in contrast to mock-infected and
dl1014-infections.
[0041] FIG. 16 shows that normal peritoneal lining cells do not
support the replication of the E1a-deleted Ad5dl312 adenovirus even
in the presence of exogenous IL-6. Human mesothelial were cells
isolated from normal peritoneal lining by mechanical disruption and
collagenase D treatment. Cells were infected with E1-a deleted
Ad5dl312 or wild type control (MOI=10) in the absence or presence
of IL-6. Twelve days post-infection cells were fixed with
formaldehyde and stained with crystal violet. Cells remained viable
when infected with Ad5dl312.
[0042] FIG. 17 shows the analyses of adenoviral DNA. FIG. 17A shows
the map of E1A and fiber encoding regions of Ad5-D24RGD amplified
by PCR, showing the 24-bp deletion and the introduced RGD encoding
sequence. FIG. 17B shows restriction analysis of Ad5-D24RGD. The
presence of the 24-bp deletion was confirmed by BstX I digestion of
the PCR product of the E1A region. The fragments were resolved on a
2% agarose gel, and visualized by UV fluorescence. Marker: Gibco 1
Kb DNA ladder. The presence of uncleaved PCR product verified the
presence of the deletion (left). PCR amplification products of the
region encoding the fiber from Ad5-D24 and Ad5-D24RGD were resolved
on a 6% acrylamide gel. Marker: Gibco 100 bp DNA ladder. The bigger
size (27 bp) of Ad5-D24RGD band indicates the presence of the
sequence encoding RGD (right).
[0043] FIG. 18 shows propagation efficiency of Ad5-D24 versus
Ad5-D24RGD. A549 cells were infected with 0.01 particles/cell of
Ad5-D24 or Ad5-D24RGD and incubated in medium containing 1 mCi/ml
of BrdU. At the indicated times after infection, the cells were
harvested, and the encapsidated DNA was purified by the
spermine-HCl method. Viral DNA from 6.times.10.sup.5 infected cells
was digested with HindIII, electrophoresed, and the resulting
fragments were blotted into a membrane that was processed with a
mouse anti-BrdU antibody.
[0044] The amount of BrdU incorporated into viral DNA indicated
that Ad5-D24RGD propagation is more efficient than that of
Ad5-D24.
[0045] FIG. 19 shows oncolytic potency of the RGD-modified virus.
FIG. 19A shows A549 and LNCaP cells infected with 0.001 or 0.01
particles/cell of Ad5lucRGD, Ad5-D24, or Ad5-D24RGD. Eight (A549)
and 10 days (LNCaP) later, the cells were fixed and stained with
crystal violet. A higher magnification of two wells is presented to
show the incipient cytopathic effect of Ad5-D24. FIG. 19B shows
cell viability analyzed with an XTT colorimetric assay. In both
cell lines, Ad5-D24RGD had higher lytic potency than did its
unmodified counterpart, as shown by the percentage of viable cells
remaining in the corresponding treatment conditions.
[0046] FIG. 20 shows in vivo oncolysis by high and low doses of
infectivity-enhanced CRAds. FIG. 20A shows subcutaneous A549
xenografts in nude mice treated with a single i.t. injection of
10.sup.9 viral particles of Ad5lucRGD, Ad5-D24, Ad5-D24RGD, or with
PBS alone. FIG. 20B shows subcutaneous A549 xenografts in nude mice
treated with a single i.t. injection of 10.sup.7 viral particles of
Ad5lucRGD, Ad5-D24, Ad5-D24RGD, or with PBS alone. Tumor size was
measured twice a week. Results are shown as fractional tumor
volumes (V/V0, where V=volume at each time point; V0=volume at
adenovirus injection), and each line represents the mean of 5
tumors (.+-.SD) in the high-dose group, and 4 tumors (.+-.SD) in
the low-dose group. In the high-dose experiment, both CRAds show a
similar oncolytic effect that results in smaller tumors compared to
PBS treated groups (*Ad5-D24 p<0.05; **Ad5-D24RGD p<0.01).
However, in the low-dose experiment, tumors treated with Ad5-D24
followed a growth curve similar to that of tumors treated with
non-replicative Ad5-lucRGD; tumors treated with Ad5-D24RGD did not
grow (p<0.01 compared to PBS). FIG. 20C shows the detection of
adenovirus hexon in tumor xenografts by immunofluorescence. Frozen
sections of tumor specimens injected with (a) Ad5lucRGD, (b)
Ad5-D24, and (c) Ad5-D24RGD were treated with goat anti-hexon
antibody and Alexa Fluor 488-labeled donkey anti-goat antibody, and
nuclei were counterstained with Hoechst 33342.
[0047] Images were captured from Leitz fluorescence microscope
(100.times. magnification) with a double filter. Sections taken
from tumors treated with CRAds were positive for adenovirus
presence (green dots in b and c), being Ad5-D24RGD signal stronger
than that of Ad5-D24. Samples taken from tumors treated with PBS
(not shown) or Ad5lucRGD exhibited no hexon signal (a). i.t.,
intratumoral; vp, viral particles; Ad, adenovirus.
[0048] FIG. 21 shows in vivo oncolysis by systemic delivery of
infectivity-enhanced CRAds. A total dose of 10.sup.9 viral
particles divided into two consecutive doses of
5.times.10.sup.8/day of either Ad5lucRGD, Ad5-D24, Ad5-D24RGD,
Ad5-wt, or PBS were injected in the tail vein of nude mice bearing
s.c. A549 xenografts. Tumor size was measured weekly. Results are
shown as fractional tumor volumes (V/V0, where V=volume at each
time point; V0=volume at adenovirus injection), and each line
represents the mean of 4 tumors (.+-.SD). The data show that
modification of the fiber to broaden the tropism of a replicative
adenovirus improves the oncolytic potential in a systemic delivery
context.
[0049] FIG. 22 shows increased oncolytic effect of an Ad3
knob-containing chimeric adenovirus. SCCHN cells were mock-infected
or infected with vector particles (vp; 10 vp/cell or 100 vp/cell)
of two oncolytic vectors, Ad5Luc3 or Ad5/3Luc3. Three days later
the monolayers were stained with crystal violet to estimate the
amount of survival tumor cells.
[0050] FIG. 23 shows schematic diagrams of Ad vectors containing
VEGF promoter. These vectors are constructed from an E3
region-deleted Ad5 backbone and do not contain the Ad E1A promoter
region (from nucleotides 324 to 488 of the Ad genome). Deletion of
the E3 region was necessary due to the length of the 2.6 kb VEGF.
AdCMVE1 and AdVEGFE1 differ in the promoter driving E1A
expression.
[0051] FIG. 24A shows VEGF mRNA expression in various cell lines.
The RT-PCR product for VEGF121(408 bp), VEGF165 (541 bp) or GAPDH
(574 bp) is shown in upper or lower panel respectively. Lane 1,
H82; lane 2, H460; lane 3, H157; lane 4, H322; lane 5, H522; lane
6, H1299; lane 7, QG56; lane 8, QG90; lane 9, A427; lane 10, H358;
lane 11, A549; lane 12, N417 (lanes 1-12 are lung cancer cell
lines); lane 13, BEAS-2B, a normal bronchial epithelial cell line;
lane 14, SKOV3.1p1, ovarian cancer cells; lane 15, MeWo, melanoma
cells and lane 16, Panc-I, pancreatic cancer cells. FIG. 24B shows
VEGF protein expression in the same cell lines. 1.times.10.sup.5
cancer cells were cultured for 24 h in the serum free media. The
VEGF protein concentration in the media was measured by ELISA.
Mean+SE of triplicate determination is shown.
[0052] FIG. 25 shows transgene expression by VEGF promoter in the
Ad context in vitro. Upper panel shows luciferase activities in
various cell lines infected by Ad5CMVLuc or Ad5VEGFLuc.
1.times.10.sup.5 cells of each cell line were infected with
Ad5CMVLuc or Ad5VEGFLuc for 3 h at MOI 10. Cells were harvested 48
h after infection and lysed in 100 ml of lysis buffer. Ten ml of
each lysate was used for luciferase assay. Mean+SE of triplicate
determination is shown. Lower panel shows the ratio of VEGF
promoter activity to CMV promoter activity. To standardize the VEGF
promoter activity in each cell line, the luciferase activity with
Ad5VEGFLuc was expressed as the percentage of luciferase activity
with Ad5CMVLuc.
[0053] FIG. 26 shows tissue specificity of the VEGF promoter in the
adenoviral context. Mice received 1.times.10.sup.9 pfu of
Ad5VEGFLuc or Ad5CMVLuc via tail vein injection (three per group).
Two days after virus injection, mice were sacrificed to obtain the
organ samples. Each organ lysate was assayed for lucifrase activity
and normalized for protein concentration. Mean+SE of triplicate
determination is shown.
[0054] FIG. 27 shows viral DNA replication 24 h after infection.
1.times.10.sup.5 cells were infected with replication-competent Ad5
(Ad5VEGFE1, Ad5CMVE1 or Ad5 wt) or non-replicative Ad (Ad5VEGFLuc)
at an MOI of 10 for 3 h and then cultured for 24 h. Viral DNA was
isolated from the cells and analyzed by real-time PCR analysis to
evaluate adenoviral E4 copy number. E4 copy numbers were normalized
by the b-actin DNA copy number. Mean+SE of triplicate determination
is shown.
[0055] FIG. 28A shows the cell killing effect of AdVEGFE1 evaluated
by MTS assay. 5.times.10.sup.3H157 cells were infected with
Ad5CMVLuc (negative control), Ad5CMVE1 (positive control), or
Ad5VEGFE1 at MOI of 0.1. After infection cell viability in each
well was quantified by MTS assay every three days. The cell
viability of cells infected with Ad5VEGFE1 or Ad5CMVE1 is expressed
as the percentage of the OD490 value to control cells infected with
Ad5CMVLuc (100%). BEAS-2B cells were infected with each Ad at MOI
10 and evaluated by MTS assay in the same manner. FIG. 28B shows
the cell killing effect of AdVEGFE1 evaluated by crystal violet
staining. 2.times.10.sup.5H157 cells and BEAS-2B cells were
infected with each Ad at MOI 0.1, 1.0 or 10. All wells were stained
by crystal violet 9 days after infection to visualize viable
cells.
[0056] FIG. 29 shows Ad5VEGFE1 suppressed tumor growth in vivo.
Intact H157 cells (5.times.10.sup.6) were injected s.c. into nude
mice. When tumor formation was seen 10 days after inoculation,
1.times.10.sup.8 pfu of each virus (diamond, Ad5CMVLuc; circle,
Ad5VEGFE1; square, Ad5p53) was injected into the tumor directly.
Three similar sized tumors were injected with each virus, and the
mean volume+SE is shown.
[0057] FIG. 30 shows enhancement of infectivity to cancer cells
with Ad5/3 chimeric vector. 1.times.10.sup.5 cells of each cell
line were infected by Ad5CMVLuc or Ad5/3luc1 at MOI 10. Infected
cells were harvested 48 h after infection and lysed in 100 ml of
lysis buffer. Ten ml of each lysate was used for luciferase assay.
Mean+SE of triplicate determination is shown.
[0058] FIG. 31 shows enhancement of cell killing with Ad5/3
chimeric CRAd. Cell killing effect was evaluated by MTS assay.
5.times.10.sup.3 cells of each cell line were infected with
Ad5CMVLuc (negative control), Ad5CMVE1 (positive control),
Ad5VEGFE1 or Ad5/3VEGFE1 at MOI of 1.0. After infection cell
viability in each well was quantified using OD490 by MTS assay
every three days. The viability of cells infected with Ad5CMVE1,
Ad5VEGFE1 or Ad5/3VEGFE1 was expressed as a percentage of cells
infected with Ad5CMVLuc (100%).
[0059] FIG. 32 shows AdCK/CMV-Luc (black) demonstrates
CAR-independent tropism versus Ad5/CMV-Luc (gray) in CAR-negative
U118 cells and in the presence of increasing free Ad5 knob in
CAR-positive U118-CAR cells. 100 viral particles/cell, n=4,
Bar=S.D.
[0060] FIG. 33 shows real-time PCR quantification of CXCR4 (gray)
and Survivin (black) mRNA in various cell lines. Data expressed as
copies/ng total RNA.
[0061] FIG. 34 shows schematic of vectors Ad5/CMV-Luc,
Ad5/CXCR4-Luc and Ad5/Survivin-Luc. Promoter region is indicated
for each.
[0062] FIG. 35 shows luciferase activities as percent of
Ad5/CMV-Luc for Ad5/CXCR4-Luc and Ad5/Survivin-Luc at 48 h. 50
pfu/cell, n=3.
DETAILED DESCRIPTION OF THE INVENTION
[0063] The present invention addresses the two major limitations of
replicative adenoviral agents (viruses and vectors) in their
application to cancer gene therapy, i.e., the efficacy of
transduction and the specificity of replication. Adenovirus binds
to the coxsackie-adenovirus receptor, CAR, in the cellular membrane
using the C-terminal globular domain of the viral fiber, the knob.
Since a limited amount of coxsackie-adenovirus receptor is present
in tumors, one means to enhance infectivity would be to provide
additional binding pathways. Therefore, two methods have been
developed to modify adenovirus binding. The first method uses a Fab
fragment of an anti-knob antibody conjugated to a ligand of a
cellular receptor, while the second method comprises direct genetic
modification of the knob sequence.
[0064] One important advantage of direct genetic modification is
that the progeny will carry the modified fiber, thereby retaining
the replicative virus' enhanced infectivity trait through the
amplification cycles. Wickman et al. (1997) have generated
adenoviruses with chimeric fibers in which the ligand is connected
to the carboxyl terminal position of the fiber. This carboxyl
terminal location is not always appropriate because the addition of
more than 20-30 heterologous amino acid residues can result in the
loss of fiber trimerization and binding to the capsid. Furthermore,
the three-dimensional structure of the fiber indicates that the
carboxyl terminal end points towards the virion, and therefore,
away from the cell surface. For these reasons, the HI loop was used
herein as an exposed and amenable site for the incorporation of
exogenous sequences.
[0065] It has been recognized that the major limitation in several
strategies of cancer gene therapy resides in the need to transduce
the majority of cells of a tumor. With the exception of a limited
bystander effect described in some strategies, the cells that are
left untransduced will jeopardize and reduce any therapeutic
effect. Adenoviral vectors are limited in this regard by the
paucity of its receptor, CAR, in tumors. It is a goal of the
present invention to improve the infectivity of adenoviral vectors
by providing additional pathways to cell binding besides CAR.
Previous data has shown that modification of the HI loop of the
fiber is a feasible strategy to add new ligand motifs into the
fiber. An RGD motif has already been incorporated into the fiber of
regular E1-deleted vectors and been shown to enhance the
therapeutic effects in vivo.
[0066] With regard to the efforts to increase the specificity at
the level of virus replication, methods have been developed to
confer regulated-replication or conditional-replication competency
to adenoviral vectors based upon complementing, in trans, the
essential early genes that are missing in the replication-defective
vectors. In this way, E1-deleted and E4-deleted vectors have been
transcomplemented by conjugating them to E1 or E4 expression
plasmids. This method enables the vectors to replicate, thereby
augmenting their transduction ability. Methods have also been
explored that allow the continuous replication of the vector, such
as using the E1a-like activity provided by interleukin 6 to enable
replication of E1a-deleted vectors.
[0067] The present invention further describes methods to enhance
the specificity of the replication of these replicative adenoviral
vectors. The current methods of mutating E1, or regulation of E1
with tumor-specific promoters, are both very rational approaches,
but may prove not selective enough for several reasons. In the case
of E1 deletions, the main limitation lies in incomplete knowledge
of the role of these proteins in the viral replicative cycle and in
controlling the cell cycle. For example, adenovirus may use a
p53-dependent mechanism to release the progeny from the infected
cell. This would predicate a positive role for p53 in virus
production and would reduce the yields of virus in p53-deficient
cells. On the other hand, other viral proteins besides E1-55K may
block p53 function, such as E4, and this would allow the 55K to
replicate in p53+cells. In any case the specificity of a 55K.sup.-
for p53-defective cells is controversial. Regarding to strategies
based on regulation of E1 it is a concern that promoters can lose
certain degree of specificity when inserted into the viral genome.
The presence of E1-like activity in uninfected cells could also
pose a problem for the specificity achieved with both vectors. In
this regard, some replication of E1 vectors has been observed in
many different cell lines.
[0068] Therefore, it is desirable to improve the replication
selectivity of replicative adenoviral vectors for tumors by
achieving tumor-selective regulation of key early genes other than
E1, such as E2 or E4. An adenovirus-polylysine-DNA
transcomplementation system has been developed as a means to
evaluate replication. This replication-enabling system is used to
analyze the efficacy and specificity of tumor-specific replication
mechanisms based on the regulation of the E4 or E2 genes. In the
transcomplementation system, plasmids encoding E2 or E4 under the
control of different tumor-specific promoters are used to screen
for mechanisms that confer selective replication. Ultimately,
selective replication will involve the incorporation of the
regulated E4 or E2 into the viral genome to achieve continuous
replication. Accordingly, after the tumor-selective replication has
been demonstrated, these regulatory mechanisms are incorporated
into a single viral vector. Optimally, these regulatory mechanisms
are combined with the fiber modification described herein to
enhance infectivity.
[0069] Initial tumor models are based on cell lines with
differential expression of the PSA protein: LNCaP and DU145. Tumors
derived from lung adenocarcinoma cell lines and ovarian cell lines
are used to evaluate viruses with promoters such as
Carcinoembryonic antigen (CEA) or secretory leukoprotease inhibitor
(SLPI). Therapeutic effects are only observed in tumors derived
from the cell lines that allow the expression of the tumor-specific
controlled E4 or E2, that is, replication of the virus. In these
permissive cell lines, higher therapeutic advantage is observed for
the RGD-modified virus relative to the unmodified virus. The
present invention is directed towards an infectivity-enhanced
conditionally-replicative adenovirus. This adenovirus possesses
enhanced infectivity towards a specific cell type, which is
accomplished by a modification or replacement of the fiber of a
wildtype adenovirus and results in enhanced infectivity relative to
the wildtype adenovirus. The adenovirus also has at least one
conditionally regulated early gene, such that replication of the
adenovirus is limited to the specific cell type. Preferably, the
cell is a tumor cell.
[0070] Preferably, the modification or replacement of the fiber
results in CAR-independent gene transfer. Generally, the
modification is accomplished by introducing a fiber knob domain
from a different subtype of adenovirus. The fiber can also be
modified by introducing a ligand into the HI loop of the fiber
knob, or replacing the fiber with a substitute protein which
presents a targeting ligand. Representative ligands include
physiological ligands, anti-receptor antibodies and cell-specific
peptides. Additionally, the ligand may comprise a tripeptide having
the sequence Arg-Gly-Asp (RGD), or more specifically, a peptide
having the sequence CDCRGDCFC.
[0071] Generally, the fiber substitute protein associates with the
penton base of the adenovirus. Structurally, the fiber substitute
protein is preferably a rod-like, trimeric protein. It is desirable
for the diameter of the rod-like, trimeric protein to be comparable
to the native fiber protein of wild type adenovirus. It is
important that the fiber substitute protein retain trimerism when a
sequence encoding a targeting ligand is incorporated into the
carboxy-terminus. In a preferred aspect, a representative example
of a fiber substitute protein is T4 bacteriophage fibritin protein.
In a preferred embodiment, the fiber substitute protein comprises:
a) an amino-terminal portion comprising an adenoviral fiber tail
domain; b) a chimeric fiber substitute protein; and c) a
carboxy-terminal portion comprising a targeting ligand. More
generally, the fiber substitute protein can be selected from the
group consisting of trimeric structural proteins, trimeric viral
proteins and trimeric transcription factors. Other representative
examples of fiber substitute proteins include isoleucine
trimerization motif and neck region peptide from human lung
surfactant D. Preferably, the fiber substitute protein has a coiled
coil secondary structure. The secondary structure provides
stability because of multiple interchain interactions. The fiber
substitute protein does not have to be a natural protein. In fact,
a person having ordinary skill in this art would be able to
construct an artificial protein. Preferably, such an artificial
fiber substitute protein would have a coiled coil secondary
structure.
[0072] The early gene may be conditionally regulated by means
consisting of a tissue-specific promoter operably linked to an
early gene (e.g., E1, E2 and/or E4) and a mutation in an early gene
(e.g., E1, E2 and/or E4). Representative tissue-specific promoters
are derived from genes encoding proteins such as the prostate
specific antigen (PSA), Carcinoembryonic antigen (CEA), secretory
leukoprotease inhibitor (SLPI), alpha-fetoprotein (AFP), vascular
endothelial growth factor, CXCR4 or survivin.
[0073] Additionally, the adenovirus may carry a therapeutic gene in
its genome. In conjunction with the above-mentioned adenoviral
vector, a method of providing gene therapy to an individual is
disclosed herein, comprising the steps of: administering to the
individual an effective amount of an infectivity-enhanced
conditionally-replicative adenovirus.
[0074] Representative routes of administration are intravenously,
intraperitoneally, systemically, orally and intratumorally.
Generally, the individual has cancer and the cell is a tumor cell.
When the therapeutic gene carried by the adenovirus is, for
instance, a herpes simplex virus thymidine kinase gene, the present
invention further provides for a method of killing tumor cells in
an individual, comprising the steps of: pretreating the individual
with an effective amount of an infectivity-enhanced
conditionally-replicative adenovirus expressing the TK gene; and
administering ganciclovir to the individual. Generally, the
individual has cancer. In accordance with the present invention,
there may be employed conventional molecular biology, microbiology,
and recombinant DNA techniques within the skill of the art.
[0075] Such techniques are explained fully in the literature. See,
e.g., Sambrook, Fritsch & Maniatis, "Molecular Cloning: A
Laboratory Manual (1982); "DNA Cloning: A Practical Approach,"
Volumes I and II (D. N. Glover ed. 1985); "Oligonucleotide
Synthesis" (M. J. Gait ed. 1984); "Nucleic Acid Hybridization" [B.
D. Hames & S. J. Higgins eds. (1985)]; "Transcription and
Translation" [B. D. Hames & S. J. Higgins eds. (1984)]; "Animal
Cell Culture" [R. I. Freshney, ed. (1986)]; "Immobilized Cells And
Enzymes" [IRL Press, (1986)]; B. Perbal, "A Practical Guide To
Molecular Cloning" (1984). Therefore, if appearing herein, the
following terms shall have the definitions set out below.
[0076] A "vector" is a replicon to which another DNA segment may be
attached so as to bring about the replication of the attached
segment. A "replicon" is any genetic element (e.g., plasmid,
chromosome, virus) that functions as an autonomous unit of DNA
replication in vivo; i.e., capable of replication under its own
control. An "expression control sequence" is a DNA sequence that
controls and regulates the transcription and translation of another
DNA sequence. A coding sequence is "operably linked" and "under the
control" of transcriptional and translational control sequences in
a cell when RNA polymerase transcribes the coding sequence into
mRNA, which is then translated into the protein encoded by the
coding sequence.
[0077] Transcriptional and translational control sequences are DNA
regulatory sequences, such as promoters, enhancers, polyadenylation
signals, terminators, and the like, that provide for the expression
of a coding sequence in a host cell. A "cis-element" is a
nucleotide sequence, also termed a "consensus sequence" or "motif",
that interacts with other proteins which can upregulate or
downregulate expression of a specific gene locus. A "signal
sequence" can also be included with the coding sequence. This
sequence encodes a signal peptide, N-terminal to the polypeptide,
that communicates to the host cell and directs the polypeptide to
the appropriate cellular location. Signal sequences can be found
associated with a variety of proteins native to prokaryotes and
eukaryotes.
[0078] A "promoter sequence" is a DNA regulatory region capable of
binding RNA polymerase in a cell and initiating transcription of a
downstream (3' direction) coding sequence. For purposes of defining
the present invention, the promoter sequence is bounded at its 3'
terminus by the transcription initiation site and extends upstream
(5' direction) to include the minimum number of bases or elements
necessary to initiate transcription at levels detectable above
background. Within the promoter sequence will be found a
transcription initiation site, as well as protein binding domains
(consensus sequences) responsible for the binding of RNA
polymerase. Eukaryotic promoters often, but not always, contain
"TATA" boxes and "CAT" boxes. Prokaryotic promoters contain
Shine-Dalgarno sequences in addition to the -10 and -35 consensus
sequences.
[0079] As used herein, the terms "conditionally regulated" and
"conditionally-replicative" refer to the expression of a viral gene
or the replication of a virus or a vector, wherein the expression
of replication is dependent (i.e., conditional) upon the presence
or absence of specific factors in the target cell.
[0080] As used herein, the term "early genes" refers to those
adenoviral genes expressed prior to the onset of adenoviral DNA
replication.
[0081] As used herein, the term "CAR-independent infectivity"
refers to the entry of adenovirus into a cell by receptors
different from the coxsackie-adenovirus receptor (CAR).
[0082] As used herein, the term "RGD-integrin interaction" refers
to binding of the arginine-glycine-aspartic acid (RGD) residues in
a peptide to integrin receptor molecules.
[0083] As used herein, the term "replication-competent
adenoviruses" refers to an adenovirus capable of replication (i.e.,
an adenovirus that yields progeny).
[0084] As used herein, the term "fiber substitute protein" is a
protein that substitutes for fiber and provides three essential
features: trimerizes like fiber, lacks adenoviral tropism and has
novel tropism.
[0085] When used in vivo for therapy, the adenovirus of the present
invention is administered to the patient or an animal in
therapeutically effective amounts, i.e., amounts that eliminate or
reduce the tumor burden. A person having ordinary skill in this art
would readily be able to determine, without undue experimentation,
the appropriate dosages and routes of administration of this
adenovirus of the present invention. It may be administered
parenterally, e.g. intravenously, but other routes of
administration will be used as appropriate. The dose and dosage
regimen will depend upon the nature of the cancer (primary or
metastatic) and its population, the characteristics of the
particular immunotoxin, e.g., its therapeutic index, the patient,
the patient's history and other factors. The amount of adenovirus
administered will typically be in the range of about 10.sup.10 to
about 10.sup.11 viral particles per patient. The schedule will be
continued to optimize effectiveness while balanced against negative
effects of treatment. See Remington's Pharmaceutical Science, 17th
Ed. (1990) Mark Publishing Co., Easton, Penn.; and Goodman and
Gilman's: The Pharmacological Basis of Therapeutics 8th Ed (1990)
Pergamon Press; which are incorporated herein by reference.
[0086] The following examples are given for the purpose of
illustrating various embodiments of the invention and are not meant
to limit the present invention in any fashion. One skilled in the
art will appreciate readily that the present invention is well
adapted to carry out the objects and obtain the ends and advantages
mentioned, as well as those objects, ends and advantages inherent
herein. Changes therein and other uses which are encompassed within
the spirit of the invention as defined by the scope of the claims
will occur to those skilled in the art.
EXAMPLE 1
[0087] Enhanced Tumor Transduction with Adenoviral Vectors Modified
with an Antibody Conjugate
[0088] As a first approach towards enhancing the infectivity of
adenoviral vectors and to demonstrate the tumor transduction
advantage of vectors with altered tropism over unmodified vectors,
an anti-fiber antibody conjugated to fibroblast growth factor
(FGF2) was used. The Fab portion of the anti-knob antibody, 1D6.14,
which is capable of blocking the interaction of the fiber with its
cognate cellular receptor, was chemically conjugated to FGF2. The
resulting Fab-FGF2 conjugate was complexed with adenoviral vectors
expressing luciferase or .beta.-galactosidase reporter genes to
compare the transduction efficiency of the modified and unmodified
vectors. Vector modification increased the level of gene expression
more than 9-fold, as measured by luciferase activity (FIG. 1A),
largely due to transduction of a greater percentage of target cells
as seen by .beta.-galactosidase staining (FIG. 1B). This experiment
clearly demonstrates that a retargeted adenoviral vector can
overcome the inefficacious transduction observed in certain cell
lines transduced poorly by adenoviral vectors.
[0089] To compare the therapeutic effect of an FGF2-modified vector
to an unmodified vector in established tumors, the conjugate was
then mixed with an adenovirus expressing HSV-TK (AdCMVHSV-TK).
Treatment of SKOV3 ovarian carcinomas established in nude mice with
the modified vector followed by administration of the prodrug,
ganciclovir, resulted in a significant prolongation of survival
when compared with the unmodified vector plus ganciclovir (FIG. 2).
Thus, retargeting can increase the in vivo therapeutic effect of
adenoviral vectors against tumors. It is clear that the infectivity
of tumors by unmodified adenovirus is not optimal and modification
of the capsid to alter the tropism of the virus is a direct
approach to increase this infectivity.
EXAMPLE 2
[0090] Genetic Modification of the HI Loop of the Fiber Provides
Enhanced Infectivity to Adenoviral Vectors
[0091] The Fab-ligand conjugation method described in Example 1
only modifies the tropism of the vector prepared for inoculation.
In the context of a replicative vector, it is advantageous to
modify the tropism of the vector that replicates in the tumor as
well. With this rationale, a genetic modification of the fiber is
necessary for replicative vectors because it is carried over to the
progeny. As a simple and potent strategy for retargeting, the
sequence of the fiber was genetically modified. Based on the
three-dimensional model of the fiber knob, targeting ligands were
inserted into the HI loop of the fiber (FIG. 3). This loop is
flexible, exposed on the outside of the knob, is not involved in
fiber trimerization and its variable length in different Ad
serotypes suggests that insertions or substitutions would not
affect the fiber stability.
[0092] As a ligand to introduce into the HI loop of the fiber knob,
the sequence coding for an RGD peptide, CDCRGDCFC (SEQ ID NO:1),
was chosen. This RGD sequence is known to target tumors by binding
with high affinity to several types of integrins. It was
hypothesized that an adenoviral vector able to bind via
fiber-RGD/integrin interaction would not depend upon the presence
of the CAR receptor in tumors to be effective, and would therefore
target tumors more efficiently than the unmodified vector
counterpart.
[0093] The DNA sequence encoding the peptide was cloned into the
EcoRV site of the knob domain in a plasmid containing the fiber
sequence. The wild type fiber of an E1,E3-deleted adenoviral vector
expressing the luciferase gene, AdCMVLuc, was replaced with the
RGD-modified fiber by homologous recombination in bacteria. After
homologous recombination, the genome of the new adenoviral vector
was released from the plasmid backbone by digestion with PacI. To
use the firefly luciferase gene, the internal PacI site of this
gene was eliminated by introducing a silent mutation. The plasmid
obtained as a result of these DNA recombinations was then utilized
for transfection of 293 cells to rescue Ad5lucRGD. The presence of
RGD in the virus was confirmed by PCR as well as by cycle
sequencing of viral DNA isolated from CsCl-purified virions of
Ad5lucRGD.
[0094] To demonstrate that the genetic modification of the fiber
was able to confer CAR-independent infectivity to the modified
vector, the unmodified AdCMVLuc and the modified Ad5lucRGD vectors
were used to transduce 293, HUVEC, and RD cell lines, which express
high, moderate, and low levels of CAR respectively. The
CAR-independent infection was further analyzed using competitive
inhibition by recombinant Ad5 fiber knob protein known to
efficiently block virus binding to CAR receptor. Luciferase
expression in 293 cells mediated by the unmodified virus, AdCMVLuc,
was efficiently blocked by recombinant knob protein (FIG. 4A).
Depending on the multiplicity of infection (MOI) used, knob protein
blocked 85% to 93% of luciferase activity in AdCMVLuc-transduced
cells. In contrast, the same concentration of knob was able to
block only 40% to 60% of Ad5lucRGD-mediated gene expression in 293
cells, indicating that in addition to the fiber-CAR interaction
utilized by the wild type Ad5, Ad5lucRGD is capable of using an
alternative, CAR-independent, cell entry pathway. Of note, the
contribution of that alternative mechanism of cell binding was
quite significant, providing 40% to 60% of overall gene transfer to
293 cells. Luciferase expression in HUVEC cells transduced with
Ad5lucRGD was about 30-fold higher than with AdCMVLuc (FIG. 4B).
The effect of Ad5 fiber knob on AdCMVluc-mediated transduction was
less dramatic than in 293 cells, consistent with a relative lack of
CAR in the HUVEC. Most importantly, recombinant knob protein did
not inhibit the levels of luciferase expression directed by
Ad5lucRGD. The luciferase activity detected in RD cells transduced
with AdCMVluc was extremely low: at an MOI of one pfu/cell, it was
almost equal to the background level of mock-infected cells (FIG.
4C). In contrast, the level of transgene expression achieved with
Ad5lucRGD was 16- to 47-fold higher than with AdCMVLuc, and
expression was not inhibited by the fiber knob.
[0095] These experiments clearly showed that incorporation of the
RGD peptide into the fiber of Ad5lucRGD resulted in dramatic
changes in virus-to-cell interaction by providing an alternative
CAR-independent cell attachment pathway. Of note, the insertion of
the RGD sequence in the HI loop did not abrogate the CAR-mediated
entry pathway, so the modified vector has a two independent
mechanism to bind to the cells. As the present invention shows,
this contributes to the enhanced infectivity of the modified vector
in all cell lines and tumors tested.
EXAMPLE 3
[0096] Enhanced Tumor Transduction Via RDG-Fiber Modification
[0097] To determine if the RGD sequence incorporated into the HI
loop of the fiber could increase the infectivity of tumors, the
ability of the modified vector to deliver genes to cultured human
ovarian cancer cells was examined. Characterization of two cell
lines, SKOV3.1p1 and OV-4, by flow cytometry showed that they both
express moderate-to-high levels of .alpha.v.beta.3 and
.alpha.v.beta.5 integrins. SKOV3.1p1 also expresses a high level of
CAR, whereas OV-4 only modestly expresses CAR.
[0098] The incorporation of recombinant RGD-containing fiber
protein in the Ad5lucRGD vector dramatically improved the ability
of the virus to efficiently transduce these cells (FIG. 5A). At
different MOIs tested, Ad5lucRGD-transduced cultures of SKOV3.1p1
cells showed 30-fold to 60-fold increase in luciferase activity
compared to cells transduced with control virus. Interestingly,
while the purified fiber knob blocked over 90% of AdCMVLuc-mediated
gene transfer, it could only block 20% of luciferase activity in
Ad5lucRGD-treated cells, indicating a significant CAR-independent
entry mechanisms for Ad5lucRGD. In OV-4 cells, the transduction
efficiency achieved with the RGD-modified vector was 300- to
600-fold higher than the unmodified one (FIG. 5B). Again, when the
fiber knob was used as an inhibitor of CAR-mediated cell entry, it
did not have any significant effect on Ad5lucRGD-mediated gene
delivery, strongly suggesting that this virus primarily utilizes
RGD-integrin interaction to bind to target cells.
[0099] The utility of the Ad5lucRGD vector was next evaluated in
the context of primary tumor cells. In this regard, recent human
clinical trials have pointed out the disparity between the efficacy
of adenoviral vectors in various model systems and in the clinical
context, where rather low transduction efficiencies have been
noted. As integrins have been shown to be frequently overexpressed
by various epithelial tumors, vector targeting to these cell
surface receptors provides a means to achieve CAR-independent gene
transfer.
[0100] Ovarian cancer cells obtained from two patients were treated
with either Ad5lucRGD or AdCMVLuc in the presence or absence of
blocking knob protein. Luciferase expression in cells treated with
AdCMVLuc was extremely low (FIG. 6), thereby indicating inability
of adenoviral vectors containing unmodified fibers to efficiently
infect ovarian cancer cells.
[0101] Strong inhibition by the fiber knob on AdCMVLuc-mediated
luciferase expression suggests that the fiber-CAR interaction is
the only pathway this virus can use to infect this type of cell. In
contrast, Ad5lucRGD directed levels of transgene expression two- to
three-orders of magnitude higher than those detected in
AdCMVLuc-transduced cells. The knob protein blocked 20% of the gene
transfer at an MOI of 1 pfu/cell, and no effect was observed at an
MOI of 10 pfu/cell.
[0102] The observations of enhanced infectivity have been extended
to other tumor cell types besides ovarian carcinoma. In six human
non-small cell lung adenocarcinoma cell lines, one human
mesothelioma cell line, and one rat mesothelioma cell line, the
luciferase expression level achieved with the RGD-modified vectors
was always higher than the level achieved with the non-modified
vector at a variety of different MOIs (FIG. 7).
[0103] The increase in transduction was also observed in A549 lung
adenocarcinoma cells and LNCaP prostate carcinoma cells (FIG. 8).
In both cell lines the RGD modified vector showed an infectivity
advantage over the non-modified counterpart. The major difference
was observed in A549 cells, showing a 100-fold increase in
infection, whereas LNCaP cells showed 10-fold increase. In LNCaP,
the major differences were observed at lower multiplicities of
infection, likely indicating that the integrin-mediated pathway was
saturated.
[0104] The increased efficacy of infection of the RGD-modified
vector was also measured in time course experiments in which the
incubation time of the virus with the cells was limited. The
transduction efficiency was always better with the modified vector
and the differences were more marked at shorter times of infection,
i.e. the RGD-modified vector produced a 1000-fold greater
luciferase expression when only 7 minutes of adsorption were
allowed (FIG. 9). At longer adsorption times, the differences
between the modified and non-modified vectors were reduced to
10-fold. This difference could have important implications in
adenoviral-mediated gene therapy because the time of exposure of
the vector to the tumor target cells is expected to be limited by
the intratumoral high pressure.
[0105] Overall, this data points out the importance of providing an
alternative entry pathway to adenoviral vectors for the infectivity
of tumors. In all cell lines and tumor types analyzed, a vector
that can use the natural entry pathway via primary binding to CAR
and an additional entry pathway via binding to integrins transduces
more efficiently than a vector that only can use the natural CAR
receptor.
EXAMPLE 4
[0106] Replication-Competent, E1-Transcomplementation Vectors
[0107] Most replication-defective adenovirus vectors in preclinical
and clinical use have deleted E1A and E1B genes. These deletions
render the vector unable to replicate, or replication-incompetent,
and these vectors can replicate only when E1 proteins are supplied
in trans. These replication-incompetent vectors transduce the cells
that they infect but they do not produce any progeny.
[0108] A conditional replication enablement system for adenovirus
has been developed in which the E1 genes are supplied in trans to
cells infected with E1-deleted vectors (FIG. 10). The
replication-enabling system has been developed primarily as a means
of amplifying transduction in tumor nodules. In order to achieve a
more extensive amplification of the vector and lysis of tumor
cells, the secondarily produced vector should propagate
continuously in tumor cells. Replication-enabling has been achieved
by linking plasmids encoding the E1 proteins to the exterior of the
capsid or separately introducing the plasmid using cationic lipids.
These experiments provided evidence that replication-enabling
systems could achieve amplification of the in vivo therapeutic
response of an adenoviral vector carrying HSV-TK. E4-deleted
adenoviruses have also been transcomplemented with a plasmid
containing the E4 open reading frame 6 gene or the complete E4
region. E4 transcomplementation is important in the context of
reducing immunogenicity and increasing long-term gene transfer.
[0109] In order to further enhance the utility of the
replication-enabling system, it is a goal of the present invention
to reduce the possibilities of recombination between the E1-deleted
vector and the transcomplementing plasmid. This recombination would
generate replication-competent adenoviruses (RCA). Therefore, an E1
expressing plasmid has been constructed, pE1FR, in which E1a and
E1b sequences are in tandem but oriented in opposite 5' to 3'
direction. Cells co-transduced with this plasmid and an
E1-defective adenoviral vector using cationic liposomes resulted in
replication-defective adenovirus production levels comparable to
that achieved by co-transduction of the virus and pE1 (FIG. 11).
Comparable results were obtained with HeLa, A549 and SKOV3-ip1 cell
lines.
[0110] This demonstrates that pE1FR can transcomplement E1-deleted
vectors and convert the infected cells into vector-producing cells.
To demonstrate that this vector could also enhance the tumor
transduction achieved with an E1-deleted vector in vivo, tumors
were injected with E1-defective virus mixed with pE1FR, or a
plasmid control. Assessment of the luciferase content showed that 6
out of 8 tumors had increased luciferase activity in the pE1FR
group relative to the controls (FIG. 11).
[0111] This data indicates that E1-expression vectors, such as
pE1FR, represent a feasible way to increase the in vivo
transduction efficiency of E1-deleted vectors in tumors. The
amplification of the transduction efficiency achieved with a system
such as the replication-enabling system is limited, however, by the
inability of the vector progeny to keep replicating.
[0112] The replication-enabling function needs to be carried over
in the vectors produced by the tumor cells to allow repeated cycles
of replication.
EXAMPLE 5
[0113] Replication Competent Vectors Dependent Upon IL-6
[0114] As shown in the data above, the replication-enabling system
has been developed primarily as a means of amplifying transduction
in tumor nodules. Methods have also been explored to achieve a more
extensive amplification of the vector and subsequent lysis of tumor
cells. To fulfill this goal, the secondarily produced vector should
propagate continuously in tumor cells and incorporate a regulatory
mechanism that confines this propagation to the tumor. E1a 12s and
13s adenoviral proteins are necessary to induce the expression of
other viral genes, and therefore, an E1a-deleted vector is impaired
in its replication. It has been reported that interleukin 6 can
induce transcription factors that are able to substitute for the
E1a activity of adenovirus.
[0115] To explore whether an E1a-deleted vector such as Ad5dl312
could replicate in the presence of IL-6 in different cancer cell
lines, cells were infected with dl312 in the presence of IL-6 and
the progeny were examined (FIG. 13). In all cell lines, infectious
virions were produced to a certain extent in the presence and
absence of IL-6, although in lower amounts than the wild type
adenovirus. The effects of IL-6 in dl312 production were markedly
seen in two cell lines: HepG2 and EJ. In HepG2 cells, IL-6 resulted
in a 1.5 log increase of viral production.
[0116] These experiments demonstrate that the IL-6-inducible
E1a-like activity can complement the E1a deletion during infection
of HepG2 and EJ cells. To overcome the requirement of exogenous
IL-6, carcinomas, e.g., cervical, chorio, and ovarian, that have an
IL-6 autocrine loop were infected with the ElA-deleted virus,
dl312. OVCAR-3 and SW626 cells have a functional IL-6 autocrine
loop. Upon infection of OVCAR-3 cells with Ad5dl312, or wild type
or E4-deleted control viruses, Ad5dl312 was produced to levels
similar to levels produced by the wild type control, even in the
absence of IL-6 (FIG. 14). This IL-6-independent replication of
E1a-deleted virus was also demonstrated in SW626 cells and primary
cultures of ovarian tumors (FIG. 14). These results indicate that
cells with an autocrine loop of IL-6 can selectively support the
replication of Ad5dl312 without the addition of exogenous IL-6, and
that these cells are lysed by the E1a-deleted virus. The effects of
the E1a-deleted virus in normal cells were examined. To test the
ability of this virus to propagate in normal cells adjacent to
ovarian tumors, human mesothelial cells isolated from peritoneal
lining tissue were infected. Contrary to the wildtype virus
control, Ad5dl312 did not replicate in these cells even in the
presence of IL-6 (FIG. 16).
[0117] Overall, this data indicates that E1a-deleted adenovirus can
be complemented by the IL-6-induced E1a-like activity found in
several tumors. E1a-deleted vectors are, however, limited by the
fact that E1a intrinsic activity has been noted in normal cells.
IL-6 production, in the other hand, could result from the injection
of the vector in an immunocompetent host and this natural
inflammatory response would result in nonspecific complementation.
Clearly, new mechanisms of tumor-specificity need to be
incorporated to control the replication of adenoviral vectors.
[0118] The clinical benefits of cancer gene therapy achieved with
non-replicative adenoviral vectors have been hampered by the
significant number of cells in a tumor which have been left
unaffected by the direct or indirect effects of the transgenes.
Conditional replicative adenoviruses may represent a significant
improvement to solve this problem, but efficient infectivity and
tumor-selective replication need to be achieved to realize their
full potential.
[0119] The importance of the modification of the adenoviral capsid
to increase the binding of the vector to the tumor cells has been
demonstrated herein. An integrin-binding RGD motif inserted in the
HI loop of the adenoviral fiber confers an additional binding
pathway besides the natural coxsackie-adenovirus receptor, and this
dramatically increases the infectivity of the vector. The data
herein also indicates that transduction efficiency can also be
enhanced if the vector is able to replicate in the tumor. A
transcomplementation system has been developed as a means to
evaluate the effects of replication on the transduction efficiency.
This replication-enabling system also provides the opportunity to
analyze the efficacy and specificity of different tumor-specific
replication mechanisms before incorporating these mechanisms into a
single viral vector in a cis-complementation strategy that will
allow continuous replication. In this regard, continuous
tumor-selective replication has been shown using E1a-deletion
mutants that propagate in tumors due to an E1 a-like activity.
EXAMPLE 6
[0120] Incorporation of RGD-fiber Into Currently Defined
Conditional Replicative Mutant Viruses
[0121] As an initial approach towards comparing the therapeutic
potential of an RGD-modified versus an unmodified replicative
adenovirus, conditional replicative mutants that have been
previously described were chosen. Deletion of the E1b-55K protein
was designed to confer selective replication to adenoviruses in
cells lacking functional p53. In a similar way, deletion of the
Rb-binding sites of E1a has been proposed to achieve selective
replication in cells lacking Rb. These deletion mutants are used as
established models of selective replication-competent viruses.
[0122] The initial plasmid to construct these deletions is pXC1,
which contains adenoviral sequences from basepair 22 to 5790
(Microbix, Hamilton, Canada). For the E1b55K deletion, the region
from Sau3A1 (Ad5#2426) to BglII (Ad5#3328) is removed by ligation
of the 1 kb XbaI-Sau3A1 DNA fragment with the 7.9 kb Xba1-BglII DNA
fragment to yield plasmid pXC-55K-. For an E1a deletion construct
that abrogates binding to Rb, a derivative of pXC1 (pXC1 D24) is
obtained with E1a deleted in residues 122 to 129 (Dr. Juan Fueyo,
MDACC). This deletion affects the residues of the conserved region
1 of E1a necessary to bind Rb. These E1b and E1a deletions are
incorporated into the viral genome by homologous recombination with
plasmid pVK503, containing either an unmodified fiber or an
RGD-modified fiber. From the plasmids obtained by homologous
recombination, the unmodified 55k- and D24 mutants are generated by
releasing the viral genome with PacI and transfecting into 293
cells. Viruses are amplified and purified by double CsCl gradient,
and titered in 293 cells for in vitro and in vivo experiments. The
presence of mutated E1, altered fiber, and contaminating wild type
E1, is analyzed by PCR as well as by sequencing of viral DNA
isolated from CsCl-purified virions.
[0123] The 24-bp deletion in the E1A gene and the RGD encoding
sequence in the fiber were verified by PCR (FIG. 17). The presence
of the RGD motif in the modified fiber was confirmed by PCR
employing fiber primers FiberUp (5'-CAAACGCTGTTGGATTTATG-3') (SEQ
ID NO:2) and FiberDown (5'-GTGTAAGAGGATGTGGCAAAT-3') (SEQ ID NO:3).
The 24-bpdeletion was analyzed by PCR with primers E1a-1
(5'-ATTACCGAAGAAATGGCCGC-3') (SEQ ID NO:4) and E1a-2
(5'-CCATTTAACACGCCATGCA-3') (SEQ ID NO:5) followed by BstXI
digestion. Of note, no adenoviruses having wild-type E1 or
wild-type fiber appeared throughout the propagation of Ad5-D24RGD,
a finding that confirms the lack of endogenous adenoviral sequences
in A549 cells.
EXAMPLE 7
[0124] Evaluation of Infectivity of RGD-Modified Conditional
Replicative Viruses
[0125] Procedures described above are used to demonstrate that the
RGD-modified 55K- and D24virions bind to integrins. ELISAs are
performed with immobilized virions incubated with purified
.alpha..sub.v.beta..sub.- 3 integrins and anti-.alpha. subunit
monoclonal antibody, VNR139. The modified replicative viruses are
examined to determine if they are able to bind cells via a
CAR-independent pathway. 293, HUVEC, and RD cells are used, as
enhanced RGD-mediated transduction of these cell lines has already
been demonstrated. For binding analysis, virions are labeled with
.sup.125I and incubated with cells. Recombinant knob protein is
used as an inhibitor to measure CAR-independent binding.
Infectivity of modified and unmodified 55K and D24 mutants in
ovarian, lung and other tumor cell lines, as well as in primary
tumors, are compared. These experiments indicate that the
RGD-modified viruses infect tumor cells more efficiently than the
non-modified vectors.
EXAMPLE 8
[0126] Evaluation of Oncolytic Potential of RGD-Modified
Conditional Replicative Viruses
[0127] This example demonstrates that the genetic introduction of
an RGD sequence in the fiber of a CRAd allows CAR-independent
infection that leads to the enhancement of viral propagation and
oncolytic effect in vitro and in vivo.
[0128] Cell Lines
[0129] A549 human lung adenocarcinoma and LNCaP human prostate
cancer cell lines were obtained from the American Type Culture
Collection (Manassas, Va.). The cells were cultured in Dulbecco's
modified Eagle's medium (DMEM) supplemented with 5%
heat-inactivated fetal bovine serum (FBS), 100 I.U./ml penicillin,
and 100 mg/ml streptomycin.
[0130] Virus DNA Replication
[0131] A549 cells cultured at 90% confluence in 6-well plates were
infected with Ad5-D24 or Ad5-D24RGD at a dose of 0.01 viral
particles/cell. After 2 h, the cells were washed and maintained in
DMEM-5% FBS with 1 mCi/ml bromodeoxyuridine (BrdU) (Amersham
Pharmacia Biotech Inc., Piscataway, N.J.). Attached and detached
cells were harvested at 2, 4, 6, and 8 days after infection, and
encapsidated viral DNA was purified by the spermine-HCl method
(Hardy et al., 1997). One third of the total purified viral DNA
(corresponding to 6.times.10.sup.5 cells) was digested with HindIII
and resolved in 1% agarose gel. The fragments were transferred to a
nylon membrane (Amersham Pharmacia Biotech), fixed, blocked in
blocking buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 5% dry milk,
2% Tween 20), and incubated with mouse anti-BrdU IgG (DAKO,
Carpinteria, Calif.) at 4.degree. C. overnight. The membrane was
washed next day, incubated with peroxidase-labeled anti-mouse
antibody (Amersham), and processed by Western blotting analysis
with the ECL system (Amersham). The membrane was exposed to Kodak
Biomax ML film for 3 seconds at room temperature and developed in
an automated processor.
[0132] Adenovirus Yield Assay
[0133] A549 cells cultured at 90% confluence in 6-well plates were
infected with 0.01 particles/cell of Ad5lucRGD, Ad5-D24, or
Ad5-D24RGD for 2 h. The cells were then washed thoroughly with PBS
to remove all non-adsorbed viruses, and maintained in DMEM-5% FBS.
After 8 days, cells and media were harvested, freeze-thawed 3
times, centrifuged, and the titer was determined by plaque assay
with A549 cells as targets.
[0134] Oncolysis Assay
[0135] A549 and LNCaP cells cultured in triplicate in 6-well plates
were infected with one of the three types of adenovirus at doses of
0.001 or 0.01 viral particles/cell when 90% confluence was reached.
Eight or ten days after infection, the cell monolayers were washed
with PBS, fixed with 10% fresh buffered formaldehyde for 10 min,
and stained with crystal violet solution (1% crystal violet [w/v],
70% ethanol). After 1 h staining, the plates were rinsed with tap
water and dried.
[0136] In Vitro Cytotoxicity Assay (XTT)
[0137] A549 and LNCaP cells were seeded and infected in parallel
with the ones used for the oncolysis assay described above. Eight
or ten days after infection, the media was carefully removed, and
fresh media containing 200 ug/ml of
2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetra-
zolium-5-carboxyanilide (XTT) (Sigma, St. Louis, Mo.) was added.
Cells were then incubated for 3 h at 37.degree. C. The content of
each well was transferred to a microwell plate, and the light
absorbance was read at 450 nm in a microplate reader (Molecular
Devices Corp., Sunnyvale, Calif.). The number of living cells was
calculated from non infected cells cultured and treated with XTT in
the same way as were the experimental groups.
[0138] Subcutaneous Tumor Xenograft Model in Nude Mice
[0139] Female athymic nu/nu mice (Frederick Cancer Research, MD)
8-10 weeks old were used to grow A549 s.c. nodules. Eight million
cells were xenografted under the skin of each flank in anesthetized
mice. When the nodules reached 60-100 mm.sup.3, a single dose of
10.sup.9 viral particles (high-dose experiment, n=5) or 10.sup.7
viral particles (low-dose experiment, n=4) of Ad5lucRGD, Ad5-D24,
Ad5-D24RGD, Ad5-wt or PBS was administered intratumorally
(i.t.).
[0140] Tumor size was monitored twice a week, and fractional volume
was calculated from the formula:
(length.times.width.times.depth).times.1/2. The mice were
euthanized 35 days after the treatment because of the size of the
tumors in the control group. Statistical differences among groups
were assessed with student's t tests.
[0141] Adenovirus Hexon Immunodetection
[0142] The presence of adenovirus hexon in the treated tumor
xenografts was assessed by immunofluorescence at the end of the
experiment. Frozen A549 nodule specimens were sections, fixed in 3%
formaldehyde, and blocked with normal donkey serum for 30 min at
room temperature. Then goat anti-hexon antibody (Chemicon Inc.,
Temecula, Calif.) was applied for 2 h at room temperature, followed
by PBS rinse and incubation with Alexa Fluor 488-labeled donkey
anti-goat antibody (Molecular Probes, Eugene, Oreg.) for 30 min at
room temperature. The slides were then rinsed and counterstained
with Hoechst 33342 (Molecular Probe) for 10 min, and analyzed under
a fluorescent microscope (Leitz Orthoplan).
[0143] After structural confirmation, the replication capacity of
Ad5-D24RGD and Ad5D24 were compared in A549 cells. Cell monolayers
were infected with low dose of each virus (0.01 viral
particles/cell), and were maintained in media with BrdU throughout
the 8-day incubation period. The encapsidated viral DNA was
purified on days 2, 4, 6, and 8 postinfection. Viral DNA
corresponding to 6.times.10.sup.5 cells was analyzed by
Southwestern blot using anti-BrdU antibody. As indicated by the
BrdU incorporated into replicating viral DNA, Ad5-D24RGD
propagation was more efficient than that of Ad5-D24 (FIG. 18). The
Ad5-D24RGD DNA can be detected not only sooner (day 6) compared to
Ad5-D24 DNA (day 8), but in greater amounts. Thus, the infectivity
advantage conferred by RGD incorporation into the fiber knob
increased adenovirus propagation in target cells. As this tropism
modification would not be anticipated to alter fundamental aspects
of the viral replication cycle, this effect was likely achieved
exclusively on the basis of the infectivity enhancement allowed by
routing the virus through CAR-independent pathways.
[0144] Based on the previous experiment, the actual amount of
infectious virus produced by Ad5lucRGD, Ad5-D24, or Ad5-D24RGD in
A549 cells at 8 days after infection were quantified by plaque
assay. Ad5-D24RGD produced a viral yield of 3.75.times.10.sup.9
pfu/ml, which was 43 times higher than that of its unmodified
Ad5-D24 counterpart (8.75.times.10.sup.7 pfu/ml). No virus was
obtained from the nonreplicative control Ad5lucRGD infected cells.
These results are consistent with the fact that modifying the fiber
knob with an RGD motif led to enhancement of viral infectivity and
an increase in the production of infectious adenovirus.
[0145] To demonstrate the increased lytic potency of Ad5-D24RGD,
A549 and LNCaP cells were infected with small amounts of each virus
to allow multiple cycles of viral replication over the ensuing 8
days, then stained the attached cells with crystal violet and
counted viable cells by XTT assay. In both cell lines, the fewest
viable cells were detected in the Ad5-D24RGD-infected group (FIGS.
19A and B). The cell lysis capacity of Ad5-D24RGD is 7 times higher
in A549, and 3.5 times higher in LNCaP compared to Ad5-D24. These
results demonstrate that the fiber knob modification enhanced
adenoviral lytic potency over that of the Ad5-D24 virus.
[0146] A goal of this study was to support the oncolytic
superiority of infectivity enhanced conditionally replicative
adenovirus (CRAd) over that of unmodified adenoviruses in vivo.
Since low doses of virus allow several cycles of replication along
with destruction of tumor cells, even a single dose would produce
an exponential rise in the number of killed cells, which would
extend to the entire tumor. In order to demonstrate this
hypothesis, A549 xenografts in nude mice were treated with a single
i.t. injection (10.sup.9 viral particles) of one of the three
viruses or with PBS. At 32 days after injection, both CRAds
demonstrated to have an oncolytic effect in the tumors opposite to
those treated with nonreplicative virus or with PBS (Ad5-D24,
p<0.05; Ad5-D24RGD, p<0.01 compared to PBS group) (FIG. 20A).
Given these results, another experiment was performed in which a
100-fold lower dose (10.sup.7 viral particles) of the viruses were
administered. This low-dose treatment demonstrated that the
oncolytic effect of Ad5-D24RGD was superior to that of Ad5-D24
(p<0.05). These differences observed between high-dose and
low-dose experiments suggest that a threshold dose over 10.sup.7
viral particles of Ad5-D24 is required to obtain an oncolytic
effect in tumor nodules (FIG. 20B).
[0147] To confirm that the CRAds were present in the tumor tissue,
immunofluorescence assays were used to detect the virus hexon in
tumor samples collected after the low-dose experiment (35 days
postinjection). Ad5-D24RGD was present in the tumor nodules, as was
Ad5-D24 to a lesser extent. PBS and Ad5lucRGD treated nodules
showed no hexon signal (FIG. 20C). These results corroborate that
the partial reduction of tumor mass was due to virus replication
and that the RGD modification of the fiber knob conferred
infectivity and oncolysis advantage to a CRAd in vivo.
[0148] Enhanced oncolytic potential was also demonstrated in a
systemic context. A total dose of 10.sup.9 viral particles divided
into two consecutive doses of 5.times.10.sup.8/day of either
Ad5lucRGD, Ad5-D24, Ad5-D24RGD, Ad5-wt, or PBS were injected in the
tail vein of nude mice bearing s.c. A549 xenografts. FIG. 21 shows
that modification of the fiber to broaden the tropism of a
replicative adenovirus improves the oncolytic potential in a
systemic delivery context.
[0149] Conditionally replicative adenoviruses (CRAds) are novel and
promising agents for cancer therapy. However, their efficacy is
predicated upon efficient tumor infection, specific replication,
and lateral spread. The deficiency of coxsackie-adenovirus receptor
(CAR) in a variety of tumor targets is a limitation to adenovirus
infection. In a previous report, it was demonstrated that the
insertion of an RGD motif into the HI loop of the fiber knob of
non-replicative adenoviruses enhances tumor infection, indicating
that CAR-independent entry represent a viable way to circumvent CAR
deficiency in some tumor types.
[0150] In this example, it was demonstrated that the genetic
introduction of an RGD sequence in the fiber of a CRAd allows
CAR-independent infection that leads to the enhancement of viral
propagation and oncolytic effect in vitro and in vivo. The
increased initial virus entry into the cells rendered by the
RGD-modification results in sooner detection and augmented yields
of encapsidated DNA of Ad5-D24RGD compared to the unmodified
Ad5-D24 (FIG. 18).
[0151] As this tropism modification is not anticipated to alter
fundamental aspects of the viral replication cycle, this effect was
likely due to the infectivity enhancement allowed by delivering the
virus through CAR-independent pathways. Subsequently, studies of
the oncolytic potency of CRAds in two cell lines conclude that
Ad5-D24RGD potency is higher than that of the unmodified virus.
Although the XTT assay was not sensitive enough to demonstrate the
lytic effect of Ad5-D24 compared to the non-replicative Ad5lucRGD,
the crystal violet showed early comet-like cytopathic areas in
Ad5-D24-treated A549 and LNCaP cells, indicating the presence of an
incipient lytic effect, whereas Ad5lucRGD treated cells were intact
(FIG. 19A). The less notable difference between Ad5-D24RGD and
Ad5-D24 seen in LNCaP cells is explained by the absence of the
a.sub.vb.sub.3 integrins, compensated by the presence of other
types of RGD-binding integrins (a.sub.3b.sub.1 and a.sub.5b.sub.1)
that were rapidly saturated (FIG. 19).
[0152] Another object of the present invention was to demonstrate
the superior oncolytic effect of Ad5-D24RGD in an in vivo model. To
this end, A549 cells xenografted in nude mice were treated with
single, high dose (10.sup.9 viral particles) i.t. injections of
Ad5lucRGD, Ad5-D24, Ad5-D24RGD, or PBS, and the results showed that
both CRAds (modified and unmodified) yielded similar oncolysis
(FIG. 20A). However, when a 100-fold lower dose (10.sup.7 viral
particles) was administered, it became clear that the oncolytic
effect of Ad5-D24RGD was higher than that of Ad5-D24 (p<0.05)
(FIG. 20B). Furthermore, the observed oncolytic effects were
correlated with the presence of virus progeny in the tumor samples
by immunofluorescent detection of adenoviral hexon. Hexon was not
detected in PBS (not shown) and Ad5lucRGD treated nodules (FIG.
20C, a), whereas it was detected throughout the tumors treated with
CRAds. The comparison between the two CRAds showed that
fluorescence in Ad5-D24RGD treated tumors was stronger than the one
observed in Ad5-D24 treated tumors (FIG. 20C, b and c). The lack of
fluorescent staining in tumors treated with the non-replicative
control Ad5lucRGD indicates that the detected hexon belongs to the
viral progeny of Ad5-D24 and Ad5-D24RGD, and not to the initial
inoculum. As regards to the high divergence of the volumes of PBS
and Ad5lucRGD treated tumors, factors such as highly heterogeneous
cell replication rates and hypoxic and necrotic areas are known to
affect individual tumor volume after a critical size is reached.
These differences have been noted before when using oncolytic
viruses. Nevertheless, total resolution of the tumors in the s.c.
xenograft model was seen only in some nodules treated with
Ad5-D24RGD, indicating that administration volume and schema
adjustments, such as the ones suggested recently by Heise and
co-workers (1999), might be necessary to achieve complete
oncolysis.
[0153] As presented here and elsewhere, the efficacy of
replication-competent viruses employed as oncolytic agents can be
improved at the level of infectivity. As other tumor-binding
peptides are isolated (Shinoura et al., 1999; Koivunen et al.,
1999), modifications in addition to the RGD insertion can be
considered as well. Of note, the RGD-modification described here
does not preclude the binding of the fiber to CAR, and the modified
virus can enter the cells through a.sub.v integrins and CAR.
[0154] One approach to improve specific tumor
infection/transduction would be the combination of CAR-ablation and
tumor-specific ligands to redirect the virus tropism. Recently, the
adenovirus fiber amino acids crucial for CAR-binding abrogation and
new tumor-selective peptides have been defined (Koivunen et al.,
1999; Roelvink et al., 1999). This combination will generate truly
targeted viruses, and the efficiency of their propagation will
depend on the amount of the targeted receptor in the same way as
the propagation of the unmodified virus depends on CAR. This
strategy could be very valuable when the population to be targeted
is homogeneous, such as endothelial cells of tumor vasculature.
[0155] Other aspects of adenovirus biology that can be improved are
replication specificity, tumor cell killing, and evasion from host
immune responses. Tumor selectivity has been the major area of
research with the design of CRAds based on deletions of adenoviral
early genes and utilization of tumor-specific promoters. With
regard to cell killing capacity, the combination of oncolysis with
suicide genes such as cytosine deaminase and herpes simplex virus
thymidine kinase has demonstrated to be superior to either
treatment alone. In a similar way, the combination of oncolysis
with radiotherapy and chemotherapy has also proved to have better
efficacy. Immune responses will play an important role in the
ultimate outcome of oncolytic virotherapy, an ideal scenario would
favor a response that can destroy tumor cells, and yet allow viral
spread. The manipulation of the immune response against adenovirus
towards a Th1 type could lead in this direction. The use of
immunocompetent animals will be needed for the study of immune
response to adenovirus, and also ovine and canine adenovirus could
be useful for this purpose.
[0156] Specifically targeted CRAds have theoretical attributes that
could make them effective via systemic administration: low toxicity
due to lack of adsorption and replication in normal cells and low
effective dose due to their amplification. To ascertain whether
these agents have enough targeting/amplification potency to be
efficacious through systemic administration, the oncolytic
efficiency of enhanced infectivity CRAds administered via tail vein
in mice would be determined. It seems that not only the presence of
CAR and av integrin are important for adenovirus infection, but
anatomical and immunological barriers are also crucial when
considering this route of administration. In particular, vector
clearance by liver macrophages is a major obstacle that has to be
overcome. This can be attempted with targeting or other strategies
that change the physico-chemical properties of the virion such as
PEGylation. The emerging picture is that of a targeted adenovirus
that remains in circulation for a sufficient period to achieve
specific recognition of the target. In such a scenario, the
infectivity enhancement maneuvers described herein will clearly
improve the therapeutic gain achievable via CRAds.
EXAMPLE 9
[0157] Targeting Endogenous Receptors with Chimeric
Replication-Competent Adenovirus Vectors
[0158] Squamous cell carcinoma of the head and neck (SCCHN)
expresses relatively low levels of the primary adenovirus type 5
(Ad5) receptor, coxsackie-adenovirus receptor (CAR). This relative
deficiency of CAR has predicated the development of CAR-independent
transduction strategies to make adenovirus-mediated cancer gene
therapy more efficient for this disease. CAR-independent
transduction strategies have been made by a number of methods
including the development of adenovirus vectors containing chimeric
knob domains that alter the virus' target cell tropism. Recently it
has been suggested that the receptor for adenovirus type 3 (Ad3) is
more highly expressed in SCCHN compared to the Ad5 receptor,
thereby making the Ad3 receptor as excellent alternative target for
SCCHN. Therefore, it is hypothesized that a chimeric Ad5 vector
containing Ad3 knob domains would have preferential targeting to
SCCHN compared to an Ad5 vector containing only Ad5 knob
domain.
[0159] SCCHN cells were infected with equal amount of two oncolytic
Ad5 vectors, Ad5Luc3 or Ad5/3Luc3. Ad5Luc3 contains an Ad5 knob
domain that necessitates CAR-dependent transduction. Alternatively,
Ad5/3Luc3 contains an Ad3 knob domain that utilizes a
CAR-independent pathway. The apparent disproportion of Ad5
receptors and Ad3 receptors on this tumor type resulted in more
efficient infection and replication of Ad5/3Luc3 compared to
Ad5Luc3. As shown in FIG. 22, the ability of Ad5/3Luc3 to more
efficiently infect and replicate resulted in a dramatic increase in
the oncolytic effect of this virus. Thus, infectivity-enhancement
via knob chimerism also improves the oncolytic potency of the CRAd
therapy.
EXAMPLE 10
[0160] Evaluation of Tumor-Selective E2 and E4 Functions
[0161] One goal of the present invention is to demonstrate that
tumor-selective regulation of E4 and E2 can confer tumor-selective
replication to adenovirus. It has previously been shown that
E4-deleted adenoviruses can be transcomplemented by conjugating an
E4 expression plasmid into their capsid. In this regard, plasmids
such as pCEP-ORF6, that contain the E4 ORF6 under a constitutive
promoter, can be used to transcomplement E4 deleted viruses, such
as dl1014. In order to achieve tumor-selective expression of
E4-ORF6, tumor-specific promoters are substituted for the CMV
promoter. Among several tumor or tissue selective promoters that
have been used in restricting expression of genes to tumor cells,
the promoter of the prostate specific antigen (PSA) is used
initially. PSA is expressed in prostate cells and has been used to
direct expression of TK to prostate tumors. This promoter was
chosen to control E4 and E2 in the context of replicative
adenoviruses because it has already been used to control E1 in this
context (obtained from Dr. Chris Baigma). The promoter is subcloned
in front of the E40RF6 in plasmid pCEP-ORF6 to obtain a pPSA-ORF6
expression plasmid. To evaluate the conditional replicative
phenotype of a PSA-ORF6-regulated virus, this plasmid is conjugated
with the E4-deleted virus, dl1014. Conjugates with pCEP-ORF6 or
irrelevant plasmids are used as positive and negative controls,
respectively. These Ad5dl1014 adenovirus-polylysine-plasmid
conjugates are used to infect tumor cell lines that express
prostate specific antigen, such as LNCaP, and cell lines that do
not express prostate specific antigen, such as DU145 or PC3. In
time course experiments, viral replication is measured at the DNA
level by Southern blot. The amount of virus produced from the
molecular conjugates is measured by plaque assays in W162 cells.
dl1014 DNA replication and virus production is observed in all cell
lines when using pCEP-ORF6, but only in the PSA-expressing cell
line, LNCaP, when using pPSA-ORF6. These results indicate that the
E4 can be used to control the replication of E4-deleted
adenoviruses and the PSA promoter restricts this replication to
cells expressing PSA.
[0162] As a reference background and for comparison purposes, a
PSA-E1 plasmid is constructed as a derivative of the E1 constructs
used in the replication-enabling system, such as pE1FR. An
E1-deleted vector and 293 cells are used to evaluate the selective
replication conditional to the expression of prostate specific
antigen. The differential propagation and the levels of virus
production obtained with PSA-E4 and PSA-E1 regulation indicates
which of these regulatory mechanism renders better selectivity of
replication when used independently.
[0163] A similar strategy is followed to achieve selective
expression of E2. E2-expression plasmids transcomplement
E2-defective viruses using the replication-enabling system. The
function of the three open reading frames of E2 (DNA binding
protein, terminal protein, and polymerase) are subcloned into
separate plasmids. These open reading frames of E2 are then placed
under the regulation of the PSA promoter. Appropriate E2-defective
mutant viruses, such as Ad5ts125 which contains a
temperature-sensitive mutation of E2-DBP, are used to construct the
corresponding adenovirus-polylysine-DNA conjugates. As above, these
conjugates are used to infect LNCaP, DU145 and PC3 cell lines.
Viral DNA replication is measured by Southern blot. Cell lines
expressing E2 are used to measure the amount of E2-deleted viruses
produced by plaque assays.
EXAMPLE 11
[0164] Construction of RGD-Fiber Adenoviruses with Tumor-Selective
E4 or E2 Transcriptional Units
[0165] It is a goal of the present invention to combine the fiber
modification with the replication-regulatory mechanisms. Towards
this direction, the E4 and/or E2 construct(s) that demonstrated
conditional regulation in the replication-enabling system replace
the endogenous viral E4 and/or E2 transcriptional unit. For this,
the region that is to be modified is subcloned into a small plasmid
to facilitate its manipulation. This region is then removed from
the plasmid and co-transformed into competent bacteria with a
plasmid containing the complete viral genome. The recombination
between the viral sequences flanking the modified region and the
homologous sequences in the larger plasmid results in the
incorporation of the modified region into the adenoviral genome.
Before the co-transformation step, it is necessary to cut the large
plasmid in a unique site located in the middle of the homology
region to avoid the presence of colonies derived from the large
plasmid. As there are no available unique sites in the E4 or E2
promoter region, the RecA-assisted cleavage method will be used to
restrict in the proper site.
[0166] This method involves three steps: first, an oligonucleotide
spanning the site to be cut in the E2 or E4 promoter region is
annealed to the large plasmid in the presence of RecA protein (New
England Biolabs, Beverly, Mass.) to form a three-stranded segment.
Second, a methylase recognizing this site is then used to methylate
all the sites in the large plasmid except the one protected by the
oligonucleotide. Finally, the oligonucleotide is removed by heat
and the corresponding restriction endonuclease is used to cut the
unique non-methylated site. Common site-specific methylases, such
as AluI, HaeIII, HhaI, HpaII, etc, and the corresponding
restriction endonucleases are purchased from New England Biolabs.
Plasmids containing the wild type fiber and plasmids with the
modified RGD fiber are used. After the homologous recombination
step, the larger plasmids containing the viral genomes with the
substituted E4 or E2 regions are cut with PacI to release the viral
genome. Finally, the viruses are obtained by transfection into E4
or E2 complementing cell lines. Viruses are amplified and purified
by double CsCl gradient, and titered in these cell lines for in
vitro and in vivo experiments. The presence of the E4 or E2
transcription unit regulated with the tumor-specific promoter and
of the mutated fiber is analyzed by PCR as well as by sequencing of
viral DNA isolated from CsCl-purified virions.
EXAMPLE 12
[0167] Testing of Adenoviruses with Enhanced Infectivity and
Tumor-Selective Replication
[0168] Mice containing human tumors can be used to evaluate the
therapeutic potential of adenoviruses with enhanced infectivity and
tumor-selective replication. Three types of models can be used:
subcutaneous engrafted cell lines (e.g. prostate LNCaP and DU145),
diffuse intraperitoneal engraftments (e.g. ovarian SKOV3-ip1), and
liver metastases (e.g. colorectal carcinoma cell line LS174T).
Adult (6-8 week old) athymic nu/nu mice can be used in the
subcutaneous and metastatic models whereas SCID mice can be used in
the intraperitoneal model. Except for the prostate cell lines,
female mice are used. Treatments include the RGD-modified,
non-modified and vehicle control in a single injection for each
dose. Intratumoral, intraperitoneal or intravenous administration
of the viruses (according to the model used) is performed with
unsedated mice using gentle physical restraint. All mice are
euthanized at the conclusion of all experiments by CO.sub.2 vapor
sedation followed by Phenobarbital overdose.
[0169] Localized Models
[0170] Subcutaneous tumor nodules can be established using the
LNCaP and DU145 cell lines. Cells (107) are mixed 1:1 with Matrigel
(Collaborative Bioproducts), loaded into syringes and injected
subcutaneously in a total volume of 200 .mu.l into the front flanks
of athymic nude mice (2.times.10.sup.6 cells per engraftment site).
Initially, three pairs of viruses are compared: PSAE4-RGD versus
PSAE4; PSA-E2 versus RGD-PSAE2; and PSA-E1 versus RGD-PSAE1.
Viruses with double E1/E4 or E1/E2 controlled transcriptional units
can also be analyzed. Tumor nodules are injected with the
appropriate adenovirus or vehicle control (PBS/10% glycerol) when
their volume (length.times.width 2.times.1/2) reaches 0.2 cm.sup.3.
Injections are with a Hamilton syringe in a volume of 20 .mu.l
(1/10 of tumor volume). The amount of virus injected per tumor is
adjusted from 10.sup.4 pfus (plaque forming units) to 108 pfus by
serial dilution. A series of experiments are done to measure the
tumor volume until regression or a maximum of 1 cm.sup.3. Another
series of experiment are performed to measure the intratumoral
amount of virus in a time course. This amount is measured by
resecting the tumors and staining sections with anti-hexon antibody
(Chemicon) and by extracting the virus from the tumors and
measuring the viable virus in a plaque assay. In DU145 tumors, no
therapeutic effect is observed with the PSA-controlled viruses. In
LNCaP tumors, smaller tumors or complete tumor regressions is
observed, and more intratumoral virus in tumors treated with the
PSA-controlled replicative viruses is observed when compared to the
non-replicative and vehicle control treated tumors. Smaller tumors
or more frequent complete regressions are observed, likely due to
higher amounts of intratumoral virus with the RGD-modified vector.
These results demonstrate that the tumor-specific regulation of
adenoviral genes, such as E4, allows replication in vivo in
permissive tumors and also demonstrates the therapeutic advantage
of the RGD modification for a replicative adenovirus.
[0171] Local-Regional and Disseminated Models
[0172] A murine model for ovarian cancer and liver metastases of
colon cancer has been developed. These models have been useful in
demonstrating the utility of the RGD modification for
non-replicative adenoviral vectors, and therefore, are used herein
in the context of replicative adenoviruses containing
tumor-specific promoters. The ovarian cancer model is a
local-regional model that uses the human ovarian cancer cell line,
SKOV3.1p1. As these cells express SLPI, this model is useful to
evaluate viruses in which the E4 or E2 gene is regulated by the
SLPI promoter. This cell line has been serially passaged in SCID
mice and selected for its ability to grow aggressively in the
peritoneum. Female SCID mice receive an i.p. injection of
2.times.10.sup.7 cells in 0.5 ml of serum-free medium. Five days
after injection, tumors start to form at the peritoneum surface and
the progression of the disease mimics the human disease. One week
after injection, the viruses (RGD-modified or the unmodified
control) will be injected i.p. in a volume of 100 .mu.l. The
therapeutic viruses are also intravenously injected. Virus dosages
range from 10.sup.4 pfus to 10.sup.8 pfus. The therapeutic effect
is measured by surviving cells. The amount of replicating virus is
measured in peritoneal lavages in time course experiments.
[0173] The model of colon cancer liver metastases uses LS174T human
colon cancer cells and allows for expression of genes under the CEA
promoter. In a surgical operation, cells (5.times.10.sup.8) are
injected along the long axis of the spleen. Five minutes after the
injection, the splenic vessels are tied off and the spleen is cut
and removed. After the abdominal wall and skin are sutured,
extensive liver metastases form in 7-10 days. Tail vein injection
of RGD-modified and unmodified replicative adenoviruses to
demonstrate systemic treatment using this model. Liver metastases
are counted in a time course experiment after virus injection.
[0174] These experiments provide in vivo data demonstrating
selective replication and oncolytic potency of replicative vectors
with restricted replication and enhanced infectivity.
[0175] The RGD modification in the fiber of replicative
adenoviruses, along with tumor-selective expression of E4 or E2 in
addition to E1, increases the virus' propagation efficacy and
ultimately its therapeutic efficacy.
EXAMPLE 13
[0176] VEGF Promoter-Based Conditionally Replicative Adenovirus
[0177] In this example, the inventors exploited the expression of
vascular endothelial growth factor (VEGF) in tumors for therapeutic
advantage. Several studies have shown that angiogenesis is one of
the key control factors in the growth, progression, and metastasis
of solid tumors. Among the many known angiogenic factors, such as
bFGF, angiogenin, IL-8, PD-ECGF, VEGF is now believed to play a
pivotal role in tumor-associated angiogenesis in a number of solid
tumors.
[0178] A conditionally replication-competent adenovirus (CRAd) was
constructed in which the expression of the adenoviral E1 gene was
controlled by the human VEGF promoter. This virus achieved high
levels of viral replication in lung cancer cells and induced a
substantial anti-tumor effect in vitro and in vivo. Further
enhancement of the anti-cancer cell killing effect was achieved
with tropism modification of the virus via serotype chimerism of
the adenoviral fiber knob. These infectivity-enhanced VEGF
promoter-based CRAds also showed a significant cell killing effect
for various types of cancer cells other than lung cancer. In this
regard, a dysregulated VEGF axis is characteristic of many
carcinomas. On this basis, this current CRAd agent may be useful as
a "pan-carcinoma" therapeutic agent.
[0179] Cell Culture
[0180] The NCI-H82, NCI-H460, NCI-H157, NCI-H322, NCI-H522,
NCI-H1299, NCI-H358, NCI-N417, A427, A549 lung cancer cell lines;
BEAS-2B, normal human bronchial epithelial cell line; Panc-I,
pancreas cancer cell line; and HEK293 adenoviral transformed human
embryonic kidney cell line were obtained from ATCC (American Type
Culture Collection, Manassas, Va.). QG56 and QG90 were provided by
National Kyushu Cancer Center, Fukuoka, Japan. Human ovarian
adenocarcinoma cell line SKOV3.1p1 was obtained from Dr. Janet
Price (M. D. Anderson Cancer Center, Houston, Tex.). The MeWo cell
line was obtained from Dr. Ian R. Hart (St. Thomas Hospital,
London, UK). Cells were cultured in the media recommended by each
provider and incubated at 37.degree. C. and 5% CO.sub.2.
[0181] Adenovirus Vectors
[0182] The recombinant adenoviral vectors that express firefly
luciferase were constructed through homologous recombination in
Esherichia coli using the AdEasy system (He et al., 1998). The 2.6
kb human VEGF promoter region derived from pVEGF-kpnI (Forsythe et
al., 1996) was placed in front of the firefly luciferase gene in an
Ad E1 shuttle vector, recombined with the E1- and E3-deleted
adenoviral backbone vector pAdEasy 1, then transfected into 293
cells by standard techniques to form Ad5VEGFLuc. The luciferase
gene and simian virus 40-polyadenylation signal were derived from
pGL3 Basic (Promega, Madison, Wis.). As a control, a vector
containing the ubiquitously active cytomegalovirus (CMV) immediate
early promoter (derived from plasmid pCEP4; Invitrogen, Carlsbad,
Calif.) instead of the VEGF promoter was also constructed and named
Ad5CMVLuc.
[0183] The replication competent adenovirus, Ad5VEGFE1 was also
generated from the same E1- and E3-deleted adenoviral backbone
vector. Briefly, the fragment corresponding 489 bp to 3533 bp from
the left end of the type 5 adenoviral genome was amplified by PCR
and inserted in the E1 deleted region of the backbone vector. This
fragment contains the transcriptional start site of the E1A gene
but not the native E1A promoter. The 2.6 kb VEGF promoter region
was placed upstream of this fragment. A control vector was also
constructed in which the CMV promoter was placed in the same
position upstream of E1A. The strategy for these constructs is
summarized in FIG. 23. Fiber modified CRAd, Ad5/3VEGFE1 was
generated in similar manner as Ad5VEGFE1 but using
Ad5/3E1-E3-deleted backbone vector derived from Ad5/3luc1
containing Ad3 knob in place of Ad5 wild-type knob gene as
described previously (Krasnykh et al., 1996). To compare the
differences in infectivity between the Ad5 and Ad5/3 chimeric
vectors on the target cells, an Ad vector (Ad5/3luc1) that contains
a CMV driven luciferase gene in E1 was compared to AdCMVLuc. Wild
type p53 protein expressing adenovirus, Ad5p53 which contains CMV
driven p53 cDNA was provided from Dr. Ueno (University of
Occupational and Environmental Health, Kitakyusyu, Japan) Takayama
et al., 1998)
[0184] The viruses were propagated in the adenovirus packaging cell
line, 293HEK, and purified by double CsCl density gradient
centrifugation, followed by dialysis against phosphate-buffered
saline with 10% glycerol. The viral particle (VP) concentration was
determined spectrophotometrically, using a conversion factor of
1.1.times.10 .sup.12 viral particles per absorbance unit at 260 nm,
and standard plaque assays on 293 cells were performed to determine
infectious particles.
[0185] Analysis of VEGF RNA Expression
[0186] The VEGF RNA status of cell lines was analyzed by reverse
transcription and polymerase chain reaction (RT-PCR) as described
previously (Ohta et al., 1996). Total cellular RNA was extracted
from 1.times.10.sup.7 cells using the RNeasy kit (Qiagen, Valencia,
Calif.) and analyzed for VEGF and glyceraldehydes-3-phosphate
dehydrogenase (GAPDH) RNA with the GeneAmp RNA PCR core kit
(Applied Biosystems) as described by manufacturer. Briefly, 500 ng
of total RNA was reverse-transcribed with the random hexamer and
murine leukemia virus reverse transcriptase (50.degree. C., 30 min)
and amplified by PCR with 50 nM of primer pairs described below
using a cycling program (initial step of 95.degree. C. for 15 min,
27 cycles of 95.degree. C. for 1 min and 60.degree. C. for 1 min
and 72.degree. C. for 1 min, final step of 72.degree. C. for 10
min). The primers used for the analyses were as follows: VEGF
sense,
1 5'GAAGTGGTGAAGTTCATGGATGTC3', SEQ ID NO:6; VEGF antisense,
5'CGATCGTTCTGTATCAGTCTTTCC3', SEQ ID NO:7; GAPDH sense,
5'CCTTCATTGACCTCAACTA 3', SEQ ID NO:8; GAPDH antisense,
5'GGAAGGCCATGCCAGTGAGC3', SEQ ID NO:9.
[0187] Measurement of VEGF Protein in Culture Media
[0188] The VEGF protein expression was evaluated as described
previously. Briefly, 1.times.10.sup.5 cancer cells were cultured
for 24 h in serum free media, and then the medium was collected.
After centrifugation, the supernatant was stored at -80.degree. C.
until the assay. The VEGF protein in the culture medium was
determined using an ELISA kit (Quantikine Human VEGF Immunoassay,
R&D Systems, Minneapolis, Minn.) according to the
manufacturer's instructions. Each of the values given here is the
mean of triplicate determination with respect to standardized cell
numbers, 1.times.10.sup.5 cells.
[0189] In Vitro Analysis of VEGF Promoter Activation
[0190] The activity of the VEGF promoter in an adenovirus context
was analyzed by infection of cells with luciferase expression
vectors as reported previously (Adachi et al., 2001). Briefly,
cells were plated in 12-well plates in triplicate at a density of
1.times.10.sup.5 cells/well. The next day, the cells were infected
with Ad5VEGFLuc or Ad5CMVLuc at a MOI of 10 pfu/cell in DMEM with
2% FCS for 3 h and then maintained in complete medium. The infected
cells were harvested and treated with 100 ml of lysis buffer
(Promega, cat #E153A) after 2 days culture. A luciferase assay
(Luciferase Assay System; Promega) and a FB12 luminometer (Zyluc
corporation) were used for the evaluation of luciferase activities
of Ad-infected cells. Luciferase activities were normalized by the
protein concentration in cell lysate (Bio-Rad DC Protein Assay
kit).
[0191] In Vivo Analysis of VEGF Promoter Activation
[0192] For determination of luciferase gene expression in mouse
organs, nude mice (Charles Rivers) received 1.times.10.sup.9 pfu of
Ad5CMVluc or Ad5VEGFLuc by tail vein injection as described
previously (Adachi et al., 2001). Two days later, mice were
sacrificed, and the livers, kidneys, lungs, spleens were resected
to measure the luciferase gene expression. The resected organs were
placed in the polypropylene tubes, and immediately frozen in
ethanol/dry ice. Frozen tissues ground to a fine powder was lysed
using a tissue lysis buffer (Promega), and then luciferase activity
was determined using a luciferase assay kit (Promega). The
luciferase activity was normalized by protein concentration in the
tissue lysate.
[0193] Analysis of Viral Genome Amplification
[0194] Viral DNA amplification was assessed as reported previously
(Adachi et al., 2001).
[0195] Cells were plated in a 12-well culture plate in triplicate
at the density of 1.times.10.sup.5 cells/well. After overnight
culture, cells were infected with replication-competent Ad5
(Ad5VEGFE1, Ad5CMVE1 or Ad5 wt) or non-replicative Ad (Ad5CMVLuc)
at the MOI of 10 for 3 h and then cultured for 24 h. The harvest of
infected cells was followed by viral DNA isolation using Blood DNA
kit (Qiagen, Valencia, Calif.). Viral DNA was eluted with 100 ml of
elution buffer [10 mM TrisCl (pH 8.5)]. Eluted samples (1 ml) were
analyzed by real-time PCR analysis to evaluate Adenoviral E4 copy
number using a LightCycler (Roche). Oligonucleotides corresponding
to the sense strand of Ad E4 region (5'-TGACACGCATACTCGGAGC- TA-3',
34885-34905 nt, SEQ ID NO:10), the antisense strand of E4 region
(5'-TTTGAGCAGCACCTTGCATT-3', 34977-34958 nt, SEQ ID NO:11), and a
probe (5'-CGCCGCCCATGCAACAAGCTT-3', 34930-34951 nt, SEQ ID NO:12)
were used as primers and probe for real-time PCR analysis. The PCR
conditions were as follows: 35 cycles of denaturation (94.degree.
C., 20 s), annealing (55.degree. C., 20 s), and extension
(72.degree. C., 30 s). Adenovirus backbone vector pTG3602
(Chartier; Transgene, Strasbourg, France) was available for making
a standard curve for Ad E4 DNA copy number. E4 copy numbers were
normalized by the b-actin DNA copy number.
[0196] In Vitro Cytotoxicity Assay
[0197] For determination of virus-mediated cytotoxicity,
5.times.10.sup.3 cells were plated in 96-well plates in triplicate.
After overnight culture, cells were infected with each Ad5 at
various MOI for 3 h. The infection medium was then replaced with
RPMI1640 containing 10% FCS.
[0198] Viable cells using MTS assay (CellTiter 96 Aqueous
Non-Radioactive Cell Proliferation Assay; Promega) were evaluated
every 3 days. The MTS color development was quantified as optical
density at 490 nm by an EL 800 Universal Microplate Reader (Biotec
Instruments Inc.)
[0199] To visualize the cytotoxic effect, crystal violet staining
was also performed. Cells (2.times.10.sup.5) were plated in 12-well
plates and infected with each Ad at various MOI for 3 h. The
infection medium was replaced with growth medium the next day. When
cell lysis was observed, cells were fixed and stained with 1%
crystal violet in 70% ethanol for 45 min, followed by washing with
tap water to remove excess color. The plates were dried, and images
were captured with a Kodak DC260 digital camera (Eastman Kodak,
Rochester, N.Y.). All experiments were performed in duplicate
wells.
[0200] In Vivo Studies--Tumor Formation in Nude Mice
[0201] Tumor suppressive effect in vivo was analyzed as described
previously (Takayama et al., 2000). Briefly, H157 cells
(5.times.10.sup.6) were injected s.c. into the dorsal skin of nude
mice, and tumor growth was monitored for 25 days. Tumor volume was
calculated according to the formula a.sup.2.times.b, where a and b
are the smallest and largest diameters, respectively as described
previously. When tumor formation was seen 10 days after
inoculation, 1.times.10.sup.8 pfu of each virus was injected into
the tumor directly. Student's t test was used to compare tumor
volumes, with p<0.05 being considered significant.
[0202] VEGF mRNA and Protein Expression in Various Cell Lines
[0203] The inventors first investigated a panel of twelve non-small
cell lung cancer cell lines, one bronchial epithelial cell line
(BEAS-2B) as a normal cell control, one ovarian cancer cell line
(SKOV3.1p1), one gastric cancer cell line (MKN28), and a pancreatic
cancer cell line (Panc-I) for VEGF mRNA expression using a RT-PCR
method. In this regard, there are four structural variants of VEGF
(VEGF121, VEGF165, VEGF189, and VEGF206) resulting from alternative
mRNA splicing in the regions encoding the cytoplasmic domains. FIG.
24A shows amplification of a 408 bp fragment (representing VEGF121
cDNA) and a 541 bp fragment (representing VEGF165 cDNA) in all cell
lines tested. The intensity of each band (VEGF121 and VEGF165) was
similar in all cancer cells tested. The PCR bands corresponding to
VEGF189 (615 bp) and VEGF206 (666 bp) were minimal or not detected,
indicating VEGF121 and VEGF165 were the dominant isoforms in these
cell lines. These results are consistent with those of previous
similar studies of primary lung cancer tissues. Of the cells
tested, H157, A427, N417, H358 and SKOV3.1p1 showed relatively high
expression of VEGF mRNA, while the control normal cell line BEAS-2B
showed a less intense band than the cancer cell lines, although the
band corresponding to VEGF121 was detected at very low levels.
[0204] The correlation between mRNA expression and protein
expression for VEGF was also investigated. As shown in FIG. 24B,
the VEGF protein expression levels also varied between cell lines.
H157 secreted the highest amount of VEGF protein into the culture
media, and the concentration was over 100 times higher than that of
BEAS-2B. Comparison between FIGS. 24A and 24B revealed that the
VEGF mRNA expression level positively correlated with VEGF protein
expression level. These results thus suggested the VEGF promoter
activity can be predicated from the VEGF protein concentration of
tumor cellular substrates.
[0205] Transgene Expression by VEGF Promoter in the Ad Context In
Vitro
[0206] Candidate tumor-specific promoters may lose their
specificity when placed in the context of the Ad genome. Thus, the
VEGF promoter activity was assessed in an Ad vector (Ad5VEGFluc)
containing the luciferase gene as a reporter. This was examined in
several cell lines that represented the range of VEGF levels
detected in FIG. 24. In all of the cells lines tested, luciferase
expression was achieved using the positive control Ad5CMVLuc, which
contains the luciferase gene driven by the non-selective viral CMV
promoter. These results demonstrate that the A247 and H157 cells
were most susceptible to Ad5 infection, exhibiting luciferase
levels over 100 times higher than these of H460 as shown in upper
panel of FIG. 25. To standardize the differential susceptibility to
Ad5 infection between cell lines, VEGF promoter activity is thus
shown as the percentage of luciferase activity of AdSVEGFLuc
relative to Ad5CMVLuc. As shown in the lower panel in FIG. 25, H157
cells showed the strongest VEGF promoter activity which was 28% of
CMV promoter activity. In contrast, BEAS-2B cells, which presented
the lowest VEGF promoter activity, was less than 0.1% of CMV. This
low transgene expression seen with the VEGF promoter in the
adenoviral context with BEAS-2B was consistent with other recent
reports. Other cell lines demonstrated various VEGF promoter
activities which correlated with the mRNA expression level for each
cell lines tested (FIG. 24A). Based on these data, it is concluded
that the VEGF promoter was able to induce transgene expression in
VEGF producing cells and, importantly, that the promoter retained
its specificity when configured in the Ad genome context.
[0207] Transgene Expression by VEGF Promoter in the Ad Context In
Vivo
[0208] A key limitation of adenovirus-mediated cancer gene therapy
is the potential for toxicity to non-target organs. Because Ad
exhibits a marked tropism for the liver, it is important to
determine whether the VEGF promoter would have low activity in the
liver in vivo. Such a "liver off" phenotype would be critical to
avoid any toxic effects of VEGF promoter CRAd therapy. Normal liver
was reported to exhibit minimal VEGF expression.
[0209] On this basis, Ad5VEGFLuc or Ad5CMVLuc (as a positive
control) were injected i.v. via the tail vein into mice and the
level of transgene expression at day 2 was determined (FIG. 26). In
this assay, transgene expression in the liver induced by the VEGF
promoter was a mean 270-fold less than that seen with the CMV
promoter. These results thus confirm the key property of VEGF
promoter fidelity in vivo in the context of the Ad vector used.
Furthermore, the "liver off" phenotype of the VEGF promoter makes
the use of a VEGF promoter CRAd feasible in a systemic delivery
context.
[0210] VEGF Promoter Driven CRAd Shows Replication Specificity
[0211] To exploit the cell specificity of the VEGF promoter in a
CRAd context, the inventors then constructed a recombinant Ad
(Ad5VEGFE1) in which the native E1promoter was replaced with the
2.6 kb human VEGF promoter. The genomic structures of
replication-competent Ad5 used in this study are depicted in FIG.
23. An Ad in which E1 expression is controlled by the non-selective
viral CMV (Ad5CMVE1) promoter was used as control. These viruses
are deleted in the E3 region to accommodate the large VEGF promoter
and the E1A gene region. The deleted E1A promoter region,
containing the native E1A TATA box, was replaced with either the
VEGF promoter or CMV enhancer/promoter to produce the viruses
Ad5VEGFE1 or Ad5CMVE1, respectively.
[0212] To determine the specificity of replication of the AdVEGFE1,
the high VEGF expressing cell line (H157) and low expressing cell
line (BEAS-2B) were infected with the Ad vectors, and then
quantitative real-time PCR was used to determine the level of
amplification of viral DNA. The non-replicative Ad5CMVLuc and
wild-type Ad5 virus (Ad5 wt) were used as negative and positive
controls, respectively. Since all viruses tested contained the Ad
E4 region, viral DNA was quantified by E4 copy number via real-time
PCR. As shown in the upper panel of FIG. 27, the Ad5VEGFE1 viral
genome replicated in the high VEGF producing cancer cells H157 to a
similar extent as did the Ad5CMVE1 genome. The non-replicative
Ad5CMVLuc showed a background level of E4 signal, indicating no
replication in this cell line. Importantly the replicative capacity
of Ad5VEGFE1 decreased in the low VEGF expressing BEAS-2B cells,
with values 3-logs lower than that for Ad5CMVE1 (lower panel in
FIG. 27). These results indicate that the VEGF promoter retains
fidelity in the replication-competent adenoviral context and
mediates tumor-specific adenoviral replication.
[0213] Specific Cell Killing Efficacy of VEGF Promoter-Driven
CRAd
[0214] The ability of Ad5VEGFE1 to achieve cell killing in the
VEGF-positive cell lines was determined using a MTS assay. The
viability of the high VEGF expressing H157 cells and the low VEGF
expressing BEAS-2B cells was quantified every three days after
virus infection as shown in FIG. 28A. For the H157 cells, Ad5VEGFE1
showed cytotoxic effect as strong as that of the Ad5CMVE1 positive
control virus. All cancer cells were killed by day 9 with infection
at a low MOI. The relatively steep fall in the survival curve after
day 5 suggested a minimal temporal requirement before sufficient
replication occurred to induce toxicity.
[0215] To reconcile these results with an alternative gene-based
approach to cancer treatment which has been proposed, the Ad5VEGFE1
cytotoxic effect was compared with that of Ad5p53, which encodes
the wild-type p53 gene and has been employed in human clinical
trials. In this regard, it has previously been shown that H157
cells, which have a mutated p53 gene, undergo apoptosis when
infected with Ad5p53. Ad5p53 infection of H157 cells at MOI 0.1
showed a weak cytotoxic effect compared with Ad5VEGFE1. Similar
results were obtained with A427 cells (data not shown). In contrast
to the effect in the cancer cells, BEAS-2B cells were resistant to
Ad5VEGFE1 toxicity even with infection at a high MOI of 10. These
data were consistent with the crystal violet staining appearance as
shown in FIG. 27B.
[0216] Tumor Growth Suppression by Ad5VEGFE1 In Vivo
[0217] The inventors next investigated whether Ad5VEGFE1 could
suppress tumor growth in vivo. To this end, subcutaneous tumors
established in nude mice were directly injected with either
Ad5CMVLuc, Ad5VEGFE1 or Ad5p53. Tumors become visible and
injectable 10 days after subcutaneous inoculation. Previous work
revealed that the inoculated H157 cells have completed angiogenesis
at this time, and in this regard resemble advanced human tumors
(Takayama et al., 2000). For these studies, 1.times.10' pfu of each
virus was injected into the tumor directly and each tumor was
observed for 2 weeks. As shown in FIG. 29, tumor injected with
Ad5CMVLuc increased in size. Ad5p53 suppressed tumor growth
partially; however, the suppressive effect was minimal. In
contrast, Ad5VEGFE1 suppressed the tumor growth to a significantly
greater degree than Ad5p53. These findings suggested that CRAd may
be a more efficacious agent than non-replicative virus-based gene
therapy approaches such as Ad5p53.
[0218] Improvement of CRAd Potency Via Fiber Modification.
[0219] The oncolytic effect of any CRAd is dependant on the
infectivity of the cancer cells as well as promoter activation
specificity. Based on these concepts, the inventors endeavored to
achieve improvement of adenovirus infectivity as a means to enhance
the anticancer effect achieved via the CRAd agent. In this study,
it is noted that adenovirus infectivity for H460 lung cancer cells
and SKOV3.1p1 ovarian cancer cells was almost 2 orders of magnitude
lower than that of H157 and A427 lung cancer cells (FIG. 25). This
differential infectivity is likely the basis of differential CRAd
efficacy noted in these contexts. In this regard, it has been
previously reported that infectivity of serotype 5 adenovirus can
be improved by fiber modifications. For example, a modified
adenovirus with a chimeric fiber which expresses Ad3 knob instead
of Ad5 knob, (Ad5/3) showed enhanced infectivity for various tumor
cells that was otherwise Ad refractory.
[0220] The inventors therefore analyzed the effect of infectivity
enhancement via knob serotype chimerism for the cell lines tested
in this study. As shown in FIG. 30, the luciferase activities with
the Ad5/3 vector increased in all 6 cell lines tested. The
increases observed were between 5.1 times in Panc I cells and 39.4
times in A549 cells. These findings led the inventors to construct
an Ad5/3VEGFE1 in which the Ad5 knob is replaced with Ad3 knob.
Ad5/3VEGFE1 was generated and propagated as described in Materials
and Methods. The oncolytic effect of Ad5/3VEGFE1 relative to
Ad5VEGFE1 for the various cancer cells was evaluated using
infection at 1 MOI (FIG. 31). Cytopathic effect with Ad5/3VEGFE1
infection was seen rapidly, almost 2 days earlier than that with
Ad5VEGFE1 in all cell lines. In this experiment, complete cell
death was seen for all lines infected with Ad5/3VEGFE1 nine days
after infection whereas a significant number of cells survived with
Ad5VEGFE1 infection. Moreover, Ad5/3VEGFE1 showed a stronger cell
killing effect for H322 cells and SKOV3.1p1 cells compared with
Ad5CMVE1. These results suggested that infectivity enhancement with
modified adenovirus fiber could improve the cell killing effect of
the VEGF promoter CRAd.
[0221] Conditionally replicative adenovirus (CRAd) represents a
promising new therapeutic approach for malignancies resistant to
conventional treatments. The current example demonstrates a
strategy based on the use of a replication-competent Ad controlled
by a VEGF promoter. Furthermore, it is demonstrated that AdVFEGFE1
is applicable for the treatment of a wide spectrum of tumors. With
regard to gene therapy of lung cancer, replication-incompetent Ad
expressing wild-type p53 is currently being employed in human
clinical trials. While replication-incompetent viral vectors have
demonstrated great promise as anticancer agents in preclinical
studies, this has not been translated into patient benefit in the
clinical setting. The poor anticancer effect with
replication-incompetent Ad is partly due to limited penetration of
the vector into the tumor mass. In this regard, CRAd agents are
designed to achieve intratumoral spread and penetration by virtue
of their replicative capacity.
[0222] For clinical application, prevention of hepatic toxicity by
adenoviral agents is an important consideration. Tumor cells
infected with replication-competent Ad may release new viruses in
vivo. Such dissemination could predicate treatment related
toxicity, especially in the context of the liver as this is the
predominant site of Ad vector localization after systemic
injection. In this regard, the present example shows that the VEGF
promoter exhibits extremely limited promoter activity in the liver
and thus may avoid untoward hepatic injury. Since AdVEGFE1
exhibited a high degree of specificity in both replication and
cytotoxicity which correlated with target cell VEGF expression, it
would be predicated to be less toxic to the liver compared with
AdCMVE1 or wild-type Ad. Results of a phase I clinical trial with
VEGF inhibitors showed that these agents were well tolerated,
indicating a marginal role for VEGF signaling in normal organs
under physiological conditions except the ovary during the
menstrual cycle.
[0223] An emerging strategy for cancer therapy is the use of
conditionally replicative adenoviruses (CRAds) that are designed to
exploit key differences between tumor cells and normal cells to
allow tumor-selective viral replication and oncolysis. Two basic
strategies have been employed to generate CRAds. A type I approach,
such as Ad-dl1520 (ONYX-015) or AdD24, involves directly mutating
Ad genes such as E1 to take advantage of the disordered cell cycle
regulation in tumor cells with functionally deficient p53 or RB
signaling, respectively. The type II approach involves replacement
of wild-type Ad promoters with tumor-specific promoters to drive
the expression of genes essential for Ad replication.
[0224] A consideration for the clinical employment of type II CRAd
is that the relevant promoter activity in each tumor should be
confirmed before treatment. In this regard, it is clear that tumors
with low promoter activity are resistant to type II CRAds
containing that promoter. Therefore it is important to evaluate the
promoter activity a priori to avoid potentially non-indicated
therapy. Analysis for RNA status requires tissue obtained from the
patient to prepare RNA samples for RT-PCR or northern blotting.
Precise evaluation of promoter activity with a reporter gene such
as luciferase is more difficult in the clinical setting generally.
Considered in this context, it is clear that the VEGF promoter has
an advantage for its activity evaluation. Results in FIGS. 24 and
25 demonstrated that there is a positive correlation between VEGF
mRNA expression level, VEGF protein expression level, and transgene
activation by the VEGF promoter. Taken together these data suggest
that the VEGF promoter activity within a tumor can be predicted
from VEGF protein expression levels. Of note, VEGF protein is
easily detectable in clinical samples by ELISA evaluation of fluid
samples and immunohistochemical staining of tissue samples. Thus
these tests can potentially be employed to prospectively select the
most appropriate patients for consideration of VEGF promoter CRAd
therapy in the clinical setting.
[0225] VEGF production is an important mechanism for the
development of tumor-associated angiogenesis in many types of
tumors. In fact, many types of cancer are already known to express
VEGF protein at significant levels and this VEGF expression is
associated with poor prognosis in several disease contexts
including leukemia, breast cancer, colorectal cancer,
hepatocellular carcinoma, ovarian cancer and non-small cell lung
cancer. It appears that more advanced stage tumors actually express
higher levels of VEGF protein. Of note, VEGF gene expression is
known to be regulated transcriptionally. Although several
transcription factors bind to the cis-elements on the promoter,
hypoxia inducible factor (HIF) is the key factor for activation of
the promoter. In this regard, the central regions of tumors are
often hypoxic and necrotic due to decreased blood flow.
Immunohistochemical analysis of primary tumor samples shows that
VEGF protein expression is enhanced in the tumor tissue adjacent to
necrotic regions. On the other hand, some types of cancer are known
to express the HIF protein constitutively despite the oxygen
tension, leading to an increase VEGF promoter activation. Taken
together these findings suggest that the antitumor effect of
AdVEGFE1 may be even more efficacious in large in vivo tumors than
under the normoxic conditions under which the above in vitro
experiments were performed.
[0226] The cell killing effect of a type II CRAd may be improved by
several mechanisms such as promoter induction, infectivity
enhancement, or an armed CRAd strategy. A major obstacle to be
overcome in Ad5-based cancer gene therapy has been the paucity of
the primary receptor, CAR, which frequently characterizes human
primary tumor cells. Furthermore, down regulation of CAR may be
associated with a more malignant phenotype. Due to variable
expression of CAR on human primary cancer cells, the utility of Ad5
as a cancer gene therapy vector may be compromised, limiting the
overall efficacy of any Ad-based cancer gene therapy, including the
use of CRAds agents. On this basis, approaches to circumvent
tumor-associated CAR deficiency are required. In this regard, the
native Ad5 tropism can be modified to enhance Ad infectivity. One
approach is pseudotyping, i.e., retargeting Ad by creating chimeric
fibers possessing knob domains derived from alternate serotypes
which bind to receptors other than CAR. To this end, nonreplicating
Ad5 containing chimeric fibers with the tail and shaft domains of
Ad serotype 5 and the knob domain of serotype 3 have been
constructed (Krasnykh et al., 1996). Previous work has revealed
that a distinct Ad3 receptor exists in ovarian cancer cells, and
that the Ad5/3 chimeric vector is retargeted to the Ad3 receptor.
Based on these findings, a CRAd exploiting the Ad5/3 chimeric
approach was constructed in this study. Results presented above
indicate that Ad5/3VEGFE1 showed a stronger cell killing effect
than that of the Ad5-based CRAd, likely on this basis of conferred
infectivity enhancement.
[0227] In conclusion, the data presented here provide a basis for
the advancement of replication-competent adenovirus strategies
based on the VEGF promoter for the therapy of various cancers.
Furthermore, a CRAd based on the Ad5/3 chimeric vector is a
promising way to enhance the anti-tumor potency via infectivity
enhancement for cancer cells. Given the relevance of a dysregulated
VEGF axis in a broad spectrum of tumor types, as well as the
frequency of deficient adenoviral receptor CAR in the context of
epithelial neoplasms, the current infectivity enhanced VEGF
promoter CRAd may represent a "pan-carcinoma" CRAd with broad
potential utilities.
EXAMPLE 14
[0228] CXCR-4 or Survivin Promoter-Based Conditionally Replicative
Adenovirus
[0229] The enormous promise of CRAd vectors for cancer gene therapy
has been established and has resulted in the rapid clinical
translation of this approach. The present example provides a
CAR-independent vector that was rendered selectively replicative
via the CXCR4 or survivin promoter. These vectors have improved
transductional efficiency and specificity required for human
clinical trials and allow full realization of the potential
benefits of the CRAd approach for breast cancer.
[0230] Derivation of a Novel, CAR-Independent Ad Vector
[0231] Many clinically relevant tissues are refractory to Ad5
infection due to negligible CAR levels. Some non-human Ad5 display
CAR-independent infection of human cells. Canine adenovirus type 2
(CAd2) infects human cells via CAR, but also displays
CAR-independent infection of CAR-negative human cells with
identical entry kinetics to Ad5 (Soudais et al., 2000). To create
an Ad vector for infection of CAR-deficient cells, a
"knob-switching" technology (Krasnykh et al., 1996) was employed to
engineer a non-replicative, E1a-deleted Ad vector, AdCK/CMV-Luc,
which contains the knob domain of the canine adenovirus type 2
(CAd2) and a luciferase reporter gene. The AdCK/CMV-Luc vector was
rescued in HEK 293 cells, and the correct chimeric fiber DNA
sequence was confirmed. This novel Ad was propagated in HEK 293
cells, and was grown to high titers and purified by traditional
methods.
[0232] To confirm that AdCK/CMV-Luc displays CAR-independent
infection, infection assays were performed on human glioma cells, U
118-CAR that was engineered to express human CAR, and the parental
CAR-negative U118 cells. In CAR-negative U118 cells, AdCK/CMV-Luc
showed 15-fold higher luciferase activity than the isogenic
control, Ad5/CMV-Luc (FIG. 32). Furthermore, in Ul 18-CAR cells,
AdCK/CMV-Luc had similar luciferase activity to Ad5/CMV-Luc.
Importantly, addition of excess recombinant Ad5 knob protein
blocked Ad5/CMV-Luc infection, but not that of AdCK/CMV-Luc,
indicating AdCK/CMV-Luc has novel, CAR-independent tropism. In
addition, AdCK/CMV-Luc demonstrated a 10-fold infectivity
enhancement in ovarian SKOV3.1p1 vs. Ad5/CMV-Luc (data not
shown).
[0233] Initial Characterization of Potential Breast
Cancer-Selective Promoters
[0234] The inventors have obtained full length human CXCR4 and
survivin promoters for evaluation as breast cancer-specific
promoters for CRAd agents. CXCR4, identified as co-receptor for
HIV-1, is also a chemokine receptor recently implicated in the
metastatic homing of breast cancer cells to alternate tissues.
CXCR4 gene expression is markedly upregulated in breast cancer
cells, but is undetectable in normal mammary primary epithelial and
stromal cells. Expression of survivin, a member of the inhibitor of
apoptosis (IAP) family, is associated with loss of apoptosis in
breast cancer, and is a significant prognostic parameter of poor
outcome. Over 70% of stage I to IH breast carcinomas have been
shown to express survivin, with undetectable expression levels in
adjacent normal differentiated tissues or stromal cells.
[0235] To verify the overexpression of CXCR4 and survivin in breast
cancer cells, real-time PCR mRNA analysis was performed in two
breast cancer cell lines, DU4475 and MDA-MB-361 (FIG. 33). Both
cell lines showed elevated survivin and very high CXCR4 mRNA levels
compared with human fibroblast (HFB), prostate (BxPC-3 and AsPC-1)
or ovarian (OV4 and SKOV3.1p1) cancer cells. To evaluate promoter
specificity in the Ad genome context, a panel of non-replicative Ad
vectors was constructed with a luciferase reporter gene under the
transcriptional control of the CXCR4 (Ad5/CXCR4-Luc) and survivin
(Ad5/survivin-Luc) promoters (FIG. 34). As expected, luciferase
activities were elevated in MDA-MB-361 breast cancer cells,
expressed as percent of Ad5/CMV-Luc (FIG. 35).
[0236] Evaluation of CAR-Independent Breast Cancer CRAd Agents for
Improved Oncolytic Potency
[0237] Preliminary data clearly show that the CAR-independent
vector, AdCK/CMV-Luc, provides substantial infectivity enhancement
for CAR-deficient substrates. The CAd2 knob domain can be
incorporated into the fiber of the CXCR4 and survivin CRAds via
well established recombinational strategies. The viral replication
and oncolytic cells killing activities of the newly derived
CAR-independent CRAds can be compared to their wild-type
counterparts as follows. Various doses of CRAds are added to target
cells in culture. At various time points, cells are evaluated for
CRAd replication using automated PCR-based assay based on the
TaqMan approach. Crystal violet staining of infected plates, plus
MTT/XTT viability assays can be used to provide indices of
replication-induced oncolysis. Various input m.o.i's will be
evaluated and dose equivalencies established. The CAR-independent
CRAds should achieve increased oncolysis at lower m.o.i.,
indicating their increased potency. As an additional assay, the
inventors will employ a spheroid cell culture system that provides
growth of cell lines and primary cultures in a three-dimensional
configuration. This novel system allows determination of efficacy
of agents that operate via "amplification", such as CRAds. These
studies will determine the relevance of infectivity enhancement for
the context of breast cancer CRAds. CRAd agents that provide breast
cancer-specific replication as well as increased breast cancer
infectivity will allow early definition of a lead agent for further
pre-clinical development.
[0238] Analysis of Therapeutic Utility in Murine Model Systems
[0239] Studies accomplished to this point will establish a "lead
agent" for further evaluation.
[0240] The use of a murine xenograft model system will provide a
means to determine the therapeutic utility of this agent. For
therapeutic analysis studies, SCID mice are xenotransplanted
subcutaneously with human breast cell lines, including MDA-MB-231
cells. This model will be challenged with the CRAd agent via
distinct routes: intratumoral, intraperitoneal and intravenous. The
former route parallels treatment of loco-regional disease via CRAd
delivery. The latter route parallels systemic delivery relevant to
disseminated disease. Tumors will be harvested post-treatment and
assayed for CRAd replication via TaqMan PCR. Direct
three-dimensional measurement of tumor regression can be performed
as a function of time and viral dose. Control agents include
non-replicative Ad, as well as replicative wild-type Ad.
Comparisons are also made between the CAR-independent CRAd, and its
native-tropism counterpart, and control Ad5. Ectopic localization
of CRAd occurs largely in liver. Thus, this organ provides the best
index of CRAd-induced toxicity. Therefore, treated animals will
undergo histopathological analysis for evidence of CRAd-related
pathology. These efficacy and toxicity studies will provide direct
insight into the therapeutic index of these CRAd agents, and
predict the pre-clinical/clinical pathway for a human breast cancer
clinical trial with the novel CRAd agents.
EXAMPLE 15
[0241] Uses of Survivin Promoter in Double Targeting to Ovarian
Carcinoma
[0242] This example discloses double targeting for ovarian cancer
cells in vitro and in vivo that involves transductional targeting
and transcriptional targeting. Transductional targeting is achieved
by retargeting adenoviral vector to tumor-specific cell surface
markers, such as epidermal growth factor receptor (EGFR), by a
bi-functional adaptor or modified fiber of adenoviral vector.
Transcriptional targeting can enhance tumor specificity by using a
tumor-specific promoter (such as surviving promoter) to restrict
transgene expression to tumor cells. It is anticipated that ovarian
tumor specificity will be enhanced by targeting based on a tumor
specific promoter, survivin, and a retargeting site, EGFR, which is
overexpressed in ovarian cancer; and the toxicity to normal tissue
will be limited by enhancing tumor specificity and decreasing the
dose of administration.
[0243] Transductional Targeting by EGFR-Retargeted Adenoviral
Vector
[0244] Several human ovarian cell lines have been chosen for this
study. To determine EGF receptor expression on cell surface by flow
cytometry, cells (10.sup.4) are sorted on FACScan flow cytometry
after treated with 1.sup.st antibody (5 mg/ml) mAb 425, a
monoclonal antibody anti-EGFR and 2.sup.nd antibody (5 mg/ml), a
goat anti-mouse IgG labeled with FITC.
[0245] Adenoviral vector will be targeted to EGF receptor by using
a fusion protein sCAR-EGF encoded by the construct pFBsCAR6hEGF.
The donor plasmid pFBsCAR6hEGF will be transformed into competent
DH10Bac E. coli cells to generate a recombinant Bacmid. The fusion
protein sCAR-EGF will be produced in High Five cells, purified with
NI-NTA resin, and detected by Western Blot.
[0246] To compare EGFR-targeted Ad gene transfer among human
ovarian cancer cell lines, human ovarian cancer cells
(5.times.10.sup.4 cells) will be infected with AdGL3BCMV
(M.O.I.=100) pre-incubated with various doses of the sCAR-EGF
fusion protein (0, 5, 15, and 20 mg) at room temperature for 30
min. Forty-eight hours post-infection, the luciferase activity will
be determined with the luciferase Assay System on the lumicount. A
competition test will be performed by using mAb A-431 to block
retargeting site on the surface of tumor cells.
[0247] Transcriptional Targeting Using Survivin Promoter
[0248] mRNA levels of survivin are over expressed in the ovarian
cell line, SKOV3.1p1, but not in OV4, as determined by real-time
PCR using a LightCycler. The results indicated survivin
transcriptional activity in SKOV3ip1 was 40-fold and 10-fold higher
than that of 2 control cell lines, human fibroblasts and human
mammary epithelial cells, respectively. The results also showed
that, with in vitro analysis of the survivin promoter in an
adenoviral context, the luciferase activities were 4- and 5-fold
higher in SKOV3ip.1 and OVCAR3 cell lines than the 2 control cell
lines, respectively. These cells were infected with AdGL3BSurvivin
or AdGL3BCMV. AdGL3Bsurvivin is a vector in which the reporter gene
luciferase is driven by the ovarian tumor specific promoter
survivin, whereas AdGL3BCMV is a control for normalizing the
luciferase activity driven by survivin promoter (set CMV promoter
activity to 100%).
[0249] To determine survivin promoter activity in ovarian cancer
cell lines in vitro and in vivo, luciferase activity driven by
survivin promoter are detected as a percentage of that driven by
CMV promoter in different ovarian cancer cell lines. Briefly,
5.times.10.sup.4 cells are infected with AdGL3Bsurvivin or
AdGL3BCMV (M.O.I=100) in a conventional condition. Luciferase
activities are measured 48 hours post-infection.
[0250] To analysis the distribution of luciferase gene expression
in mouse organs, six mice are injected with 10.sup.9 pfu of
AdGL3B-Survivin or AdGL3BCMV via tail vein. Two days later, major
organs are harvested, and luciferase activity determined.
[0251] Double Targeting for Ovarian Cancer Cells in Vitro and In
Vivo
[0252] To examine double specific targeting for ovarian cancer
cells in vitro, luciferase activity driven by survivin promoter
will be determined as a percentage of that driven by CMV promoter
in different ovarian cancer cell lines and controls. Briefly,
5.times.10.sup.4 ovarian cancer cells are infected with
AdGL3BSurvivin or AdGL3BCMV (M.O.I.=100) both pre-incubated with
various amount of fusion protein sCAR-EGF (0, 5, 10, 15, 20 mg) at
room temperature for 30 min. As a control, sCAR6His is used for
blocking the native interaction of CAR. Luciferase activities will
be measured 48 hours post-infection.
[0253] To examine double targeting in primary ovarian cancers, the
experiment described above can be repeated with primary ovarian
cancers obtained from 4-5 patients.
[0254] To determine double specific targeting for ovarian cancer in
vivo, 2.times.10.sup.7 cells of SKOV3ip1 will be inoculated
subcutaneously into flank of BALB/c nu/nu mice. When the tumor
reaches a diameter of 6-8-mm, intra-tumor or i.v. injection will be
performed with 5.times.10.sup.8 pfu of AdGL3BSurvivin or AdGL3BCMV
pre-incubated with suitable amount of fusion protein sCAR-EGF. Two
days later, the tumor will be resected for luciferase analysis.
[0255] The following references were cited herein:
[0256] Adachi et al., A midkine promoter-based conditionally
replicative adenovirus for treatment of pediatric solid tumors and
bone marrow tumor purging. Cancer Res. 61:7882-7888 (2001).
[0257] Forsythe et al., Activation of vascular endothelial growth
factor gene transcription by hypoxia-inducible factor I. Mol. Cell.
Biol. 16:4604-4613 (1996).
[0258] Hardy et al., Construction of adenovirus vectors through
Cre-lox recombination. J. Virol. 71:1842-1849 (1997).
[0259] He et al., A simplified system for generating recombinant
adenoviruses. Proc. Natl. Acad. Sci. USA 95:2509-2514 (1998).
[0260] Heise et al., Efficacy of a replication-competent adenovirus
(ONYX-015) following intratumoral injection: intratumoral spread
and distribution effects. Cancer Gene Ther. 6:499-504 (1999).
[0261] Koivunen et al., Identification of receptor ligands with
phage display peptide libraries. J. Nucl. Med. 40:883-888
(1999).
[0262] Krasnykh et al., Generation of recombinant adenovirus
vectors with modified fibers for altering viral tropism. J. Virol.
70:6839-6846 (1996).
[0263] Ohta et al., Significance of vascular endothelial growth
factor messenger RNA expression in primary lung cancer. Clin.
Cancer. Res. 2:1411-1416 (1996).
[0264] Roelvink et al., Identification of a conserved
receptor-binding site on the fiber proteins of CAR-recognizing
adenoviridae. Science 286:1568-1571 (1999).
[0265] Shinoura et al., Highly augmented cytopathic effect of a
fiber-mutant E1B-defective adenovirus for gene therapy of gliomas.
Cancer Res. 59:3411-3406 (1999).
[0266] Soudais et al., Canine adenovirus type 2 attachment and
internalization: coxsackie-adenovirus receptor, alternate
receptors, and an RGD-independent pathway. J. Virol. 74:10639-10649
(2000).
[0267] Takayama et al., Suppression of tumor angiogenesis and
growth by gene transfer of a soluble form of vascular endothelial
growth factor receptor into a remote organ. Cancer Res.
60:2169-2177 (2000).
[0268] Takayama et al., The levels of integrin avb5 may predict the
susceptibility to adenovirus-mediated gene transfer in human lung
cancers. Gene Ther. 5:361-368 (1998).
[0269] Wickham et al., Increased in vitro and in vivo gene transfer
by adenovirus vectors containing chimeric fiber proteins. J. Virol.
71: 8221-8229 (1997).
[0270] Any patents or publications mentioned in this specification
are indicative of the levels of those skilled in the art to which
the invention pertains. Further, these patents and publications are
incorporated by reference herein to the same extent as if each
individual publication was specifically and individually indicated
to be incorporated by reference.
Sequence CWU 1
1
12 1 9 PRT artificial sequence Amino acid sequence of an RGD
peptide which binds with high affinity to some integrins the
encoding sequence of which is introduced into the HI loop of the
fiber knob 1 Cys Asp Cys Arg Gly Asp Cys Phe Cys 5 2 20 DNA
artificial sequence FiberUp primer used to verify the presence of
the RGD motif in the modified fiber. 2 caaacgctgt tggatttatg 20 3
21 DNA artificial sequence FiberDown primer used to verify the
presence of the RGD motif in the modified fiber. 3 gtgtaagagg
atgtggcaaa t 21 4 20 DNA artificial sequence E1a-1 primer used to
verify the (24 base pair deletion from the E1A gene in the modified
fiber. 4 attaccgaag aaatggccgc 20 5 19 DNA artificial sequence
E1a-2 primer used to verify the (24 base pair deletion from the E1A
gene in the modified fiber. 5 ccatttaaca cgccatgca 19 6 24 DNA
artificial sequence VEGF sense primer 6 gaagtggtga agttcatgga tgtc
24 7 24 DNA artificial sequence VEGF anti-sense primer 7 cgatcgttct
gtatcagtct ttcc 24 8 19 DNA artificial sequence GAPDH sense primer
8 ccttcattga cctcaacta 19 9 20 DNA artificial sequence GAPDH
anti-sense primer 9 ggaaggccat gccagtgagc 20 10 21 DNA artificial
sequence primer for sense strand of Ad E4 region 10 tgacacgcat
actcggagct a 21 11 20 DNA artificial sequence primer for anti-sense
strand of Ad E4 region 11 tttgagcagc accttgcatt 20 12 21 DNA
artificial sequence probe for Ad E4 region 12 cgccgcccat gcaacaagct
t 21
* * * * *